|
|
|
|
| smRNA ID |
siR2737 |
| Category |
siRNA |
| Stage |
M-to-S |
| Gene ID |
tRNA-Phe |
| Organelle |
Chloroplasts |
| Direction |
sense |
| Sequence |
GCCAAGAACCAGATTTGAACT |
| 4D |
8D |
12D |
16D |
20D |
24D |
28D |
| 0.48 |
0.33 |
0.96 |
1.66 |
2.16 |
2.6 |
2.89 |
| Category |
Stage |
Gene ID |
Transcript ID |
GO |
| siRNA | M-to-S | AT1G03430 | AT1G03430.1 | response to endogenous stimulus |
| siRNA | M-to-S | AT5G01240 | AT5G01240.1 | response to endogenous stimulus,response to auxin stimulus |
|
