Online Tools - Resource for Coronavirus 2019

Variation Identification

‘Fastq-to-Variants’ can align raw NGS sequencing data to the reference genome of 2019nCoV, identify 2019nCoV genetic sequences from the sequencing sample(s), analyze the degree of genomic coverage, sequencing depth, sequencing error rates, detect and annotate the SNPs or Indels.

Upload Reference FASTA

Default Reference NC_045512

Upload a reference FASTA

Upload FASTQ Files

Sequencing Type:

Single-end

Paired-end

Upload Single-end Sequencing file

Sample Name:

Sample Name

*This process currently only supports Illumina sequencing data. Processing pipelines for analyzing the third-generation sequencing data (PacBio /Nanopore) will be deployed later. To reduce upload time, ‘gzip’ compressed file is recommended.

Or Input GSA's CRR Accession

CRR Accession

*SARS-CoV-2 data list in GSA: https://ngdc.cncb.ac.cn/gsa/browse/run/?tag=Coronaviridae

Subject

Run

Reminder: Running tasks: , Tasks in queue: ; Refer to the table below for the estimated processing time.

Click Here

1. Reference Running Time

Reference running time is tested using real data set when the server system is idle (not including upload time). Running time of actual tasks depend on the workload state of the server system, data volume, data quality and so on.

	Data1	Data2	Data3	Data4	Data5
Data Volume	118Mb	1.0Gb	1.5Gb	2.2Gb	8.0Gb
Calculating Time*	0m37s	0m55s	1m10s	1m36s	3m42s
Accession	SRR11247077	SRR11092064	SRR11092057	SRR11092058	SRR10971381

*Run on 24 CPU cores

This tool can detect mutation sites in the virus genome sequence. SARS-CoV-2 (NC_045512) and your upload fasta file are supported as reference for the online variation identification. The input file can be the whole genome sequence of virus(es) in the format of FASTA, and support for partial sequence(s) also.
You must upload single FASTA format file contain one virus genomic sequence or multiple sequences.

Upload Reference FASTA

Default Reference NC_045512

Upload a reference FASTA

Upload file

Subject

Run

Reminder: Running tasks: , Tasks in queue: ; Refer to the table below for the estimated processing time.

>BetaCoV/Wuhan/IVDC-HB-01/2019 EPI_ISL_402119 ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGA TCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAG TGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAAC TCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGC ACATCTAGGTTTCGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTG ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGA TCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAG TGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAAC TCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGC ACATCTAGGTTTCGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTG

1). NC - Maximum number of N's contained in the input fasta sequence, the default value is 15, Discard the sequences when number of N's of genome greater than NC number;
2). SC - Maximum number of the degenerate bases contained in the input fasta sequence, the default value is 50, Discard the sequences when number of degenerate bases of genome greater than SC number;