| AT5G29550 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 7.4e-126 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G06125 | transposable_element_gene;(source:Araport11);hypothetical protein;(source:TAIR10) |
| AT2G38260 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT4G30770 | Putative membrane lipoprotein;(source:Araport11) |
| AT5G35240 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative transposable element, blastp match of 47%25 identity and 9.3e-52 P-value to GP|13122426|dbj|BAB32907.1||AP003047 putative transposable element {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT3G29630 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G33420 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT3G32970 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G06497 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.0e-48 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT4G23490 | fringe-like protein (DUF604);(source:Araport11) |
| AT5G01881 | transmembrane protein;(source:Araport11) |
| AT1G20875 | hypothetical protein;(source:Araport11) |
| AT1G43690 | ubiquitin interaction motif-containing protein;(source:Araport11) |
| AT5G21105 | Plant L-ascorbate oxidase;(source:Araport11) |
| AT3G42047 | pseudogene of Ta11-like non-LTR retrotransposon;(source:Araport11) |
| AT5G35057 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 8.7e-292 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G36225 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 6.4e-18 P-value blast match to Q9S9L6 /322-461 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G47430 | DWNN domain, a CCHC-type zinc finger;(source:Araport11) |
| AT5G10820 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G10610 | Ribosomal S17 family protein;(source:Araport11) |
| AT4G39985 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT5G58110 | chaperone binding / ATPase activator;(source:Araport11) |
| AT3G03670 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G03310 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.4e-90 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G42540 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43940.1);(source:TAIR10) |
| AT2G38255 | hypothetical protein (DUF239);(source:Araport11) |
| AT4G28811 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT2G23650 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT3G43528 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G37120.1);(source:TAIR10) |
| AT5G38610 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G40700 | transcriptional regulator ATRX-like protein;(source:Araport11) |
| AT1G37170 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.1e-84 P-value blast match to O22278 /203-375 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT1G63640 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
| AT5G24915 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.1e-38 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G40050 | F-box/FBD-like domains containing protein;(source:Araport11) |
| AT4G30940 | BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11) |
| AT5G52330 | TRAF-like superfamily protein;(source:Araport11) |
| AT5G18590 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G57810 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G24300 | GYF domain-containing protein;(source:Araport11) |
| AT5G49120 | DUF581 family protein, putative (DUF581);(source:Araport11) |
| AT5G48220 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT3G29830 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G43005 | F-box/associated interaction domain protein;(source:Araport11) |
| AT5G32345 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.2e-183 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G20300 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
| AT3G55735 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT2G15160 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.8e-86 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G12330 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.1e-219 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G14200 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G66290 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G30420 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G54430.1);(source:TAIR10) |
| AT5G34431 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G58610 | PHD finger transcription factor;(source:Araport11) |
| AT1G58320 | PLAC8 family protein;(source:Araport11) |
| AT5G35336 | transposable_element_gene;(source:Araport11);pseudogene, similar to SAE1-S9-protein, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
| AT1G20390 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.5e-251 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT2G44730 | Alcohol dehydrogenase transcription factor Myb/SANT-like family protein;(source:Araport11) |
| AT5G32053 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G35602 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.0e-171 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT4G18660 | delay of germination protein;(source:Araport11) |
| AT1G13540 | hypothetical protein (DUF1262);(source:Araport11) |
| AT2G46380 | extra-large G-like protein, putative (DUF3133);(source:Araport11) |
| AT4G04405 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.6e-50 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT4G07820 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT1G20132 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G24290 | MAC/Perforin domain-containing protein;(source:Araport11) |
| AT1G62480 | Vacuolar calcium-binding protein-like protein;(source:Araport11) |
| AT5G58005 | Cytochrome c oxidase, subunit Vib family protein;(source:Araport11) |
| AT2G21520 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G80130 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G32471 | pseudogene of hypothetical protein;(source:Araport11) |
| AT1G04990 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT5G29560 | caleosin-related family protein;(source:Araport11) |
| AT1G20880 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G06540 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.6e-42 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G30320 | hypothetical protein;(source:Araport11) |
| AT3G02290 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G14810 | encodes an aspartate semialdehyde dehydrogenase, which produces the branch point intermediate for lysine and threonine/methionine biosynthesis |
| AT5G59020 | hepatocyte growth factor activator, putative (DUF3527);(source:Araport11) |
| AT3G44420 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G57885 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT3G30834 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-90 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G33100 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 0. P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G21213 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G29220 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30843.1);(source:TAIR10) |
| AT1G71110 | transmembrane protein;(source:Araport11) |
| AT2G12640 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.7e-25 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G57410 | Encodes a microtubule-associated protein. |
| AT2G25520 | Drug/metabolite transporter superfamily protein;(source:Araport11) |
| AT4G39780 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT2G08986 | hypothetical protein;(source:Araport11) |
| AT5G02340 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G09876 | hypothetical protein;(source:Araport11) |
| AT2G37130 | Peroxidase superfamily protein;(source:Araport11) |
| AT2G16420 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.8e-39 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G18360 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G37125 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 8.0e-35 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT5G45210 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT2G28220 | aspartic proteinase CDR1-like protein;(source:Araport11) |
| AT2G42150 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT1G54430 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G13250.1);(source:TAIR10) |
| AT1G33860 | hypothetical protein;(source:Araport11) |
| AT3G43740 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT4G32020 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT4G16155 | dihydrolipoamide dehydrogenase;(source:Araport11) |
| AT1G36730 | Translation initiation factor IF2/IF5;(source:Araport11) |
| AT2G07780 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.5e-32 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT3G62725 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-41 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G49870 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT5G54865 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT2G12500 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 6.8e-208 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G17020 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT5G61190 | putative endonuclease or glycosyl hydrolase with C2H2-type zinc finger domain-containing protein;(source:Araport11) |
| AT5G11430 | SPOC domain / Transcription elongation factor S-II protein;(source:Araport11) |
| AT5G08139 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G04316 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 9.6e-40 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G33180 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G20380 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G17165 | hypothetical protein;(source:Araport11) |
| AT5G28765 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-70 P-value blast match to O22278 /203-375 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G35331 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 7.8e-44 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G28497 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT1G43980 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G01020 | 5.8SrRNA |
| AT3G24780 | Uncharacterized conserved protein UCP015417, vWA;(source:Araport11) |
| AT2G12945 | hypothetical protein;(source:Araport11) |
| AT1G32460 | hypothetical protein;(source:Araport11) |
| AT4G39360 | hypothetical protein;(source:Araport11) |
| AT2G14180 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-307 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G45650 | subtilase family protein;(source:Araport11) |
| AT2G44660 | ALG6, ALG8 glycosyltransferase family;(source:Araport11) |
| AT2G07770 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G15600.1);(source:TAIR10) |
| AT2G34350 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
| AT1G33450 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G04780.2);(source:TAIR10) |
| AT3G32899 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 7.0e-240 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT3G07425 | transmembrane protein;(source:Araport11) |
| AT2G10910 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-24 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT5G19095 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT1G63630 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G40470 | RNI-like superfamily protein;(source:Araport11) |
| AT1G70185 | other_RNA;(source:Araport11) |
| AT5G47060 | hypothetical protein (DUF581);(source:Araport11) |
| AT1G64140 | WRKY transcription factor;(source:Araport11) |
| AT4G28200 | U3 small nucleolar RNA-associated-like protein;(source:Araport11) |
| AT3G43175 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.4e-49 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G58430 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT4G17670 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT4G04190 | transmembrane protein;(source:Araport11) |
| AT1G80745 | Transcription factor TFIIIC, tau55-related protein;(source:Araport11) |
| AT5G62960 | UDP-N-acetylglucosamine-N-acetylmuramyl-pyrophosphoryl-undecaprenol N-acetylglucosamine protein;(source:Araport11) |
| AT2G33280 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G49138 | Natural antisense transcript overlaps with AT5G49130;(source:Araport11) |
| AT5G24155 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT4G34310 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G06140 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32605.1);(source:TAIR10) |
| AT3G30710 | transposable_element_gene;(source:Araport11);similar to myosin heavy chain-related [Arabidopsis thaliana] (TAIR:AT4G08113.1);(source:TAIR10) |
| AT5G01390 | DNAJ heat shock family protein;(source:Araport11) |
| AT5G65470 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G30818 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.4e-94 P-value blast match to reverse transcriptase (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G30830 | myosin-like protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT2G14630 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G28785.1);(source:TAIR10) |
| AT1G43940 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42540.1);(source:TAIR10) |
| AT5G33050 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 6.2e-129 P-value blast match to gb|AAL06421.1|AF378079_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10) |
| AT5G14790 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G05591 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to Athila retroelement ORF2, putative;(source:TAIR10) |
| AT3G33069 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.6e-294 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G04041 | ECA1 gametogenesis family protein (DUF784);(source:Araport11) |
| AT3G15602 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 9.9e-40 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT4G35320 | hypothetical protein;(source:Araport11) |
| AT2G13542 | Encodes a defensin-like (DEFL) family protein. |
| AT4G39955 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G64560 | pseudogene of S-adenosylmethionine-dependent methyltransferase/rRNA (adenine-N6,N6-)-dimethyltransferase/rRNA methyltransferase |
| AT3G27350 | transcriptional regulator ATRX-like protein;(source:Araport11) |
