|
|
|
|
| smRNA ID |
miR841a |
| Category |
mature miRNA |
| Stage |
G-to-M |
| Gene ID |
miR841a |
| Organelle |
Nucleus |
| Direction |
sense |
| Sequence |
UUCAGUUUCAAGUGGCUCGUA |
| 4D |
8D |
12D |
16D |
20D |
24D |
28D |
| 7.78 |
7.88 |
7.32 |
6.67 |
6.2 |
5.57 |
4.84 |
| Category |
Stage |
Gene ID |
Transcript ID |
GO |
| miRNA | M-to-S | AT1G63010 | AT1G63010.4 | - |
| miRNA | M-to-S | AT5G13220 | AT5G13220.1 | regulation of transcription,response to endogenous stimulus,response to wounding,response to jasmonic acid stimulus |
|