|
|
| Locus name | AT5G01747 |
| Alias | miR164B |
| Organism | Arabidopsis thaliana |
| Taxonomic identifier | [NCBI] |
| Function category | Transcription regulation:MicroRNA |
| Effect for Senescence | delay |
| Gene Description | Encodes a microRNA that targets several genes containing NAC domains including NAC1. Also targets ORE1 to negatively regulate the timing of leaf senescence. Mature sequence: UGGAGAAGCAGGGCACGUGCA |
| Evidence | Genetic evidence:Transgene and mutant [Ref 1] |
| References | 1: Kim JH, Woo HR, Kim J, Lim PO, Lee IC, Choi SH, Hwang D, Nam HGTrifurcate feed-forward regulation of age-dependent cell death involving miR164 in Arabidopsis.Science 2009 Feb 20;323(5917):1053-7 |
| Sequence | AT5G01747.1 | Genomic | mRNA
|
|
| Mutated 1 | | Mutant name |
miR164Box | | Mutant/Transgenic |
transgenic | | Ecotype |
Ws |
| Mutagenesis type |
transgene |
|
| Mutated 2 | | Mutant name |
mir164b-1 | | Mutant/Transgenic |
mutant | | Ecotype |
Col-0 |
| Mutagenesis type |
T-DNA insertion_knock out |
|
| Mutated 3 | | Mutant name |
mir164abc | | Mutant/Transgenic |
mutant | | Ecotype |
Col-0 |
| Mutagenesis type |
cross |
|
