|
|
|
|
| Locus name | AT5G03340 |
| Organism | Arabidopsis thaliana | | Taxonomic identifier | [NCBI] | | Function category | Others | | Effect for Senescence | unclear | | Gene Description | cell division cycle protein 48, putative / CDC48, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), Aspartate decarboxylase-like fold (InterPro:IPR009010), Cell division protein 48, CDC48, domain 2 (InterPro:IPR004201), ATPase, AAA-type, VAT, N-terminal (InterPro:IPR003338), ATPase, AAA-type, CDC48 (InterPro:IPR005938); BEST Arabidopsis thaliana protein match is: CDC48 (CELL DIVISION CYCLE 48); ATPase/ identical protein binding (TAIR:AT3G09840.1); Has 44402 Blast hits to 25576 proteins in 1886 species: Archae - 977; Bacteria - 15729; Metazoa - 7172; Fungi - 4080; Plants - 3020; Viruses - 56; Other Eukaryotes - 13368 (source: NCBI BLink). | | Evidence | Genomic evidence:microarray data [Ref 1] | | References | 1: Breeze E, Harrison E, McHattie S, Hughes L, Hickman R, Hill C, Kiddle S, Kim YS, Penfold CA, Jenkins D, Zhang C, Morris K, Jenner C, Jackson S, Thomas B, Tabrett A, Legaie R, Moore JD, Wild DL, Ott S, Rand D, Beynon J, Denby K, Mead A, Buchanan-WollastonHigh-resolution temporal profiling of transcripts during Arabidopsis leaf senescence reveals a distinct chronology of processes and regulation.Plant Cell 2011 Mar;23(3):873-94 | | Gene Ontology | | | Sequence | AT5G03340.1 | Genomic | mRNA | CDS | Protein
|
miRNA Interaction  | |
| | Details | | target: AT5G03340.1 miRNA: ath-miR5658 miRNA: ath-miR5658 mfe: -35.7 kcal/mol p-value: 0.000092
position: 1 target 5' A C 3' UUCAUCAUCAUCAUCAUCAU AAGUAGUAGUAGUAGUAGUA miRNA 3' A 5'
|
|
Ortholog Group  | |
| | Ortholog Groups: OG5_126926 | |
Cross Link  | |
| | Database | Entry ID | E-value | Start | End | InterPro ID | Description | | PANTHER | PTHR23077 | 0.0 | 1 | 790 | No hit | NA | | SUPERFAMILY | SSF50692 | 3.5E-28 | 25 | 109 | IPR009010 | Aspartate decarboxylase-like domain | | Pfam | PF02359 | 2.8E-23 | 29 | 111 | IPR003338 | CDC48, N-terminal subdomain | | SMART | SM01073 | 4.3E-31 | 29 | 112 | IPR003338 | CDC48, N-terminal subdomain | | TIGRFAM | TIGR01243 | 1.2E-264 | 30 | 767 | IPR005938 | ATPase, AAA-type, CDC48 | | SUPERFAMILY | SSF54585 | 9.8E-34 | 111 | 203 | No hit | NA | | SMART | SM01072 | 9.3E-16 | 129 | 195 | IPR004201 | CDC48, domain 2 | | Pfam | PF02933 | 1.7E-11 | 131 | 194 | IPR004201 | CDC48, domain 2 | | SUPERFAMILY | SSF52540 | 3.5E-67 | 203 | 465 | IPR027417 | P-loop containing nucleoside triphosphate hydrolase | | SMART | SM00382 | 2.8E-23 | 240 | 376 | IPR003593 | AAA+ ATPase domain | | Pfam | PF00004 | 1.1E-47 | 244 | 373 | IPR003959 | ATPase, AAA-type, core | | ProSitePatterns | PS00674 | NA | 344 | 362 | IPR003960 | ATPase, AAA-type, conserved site | | SUPERFAMILY | SSF52540 | 2.8E-74 | 475 | 764 | IPR027417 | P-loop containing nucleoside triphosphate hydrolase | | SMART | SM00382 | 1.7E-24 | 513 | 652 | IPR003593 | AAA+ ATPase domain | | Pfam | PF00004 | 5.0E-47 | 517 | 650 | IPR003959 | ATPase, AAA-type, core | | ProSitePatterns | PS00674 | NA | 620 | 638 | IPR003960 | ATPase, AAA-type, conserved site |
|
| | Localization | cytosol | | Evidence | SUBAcon | | Pubmed ID | 23180787 |
|