smRNA information   
smRNA ID siR99
Category siRNA
Stage G-to-M
Gene ID AT1G62910
Organelle Nucleus
Direction antisense
Sequence GAACCATTTGATCAACTAAAG
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
0.91 1.19 1.71 2.18 1.96 1.36 0.3
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 siRNA  M-to-S  AT1G11910  AT1G11910.1  response to abiotic stimulus,response to osmotic stress,response to salt stress