PPR756 - Plant Editosome Database - CNCB-NGDC

Summary

Editing Factor: PPR756
Synonym: NA
Description: The Rice Pentatricopeptide Repeat Protein PPR756 Is Involved in Pollen Development by Affecting Multiple RNA Editing in Mitochondria
Protein Family: PPR
Subclass: E
Physical Interaction: OsMORF1; OsMORF8-1; OsMORF8-2
Construct Structure: PLS-E1-E2
Gene ID & Species: Os12g19260 (Oryza sativa)
Edited Gene(s): atp6    ccmC    nad7
Editing Type(s): C-to-U (24)
Publication(s): [1] The Rice Pentatricopeptide Repeat Protein PPR756 Is Involved in Pollen Development by Affecting Multiple RNA Editing in Mitochondria., Frontiers in plant science, 2020. [PMID=32595669]

Editing Details

Species Gene ID Organelle Edited Gene Position Region Nuclear Genome Organelle Genome Other Position Region Other Position Editing Type Codon Amino Acid Molecular Effect Experiment Details
Oryza sativa Os12g19260 Mitochondrion atp6 368 CDS NA NA NA NA C-to-U CCA=>CUA P=>L Recoding
Experiment Details
Genotype (Ecotype) Allele Treatment Treatment Detail Mutant Type Phenotype Tissue Development Stage Detection Method Editing Frequency Editing Extent Mutant Effect PMID
NAWTControlControlControlNormalNANART-PCR and direct sequencing77.78%HighNone32595669
NAPPR756-OE-2Generating over-expression (OE) transgenic lines, in which the CDS of PPR756 was driven by the ubiquitin promoter and fused with the Flag and cMyc tags.The overexpression lines were created by carrying the full length of cDNA of PPR756 without the stop codon fused to the N-terminus of tags, driven by the ubiquitin promoter in the pCAMBIA1301 backboneNAData showed chlorophyll a (Chla) and chlorophyll b (Chlb) were reduced in OE lines compared with the WT.NANART-PCR and direct sequencing85.00%HighSimilar32595669
NAppr756-1Applying the CRISPR-Cas9 system to create knock-out (KO) mutant lines using the background of ZH11 to confirm the function of PPR756.To construct the knock-out lines, we used the CRISPR-Cas9 system and designed two gRNAs (sgRNA1: CGCCCGAAACGAGTACTCCTGG and sgRNA2: GTATCCTGCTACGTGCGGGCTGG) driven by OsU6a and OsU3 for two target sitKnockoutData showed chlorophyll a (Chla) and chlorophyll b (Chlb) were highly accumulated in KO mutants compared with the WT. The knock-out plants of PPR756 exhibited retarded growth and greener leaves during the early vegetative stages, along with sterile pollen and lower seed setting at the reproductive stage.NANART-PCR and direct sequencing0.00%UneditedAbsent32595669
NAPPR756-OE-1Generating over-expression (OE) transgenic lines, in which the CDS of PPR756 was driven by the ubiquitin promoter and fused with the Flag and cMyc tags.The overexpression lines were created by carrying the full length of cDNA of PPR756 without the stop codon fused to the N-terminus of tags, driven by the ubiquitin promoter in the pCAMBIA1301 backboneNAData showed chlorophyll a (Chla) and chlorophyll b (Chlb) were reduced in OE lines compared with the WT.NANART-PCR and direct sequencing85.71%HighSimilar32595669
NAppr756-2Applying the CRISPR-Cas9 system to create knock-out (KO) mutant lines using the background of ZH11 to confirm the function of PPR756.To construct the knock-out lines, we used the CRISPR-Cas9 system and designed two gRNAs (sgRNA1: CGCCCGAAACGAGTACTCCTGG and sgRNA2: GTATCCTGCTACGTGCGGGCTGG) driven by OsU6a and OsU3 for two target sitKnockoutData showed chlorophyll a (Chla) and chlorophyll b (Chlb) were highly accumulated in KO mutants compared with the WT. The knock-out plants of PPR756 exhibited retarded growth and greener leaves during the early vegetative stages, along with sterile pollen and lower seed setting at the reproductive stage.NANART-PCR and direct sequencing0.00%UneditedAbsent32595669
