Basic mutant information
Mutant name	mir164a-4
Mutant/Transgenic	mutant
Ecotype	Col-0
Mutagenesis type	T-DNA insertion_knock out
(Semi-)Dominant/Recessive	recessive
Description	slightly early senescence
References	1: Sieber P, Wellmer F, Gheyselinck J, Riechmann JL, Meyerowitz EM Redundancy and specialization among plant microRNAs: role of the MIR164 family in developmental robustness. Development 2007 Mar;134(6):1051-60 2: Kim JH, Woo HR, Kim J, Lim PO, Lee IC, Choi SH, Hwang D, Nam HG Trifurcate feed-forward regulation of age-dependent cell death involving miR164 in Arabidopsis. Science 2009 Feb 20;323(5917):1053-7
Mutated genes
Locus name	AT2G47585
Alias	miR164A
Organism	Arabidopsis thaliana
Description	Encodes a microRNA that targets several genes containing NAC domains including NAC1 and ORE1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets CUC2 and modulates the extent of leaf margin serration. Also targets ORE1 to negatively regulate the timing of leaf senescence. Mature sequence: UGGAGAAGCAGGGCACGUGCA
Phenotype information
Natural senescence Chlorophyll content normal