Oryza sativa |
Os12g36620 |
Mitochondrion |
nad3
|
155 |
CDS |
C-to-U |
CCG=>CUG |
P=>L |
Recoding |
|
Experiment Details
Genotype (Ecotype) |
Allele |
Treatment |
Treatment Detail |
Mutant Type |
Phenotype |
Tissue |
Development Stage |
Detection Method |
Editing Frequency |
Editing Extent |
Mutant Effect |
PMID |
ZhongHua 11 | WT | No treatment | No treatment | No treatment | Normal | Calli | NA | RT‐PCR products were sequenced directly | 73.00% | High | None | 30019754 | ZhongHua 11 | pps1‐RNAi | RNAi | A 251 bp fragment (ranging from 56 to 306 bp) of LOC_Os12 g36620 cDNA was cloned into the pH7GWIWG(II) vector to construct the RNAi vector. Calli derived from ZhongHua 11 (Oryza sativa. L. Japonica) w | Knockdown | Growing slowly, dwarfing and delayed development in vegetative stages, smaller and shorter anthers, sterile pollen, lower germination on the stigma, shorter panicles and lower seed‐setting rates. | Calli | NA | RT‐PCR products were sequenced directly | 12.00% | Poor | Decreased | 30019754 | ZhongHua 11 | T0-4 | RNAi | A 251 bp fragment (ranging from 56 to 306 bp) of LOC_Os12 g36620 cDNA was cloned into the pH7GWIWG(II) vector to construct the RNAi vector. Calli derived from ZhongHua 11 (Oryza sativa. L. Japonica) w | Knockdown | NA | Calli | NA | RT‐PCR products were sequenced directly | 26.92% | Low | Decreased | 30019754 | ZhongHua 11 | T0-6 | RNAi | A 251 bp fragment (ranging from 56 to 306 bp) of LOC_Os12 g36620 cDNA was cloned into the pH7GWIWG(II) vector to construct the RNAi vector. Calli derived from ZhongHua 11 (Oryza sativa. L. Japonica) w | Knockdown | NA | Calli | NA | RT‐PCR products were sequenced directly | 14.29% | Poor | Decreased | 30019754 | ZhongHua 11 | T0-21 | RNAi | A 251 bp fragment (ranging from 56 to 306 bp) of LOC_Os12 g36620 cDNA was cloned into the pH7GWIWG(II) vector to construct the RNAi vector. Calli derived from ZhongHua 11 (Oryza sativa. L. Japonica) w | Knockdown | NA | Calli | NA | RT‐PCR products were sequenced directly | 21.43% | Low | Decreased | 30019754 | ZhongHua 11 | pps1/+ #1 | A single‐base insertion at target site 1 | pps1 knockout plants generated using the CRISPR/Cas9 system. Target site 1 for Knockout: GGTTCCGGAGATACACGCGAAGG | Knockout | Growing slowly, dwarfing and delayed development in vegetative stages, smaller and shorter anthers, sterile pollen, lower germination on the stigma, shorter panicles and lower seed‐setting rates. | Calli | NA | RT‐PCR products were sequenced directly | 0.00% | Unedited | Absent | 30019754 | ZhongHua 11 | pps1/+ #2 | A four‐base deletion at target site 2 | pps1 knockout plants generated using the CRISPR/Cas9 system. Target site 2 for Knockout: GCCTGGCCTTGTCCGCAAATAGG | Knockout | Growing slowly, dwarfing and delayed development in vegetative stages, smaller and shorter anthers, sterile pollen, lower germination on the stigma, shorter panicles and lower seed‐setting rates. | Calli | NA | RT‐PCR products were sequenced directly | 10.00% | Poor | Decreased | 30019754 |
|
Oryza sativa |
Os12g36620 |
Mitochondrion |
nad3
|
172 |
CDS |
C-to-U |
CCA=>UUA(172 and 173) |
P=>L |
Recoding |
|
Experiment Details
Genotype (Ecotype) |
Allele |
Treatment |
Treatment Detail |
Mutant Type |
Phenotype |
Tissue |
Development Stage |
Detection Method |
Editing Frequency |
Editing Extent |
Mutant Effect |
PMID |
