|
|
|
|
| smRNA ID |
miR393a;b |
| Category |
mature miRNA |
| Stage |
G-to-M |
| Gene ID |
miR393a;b |
| Organelle |
Nucleus |
| Direction |
sense |
| Sequence |
UCCAAAGGGAUCGCAUUGAUCC |
| 4D |
8D |
12D |
16D |
20D |
24D |
28D |
| 3.65 |
4.6 |
4.81 |
4.81 |
4.62 |
4.27 |
3.75 |
| Category |
Stage |
Gene ID |
Transcript ID |
GO |
| miRNA | G-to-M | AT5G65700 | AT5G65700.1 | cellular carbohydrate catabolic process,reproductive structure development |
| miRNA | G-to-M | AT5G09650 | AT5G09650.1 | response to bacterium,response to osmotic stress,response to metal ion |
|