NAppr756-3Applying the CRISPR-Cas9 system to create knock-out (KO) mutant lines using the background of ZH11 to confirm the function of PPR756.To construct the knock-out lines, we used the CRISPR-Cas9 system and designed two gRNAs (sgRNA1: CGCCCGAAACGAGTACTCCTGG and sgRNA2: GTATCCTGCTACGTGCGGGCTGG) driven by OsU6a and OsU3 for two target sitKnockoutData showed chlorophyll a (Chla) and chlorophyll b (Chlb) were highly accumulated in KO mutants compared with the WT. The knock-out plants of PPR756 exhibited retarded growth and greener leaves during the early vegetative stages, along with sterile pollen and lower seed setting at the reproductive stage.NANART-PCR and direct sequencing0.00%UneditedAbsent32595669
NAppr756-4Applying the CRISPR-Cas9 system to create knock-out (KO) mutant lines using the background of ZH11 to confirm the function of PPR756.To construct the knock-out lines, we used the CRISPR-Cas9 system and designed two gRNAs (sgRNA1: CGCCCGAAACGAGTACTCCTGG and sgRNA2: GTATCCTGCTACGTGCGGGCTGG) driven by OsU6a and OsU3 for two target sitKnockoutData showed chlorophyll a (Chla) and chlorophyll b (Chlb) were highly accumulated in KO mutants compared with the WT. The knock-out plants of PPR756 exhibited retarded growth and greener leaves during the early vegetative stages, along with sterile pollen and lower seed setting at the reproductive stage.NANART-PCR and direct sequencing0.00%UneditedAbsent32595669
NAPPR756-RNAiInvestigating novel independent RNAi lines, in which the expression of Os12g19260 was knocked down solidly.To construct the RNAi lines, a fragment (ranging from 13 to 354 bp) of Os12g19260 cDNA was amplified with primers and cloned into the pH7GWIWG(II) vector to construct the RNAi vector. KnockdownThese lines displayed pleotropic phenotypes compared with the WT, including delayed development, more green leaves, and smaller leaf angles in the early vegetative stageNANART-PCR and direct sequencing78.57%HighSimilar32595669
Oryza sativa Os12g19260 Mitochondrion ccmC 236 CDS NA NA NA NA C-to-U CCA=>CUA P=>L Recoding
Experiment Details
Genotype (Ecotype) Allele Treatment Treatment Detail Mutant Type Phenotype Tissue Development Stage Detection Method Editing Frequency Editing Extent Mutant Effect PMID
NAWTControlControlControlNormalNANART-PCR and direct sequencing100.00%CompleteNone32595669
NAPPR756-OE-2Generating over-expression (OE) transgenic lines, in which the CDS of PPR756 was driven by the ubiquitin promoter and fused with the Flag and cMyc tags.The overexpression lines were created by carrying the full length of cDNA of PPR756 without the stop codon fused to the N-terminus of tags, driven by the ubiquitin promoter in the pCAMBIA1301 backboneNAData showed chlorophyll a (Chla) and chlorophyll b (Chlb) were reduced in OE lines compared with the WT.NANART-PCR and direct sequencing100.00%CompleteSimilar32595669
NAppr756-1Applying the CRISPR-Cas9 system to create knock-out (KO) mutant lines using the background of ZH11 to confirm the function of PPR756.To construct the knock-out lines, we used the CRISPR-Cas9 system and designed two gRNAs (sgRNA1: CGCCCGAAACGAGTACTCCTGG and sgRNA2: GTATCCTGCTACGTGCGGGCTGG) driven by OsU6a and OsU3 for two target sitKnockoutData showed chlorophyll a (Chla) and chlorophyll b (Chlb) were highly accumulated in KO mutants compared with the WT. The knock-out plants of PPR756 exhibited retarded growth and greener leaves during the early vegetative stages, along with sterile pollen and lower seed setting at the reproductive stage.NANART-PCR and direct sequencing0.00%UneditedAbsent32595669
NAPPR756-OE-1Generating over-expression (OE) transgenic lines, in which the CDS of PPR756 was driven by the ubiquitin promoter and fused with the Flag and cMyc tags.The overexpression lines were created by carrying the full length of cDNA of PPR756 without the stop codon fused to the N-terminus of tags, driven by the ubiquitin promoter in the pCAMBIA1301 backboneNAData showed chlorophyll a (Chla) and chlorophyll b (Chlb) were reduced in OE lines compared with the WT.NANART-PCR and direct sequencing100.00%CompleteSimilar32595669