ZhongHua 11 | WT | No treatment | No treatment | No treatment | Normal | Calli | NA | RT‐PCR products were sequenced directly | 75.00% | High | None | 30019754 | ZhongHua 11 | pps1‐RNAi | RNAi | A 251 bp fragment (ranging from 56 to 306 bp) of LOC_Os12 g36620 cDNA was cloned into the pH7GWIWG(II) vector to construct the RNAi vector. Calli derived from ZhongHua 11 (Oryza sativa. L. Japonica) w | Knockdown | Growing slowly, dwarfing and delayed development in vegetative stages, smaller and shorter anthers, sterile pollen, lower germination on the stigma, shorter panicles and lower seed‐setting rates. | Calli | NA | RT‐PCR products were sequenced directly | 10.00% | Poor | Decreased | 30019754 | ZhongHua 11 | T0-4 | RNAi | A 251 bp fragment (ranging from 56 to 306 bp) of LOC_Os12 g36620 cDNA was cloned into the pH7GWIWG(II) vector to construct the RNAi vector. Calli derived from ZhongHua 11 (Oryza sativa. L. Japonica) w | Knockdown | NA | Calli | NA | RT‐PCR products were sequenced directly | 13.04% | Poor | Decreased | 30019754 | ZhongHua 11 | T0-6 | RNAi | A 251 bp fragment (ranging from 56 to 306 bp) of LOC_Os12 g36620 cDNA was cloned into the pH7GWIWG(II) vector to construct the RNAi vector. Calli derived from ZhongHua 11 (Oryza sativa. L. Japonica) w | Knockdown | NA | Calli | NA | RT‐PCR products were sequenced directly | 5.88% | Poor | Decreased | 30019754 | ZhongHua 11 | T0-21 | RNAi | A 251 bp fragment (ranging from 56 to 306 bp) of LOC_Os12 g36620 cDNA was cloned into the pH7GWIWG(II) vector to construct the RNAi vector. Calli derived from ZhongHua 11 (Oryza sativa. L. Japonica) w | Knockdown | NA | Calli | NA | RT‐PCR products were sequenced directly | 10.00% | Poor | Decreased | 30019754 | ZhongHua 11 | pps1/+ #1 | A single‐base insertion at target site 1 | pps1 knockout plants generated using the CRISPR/Cas9 system. Target site 1 for Knockout: GGTTCCGGAGATACACGCGAAGG | Knockout | Growing slowly, dwarfing and delayed development in vegetative stages, smaller and shorter anthers, sterile pollen, lower germination on the stigma, shorter panicles and lower seed‐setting rates. | Calli | NA | RT‐PCR products were sequenced directly | 0.00% | Unedited | Absent | 30019754 | ZhongHua 11 | pps1/+ #2 | A four‐base deletion at target site 2 | pps1 knockout plants generated using the CRISPR/Cas9 system. Target site 2 for Knockout: GCCTGGCCTTGTCCGCAAATAGG | Knockout | Growing slowly, dwarfing and delayed development in vegetative stages, smaller and shorter anthers, sterile pollen, lower germination on the stigma, shorter panicles and lower seed‐setting rates. | Calli | NA | RT‐PCR products were sequenced directly | 15.00% | Poor | Decreased | 30019754 |
|
Oryza sativa |
Os12g36620 |
Mitochondrion |
nad3
|
173 |
CDS |
C-to-U |
CCA=>UUA(172 and 173) |
P=>L |
Recoding |
|
Experiment Details
Genotype (Ecotype) |
Allele |
Treatment |
Treatment Detail |
Mutant Type |
Phenotype |
Tissue |
Development Stage |
Detection Method |
Editing Frequency |
Editing Extent |
Mutant Effect |
PMID |
ZhongHua 11 | WT | No treatment | No treatment | No treatment | Normal | Calli | NA | RT‐PCR products were sequenced directly | 80.00% | High | None | 30019754 | ZhongHua 11 | pps1‐RNAi | RNAi | A 251 bp fragment (ranging from 56 to 306 bp) of LOC_Os12 g36620 cDNA was cloned into the pH7GWIWG(II) vector to construct the RNAi vector. Calli derived from ZhongHua 11 (Oryza sativa. L. Japonica) w | Knockdown | Growing slowly, dwarfing and delayed development in vegetative stages, smaller and shorter anthers, sterile pollen, lower germination on the stigma, shorter panicles and lower seed‐setting rates. | Calli | NA | RT‐PCR products were sequenced directly | 15.00% | Poor | Decreased | 30019754 | ZhongHua 11 | T0-4 | RNAi | A 251 bp fragment (ranging from 56 to 306 bp) of LOC_Os12 g36620 cDNA was cloned into the pH7GWIWG(II) vector to construct the RNAi vector. Calli derived from ZhongHua 11 (Oryza sativa. L. Japonica) w | Knockdown | NA | Calli | NA | RT‐PCR products were sequenced directly | 50.00% | Poor | Decreased | 30019754 | ZhongHua 11 | T0-6 | RNAi | A 251 bp fragment (ranging from 56 to 306 bp) of LOC_Os12 g36620 cDNA was cloned into the pH7GWIWG(II) vector to construct