Basic information
Locus name	AT3G60190
Alias	ADL1E
Organism	Arabidopsis thaliana
Taxonomic identifier	[NCBI]
Function category	Signal transduction
Effect for Senescence	unclear
Gene Description	ARABIDOPSIS DYNAMIN-LIKE 1E (ADL1E); FUNCTIONS IN: GTP binding, GTPase activity; INVOLVED IN: response to cadmium ion, defense response to fungus, vesicle-mediated transport; LOCATED IN: mitochondrion, plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dynamin GTPase effector (InterPro:IPR003130), Dynamin, GTPase region (InterPro:IPR001401), Dynamin central region (InterPro:IPR000375); BEST Arabidopsis thaliana protein match is: ADL1D (ARABIDOPSIS DYNAMIN-RELATED PROTEIN 1D); GTP binding / GTPase (TAIR:AT2G44590.3); Has 2152 Blast hits to 2046 proteins in 248 species: Archae - 2; Bacteria - 35; Metazoa - 943; Fungi - 554; Plants - 324; Viruses - 0; Other Eukaryotes - 294 (source: NCBI BLink).
Evidence	Genomic evidence:microarray data [Ref 1]
References	1: Breeze E, Harrison E, McHattie S, Hughes L, Hickman R, Hill C, Kiddle S, Kim YS, Penfold CA, Jenkins D, Zhang C, Morris K, Jenner C, Jackson S, Thomas B, Tabrett A, Legaie R, Moore JD, Wild DL, Ott S, Rand D, Beynon J, Denby K, Mead A, Buchanan-Wollaston High-resolution temporal profiling of transcripts during Arabidopsis leaf senescence reveals a distinct chronology of processes and regulation. Plant Cell 2011 Mar;23(3):873-94
Gene Ontology	molecular function GTP binding GTPase activity
Sequence	AT3G60190.1 | Genomic | mRNA | CDS | Protein
miRNA Interaction
Details	target: AT3G60190.1  miRNA: ath-miR870 miRNA: ath-miR870 mfe: -27.9 kcal/mol  p-value: 0.007720  position: 1429  target 5' A                    C  3'             AUCGAAGGGGCACUGGGUUA                 UAGCUUCUUUGUGGUUUAAU      miRNA  3' C                       5'
Ortholog Group
Ortholog Groups: OG5_134850	Accession Taxon NP_172936 Arabidopsis thaliana NP_191735 Arabidopsis thaliana NP_567094 ( AT3G60190 ) Arabidopsis thaliana NP_568602 Arabidopsis thaliana NP_850418 Arabidopsis thaliana NP_850419 Arabidopsis thaliana NP_850420 Arabidopsis thaliana NP_851120 Arabidopsis thaliana 195431 Chlamydomonas reinhardtii ACO67584 Micromonas sp. RCC299 NP_001043878 Oryza sativa Japonica Group NP_001051070 Oryza sativa Japonica Group NP_001056278 Oryza sativa Japonica Group NP_001064002 Oryza sativa Japonica Group NP_001065436 Oryza sativa Japonica Group estExt_fgenesh1_pg.C_1620094 Physcomitrella patens subsp. patens estExt_fgenesh1_pg.C_330100 Physcomitrella patens subsp. patens estExt_gwp_gw1.C_1090064 Physcomitrella patens subsp. patens estExt_gwp_gw1.C_3000051 Physcomitrella patens subsp. patens fgenesh1_pg.scaffold_162000008 Physcomitrella patens subsp. patens 27647.m000182 Ricinus communis 29628.m000770 Ricinus communis 29709.m001211 Ricinus communis 29742.m001419 Ricinus communis 30190.m010847 Ricinus communis XP_002952734 Volvox carteri f. nagariensis
Cross Link
Database Entry ID E-value Start End InterPro ID Description PANTHER PTHR11566 3.6E-266 1 622 IPR022812 Dynamin SMART SM00053 2.5E-110 4 257 IPR001401 Dynamin, GTPase domain SUPERFAMILY SSF52540 1.4E-73 32 315 IPR027417 P-loop containing nucleoside triphosphate hydrolase PRINTS PR00195 1.3E-58 40 58 IPR022812 Dynamin Pfam PF00350 3.3E-55 43 219 IPR001401 Dynamin, GTPase domain PRINTS PR00195 1.3E-58 65 82 IPR022812 Dynamin ProSitePatterns PS00410 NA 66 75 IPR019762 Dynamin, GTPase region, conserved site PRINTS PR00195 1.3E-58 138 155 IPR022812 Dynamin PRINTS PR00195 1.3E-58 188 206 IPR022812 Dynamin PRINTS PR00195 1.3E-58 207 223 IPR022812 Dynamin Pfam PF01031 3.5E-70 228 501 IPR000375 Dynamin central domain PRINTS PR00195 1.3E-58 230 249 IPR022812 Dynamin SMART SM00302 1.4E-34 527 620 IPR003130 Dynamin GTPase effector Pfam PF02212 9.1E-20 531 620 IPR003130 Dynamin GTPase effector ProSiteProfiles PS51388 22.5 532 624 IPR020850 GTPase effector domain, GED
Subcellular Localization
Localization	cytosol
Evidence	SUBAcon
Pubmed ID	23180787