| AT2G06600 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.2e-73 P-value blast match to Q9SL18 /349-510 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT2G10250 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.0e-157 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G44050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G44330 | M28 Zn-peptidase nicastrin;(source:Araport11) |
| AT3G06770 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G61826 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G07920 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G45905 | Encodes a defensin-like (DEFL) family protein. |
| AT5G41675 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT1G37669 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.0e-258 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G45230 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.9e-46 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT5G26590 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-11 P-value blast match to GB:AAC24836 pol polyprotein (Ty1_Copia-element) (Candida albicans);(source:TAIR10) |
| AT5G31980 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.3e-304 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G31367 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.1e-71 P-value blast match to GB:226407 retrotransposon del1-46 (Gypsy_Ty3-element) (Lilium henryi);(source:TAIR10) |
| AT3G41345 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.6e-18 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G46580 | Pyridoxamine 5-phosphate oxidase family protein;(source:Araport11) |
| AT4G21437 | unknown pseudogene |
| AT2G47370 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT1G43760 | DNAse I-like superfamily protein;(source:Araport11) |
| AT3G44010 | Ribosomal protein S14p/S29e family protein;(source:Araport11) |
| AT2G45590 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G34230 | transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBb0041J06.18, blastp match of 33%25 identity and 2.8e-10 P-value to GP|27818010|dbj|BAC55773.1||AP005176 OSJNBb0041J06.18 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT5G23955 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.6e-41 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G33205 | pseudogene of hypothetical protein (Protein of unknown function;(source:Araport11) |
| AT5G18130 | transmembrane protein;(source:Araport11) |
| AT2G07635 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.6e-89 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10) |
| AT3G12710 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G38185 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-21 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G61640 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G24256 | hypothetical protein;(source:Araport11) |
| AT5G15000 | Encodes a ECA1 gametogenesis related family protein |
| AT5G28410 | hypothetical protein;(source:Araport11) |
| AT2G15500 | RNA-binding protein;(source:Araport11) |
| AT5G16250 | transmembrane protein;(source:Araport11) |
| AT2G41231 | transmembrane protein;(source:Araport11) |
| AT5G07590 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G12990 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT4G07524 | Ras-related small GTP-binding family protein;(source:Araport11) |
| AT1G05135 | Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167. |
| AT5G61997 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G21940 | hybrid signal transduction histidine kinase M-like protein;(source:Araport11) |
| AT3G27210 | hypothetical protein;(source:Araport11) |
| AT3G25700 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G08032 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative transposable element, similar to transposase, putative;(source:TAIR10) |
| AT1G05650 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G22426 | hypothetical protein;(source:Araport11) |
| AT5G24610 | cyclic AMP-responsive element-binding protein;(source:Araport11) |
| AT3G60760 | hypothetical protein;(source:Araport11) |
| AT1G05835 | PhD finger protein. |
| AT5G02580 | argininosuccinate lyase;(source:Araport11) |
| AT4G09875 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
| AT1G79470 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT4G08110 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 4.2e-66 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G07932 | hypothetical protein;(source:Araport11) |
| AT1G04480 | Ribosomal protein L14p/L23e family protein;(source:Araport11) |
| AT3G32975 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-133 P-value blast match to gb|AAL06422.1|AF378081_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10) |
| AT1G33010 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G32920 | glycine-rich protein;(source:Araport11) |
| AT4G06700 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.7e-54 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
| AT3G43153 | cAMP-dependent protein kinase inhibitor-like protein;(source:Araport11) |
| AT5G32410 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G07710.1);(source:TAIR10) |
| AT3G56060 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT5G32404 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to Athila retroelement ORF2, putative;(source:TAIR10) |
| AT2G06590 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.2e-69 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G33440 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G04780 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G08050 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 0. P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G43270 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G33360 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT1G17390.1);(source:TAIR10) |
| AT2G36360 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G22482 | other_RNA;(source:Araport11) |
| AT5G56240 | hapless protein;(source:Araport11) |
| AT5G31804 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-259 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G08056 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30843.1);(source:TAIR10) |
| AT2G16980 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G33870 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G22910 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G21020 | transmembrane protein;(source:Araport11) |
| AT3G15220 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G12190 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G41761 | other_RNA;(source:Araport11) |
| AT5G34358 | transposable_element_gene;(source:Araport11) |
| AT3G43355 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, temporary automated functional assignment;(source:TAIR10) |
| AT5G33300 | chromosome-associated kinesin-like protein;(source:Araport11) |
| AT4G17560 | Ribosomal protein L19 family protein;(source:Araport11) |
| AT3G46540 | ENTH/VHS family protein;(source:Araport11) |
| AT5G35416 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-16 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G10880 | Putative role in response to salt stress. Mutants grow larger than the wild type under salt stress condition (Ann Stapleton and Ashley Green, 2009, personal communication). |
| AT3G33080 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30650.1);(source:TAIR10) |
| AT1G77160 | hypothetical protein (DUF506);(source:Araport11) |
| AT4G34975 | pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10) |
| AT5G22520 | hypothetical protein;(source:Araport11) |
| AT1G48080 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT4G35400 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G48250.1);(source:TAIR10) |
| AT2G10660 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 4.3e-277 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G06477 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.1e-112 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT3G15870 | Fatty acid desaturase family protein;(source:Araport11) |
| AT2G06830 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT4G20180 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.2e-10 P-value blast match to GB:AAC24836 pol polyprotein (Ty1_Copia-element) (Candida albicans);(source:TAIR10) |
| AT4G29310 | DUF1005 family protein (DUF1005);(source:Araport11) |
| AT4G10010 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G20430 | Mob1/phocein family protein;(source:Araport11) |
| AT3G55420 | hypothetical protein;(source:Araport11) |
| AT3G30724 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative GB:AAC67331 GI:3785984 non-LTR retroelement reverse transcriptase from (Arabidopsis thaliana);(source:TAIR10) |
| AT1G38360 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 9.0e-98 P-value blast match to gb|AAL06419.1|AF378075_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10) |
| AT4G07515 | ECA1 gametogenesis family protein (DUF784);(source:Araport11) |
| AT4G08450 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G49500 | Signal recognition particle, SRP54 subunit protein;(source:Araport11) |
| AT4G35880 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G04510 | pseudogene of ribonuclease H;(source:Araport11) |
| AT4G03860 | transposable_element_gene;(source:Araport11);transposon protein -related, similar to athila retroelement;(source:TAIR10) |
| AT3G15200 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G03640 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G43100.1);(source:TAIR10) |
| AT5G29890 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.2e-21 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
| AT3G43260 | deoxyhypusine protein;(source:Araport11) |
| AT1G06002 | Natural antisense transcript overlaps with AT1G06000;(source:Araport11) |
| AT2G03250 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT3G44245 | pseudogene of cytochrome P450;(source:Araport11) |
| AT5G49746 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-20 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT3G10415 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT2G46550 | transmembrane protein;(source:Araport11) |
| AT3G43863 | transposable_element_gene;(source:Araport11) |
| AT5G19760 | Encodes a novel mitochondrial carrier capable of transporting both dicarboxylates (such as malate, oxaloacetate, oxoglutarate, and maleate) and tricarboxylates (such as citrate, isocitrate, cis-aconitate, and trans-aconitate). |
| AT5G57000 | DEAD-box ATP-dependent RNA helicase;(source:Araport11) |
| AT5G60130 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT3G50340 | hypothetical protein;(source:Araport11) |
| AT4G32030 | hypothetical protein;(source:Araport11) |
| AT2G02690 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G44380 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT2G39950 | flocculation protein;(source:Araport11) |
| AT4G08760 | hypothetical protein;(source:Araport11) |
| AT1G09390 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G13548 | Pseudogene of AT3G12600; ATNUDT16 (Arabidopsis thaliana Nudix hydrolase homolog 16); hydrolase |
| AT1G02020 | nitroreductase family protein;(source:Araport11) |
| AT5G17350 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT5G28660 | NHL domain-containing protein;(source:Araport11) |
| AT1G52615 | other_RNA;(source:Araport11) |
| AT5G20880 | transposable_element_gene;(source:Araport11);retrotransposon family;(source:TAIR10) |
| AT1G35614 | hypothetical protein;(source:Araport11) |
| AT2G01990 | XRI1-like protein;(source:Araport11) |
| AT3G44005 | pseudogene of Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT3G43070 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G35750 | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein;(source:Araport11) |
| AT4G37950 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
| AT2G06680 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 7.2e-67 P-value blast match to Q9SL18 /349-510 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G43405 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43940.1);(source:TAIR10) |
| AT5G62890 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT1G64500 | A member of a protein family found in plants and animals that contain conserved C-terminal glutaredoxin-like and putative zinc-binding cysteine-rich domains. It is involved in light stimulated actin bundling and chloroplast movement. The mRNA is cell-to-cell mobile. |
| AT5G40860 | transmembrane protein;(source:Araport11) |
| AT3G15585 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT2G06560 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.8e-38 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G37570 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT5G60840 | hypothetical protein;(source:Araport11) |
| AT5G64780 | holocarboxylase synthetase;(source:Araport11) |
| AT3G33084 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.6e-186 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT2G06390 | transposable_element_gene;(source:Araport11) |
| AT5G66770 | GRAS family transcription factor;(source:Araport11) |
| AT1G75810 | transmembrane protein;(source:Araport11) |
| AT5G29762 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G42316 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.9e-38 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
| AT4G29090 | Ribonuclease H-like superfamily protein;(source:Araport11) |
| AT5G34412 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 8.7e-05 P-value blast match to GB:BAA84457 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902444|dbj|BAA84457.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
| AT3G33572 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G07523.1);(source:TAIR10) |
| AT3G32035 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-16 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G15800 | hypothetical protein;(source:Araport11) |
| AT1G20070 | hypothetical protein;(source:Araport11) |
| AT1G76460 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G43340 | hypothetical protein (DUF1685);(source:Araport11) |
| AT1G42120 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT3G13760 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G43020 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G69000 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT5G38300 | homeobox Hox-B3-like protein;(source:Araport11) |
| AT1G20890 | caveolin-1 protein;(source:Araport11) |
