smRNA information   
smRNA ID siR1408
Category siRNA
Stage G-to-M
Gene ID AT3G17185
Organelle Nucleus
Direction sense
Sequence TTTCTTGACCTTGTAAGGCCT
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
3.17 2.7 1.95 1.27 0.82 0.38 -0.03
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 siRNA  G-to-M  AT3G45140  AT3G45140.1  response to bacterium,response to endogenous stimulus,response to abiotic stimulus,response to wounding,response to jasmonic acid stimulus,oxidation reduction,lipid biosynthetic process