NAppr756-2Applying the CRISPR-Cas9 system to create knock-out (KO) mutant lines using the background of ZH11 to confirm the function of PPR756.To construct the knock-out lines, we used the CRISPR-Cas9 system and designed two gRNAs (sgRNA1: CGCCCGAAACGAGTACTCCTGG and sgRNA2: GTATCCTGCTACGTGCGGGCTGG) driven by OsU6a and OsU3 for two target sitKnockoutData showed chlorophyll a (Chla) and chlorophyll b (Chlb) were highly accumulated in KO mutants compared with the WT. The knock-out plants of PPR756 exhibited retarded growth and greener leaves during the early vegetative stages, along with sterile pollen and lower seed setting at the reproductive stage.NANART-PCR and direct sequencing0.00%UneditedAbsent32595669
NAppr756-3Applying the CRISPR-Cas9 system to create knock-out (KO) mutant lines using the background of ZH11 to confirm the function of PPR756.To construct the knock-out lines, we used the CRISPR-Cas9 system and designed two gRNAs (sgRNA1: CGCCCGAAACGAGTACTCCTGG and sgRNA2: GTATCCTGCTACGTGCGGGCTGG) driven by OsU6a and OsU3 for two target sitKnockoutData showed chlorophyll a (Chla) and chlorophyll b (Chlb) were highly accumulated in KO mutants compared with the WT. The knock-out plants of PPR756 exhibited retarded growth and greener leaves during the early vegetative stages, along with sterile pollen and lower seed setting at the reproductive stage.NANART-PCR and direct sequencing0.00%UneditedAbsent32595669
NAppr756-4Applying the CRISPR-Cas9 system to create knock-out (KO) mutant lines using the background of ZH11 to confirm the function of PPR756.To construct the knock-out lines, we used the CRISPR-Cas9 system and designed two gRNAs (sgRNA1: CGCCCGAAACGAGTACTCCTGG and sgRNA2: GTATCCTGCTACGTGCGGGCTGG) driven by OsU6a and OsU3 for two target sitKnockoutData showed chlorophyll a (Chla) and chlorophyll b (Chlb) were highly accumulated in KO mutants compared with the WT. The knock-out plants of PPR756 exhibited retarded growth and greener leaves during the early vegetative stages, along with sterile pollen and lower seed setting at the reproductive stage.NANART-PCR and direct sequencing0.00%UneditedAbsent32595669
NAPPR756-RNAiInvestigating novel independent RNAi lines, in which the expression of Os12g19260 was knocked down solidly.To construct the RNAi lines, a fragment (ranging from 13 to 354 bp) of Os12g19260 cDNA was amplified with primers and cloned into the pH7GWIWG(II) vector to construct the RNAi vector. KnockdownThese lines displayed pleotropic phenotypes compared with the WT, including delayed development, more green leaves, and smaller leaf angles in the early vegetative stageNANART-PCR and direct sequencing80.00%HighDecreased32595669
Oryza sativa Os12g19260 Mitochondrion nad7 83 CDS NA NA NA NA C-to-U UCA=>UUA S=>L Recoding
Experiment Details
Genotype (Ecotype) Allele Treatment Treatment Detail Mutant Type Phenotype Tissue Development Stage Detection Method Editing Frequency Editing Extent Mutant Effect PMID
NAWTControlControlControlNormalNANART-PCR and direct sequencing100.00%CompleteNone32595669
NAPPR756-OE-2Generating over-expression (OE) transgenic lines, in which the CDS of PPR756 was driven by the ubiquitin promoter and fused with the Flag and cMyc tags.The overexpression lines were created by carrying the full length of cDNA of PPR756 without the stop codon fused to the N-terminus of tags, driven by the ubiquitin promoter in the pCAMBIA1301 backboneNAData showed chlorophyll a (Chla) and chlorophyll b (Chlb) were reduced in OE lines compared with the WT.NANART-PCR and direct sequencing100.00%CompleteSimilar32595669