| AT3G04850 | Tesmin/TSO1-like CXC domain-containing protein;(source:Araport11) |
| AT3G33106 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 0. P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G30582 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.9e-156 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G42230 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G42240 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43940.1);(source:TAIR10) |
| AT2G23020 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT4G06474 | transposable_element_gene;(source:Araport11);retroelement pol polyprotein;(source:TAIR10) |
| AT5G28667 | pseudogene of nuclease;(source:Araport11) |
| AT5G20970 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT1G28400 | GATA zinc finger protein;(source:Araport11) |
| AT4G12760 | RPA-interacting protein A;(source:Araport11) |
| AT1G43775 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-147 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT1G42200 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.3e-27 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G41250 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G21400 | Thiamin diphosphate-binding fold (THDP-binding) superfamily protein;(source:Araport11) |
| AT4G08078 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 4.6e-276 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G33103 | pseudogene of cytochrome c oxidase assembly protein CtaG / Cox11 family;(source:Araport11) |
| AT1G22560 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.4e-20 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G31080 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.3e-49 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G42050 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G14410 | Nucleotide/sugar transporter family protein |
| AT1G55535 | transmembrane protein;(source:Araport11) |
| AT1G74330 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G26775 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.9e-28 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT1G77040 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
| AT5G55180 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT2G07791 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G35420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G02910 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT5G36905 | transposable_element_gene;(source:Araport11);similar to reverse transcriptase-related [Arabidopsis thaliana] (TAIR:AT4G12275.1);(source:TAIR10) |
| AT2G01840 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.6e-34 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G33055 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-282 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G23540 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G33076 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.2e-187 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT5G35601 | pseudogene of aconitase 3;(source:Araport11) |
| AT2G13180 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.1e-23 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT5G14690 | transmembrane protein;(source:Araport11) |
| AT2G10330 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.7e-176 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT5G10340 | F-box family protein;(source:Araport11) |
| AT3G52710 | hypothetical protein;(source:Araport11) |
| AT1G11265 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.4e-253 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT2G11405 | transmembrane protein;(source:Araport11) |
| AT1G67328 | Natural antisense transcript overlaps with AT1G67330;(source:Araport11) |
| AT5G06278 | pseudogene of abscisic acid-responsive HVA22 family protein |
| AT2G33360 | cadherin EGF LAG seven-pass G-type receptor, putative (DUF3527);(source:Araport11) |
| AT3G33058 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-112 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G01023 | hypothetical protein;(source:Araport11) |
| AT4G01330 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G11166 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G29791 | hypothetical protein;(source:Araport11) |
| AT3G11590 | golgin family A protein;(source:Araport11) |
| AT5G33393 | hypothetical protein;(source:Araport11) |
| AT4G06636 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-74 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G21070 | Fe(3+) dicitrate transport system permease;(source:Araport11) |
| AT3G30715 | transposable_element_gene;(source:Araport11);expressed protein;(source:TAIR10) |
| AT1G30440 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT4G07380 | hypothetical protein;(source:Araport11) |
| AT4G10860 | hypothetical protein;(source:Araport11) |
| AT1G79030 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G15757 | Encodes a defensin-like (DEFL) family protein. |
| AT4G25070 | caldesmon-like protein;(source:Araport11) |
| AT3G32940 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT2G42100 | Actin-like ATPase superfamily protein;(source:Araport11) |
| AT5G06590 | hypothetical protein;(source:Araport11) |
| AT5G14230 | ankyrin;(source:Araport11) |
| AT1G07025 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT3G31420 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.2e-45 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G60150 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 28%25 identity and 3.6e-07 P-value to GP|21952510|gb|AAM82604.1|AF525305_2|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10) |
| AT2G11610 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.6e-24 P-value blast match to O22278 /203-375 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G67455 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT2G04580 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10) |
| AT3G44093 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.4e-162 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10) |
| AT3G42712 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.6e-81 P-value blast match to Q9ZQM3 /24-192 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G66290 | hypothetical protein;(source:Araport11) |
| AT1G13940 | T-box transcription factor, putative (DUF863);(source:Araport11) |
| AT3G42590 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G12110.1);(source:TAIR10) |
| AT5G57610 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
| AT2G27980 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
| AT1G36360 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.4e-39 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G42794 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.2e-05 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT4G14135 | Pseudogene of AT3G29785 |
| AT2G10590 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.4e-257 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G43740 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila);(source:TAIR10) |
| AT4G31441 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT2G13720 | putative DNA topoisomerase;(source:Araport11) |
| AT3G41979 | 5.8SrRNA |
| AT2G07160 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.2e-44 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G44040 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT5G29015 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.3e-121 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
| AT1G72175 | E3 ubiquitin-protein ligase RNF170-like protein (DUF 1232);(source:Araport11) |
| AT2G46670 | CCT motif family protein;(source:Araport11) |
| AT2G04795 | hypothetical protein;(source:Araport11) |
| AT3G19550 | glutamate racemase;(source:Araport11) |
| AT1G70620 | cyclin-like protein;(source:Araport11) |
| AT3G42716 | transposable_element_gene;(source:Araport11);Athila retroelement ORF2 -related, temporary automated functional assignment;(source:TAIR10) |
| AT1G50770 | Aminotransferase-like, plant mobile domain family protein;(source:Araport11) |
| AT1G07870 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G02228 | pseudogene of no apical meristem (NAM) family protein |
| AT3G42190 | transposable_element_gene;(source:Araport11);similar to cysteine-type peptidase [Arabidopsis thaliana] (TAIR:AT3G42820.1);(source:TAIR10) |
| AT5G24810 | ABC1 family protein;(source:Araport11) |
| AT4G25570 | Encodes cytochrome b561. |
| AT4G01510 | Arv1-like protein;(source:Araport11) |
| AT4G20800 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G20840 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
| AT5G03760 | encodes a beta-mannan synthase that is required for agrobacterium-mediated plant genetic transformation involves a complex interaction between the bacterium and the host plant. 3' UTR is involved in transcriptional regulation and the gene is expressed in the elongation zone of the root. |
| AT1G52150 | Member of the class III HD-ZIP protein family. Contains homeodomain and leucine zipper domain. Critical for vascular development and negatively regulates vascular cell differentiation. |
| AT2G15570 | chloroplast protein similar to prokaryotic thioredoxin. |
| AT3G46430 | Mitochondrial F1F0-ATP synthase. |
| AT5G21280 | Seed plant lineage specific gene that is expressed in response to oxidative and abiotic stresses. |
| AT2G23310 | Encodes AtRER1C1, a Golgi membrane protein involved in returning the molecules that are exported from the endoplasmic reticulum (ER) to the Golgi apparatus back to the ER (a mechanism known as retrieval). There are two Arabidopsis homologues of AtRERC1: AtRER1A and AtRER1B. |
| AT3G08760 | Encodes an osmotic stress-inducible kinase that functions as a negative regulator of osmotic stress signaling in plants. |
| AT5G37370 | encodes a putative splicing factor. Over-expression in yeast and Arabidopsis result in increased tolerance to high salt. |
| AT5G28540 | Encodes the luminal binding protein BiP, an ER-localized member of the HSP70 family. BiP is composed of an N-terminal ATP binding domain and a C-terminal domain that binds to hydrophobic patches on improperly/incompletely folded proteins in an ATP-dependent manner. Involved in polar nuclei fusion during proliferation of endosperm nuclei. |
| AT2G42380 | Encodes a member of the BZIP family of transcription factors. Forms heterodimers with the related protein AtbZIP61. Binds to G-boxes in vitro and is localized to the nucleus in onion epidermal cells. |
| AT3G58120 | Encodes a member of the BZIP family of transcription factors. Forms heterodimers with the related protein AtbZIP34. Binds to G-boxes in vitro and is localized to the nucleus in onion epidermal cells. |
| AT3G49230 | transmembrane protein;(source:Araport11) |
| AT1G12230 | Aldolase superfamily protein;(source:Araport11) |
| AT1G76890 | encodes a plant trihelix DNA-binding protein |
| AT4G36710 | GRAS family transcription factor;(source:Araport11) |
| AT5G47370 | homeobox-leucine zipper genes induced by auxin, but not by other phytohormones. Plays opposite roles in the shoot and root tissues in regulating auxin-mediated morphogenesis. |
| AT4G02800 | GRIP/coiled-coil protein;(source:Araport11) |
| AT3G61690 | Putative TNAase |
| AT3G44370 | Member of the Oxa1 super family protein insertases.It is structurally distinct having a tetratricopeptide repeat (TPR) domain at the C terminus. Paralog of OXA2a. Involved in biogenesis of mitochondrial respiratory chain complex IV, specifically via membrane insertion of COX2. |
| AT5G18610 | Encodes a receptor-like cytoplasmic kinase that is an immediate downstream component of the chitin receptor CERK1 and contributes to the regulation of chitin-induced immunity. |
| AT1G60890 | Phosphatidylinositol-4-phosphate 5-kinase family protein;(source:Araport11) |
| AT2G06925 | Encodes a secretory phospholipase A2 enzyme, which specifically hydrolyzes the sn-2 position of phospholipids. The enzyme has a preference towards linoleoyl acyl chain over palmitoyl acyl chain. It also has a slight preference for phosphatidylcholine over phosphatidylethanolamine. |
| AT5G01830 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT3G05230 | Signal peptidase subunit;(source:Araport11) |
| AT4G19700 | Encodes BOI (Botrytis Susceptible 1 Interactor). Has E3 ubiquitin ligase activity. Interacts with and ubiquitinates BOS1 (Botrytis Susceptible 1). It prevents caspase activation and attenuates cell death. |
| AT3G61620 | exonuclease RRP41 (RRP41) |
| AT1G78880 | Plasma membrane-localized proteins that negatively regulate cellulose synthesis by inhibiting the exocytosis of CESAs. |
| AT5G66690 | UGT72E2 is an UDPG:coniferyl alcohol glucosyltransferase which glucosylates sinapyl- and coniferyl aldehydes as well as sinapyl- and coniferyl alcohol. The enzyme is thought to be involved in lignin metabolism. A knockdown mutant line (72E2KD) was obtained using RNAi silencing. A twofold reduction in coniferyl alcohol 4-O-glucoside and sinapyl alcohol 4-O-glucoside was detected in this line compared to wildtype. In comparison, both knockout and knockdown lines of UGT72E1 and UGT72E3, respectively, failed to display the same reduction in phenylpropanoid 4-O-glucosides. The mRNA is cell-to-cell mobile. |
| AT4G24060 | Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis. |
| AT3G58730 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
| AT3G14370 | The WAG2 and its homolog, WAG1 each encodes protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT5G28080 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. |
| AT4G01720 | member of WRKY Transcription Factor; Group II-b |
| AT4G28710 | member of Myosin-like proteins The mRNA is cell-to-cell mobile. |
| AT1G09780 | Encodes a 2,3-biphosphoglycerate-independent phosphoglycerate mutase that is involved in pollen development and stomatal movement. |
| AT2G20580 | encoding the RPN subunits of the 26S proteasome The mRNA is cell-to-cell mobile. |
| AT1G51680 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. In addition to 4-coumarate, it also converts ferulate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, ferulic acid, caffeic acid and 5-OH-ferulic acid. At4CL1 was unable to use sinapic acid as substrate. |
