Experiment Details
| Genotype (Ecotype) |
Allele |
Treatment |
Treatment Detail |
Mutant Type |
Phenotype |
Tissue |
Development Stage |
Detection Method |
Editing Frequency |
Editing Extent |
Mutant Effect |
PMID |
| NA | WT | No treatment | No treatment | No treatment | Normal | NA | NA | RT-PCR and direct sequencing | 100.00% | Complete | None | 32595669 |
| NA | PPR756-OE-2 | Generating over-expression (OE) transgenic lines, in which the CDS of PPR756 was driven by the ubiquitin promoter and fused with the Flag and cMyc tags. | The overexpression lines were created by carrying the full length of cDNA of PPR756 without the stop codon fused to the N-terminus of tags, driven by the ubiquitin promoter in the pCAMBIA1301 backbone | NA | Data showed chlorophyll a (Chla) and chlorophyll b (Chlb) were reduced in OE lines compared with the WT. | NA | NA | RT-PCR and direct sequencing | 100.00% | Complete | Similar | 32595669 |
| NA | ppr756-1 | Applying the CRISPR-Cas9 system to create knock-out (KO) mutant lines using the background of ZH11 to confirm the function of PPR756. | To construct the knock-out lines, we used the CRISPR-Cas9 system and designed two gRNAs (sgRNA1: CGCCCGAAACGAGTACTCCTGG and sgRNA2: GTATCCTGCTACGTGCGGGCTGG) driven by OsU6a and OsU3 for two target sit | Knockout | Data showed chlorophyll a (Chla) and chlorophyll b (Chlb) were highly accumulated in KO mutants compared with the WT. The knock-out plants of PPR756 exhibited retarded growth and greener leaves during the early vegetative stages, along with sterile pollen and lower seed setting at the reproductive stage. | NA | NA | RT-PCR and direct sequencing | 0.00% | Unedited | Absent | 32595669 |
| NA | PPR756-OE-1 | Generating over-expression (OE) transgenic lines, in which the CDS of PPR756 was driven by the ubiquitin promoter and fused with the Flag and cMyc tags. | The overexpression lines were created by carrying the full length of cDNA of PPR756 without the stop codon fused to the N-terminus of tags, driven by the ubiquitin promoter in the pCAMBIA1301 backbone | NA | Data showed chlorophyll a (Chla) and chlorophyll b (Chlb) were reduced in OE lines compared with the WT. | NA | NA | RT-PCR and direct sequencing | 100.00% | Complete | Similar | 32595669 |
| NA | ppr756-2 | Applying the CRISPR-Cas9 system to create knock-out (KO) mutant lines using the background of ZH11 to confirm the function of PPR756. | To construct the knock-out lines, we used the CRISPR-Cas9 system and designed two gRNAs (sgRNA1: CGCCCGAAACGAGTACTCCTGG and sgRNA2: GTATCCTGCTACGTGCGGGCTGG) driven by OsU6a and OsU3 for two target sit | Knockout | Data showed chlorophyll a (Chla) and chlorophyll b (Chlb) were highly accumulated in KO mutants compared with the WT. The knock-out plants of PPR756 exhibited retarded growth and greener leaves during the early vegetative stages, along with sterile pollen and lower seed setting at the reproductive stage. | NA | NA | RT-PCR and direct sequencing | 0.00% | Unedited | Absent | 32595669 |
| NA | ppr756-3 | Applying the CRISPR-Cas9 system to create knock-out (KO) mutant lines using the background of ZH11 to confirm the function of PPR756. | To construct the knock-out lines, we used the CRISPR-Cas9 system and designed two gRNAs (sgRNA1: CGCCCGAAACGAGTACTCCTGG and sgRNA2: GTATCCTGCTACGTGCGGGCTGG) driven by OsU6a and OsU3 for two target sit | Knockout | Data showed chlorophyll a (Chla) and chlorophyll b (Chlb) were highly accumulated in KO mutants compared with the WT. The knock-out plants of PPR756 exhibited retarded growth and greener leaves during the early vegetative stages, along with sterile pollen and lower seed setting at the reproductive stage. | NA | NA | RT-PCR and direct sequencing | 0.00% | Unedited | Absent | 32595669 |
| NA | ppr756-4 | Applying the CRISPR-Cas9 system to create knock-out (KO) mutant lines using the background of ZH11 to confirm the function of PPR756. | To construct the knock-out lines, we used the CRISPR-Cas9 system and designed two gRNAs (sgRNA1: CGCCCGAAACGAGTACTCCTGG and sgRNA2: GTATCCTGCTACGTGCGGGCTGG) driven by OsU6a and OsU3 for two target sit | Knockout | Data showed chlorophyll a (Chla) and chlorophyll b (Chlb) were highly accumulated in KO mutants compared with the WT. The knock-out plants of PPR756 exhibited retarded growth and greener leaves during the early vegetative stages, along with sterile pollen and lower seed setting at the reproductive stage. | NA | NA | RT-PCR and direct sequencing | 0.00% | Unedited | Absent | 32595669 |
| NA | PPR756-RNAi | Investigating novel independent RNAi lines, in which the expression of Os12g19260 was knocked down solidly. | To construct the RNAi lines, a fragment (ranging from 13 to 354 bp) of Os12g19260 cDNA was amplified with primers and cloned into the pH7GWIWG(II) vector to construct the RNAi vector. | Knockdown | These lines displayed pleotropic phenotypes compared with the WT, including delayed development, more green leaves, and smaller leaf angles in the early vegetative stage | NA | NA | RT-PCR and direct sequencing | 80.00% | High | Decreased | 32595669 |