37 senescence-associated transcription factors (Sen-TFs) ChIP-seq or DAP-seq data
| MYB44 Targets | Description |
| AT1G64210 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G16750 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT2G18310 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
| AT3G60290 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G55380 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT5G62550 | microtubule-associated futsch-like protein;(source:Araport11) |
| AT5G02890 | Encodes a protein with similarity to transferases in plants and fungi. |
| AT5G06930 | nucleolar-like protein;(source:Araport11) |
| AT2G42140 | VQ motif-containing protein;(source:Araport11) |
| AT3G55840 | Hs1pro-1 protein;(source:Araport11) |
| AT1G62422 | hypothetical protein;(source:Araport11) |
| AT1G67590 | Remorin family protein;(source:Araport11) |
| AT1G16220 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT2G16676 | Ta11-like non-LTR retrotransposon;(source:Araport11) |
| AT3G15630 | plant/protein;(source:Araport11) |
| AT2G22650 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT3G05900 | neurofilament protein-like protein;(source:Araport11) |
| AT5G03230 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT5G65260 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G02500 | mental retardation GTPase activating protein;(source:Araport11) |
| AT5G10370 | helicase domain-containing protein / IBR domain-containing protein / zinc finger protein-like protein;(source:Araport11) |
| AT1G64120 | pre-tRNA tRNA-Leu (anticodon: CAA);(source:Araport11, TAIR10) |
| AT5G63710 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G03420 | hypothetical protein (DUF789);(source:Araport11) |
| AT1G67060 | peptidase M50B-like protein;(source:Araport11) |
| AT5G15175 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
| AT5G63040 | transmembrane protein;(source:Araport11) |
| AT1G07580 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT5G13140 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT2G03110 | putative RNA-binding protein;(source:Araport11) |
| AT5G66607 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G58007 | multidrug resistance protein;(source:Araport11) |
| AT4G31875 | hypothetical protein;(source:Araport11) |
| AT3G11395 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
| AT3G58090 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT2G28360 | SIT4 phosphatase-associated family protein;(source:Araport11) |
| AT5G51400 | PLAC8 family protein;(source:Araport11) |
| AT1G70780 | hypothetical protein;(source:Araport11) |
| AT2G44600 | hypothetical protein;(source:Araport11) |
| AT1G67240 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.5e-23 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT5G66430 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G11785 | transmembrane protein;(source:Araport11) |
| AT3G14430 | GRIP/coiled-coil protein;(source:Araport11) |
| AT5G18590 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G19730 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G20160 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
| AT1G35110 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT5G28970.1);(source:TAIR10) |
| AT2G37520 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
| AT4G22785 | tRNA-Lys (anticodon: CTT) |
| AT3G06890 | transmembrane protein;(source:Araport11) |
| AT5G02440 | 60S ribosomal protein L36;(source:Araport11) |
| AT1G05870 | hypothetical protein (DUF1685);(source:Araport11) |
| AT4G03038 | other_RNA;(source:Araport11) |
| AT3G24518 | Natural antisense transcript overlaps with AT3G24520;(source:Araport11) |
| AT4G16470 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G03828 | transmembrane protein;(source:Araport11) |
| AT1G56140 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT1G49140 | NADH dehydrogenase ubiquinone 1 beta subcomplex subunit 10-B-like protein (Complex I subunit NDUFS6);(source:Araport11) |
| AT3G13690 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT1G55365 | hypothetical protein;(source:Araport11) |
| AT1G59880 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
| AT2G30230 | 6,7-dimethyl-8-ribityllumazine synthase;(source:Araport11) |
| AT5G42930 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G30720 | Thioesterase/thiol ester dehydrase-isomerase superfamily protein;(source:Araport11) |
| AT2G19660 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G78476 | hypothetical protein;(source:Araport11) |
| AT1G75180 | Erythronate-4-phosphate dehydrogenase family protein;(source:Araport11) |
| AT3G46690 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G31560 | signal transducer/transcription protein, putative (DUF1685);(source:Araport11) |
| AT4G27610 | intracellular protein transporter;(source:Araport11) |
| AT1G67238 | other_RNA;(source:Araport11) |
| AT1G67785 | hypothetical protein;(source:Araport11) |
| AT2G42020 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
| AT3G20850 | proline-rich family protein;(source:Araport11) |
| AT2G15042 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G04680 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G08075 | pre-tRNA tRNA-Ala (anticodon: CGC);(source:Araport11, TAIR10) |
| AT4G35690 | hypothetical protein (DUF241);(source:Araport11) |
| AT1G04340 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
| AT1G74929 | hypothetical protein;(source:Araport11) |
| AT5G11420 | Encodes a DUF642 cell wall protein. |
| AT3G54680 | proteophosphoglycan-like protein;(source:Araport11) |
| AT2G17540 | hypothetical protein;(source:Araport11) |
| AT5G21100 | Plant L-ascorbate oxidase;(source:Araport11) |
| AT1G06650 | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase The mRNA is cell-to-cell mobile. |
| AT5G19050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G38030 | pre-tRNA tRNA-Glu (anticodon: CTC);(source:Araport11, TAIR10) |
| AT4G27700 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT4G04560 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.0e-94 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT3G51238 | Natural antisense transcript overlaps with AT3G51240;(source:Araport11) |
| AT2G39860 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT3G61540 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G28790 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G37710 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G13250 | RING finger protein;(source:Araport11) |
| AT2G37750 | hypothetical protein;(source:Araport11) |
| AT1G61760 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G41390 | PLAC8 family protein;(source:Araport11) |
| AT3G22845 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT1G32660 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G05170 | Galactosyltransferase family protein;(source:Araport11) |
| AT5G15581 | transmembrane protein;(source:Araport11) |
| AT1G77840 | Translation initiation factor IF2/IF5;(source:Araport11) |
| AT1G77260 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G61900 | hypothetical protein;(source:Araport11) |
| AT4G30130 | DUF630 family protein (DUF630 and DUF632);(source:Araport11) |
| AT1G58060 | RNA helicase family protein;(source:Araport11) |
| AT4G01860 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT3G51180 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G28580 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G73470 | hypothetical protein;(source:Araport11) |
| AT1G15590 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT1G08040 | trimethylguanosine synthase (DUF707);(source:Araport11) |
| AT2G34100 | nonsense-mediated mRNA decay-like protein;(source:Araport11) |
| AT1G69130 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT1G67720 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G01593 | Natural antisense transcript overlaps with AT4G01595;(source:Araport11) |
| AT2G28200 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT1G11730 | Galactosyltransferase family protein;(source:Araport11) |
| AT3G04920 | Ribosomal protein S24e family protein;(source:Araport11) |
| AT2G43210 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT1G18265 | zein-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT4G10080 | transmembrane protein;(source:Araport11) |
| AT3G28650 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G56230 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT3G54130 | Josephin family protein;(source:Araport11) |
| AT2G16660 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G22820 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G17620 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT3G02930 | Encodes a microtubule-associated protein. |
| AT3G62630 | stress response NST1-like protein (DUF1645);(source:Araport11) |
| AT1G80870 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G66270 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT2G35580 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT5G43190 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G38090 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT1G07210 | Ribosomal protein S18;(source:Araport11) |
| AT3G44850 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G02510 | UDP-glucose 6-dehydrogenase;(source:Araport11) |
| AT5G41100 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G06380 | Ribosomal protein L1p/L10e family;(source:Araport11) |
| AT4G01200 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G24490 | Alcohol dehydrogenase transcription factor Myb/SANT-like family protein;(source:Araport11) |
| AT3G06035 | Glycoprotein membrane precursor GPI-anchored;(source:Araport11) |
| AT1G50270 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G42800 | AF-like protein;(source:Araport11) |
| AT5G10830 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G07330 | dentin sialophosphoprotein;(source:Araport11) |
| AT5G64550 | loricrin-like protein;(source:Araport11) |
| AT4G01210 | glycosyl transferase family 1 protein;(source:Araport11) |
| AT4G08460 | hypothetical protein (DUF1644);(source:Araport11) |
| AT4G11355 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT1G26300 | BSD domain-containing protein;(source:Araport11) |
| AT3G08636 | hypothetical protein;(source:Araport11) |
| AT4G38950 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT5G19500 | Encodes a putative amino acid transporter that localizes to the chloroplast inner envelope membrane. |
| AT2G42110 | hypothetical protein;(source:Araport11) |
| AT1G60630 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G43720 | rRNA-processing EFG1-like protein (DUF2361);(source:Araport11) |
| AT3G11800 | Expp1 protein;(source:Araport11) |
| AT2G34110 | hypothetical protein;(source:Araport11) |
| AT5G46900 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G61826 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G05150 | Calcium-binding tetratricopeptide family protein;(source:Araport11) |
| AT1G14680 | early endosome antigen;(source:Araport11) |
| AT2G24240 | BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11) |
| AT5G19870 | transmembrane epididymal protein (DUF716);(source:Araport11) |
| AT3G62820 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G69480 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT1G75610 | pseudogene of Histone superfamily protein;(source:Araport11) |
| AT5G19490 | Histone superfamily protein;(source:Araport11) |
| AT1G19450 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G64395 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G03130 | hypothetical protein;(source:Araport11) |
| AT3G17680 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT4G18630 | hypothetical protein (DUF688);(source:Araport11) |
| AT4G36980 | CLK4-associating serine/arginine-rich protein;(source:Araport11) |
| AT4G34480 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G44330 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G15530 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G23500 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G16730 | Encodes a microtubule-associated protein. The mRNA is cell-to-cell mobile. |
| AT5G62280 | DUF1442 family protein (DUF1442);(source:Araport11) |
| AT3G44820 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G55258 | pseudogene similar to self-incompatibility |
| AT2G39960 | Microsomal signal peptidase 25 kDa subunit (SPC25);(source:Araport11) |
| AT5G40690 | histone-lysine N-methyltransferase trithorax-like protein;(source:Araport11) |
| AT3G46630 | DCL protein (DUF3223);(source:Araport11) |
| AT4G32470 | Cytochrome bd ubiquinol oxidase, 14kDa subunit;(source:Araport11) |
| AT2G31600 | INO80 complex subunit D-like protein;(source:Araport11) |
| AT4G31460 | Ribosomal L28 family;(source:Araport11) |
| AT3G18170 | Glycosyltransferase family 61 protein;(source:Araport11) |
| AT5G05220 | hypothetical protein;(source:Araport11) |
| AT4G01460 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G09176 | transmembrane protein;(source:Araport11) |
| AT4G18465 | RNA helicase family protein;(source:Araport11) |
| AT2G17300 | hypothetical protein;(source:Araport11) |
| AT3G27210 | hypothetical protein;(source:Araport11) |
| AT5G62350 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G52855 | hypothetical protein;(source:Araport11) |
| AT1G56270 | RPB1a;(source:Araport11) |
| AT3G63340 | kinase superfamily protein;(source:Araport11) |
| AT1G13460 | Encodes protein phosphatase 2A (PP2A) B'theta subunit. Targeted to peroxisomes. |
| AT5G20190 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G16170 | ephrin-A3 protein;(source:Araport11) |
| AT3G61840 | auxin response factor, putative (DUF688);(source:Araport11) |
| AT1G15825 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT2G40720 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G29690 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT5G59050 | G patch domain protein;(source:Araport11) |
| AT3G43510 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-11 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT3G13800 | Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11) |
| AT4G36032 | Natural antisense transcript overlaps with AT4G36030;(source:Araport11) |
| AT2G34585 | transmembrane protein;(source:Araport11) |
| AT1G49470 | transmembrane epididymal protein (DUF716);(source:Araport11) |
| AT3G60961 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G18860 | Syntaxin/t-SNARE family protein;(source:Araport11) |
| AT1G49170 | hypothetical protein;(source:Araport11) |
| AT1G03240 | hypothetical protein;(source:Araport11) |
| AT2G01422 | other_RNA;(source:Araport11) |
| AT5G16375 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT3G56880 | VQ motif-containing protein;(source:Araport11) |
| AT2G01818 | PLATZ transcription factor family protein;(source:Araport11) |
| AT1G15165 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT1G19010 | hypothetical protein;(source:Araport11) |
| AT2G41000 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT4G23040 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT2G40660 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT3G12510 | MADS-box family protein;(source:Araport11) |
| AT1G03940 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G10140 | Uncharacterized conserved protein UCP031279;(source:Araport11) |
| AT1G21928 | Encodes a Plant thionin family protein |
| AT4G30010 | ATP-dependent RNA helicase;(source:Araport11) |
| AT3G15220 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G57150 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G58180 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G02750 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G48670 | auxin-responsive GH3 family protein;(source:Araport11) |
| AT1G45163 | transmembrane protein;(source:Araport11) |
| AT5G05965 | cell wall RBR3-like protein;(source:Araport11) |
| AT1G27530 | ubiquitin-fold modifier-conjugating enzyme;(source:Araport11) |
| AT1G19410 | FBD / Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT4G16465 | pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10) |
| AT1G76954 | Encodes a defensin-like (DEFL) family protein. |
| AT5G45660 | adenine phosphoribosyltransferase;(source:Araport11) |
| AT4G30470 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G49930 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT1G11740 | ankyrin repeat family protein;(source:Araport11) |
| AT1G66460 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G35181 | transmembrane protein;(source:Araport11) |
| AT3G24830 | Ribosomal protein L13 family protein;(source:Araport11) |
