smRNA information   
smRNA ID siR1384
Category siRNA
Stage M-to-S
Gene ID AT3G17185
Organelle Nucleus
Direction antisense
Sequence CAAGAAAAAGAGAATAATGAA
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
3.51 3.19 2.24 1.37 0.63 0.26 0.18
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 siRNA  G-to-M  AT5G58787  AT5G58787.1  -
 siRNA  G-to-M  AT1G18265  AT1G18265.1  -
 siRNA  G-to-M  AT5G18030  AT5G18030.1  response to endogenous stimulus,response to auxin stimulus
 siRNA  G-to-M  AT4G11910  AT4G11910.1  -
 siRNA  M-to-S  AT5G06760  AT5G06760.1  reproductive structure development
 siRNA  M-to-S  AT5G23660  AT5G23660.1  -
 siRNA  M-to-S  AT3G10190  AT3G10190.1  -
 siRNA  M-to-S  AT5G45130  AT5G45130.1  regulation of transcription,response to endogenous stimulus,response to abiotic stimulus,response to auxin stimulus,reproductive structure development
 siRNA  M-to-S  AT4G11910  AT4G11910.1  -
 siRNA  M-to-S  AT1G67970  AT1G67970.1  regulation of transcription
smRNA-DETF interaction   
Category Stage Gene ID Transcript ID TF Family
 siRNA  M-to-S  AT1G67970  AT1G67970.1  Hsfs