|
|
|
|
| smRNA ID |
miR858b |
| Category |
mature miRNA |
| Stage |
G-to-M |
| Gene ID |
miR858b |
| Organelle |
Nucleus |
| Direction |
sense |
| Sequence |
CAAGGUCGAACAGACAACGAA |
| 4D |
8D |
12D |
16D |
20D |
24D |
28D |
| 1.98 |
1.29 |
0.87 |
0.48 |
0.31 |
0.12 |
-0.06 |
| Category |
Stage |
Gene ID |
Transcript ID |
GO |
| miRNA | G-to-M | AT3G27170 | AT3G27170.1 | - |
| miRNA | G-to-M | AT1G18710 | AT1G18710.1 | regulation of transcription,response to endogenous stimulus,response to osmotic stress,response to jasmonic acid stimulus |
| miRNA | G-to-M | AT1G22640 | AT1G22640.1 | regulation of transcription,response to endogenous stimulus,response to osmotic stress,response to wounding,response to auxin stimulus,response to metal ion,response to salicylic acid stimulus,response to jasmonic acid stimulus,response to ethylene stimul |
| miRNA | G-to-M | AT4G34990 | AT4G34990.1 | regulation of transcription,response to endogenous stimulus,response to osmotic stress,response to metal ion,response to salicylic acid stimulus,response to jasmonic acid stimulus,response to ethylene stimulus |
| miRNA | G-to-M | AT1G48000 | AT1G48000.1 | regulation of transcription,response to endogenous stimulus,response to osmotic stress,response to metal ion,response to salicylic acid stimulus |
| Category |
Stage |
Gene ID |
Transcript ID |
TF Family |
| miRNA | G-to-M | AT1G18710 | AT1G18710.1 | MYB |
| miRNA | G-to-M | AT1G22640 | AT1G22640.1 | MYB |
| miRNA | G-to-M | AT4G34990 | AT4G34990.1 | MYB |
| miRNA | G-to-M | AT1G18710 | AT1G18710.1 | MYB |
| miRNA | G-to-M | AT1G22640 | AT1G22640.1 | MYB |
| miRNA | G-to-M | AT4G34990 | AT4G34990.1 | MYB |
| miRNA | G-to-M | AT1G48000 | AT1G48000.1 | MYB |
|