| AT5G66600 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT2G41410 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT3G51230 | chalcone-flavanone isomerase family protein;(source:Araport11) |
| AT3G15200 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G05280 | Integral membrane Yip1 family protein;(source:Araport11) |
| AT2G21430 | Papain family cysteine protease;(source:Araport11) |
| AT5G41050 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT1G02350 | protoporphyrinogen oxidase-like protein;(source:Araport11) |
| AT5G21970 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT5G42655 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT3G54830 | Transmembrane amino acid transporter family protein; CONTAINS InterPro DOMAIN/s: Amino acid transporter, transmembrane (InterPro:IPR013057); BEST Arabidopsis thaliana protein match is: Transmembrane amino acid transporter family protein (TAIR:AT2G39130.1). Note that a different cDNA sequence has been reported (see Community Comments). |
| AT3G10030 | aspartate/glutamate/uridylate kinase family protein;(source:Araport11) |
| AT3G56408 | Natural antisense transcript overlaps with AT3G56410;(source:Araport11) |
| AT1G09390 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G03590 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT4G24380 | dihydrofolate reductase;(source:Araport11) |
| AT5G17350 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT5G42170 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT2G41830 | Uncharacterized protein;(source:Araport11) |
| AT1G59690 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G23070 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
| AT3G48790 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT3G01202 | Natural antisense transcript overlaps with AT3G01200;(source:Araport11) |
| AT4G36150 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT2G48000 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G27180 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT2G02640 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G09260 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G27440 | transmembrane protein;(source:Araport11) |
| AT2G31790 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G78070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G51650 | stress response NST1-like protein;(source:Araport11) |
| AT1G52200 | PLAC8 family protein;(source:Araport11) |
| AT5G02960 | Ribosomal protein S12/S23 family protein;(source:Araport11) |
| AT1G32730 | electron carrier/iron ion-binding protein;(source:Araport11) |
| AT3G13404 | hypothetical protein;(source:Araport11) |
| AT5G25240 | stress induced protein;(source:Araport11) |
| AT4G32340 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G23030 | MATE efflux family protein;(source:Araport11) |
| AT5G66480 | bacteriophage N4 adsorption B protein;(source:Araport11) |
| AT2G35920 | RNA helicase family protein;(source:Araport11) |
| AT5G52840 | NADH-ubiquinone oxidoreductase-like protein;(source:Araport11) |
| AT1G69000 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT1G04210 | Encodes a putative Raf-related kinase. |
| AT3G18060 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT1G02670 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G23890 | NHL domain-containing protein;(source:Araport11) |
| AT3G50550 | hypothetical protein;(source:Araport11) |
| AT4G30990 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G14460 | hypothetical protein;(source:Araport11) |
| AT3G14595 | Ribosomal protein L18ae family;(source:Araport11) |
| AT3G02460 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT3G14830 | epstein-barr nuclear antigen;(source:Araport11) |
| AT1G26795 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT4G28915 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
| AT3G46850 | Subtilase family protein;(source:Araport11) |
| AT3G06895 | syntaxin KNOLLE-like protein;(source:Araport11) |
| AT2G42960 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G16900 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT1G12440 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT3G18815 | pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10) |
| AT2G05755 | Nucleotide/sugar transporter family protein |
| AT4G01590 | DNA-directed RNA polymerase III subunit;(source:Araport11) |
| AT4G15840 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT4G12450 | zinc finger (C2H2 type) family protein;(source:Araport11) |
| AT1G44608 | hypothetical protein;(source:Araport11) |
| AT3G56250 | hypothetical protein;(source:Araport11) |
| AT5G63130 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT1G49032 | hypothetical protein;(source:Araport11) |
| AT1G79520 | Cation efflux family protein;(source:Araport11) |
| AT2G41080 | pentatricopeptide (PPR) repeat protein;(source:Araport11) |
| AT5G24390 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT3G49320 | Metal-dependent protein hydrolase;(source:Araport11) |
| AT5G51840 | junctophilin-like protein;(source:Araport11) |
| AT3G56270 | WEB family protein (DUF827);(source:Araport11) |
| AT1G48250 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G35400.1);(source:TAIR10) |
| AT2G27830 | hypothetical protein;(source:Araport11) |
| AT3G05810 | IGR motif protein;(source:Araport11) |
| AT4G14310 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G60350 | hypothetical protein;(source:Araport11) |
| AT4G28400 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT2G22890 | Kua-ubiquitin conjugating enzyme hybrid localization domain-containing protein;(source:Araport11) |
| AT3G11590 | golgin family A protein;(source:Araport11) |
| AT5G51900 | Cytochrome P450 family protein;(source:Araport11) |
| AT5G24980 | transmembrane protein;(source:Araport11) |
| AT5G51260 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT2G07010 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.9e-175 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G53830 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT1G53380 | hypothetical protein (DUF641);(source:Araport11) |
| AT2G44500 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G50690 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G01740 | Mitochondrial ribosomal protein L37;(source:Araport11) |
| AT4G39600 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G60010 | PADRE protein down-regulated after infection by S. sclerotiorun. |
| AT2G45780 | other_RNA;(source:Araport11) |
| AT1G64385 | transmembrane protein;(source:Araport11) |
| AT4G21630 | Subtilase family protein;(source:Araport11) |
| AT3G25940 | TFIIB zinc-binding protein;(source:Araport11) |
| AT4G25070 | caldesmon-like protein;(source:Araport11) |
| AT2G20835 | hypothetical protein;(source:Araport11) |
| AT3G50140 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G56080 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G57010 | calmodulin-binding family protein;(source:Araport11) |
| AT2G31730 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT2G23780 | Leucine rich extensin protein involved in cell wall biogenesis and organization. Interacts with several members of the RALF family of ligand peptides. |
| AT1G54420 | hypothetical protein;(source:Araport11) |
| AT4G17760 | PCNA domain-containing protein;(source:Araport11) |
| AT2G30600 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT2G37140 | Terpenoid synthases superfamily protein;(source:Araport11) |
| AT2G24550 | major centromere autoantigen B-like protein;(source:Araport11) |
| AT5G57610 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
| AT5G20800 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, predicted non-LTR reverse ranscriptase sequence fragments;(source:TAIR10) |
| AT2G43860 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G02230 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G48290 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G04040 | transmembrane protein;(source:Araport11) |
| AT3G52072 | Natural antisense transcript overlaps with AT3G52070;(source:Araport11) |
| AT3G06150 | cytochrome P450 family protein;(source:Araport11) |
| AT1G77480 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G69526 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G14090 | pseudogene of Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G04430 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G48980 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT5G39900 | Small GTP-binding protein;(source:Araport11) |
| AT1G07870 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G57010 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT2G33170 | Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11) |
| AT5G54145 | hypothetical protein;(source:Araport11) |
| AT4G26480 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT2G42720 | FBD, F-box, Skp2-like and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT4G38540 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT1G64130 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT5G54855 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT5G25590 | DNA ligase (DUF630 and DUF632);(source:Araport11) |
| AT4G22360 | SWIB complex BAF60b domain-containing protein;(source:Araport11) |
| AT5G07670 | RNI-like superfamily protein;(source:Araport11) |
| AT3G47210 | hypothetical protein (DUF247);(source:Araport11) |
| AT1G26490 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
| AT5G07030 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G27965 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.5e-26 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
| AT1G20770 | coiled-coil protein;(source:Araport11) |
| AT1G71695 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G12440 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT3G04640 | glycine-rich protein;(source:Araport11) |
| AT5G02540 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G47570 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G47818 | pseudogene of WPP domain interacting protein 1;(source:Araport11) |
| AT4G13120 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.6e-50 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G77400 | extensin-like protein;(source:Araport11) |
| AT5G45740 | Ubiquitin domain-containing protein;(source:Araport11) |
| AT2G38000 | chaperone protein dnaJ-like protein;(source:Araport11) |
| AT1G28590 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G54940 | Translation initiation factor SUI1 family protein;(source:Araport11) |
| AT3G07310 | phosphoserine aminotransferase, putative (DUF760);(source:Araport11) |
| AT5G59970 | Histone superfamily protein;(source:Araport11) |
| AT5G45590 | Ribosomal protein L35;(source:Araport11) |
| AT4G00893 | F-box/kelch-repeat protein;(source:Araport11) |
| AT3G50780 | BTB/POZ domain protein;(source:Araport11) |
| AT5G67390 | glycosyltransferase-like protein;(source:Araport11) |
| AT1G14890 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G05790 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT1G69420 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT4G06744 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G52280 | Myosin heavy chain-related protein;(source:Araport11) |
| AT1G25430 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 8.0e-45 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G07930 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT2G21300 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT1G75295 | Natural antisense transcript overlaps with AT1G75290 and AT1G75300;(source:Araport11) |
| AT5G41770 | crooked neck protein, putative / cell cycle protein;(source:Araport11) |
| AT1G71530 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G04610 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G25200 | hypothetical protein (DUF868);(source:Araport11) |
| AT2G22600 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT5G52010 | C2H2-like zinc finger protein;(source:Araport11) |
| AT5G56190 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G19780 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT4G22212 | Encodes a defensin-like (DEFL) family protein. |
| AT1G12650 | rRNA biogenesis RRP36-like protein;(source:Araport11) |
| AT5G23330 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
| AT5G66590 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT3G60805 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT2G46290 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G39240 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
| AT1G73885 | AT-rich interactive domain protein;(source:Araport11) |
| AT5G38290 | Peptidyl-tRNA hydrolase family protein;(source:Araport11) |
| AT2G38890 | hypothetical protein;(source:Araport11) |
| AT3G15110 | transmembrane protein;(source:Araport11) |
| AT4G14530 | agamous-like MADS-box protein;(source:Araport11) |
| AT4G29103 | transmembrane protein;(source:Araport11) |
| AT4G03490 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G72410 | COP1-interacting protein-like protein;(source:Araport11) |
| AT1G49030 | PLAC8 family protein;(source:Araport11) |
| AT2G24545 | Natural antisense transcript overlaps with AT2G24540;(source:Araport11) |
| AT5G06990 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT5G19230 | Glycoprotein membrane precursor GPI-anchored;(source:Araport11) |
| AT5G44450 | alpha amino-terminal protein methyltransferase;(source:Araport11) |
| AT3G03930 | kinase-like protein;(source:Araport11) |
| AT1G22970 | cyclin-D1-binding protein;(source:Araport11) |
| AT5G59020 | hepatocyte growth factor activator, putative (DUF3527);(source:Araport11) |
| AT5G22310 | trichohyalin-like protein;(source:Araport11) |
| AT4G00090 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G41640 | Glycosyltransferase family 61 protein;(source:Araport11) |
| AT1G63850 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT3G01311 | actin cross-linking protein, putative (DUF569);(source:Araport11) |
| AT5G47510 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G07550 | RNI-like superfamily protein;(source:Araport11) |
| AT3G27090 | DCD (Development and Cell Death) domain protein;(source:Araport11) |
| AT1G64590 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G21805 | snoRNA;(source:Araport11) |
| AT4G39780 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT3G52330 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT5G19150 | AT5G19150 is a dehydratase that converts (S)-NAD(P)HX to NAD(P)H. |
| AT1G61170 | hypothetical protein;(source:Araport11) |
| AT1G10150 | Carbohydrate-binding protein;(source:Araport11) |
| AT5G43460 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
| AT1G01210 | DNA-directed RNA polymerase, subunit M, archaeal;(source:Araport11) |
| AT5G41850 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G09580 | heat shock protein;(source:Araport11) |
| AT5G09655 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT2G43890 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G11810 | rhomboid family protein;(source:Araport11) |
| AT3G19360 | Zinc finger (CCCH-type) family protein;(source:Araport11) |
| AT1G70900 | hypothetical protein;(source:Araport11) |
| AT1G33250 | beta-1,3-n-acetylglucosaminyltransferase radical fringe protein, putative (DUF604);(source:Araport11) |
| AT1G15180 | MATE efflux family protein;(source:Araport11) |
| AT4G27415 | hypothetical protein;(source:Araport11) |
| AT2G36440 | hypothetical protein;(source:Araport11) |
| AT2G40560 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G48200 | hypothetical protein;(source:Araport11) |
| AT5G54585 | hypothetical protein;(source:Araport11) |
| AT3G19390 | Granulin repeat cysteine protease family protein;(source:Araport11) |
| AT4G32080 | hypothetical protein;(source:Araport11) |
| AT5G52815 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
| AT2G23755 | transmembrane family 220 helix protein;(source:Araport11) |
| AT2G39870 | hypothetical protein;(source:Araport11) |
| AT4G28260 | acyl-UDP-N-acetylglucosamine O-acyltransferase;(source:Araport11) |
| AT3G49550 | hypothetical protein;(source:Araport11) |
| AT5G60580 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G77290 | Glutathione S-transferase family protein;(source:Araport11) |
| AT2G34350 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
| AT2G25169 | transmembrane protein;(source:Araport11) |
| AT4G33170 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G33847 | hypothetical protein;(source:Araport11) |
| AT5G64850 | sorbin/SH3 domain protein;(source:Araport11) |
