smRNA information   
smRNA ID miR841a
Category mature miRNA
Stage G-to-M
Gene ID miR841a
Organelle Nucleus
Direction sense
Sequence UUCAGUUUCAAGUGGCUCGUA
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
7.78 7.88 7.32 6.67 6.2 5.57 4.84
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 miRNA  M-to-S  AT1G63010  AT1G63010.4  -
 miRNA  M-to-S  AT5G13220  AT5G13220.1  regulation of transcription,response to endogenous stimulus,response to wounding,response to jasmonic acid stimulus