smRNA information   
smRNA ID miR838
Category mature miRNA
Stage G-to-M
Gene ID miR838
Organelle Nucleus
Direction sense
Sequence UGUGCAAGAAGUAGAAGAAAA
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
1.4 2.19 2.51 2.63 2.41 2.06 1.48
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 miRNA  G-to-M  AT5G65300  AT5G65300.1  -
 miRNA  G-to-M  AT5G46910  AT5G46910.1  regulation of transcription
 miRNA  G-to-M  AT5G45110  AT5G45110.1  response to bacterium
 miRNA  G-to-M  AT3G02880  AT3G02880.1  -
 miRNA  G-to-M  AT1G57990  AT1G57990.1  -
 miRNA  G-to-M  AT1G67040  AT1G67040.1  -
 miRNA  G-to-M  AT5G22640  AT5G22640.1  reproductive structure development
 miRNA  G-to-M  AT1G10740  AT1G10740.1  -
 miRNA  G-to-M  AT4G39570  AT4G39570.1  -
 miRNA  G-to-M  AT5G24030  AT5G24030.1  ion homeostasis
 miRNA  G-to-M  AT5G05940  AT5G05940.1  -
 miRNA  G-to-M  AT4G18780  AT4G18780.1  response to bacterium,response to endogenous stimulus,response to osmotic stress,response to salicylic acid stimulus,response to jasmonic acid stimulus,response to ethylene stimulus
 miRNA  G-to-M  AT1G21070  AT1G21070.1  -
 miRNA  G-to-M  AT5G51460  AT5G51460.3  glycoside metabolic process
 miRNA  G-to-M  AT3G52940  AT3G52940.1  oxidation reduction,lipid biosynthetic process,reproductive structure development
 miRNA  G-to-M  AT2G31890  AT2G31890.1  -
 miRNA  G-to-M  AT1G15420  AT1G15420.1  -
 miRNA  G-to-M  AT2G21790  AT2G21790.1  response to metal ion,oxidation reduction
 miRNA  G-to-M  AT3G20260  AT3G20260.1  -
 miRNA  G-to-M  AT5G40610  AT5G40610.1  cellular carbohydrate catabolic process,oxidation reduction
 miRNA  G-to-M  AT1G64380  AT1G64380.1  regulation of transcription,response to endogenous stimulus,response to ethylene stimulus
 miRNA  G-to-M  AT4G23750  AT4G23750.1  regulation of transcription,response to endogenous stimulus,response to ethylene stimulus,reproductive structure development
 miRNA  G-to-M  AT1G64150  AT1G64150.1  -
 miRNA  G-to-M  AT2G37990  AT2G37990.1  -
 miRNA  G-to-M  AT4G09160  AT4G09160.1  -
 miRNA  G-to-M  AT3G24630  AT3G24630.1  -
 miRNA  G-to-M  AT5G39550  AT5G39550.1  reproductive structure development
 miRNA  G-to-M  AT1G03440  AT1G03440.1  -
 miRNA  G-to-M  AT3G28460  AT3G28460.1  -
 miRNA  G-to-M  AT3G57150  AT3G57150.1  -
 miRNA  G-to-M  AT3G52380  AT3G52380.1  -
 miRNA  M-to-S  AT5G65300  AT5G65300.1  -
 miRNA  M-to-S  AT5G46910  AT5G46910.1  regulation of transcription
 miRNA  M-to-S  AT5G45110  AT5G45110.1  response to bacterium
 miRNA  M-to-S  AT3G02880  AT3G02880.1  -
 miRNA  M-to-S  AT1G57990  AT1G57990.1  -
 miRNA  M-to-S  AT5G43130  AT5G43130.1  -
 miRNA  M-to-S  AT2G45720  AT2G45720.1  -
 miRNA  M-to-S  AT5G02010  AT5G02010.1  -
 miRNA  M-to-S  AT1G54270  AT1G54270.1  response to metal ion
 miRNA  M-to-S  AT5G02570  AT5G02570.1  -
 miRNA  M-to-S  AT2G37360  AT2G37360.1  -
 miRNA  M-to-S  AT5G52640  AT5G52640.1  response to bacterium
 miRNA  M-to-S  AT1G69870  AT1G69870.1  -
 miRNA  M-to-S  AT5G03495  AT5G03495.1  -
 miRNA  M-to-S  AT5G65200  AT5G65200.1  -
 miRNA  M-to-S  AT2G44430  AT2G44430.1  -
 miRNA  M-to-S  AT5G21900  AT5G21900.1  -
 miRNA  M-to-S  AT3G01970  AT3G01970.1  regulation of transcription
 miRNA  M-to-S  AT4G16680  AT4G16680.1  -
 miRNA  M-to-S  AT2G44990  AT2G44990.1  oxidation reduction
 miRNA  M-to-S  AT5G54040  AT5G54040.1  -
 miRNA  M-to-S  AT5G47060  AT5G47060.1  -
 miRNA  M-to-S  AT1G14200  AT1G14200.1  -
 miRNA  M-to-S  AT3G22850  AT3G22850.1  -
 miRNA  M-to-S  AT4G29230  AT4G29230.1  regulation of transcription
 miRNA  M-to-S  AT4G36640  AT4G36640.1  -
 miRNA  M-to-S  AT1G44770  AT1G44770.1  -
 miRNA  M-to-S  AT5G04760  AT5G04760.1  regulation of transcription
 miRNA  M-to-S  AT5G56270  AT5G56270.1  regulation of transcription
 miRNA  M-to-S  AT1G72070  AT1G72070.1  -
 miRNA  M-to-S  AT3G54670  AT3G54670.3  -
 miRNA  M-to-S  AT1G69270  AT1G69270.1  response to endogenous stimulus,response to osmotic stress,reproductive structure development
 miRNA  M-to-S  AT5G18310  AT5G18310.2  -
 miRNA  M-to-S  AT2G26830  AT2G26830.1  reproductive structure development
 miRNA  M-to-S  AT4G23280  AT4G23280.1  -
 miRNA  M-to-S  AT1G28200  AT1G28200.1  -
 miRNA  M-to-S  AT3G04040  AT3G04040.1  -
 miRNA  M-to-S  AT2G32240  AT2G32240.1  response to metal ion
 miRNA  M-to-S  AT3G12980  AT3G12980.1  regulation of transcription,reproductive structure development
 miRNA  M-to-S  AT4G26080  AT4G26080.1  response to endogenous stimulus,regulation of abscisic acid mediated signaling
 miRNA  M-to-S  AT1G54130  AT1G54130.1  -
smRNA-DETF interaction   
Category Stage Gene ID Transcript ID TF Family
 miRNA  G-to-M  AT1G64380  AT1G64380.1  AP2-EREBP
 miRNA  G-to-M  AT4G23750  AT4G23750.1  AP2-EREBP
 miRNA  G-to-M  AT5G39550  AT5G39550.1  C2H2
 miRNA  G-to-M  AT3G57150  AT3G57150.1  NAC
 miRNA  M-to-S  AT3G01970  AT3G01970.1  WRKY
 miRNA  M-to-S  AT1G14200  AT1G14200.1  C3H
 miRNA  M-to-S  AT4G29230  AT4G29230.1  NAC
 miRNA  M-to-S  AT5G56270  AT5G56270.1  WRKY