| AT3G14560 | Its transcript is targeted by miR824. |
| AT2G03370 | O-linked-mannose beta-1,4-N-acetylglucosaminyltransferase-like protein;(source:Araport11) |
| AT4G24100 | Protein kinase superfamily protein |
| AT1G15840 | hypothetical protein;(source:Araport11) |
| AT2G44400 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G09965 | hypothetical protein;(source:Araport11) |
| AT4G19670 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G17140 | pleckstrin homology (PH) domain-containing protein;(source:Araport11) |
| AT2G39270 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G48710 | DEK domain-containing chromatin associated protein;(source:Araport11) |
| AT3G51642 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G49138 | Natural antisense transcript overlaps with AT5G49130;(source:Araport11) |
| AT2G16340 | hypothetical protein;(source:Araport11) |
| AT3G49970 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT2G01220 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
| AT5G22930 | enabled-like protein (DUF1635);(source:Araport11) |
| AT3G04930 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT3G13403 | Encodes a defensin-like (DEFL) family protein. |
| AT1G22600 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT5G65380 | MATE efflux family protein;(source:Araport11) |
| AT1G03510 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G26780 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G17098 | Natural antisense transcript overlaps with AT4G17100;(source:Araport11) |
| AT1G10850 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G13100 | Gap junction beta-4 protein;(source:Araport11) |
| AT4G21926 | hypothetical protein;(source:Araport11) |
| AT4G23730 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT1G70590 | F-box family protein;(source:Araport11) |
| AT4G37620 | transposable_element_gene;(source:Araport11);similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT4G09490.1);(source:TAIR10) |
| AT4G35320 | hypothetical protein;(source:Araport11) |
| AT2G15830 | hypothetical protein;(source:Araport11) |
| AT1G66830 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G05937 | hypothetical protein;(source:Araport11) |
| AT3G11420 | beta-1,3-N-acetylglucosaminyltransferase lunatic protein, putative (DUF604);(source:Araport11) |
| AT1G05562 | Natural antisense transcript overlaps with AT1G05560;(source:Araport11) |
| AT1G26950 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT5G33360.1);(source:TAIR10) |
| AT3G54120 | Reticulon family protein;(source:Araport11) |
| AT3G51360 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G67300 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G29880 | glycyl-tRNA synthetase / glycine-tRNA ligase;(source:Araport11) |
| AT4G35030 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G40820 | stomatal closure actin-binding-like protein;(source:Araport11) |
| AT2G34190 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT1G78840 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G52470 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT3G24542 | Beta-galactosidase related protein;(source:Araport11) |
| AT2G28140 | enabled-like protein (DUF1635);(source:Araport11) |
| AT2G17020 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G35612 | pseudogene of Ulp1 protease family protein |
| AT1G33470 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G03560 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT4G14380 | cotton fiber protein;(source:Araport11) |
| AT4G21437 | unknown pseudogene |
| AT1G14460 | AAA-type ATPase family protein;(source:Araport11) |
| AT4G29700 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT2G03350 | DUF538 family protein (Protein of unknown function, DUF538);(source:Araport11) |
| AT2G24990 | Serine/threonine-protein kinase Rio1;(source:Araport11) |
| AT5G12120 | Ubiquitin-associated/translation elongation factor EF1B protein;(source:Araport11) |
| AT3G29000 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT3G23910 | reverse transcriptase-like protein;(source:Araport11) |
| AT1G28685 | Natural antisense transcript overlaps with AT1G28680;(source:Araport11) |
| AT1G28395 | hypothetical protein;(source:Araport11) |
| AT4G25770 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G60930 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G57700 | BNR/Asp-box repeat family protein;(source:Araport11) |
| AT1G15730 | Cobalamin biosynthesis CobW-like protein;(source:Araport11) |
| AT3G53100 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G22390 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT5G46770 | hypothetical protein;(source:Araport11) |
| AT5G11680 | classical AGP protein;(source:Araport11) |
| AT1G15170 | MATE efflux family protein;(source:Araport11) |
| AT5G66500 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G62914 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT2G17705 | methionine-S-oxide reductase;(source:Araport11) |
| AT1G61260 | cotton fiber (DUF761);(source:Araport11) |
| AT1G50890 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G01860 | hypothetical protein;(source:Araport11) |
| AT5G40645 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
| AT2G36860 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT2G26520 | transmembrane protein;(source:Araport11) |
| AT1G63400 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G30600 | Subtilase family protein;(source:Araport11) |
| AT5G65205 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G03280 | Transcription factor TFIIE, alpha subunit;(source:Araport11) |
| AT5G44010 | fanconi anemia group F protein (FANCF);(source:Araport11) |
| AT5G12060 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G46195 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 8.8e-38 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G05160 | CCCH-type zinc fingerfamily protein with RNA-binding domain-containing protein;(source:Araport11) |
| AT3G24070 | Zinc knuckle (CCHC-type) family protein;(source:Araport11) |
| AT2G43220 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G47260 | putative disease resistance protein;(source:Araport11) |
| AT1G21930 | transmembrane protein;(source:Araport11) |
| AT5G07800 | Flavin-binding monooxygenase family protein;(source:Araport11) |
| AT2G15695 | peptide methionine sulfoxide reductase (Protein of unknown function DUF829, transmembrane 53);(source:Araport11) |
| AT3G18310 | TATA box-binding protein associated factor RNA polymerase I subunit C;(source:Araport11) |
| AT5G06280 | hypothetical protein;(source:Araport11) |
| AT5G38550 | Jacalin lectin family protein gene |
| AT1G72820 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT1G71015 | PADRE protein. |
| AT5G18245 | Natural antisense transcript overlaps with AT5G18240;(source:Araport11) |
| AT1G54110 | Membrane fusion protein Use1;(source:Araport11) |
| AT5G33300 | chromosome-associated kinesin-like protein;(source:Araport11) |
| AT1G63380 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G12470 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT4G38932 | Natural antisense transcript overlaps with AT4G38930;(source:Araport11) |
| AT1G03440 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT2G01275 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT3G60200 | hypothetical protein;(source:Araport11) |
| AT3G47610 | transcription regulator/ zinc ion binding protein;(source:Araport11) |
| AT5G15940 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G08480 | VQ motif-containing protein;(source:Araport11) |
| AT1G76070 | hypothetical protein;(source:Araport11) |
| AT5G59400 | PGR5-like A protein;(source:Araport11) |
| AT2G05810 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G55680 | glycine-rich protein;(source:Araport11) |
| AT4G10010 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G30282 | Natural antisense transcript overlaps with AT1G30280;(source:Araport11) |
| AT1G29580 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
| AT4G34920 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT5G64880 | transmembrane protein;(source:Araport11) |
| AT1G29240 | transcription initiation factor TFIID subunit, putative (DUF688);(source:Araport11) |
| AT5G47455 | hypothetical protein;(source:Araport11) |
| AT1G76580 | Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein;(source:Araport11) |
| AT3G49115 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G05670 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT4G21910 | MATE efflux family protein;(source:Araport11) |
| AT1G24640 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-37 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G61829 | transmembrane protein;(source:Araport11) |
| AT5G35735 | Auxin-responsive family protein;(source:Araport11) |
| AT4G20250 | hypothetical protein;(source:Araport11) |
| AT1G33230 | TMPIT-like protein;(source:Araport11) |
| AT3G16680 | DNA binding / DNA-directed RNA polymerase;(source:Araport11) |
| AT1G61795 | PAK-box/P21-Rho-binding family protein;(source:Araport11) |
| AT5G66310 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT4G03405 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
| AT4G33910 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G12880 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G11280 | tail fiber;(source:Araport11) |
| AT3G46880 | hypothetical protein;(source:Araport11) |
| AT3G62160 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT4G22350 | Ubiquitin C-terminal hydrolases superfamily protein;(source:Araport11) |
| AT1G01710 | acyl-CoA thioesterase II;(source:Araport11) |
| AT1G78865 | other_RNA;(source:Araport11) |
| AT4G14345 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT5G05435 | Natural antisense transcript overlaps with AT5G05430;(source:Araport11) |
| AT1G35614 | hypothetical protein;(source:Araport11) |
| AT1G07485 | hypothetical protein;(source:Araport11) |
| AT5G02330 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G02970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G14910 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G63135 | transcription termination factor;(source:Araport11) |
| AT2G15630 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G23321 | hypothetical protein;(source:Araport11) |
| AT1G14930 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT4G21620 | glycine-rich protein;(source:Araport11) |
| AT4G36140 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT5G42740 | Sugar isomerase (SIS) family protein;(source:Araport11) |
| AT1G28570 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT4G02200 | Drought-responsive family protein;(source:Araport11) |
| AT1G77790 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT5G41140 | Myosin heavy chain-related protein;(source:Araport11) |
| AT1G78170 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT5G60070 | ankyrin repeat family protein;(source:Araport11) |
| AT2G35945 | Natural antisense transcript overlaps with AT2G35940;(source:Araport11) |
| AT2G19825 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G42232 | Encodes a defensin-like (DEFL) family protein. |
| AT1G11010 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT3G49070 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT1G53760 | K+-H+ exchange-like protein;(source:Araport11) |
| AT4G36120 | filament-like protein (DUF869);(source:Araport11) |
| AT2G43340 | hypothetical protein (DUF1685);(source:Araport11) |
| AT3G57450 | hypothetical protein;(source:Araport11) |
| AT4G32390 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT2G39855 | plant/protein;(source:Araport11) |
| AT1G48698 | Potential natural antisense gene, locus overlaps with AT1G48700 |
| AT4G03100 | Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11) |
| AT1G68580 | Agenet and bromo-adjacent homology (BAH) domain-containing protein;(source:Araport11) |
| AT5G66455 | pseudogene of pentatricopeptide (PPR) repeat-containing protein |
| AT3G02065 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G45120 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G10490 | GNAT acetyltransferase (DUF699);(source:Araport11) |
| AT2G36410 | transcriptional activator (DUF662);(source:Araport11) |
| AT3G15536 | Unknown gene The mRNA is cell-to-cell mobile. |
| AT4G21780 | hypothetical protein;(source:Araport11) |
| AT5G53960 | Mid-1-related chloride channel domain-containing protein;(source:Araport11) |
| AT3G59300 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G14410 | Nucleotide/sugar transporter family protein |
| AT4G27875 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
| AT2G40980 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G05990 | Mitochondrial glycoprotein family protein;(source:Araport11) |
| AT3G28216 | hypothetical protein;(source:Araport11) |
| AT4G28180 | hypothetical protein;(source:Araport11) |
| AT3G02910 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT5G66780 | late embryogenesis abundant protein;(source:Araport11) |
| AT1G78890 | hypothetical protein;(source:Araport11) |
| AT1G70100 | neurofilament heavy protein;(source:Araport11) |
| AT1G22830 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G75230 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT5G43450 | encodes a protein whose sequence is similar to ACC oxidase |
| AT5G23390 | polygalacturonase inhibitor (DUF639);(source:Araport11) |
| AT1G12760 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
| AT2G47380 | Cytochrome c oxidase subunit Vc family protein;(source:Araport11) |
| AT2G17787 | cylicin;(source:Araport11) |
| AT2G41890 | curculin-like (mannose-binding) lectin family protein / PAN domain-containing protein;(source:Araport11) |
| AT5G09445 | hypothetical protein;(source:Araport11) |
| AT5G62400 | transmembrane protein;(source:Araport11) |
| AT5G11620 | SWIM zinc finger family protein / mitogen-activated protein kinase kinase kinase (MAPKKK)-like protein;(source:Araport11) |
| AT4G02540 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G39404 | other_RNA;(source:Araport11) |
| AT5G19120 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G26742 | hypothetical protein;(source:Araport11) |
| AT1G15405 | other_RNA;(source:Araport11) |
| AT3G06437 | pseudogene of hypothetical protein;(source:Araport11) |
| AT4G11350 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT4G36230 | transmembrane protein;(source:Araport11) |
| AT5G49640 | hypothetical protein;(source:Araport11) |
| AT1G07040 | plant/protein;(source:Araport11) |
| AT2G25190 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
| AT1G30860 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G25720 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT5G07215 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.9e-34 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G26560 | ATP-dependent RNA helicase;(source:Araport11) |
| AT2G19650 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G20030 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT1G53370 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G57650 | eukaryotic translation initiation factor-like protein;(source:Araport11) |
| AT4G22380 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
| AT5G47620 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT4G16140 | proline-rich family protein;(source:Araport11) |
| AT5G37010 | rho GTPase-activating protein;(source:Araport11) |
| AT3G13510 | carboxyl-terminal peptidase, putative (DUF239);(source:Araport11) |
| AT5G43910 | pfkB-like carbohydrate kinase family protein;(source:Araport11) |
| AT5G07090 | Ribosomal protein S4 (RPS4A) family protein;(source:Araport11) |
| AT4G00905 | NC domain-containing protein-like protein;(source:Araport11) |
| AT3G18050 | GPI-anchored protein;(source:Araport11) |
| AT3G22421 | F-box/associated interaction domain protein;(source:Araport11) |
| AT4G37850 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G03810 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT1G26270 | Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11) |
| AT5G05200 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G54130 | Calcium-binding endonuclease/exonuclease/phosphatase family;(source:Araport11) |
| AT2G34760 | pseudogene of tubulin beta-9 chain;(source:Araport11) |
| AT5G65305 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT3G46700 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G03240 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT5G65207 | hypothetical protein;(source:Araport11) |
