|
|
|
|
| smRNA ID |
siR1408 |
| Category |
siRNA |
| Stage |
G-to-M |
| Gene ID |
AT3G17185 |
| Organelle |
Nucleus |
| Direction |
sense |
| Sequence |
TTTCTTGACCTTGTAAGGCCT |
| 4D |
8D |
12D |
16D |
20D |
24D |
28D |
| 3.17 |
2.7 |
1.95 |
1.27 |
0.82 |
0.38 |
-0.03 |
| Category |
Stage |
Gene ID |
Transcript ID |
GO |
| siRNA | G-to-M | AT3G45140 | AT3G45140.1 | response to bacterium,response to endogenous stimulus,response to abiotic stimulus,response to wounding,response to jasmonic acid stimulus,oxidation reduction,lipid biosynthetic process |
|