smRNA information   
smRNA ID miR393a;b
Category mature miRNA
Stage G-to-M
Gene ID miR393a;b
Organelle Nucleus
Direction sense
Sequence UCCAAAGGGAUCGCAUUGAUCC
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
3.65 4.6 4.81 4.81 4.62 4.27 3.75
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 miRNA  G-to-M  AT5G65700  AT5G65700.1  cellular carbohydrate catabolic process,reproductive structure development
 miRNA  G-to-M  AT5G09650  AT5G09650.1  response to bacterium,response to osmotic stress,response to metal ion