| AT5G44020 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT5G24820 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G20810 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT4G13580 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT3G51350 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G13433 | transmembrane protein;(source:Araport11) |
| AT1G01540 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G45660 | Encodes a member of the NAXT NPF subfamily. |
| AT1G61890 | MATE efflux family protein;(source:Araport11) |
| AT1G63300 | Myosin heavy chain-related protein;(source:Araport11) |
| AT5G66631 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G57220 | Glycosyl transferase family 4 protein;(source:Araport11) |
| AT5G66330 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G51530 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G14688 | E3 ubiquitin ligase;(source:Araport11) |
| AT1G07135 | glycine-rich protein;(source:Araport11) |
| AT4G24050 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G44230 | hypothetical protein (DUF946);(source:Araport11) |
| AT3G05905 | Natural antisense transcript overlaps with AT3G05900;(source:Araport11) |
| AT2G35820 | ureidoglycolate hydrolase;(source:Araport11) |
| AT1G09170 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
| AT4G06534 | transmembrane protein;(source:Araport11) |
| AT1G35830 | VQ motif-containing protein;(source:Araport11) |
| AT3G45256 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
| AT1G11210 | cotton fiber protein, putative (DUF761);(source:Araport11) |
| AT2G24390 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT3G15350 | G14 enzyme |
| AT1G69550 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT4G15240 | glycosyltransferase (DUF604);(source:Araport11) |
| AT3G56670 | F-box/associated interaction domain protein;(source:Araport11) |
| AT4G14420 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
| AT4G26380 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G49200 | WD-40 repeat family protein / zfwd4 protein (ZFWD4);(source:Araport11) |
| AT5G14730 | Unknown protein, expression induced by IDL7 and stress. |
| AT5G37790 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G14360 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G61370 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G24090 | homer protein;(source:Araport11) |
| AT5G45470 | transmembrane protein, putative (DUF594);(source:Araport11) |
| AT1G20875 | hypothetical protein;(source:Araport11) |
| AT1G20500 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G30814 | hypothetical protein;(source:Araport11) |
| AT1G23040 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G02030 | C2H2-like zinc finger protein;(source:Araport11) |
| AT5G55856 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT3G02070 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G10095 | Protein prenylyltransferase superfamily protein;(source:Araport11) |
| AT4G12731 | hypothetical protein;(source:Araport11) |
| AT5G15780 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT3G23510 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
| AT1G75170 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G04020 | hypothetical protein;(source:Araport11) |
| AT5G24320 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G37930 | hypothetical protein (DUF3527);(source:Araport11) |
| AT1G54320 | LEM3 (ligand-effect modulator 3) family protein / CDC50 family protein;(source:Araport11) |
| AT5G64110 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G30500 | transmembrane protein (DUF788);(source:Araport11) |
| AT1G73090 | WD repeat protein;(source:Araport11) |
| AT1G05450 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT4G32420 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT5G10750 | enhanced disease resistance-like protein (DUF1336);(source:Araport11) |
| AT1G49520 | SWIB complex BAF60b domain-containing protein;(source:Araport11) |
| AT3G63445 | Natural antisense transcript overlaps with AT3G63440;(source:Araport11) |
| AT1G04500 | CCT motif family protein;(source:Araport11) |
| AT5G56100 | glycine-rich protein / oleosin;(source:Araport11) |
| AT5G16486 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT3G18020 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G57830 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G14760 | transmembrane protein;(source:Araport11) |
| AT3G04010 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G14080 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G69430 | Son of sevenless protein;(source:Araport11) |
| AT3G13674 | hypothetical protein;(source:Araport11) |
| AT3G13340 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G63390 | flavin containing monooxygenase FMO GS-OX-like protein;(source:Araport11) |
| AT5G56880 | hypothetical protein;(source:Araport11) |
| AT4G01410 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G70209 | hypothetical protein;(source:Araport11) |
| AT2G29620 | dentin sialophosphoprotein;(source:Araport11) |
| AT1G04490 | hypothetical protein (DUF3527);(source:Araport11) |
| AT3G60164 | Pseudogene of AT3G60966; protein binding / zinc ion binding |
| AT4G36010 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT1G10720 | BSD domain-containing protein;(source:Araport11) |
| AT2G34930 | disease resistance family protein / LRR family protein;(source:Araport11) |
| AT5G58790 | hypothetical protein;(source:Araport11) |
| AT4G28068 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT2G47480 | DUF3511 domain protein, putative (DUF3511);(source:Araport11) |
| AT2G15950 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT1G12510 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT3G56200 | Encodes a putative amino acid transporter. The mRNA is cell-to-cell mobile. |
| AT3G05160 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G40640 | transmembrane protein;(source:Araport11) |
| AT1G70949 | hypothetical protein;(source:Araport11) |
| AT1G70885 | pseudogene of MLP-like protein 31;(source:Araport11) |
| AT2G27520 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G06410 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT2G25250 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT2G44710 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G63420 | O-glucosyltransferase-like protein (DUF821);(source:Araport11) |
| AT1G63870 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G54830 | DOMON domain-containing protein / dopamine beta-monooxygenase N-terminal domain-containing protein;(source:Araport11) |
| AT1G06475 | transmembrane protein;(source:Araport11) |
| AT3G52800 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT1G50000 | methyltransferase;(source:Araport11) |
| AT3G15520 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT5G03495 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G22790 | hypothetical protein;(source:Araport11) |
| AT4G02725 | spindle pole body-associated protein;(source:Araport11) |
| AT1G22110 | structural constituent of ribosome;(source:Araport11) |
| AT3G26750 | HECT-like ubiquitin-conjugating enzyme (E2)-binding protein;(source:Araport11) |
| AT4G23860 | PHD finger protein-like protein;(source:Araport11) |
| AT5G19190 | hypothetical protein;(source:Araport11) |
| AT1G76185 | NADH-ubiquinone oxidoreductase chain;(source:Araport11) |
| AT5G61820 | stress up-regulated Nod 19 protein;(source:Araport11) |
| AT4G17450 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-306 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G13560 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT2G37440 | DNAse I-like superfamily protein;(source:Araport11) |
| AT1G51380 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT3G49510 | F-box family protein;(source:Araport11) |
| AT4G27870 | Vacuolar iron transporter (VIT) family protein;(source:Araport11) |
| AT5G65660 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G73970 | obscurin-like protein;(source:Araport11) |
| AT5G56380 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G26270 | transmembrane protein;(source:Araport11) |
| AT5G55780 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G41800 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT3G42580 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT2G12100.1);(source:TAIR10) |
| AT3G15470 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G06630 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G17020 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT1G22960 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G48340 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G42970 | pre-tRNA tRNA-Arg (anticodon: ACG);(source:Araport11, TAIR10) |
| AT2G20830 | folic acid binding / transferase;(source:Araport11) |
| AT3G13700 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT4G05030 | Copper transport protein family;(source:Araport11) |
| AT3G46450 | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein;(source:Araport11) |
| AT4G33180 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G57860 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G56420 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G12010 | C18orf8;(source:Araport11) |
| AT2G45990 | ribosomal RNA small subunit methyltransferase G;(source:Araport11) |
| AT1G53080 | Legume lectin family protein;(source:Araport11) |
| AT1G68620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G61540 | N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein;(source:Araport11) |
| AT3G51440 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT1G35510 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G23050 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT2G39710 | Encodes a Cysteine-rich peptide (CRP) family protein |
| AT1G79720 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G17770 | Dihydroxyacetone kinase;(source:Araport11) |
| AT4G38290 | hemolysin-III related integral membrane protein;(source:Araport11) |
| AT2G35250 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT5G03285 | other_RNA;(source:Araport11) |
| AT4G27620 | intracellular protein transporter;(source:Araport11) |
| AT1G02110 | bZIP domain class transcription factor (DUF630 and DUF632);(source:Araport11) |
| AT2G18876 | Encodes a microtubule-associated protein. |
| AT1G61740 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT4G17670 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT5G25020 | enhanced disease resistance-like protein (DUF1336);(source:Araport11) |
| AT2G30060 | Pleckstrin homology (PH) domain superfamily protein;(source:Araport11) |
| AT2G38330 | MATE efflux family protein;(source:Araport11) |
| AT1G53340 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G63940 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT2G27630 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT1G11670 | MATE efflux family protein;(source:Araport11) |
| AT5G42092 | Natural antisense transcript overlaps with AT5G42090;(source:Araport11) |
| AT2G15960 | Unknown protein. Expression decreased in response to proline. |
| AT4G02005 | None;(source:Araport11) |
| AT1G10410 | CW14 protein (DUF1336);(source:Araport11) |
| AT5G04860 | splicing factor 3A subunit;(source:Araport11) |
| AT3G01516 | transmembrane protein;(source:Araport11) |
| AT1G21990 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G02435 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT2G41200 | transmembrane protein;(source:Araport11) |
| AT1G22750 | transmembrane protein;(source:Araport11) |
| AT1G05675 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G76220 | hypothetical protein (DUF241);(source:Araport11) |
| AT2G37540 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G49170 | hypothetical protein;(source:Araport11) |
| AT5G03250 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT1G31460 | vitellogenin-2 protein;(source:Araport11) |
| AT4G14315 | transmembrane protein;(source:Araport11) |
| AT5G41870 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G38710 | AMMECR1 family;(source:Araport11) |
| AT1G14390 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G20230 | Tetraspanin family protein;(source:Araport11) |
| AT1G78265 | Natural antisense transcript overlaps with AT1G78270;(source:Araport11) |
| AT4G23720 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT1G11170 | lysine ketoglutarate reductase trans-splicing-like protein (DUF707);(source:Araport11) |
| AT3G51950 | Contains single CCCH domain. |
| AT1G66500 | Pre-mRNA cleavage complex II;(source:Araport11) |
| AT5G42660 | DNA-directed RNA polymerase subunit beta (DUF616);(source:Araport11) |
| AT3G57460 | catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding protein;(source:Araport11) |
| AT1G71528 | Natural antisense transcript overlaps with AT1G71530;(source:Araport11) |
| AT5G25205 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.0e-33 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G79020 | Enhancer of polycomb-like transcription factor protein;(source:Araport11) |
| AT3G13435 | transmembrane protein;(source:Araport11) |
| AT2G42290 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G45590 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G48030 | DNAse I-like superfamily protein;(source:Araport11) |
| AT3G06870 | proline-rich family protein;(source:Araport11) |
| AT2G46600 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT3G54880 | zinc finger protein;(source:Araport11) |
| AT2G22795 | hypothetical protein;(source:Araport11) |
| AT4G38930 | Ubiquitin fusion degradation UFD1 family protein;(source:Araport11) |
| AT4G15765 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT1G06240 | diiron containing four-helix bundle family ferritin protein, putative (Protein of unknown function DUF455);(source:Araport11) |
| AT1G79640 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G73770 | coiled-coil protein;(source:Araport11) |
| AT3G26730 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G18375 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT2G32140 | transmembrane receptor;(source:Araport11) |
| AT1G58010 | pseudogene of R-protein L3 B;(source:Araport11) |
| AT2G38820 | DNA-directed RNA polymerase subunit beta-beta protein, putative (DUF506);(source:Araport11) |
| AT5G16250 | transmembrane protein;(source:Araport11) |
| AT3G01450 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G15880 | golgin family A protein;(source:Araport11) |
| AT2G44735 | transmembrane protein;(source:Araport11) |
| AT5G61445 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT4G31890 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G25690 | DUF581 family protein, putative (DUF581);(source:Araport11) |
| AT2G47020 | Peptide chain release factor 1;(source:Araport11) |
| AT2G30710 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT1G05135 | Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167. |
| AT1G61200 | homeobox-leucine zipper protein-like protein;(source:Araport11) |
| AT3G62400 | cytochrome C oxidase subunit;(source:Araport11) |
| AT3G10770 | Single-stranded nucleic acid binding R3H protein;(source:Araport11) |
| AT5G05430 | RNA-binding protein;(source:Araport11) |
| AT3G48240 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT1G10740 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G01715 | pseudogene of RNI-like superfamily protein;(source:Araport11) |
| AT5G65120 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
| AT3G52285 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
| AT5G54970 | hypothetical protein;(source:Araport11) |
| AT1G65070 | DNA mismatch repair protein MutS, type 2;(source:Araport11) |
| AT4G40065 | other_RNA;(source:Araport11) |
| AT1G21670 | DPP6 amino-terminal domain protein;(source:Araport11) |
| AT4G01090 | Hypothetical protein; participates in wound-induced lateral root development. |
| AT5G25040 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G54240 | membrane lipoprotein lipid attachment site-like protein, putative (DUF1223);(source:Araport11) |
| AT5G27260 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
| AT4G30800 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT3G49330 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G44280 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G21930 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT3G62570 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G55880 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
| AT1G20300 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G04520 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT5G16090 | RAD23 UV excision repair family protein;(source:Araport11) |
| AT1G12320 | ankyrin repeat/KH domain protein (DUF1442);(source:Araport11) |
