|
|
|
|
| smRNA ID |
siR1406 |
| Category |
siRNA |
| Stage |
M-to-S |
| Gene ID |
AT3G17185 |
| Organelle |
Nucleus |
| Direction |
sense |
| Sequence |
TTTCTCCTACCTTGTCTATCC |
| 4D |
8D |
12D |
16D |
20D |
24D |
28D |
| 2.33 |
1.76 |
1.28 |
0.86 |
0.54 |
0.28 |
0.06 |
| Category |
Stage |
Gene ID |
Transcript ID |
GO |
| siRNA | G-to-M | AT5G14565 | AT5G14565.1 | response to bacterium,response to abiotic stimulus,response to osmotic stress,response to salt stress |
|