| AT5G60600 | Encodes a chloroplast-localized hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate (HMBPP) synthase (HDS), catalyzes the formation of HMBPP from 2-C-methyl-D-erythrytol 2,4-cyclodiphosphate (MEcPP). The HDS enzyme controls the penultimate steps of the biosynthesis of IPP and dimethylallyl diphosphate (DMAPP) via the MEP pathway and may serve as a metabolic control point for SA-mediated disease resistance. In the light, the electrons required for the reaction catalyzed by HDS are directly provided by the electron flow from photosynthesis via ferredoxin. In the dark however, the enzyme requires an electron shuttle: ferredoxin-NADP+ reductase. The mRNA is cell-to-cell mobile. |
| AT1G12490 | F-box associated ubiquitination effector family protein;(source:Araport11). Expressed in guard cells and induced by ABA. Mutants are insensitive to ABA and osmotic stressors. |
| AT2G45190 | Encodes a member of the YABBY family of transcriptional regulators that is involved in abaxial cell type specification in leaves and fruits. YAB1 acts in a non-cell autonomous fashion within the meristem to affect phyllotactic patterning. The non-autonomous effect on the central region of the meristem is mediated through the activity if Lateral Suppressor (LAS). |
| AT5G19530 | Encodes a spermine synthase. Required for internode elongation and vascular development, specifically in the mechanism that defines the boundaries between veins and nonvein regions. This mechanism may be mediated by polar auxin transport. Though ACL5 has been shown to function as a spermine synthase in E. coli, an ACL5 knockout has no effect on the endogenous levels of free and conjugated polyamines in Arabidopsis, suggesting that ACL5 may have a very specific or altogether different in vivo function. |
| AT2G39570 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. |
| AT1G18450 | Encodes a gene similar to actin-related proteins in other organisms. Member of nuclear ARP family of genes. Component of chromatin remodeling complexes, involved in chromatin-mediated gene regulation. Phenotype of the arp4-1 mutant allele revealed partial sterility due to defects in anther development. Targeting the distinct, 3' UTR of AtARP4 transcripts with RNA interference caused a drastic reduction in the level of AtARP4 protein expression, and resulted in strong pleiotropic phenotypes such as altered organization of plant organs, early flowering, delayed flower senescence and high levels of sterility. Western blot analysis and immunolabelling demonstrated a clear correlation between reductions in the level of AtARP4 expression and severity of the phenotypes. |
| AT4G29140 | Encodes Activated Disease Susceptibility 1 (ADS1), a putative MATE (multidrug and toxic compound extrusion) transport protein that negatively regulates plant disease resistance. |
| AT4G25050 | encodes an acyl carrier protein predominantly expressed in leaves. Gene expression is upregulated by light. |
| AT1G27450 | Adenosine phosphoribosyl transferase(E.C:2.4.2.7), involved in the one-step salvage of adenine to AMP. |
| AT5G66360 | Encodes a mitochondrial rRNA dimethylase. |
| AT1G22130 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL104 is expressed in pollen.It forms heterodimers with other MICK family members (AGL65 and AGL30). Involved in late stages of pollen development and pollen tube growth. |
| AT4G37940 | encodes a MADS box protein, highly expressed in the root. |
| AT5G62165 | Encodes a MADS box transcription factor. Expressed in quiescent center. Involved in floral transition. |
| AT2G45650 | Sequence suggests this encodes a MADS-box transcription factor. Negatively regulates the FLC/MAF clade genes and positively regulates FT in Arabidopsis. |
| AT2G36350 | Member of AGC VIIIa Kinase gene family. |
| AT4G20070 | The gene encoding Arabidopsis thaliana Allantoate Amidohydrolase (AtAAH)which catalyzes the allantoate deiminase reaction (EC 3.5.3.9)is expressed in all parts of the plant being consistent with a function in purine turnover in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT1G79430 | Encodes gene product that is required for several aspects of phloem development in the root: (1) the specific divisions organizing the phloem pole, (2) sieve element differentiation and (3) the expression of a companion-specific gene. Mutant has a defect in the organization of phloem poles in the root. apl seedlings have a short, determinate root with only occasional lateral branches. |
| AT1G78770 | anaphase promoting complex 6;(source:Araport11) |
| AT3G63270 | A mutation in ANTAGONIST OF LHP1 1 (ALP1) suppresses the phenotype of lhp1 mutant plants. ALP1 interacts genetically with several PcG and trxG components and antagonizes PcG silencing. The interaction has a negative effect on polycomb-mediated gene repression since double mutant combinations of clf alp1 or lhp1 alp1 show supression of the clf and lhp1 single mutant phenotypes. ALP1 domestication probably occured at the root of angiosperm diversification coincident with mutation of conserved residues important for endonuclease activity. |
| AT5G15070 | Encodes a functional VIP1/PPIP5K-type ATP-grasp kinase that is involved in both InsP6 to InsP7 conversion and InsP7 to InsP8 conversion. It is the minor isoform in plants and is expressed in pollen. |
| AT5G05910 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G21150 | AGO9-dependent sRNA silencing is crucial to specify cell fate in the Arabidopsis ovule. AGO9 is expressed in reproductive companion cells but not in the associated male or female gametes or their precursors. Therefore, AGO9 acts non-cell autonomously to silencing the activity of TEs activity in the female gametophyte.Loss of function mutants produce ectopic megaspore mother cell and supernumary female gametophytes. |
| AT2G31780 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G01950 | Encodes a member of the armadillo/beta-catenin repeat kinesin motor family. Mutants have twisted roots due to abnormal cell file rotation; the phenotype is dependent on microtubules. |
| AT1G07890 | Encodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. The mRNA is cell-to-cell mobile. |
| AT2G42440 | Lateral organ boundaries (LOB) domain family protein;(source:Araport11) |
| AT1G67370 | Meiotic asynaptic mutant 1 (ASY1). ASY1 protein is initially distributed as numerous foci throughout the chromatin. During early G2, the foci are juxtaposed to the nascent chromosome axes to form a continuous axis associated signal. |
| AT2G17410 | AT Rich domain protein. |
| AT3G60870 | Encodes an AT hook domain containing protein that, when overexpressed, delays flowering. Los s of function mutations have defects in primary and lateral root development. |
| AT4G22770 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT4G17800 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
| AT4G25320 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT3G04570 | AT-hook motif nuclear-localized protein 19;(source:Araport11) |
| AT2G45430 | Encodes a nuclear localized AT hook domain containing protein that can bind AT rich DNA in vitro. Overexpression of the gene results in delayed flowering. Is likely to act redundantly with AHL18, AHL27 and AHL29 in the regulation of flowering. It is also involved in both photo- and skotomorphogenesis. |
| AT1G20900 | Encodes an AT hook domain containing protein that acts redundantly with SOB3 to modulate hypocotyl growth inhibition in response to light. |
| AT3G62150 | Encodes a facultative transporter controlling auxin concentrations in plant cells. |
| AT4G28630 | Half-molecule ABC transporter ATM1. Arabidopsis thaliana has three ATM genes, namely ATM1, ATM2 and ATM3. Only ATM3 has an important function for plant growth. |
| AT3G16340 | Encodes a p-coumaryl alcohol exporter involved in lignin biosynthesis. |
| AT4G15215 | pleiotropic drug resistance 13;(source:Araport11) |
| AT2G13610 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G18770 | Autophagy protein. |
| AT1G19220 | Encodes an auxin response factor that contains the conserved VP1-B3 DNA-binding domain at its N-terminus and the Aux/IAA-like domains III and IV present in most ARFs at its C-terminus. The protein interacts with IAA1 (yeast two hybrid) and other auxin response elements such as ER7 and ER9 (yeast one hybrid). ARF19 protein can complement many aspects of the arf7 mutant phenotype and , together with ARF7, is involved in the response to ethylene. In the arf7 arf19 double mutant, several auxin-responsive genes (e.g. IAA5, LBD16, LBD29 and LBD33) are no longer upregulated by auxin. |
| AT1G73870 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT4G27310 | Encodes an atypical B-box domain protein that negatively regulates photomorphogenic development by interfering with the binding of the transcription factor HY5 to target gene promoters. Degradation of BBX28 in darkness is dependent on COP1 and occurs via the 26S proteasome pathway. BBX28 acts as a key factor in the COP1-HY5 regulatory hub by maintaining proper HY5 activity to ensure normal photomorphogenic development in plants. Interacts with CO via B-box domain resulting in decreased FT expression and delayed flowering. |
| AT4G15250 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT1G06170 | Encodes a bHLH transcription factor that together with bHLH010 and bHLH091 is important for the normal transcriptome of the developing Arabidopsis anther, possibly by forming a feed-forward loop with DYT1. Recognizes the TCATGTGC box to activate the expression of target genes, including ATA20, EXL4, and MEE48. |
| AT2G31210 | Encodes a bHLH transcription factor that together with bHLH089 and bHLH010 is important for the normal transcriptome of the developing Arabidopsis anther, possibly by forming a feed-forward loop with DYT1. |
| AT4G38900 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT3G09000 | Encodes a microtubule-associated protein. Plays a minor role in cortical microtubule organization during leaf development. |
| AT1G58230 | binding protein;(source:Araport11) |
| AT5G08130 | Encodes a basic helix-loop-helix (bHLH) family protein BIM1 (BES1-INTERACTING MYC-LIKE 1), involved in brassinosteroid signaling. It synergistically interacts with BES1 to bind to E box sequences (CANNTG). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT3G13750 | beta-galactosidase, glycosyl hydrolase family 35 The mRNA is cell-to-cell mobile. |
| AT3G23920 | Encodes a chloroplast beta-amylase. Is necessary for leaf starch breakdown in the absence of BAM3.Activity of BAM1 increases 4 days after osmotic stress. BAM1 has a higher temperature optimum than BAM3 (PMID:25293962). |
| AT5G63810 | member of Glycoside Hydrolase Family 35 |
| AT4G26140 | putative beta-galactosidase |
| AT5G49360 | Encodes a bifunctional {beta}-D-xylosidase/{alpha}-L-arabinofuranosidase required for pectic arabinan modification. Located in the extracellular matrix. Gene is expressed specifically in tissues undergoing secondary wall thickening. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
| AT1G02640 | encodes a protein similar to a beta-xylosidase located in the extracellular matrix. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
| AT4G30825 | P-class pentatricopeptide repeat (PPR) protein essential for accumulation of the dicistronic atpH/F transcript in chloroplasts. Acts as barrier to prevent the atpH/F transcript degradation by exoribonucleases by binding to the consensus sequence of the atpF-atpA intergenic region. |
| AT2G43360 | Catalyzes the conversion of dethiobiotin to biotin. |
| AT3G57130 | Encodes BOP1. Contains Pfam domain, PF00023: Ankyrin repeat and Pfam domain, PF00651: BTB/POZ domain. Lines carrying recessive mutations exhibit a number of visible defects, most pronounced being ectopic outgrowths of in leaf petioles of rosette leaves. Along with BOP2, BOP1 is required for nectary development and formation of normal abscission zones.Forms homodimers and heterodimers with BOP2. Nuclear localization is required for activity which includes positive regulation of AS2 in leaves. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP1 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP1 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP1 expression is restricted to pedicel axils by BP and PNY. BOP1 promotes KNAT6 (At1g23380) expression.BOP1 Interacts with BIL1/BZR1 and Inhibits BIL1/BZR1 transport into the nucleus. |
| AT1G14580 | C2H2-like zinc finger protein;(source:Araport11) |
| AT1G79110 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT3G12920 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT5G61900 | Encodes a plasma-membrane localized, copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Mutants exhibit temperature-sensitive growth defects and increased hypersensitive response where permissive conditions are low temperature (22 degrees Celsius) and low humidity. Gene is expressed at 22 but not at 28 (restrictive condition) degrees. Lethality of double mutants with BON3 can be partially suppressed by SNC1. Double mutants show defects in development that are genetically separable from hypersensitive/cell death response. |
| AT5G07300 | Encodes a copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. |
| AT2G46020 | Encodes a SWI/SNF chromatin remodeling ATPase that upregulates transcription of all three CUC genes and is involved in the formation and/or maintenance of boundary cells during embryogenesis. Also mediates repression of expression of seed storage proteins in vegetative tissues. Interacts strongly with AtSWI3C, also with AtSWI3B, but not with AtSWI3A or AtSWI3D. |
| AT1G75080 | Encodes a positive regulator of the brassinosteroid (BR) signalling pathway that mediates both downstream BR responses and negative feedback regulation of BR biosynthesis. There is evidence for phosphorylation-dependent nucleocytoplasmic shuttling of BZR1. GSK3-like kinases (including BIN2), 14-3-3 proteins, and the phosphatase BSU1 seem to participate in this process. Phosphorylation also appears to affect BZR1's transcriptional activities. |
| AT4G39400 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction. BRI1 ligand is brassinolide which binds at the extracellular domain. Binding results in phosphorylation of the kinase domain which activates the BRI1 protein leading to BR responses. Residue T-1049 and either S-1044 or T-1045 were essential for kinase function in vitro and normal BRI1 signaling in planta. The structure of BRI1 ligand-binding domain has been determined at 2.5A resolution. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. BRI1 appears to be involved in the autonomous pathway that regulates the transition to flowering, primarily through its effects on FLC expression levels, as uncovered by double mutant analyses. This most likely occurs as a result of BRI1-dependent effects on histone acetylation, but not histone triMeH3K4 methylation, at the FLC locus. The mRNA is cell-to-cell mobile. |
