|
|
|
|
| smRNA ID |
miR164a;b |
| Category |
mature miRNA |
| Stage |
G-to-M |
| Gene ID |
miR164a;b |
| Organelle |
Nucleus |
| Direction |
sense |
| Sequence |
UGCACGUGCCCUGCUUCUCCA |
| 4D |
8D |
12D |
16D |
20D |
24D |
28D |
| 4.06 |
4.21 |
3.68 |
3.05 |
2.26 |
1.36 |
0.33 |
| Category |
Stage |
Gene ID |
Transcript ID |
GO |
| miRNA | G-to-M | AT1G56010 | AT1G56010.2 | regulation of transcription,response to endogenous stimulus,response to auxin stimulus,reproductive structure development |
| miRNA | G-to-M | AT5G39610 | AT5G39610.1 | regulation of transcription |
| miRNA | G-to-M | AT4G18930 | AT4G18930.1 | - |
| miRNA | M-to-S | AT1G56010 | AT1G56010.2 | regulation of transcription,response to endogenous stimulus,response to auxin stimulus,reproductive structure development |
| miRNA | M-to-S | AT5G39610 | AT5G39610.1 | regulation of transcription |
| miRNA | M-to-S | AT5G07680 | AT5G07680.2 | regulation of transcription |
| miRNA | M-to-S | AT5G07680 | AT5G07680.1 | regulation of transcription |
| miRNA | M-to-S | AT5G61430 | AT5G61430.1 | regulation of transcription |
| miRNA | M-to-S | AT1G56010 | AT1G56010.1 | regulation of transcription,response to endogenous stimulus,response to auxin stimulus,reproductive structure development |
| miRNA | M-to-S | AT2G38340 | AT2G38340.1 | regulation of transcription,response to endogenous stimulus |
| miRNA | M-to-S | AT1G77770 | AT1G77770.1 | - |
| miRNA | M-to-S | AT5G01600 | AT5G01600.1 | response to bacterium,response to metal ion,ion homeostasis,oxidation reduction,reproductive structure development |
| miRNA | M-to-S | AT2G44120 | AT2G44120.2 | - |
|
