smRNA information   
smRNA ID miR169h;I;j;k;l;m;n
Category mature miRNA
Stage G-to-M
Gene ID miR169h;I;j;k;l;m;n
Organelle Nucleus
Direction sense
Sequence CAGGCAAGUCAUCCUUGGCUA
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
5.54 6.17 5.57 4.52 3.15 2.07 1.09
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 miRNA  G-to-M  AT5G06510  AT5G06510.1  regulation of transcription
 miRNA  G-to-M  AT3G05690  AT3G05690.1  regulation of transcription
 miRNA  G-to-M  AT1G72830  AT1G72830.1  regulation of transcription
 miRNA  G-to-M  AT1G54160  AT1G54160.1  regulation of transcription
 miRNA  M-to-S  AT5G06510  AT5G06510.1  regulation of transcription
 miRNA  M-to-S  AT3G05690  AT3G05690.1  regulation of transcription
 miRNA  M-to-S  AT1G72830  AT1G72830.1  regulation of transcription
 miRNA  M-to-S  AT3G20910  AT3G20910.1  regulation of transcription
smRNA-DETF interaction   
Category Stage Gene ID Transcript ID TF Family
 miRNA  G-to-M  AT5G06510  AT5G06510.1  CCAAT-HAP2
 miRNA  G-to-M  AT3G05690  AT3G05690.1  CCAAT-HAP2
 miRNA  G-to-M  AT1G72830  AT1G72830.1  CCAAT-HAP2
 miRNA  G-to-M  AT1G54160  AT1G54160.1  CCAAT-HAP2
 miRNA  G-to-M  AT1G54160  AT1G54160.1  CCAAT-HAP2
 miRNA  G-to-M  AT5G06510  AT5G06510.1  CCAAT-HAP2
 miRNA  G-to-M  AT3G05690  AT3G05690.1  CCAAT-HAP2
 miRNA  G-to-M  AT1G54160  AT1G54160.1  CCAAT-HAP2
 miRNA  G-to-M  AT3G05690  AT3G05690.1  CCAAT-HAP2
 miRNA  G-to-M  AT5G06510  AT5G06510.1  CCAAT-HAP2
 miRNA  M-to-S  AT5G06510  AT5G06510.1  CCAAT-HAP2
 miRNA  M-to-S  AT3G05690  AT3G05690.1  CCAAT-HAP2
 miRNA  M-to-S  AT1G72830  AT1G72830.1  CCAAT-HAP2
 miRNA  M-to-S  AT3G20910  AT3G20910.1  CCAAT-HAP2
 miRNA  M-to-S  AT5G06510  AT5G06510.1  CCAAT-HAP2
 miRNA  M-to-S  AT3G05690  AT3G05690.1  CCAAT-HAP2
 miRNA  M-to-S  AT3G05690  AT3G05690.1  CCAAT-HAP2
 miRNA  M-to-S  AT5G06510  AT5G06510.1  CCAAT-HAP2
 miRNA  M-to-S  AT3G20910  AT3G20910.1  CCAAT-HAP2