the RNAi vector. Calli derived from ZhongHua 11 (Oryza sativa. L. Japonica) w | Knockdown | NA | Calli | NA | RT‐PCR products were sequenced directly | 25.00% | Low | Decreased | 30019754 | ZhongHua 11 | T0-21 | RNAi | A 251 bp fragment (ranging from 56 to 306 bp) of LOC_Os12 g36620 cDNA was cloned into the pH7GWIWG(II) vector to construct the RNAi vector. Calli derived from ZhongHua 11 (Oryza sativa. L. Japonica) w | Knockdown | NA | Calli | NA | RT‐PCR products were sequenced directly | 45.83% | Poor | Decreased | 30019754 | ZhongHua 11 | pps1/+ #1 | A single‐base insertion at target site 1 | pps1 knockout plants generated using the CRISPR/Cas9 system. Target site 1 for Knockout: GGTTCCGGAGATACACGCGAAGG | Knockout | Growing slowly, dwarfing and delayed development in vegetative stages, smaller and shorter anthers, sterile pollen, lower germination on the stigma, shorter panicles and lower seed‐setting rates. | Calli | NA | RT‐PCR products were sequenced directly | 0.00% | Unedited | Absent | 30019754 | ZhongHua 11 | pps1/+ #2 | A four‐base deletion at target site 2 | pps1 knockout plants generated using the CRISPR/Cas9 system. Target site 2 for Knockout: GCCTGGCCTTGTCCGCAAATAGG | Knockout | Growing slowly, dwarfing and delayed development in vegetative stages, smaller and shorter anthers, sterile pollen, lower germination on the stigma, shorter panicles and lower seed‐setting rates. | Calli | NA | RT‐PCR products were sequenced directly | 15.00% | Poor | Decreased | 30019754 |
|
Oryza sativa |
Os12g36620 |
Mitochondrion |
nad3
|
190 |
CDS |
C-to-U |
CCA=>UUA(190 and 191) |
P=>L |
Recoding |
|
Experiment Details
Genotype (Ecotype) |
Allele |
Treatment |
Treatment Detail |
Mutant Type |
Phenotype |
Tissue |
Development Stage |
Detection Method |
Editing Frequency |
Editing Extent |
Mutant Effect |
PMID |
ZhongHua 11 | WT | No treatment | No treatment | No treatment | Normal | Calli | NA | RT‐PCR products were sequenced directly | 79.00% | High | None | 30019754 | ZhongHua 11 | pps1‐RNAi | RNAi | A 251 bp fragment (ranging from 56 to 306 bp) of LOC_Os12 g36620 cDNA was cloned into the pH7GWIWG(II) vector to construct the RNAi vector. Calli derived from ZhongHua 11 (Oryza sativa. L. Japonica) w | Knockdown | Growing slowly, dwarfing and delayed development in vegetative stages, smaller and shorter anthers, sterile pollen, lower germination on the stigma, shorter panicles and lower seed‐setting rates. | Calli | NA | RT‐PCR products were sequenced directly | 8.00% | Poor | Decreased | 30019754 | ZhongHua 11 | T0-4 | RNAi | A 251 bp fragment (ranging from 56 to 306 bp) of LOC_Os12 g36620 cDNA was cloned into the pH7GWIWG(II) vector to construct the RNAi vector. Calli derived from ZhongHua 11 (Oryza sativa. L. Japonica) w | Knockdown | NA | Calli | NA | RT‐PCR products were sequenced directly | 20.00% | Low | Decreased | 30019754 | ZhongHua 11 | T0-6 | RNAi | A 251 bp fragment (ranging from 56 to 306 bp) of LOC_Os12 g36620 cDNA was cloned into the pH7GWIWG(II) vector to construct the RNAi vector. Calli derived from ZhongHua 11 (Oryza sativa. L. Japonica) w | Knockdown | NA | Calli | NA | RT‐PCR products were sequenced directly | 13.64% | Poor | Decreased | 30019754 | ZhongHua 11 | T0-21 | RNAi | A 251 bp fragment (ranging from 56 to 306 bp) of LOC_Os12 g36620 cDNA was cloned into the pH7GWIWG(II) vector to construct the RNAi vector. Calli derived from ZhongHua 11 (Oryza sativa. L. Japonica) w | Knockdown | NA | Calli | NA | RT‐PCR products were sequenced directly | 8.70% | Poor | Decreased | 30019754 | ZhongHua 11 | pps1/+ #1 | A single‐base insertion at target site 1 | pps1 knockout plants generated using the CRISPR/Cas9 system. Target site 1 for Knockout: GGTTCCGGAGATACACGCGAAGG | Knockout | Growing slowly, dwarfing