smRNA information   
smRNA ID siR1385
Category siRNA
Stage M-to-S
Gene ID AT3G17185
Organelle Nucleus
Direction antisense
Sequence TTGAGAAGAGATAGAATAGAA
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
7.06 6.74 5.65 4.54 3.42 2.45 1.57
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 siRNA  G-to-M  AT3G06510  AT3G06510.1  response to abiotic stimulus
 siRNA  G-to-M  AT5G14780  AT5G14780.1  response to wounding,response to metal ion,oxidation reduction
 siRNA  M-to-S  AT5G12230  AT5G12230.1  -
 siRNA  M-to-S  AT4G02380  AT4G02380.1  response to abiotic stimulus