| AT1G08985 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G16235 | Natural antisense transcript overlaps with AT5G16230;(source:Araport11) |
| AT1G11020 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT3G05770 | hypothetical protein;(source:Araport11) |
| AT3G46540 | ENTH/VHS family protein;(source:Araport11) |
| AT2G31981 | hypothetical protein;(source:Araport11) |
| AT5G54860 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G56165 | Natural antisense transcript overlaps with AT1G56160;(source:Araport11) |
| AT5G65840 | Thioredoxin superfamily protein;(source:Araport11) |
| AT3G26720 | Glycosyl hydrolase family 38 protein;(source:Araport11) |
| AT5G67220 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
| AT3G54080 | Concanavalin A-like lectin family protein;(source:Araport11) |
| AT1G66900 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G30380 | Encodes a Plant Natriuretic Peptide (PNP). PNPs are a class of systemically mobile molecules distantly related to expansins; their biological role has remained elusive. |
| AT3G03280 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT5G66420 | TIM-barrel signal transduction protein;(source:Araport11) |
| AT1G21540 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G11800 | endonuclease/exonuclease/phosphatase family protein;(source:Araport11) |
| AT2G44525 | NADH dehydrogenase ubiquinone 1 alpha subcomplex assembly factor-like protein (DUF498/DUF598);(source:Araport11) |
| AT3G49980 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G16460 | zinc finger CCCH domain protein;(source:Araport11) |
| AT1G11440 | hypothetical protein;(source:Araport11) |
| AT3G15550 | trichohyalin;(source:Araport11) |
| AT1G01840 | AP2-like ethylene-responsive transcription factor SNZ;(source:Araport11) |
| AT5G20165 | kish-A-like protein;(source:Araport11) |
| AT5G67488 | Natural antisense transcript overlaps with AT5G67490;(source:Araport11) |
| AT4G00755 | F-box family protein;(source:Araport11) |
| AT3G51400 | hypothetical protein (DUF241);(source:Araport11) |
| AT3G50120 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT1G72090 | Methylthiotransferase;(source:Araport11) |
| AT1G78040 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT1G29640 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT1G15630 | transmembrane protein;(source:Araport11) |
| AT3G27997 | pseudogene of expressed protein;(source:Araport11) |
| AT2G18721 | hypothetical protein;(source:Araport11) |
| AT4G37570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G52410.1);(source:TAIR10) |
| AT5G19250 | Glycoprotein membrane precursor GPI-anchored;(source:Araport11) |
| AT3G28040 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT4G23515 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT1G12211 | hypothetical protein;(source:Araport11) |
| AT3G03272 | Encodes a ECA1 gametogenesis related family protein |
| AT1G73210 | hypothetical protein (DUF789);(source:Araport11) |
| AT4G03113 | transmembrane protein;(source:Araport11) |
| AT2G34730 | myosin heavy chain-like protein;(source:Araport11) |
| AT2G20940 | transmembrane protein, putative (DUF1279);(source:Araport11) |
| AT1G79120 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT3G52480 | transmembrane protein;(source:Araport11) |
| AT5G47250 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
| AT3G07000 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G03250 | R3H domain protein involved in ribosome biogenesis. |
| AT2G45040 | Matrixin family protein;(source:Araport11) |
| AT1G27480 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G35810 | 2-oxoglutarate-dependent dioxygenase |
| AT3G50190 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT4G39790 | bZIP transcription factor, putative (DUF630 and DUF632);(source:Araport11) |
| AT1G49580 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
| AT1G48430 | Dihydroxyacetone kinase;(source:Araport11) |
| AT2G34123 | Encodes a defensin-like (DEFL) family protein. |
| AT1G77520 | O-methyltransferase family protein;(source:Araport11) |
| AT2G46735 | death domain associated protein;(source:Araport11) |
| AT2G33690 | Late embryogenesis abundant protein, group 6;(source:Araport11) |
| AT3G28865 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.8e-16 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G56520 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT1G67480 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G19460 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G69400 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G18630 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G50910 | netrin receptor DCC;(source:Araport11) |
| AT2G29660 | zinc finger (C2H2 type) family protein;(source:Araport11) |
| AT5G63990 | Inositol monophosphatase family protein;(source:Araport11) |
| AT1G23710 | hypothetical protein (DUF1645);(source:Araport11) |
| AT1G30800 | Fasciclin-like arabinogalactan family protein;(source:Araport11) |
| AT1G72620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G62420 | DUF506 family protein (DUF506);(source:Araport11) |
| AT5G08250 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT2G18320 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G22540 | hypothetical protein (DUF1677);(source:Araport11) |
| AT5G46890 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT5G03620 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT5G61050 | histone deacetylase-related / HD-like protein;(source:Araport11) |
| AT2G46150 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT2G19180 | hypothetical protein;(source:Araport11) |
| AT3G60310 | acyl-CoA synthetase family protein;(source:Araport11) |
| AT3G11720 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT5G12043 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G59130 | Subtilase family protein;(source:Araport11) |
| AT5G02690 | hypothetical protein;(source:Araport11) |
| AT3G03170 | hypothetical protein;(source:Araport11) |
| AT1G11803 | pseudogene of (SAUR) auxin-responsive family protein |
| AT5G23360 | GRAM domain-containing protein / ABA-responsive protein-like protein;(source:Araport11) |
| AT5G05240 | cation-transporting ATPase;(source:Araport11) |
| AT3G12835 | hypothetical protein;(source:Araport11) |
| AT1G19540 | NmrA-like negative transcriptional regulator family protein;(source:Araport11) |
| AT4G01330 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G44065 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G21745 | PAK-box/P21-Rho-binding family protein;(source:Araport11) |
| AT5G64430 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT3G28193 | transmembrane protein;(source:Araport11) |
| AT3G50825 | snoRNA;(source:Araport11) |
| AT5G03360 | cysteine/histidine-rich C1 domain protein;(source:Araport11) |
| AT1G25400 | transmembrane protein;(source:Araport11) |
| AT3G22436 | hypothetical protein;(source:Araport11) |
| AT1G20515 | Natural antisense transcript overlaps with AT1G20520;(source:Araport11) |
| AT3G22104 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT2G47830 | Cation efflux family protein;(source:Araport11) |
| AT1G55410 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G35810 | ureidoglycolate hydrolase;(source:Araport11) |
| AT1G52510 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G19380 | Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11) |
| AT1G06470 | Nucleotide/sugar transporter family protein;(source:Araport11) |
| AT5G66050 | Wound-responsive family protein;(source:Araport11) |
| AT3G15534 | hypothetical protein;(source:Araport11) |
| AT2G31010 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G32290 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G10050 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
| AT3G11415 | other_RNA;(source:Araport11) |
| AT2G01667 | hypothetical protein;(source:Araport11) |
| AT3G61750 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11) |
| AT3G46720 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G26940 | Galactosyltransferase family protein;(source:Araport11) |
| AT5G08690 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. The mRNA is cell-to-cell mobile. |
| AT2G20250 | hypothetical protein;(source:Araport11) |
| AT3G44700 | transmembrane protein;(source:Araport11) |
| AT2G16870 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G62050 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G20310 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT2G19850 | transcription repressor;(source:Araport11) |
| AT1G32920 | hypothetical protein;(source:Araport11) |
| AT1G13230 | Encodes a leucine-rich repeat protein pii-2. Located in the endoplasmic reticulum/plasma membrane continuum in Arabidopsis roots. Required for growth promotion and enhanced seed production mediated by the endophytic fungus Piriformospora indica in Arabidopsis. |
| AT2G21500 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G08200 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
| AT2G40480 | WEB family protein (DUF827);(source:Araport11) |
| AT5G22050 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G18370 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT1G15830 | hypothetical protein;(source:Araport11) |
| AT1G32928 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
| AT2G40680 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G52065.1);(source:TAIR10) |
| AT1G15810 | S15/NS1, RNA-binding protein;(source:Araport11) |
| AT1G13195 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G79060 | TPRXL;(source:Araport11) |
| AT5G35180 | ENHANCED DISEASE RESISTANCE protein (DUF1336);(source:Araport11) |
| AT3G23300 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G66860 | Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain-containing protein;(source:Araport11) |
| AT4G02370 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
| AT1G16480 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G60290 | hypothetical protein;(source:Araport11) |
| AT3G51710 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11) |
| AT4G16475 | pre-tRNA tRNA-Leu (anticodon: CAG);(source:Araport11, TAIR10) |
| AT3G51150 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT3G61755 | pre-tRNA tRNA-Ala (anticodon: CGC);(source:Araport11, TAIR10) |
| AT2G36885 | translation initiation factor;(source:Araport11) |
| AT4G14746 | neurogenic locus notch-like protein;(source:Araport11) |
| AT3G63290 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G26208 | Natural antisense transcript overlaps with AT1G26210;(source:Araport11) |
| AT4G16510 | YbaK/aminoacyl-tRNA synthetase-associated domain-containing protein;(source:Araport11) |
| AT1G02228 | pseudogene of no apical meristem (NAM) family protein |
| AT3G47010 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT3G62710 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT4G32480 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
| AT1G78800 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G21970 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT2G23700 | Itga6 (Protein of unknown function, DUF547);(source:Araport11) |
| AT1G01450 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G38200 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
| AT1G80020 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.0e-62 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G56690 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G73750 | alpha/beta hydrolase family protein;(source:Araport11) |
| AT3G17640 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G02830 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G26500 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G37160 | P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11) |
| AT3G08610 | NADH dehydrogenase ubiquinone 1 alpha subcomplex subunit;(source:Araport11) |
| AT1G15740 | Leucine-rich repeat family protein;(source:Araport11) |
| AT5G50840 | alpha-taxilin-like protein;(source:Araport11) |
| AT3G52070 | RNA/RNP complex-1-interacting phosphatase;(source:Araport11) |
| AT5G66558 | Natural antisense transcript overlaps with AT5G66560;(source:Araport11) |
| AT4G16980 | arabinogalactan-protein family;(source:Araport11) |
| AT2G18900 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G10820 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G30930 | hypothetical protein;(source:Araport11) |
| AT5G09630 | LisH/CRA/RING-U-box domains-containing protein;(source:Araport11) |
| AT3G45090 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G50900 | hypothetical protein;(source:Araport11) |
| AT3G17450 | hAT dimerization domain-containing protein;(source:Araport11) |
| AT5G41780 | myosin heavy chain-like protein;(source:Araport11) |
| AT3G51640 | stress response NST1-like protein;(source:Araport11) |
| AT3G58800 | secretion-regulating guanine nucleotide exchange factor;(source:Araport11) |
| AT1G71828 | Potential natural antisense gene, locus overlaps with AT1G71830 |
| AT5G67460 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT1G67050 | membrane-associated kinase regulator;(source:Araport11) |
| AT2G45860 | hypothetical protein;(source:Araport11) |
| AT2G25460 | EEIG1/EHBP1 protein amino-terminal domain protein;(source:Araport11) |
| AT4G30940 | BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11) |
| AT3G09430 | peptide transporter family protein;(source:Araport11) |
| AT4G24350 | Phosphorylase superfamily protein;(source:Araport11) |
| AT2G43240 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT1G01830 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G54300 | cotton fiber-like protein (DUF761);(source:Araport11) |
| AT2G35850 | transmembrane protein;(source:Araport11) |
| AT5G08695 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT4G14270 | Protein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins. |
| AT3G44940 | enabled-like protein (DUF1635);(source:Araport11) |
| AT5G64380 | Inositol monophosphatase family protein;(source:Araport11) |
| AT1G14185 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT1G72420 | NADH:ubiquinone oxidoreductase intermediate-associated protein 30;(source:Araport11) |
| AT3G23600 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G15090 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
| AT4G26485 | methyltransferase small domain protein;(source:Araport11) |
| AT1G15970 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT5G66150 | Glycosyl hydrolase family 38 protein;(source:Araport11) |
| AT3G63230 | senescence-associated-like protein (DUF581);(source:Araport11) |
| AT3G15780 | transmembrane protein;(source:Araport11) |
| AT3G07460 | transmembrane protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT4G32050 | neurochondrin family protein;(source:Araport11) |
| AT2G17295 | snoRNA;(source:Araport11) |
| AT5G12410 | THUMP domain-containing protein;(source:Araport11) |
| AT1G63720 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G26976 | hypothetical protein;(source:Araport11) |
| AT2G21440 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G44040 | eisosome SEG2-like protein;(source:Araport11) |
| AT1G62030 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G09220 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G19500 | nucleoside-triphosphatase/transmembrane receptor/nucleotide binding/ATP binding protein;(source:Araport11) |
| AT3G50250 | transmembrane protein;(source:Araport11) |
| AT3G03430 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G15080 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT1G44478 | Cyclophilin;(source:Araport11) |
| AT4G31075 | pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10) |
| AT1G02360 | Chitinase family protein;(source:Araport11) |
| AT1G72480 | Lung seven transmembrane receptor family protein;(source:Araport11) |
| AT1G12540 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G25170 | Uncharacterized conserved protein (UCP012943);(source:Araport11) |
| AT1G14300 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G46875 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT1G06860 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT5G25210 | hypothetical protein;(source:Araport11) |
| AT3G01690 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G30060 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT4G01930 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G30925 | transmembrane protein;(source:Araport11) |
| AT5G19070 | SNARE associated Golgi protein family;(source:Araport11) |
| AT5G10560 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT1G66190 | hypothetical protein;(source:Araport11) |
