|
|
|
|
| smRNA ID |
siR1737 |
| Category |
siRNA |
| Stage |
G-to-M |
| Gene ID |
AT4G13495 |
| Organelle |
Nucleus |
| Direction |
sense |
| Sequence |
TTGTTGATCTCAATAGCATTG |
| 4D |
8D |
12D |
16D |
20D |
24D |
28D |
| 2.16 |
2.46 |
1.69 |
0.87 |
0.37 |
0.09 |
0.04 |
| Category |
Stage |
Gene ID |
Transcript ID |
GO |
| siRNA | G-to-M | AT5G46180 | AT5G46180.1 | response to abiotic stimulus,response to osmotic stress,response to salt stress |
|