and delayed development in vegetative stages, smaller and shorter anthers, sterile pollen, lower germination on the stigma, shorter panicles and lower seed‐setting rates. | Calli | NA | RT‐PCR products were sequenced directly | 0.00% | Unedited | Absent | 30019754 | ZhongHua 11 | pps1/+ #2 | A four‐base deletion at target site 2 | pps1 knockout plants generated using the CRISPR/Cas9 system. Target site 2 for Knockout: GCCTGGCCTTGTCCGCAAATAGG | Knockout | Growing slowly, dwarfing and delayed development in vegetative stages, smaller and shorter anthers, sterile pollen, lower germination on the stigma, shorter panicles and lower seed‐setting rates. | Calli | NA | RT‐PCR products were sequenced directly | 0.00% | Unedited | Absent | 30019754 |
|
Oryza sativa |
Os12g36620 |
Mitochondrion |
nad3
|
191 |
CDS |
C-to-U |
CCA=>UUA(190 and 191) |
P=>L |
Recoding |
|
Experiment Details
Genotype (Ecotype) |
Allele |
Treatment |
Treatment Detail |
Mutant Type |
Phenotype |
Tissue |
Development Stage |
Detection Method |
Editing Frequency |
Editing Extent |
Mutant Effect |
PMID |
ZhongHua 11 | WT | No treatment | No treatment | No treatment | Normal | Calli | NA | RT‐PCR products were sequenced directly | 83.00% | High | None | 30019754 | ZhongHua 11 | pps1‐RNAi | RNAi | A 251 bp fragment (ranging from 56 to 306 bp) of LOC_Os12 g36620 cDNA was cloned into the pH7GWIWG(II) vector to construct the RNAi vector. Calli derived from ZhongHua 11 (Oryza sativa. L. Japonica) w | Knockdown | Growing slowly, dwarfing and delayed development in vegetative stages, smaller and shorter anthers, sterile pollen, lower germination on the stigma, shorter panicles and lower seed‐setting rates. | Calli | NA | RT‐PCR products were sequenced directly | 10.00% | Poor | Decreased | 30019754 | ZhongHua 11 | T0-4 | RNAi | A 251 bp fragment (ranging from 56 to 306 bp) of LOC_Os12 g36620 cDNA was cloned into the pH7GWIWG(II) vector to construct the RNAi vector. Calli derived from ZhongHua 11 (Oryza sativa. L. Japonica) w | Knockdown | NA | Calli | NA | RT‐PCR products were sequenced directly | 33.33% | Poor | Decreased | 30019754 | ZhongHua 11 | T0-6 | RNAi | A 251 bp fragment (ranging from 56 to 306 bp) of LOC_Os12 g36620 cDNA was cloned into the pH7GWIWG(II) vector to construct the RNAi vector. Calli derived from ZhongHua 11 (Oryza sativa. L. Japonica) w | Knockdown | NA | Calli | NA | RT‐PCR products were sequenced directly | 28.57% | Poor | Decreased | 30019754 | ZhongHua 11 | T0-21 | RNAi | A 251 bp fragment (ranging from 56 to 306 bp) of LOC_Os12 g36620 cDNA was cloned into the pH7GWIWG(II) vector to construct the RNAi vector. Calli derived from ZhongHua 11 (Oryza sativa. L. Japonica) w | Knockdown | NA | Calli | NA | RT‐PCR products were sequenced directly | 20.00% | Low | Decreased | 30019754 | ZhongHua 11 | pps1/+ #1 | A single‐base insertion at target site 1 | pps1 knockout plants generated using the CRISPR/Cas9 system. Target site 1 for Knockout: GGTTCCGGAGATACACGCGAAGG | Knockout | Growing slowly, dwarfing and delayed development in vegetative stages, smaller and shorter anthers, sterile pollen, lower germination on the stigma, shorter panicles and lower seed‐setting rates. | Calli | NA | RT‐PCR products were sequenced directly | 0.00% | Unedited | Absent | 30019754 | ZhongHua 11 | pps1/+ #2 | A four‐base deletion at target site 2 | pps1 knockout plants generated using the CRISPR/Cas9 system. Target site 2 for Knockout: GCCTGGCCTTGTCCGCAAATAGG | Knockout | Growing slowly, dwarfing and delayed development in vegetative stages, smaller and shorter anthers, sterile pollen, lower germination on the stigma, shorter panicles and lower seed‐setting rates. | Calli | NA | RT‐PCR products were sequenced directly | 0.00% | Unedited | Absent | 30019754 |
|