smRNA information   
smRNA ID miR858a
Category mature miRNA
Stage G-to-M
Gene ID miR858a
Organelle Nucleus
Direction sense
Sequence AAGGUCGAACAGACAACGAAA
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
2.71 2.12 1.35 0.77 0.49 0.26 0.09
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 miRNA  G-to-M  AT3G46130  AT3G46130.2  regulation of transcription,response to endogenous stimulus,response to osmotic stress,response to metal ion,response to salicylic acid stimulus,response to jasmonic acid stimulus,response to ethylene stimulus
 miRNA  G-to-M  AT1G22640  AT1G22640.1  regulation of transcription,response to endogenous stimulus,response to osmotic stress,response to wounding,response to auxin stimulus,response to metal ion,response to salicylic acid stimulus,response to jasmonic acid stimulus,response to ethylene stimul
 miRNA  G-to-M  AT4G34990  AT4G34990.1  regulation of transcription,response to endogenous stimulus,response to osmotic stress,response to metal ion,response to salicylic acid stimulus,response to jasmonic acid stimulus,response to ethylene stimulus
smRNA-DETF interaction   
Category Stage Gene ID Transcript ID TF Family
 miRNA  G-to-M  AT3G46130  AT3G46130.2  MYB
 miRNA  G-to-M  AT1G22640  AT1G22640.1  MYB
 miRNA  G-to-M  AT4G34990  AT4G34990.1  MYB