NAppr756-1Applying the CRISPR-Cas9 system to create knock-out (KO) mutant lines using the background of ZH11 to confirm the function of PPR756.To construct the knock-out lines, we used the CRISPR-Cas9 system and designed two gRNAs (sgRNA1: CGCCCGAAACGAGTACTCCTGG and sgRNA2: GTATCCTGCTACGTGCGGGCTGG) driven by OsU6a and OsU3 for two target sitKnockoutData showed chlorophyll a (Chla) and chlorophyll b (Chlb) were highly accumulated in KO mutants compared with the WT. The knock-out plants of PPR756 exhibited retarded growth and greener leaves during the early vegetative stages, along with sterile pollen and lower seed setting at the reproductive stage.NANART-PCR and direct sequencing0.00%UneditedAbsent32595669
NAPPR756-OE-1Generating over-expression (OE) transgenic lines, in which the CDS of PPR756 was driven by the ubiquitin promoter and fused with the Flag and cMyc tags.The overexpression lines were created by carrying the full length of cDNA of PPR756 without the stop codon fused to the N-terminus of tags, driven by the ubiquitin promoter in the pCAMBIA1301 backboneNAData showed chlorophyll a (Chla) and chlorophyll b (Chlb) were reduced in OE lines compared with the WT.NANART-PCR and direct sequencing100.00%CompleteSimilar32595669
NAppr756-2Applying the CRISPR-Cas9 system to create knock-out (KO) mutant lines using the background of ZH11 to confirm the function of PPR756.To construct the knock-out lines, we used the CRISPR-Cas9 system and designed two gRNAs (sgRNA1: CGCCCGAAACGAGTACTCCTGG and sgRNA2: GTATCCTGCTACGTGCGGGCTGG) driven by OsU6a and OsU3 for two target sitKnockoutData showed chlorophyll a (Chla) and chlorophyll b (Chlb) were highly accumulated in KO mutants compared with the WT. The knock-out plants of PPR756 exhibited retarded growth and greener leaves during the early vegetative stages, along with sterile pollen and lower seed setting at the reproductive stage.NANART-PCR and direct sequencing0.00%UneditedAbsent32595669
NAppr756-3Applying the CRISPR-Cas9 system to create knock-out (KO) mutant lines using the background of ZH11 to confirm the function of PPR756.To construct the knock-out lines, we used the CRISPR-Cas9 system and designed two gRNAs (sgRNA1: CGCCCGAAACGAGTACTCCTGG and sgRNA2: GTATCCTGCTACGTGCGGGCTGG) driven by OsU6a and OsU3 for two target sitKnockoutData showed chlorophyll a (Chla) and chlorophyll b (Chlb) were highly accumulated in KO mutants compared with the WT. The knock-out plants of PPR756 exhibited retarded growth and greener leaves during the early vegetative stages, along with sterile pollen and lower seed setting at the reproductive stage.NANART-PCR and direct sequencing0.00%UneditedAbsent32595669
NAppr756-4Applying the CRISPR-Cas9 system to create knock-out (KO) mutant lines using the background of ZH11 to confirm the function of PPR756.To construct the knock-out lines, we used the CRISPR-Cas9 system and designed two gRNAs (sgRNA1: CGCCCGAAACGAGTACTCCTGG and sgRNA2: GTATCCTGCTACGTGCGGGCTGG) driven by OsU6a and OsU3 for two target sitKnockoutData showed chlorophyll a (Chla) and chlorophyll b (Chlb) were highly accumulated in KO mutants compared with the WT. The knock-out plants of PPR756 exhibited retarded growth and greener leaves during the early vegetative stages, along with sterile pollen and lower seed setting at the reproductive stage.NANART-PCR and direct sequencing0.00%UneditedAbsent32595669
NAPPR756-RNAiInvestigating novel independent RNAi lines, in which the expression of Os12g19260 was knocked down solidly.To construct the RNAi lines, a fragment (ranging from 13 to 354 bp) of Os12g19260 cDNA was amplified with primers and cloned into the pH7GWIWG(II) vector to construct the RNAi vector. KnockdownThese lines displayed pleotropic phenotypes compared with the WT, including delayed development, more green leaves, and smaller leaf angles in the early vegetative stageNANART-PCR and direct sequencing76.92%HighDecreased32595669
Last update: Feb 2026 (version 2.0)