smRNA information   
smRNA ID miR5026
Category mature miRNA
Stage G-to-M
Gene ID miR5026
Organelle Nucleus
Direction sense
Sequence ACGUGUCACGAUCUUAUGAGU
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
2.53 3.47 3.54 3.23 2.6 2.21 1.88
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 miRNA  M-to-S  AT4G28490  AT4G28490.1  -
 miRNA  M-to-S  AT5G14180  AT5G14180.1  -
 miRNA  M-to-S  AT3G19980  AT3G19980.1  reproductive structure development
 miRNA  M-to-S  AT1G10585  AT1G10585.1  regulation of transcription
 miRNA  M-to-S  AT2G27990  AT2G27990.1  regulation of transcription,reproductive structure development
smRNA-DETF interaction   
Category Stage Gene ID Transcript ID TF Family
 miRNA  M-to-S  AT2G27990  AT2G27990.1  Homeobox