| AT5G14495 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT4G22233 | Natural antisense transcript overlaps with AT4G22235;(source:Araport11) |
| AT4G39140 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G47341 | transmembrane protein;(source:Araport11) |
| AT1G76170 | 2-thiocytidine tRNA biosynthesis protein, TtcA;(source:Araport11) |
| AT3G08920 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT1G76600 | PADRE protein up-regulated after infection by S. sclerotiorun. |
| AT2G38800 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
| AT1G75300 | encodes a protein whose sequence is similar to an isoflavone reductase |
| AT3G07250 | RNA-binding (RRM-RBD-RNP motif) domain nuclear transport factor 2 family protein;(source:Araport11) |
| AT5G62080 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT5G45745 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
| AT1G53560 | Ribosomal protein L18ae family;(source:Araport11) |
| AT1G01440 | hypothetical protein (DUF3133);(source:Araport11) |
| AT3G49540 | hypothetical protein;(source:Araport11) |
| AT2G37130 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G36808 | Natural antisense transcript overlaps with AT4G36810;(source:Araport11) |
| AT1G80850 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT4G31510 | major centromere autoantigen B-like protein;(source:Araport11) |
| AT1G52840 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G13865.1);(source:TAIR10) |
| AT5G59600 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G21830 | hypothetical protein;(source:Araport11) |
| AT5G45020 | Glutathione S-transferase family protein;(source:Araport11) |
| AT3G07350 | sulfate/thiosulfate import ATP-binding protein, putative (DUF506);(source:Araport11) |
| AT3G27390 | transmembrane protein;(source:Araport11) |
| AT2G23790 | calcium uniporter (DUF607);(source:Araport11) |
| AT2G31005 | Encodes a Cysteine-rich peptide (CRP) family protein |
| AT4G22110 | GroES-like zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT2G47485 | hypothetical protein;(source:Araport11) |
| AT1G11380 | PLAC8 family protein;(source:Araport11) |
| AT1G56145 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT2G16880 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G01750 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT3G43850 | hypothetical protein;(source:Araport11) |
| AT4G27840 | SNARE-like superfamily protein;(source:Araport11) |
| AT5G44900 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT3G03855 | Annotated as pseudogene of disease resistance protein.Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 . |
| AT1G80520 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
| AT1G72230 | Cupredoxin superfamily protein;(source:Araport11) |
| AT3G59340 | solute carrier family 35 protein (DUF914);(source:Araport11) |
| AT1G01305 | hypothetical protein;(source:Araport11) |
| AT3G45050 | transmembrane protein;(source:Araport11) |
| AT1G32700 | PLATZ transcription factor family protein;(source:Araport11) |
| AT3G04350 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
| AT4G03295 | snoRNA;(source:Araport11) |
| AT1G52430 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT2G39920 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT2G35155 | Trypsin family protein;(source:Araport11) |
| AT3G45530 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G09210 | GC-rich sequence DNA-binding factor-like protein;(source:Araport11) |
| AT1G71970 | hypothetical protein;(source:Araport11) |
| AT5G16380 | autophagy-like protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT3G26550 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G25290 | Auxin-responsive family protein;(source:Araport11) |
| AT2G36030 | hypothetical protein;(source:Araport11) |
| AT1G63860 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G04030 | eisosome protein;(source:Araport11) |
| AT3G15115 | serine/arginine repetitive matrix protein;(source:Araport11) |
| AT5G44320 | Eukaryotic translation initiation factor 3 subunit 7 (eIF-3);(source:Araport11) |
| AT2G47500 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
| AT1G79010 | Alpha-helical ferredoxin;(source:Araport11) |
| AT3G46600 | GRAS family transcription factor;(source:Araport11) |
| AT4G24231 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G23990 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.0e-30 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G43200 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G41890 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G39380 | TSL-kinase interacting-like protein;(source:Araport11) |
| AT3G13335 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT1G58460 | hypothetical protein;(source:Araport11) |
| AT5G52882 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G54400 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G24190 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G69800 | Cystathionine beta-synthase (CBS) protein;(source:Araport11) |
| AT1G14710 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G27435 | fiber (DUF1218);(source:Araport11) |
| AT1G01300 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G27720 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G12735 | Encodes a peroxisomal protein. |
| AT3G49900 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT4G36770 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G40270 | Protein kinase family protein;(source:Araport11) |
| AT2G30362 | Natural antisense transcript overlaps with AT2G30360;(source:Araport11) |
| AT1G55840 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G54625 | Natural antisense transcript overlaps with AT3G54630;(source:Araport11) |
| AT5G61520 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G56920 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT1G10330 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G15548 | transmembrane protein;(source:Araport11) |
| AT5G43620 | Pre-mRNA cleavage complex II;(source:Araport11) |
| AT3G23650 | kinase-like protein;(source:Araport11) |
| AT2G18180 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G50910 | hypothetical protein;(source:Araport11) |
| AT5G07572 | hypothetical protein;(source:Araport11) |
| AT3G12430 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT5G45480 | transmembrane protein, putative (DUF594);(source:Araport11) |
| AT3G24130 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G38545 | Natural antisense transcript overlaps with AT4G38530 and AT4G38540;(source:Araport11) |
| AT1G26590 | C2H2-like zinc finger protein;(source:Araport11) |
| AT3G15357 | phosphopantothenoylcysteine decarboxylase subunit;(source:Araport11) |
| AT1G03200 | hypothetical protein;(source:Araport11) |
| AT4G05018 | transmembrane protein;(source:Araport11) |
| AT5G17470 | EF hand calcium-binding protein family;(source:Araport11) |
| AT5G64540 | mucin-like protein;(source:Araport11) |
| AT2G29770 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G20210 | RNI-like superfamily protein;(source:Araport11) |
| AT2G34185 | hypothetical protein;(source:Araport11) |
| AT3G22550 | NAD(P)H-quinone oxidoreductase subunit, putative (DUF581);(source:Araport11) |
| AT1G49850 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G05960 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G17180 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT4G26490 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G17390 | transposable_element_gene;(source:Araport11);similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT5G36905.1);(source:TAIR10) |
| AT4G14500 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT3G05625 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G37895 | Natural antisense transcript overlaps with AT4G37890;(source:Araport11) |
| AT2G30505 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT4G26680 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G15810 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT2G38450 | Sel1 repeat protein;(source:Araport11) |
| AT4G24700 | hypothetical protein;(source:Araport11) |
| AT2G30945 | None;(source:Araport11) |
| AT5G24610 | cyclic AMP-responsive element-binding protein;(source:Araport11) |
| AT3G60760 | hypothetical protein;(source:Araport11) |
| AT3G62070 | hypothetical protein;(source:Araport11) |
| AT4G01570 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G23820 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G47180 | Plant VAMP (vesicle-associated membrane protein) family protein;(source:Araport11) |
| AT3G46280 | kinase-like protein;(source:Araport11) |
| AT5G61940 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT2G30984 | Natural antisense transcript overlaps with AT2G30985;(source:Araport11) |
| AT2G14455 | transposable_element_gene;(source:Araport11);similar to replication protein-related [Arabidopsis thaliana] (TAIR:AT1G35930.1);(source:TAIR10) |
| AT4G20300 | Serine/Threonine-kinase, putative (DUF1639);(source:Araport11) |
| AT2G36220 | hypothetical protein;(source:Araport11) |
| AT5G40720 | C3H4 type zinc finger protein (DUF23);(source:Araport11) |
| AT3G25930 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT2G39980 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G48680 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-298 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G16640 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT4G25433 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
| AT5G20940 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT2G42710 | Ribosomal protein L1p/L10e family;(source:Araport11) |
| AT2G34610 | cotton fiber protein;(source:Araport11) |
| AT2G42760 | DUF1685 family protein;(source:Araport11) |
| AT5G49665 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT2G04250 | pseudogene of ribonuclease H;(source:Araport11) |
| AT3G24180 | Beta-glucosidase, GBA2 type family protein;(source:Araport11) |
| AT1G80865 | hypothetical protein;(source:Araport11) |
| AT3G51720 | WEB family protein (DUF827);(source:Araport11) |
| AT2G27500 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT3G08930 | LMBR1-like membrane protein;(source:Araport11) |
| AT2G46300 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G48900 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G25820 | Exostosin family protein;(source:Araport11) |
| AT5G51790 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G07940 | Calcium-dependent ARF-type GTPase activating protein family;(source:Araport11) |
| AT1G07280 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G01680 | Ankyrin repeat family protein;(source:Araport11) |
| AT4G16745 | Exostosin family protein;(source:Araport11) |
| AT3G51410 | hypothetical protein (DUF241);(source:Araport11) |
| AT5G01110 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G12960 | Ribosomal protein L18e/L15 superfamily protein;(source:Araport11) |
| AT5G47225 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10) |
| AT5G02940 | ion channel POLLUX-like protein, putative (DUF1012);(source:Araport11) |
| AT5G24165 | hypothetical protein;(source:Araport11) |
| AT2G33180 | hypothetical protein;(source:Araport11) |
| AT5G42700 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT3G02750 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT2G24395 | chaperone protein dnaJ-like protein;(source:Araport11) |
| AT5G06800 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
| AT1G77640 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT4G36925 | transmembrane protein;(source:Araport11) |
| AT1G30795 | Glycine-rich protein family;(source:Araport11) |
| AT4G35240 | DNA-directed RNA polymerase subunit beta, putative (DUF630 and DUF632);(source:Araport11) |
| AT3G47560 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G11560 | LETM1-like protein;(source:Araport11) |
| AT1G02816 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
| AT3G46870 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G23340 | RNI-like superfamily protein;(source:Araport11) |
| AT1G72600 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G56220 | transcription regulator;(source:Araport11) |
| AT2G03250 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT3G15090 | GroES-like zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
| AT3G12915 | Ribosomal protein S5/Elongation factor G/III/V family protein;(source:Araport11) |
| AT3G18230 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT1G53180 | hypothetical protein;(source:Araport11) |
| AT4G10280 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT5G49850 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT2G31585 | other_RNA;(source:Araport11) |
| AT1G33350 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G19960 | hAT family dimerization domain-containing protein;(source:Araport11) |
| AT3G56810 | hypothetical protein;(source:Araport11) |
| AT4G12115 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT2G18245 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G09595 | pre-tRNA tRNA-Ser (anticodon: TGA);(source:Araport11, TAIR10) |
| AT4G01915 | hypothetical protein;(source:Araport11) |
| AT5G56975 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
| AT5G51880 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G64130 | cAMP-regulated phosphoprotein 19-related protein;(source:Araport11) |
| AT5G48335 | hypothetical protein;(source:Araport11) |
| AT1G75490 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT2G05540 | Glycine-rich protein family;(source:Araport11) |
| AT1G19650 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT5G20110 | Dynein light chain type 1 family protein;(source:Araport11) |
| AT3G05190 | D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein;(source:Araport11) |
| AT3G24612 | snoRNA;(source:Araport11) |
| AT5G44255 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.5e-09 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT5G11550 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G03120 | transmembrane protein;(source:Araport11) |
| AT1G18700 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT2G38830 | Ubiquitin-conjugating enzyme/RWD-like protein;(source:Araport11) |
| AT5G45720 | AAA-type ATPase family protein;(source:Araport11) |
| AT3G62360 | Carbohydrate-binding-like fold;(source:Araport11) |
| AT1G47497 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT3G19440 | Pseudouridine synthase family protein;(source:Araport11) |
| AT5G62610 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G20820 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT4G12220 | hypothetical protein;(source:Araport11) |
| AT4G32440 | Plant Tudor-like RNA-binding protein;(source:Araport11) |
| AT1G73066 | Leucine-rich repeat family protein;(source:Araport11) |
| AT1G18290 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT5G38300 | homeobox Hox-B3-like protein;(source:Araport11) |
| AT1G79630 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT1G07440 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G10320 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT2G17860 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT2G32520 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G06880 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G33585 | subtilisin-like protease;(source:Araport11) |
| AT5G16360 | NC domain-containing protein-like protein;(source:Araport11) |
| AT3G60810 | DUF1499 family protein;(source:Araport11) |
| AT1G66250 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT4G03340 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G03990 | Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11) |
| AT5G08240 | transmembrane protein;(source:Araport11) |
| AT3G61820 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G39020 | SH3 domain-containing protein;(source:Araport11) |
| AT5G06540 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G18460 | carboxyl-terminal peptidase (DUF239);(source:Araport11) |
| AT5G65250 | transmembrane protein;(source:Araport11) |
| AT1G18745 | other_RNA;(source:Araport11) |
| AT1G68410 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT1G11806 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G11320 | GDSL esterase/lipase;(source:Araport11) |
| AT3G56050 | Protein kinase family protein;(source:Araport11) |
| AT5G40190 | Identified in a screen for calmodulin-binding proteins obtained from an auxin treated cDNA library. |
| AT3G55780 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G15790 | uveal autoantigen with coiled-coil/ankyrin;(source:Araport11) |
