|
|
|
|
| smRNA ID |
miR164c |
| Category |
mature miRNA |
| Stage |
M-to-S |
| Gene ID |
miR164c |
| Organelle |
Nucleus |
| Direction |
sense |
| Sequence |
CGCACGUGCCCUGCUUCUCCA |
| 4D |
8D |
12D |
16D |
20D |
24D |
28D |
| 0.52 |
0.65 |
1.19 |
1.62 |
1.63 |
1.3 |
0.6 |
| Category |
Stage |
Gene ID |
Transcript ID |
GO |
| miRNA | G-to-M | AT1G57820 | AT1G57820.1 | regulation of transcription |
| miRNA | G-to-M | AT5G03120 | AT5G03120.1 | - |
| miRNA | G-to-M | AT4G10480 | AT4G10480.1 | - |
| miRNA | M-to-S | AT5G07680 | AT5G07680.2 | regulation of transcription |
| miRNA | M-to-S | AT5G07680 | AT5G07680.1 | regulation of transcription |
| miRNA | M-to-S | AT5G61430 | AT5G61430.1 | regulation of transcription |
| miRNA | M-to-S | AT1G56010 | AT1G56010.1 | regulation of transcription,response to endogenous stimulus,response to auxin stimulus,reproductive structure development |
| miRNA | M-to-S | AT1G56010 | AT1G56010.2 | regulation of transcription,response to endogenous stimulus,response to auxin stimulus,reproductive structure development |
| miRNA | M-to-S | AT5G39610 | AT5G39610.1 | regulation of transcription |
| miRNA | M-to-S | AT2G38340 | AT2G38340.1 | regulation of transcription,response to endogenous stimulus |
| miRNA | M-to-S | AT5G01600 | AT5G01600.1 | response to bacterium,response to metal ion,ion homeostasis,oxidation reduction,reproductive structure development |
| miRNA | M-to-S | AT1G77770 | AT1G77770.1 | - |
|