| AT1G19350 | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes. Works with BRAVO to regulate QC division in the root. AT1G19350.3(BES1-L) is the long isoform of BES1. It contains an additive N-terminal NLS compared with the canonical BES1-S. This recently evolved isoform is expressed specifically in the Arabidopsis lineage |
| AT3G48360 | Encodes a protein (BT2) that is an essential component of the TAC1-mediated telomerase activation pathway. Acts redundantly with BT3 and BT1 during female gametophyte development and with BT3 during male gametophyte development. BT2 also mediates multiple responses to nutrients, stresses, and hormones. |
| AT4G37610 | BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves. |
| AT5G62570 | Calmodulin binding protein-like protein;(source:Araport11) |
| AT5G18520 | Encodes a candidate G-protein Coupled Receptor that is involved in the regulation of root growth by bacterial N-acyl-homoserine lactones (AHLs) and plays a role in mediating interactions between plants and microbes. The mRNA is cell-to-cell mobile. |
| AT1G72710 | Encodes a member of the casein kinase 1 protein family that is localized to the cytoplasm and nucleus. The mRNA is cell-to-cell mobile. |
| AT3G44910 | member of Putative Na+/H+ antiporter family |
| AT1G05580 | member of Putative Na+/H+ antiporter family |
| AT5G37060 | member of Putative Na+/H+ antiporter family |
| AT1G17120 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. |
| AT2G38270 | Encodes protein homologous to CXIP1. CXIP1 is a PICOT domain containing protein interacts with CAX1, a high capacity calcium transporter. However, CXP2 does not interact with CAX1 and only moderately activates another calcium transporter CAX4. |
| AT3G44240 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT3G50530 | CDPK-related kinase |
| AT4G32410 | Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. |
| AT5G09870 | Encodes a cellulose synthase CESA5 that produces seed mucilage cellulose.Mutants are defective in seed coat mucilage.Involved in the regulation of mucilage composition and/or mucilage synthesis. |
| AT5G64740 | Encodes a cellulose synthase isomer. CESA6 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA6, along with CESA1 and CESA3 are present in the same plasma membrane complex for cellulose biosynthesis. CESA2 and CESA5 are related to CESA6, having partially redundant roles. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. The mRNA is cell-to-cell mobile. |
| AT3G50360 | CAM like protein with four EF-hand domains. Binds calcium. Loss of function mutants affect ABA regulation of guard cell channels and accumulation of stress responsive transcripts(PMID:28603528). |
| AT1G25330 | Encodes CESTA, a positive regulator of brassinosteroid biosynthesis. |
| AT3G04000 | ChlADR is an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. The N-terminal region of this protein directs GFP to the chloroplast where where ChlADR likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation. In addition, this enzyme can also reduce cis-3-hexenal, a major plant volatile compound that contributes to green leaf odor, as well as methylglyoxal in vitro. |
| AT4G24280 | Involved in protein import into chloroplasts during early developmental stages. The mRNA is cell-to-cell mobile. |
| AT5G57180 | Transcription regulator responsible for specific upregulation of the translocon genes atToc33 and atToc75 in leaves. Involved in protein import into chloroplast. |
| AT2G46830 | Encodes a transcriptional repressor that performs overlapping functions with LHY in a regulatory feedback loop that is closely associated with the circadian oscillator of Arabidopsis. Binds to the evening element in the promoter of TOC1 and represses TOC1 transcription. CCA1 and LHY colocalize in the nucleus and form heterodimers in vivo. CCA1 and LHY function synergistically in regulating circadian rhythms of Arabidopsis. CCA1 binds the GI promoter. |
| AT2G42790 | Encodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development. |
| AT1G29390 | Integral membrane protein in the inner envelope of chloroplasts. Provide freezing tolerance. |
| AT1G20440 | Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. Cold regulated gene, amino acid sequence homology with Group II LEA (late embryogenesis abundant) proteins. Also responds to osmotic stress, ABA, dehydration and inhibits e.coli growth while overexpressed. COR47 and RAB18 double overexpressor plants are cold tolerant. Regulated by heat shock. |
| AT5G24930 | Flowering repressor in long days (LD) and short days (SD) and acts on the expression of FT and FT-like genes as well as on SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1). |
| AT3G07650 | This gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO. The mRNA is cell-to-cell mobile. |
| AT2G32950 | Represses photomorphogenesis and induces skotomorphogenesis in the dark. Contains a ring finger zinc-binding motif, a coiled-coil domain, and several WD-40 repeats, similar to G-beta proteins. The C-terminus has homology to TAFII80, a subunit of the TFIID component of the RNA polymerase II of Drosophila. Nuclear localization in the dark and cytoplasmic in the light. The mRNA is cell-to-cell mobile. |
| AT5G41790 | encodes a protein that physically interacts specifically with the putative coiled-coil region of COP1 in vitro. In hypocotyl and cotyledon protoplasts, it is associated to the cytoskeleton, but not in the root. expression is not regulated by light. The mRNA is cell-to-cell mobile. |
| AT5G13290 | Encodes a protein with predicted Ser/Thr kinase activity and membrane localization that is involved in the CLV3 signaling pathway that represses WUS expression in the meristem. Loss of function of CRN can suppress the phenotype caused by overexpression of CLV3. SOL2 isolated as a suppressor of root- specific overexpression of CLE19, a clavata3 like gene. sol2 partially suppresses the short root phenotype caused by CLE19 overexpression. Mutant flowers have extra carpels. |
| AT4G08920 | Encodes CRY1, a flavin-type blue-light photoreceptor with ATP binding and autophosphorylation activity. Functions in perception of blue / green ratio of light. The photoreceptor may be involved in electron transport. Mutant phenotype displays a blue light-dependent inhibition of hypocotyl elongation. Photoreceptor activity requires light-induced homodimerisation of the N-terminal CNT1 domains of CRY1. Involved in blue-light induced stomatal opening. The C-terminal domain of the protein undergoes a light dependent conformational change. Also involved in response to circadian rhythm. Mutants exhibit long hypocotyl under blue light and are out of phase in their response to circadian rhythm. CRY1 is present in the nucleus and cytoplasm. Different subcellular pools of CRY1 have different functions during photomorphogenesis of Arabidopsis seedlings. The mRNA is cell-to-cell mobile. |
| AT2G24610 | member of Cyclic nucleotide gated channel family |
| AT1G77390 | Encodes a core cell cycle gene involved in meiosis II during microsporogenesis. Recessive mutants exhibit delayed and asynchronous meiosis in pollen mother cell populations and uncoordinated nuclear division and cytokinesis resulting in dyad microspores. |
| AT2G07050 | Involved in the biosynthesis of brassinosteroids. Catalyzes the reaction from epoxysqualene to cycloartenol. |
| AT5G64660 | CYS, MET, PRO, and GLY protein 2;(source:Araport11) |
| AT1G16410 | member of CYP79F The mRNA is cell-to-cell mobile. |
| AT5G45340 | Encodes a protein with ABA 8'-hydroxylase activity; involved in ABA catabolism. Mutant analyses show that disruption in the gene results in more drought tolerance whereas overexpression results in increased transpiration rate and reduced drought tolerance. Gene involved in postgermination growth. Plant P450 CYP707A3, ABA 8'-hydroxylase, binds enantioselectively (+)-ABA but not (-)-ABA, whereas the enzyme binds both enantiomers of AHI1 (a structural ABA analogue used as ABA 8'-hydroxylase competitive inhibitor). |
| AT4G39950 | Belongs to cytochrome P450 and is involved in tryptophan metabolism. Converts Trp to indo-3-acetaldoxime (IAOx), a precursor to IAA and indole glucosinolates. The mRNA is cell-to-cell mobile. |
| AT2G22330 | Encodes a cytochrome P450. Involved in tryptophan metabolism. Converts Trp to indole-3-acetaldoxime (IAOx), a precursor to IAA and indole glucosinolates. The mRNA is cell-to-cell mobile. |
| AT1G75450 | This gene used to be called AtCKX6. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT1G68550 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT2G43230 | Member of cytosolic ABA receptor kinases; interacts with ABA receptors RCAR11-14. Positively regulates germination, seedling architecture and root growth in response to ABA. |
| AT1G04270 | Encodes cytosolic ribosomal protein S15. |
| AT3G04620 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT4G39800 | ** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT5G20250 | encodes a member of glycosyl hydrolase family 36. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile. |
| AT5G13570 | Encodes DCP2 with mRNA decapping activity. DCP2 forms a mRNA decapping complex with DCP1 (At1g08370) and VCS (VARICOSE) (At3g13300). Recombinant DCP2 is enzymatically active in vitro, generating from capped mRNAs m7GDP, and 5?-phosphorylated mRNAs. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. The protein was shown by immunoprecipitation not to interact with DCP1. |
| AT1G19100 | Encodes a member of the conserved Microrchidia (MORC) adenosine triphosphatase (ATPase) family, predicted to catalyze alterations in chromosome superstructure. Required for heterochromatin condensation and gene silencing. |
| AT4G25480 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF3). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. |
| AT1G30825 | Involved in trichome maturation. mutant displays enlarged trichomes |
| AT4G10500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G12610 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (DDF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. Overexpression of this gene results in delayed flowering and dwarfism, reduction of gibberellic acid biosynthesis, and increased tolerance to high levels of salt. This gene is expressed in all tissues examined, but most abundantly expressed in upper stems. Overexpression of this gene is also correlated with increased expression of GA biosynthetic genes and RD29A (a cold and drought responsive gene). Under salt stress it induces the expression of GAOX7, which encodes ad C20-GA inhibitor. |
| AT5G62640 | nuclear targeted protein involved in flowering time regulation that affects flowering time independent of FLC |
| AT1G02205 | Expression of the CER1 gene associated with production of stem epicuticular wax and pollen fertility. Biochemical studies showed that cer1 mutants are blocked in the conversion of stem wax C30 aldehydes to C29 alkanes, and they also lack the secondary alcohols and ketones. These suggested the CER1 protein is an aldehyde decarbonylase, but the exact molecular function of this protein remains to be determined. |
| AT3G55830 | A member of the Glycosyltransferase Family 64, homologous to Poplar cambium-expressed GT64 gene. The EPC1 protein plays a critical role during plant development in maintaining the integrity of organs via cell-cell adhesion, thereby providing mechanical strength and facilitating the movement of metabolites throughout the plant.Loss of function specifically affects glycosylinositolphosphorylceramide (GIPC) mannosylation. |
| AT3G06470 | ELO family protein containing a characteristic histidine motif which binds to AtCb5-B, interacts with AtBI-1. Together with AtCb5-B interacts with KCR1, PAS2, and CER10, which are essential for the synthesis of VLCFAs. |
| AT3G09150 | Required for biosynthesis of the tetrapyrrole phytochrome chromophore phytochromobilin. Encodes phytochromobilin synthase, a ferredoxin-dependent biliverdin reductase. It is necessary for coupling the expression of some nuclear genes to the functional state of the chloroplast. |
| AT5G11260 | Basic leucine zipper (bZIP) transcription factor. Nuclear localization. Involved in light-regulated transcriptional activation of G-box-containing promoters. Negatively regulated by Cop1. Although cytokinins do not appear to affect the gene's promoter activity, they appear to stabilize the protein. HY5 plays a role in anthocyanin accumulation in far-red light and blue light, but not in red light or in the dark. Mutant studies showed that the gene product is involved in the positive regulation of the PHYA-mediated inhibition of hypocotyl elongation. Binds to G- and Z-boxes, and other ACEs, but not to E-box. Loss of function mutation shows ABA resistant seedling phenotypes suggesting involvement for HY5 in mediating ABA responses. Binds to the promoter of ABI5 and regulates its expression.Involved in the regulation of response to nutrient levels. |
| AT2G26830 | Encodes a member of a small family of choline/ethanolamine kinases that is localized to the plasma membrane. Homozygous loss of function alleles are embryo lethal. Overexpression results in altered phospholipid levels suggesting a critical role in phospholipid biosynthesis. |
| AT2G18510 | Essential gene (embryo lethal) that is similar to component of splicosome. Regulates embryonic pattern formation through Pol II-Mediated transcription of WOX2 an PIN7 (DOI:10.1016/j.isci.2019.09.004). JANUS positively regulates PLT1 expression in the root meristem by recruiting RNA polymerase II (Pol II) to PLT1 and by interacting with PLT1. Nuclear accumulation of JANUS in root meristem depends on IMB4. (DOI:10.1105/tpc.20.00108 ) |
| AT2G48140 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G71220 | Encodes UDP-glucose:glycoprotein glucosyltransferase. Non-receptor component required for EFR-mediated immunity. Mutants show de-repressed anthocyanin accumulation in the presence of elf18, and EFR accumulation and signalling. |
| AT5G13020 | Agenet domain containing nucleosome binding protein. Binds H3K36 sites. |
| AT3G07100 | Encodes SEC24a/ERMO2. Required for endoplasmic reticulum (ER) morphology. Has epistatic interactions with AT1G55350, AT3G59420, and AT3G10525. |
