Basic mutant information
Mutant name	mir164abc
Mutant/Transgenic	mutant
Ecotype	Col-0
Mutagenesis type	cross
(Semi-)Dominant/Recessive	recessive
Description	triple mutant (mir164a-4,mir164b-1 and mir164c-2)
References	1: Sieber P, Wellmer F, Gheyselinck J, Riechmann JL, Meyerowitz EM Redundancy and specialization among plant microRNAs: role of the MIR164 family in developmental robustness. Development 2007 Mar;134(6):1051-60 2: Kim JH, Woo HR, Kim J, Lim PO, Lee IC, Choi SH, Hwang D, Nam HG Trifurcate feed-forward regulation of age-dependent cell death involving miR164 in Arabidopsis. Science 2009 Feb 20;323(5917):1053-7
Mutated genes
Mutated Gene 1 Locus name AT5G01747 Alias miR164B Organism Arabidopsis thaliana Description Encodes a microRNA that targets several genes containing NAC domains including NAC1. Also targets ORE1 to negatively regulate the timing of leaf senescence. Mature sequence: UGGAGAAGCAGGGCACGUGCA
Mutated Gene 2 Locus name AT5G27807 Alias miR164C Organism Arabidopsis thaliana Description Early extra petal mutant (eep1). Encodes a microRNA that targets several genes containing NAC domains including NAC1 and NAC2.Mature sequence: UGGAGAAGCAGGGCACGUGCG.
Mutated Gene 3 Locus name AT2G47585 Alias miR164A Organism Arabidopsis thaliana Description Encodes a microRNA that targets several genes containing NAC domains including NAC1 and ORE1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets CUC2 and modulates the extent of leaf margin serration. Also targets ORE1 to negatively regulate the timing of leaf senescence. Mature sequence: UGGAGAAGCAGGGCACGUGCA
Phenotype information
Natural senescence Chlorophyll content low Leaf color yellow