smRNA information   
smRNA ID miR398b;c
Category mature miRNA
Stage M-to-S
Gene ID miR398b;c
Organelle Nucleus
Direction sense
Sequence CAGGGGUGACCUGAGAACACA
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
8.92 10.38 11.6 12.54 12.14 11.72 10.97
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 miRNA  G-to-M  AT1G53250  AT1G53250.1  -
 miRNA  G-to-M  AT1G03630  AT1G03630.2  chlorophyll biosynthetic process,oxidation reduction
 miRNA  G-to-M  AT4G26230  AT4G26230.1  -
 miRNA  G-to-M  AT1G12520  AT1G12520.1  ion homeostasis,oxidation reduction
 miRNA  G-to-M  AT3G06370  AT3G06370.1  response to osmotic stress,ion homeostasis
 miRNA  M-to-S  AT3G43860  AT3G43860.1  -
 miRNA  M-to-S  AT1G28050  AT1G28050.1  regulation of transcription
smRNA-DETF interaction   
Category Stage Gene ID Transcript ID TF Family
 miRNA  M-to-S  AT1G28050  AT1G28050.1  C2C2-CO-like