| AT1G10130 | Encodes a golgi localized P2A-type Ca2+ ATPase involved in Mn nutrition and homeostasis. |
| AT1G73840 | Resembles the CstF64 family of RNA processing factors that are conserved between yeast and mammals. In mammals, CstF64 is a component of the CstF complex which is required for mRNA 3'end formation along with other factors. |
| AT2G43160 | Involved in plant trans-Golgi network (TGN) transport. |
| AT1G61630 | equilibrative nucleoside transporter 7;(source:Araport11) |
| AT2G22140 | Forms a complex with MUS81 that functions as endonuclease in DNA recombination and repair processes. |
| AT1G04310 | encodes an ethylene receptor related to bacterial two-component histidine kinases. |
| AT3G15210 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-4). The protein contains one AP2 domain. Acts as a negative regulator of JA-responsive defense gene expression and resistance to the necrotrophic fungal pathogen Fusarium oxysporum and antagonizes JA inhibition of root elongation. The mRNA is cell-to-cell mobile. |
| AT1G04370 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT4G16750 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT3G09520 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G64260 | EXORDIUM like 2;(source:Araport11) |
| AT5G51550 | EXORDIUM like 3;(source:Araport11) |
| AT4G08370 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT2G23460 | encodes a novel G-alpha protein that shares similarity to plant, yeast, and animal G-alpha proteins at the C-terminus. It contains an N-terminus that is as large as the C-terminus, is a member of a small family, and is expressed in all tissues examined, including roots, leaves, stems, flowers, and fruits. |
| AT4G38180 | FAR1-related sequence 5;(source:Araport11) |
| AT5G60490 | Encodes a member of fasciclin-like arabinogalactan proteins (FLAs) containing a cell adhesion fasciclin (FAS) domain. Mutations result in altered stem biomechanics with reduced tensile strength and reduced tensile modulus of elasticity, as well as altered cell wall architecture and composition, with increased cellulose microfibril angle, reduced arabinose, galactose and cellulose content. Possibly involved in embryogenesis and seed development. |
| AT1G03870 | fasciclin-like arabinogalactan-protein 9 (Fla9). Possibly involved in embryogenesis and seed development. |
| AT1G78020 | FCS like zinc finger 6 is induced during energy starvation through SnRK1 signaling. Mutants accumulate more SnRK1alpha1 which results in the inhibition of seedling growth under favorable growth conditions. Increased SnRK1 activity in the mutant also results in the downregulation of TOR signaling (DOI:10.1111/tpj.13854). |
| AT1G01580 | Encodes the low-iron-inducible ferric chelate reductase responsible for reduction of iron at the root surface. It is likely to be the major Fe(III) chelate reductase in Arabidopsis iron metabolism. Coordinately regulated with IRT1, the major transporter responsible for high-affinity iron uptake from the soil, at both transcriptional and posttranscriptional levels. Steady state mRNA levels are regulated by several metals. Its transcription is regulated by FIT1. |
| AT1G23020 | Encodes a ferric chelate reductase whose transcription is regulated by FIT1. Expressed in the root, shoot, flower and cotyledon. |
| AT4G26555 | Encodes a chloroplast lumen-targeted immunophilin that plays a role in the acclimation of plants under photosynthetic stress conditions, probably by regulating PsaL stability. |
| AT1G51140 | Encodes a basic helix-loop-helix-type transcription factor involved in photoperiodism flowering. Binds to the E-box cis-element in the CONSTANS (CO) promoter to regulate flowering. Interacts with CFL1 and along with CFLAP2 negatively regulates cuticle development. Binds to the potassium channel gene KAT1 as a dimer. The DNA-binding capacity is inhibited in response to ABA through phosphorylation-dependent monomerization. |
| AT1G54520 | FLAP1 is a chloroplast membrane protein of unknown function. When grown in variable light mutants have reduced chloroplast number and size. NPQ is increased relative to wild type under low light. |
| AT1G59910 | Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. |
| AT1G31810 | Encodes the Type II Arabidopsis formin14. Interacts with microtubules and microfilaments to regulate cell division. |
| AT1G34260 | Encodes a protein that is predicted to act as a phosphatidylinositol-3P 5-kinase, but, because it lacks a FYVE domain, it is unlikely to be efficiently targeted to membranes containing the porposed phosphatidylinositol-3P substrate. Therefore, its molecular function remains unknown. The mRNA is cell-to-cell mobile. |
| AT5G22940 | Homolog of FRA8 (AT2G28110), a member of a member of glycosyltransferase family 47; exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. |
| AT4G26530 | Aldolase superfamily protein;(source:Araport11) |
| AT5G53170 | encodes an FtsH protease that is localized to the chloroplast and the mitochondrion |
| AT1G50240 | The FUSED (FU) gene belongs to Ser/Thr protein kinase family and has a key role in the hedgehog signaling pathway known to control cell proliferation and patterning in fruit flies and humans . Arabidopsis thaliana genome has a single Fu gene that is involved in male meiosis cytokinesis. Cytokinesis-defective mutants, named two-in-one (tio), result from mutations in Arabidopsis Fu. Phenotypic analysis of tio mutants reveals an essential role for TIO in conventional modes of cytokinesis in plant meristems and during male gametogenesis. TIO is tightly localized to the midline of the nascent phragmoplast and remains associated with the expanding phragmoplast ring. This gene was previously annotated as two gene models, AT1G50230.1 and AT1G50240.1, however the experimental evidence exists (Oh et al, Current Biology, 2005) showing that these two models are in fact single gene, named FUSED. |
| AT4G01120 | bZIP (basic leucine zipper) transcription factor that binds to the G-box regulatory element found in many plant promoters. GBF2 nuclear localization is increased by blue light |
| AT2G46270 | encodes a bZIP G-box binding protein whose expression is induced by ABA. It has been shown to bind to Adh that contains the G-box and is induced by cold and water deprivation. GBF3 has been shown to be expressed mostly in the root and dark-grown leaves. GBF3 can act as homodimers and as heterodimers with GFB1, GBF2 and GBF4. In addition, GBF3!?s DNA binding activity is enhanced by GIP1, GPRI1 and GPRI2. |
| AT3G63010 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. The mRNA is cell-to-cell mobile. |
| AT1G56600 | GolS2 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS2 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS2 have increased tolerance to salt, chilling, and high-light stress. |
| AT3G53950 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT1G78660 | The Arabidopsis protein AtGGH1 is a gamma-glutamyl hydrolase cleaving pentaglutamates to yield di- and triglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. |
| AT1G80330 | Encodes a protein with gibberellin 3-oxidase activity. The enzyme, expressed and purified in E.coli, was shown to catalyze the 3β-hydroxylation of GA20 into GA29. |
| AT4G34740 | Encodes glutamine 5-phosphoribosylpyrophosphate amidotransferase. Mutants are deficient in leaf, but not cotyledon, plastid and palisade cell development. Mutants exhibit defective chloroplast development under non-low light, suggesting that the defect in chloroplast development is caused by photo-oxidative damage. Plays role in differential development of vascular-associated cells. Demonstrates a cell-specific difference in chloroplast development.Mutant leaves are highly reticulate with a green vascular pattern. |
| AT5G10550 | This gene is predicted to encode a bromodomain-containing protein. A plant line expressing RNAi constructs targeted against GTE7 shows some resistance to agrobacterium-mediated root transformation. |
| AT5G65630 | This gene is predicted to encode a bromodomain-containing protein. Plant lines expressing RNAi constructs targeted against GTE7 show some resistance to agrobacterium-mediated root transformation. |
| AT3G01640 | AtGlcAK is a sugar kinase able to phosphorylate D-GlcA to D-GlcA-1-phosphate in the presence of ATP. |
| AT2G32400 | Glr5 |
| AT2G44550 | glycosyl hydrolase 9B10;(source:Araport11) |
| AT4G39000 | glycosyl hydrolase 9B17;(source:Araport11) |
| AT2G44540 | glycosyl hydrolase 9B9;(source:Araport11) |
| AT1G53580 | Mononuclear Fe(II)-containing member of the b-lactamase fold superfamily. ETHE1 is homodimeric in solution, exhibits low-level esterase activity, and specifically binds a single Fe(II) atom in the active site. |
| AT1G55325 | Encodes the Arabidopsis homolog of the transcriptional regulator MED13, is dynamically expressed during embryogenesis and regulates both developmental timing and the radial pattern formation. |
| AT1G03830 | Assembles liquid?liquid phase separation (LLPS)-driven condensates within the nucleus to protect against infection and autoimmunity. Pseudo-GTPase which sequesters catalytically active GBPL3 under basal conditions but is displaced by GBPL3 LLPS when it enters the nucleus following immune cues to drive the formation of unique membraneless organelles. |
| AT4G30190 | Belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal domain. Its plasma membrane localization is light-dependent. |
| AT5G03720 | Member of Heat Stress Transcription Factor (Hsf) family. Expression is regulated by DREB2A and in turn HSFA3 regulates the expression of hsps Hsp18.1-CI and Hsp26.5-MII35S. Involved in establishing thermotolerence. |
| AT3G06130 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G16380 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G35570 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Cannot be phosphorylated by CK2alpha. |
| AT5G35600 | Encodes a histone deacetylase that is crucial for female gametophyte development and embryogenesis. |
| AT4G40060 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT4G16780 | Encodes a homeodomain-leucine zipper protein that is rapidly and strongly induced by changes in the ratio of red to far-red light. It is also involved in cell expansion and cell proliferation and in the response to auxin. The mRNA is cell-to-cell mobile. |
| AT2G01430 | ATHB17 is a member of the HD-Zip transcription factor family. It is expressed most strongly in roots at different stages of development and induced by ABA, paraquat, drought, and NaCl treatments. Loss of function mutants are more sensitive to salt and drought stress.The protein is nuclear localized and has been shown to bind to the promoter of SIG5 and other genes. |
| AT3G54710 | Encodes a cyclin-dependent protein kinase. Involved in nuclear DNA replication and plastid division. |
| AT3G25790 | Encodes a nuclear localized member of the GARP family of transcription factors. Along with AtNIGT1/HRS1 it is involved in nitrate and phosphate signaling in the root. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
| AT4G20930 | Encodes a 3-hydroxyisobutyrate dehydrogenase. |
| AT5G55250 | Encodes an enzyme which specifically converts IAA to its methyl ester form MelIAA. This gene belongs to the family of carboxyl methyltransferases whose members catalyze the transfer of the methyl group from S-adenosyl-L-methionine to carboxylic acid-containing substrates to form small molecule methyl esters. Expression of TCP genes is downregulated in mutant iamt1-D. SABATH methyltransferase. |
| AT3G18485 | Encodes a novel protein with no predicted membrane-spanning domains that is polymorphic among Arabidopsis accessions. The protein may modulate a metal transporter. Mutants are resistant to IAA-Leu, IAA-Phe, and the divalent metals cobalt and manganese but remain sensitive to free IAA; they are defective in lateral root formation and primary root elongation. |
| AT1G33910 | One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance. |
| AT2G02070 | RAVEN is part of the network regulated by BLJUEJAY, JACKDAW, SACRECROW and SHORT-ROOT to regulate root tissue patterning through cell lineage specification and asymmetric cell division. RAVEN is directly activated by SHORT-ROOT and directly repressed by JACKDAW. |
| AT1G04100 | Auxin induced gene, IAA10 (IAA10). |
| AT1G23420 | Essential for formation and asymmetric growth of the ovule outer integument. Member of the YABBY protein family of putative transcription factors that contain apparent Cys(2)-Cys(2) zinc-finger domains and regions of similarity to the high mobility group (HMG) transcription factors. INO may be required for polarity determination in the central part of the ovule. |
| AT4G16480 | Encodes a high affinity H+:myo-inositol symporter. The only other compound shown to be transported was pinitol, a methylated derivative of myo-inositol. The mRNA is cell-to-cell mobile. |
| AT3G09710 | Ca(2+)-dependent calmodulin-binding protein. Targeted to the nucleus. Involved in glucosinolate metabolism in response to biotic challenge. Expressed in vascular tissue.Member of IQ67 (CaM binding) domain containing family. |
| AT5G03040 | Member of IQ67 (CaM binding) domain containing family. |
| AT1G19870 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
| AT2G26410 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G21720 | Encodes a glyoxylate cycle enzyme isocitrate lyase (ICL) involved in salt tolerance. |
| AT5G20040 | Encodes tRNA isopentenyltransferase AtIPT9. |
| AT4G38600 | encodes a member of HECT ubiquitin protein ligase family that is involved in trichome cell morphogenesis. Mutants in this gene exhibit supernumerary trichome branches and increased DNA content. |
| AT3G52890 | KCBP-interacting protein kinase interacts specifically with the tail region of KCBP |
| AT3G27960 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
| AT1G80440 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB20, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. The mRNA is cell-to-cell mobile. |
| AT5G58910 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT4G32551 | LEUNIG regulates floral organ identity,gynoecium and ovule development. Negatively regulates AGAMOUS . Encodes a glutamine-rich protein with seven WD repeats similar to transcriptional corepressors. |
| AT2G45420 | LOB domain-containing protein 18;(source:Araport11) |