| AT1G67790 | sieve element occlusion protein;(source:Araport11) |
| AT4G30670 | Putative membrane lipoprotein;(source:Araport11) |
| AT3G52710 | hypothetical protein;(source:Araport11) |
| AT1G57980 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT3G17120 | transmembrane protein;(source:Araport11) |
| AT3G12150 | alpha/beta hydrolase family protein;(source:Araport11) |
| AT2G33360 | cadherin EGF LAG seven-pass G-type receptor, putative (DUF3527);(source:Araport11) |
| AT1G12330 | cyclin-dependent kinase-like protein;(source:Araport11) |
| AT5G59500 | protein C-terminal S-isoprenylcysteine carboxyl O-methyltransferase;(source:Araport11) |
| AT1G75670 | DNA-directed RNA polymerase;(source:Araport11) |
| AT3G14075 | Mono-/di-acylglycerol lipase, N-terminal;(source:Araport11) |
| AT5G21070 | Fe(3+) dicitrate transport system permease;(source:Araport11) |
| AT2G31018 | hypothetical protein;(source:Araport11) |
| AT4G21770 | Pseudouridine synthase family protein;(source:Araport11) |
| AT2G41600 | Mitochondrial glycoprotein family protein;(source:Araport11) |
| AT3G19340 | aminopeptidase (DUF3754);(source:Araport11) |
| AT4G16650 | O-fucosyltransferase family protein;(source:Araport11) |
| AT2G20420 | ATP citrate lyase (ACL) family protein;(source:Araport11) |
| AT4G21450 | PapD-like superfamily protein;(source:Araport11) |
| AT1G23330 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G75190 | hypothetical protein;(source:Araport11) |
| AT3G25870 | hypothetical protein;(source:Araport11) |
| AT4G33467 | hypothetical protein;(source:Araport11) |
| AT1G07590 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G15175 | Natural antisense transcript overlaps with AT1G15170;(source:Araport11) |
| AT4G13400 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G03298 | transmembrane protein;(source:Araport11) |
| AT5G58800 | Quinone reductase family protein;(source:Araport11) |
| AT4G38870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G66480 | Involved in chloroplast avoidance movement under intermediate and high light intensities; PADRE protein up-regulated after infection by S. sclerotiorun. |
| AT3G27200 | Cupredoxin superfamily protein;(source:Araport11) |
| AT5G60460 | Preprotein translocase Sec, Sec61-beta subunit protein;(source:Araport11) |
| AT1G02630 | Nucleoside transporter family protein;(source:Araport11) |
| AT1G24110 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G12685 | Acid phosphatase/vanadium-dependent haloperoxidase-related protein;(source:Araport11) |
| AT5G48412 | other_RNA;(source:Araport11) |
| AT4G12280 | copper amine oxidase family protein;(source:Araport11) |
| AT3G51644 | hypothetical protein;(source:Araport11) |
| AT1G27290 | transmembrane protein;(source:Araport11) |
| AT1G30430 | pre-tRNA tRNA-Glu (anticodon: CTC);(source:Araport11, TAIR10) |
| AT3G50790 | esterase/lipase/thioesterase family protein;(source:Araport11) |
| AT4G10980 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-44 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G12460 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G06620 | encodes a protein whose sequence is similar to a 2-oxoglutarate-dependent dioxygenase The mRNA is cell-to-cell mobile. |
| AT4G28070 | AFG1-like ATPase family protein;(source:Araport11) |
| AT2G21510 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT3G55430 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT4G28740 | LOW PSII ACCUMULATION-like protein;(source:Araport11) |
| AT3G56275 | pseudogene of expressed protein;(source:Araport11) |
| AT4G30680 | Initiation factor eIF-4 gamma, MA3;(source:Araport11) |
| AT1G45248 | Nucleolar histone methyltransferase-related protein;(source:Araport11) |
| AT3G03845 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT1G07100 | pre-tRNA tRNA-Ile (anticodon: TAT);(source:Araport11, TAIR10) |
| AT1G67820 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT2G13960 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G17147 | VQ motif-containing protein;(source:Araport11) |
| AT3G24615 | Encodes a Z43 snoRNA. Gb: AJ240080 |
| AT5G16810 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G30130 | DUF1365 family protein;(source:Araport11) |
| AT3G08660 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT5G26700 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT2G46220 | DUF2358 family protein (DUF2358);(source:Araport11) |
| AT4G11521 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT1G15120 | Ubiquinol-cytochrome C reductase hinge protein;(source:Araport11) |
| AT1G18270 | ketose-bisphosphate aldolase class-II family protein;(source:Araport11) |
| AT4G20790 | Leucine-rich repeat protein kinase family protein |
| AT5G02680 | methionine-tRNA ligase;(source:Araport11) |
| AT1G34630 | transmembrane protein;(source:Araport11) |
| AT4G34910 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G15430 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
| AT4G32105 | Beta-1,3-N-Acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G20520 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT4G09060 | hypothetical protein;(source:Araport11) |
| AT4G27850 | Glycine-rich protein family;(source:Araport11) |
| AT5G09430 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G62370 | heme binding protein;(source:Araport11) |
| AT2G36500 | CBS / octicosapeptide/Phox/Bemp1 (PB1) domains-containing protein;(source:Araport11) |
| AT5G21105 | Plant L-ascorbate oxidase;(source:Araport11) |
| AT4G38690 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT1G80540 | envelope glycoprotein B;(source:Araport11) |
| AT3G47540 | Chitinase family protein;(source:Araport11) |
| AT4G31960 | hypothetical protein;(source:Araport11) |
| AT1G03520 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT2G33175 | transmembrane protein;(source:Araport11) |
| AT4G32750 | transmembrane protein;(source:Araport11) |
| AT5G51180 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G24670 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G49790 | Carbohydrate-binding protein;(source:Araport11) |
| AT5G66950 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT3G10015 | pre-tRNA tRNA-Leu (anticodon: TAA);(source:Araport11, TAIR10) |
| AT1G25375 | Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11) |
| AT3G04855 | hypothetical protein;(source:Araport11) |
| AT5G38610 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G59350 | transmembrane protein;(source:Araport11) |
| AT5G02170 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT4G29850 | transmembrane protein (DUF872);(source:Araport11) |
| AT2G44580 | zinc ion binding protein;(source:Araport11) |
| AT3G52350 | D111/G-patch domain-containing protein;(source:Araport11) |
| AT2G40230 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G06570 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G22100 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G04200 | dyggve-melchior-clausen syndrome protein;(source:Araport11) |
| AT2G03700 | pre-tRNA tRNA-Thr (anticodon: CGT);(source:Araport11, TAIR10) |
| AT5G39895 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT1G77200 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT3G01750 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G53440 | LOW protein: zinc finger CCCH domain protein;(source:Araport11) |
| AT3G54510 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT5G49100 | vitellogenin-like protein;(source:Araport11) |
| AT5G54050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G02240 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. The mRNA is cell-to-cell mobile. |
| AT1G68390 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT4G32160 | Phox (PX) domain-containing protein;(source:Araport11) |
| AT4G36648 | other_RNA;(source:Araport11) |
| AT5G41590 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT1G30290 | unknown protein |
| AT2G37020 | Translin family protein;(source:Araport11) |
| AT2G44730 | Alcohol dehydrogenase transcription factor Myb/SANT-like family protein;(source:Araport11) |
| AT4G32930 | hypothetical protein;(source:Araport11) |
| AT4G24750 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT2G46308 | transmembrane protein;(source:Araport11) |
| AT2G46915 | DUF3754 family protein, putative (DUF3754);(source:Araport11) |
| AT5G17847 | hypothetical protein;(source:Araport11) |
| AT1G15200 | protein-protein interaction regulator family protein;(source:Araport11) |
| AT2G25800 | elongation factor Ts (DUF810);(source:Araport11) |
| AT3G27270 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT5G15520 | Ribosomal protein S19e family protein;(source:Araport11) |
| AT4G36945 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT5G20750 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT3G42690.1);(source:TAIR10) |
| AT5G37290 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G55770 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G22235 | Encodes a defensin-like (DEFL) family protein. |
| AT3G54800 | Pleckstrin homology (PH) and lipid-binding START domains-containing protein;(source:Araport11) |
| AT3G48115 | other_RNA;(source:Araport11) |
| AT2G40110 | Yippee family putative zinc-binding protein;(source:Araport11) |
| AT4G26950 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT2G30985 | hypothetical protein;(source:Araport11) |
| AT1G73740 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G22044 | pseudogene of zinc finger (C3HC4-type RING finger) protein |
| AT1G32410 | Vacuolar protein sorting 55 (VPS55) family protein;(source:Araport11) |
| AT4G27657 | hypothetical protein;(source:Araport11) |
| AT4G25900 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT1G64420 | pre-tRNA tRNA-Ala (anticodon: CGC);(source:Araport11, TAIR10) |
| AT5G59140 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT4G38670 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT1G61100 | disease resistance protein (TIR class);(source:Araport11) |
| AT4G33160 | F-box family protein;(source:Araport11) |
| AT5G66790 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G03010 | RNI-like superfamily protein;(source:Araport11) |
| AT4G18150 | Serine/Threonine-kinase, putative (DUF1296);(source:Araport11) |
| AT2G32970 | G1/S-specific cyclin-E protein;(source:Araport11) |
| AT2G43235 | phosphoribosylformylglycinamidine synthase;(source:Araport11) |
| AT5G44060 | embryo sac development arrest protein;(source:Araport11) |
| AT5G07430 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G26692 | Natural antisense transcript overlaps with AT2G26690;(source:Araport11) |
| AT5G49210 | stress response NST1-like protein;(source:Araport11) |
| AT5G61040 | hypothetical protein;(source:Araport11) |
| AT5G53270 | Seed maturation protein;(source:Araport11) |
| AT3G23330 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G49370 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
| AT2G30100 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT2G07000 | hypothetical protein;(source:Araport11) |
| AT1G03730 | pyrroline-5-carboxylate reductase;(source:Araport11) |
| AT1G17360 | LOW protein: protein phosphatase 1 regulatory subunit-like protein;(source:Araport11) |
| AT1G17960 | Threonyl-tRNA synthetase;(source:Araport11) |
| AT4G38050 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT1G52720 | hypothetical protein;(source:Araport11) |
| AT2G35360 | ubiquitin family protein;(source:Araport11) |
| AT4G25410 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G14330 | transmembrane protein;(source:Araport11) |
| AT4G37250 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G34140 | D111/G-patch domain-containing protein;(source:Araport11) |
| AT5G04750 | F1F0-ATPase inhibitor protein;(source:Araport11) |
| AT5G59700 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G17230 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT5G04030 | transmembrane protein;(source:Araport11) |
| AT3G03920 | H/ACA ribonucleoprotein complex, subunit Gar1/Naf1 protein;(source:Araport11) |
| AT2G34186 | hypothetical protein;(source:Araport11) |
| AT4G25835 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G13410 | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase;(source:Araport11) |
| AT5G61190 | putative endonuclease or glycosyl hydrolase with C2H2-type zinc finger domain-containing protein;(source:Araport11) |
| AT1G75530 | Forkhead-associated (FHA) domain-containing protein;(source:Araport11) |
| AT5G59490 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT2G42320 | nucleolar protein gar2-like protein;(source:Araport11) |
| AT1G04780 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G05920 | B3 domain protein (DUF313);(source:Araport11) |
| AT3G12590 | hypothetical protein;(source:Araport11) |
| AT1G19980 | cytomatrix protein-like protein;(source:Araport11) |
| AT1G29520 | AWPM-19-like family protein;(source:Araport11) |
| AT5G55560 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G21528 | hypothetical protein;(source:Araport11) |
| AT5G15360 | transmembrane protein;(source:Araport11) |
| AT5G10320 | ATP synthase subunit B;(source:Araport11) |
| AT2G20670 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
| AT5G45650 | subtilase family protein;(source:Araport11) |
| AT1G33450 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G04780.2);(source:TAIR10) |
| AT4G18070 | suppressor;(source:Araport11) |
| AT1G54095 | DUF1677 family protein, putative (DUF1677);(source:Araport11) |
| AT3G55540 | nuclear transport factor 2 (NTF2) family protein;(source:Araport11) |
| AT1G30300 | Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11) |
| AT1G27670 | transmembrane protein;(source:Araport11) |
| AT1G26773 | hypothetical protein;(source:Araport11) |
| AT5G14440 | Surfeit locus protein 2 (SURF2);(source:Araport11) |
| AT1G12600 | UDP-N-acetylglucosamine (UAA) transporter family;(source:Araport11) |
| AT5G16210 | HEAT repeat-containing protein;(source:Araport11) |
| AT5G57570 | GCK domain-containing protein;(source:Araport11) |
| AT5G19240 | Glycoprotein membrane precursor GPI-anchored;(source:Araport11) |
| AT4G38010 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT1G20816 | outer envelope pore-like protein;(source:Araport11) |
| AT5G13770 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT5G64090 | hyccin;(source:Araport11) |
| AT4G03115 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT3G03150 | hypothetical protein;(source:Araport11) |
| AT1G76770 | HSP20-like chaperone |
| AT5G15995 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.2e-36 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT1G80530 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G66820 | glycine-rich protein;(source:Araport11) |
| AT4G19865 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G66250 | kinectin-like protein;(source:Araport11) |
| AT1G52710 | Rubredoxin-like superfamily protein;(source:Araport11) |
| AT5G41401 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G79660 | ephrin-A3 protein;(source:Araport11) |
| AT3G55820 | Fasciclin-like arabinogalactan family protein;(source:Araport11) |
| AT2G17845 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G26940 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT4G33905 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
| AT1G28160 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT5G27950 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G13130 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G37550 | hypothetical protein;(source:Araport11) |
| AT1G05410 | CDPK adapter, putative (DUF1423);(source:Araport11) |
| AT3G27350 | transcriptional regulator ATRX-like protein;(source:Araport11) |
| AT1G15430 | hypothetical protein (DUF1644);(source:Araport11) |
| AT2G44930 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G62580 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT4G09150 | T-complex protein 11;(source:Araport11) |
| AT3G46080 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT5G55670 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G06770 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G42990 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G49820 | hypothetical protein;(source:Araport11) |
| AT1G67920 | hypothetical protein;(source:Araport11) |
| AT5G21090 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G62290 | nucleotide-sensitive chloride conductance regulator (ICln) family protein;(source:Araport11) |
| AT2G36430 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT1G22520 | MICOS complex subunit Mic10-like protein (DUF543);(source:Araport11) |
