Basic mutant information
Mutant name	mir164b-1
Mutant/Transgenic	mutant
Ecotype	Col-0
Mutagenesis type	T-DNA insertion_knock out
(Semi-)Dominant/Recessive	recessive
Description	SALK_136105
References	1: Sieber P, Wellmer F, Gheyselinck J, Riechmann JL, Meyerowitz EM Redundancy and specialization among plant microRNAs: role of the MIR164 family in developmental robustness. Development 2007 Mar;134(6):1051-60 2: Kim JH, Woo HR, Kim J, Lim PO, Lee IC, Choi SH, Hwang D, Nam HG Trifurcate feed-forward regulation of age-dependent cell death involving miR164 in Arabidopsis. Science 2009 Feb 20;323(5917):1053-7
Mutated genes
Locus name	AT5G01747
Alias	miR164B
Organism	Arabidopsis thaliana
Description	Encodes a microRNA that targets several genes containing NAC domains including NAC1. Also targets ORE1 to negatively regulate the timing of leaf senescence. Mature sequence: UGGAGAAGCAGGGCACGUGCA
Phenotype information
Natural senescence Chlorophyll content normal