| AT1G31320 | LOB domain-containing protein 4;(source:Araport11) |
| AT3G02550 | LOB domain-containing protein 41;(source:Araport11) |
| AT3G06140 | Paralog of LOG2 (At3g09770), a ubiquitin ligase that regulates amino acid export. |
| AT2G28355 | low-molecular-weight cysteine-rich 5;(source:Araport11) |
| AT1G61070 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT5G39030 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT3G56100 | Protein kinase expressed in meristematic cells. Phosphorylates AGL24. |
| AT3G12290 | MTHFD1 encodes a cytoplasmic bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase that is involved in one carbon metabolism and control of DNA methylation. |
| AT2G25171 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCCAAUAGGUCGAGCAUGUGC |
| AT4G26760 | microtubule-associated protein 65-2;(source:Araport11) |
| AT5G55230 | Binds and bundles microtubules. Plays a role in stabilizing anti-parallel microtubules in the central spindle at anaphase to early cytokinesis but is not essential at the midline of the phragmoplast at later stages. The timing with which the MAP65-1 was targeted to the spindle appears to be regulated by a phosphorylation sensitive switch. Enhances microtubule polymerization, promotes nucleation and stabilizes microtubules against cold treatment and dilution. |
| AT1G35310 | MLP-like protein 168;(source:Araport11) |
| AT1G28280 | VQ motif-containing protein;(source:Araport11) |
| AT1G58200 | A member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity. |
| AT1G04150 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT3G57880 | Required for maintenance of inflorescence and shoot SAMs and normal development of the derived vascular cambium, functions in the SAM to promote continuous organogenesis, affects SAM development through STM, where it affects intracellular localization of STM in SAM cells in the peripheral region and prevents STM localization toward the cell wall of SAM cells in the peripheral region. |
| AT3G27785 | MYB118 encodes a myb transcription factor that represses endosperm maturation and, along with MYB115, regulates glucosinolate biosynthesis. |
| AT5G55020 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB120). |
| AT1G17580 | Encodes a member of the type XI myosin protein family involved in organelle trafficking and overall plant development. |
| AT1G70750 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT4G37670 | N-acetyl-l-glutamate synthase 2;(source:Araport11) |
| AT2G46770 | NAC transcription factor NST1. NST1 and NST2 are redundant in regulating secondary wall thickening in anther walls and siliques. An NST1 promoter fusion was detected in various tissues in which lignified secondary walls develop. Both MYC2 and MYC4 bind to the NST1 promoter and appear to regulate its expression in response to blue light. |
| AT1G12260 | Encodes a NAC-domain transcription factor that is expressed in developing xylem. Over expression of this protein causes ectopic secondary cell wall growth. Complements some of the cell wall defects seen in SND1/NST1 double mutants. |
| AT3G15510 | Note of caution: not to be confused with another protein (AtNAC6 locus AT5G39610) which on occasion has also been referred to as AtNAC2. |
| AT1G32770 | Encodes SND1, a NAC Domain transcription factor involved in secondary wall biosynthesis in fibers. Expressed specifically in interfascicular fibers and xylary fibers in stems. Expressed in the procambium of stem inflorescences and root. May act as a negative regulator of secondary wall thickening in xylary fibers. Acts redundantly with NST1 to control development of secondary walls in siliques. |
| AT1G02230 | NAC domain containing protein 4;(source:Araport11) |
| AT3G04420 | NAC domain containing protein 48;(source:Araport11) |
| AT4G36160 | Encodes a NAC-domain transcription factor that is expressed in developing xylem. Over expression of this protein causes ectopic secondary cell wall growth. Complements some of the cell wall defects seen in SND1/NST1 double mutants. |
| AT5G13180 | Encodes a NAC domain transcription factor that interacts with VND7 and negatively regulates xylem vessel formation. |
| AT2G27080 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G09720 | Member of NET domain family of actin binding proteins. Paralog of At3g22790 (NET2A). |
| AT1G03470 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It colocalizes with filamentous actin and is localized to the nuclear membrane and the vacuolar membrane. |
| AT4G24690 | Encodes NBR1, a selective autophagy substrate. The mRNA is cell-to-cell mobile. |
| AT1G10170 | Encodes AtNFXL1, a homologue of the putative human transcription repressor NF-X1. Functions as a negative regulator of the trichothecene phytotoxin-induced defense response. |
| AT5G56080 | Encodes a protein with nicotianamine synthase activity. Its transcript levels rise in roots in response to zinc deficiency and rise in leaves in response to elevated levels of zinc. |
| AT5G06980 | Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK3 in having affects on biomass accumulation and phototrophism. |
| AT1G09415 | encodes a kinase that physically interacts with NPR1/NIM1 |
| AT4G38340 | Chip-seq data indicates bZIP1 binds to the NLP3 promoter. |
| AT3G14440 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane. |
| AT1G77760 | Encodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. Similar to molybdopterin oxidoreductases at the N-terminus, and to FAD/NAD-binding cytochrome reductases at the C-terminus. Cofactors: FAD, heme iron (cytochrome B-557), and molybdenum-pterin. |
| AT5G13390 | Required for normal pollen development and lipid accumulation within the tapetum |
| AT2G35190 | plant-specific SNARE located in cell plate of dividing cells. cofractionates with the cytokinesis-specific syntaxin, KNOLLE, which is required for the formation of the cell plate. |
| AT1G27040 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G14350 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT1G27310 | Encodes an ortholog of yeast NTF2, a nuclear envelop transport protein that functions as the nuclear import receptor for RanGDP, an essential player in nucleocytoplasmic transport. |
| AT2G05760 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT3G12600 | nudix hydrolase homolog 16;(source:Araport11) |
| AT1G30110 | Encodes a ppGpp pyrophosphohydrolase. |
| AT3G22460 | Encodes a member of a family of genes with O-acetylserine(thiol)lyase activity. |
| AT5G01840 | Encodes a member of the plant specific ovate protein family. Members of this family have been shown to bind to KNOX and BELL- like TALE class homeodomain proteins. This interaction may mediate relocalization of the TALE homeodomain from the nucleus to the cytoplasm. Functions as a transcriptional repressor that suppresses cell elongation. May also directly affect microtubule organization via interactions with TON2. |
| AT2G48120 | The pale cress (pac) mutant affects chloroplast and leaf development; mutants are ABA-deficient and accumulate lower levels of carotenoids and chlorophyll compared to wild type. PAC binds 23srRNA and appears to be required for 50s ribosome assembly. Three alternative transcripts of this gene exist.PAC is essential for photoautotrophic growth and associates with psbK-psbI, ndhF, ndhD, and 23S ribosomal RNA in vivo(PMID:28805278) |
| AT3G22270 | Topoisomerase II-associated protein PAT1;(source:Araport11) |
| AT5G56460 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G04310 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G62060 | Pectinacetylesterase family protein;(source:Araport11) |
| AT3G14310 | encodes a pectin methylesterase, targeted by a cellulose binding protein (CBP) from the parasitic nematode Heterodera schachtii during parasitism. |
| AT1G06580 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G20640 | Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT3G49110 | Class III peroxidase Perx33. Expressed in roots. Located in the cell wall. Involved in cell elongation. Expression activated by light. May play a role in generating H2O2 during defense response. The mRNA is cell-to-cell mobile. |
| AT1G30870 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G04230 | Member of Phenylalanine ammonialyase (PAL) gene family. Differs significantly from PAL1 and PAL2 and other sequenced plant PAL genes. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
| AT2G01180 | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves. |
| AT3G15730 | Encodes phospholipase D alpha 1 (PLD alpha 1). Positive regulator of abscisic acid (ABA) mediated stomatal movements. PLD alpha 1 plays an important role in seed deterioration and aging in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT1G12370 | encodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele |
| AT1G25520 | Member of the UPF0016 family of membrane proteins, belongs to the conserved group of Mn/Ca transporters. Might act to fine tune Mn allocation into the endoplasmic reticulum of specific cell types. |
| AT4G39710 | FK506-binding protein 16-2;(source:Araport11) |
| AT4G12800 | Encodes subunit L of photosystem I reaction center. |
| AT2G46970 | encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. |
| AT3G62090 | encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. |
| AT1G72390 | nuclear receptor coactivator;(source:Araport11) |
| AT3G07360 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT4G35100 | a member of the plasma membrane intrinsic protein PIP. functions as aquaporin. Salt-stress-inducible MIP |
| AT1G19880 | Encodes a regulator of chromatin condensation 1 (RCC1) family protein; confers plasticity of rosette diameter in response to changes in N availability. |
| AT1G02660 | PLIP2 is a glycerolipid A1 lipase with substrate preference for monogalactosyldiacylglycerol. Expression is induced by ABA. |
| AT5G65158 | Lipase/lipooxygenase, PLAT/LH2 family protein;(source:Araport11) |
| AT4G05320 | One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. The mRNA is cell-to-cell mobile. |
| AT1G05850 | Encodes an endo chitinase-like protein AtCTL1. Essential for tolerance to heat, salt and drought stresses. Also involved in root hair development, cell expansion and response to cytokinin. Allelic to erh2. 11 alleles described in Hauser (1995). Mutant is defective in acquired thermotolerance, appears semidwarf throughout its life cycle and has extra lateral branches. There are two EMS alleles. Expression of AtHSP101 is not affected in the mutants. |
| AT1G23540 | Encodes a member of the PERK family of putative receptor kinases. Overexpression leads to morphological defects and reduced fertility and increased expression of MAX genes. |
| AT2G44830 | AGCVIII kinase involved in the pulse-induced first positive phototropism. Plasma-membrane-associated element of a molecular rheostat that modulates auxin flux through developing protophloem sieve elements (PPSEs) while interacting with BRX, thereby timing PPSE differentiation. Activates PIN-mediated auxin efflux. |
| AT2G33640 | DHHC-type zinc finger family protein that encodes a functional s-acyl transferase. |
| AT1G62290 | Saposin-like aspartyl protease family protein;(source:Araport11) |
| AT4G04460 | Saposin-like aspartyl protease family protein;(source:Araport11) |
| AT2G40330 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT5G05440 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT5G47960 | Encodes a small molecular weight g-protein. |
| AT1G16190 | Encodes a member of the RADIATION SENSITIVE23 (RAD23) family: AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome. |
| AT5G27920 | Encodes a nuclear F-box protein that can directly interact with the C2H2‐type zinc finger transcription factor STOP1 and promote its ubiquitination and degradation. STOP1 is crucial for aluminum (Al) resistance. |
| AT2G34825 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT3G05490 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT3G24900 | receptor like protein 39;(source:Araport11) |
| AT3G24982 | receptor like protein 40;(source:Araport11) |
| AT3G25010 | receptor like protein 41;(source:Araport11) |
| AT3G25020 | receptor like protein 42;(source:Araport11) |
| AT2G48010 | receptor-like serine/threonine kinase (RKF3) The mRNA is cell-to-cell mobile. |
| AT1G69270 | RPK1 is a leucine-rich receptor-like kinase located in the plasma membrane which is upregulated by abscisic acid, dehydration, high salt, low temperature, but not by other plant hormones. RPK1 knock-out and antisense plants show an ABA-insensitive phenotype. RPK1 plays a role in ABA-controlled cell proliferation and is a regulator of the ABA signal transduction pathway. Overexpression of the LRR domain has a dominant negative effect on RPK1. Mutations in RPK1 uncouple cotyledon anlagen and primordia by modulating epidermal cell shape and polarity. |
| AT1G67500 | Encodes the catalytic subunit of DNA polymerase zeta.Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS). |
| AT1G01320 | Encodes REDUCED CHLOROPLAST COVERAGE 1 (REC1) a protein with similarity to the FLOURY locus in maize. Located in the nucleus and cytosol. Contributes to establishing the size of the chloroplast compartment. |
| AT1G13260 | Encodes an AP2/B3 domain transcription factor which is upregulated in response to low temperature. It contains a B3 DNA binding domain. It has circadian regulation and may function as a negative growth regulator. The mRNA is cell-to-cell mobile. |
| AT2G01570 | Member of the VHIID/DELLA regulatory family. Contains homopolymeric serine and threonine residues, a putative nuclear localization signal, leucine heptad repeats, and an LXXLL motif. Putative transcriptional regulator repressing the gibberellin response and integration of phytohormone signalling. DELLAs repress cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. RGA1 binds to PIF3 and inhibits its DNA binding activity and thus affects the expression of PIF3 regulated genes. RGA may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. Involved in fruit and flower development. |
| AT4G31615 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
| AT4G16990 | disease resistance protein (TIR-NBS class);(source:Araport11) |
| AT1G64060 | Interacts with AtrbohD gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. |
| AT3G08640 | alphavirus core family protein (DUF3411);(source:Araport11) |
| AT4G01280 | RVE5 is one of eleven homologous MYB-like transcription factors in Arabidopsis and a member of the RVE8 clade. Plays a minor role in clock regulation. |
