|
|
|
|
| smRNA ID |
miR860 |
| Category |
mature miRNA |
| Stage |
G-to-M |
| Gene ID |
miR860 |
| Organelle |
Nucleus |
| Direction |
sense |
| Sequence |
AUACAUAGUCCAAUCUAUUGA |
| 4D |
8D |
12D |
16D |
20D |
24D |
28D |
| 1.47 |
1.06 |
0.54 |
0.3 |
0.14 |
0.04 |
0.02 |
| Category |
Stage |
Gene ID |
Transcript ID |
GO |
| miRNA | G-to-M | AT3G06170 | AT3G06170.1 | - |
| miRNA | G-to-M | AT4G05320 | AT4G05320.2 | response to endogenous stimulus,response to auxin stimulus,response to salicylic acid stimulus |
|
