|
|
|
|
| smRNA ID |
siR1342 |
| Category |
siRNA |
| Stage |
M-to-S |
| Gene ID |
AT3G06435 |
| Organelle |
Nucleus |
| Direction |
sense |
| Sequence |
TTACCATAATCTACTTTACTG |
| 4D |
8D |
12D |
16D |
20D |
24D |
28D |
| 1.34 |
1.27 |
0.78 |
0.29 |
0.13 |
0.08 |
0.18 |
| Category |
Stage |
Gene ID |
Transcript ID |
GO |
| siRNA | G-to-M | AT1G18710 | AT1G18710.1 | regulation of transcription,response to endogenous stimulus,response to abiotic stimulus,response to osmotic stress,response to salt stress,response to jasmonic acid stimulus |
| Category |
Stage |
Gene ID |
Transcript ID |
TF Family |
| siRNA | G-to-M | AT1G18710 | AT1G18710.1 | MYB |
| siRNA | G-to-M | AT1G18710 | AT1G18710.1 | MYB |
|