| AT5G60690 | REVOLUTA regulates meristem initiation at lateral positions. a member of a small homeodomain-leucine zipper family. Has overlapping functions with PHAVOLUTA and PHABULOSA. The mRNA is cell-to-cell mobile. |
| AT1G34110 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT3G51300 | Encodes a pollen-specific Rop GTPase, member of the Rho family of small GTP binding proteins that interacts with RIC3 and RIC4 to control tip growth in pollen tubes. These three proteins promote the proper targeting of exocytic vesicles in the pollen tube tip. ROP1 activity is regulated by the REN1 GTPase activator protein. |
| AT3G17611 | RHOMBOID-like protein 14;(source:Araport11) |
| AT3G46620 | Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants. |
| AT2G01150 | Encodes a RING-H2 finger protein that is expressed in vascular tissue, root tips, embryos and pistils. |
| AT5G44180 | Interacts with CHR11, CHR17, and ARID5, several known subunits of ISWI. JA biosynthesisis is positively regulated by this chromatin remodeling complex, thereby promoting stamen filament elongation. |
| AT5G65900 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G49600 | RNA-binding protein 47A;(source:Araport11) |
| AT3G19130 | RBP47B, is a component of the stress granule proteome and interacts with 2',3'-cAMP. |
| AT3G13870 | required for regulated cell expansion and normal root hair development. Encodes an evolutionarily conserved protein with putative GTP-binding motifs that is implicated in the control of vesicle trafficking between the endoplasmic reticulum and the Golgi compartments. Degraded by LNP1 and 2 to maintain a tubular ER network. |
| AT1G68825 | ROTUNDIFOLIA like 15;(source:Araport11) |
| AT1G23860 | Encodes a 9G8-like serine-arginine rich (SR) protein that interacts in vivo with U1-70K, a U1 small nuclear ribonucleoprotein 70-kDa protein that is involved in nuclear precursor mRNA processing. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT5G15950 | Adenosylmethionine decarboxylase family protein;(source:Araport11) |
| AT1G02500 | encodes a S-adenosylmethionine synthetase. SAM1 is regulated by protein S-nitrosylation. The covalent binding of nitric oxide (NO) to the Cys114 residue inhibits the enzyme activity. |
| AT4G32300 | S-domain-2 5;(source:Araport11) |
| AT1G06040 | Encodes salt tolerance protein (STO) which confers salt tolerance to yeast cells. Fully complements calcineurin deficient yeast but does not encode a phosphoprotein phosphatase. Sequence has similarities to CONSTANS. STO co-localizes with COP1 and plays a role in light signaling.STO transcript levels are regulated by photoperiod and phtyohormones. STO competes with FLC in the regulation of floral transition genes SOC1 and FT. |
| AT5G46410 | Encodes a SCP1-like small phosphatase (SSP). Three SSPs form a unique group with long N-terminal extensions: AT5G46410 (SSP4), AT5G11860 (SSP5), AT4G18140 (SSP4b). SSP4 and SSP4b were localized exclusively in the nuclei, whereas SSP5 accumulated in both nuclei and cytoplasm. All three SSPs encodes active CTD phosphatases like animal SCP1 family proteins, with distinct substrate specificities: SSP4 and SSP4b could dephosphorylate both Ser2-PO(4) and Ser5-PO(4) of CTD, whereas SSP5 dephosphorylated only Ser5-PO(4). The mRNA is cell-to-cell mobile. |
| AT2G25600 | Encodes SPIK, a member of the Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mutant plants have impaired pollen-tube growth. |
| AT4G26690 | Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development. |
| AT5G13730 | Encodes sigma 4 factor, involved in regulating the activity of the plastid-encoded RNA polymerase PEP. Regulates the overall quantity of NDH complexes and thus influences NDH activity. |
| AT5G03310 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G10990 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G60940 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. |
| AT1G10940 | Encodes a plant protein kinase similar to the calcium/calmodulin-dependent protein kinase subfamily and the SNF1 kinase subfamily (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Kinase activity of its homolog in tobacco is induced by hyperosmotic condition within 1 minute. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT4G32400 | Encodes a plastidial nucleotide uniport carrier protein required to export newly synthesized adenylates into the cytosol. |
| AT1G14290 | Encodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth. |
| AT4G16340 | Encodes SPIKE1 (SPK1), the lone DOCK family guanine nucleotide exchange factor (GEF) in Arabidopsis. SPK1 is a peripheral membrane protein that accumulates at, and promotes the formation of, a specialized domain of the endoplasmic reticulum (ER) termed the ER exit site (ERES). SPK1 promotes polarized growth and cell-cell adhesion in the leaf epidermis. Mutant has seedling lethal; cotyledon, leaf-shape, trichome defects. |
| AT2G47070 | member of SPL gene family, encodes DNA binding proteins and putative transcription factors. All have the SBP-box, which encodes the SBP-domain, required for and sufficient for interaction with DNA. |
| AT1G27370 | In conjunction with SPL11 and SPL2, SPL10 redundantly controls proper development of lateral organs in association with shoot maturation in the reproductive phase. SPL2, SPL10, and SPL11, suppress root regeneration with age by inhibiting wound-induced auxin biosynthesis. SPL10 also controls lamina shape during vegetative development. |
| AT3G60030 | squamosa promoter-binding protein-like 12;(source:Araport11) |
| AT5G03650 | Encodes starch branching enzyme (E.C.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout the plant and highest in seedlings and cauline leaves. |
| AT2G41770 | Regulates the assembly and trafficking of cellulose synthase complexes. |
| AT1G51840 | kinase-like protein;(source:Araport11) |
| AT4G21480 | Putative sugar transporter. Expressed in nematode-induced root syncytia. |
| AT4G08620 | Encodes a high-af?nity sulfate transporter. Contains STAS domain. Expressed in roots and guard cells. Up-regulated by sulfur deficiency. |
| AT1G71360 | Encodes a member of the mid-SUN subfamily of SUN-domain proteins that is localized to both the nuclear envelope and the ER. It is involved in early seed development and nuclear morphology. |
| AT4G02020 | Encodes a polycomb group protein. Forms part of a large protein complex that can include VRN2 (VERNALIZATION 2), VIN3 (VERNALIZATION INSENSITIVE 3) and polycomb group proteins FERTILIZATION INDEPENDENT ENDOSPERM (FIE) and CURLY LEAF (CLF). The complex has a role in establishing FLC (FLOWERING LOCUS C) repression during vernalization. Performs a partially redundant role to MEA in controlling seed initiation by helping to suppress central cell nucleusendosperm proliferation within the FG. |
| AT5G60200 | Encodes a Dof-type transcription factor. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT1G50300 | TBP-associated factor 15;(source:Araport11) |
| AT5G08330 | Circadian oscillator protein which interacts with bZIP63 and regulates a response of the circadian oscillator to sugar. Is not required for the sugar-induced circadian phase advance in the morning; regulates a response of CCA1 to sugars. |
| AT2G45680 | TCP family transcription factor;(source:Araport11) |
| AT5G59430 | Encodes a telomeric repeat binding protein with a DNA binding domain at its C terminus. The DNA binding domain has a preference for GGTTTAG sequences and at least five of these repeats are required for recognition by a nearly full-length TRP1 protein. |
| AT1G04130 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808). Interacts with Hsp90/Hsp70 as co-chaperone. |
| AT5G48010 | Encodes an oxidosqualene cyclase involved in the biosynthesis of thalianol, a tricyclic triterpenoid of unknown function. Overexpression of THAS leads to dwarfing in the aerial tissues of Arabidopsis plants, but increases their root length. THAS is part of a small operon-like cluster of genes (with At5g48000 (THAH) and At5g47990 (THAD)) involved in thalianol metabolism. |
| AT3G55160 | THADA is an orphan gene in Arabidopsis thaliana. It is the only DUF2428 domain containing protein in the genome. |
| AT3G22380 | Encodes a nucleus-acting plant-specific clock regulator working close to the central oscillator and affecting the circadian gating of light responses. Circadian gating is the alteration of circadian phase according to the photoperiod of the entraining day/light cycle and the rhythmic antagonism of light responses in the early subjective night. TIC differentially regulates CCA1 and PRR9 from LHY, with LHY expression as a dominant genetic target of TIC action. Also shown to be invoved in the maintenance of Arabidopsis thaliana metabolic homeostasis. |
| AT4G23440 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
| AT5G62170 | LOW protein: M-phase inducer phosphatase-like protein;(source:Araport11) |
| AT4G01470 | Encodes AtTIP1;3, functions as water and urea channels in pollen. |
| AT3G18890 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G18700 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. |
| AT4G39770 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G10100 | Trehalose-6-phosphate phosphatase which enhances drought tolerance by regulating stomatal apertures. |
| AT3G06080 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G56330 | Involved in posttranscriptional modification of plastid tRNA. |
| AT1G52160 | Encodes a tRNase Z. |
| AT1G78240 | Encodes TSD2 (TUMOROUS SHOOT DEVELOPMENT2), a putative methyltransferase with an essential role in cell adhesion, anthocyanin accumulation, and coordinated plant development. |
| AT4G03560 | Encodes a depolarization-activated Ca(2+) channel. Anti-sense experiments with this gene as well as Sucrose-H(+) symporters and complementation of yeast sucrose uptake mutant cch1 suggest that this protein mediates a voltage-activated Ca(2+ )influx. Mutants lack detectable SV channel activity suggesting TPC1 is essential component of the SV channel. Patch clamp analysis of loss of function mutation indicates TPC1 does not affect Ca2+ signaling in response to abiotic and biotic stress. |
| AT2G30110 | Encodes a ubiquitin-activating enzyme (E1), involved in the first step in conjugating multiple ubiquitins to proteins targeted for degradation. Gene is expressed in most tissues examined. Mutant is able to revert the constitutive defense responses phenotype of snc1, which indicates the gene is involved in defense response. It also indicates that ubiquitination plays a role in plant defense signalling. |
| AT1G75440 | ubiquitin-conjugating enzyme 16;(source:Araport11) |
| AT3G15355 | ubiquitin-conjugating enzyme 25;(source:Araport11) |
| AT5G02880 | encodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT3G49600 | Encodes a ubiquitin-specific protease which catalyzes deubiquitination of histone H2B and is required for heterochromatin silencing.Loss of function mutations display autonomous endosperm development and embryo arrest. Loss of function also results in an increase in expression of the PcG complex target gene PHE1. |
| AT2G15480 | UDP-glucosyl transferase 73B5;(source:Araport11) |
| AT2G26480 | UDP-glucosyl transferase 76D1;(source:Araport11) |
| AT5G11230 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT4G02590 | Basic helix loop helix class transcriptional regulator. Shows ecotype specific effects on temperature dependent salicylic acid accumulation and immunity. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT1G30950 | Required for the proper identity of the floral meristem. Involved in establishing the whorled pattern of floral organs, in the control of specification of the floral meristem, and in the activation of APETALA3 and PISTILLATA. UFO is found at the AP3 promoter in a LFY-dependent manner, suggesting that it works with LFY to regulate AP3 expression. UFO may also promote the ubiquitylation of LFY. |
| AT3G56620 | nodulin MtN21-like transporter family protein |
| AT3G01390 | Subunit G of the vacuolar membrane ATPAse complex |
| AT1G02120 | Encodes VAD1 (Vascular Associated Death1), a regulator of cell death and defense responses in vascular tissues. VAD1 is a putative membrane associated protein and contains a GRAM domain. vad1 is a lesion mimic mutant that exhibits light conditional appearance of propagative HR (hypersensitive response)-like lesions along the vascular system. The mRNA is cell-to-cell mobile. |
| AT4G30200 | Encodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus. |
| AT2G29890 | Encodes a ubiquitously expressed villin-like protein, whose mRNA may be alternatively processed. Villin belongs to a superfamily of actin binding proteins called the villin/gelsolin family. Animal villins are involved in actin binding. VLN1 protein co-localizes with actin filaments in several assays. VLN1 binds and bundles F-actin in a calcium-independent manner. It does not nucleate, cap or sever actin filaments and it stabilizes actin filaments, protecting them from ADF-mediated depolymerization. |
| AT1G53700 | The WAG1 and its homolog, WAG2 each encodes a protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT2G35880 | Microtubule-stabilizing protein. |
| AT1G56510 | TIR-NB-LRR protein that confers resistance to four races of Albugo candida. The mRNA is cell-to-cell mobile. |
| AT4G28240 | Member of the wound-induced polypeptide (WIP) family. Positively regulates plant resistance against Pst DC3000 by enhancing PTI responses. |
| AT3G13360 | Encodes an outer nuclear membrane protein that anchors RanGAP1 to the nuclear envelope. It interacts with SUN proteins and is required for maintaining the elongated nuclear shape of epidermal cells. |
| AT4G31550 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
| AT2G30590 | Encodes WRKY DNA-binding protein 21 (WRKY21). |
| AT3G04670 | member of WRKY Transcription Factor; Group II-d |
| AT5G64530 | xylem NAC domain 1;(source:Araport11) |
| AT2G32930 | Encodes a zinc finger protein. |
| AT2G04880 | Encodes WRKY1, a member of the WRKY transcription factors in plants involved in disease resistance, abiotic stress, senescence as well as in some developmental processes. WRKY1 is involved in the salicylic acid signaling pathway. The crystal structure of the WRKY1 C-terminal domain revealed a zinc-binding site and identified the DNA-binding residues of WRKY1. The mRNA is cell-to-cell mobile. |