Basic mutant information
Mutant name	miR164Box
Mutant/Transgenic	transgenic
Ecotype	Ws
Mutagenesis type	transgene
(Semi-)Dominant/Recessive	dominant
Description	delayed senescence
References	1: Kim JH, Woo HR, Kim J, Lim PO, Lee IC, Choi SH, Hwang D, Nam HG Trifurcate feed-forward regulation of age-dependent cell death involving miR164 in Arabidopsis. Science 2009 Feb 20;323(5917):1053-7
Mutated genes
Locus name	AT5G01747
Alias	miR164B
Organism	Arabidopsis thaliana
Description	Encodes a microRNA that targets several genes containing NAC domains including NAC1. Also targets ORE1 to negatively regulate the timing of leaf senescence. Mature sequence: UGGAGAAGCAGGGCACGUGCA
Phenotype information
Natural senescence Leaf color green