smRNA information   
smRNA ID siR1209
Category siRNA
Stage M-to-S
Gene ID AT3G00000
Organelle Nucleus
Direction sense
Sequence GTCTGGAGAAGCGTCCTCAGC
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
2.37 1.87 1.48 1.26 1.02 0.82 0.67
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 siRNA  G-to-M  AT1G54100  AT1G54100.2  response to endogenous stimulus,response to abiotic stimulus,response to osmotic stress,response to salt stress,oxidation reduction