smRNA information   
smRNA ID siR1402
Category siRNA
Stage G-to-M
Gene ID AT3G17185
Organelle Nucleus
Direction sense
Sequence TTCTTGACCTTGTAAGACCCC
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
6.6 6.55 5.9 5.24 4.46 3.72 2.93
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 siRNA  G-to-M  AT5G62000  AT5G62000.2  regulation of transcription,response to endogenous stimulus,response to auxin stimulus,reproductive structure development
 siRNA  G-to-M  AT5G62000  AT5G62000.3  regulation of transcription,response to endogenous stimulus,response to auxin stimulus,reproductive structure development
 siRNA  G-to-M  AT5G62000  AT5G62000.1  regulation of transcription,response to endogenous stimulus,response to auxin stimulus,reproductive structure development
smRNA-DETF interaction   
Category Stage Gene ID Transcript ID TF Family
 siRNA  G-to-M  AT5G62000  AT5G62000.2  ARF
 siRNA  G-to-M  AT5G62000  AT5G62000.3  ARF
 siRNA  G-to-M  AT5G62000  AT5G62000.1  ARF
 siRNA  G-to-M  AT5G62000  AT5G62000.1  ARF
 siRNA  G-to-M  AT5G62000  AT5G62000.1  ARF