|
Locus name | AT2G47585 |
Alias | miR164A |
Organism | Arabidopsis thaliana |
Taxonomic identifier | [NCBI] |
Function category | Transcription regulation:MircoRNA |
Effect for Senescence | delay |
Gene Description | Encodes a microRNA that targets several genes containing NAC domains including NAC1 and ORE1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets CUC2 and modulates the extent of leaf margin serration. Also targets ORE1 to negatively regulate the timing of leaf senescence. Mature sequence: UGGAGAAGCAGGGCACGUGCA |
Evidence | Genetic evidence:Transgene and mutant [Ref 1] |
References | 1: Kim JH, Woo HR, Kim J, Lim PO, Lee IC, Choi SH, Hwang D, Nam HGTrifurcate feed-forward regulation of age-dependent cell death involving miR164 in Arabidopsis.Science 2009 Feb 20;323(5917):1053-7 |
Sequence | AT2G47585.1 | Genomic | mRNA
|
|
Mutated 1 | Mutant name |
miR164Aox | Mutant/Transgenic |
transgenic | Ecotype |
Ws |
Mutagenesis type |
transgene |
|
Mutated 2 | Mutant name |
mir164a-4 | Mutant/Transgenic |
mutant | Ecotype |
Col-0 |
Mutagenesis type |
T-DNA insertion_knock out |
|
Mutated 3 | Mutant name |
mir164abc | Mutant/Transgenic |
mutant | Ecotype |
Col-0 |
Mutagenesis type |
cross |
|