|
|
|
|
| smRNA ID |
TAS1A_S05 |
| Category |
tasiRNA |
| Stage |
M-to-S |
| Gene ID |
AT2G27400 |
| Organelle |
Nucleus |
| Direction |
sense |
| Sequence |
TGATTGGATCTTAGGAAATTA |
| 4D |
8D |
12D |
16D |
20D |
24D |
28D |
| 3.64 |
3.05 |
2.25 |
1.6 |
1.27 |
1.16 |
1.27 |
| Category |
Stage |
Gene ID |
Transcript ID |
GO |
| tasiRNA | G-to-M | AT4G01540 | AT4G01540.1 | regulation of transcription,response to endogenous stimulus |
| Category |
Stage |
Gene ID |
Transcript ID |
TF Family |
| tasiRNA | G-to-M | AT4G01540 | AT4G01540.1 | NAC |
|