smRNA information   
smRNA ID siR1406
Category siRNA
Stage M-to-S
Gene ID AT3G17185
Organelle Nucleus
Direction sense
Sequence TTTCTCCTACCTTGTCTATCC
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
2.33 1.76 1.28 0.86 0.54 0.28 0.06
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 siRNA  G-to-M  AT5G14565  AT5G14565.1  response to bacterium,response to abiotic stimulus,response to osmotic stress,response to salt stress