|
|
|
|
| Locus name | AT1G49900 |
| Organism | Arabidopsis thaliana | | Taxonomic identifier | [NCBI] | | Function category | Transcription regulation(C2H2) | | Effect for Senescence | unclear | | Gene Description | zinc finger (C2H2 type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding, nucleic acid binding | | Evidence | Genomic evidence:microarray data [Ref 1] | | References | 1: Breeze E, Harrison E, McHattie S, Hughes L, Hickman R, Hill C, Kiddle S, Kim YS, Penfold CA, Jenkins D, Zhang C, Morris K, Jenner C, Jackson S, Thomas B, Tabrett A, Legaie R, Moore JD, Wild DL, Ott S, Rand D, Beynon J, Denby K, Mead A, Buchanan-WollastonHigh-resolution temporal profiling of transcripts during Arabidopsis leaf senescence reveals a distinct chronology of processes and regulation.Plant Cell 2011 Mar;23(3):873-94 | | Gene Ontology | | | Sequence | AT1G49900.1 | Genomic | mRNA | CDS | Protein
|
miRNA Interaction  | |
| | Details | | target: AT1G49900.1 miRNA: ath-miR414 miRNA: ath-miR414 mfe: -37.5 kcal/mol p-value: 0.000127
position: 1942 target 5' A U 3' UGAUGAUGGUGAUGAGGAUGA ACUGCUACUACUACUUCUACU miRNA 3' 5'
|
|
Ortholog Group  | |
| | Ortholog Groups: OG5_149596 | | Accession | Taxon | | NP_175412 ( AT1G49900 ) | Arabidopsis thaliana |
|
Cross Link  | |
| | Database | Entry ID | E-value | Start | End | InterPro ID | Description | | PANTHER | PTHR11389 | 2.4E-26 | 186 | 820 | No hit | NA | | Pfam | PF13912 | 1.3E-8 | 192 | 215 | No hit | NA | | SUPERFAMILY | SSF57667 | 9.0E-8 | 192 | 267 | No hit | NA | | ProSiteProfiles | PS50157 | 10.0 | 193 | 220 | IPR007087 | Zinc finger, C2H2 | | SMART | SM00355 | 0.0 | 193 | 215 | IPR015880 | Zinc finger, C2H2-like | | ProSitePatterns | PS00028 | NA | 195 | 215 | IPR007087 | Zinc finger, C2H2 | | Pfam | PF13912 | 1.8E-8 | 244 | 268 | No hit | NA | | SMART | SM00355 | 0.7 | 245 | 267 | IPR015880 | Zinc finger, C2H2-like | | ProSitePatterns | PS00028 | NA | 247 | 267 | IPR007087 | Zinc finger, C2H2 | | Coils | Coil | NA | 596 | 617 | No hit | NA | | SUPERFAMILY | SSF57667 | 2.0E-6 | 749 | 820 | No hit | NA | | Pfam | PF13912 | 1.0E-5 | 750 | 773 | No hit | NA | | ProSiteProfiles | PS50157 | 10.3 | 750 | 777 | IPR007087 | Zinc finger, C2H2 | | SMART | SM00355 | 0.1 | 750 | 772 | IPR015880 | Zinc finger, C2H2-like | | ProSitePatterns | PS00028 | NA | 752 | 772 | IPR007087 | Zinc finger, C2H2 | | Pfam | PF13912 | 1.4E-7 | 797 | 821 | No hit | NA | | ProSiteProfiles | PS50157 | 9.9 | 798 | 820 | IPR007087 | Zinc finger, C2H2 | | SMART | SM00355 | 0.3 | 798 | 820 | IPR015880 | Zinc finger, C2H2-like | | ProSitePatterns | PS00028 | NA | 800 | 820 | IPR007087 | Zinc finger, C2H2 |
|
|