| AT4G00695 | Spc97/Spc98 family of spindle pole body (SBP) component;(source:Araport11) |
| AT1G76110 | HMG (high mobility group) box protein with ARID/BRIGHT DNA-binding domain-containing protein;(source:Araport11) |
| AT5G18910 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G23390 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT1G07885 | hypothetical protein;(source:Araport11) |
| AT5G41250 | Exostosin family protein;(source:Araport11) |
| AT1G34230 | transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBb0041J06.18, blastp match of 33%25 identity and 2.8e-10 P-value to GP|27818010|dbj|BAC55773.1||AP005176 OSJNBb0041J06.18 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT2G17710 | Big1;(source:Araport11) |
| AT5G19130 | GPI transamidase component family protein / Gaa1-like family protein;(source:Araport11) |
| AT3G25597 | transmembrane protein;(source:Araport11) |
| AT4G22530 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G10750 | FBD domain family;(source:Araport11) |
| AT3G03230 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G80170 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G31590 | hypothetical protein;(source:Araport11) |
| AT3G26805 | pseudogene of Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G47540 | Mo25 family protein;(source:Araport11) |
| AT5G63630 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G11090 | serine-rich protein-like protein;(source:Araport11) |
| AT1G12990 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT4G12690 | DUF868 family protein (DUF868);(source:Araport11) |
| AT1G50040 | formin-like protein, putative (DUF1005);(source:Araport11) |
| AT1G75710 | C2H2-like zinc finger protein;(source:Araport11) |
| AT4G26675 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT1G67390 | F-box family protein;(source:Araport11) |
| AT4G29780 | Expression of the gene is affected by multiple stresses. Knockout and overexpression lines show no obvious phenotypes. |
| AT5G03880 | Thioredoxin family protein;(source:Araport11) |
| AT1G34620 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 8.5e-75 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G56370 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G59926 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT4G03040 | hypothetical protein;(source:Araport11) |
| AT5G56747 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-45 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G67880 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G02420 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G56700 | Peptidase C15, pyroglutamyl peptidase I-like protein;(source:Araport11) |
| AT2G39975 | hypothetical protein;(source:Araport11) |
| AT1G09480 | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase The mRNA is cell-to-cell mobile. |
| AT1G02210 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT1G28310 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
| AT2G21180 | transmembrane protein;(source:Araport11) |
| AT1G29418 | transmembrane protein;(source:Araport11) |
| AT5G63340 | hypothetical protein;(source:Araport11) |
| AT1G03290 | ELKS/Rab6-interacting/CAST family protein;(source:Araport11) |
| AT5G67430 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT5G26610 | D111/G-patch domain-containing protein;(source:Araport11) |
| AT5G54530 | serine protease, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT5G12940 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G48540 | receptor-like protein kinase-related family protein;(source:Araport11) |
| AT4G04480 | F-box protein with a domain protein;(source:Araport11) |
| AT4G38330 | hemolysin-III integral membrane-like protein;(source:Araport11) |
| AT5G09760 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT3G18570 | Oleosin family protein;(source:Araport11) |
| AT5G56240 | hapless protein;(source:Araport11) |
| AT4G01023 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G13240 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT1G09520 | hypothetical protein;(source:Araport11) |
| AT5G59070 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G07820 | Histone superfamily protein;(source:Araport11) |
| AT1G63230 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G25290 | DNA photolyase;(source:Araport11) |
| AT3G51450 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT1G68420 | Class II aaRS and biotin synthetases superfamily protein;(source:Araport11) |
| AT1G10880 | Putative role in response to salt stress. Mutants grow larger than the wild type under salt stress condition (Ann Stapleton and Ashley Green, 2009, personal communication). |
| AT1G18191 | Pseudogene of AT1G18200; AtRABA6b (Arabidopsis Rab GTPase homolog A6b); GTP binding |
| AT2G29060 | GRAS family transcription factor;(source:Araport11) |
| AT1G69360 | T-box transcription factor, putative (DUF863);(source:Araport11) |
| AT3G61080 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G32840 | proline-rich family protein;(source:Araport11) |
| AT5G35760 | Beta-galactosidase related protein;(source:Araport11) |
| AT1G28260 | Telomerase activating protein Est1;(source:Araport11) |
| AT4G13110 | BSD domain-containing protein;(source:Araport11) |
| AT1G06930 | TPRXL;(source:Araport11) |
| AT5G43790 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G21060 | Serine/Threonine-kinase, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT4G35880 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G56410 | hypothetical protein (DUF3133);(source:Araport11) |
| AT3G07290 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G61830 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G14180 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G46550 | transmembrane protein;(source:Araport11) |
| AT5G59450 | GRAS family transcription factor;(source:Araport11) |
| AT3G18215 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
| AT5G26740 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
| AT3G27570 | Sucrase/ferredoxin-like family protein;(source:Araport11) |
| AT5G57270 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G12310 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT5G57060 | 60S ribosomal L18a-like protein;(source:Araport11) |
| AT5G15853 | hypothetical protein;(source:Araport11) |
| AT1G52615 | other_RNA;(source:Araport11) |
| AT4G35720 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT2G35480 | envelope glycoprotein;(source:Araport11) |
| AT1G45010 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT5G11640 | Thioredoxin superfamily protein;(source:Araport11) |
| AT5G19970 | GRAS family transcription factor family protein;(source:Araport11) |
| AT1G10417 | Encodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens. |
| AT5G54020 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G27671 | pseudogene of DRM2/DMT7 (domain rearranged methyltransferase protein) |
| AT4G15590 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-50 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G14890 | potassium transporter;(source:Araport11) |
| AT4G35750 | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein;(source:Araport11) |
| AT5G53840 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT4G21520 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G03400 | A single copy gene that encodes a protein with sequence similarity to tomato E8 (ACC oxidase, the last step in ethylene biosynthesis) involved in ethylene synthesis and fruit ripening in tomato. This gene is not induced by ethylene in siliques. The transcript is found in siliques, etiolated seedlings, leaves, stems and flowers. |
| AT2G35200 | DUF740 family protein;(source:Araport11) |
| AT4G21903 | MATE efflux family protein;(source:Araport11) |
| AT1G62370 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G05140 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT1G52000 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT2G27650 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT5G37420 | Note that previous reports (Plant Cell 2003,15:1538; PNAS 2003, 100:13407) have incorrectly named AT5G37420 as AGL105. AT5G37415 has now been named as AGL105 based on Plant Cell 2003, 15:1538 where the GenBank accession number given for AGL105 is AY141227 (Supplemental Table 3), which corresponds to AT5G37415. |
| AT4G27660 | hypothetical protein;(source:Araport11) |
| AT4G38820 | hypothetical protein;(source:Araport11) |
| AT2G34985 | pre-tRNA tRNA-Thr (anticodon: CGT);(source:Araport11, TAIR10) |
| AT5G59760 | hypothetical protein (DUF1635);(source:Araport11) |
| AT5G14210 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G55675 | transmembrane protein;(source:Araport11) |
| AT5G66770 | GRAS family transcription factor;(source:Araport11) |
| AT1G04140 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT3G03040 | F-box/RNI-like superfamily protein. Idenfitied in GWAS as locus involved in response to the defense molecule, allyl glucosinolate. |
| AT1G27100 | Actin cross-linking protein;(source:Araport11) |
| AT1G54575 | hypothetical protein;(source:Araport11) |
| AT1G01940 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT5G59732 | Natural antisense transcript overlaps with AT5G59730. The RNA is cell-to-cell mobile. |
| AT5G44290 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G22320 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT3G13760 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G31070 | PPR superfamily protein;(source:Araport11) |
| AT3G01850 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT2G29654 | transmembrane protein;(source:Araport11) |
| AT2G28310 | trimethylguanosine synthase (DUF707);(source:Araport11) |
| AT1G03687 | DTW domain-containing protein;(source:Araport11) |
| AT1G60970 | SNARE-like superfamily protein;(source:Araport11) |
| AT5G56940 | Ribosomal protein S16 family protein;(source:Araport11) |
| AT2G42955 | F-box/LRR protein;(source:Araport11) |
| AT3G54940 | Papain family cysteine protease;(source:Araport11) |
| AT4G01865 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT5G52430 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G47660 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G45760 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G57980 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT3G16750 | hypothetical protein;(source:Araport11) |
| AT1G28400 | GATA zinc finger protein;(source:Araport11) |
| AT2G35040 | AICARFT/IMPCHase bienzyme family protein;(source:Araport11) |
| AT1G14600 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G03240 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G03050 | knotted 1-binding protein;(source:Araport11) |
| AT2G40113 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT2G28080 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G17500 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G30845 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
| AT4G01140 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT1G77500 | DUF630 family protein, putative (DUF630 and DUF632);(source:Araport11) |
| AT5G10970 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT1G79540 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G26600 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT3G23540 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G25620 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G09520 | Cofactor-independent phosphoglycerate mutase;(source:Araport11) |
| AT1G21695 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G13630 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G60960 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G67365 | Natural antisense transcript overlaps with AT1G67370;(source:Araport11) |
| AT4G19860 | Encodes a cytosolic calcium-independent phospholipase A. |
| AT5G51390 | hypothetical protein;(source:Araport11) |
| AT5G06278 | pseudogene of abscisic acid-responsive HVA22 family protein |
| AT3G53390 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G29630 | 5-3 exonuclease family protein;(source:Araport11) |
| AT2G31800 | Integrin-linked protein kinase family;(source:Araport11) |
| AT5G57330 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT5G66820 | transmembrane protein;(source:Araport11) |
| AT1G08592 | Natural antisense transcript overlaps with AT1G08590;(source:Araport11) |
| AT4G37608 | hypothetical protein;(source:Araport11) |
| AT3G12540 | ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547);(source:Araport11) |
| AT1G74830 | myosin-binding protein, putative (Protein of unknown function, DUF593);(source:Araport11) |
| AT3G06868 | vitellogenin-like protein;(source:Araport11) |
| AT1G18210 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT5G52065 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G40680.1);(source:TAIR10) |
| AT2G12461 | hypothetical protein;(source:Araport11) |
| AT1G03506 | snoRNA;(source:Araport11) |
| AT5G48620 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT2G05752 | hypothetical protein;(source:Araport11) |
| AT5G47900 | heparan-alpha-glucosaminide N-acetyltransferase-like protein (DUF1624);(source:Araport11) |
| AT5G09443 | Natural antisense transcript overlaps with AT5G09445;(source:Araport11) |
| AT1G75480 | pseudogene of gamma-glutamyl hydrolase 1;(source:Araport11) |
| AT5G10946 | hypothetical protein;(source:Araport11) |
| AT2G22080 | transmembrane protein;(source:Araport11) |
| AT2G42370 | hypothetical protein;(source:Araport11) |
| AT2G43250 | transmembrane protein;(source:Araport11) |
| AT5G01910 | myelin transcription factor;(source:Araport11) |
| AT1G10419 | Pseudogene of AT1G10419 |
| AT4G29270 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT4G36105 | polyamine-modulated factor 1-binding protein;(source:Araport11) |
| AT5G67455 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT5G54062 | egg cell-secreted-like protein;(source:Araport11) |
| AT3G09032 | josephin-like protein;(source:Araport11) |
| AT5G05090 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT2G44410 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G17130 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G42365 | Natural antisense transcript overlaps with AT2G42360 and AT2G42370;(source:Araport11) |
| AT5G41110 | meiosis chromosome segregation family protein;(source:Araport11) |
| AT3G60075 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
| AT3G14710 | RNI-like superfamily protein;(source:Araport11) |
| AT4G39170 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT5G28400 | embryo defective protein;(source:Araport11) |
| AT1G80800 | pseudogene of Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
| AT3G06680 | Ribosomal L29e protein family;(source:Araport11) |
| AT5G09450 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G33590 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT4G32900 | Peptidyl-tRNA hydrolase II (PTH2) family protein;(source:Araport11) |
| AT2G15800 | transposable_element_gene;(source:Araport11) |
| AT1G04000 | hypothetical protein;(source:Araport11) |
| AT2G18970 | hypothetical protein;(source:Araport11) |
| AT1G34010 | hypothetical protein;(source:Araport11) |
| AT1G75200 | flavodoxin family protein / radical SAM domain-containing protein;(source:Araport11) |
| AT5G60630 | transmembrane protein;(source:Araport11) |
| AT2G31740 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G14185 | other_RNA;(source:Araport11) |
| AT5G52550 | stress response NST1-like protein;(source:Araport11) |
| AT2G46940 | fold protein;(source:Araport11) |
| AT1G63220 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT5G41860 | transmembrane protein;(source:Araport11) |
| AT5G25280 | serine-rich protein-like protein;(source:Araport11) |
| AT5G37017 | Pseudogene of AT5G16486 |
| AT3G61962 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G22608 | hypothetical protein;(source:Araport11) |
| AT4G38550 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT1G73050 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT3G62650 | hypothetical protein;(source:Araport11) |
| AT1G02813 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
| AT3G14800 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.1e-83 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
| AT4G23493 | hypothetical protein;(source:Araport11) |
| AT3G17030 | Nucleic acid-binding proteins superfamily;(source:Araport11) |
| AT2G38255 | hypothetical protein (DUF239);(source:Araport11) |
| AT3G23085 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.1e-91 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G11040 | HSP40/DnaJ peptide-binding protein;(source:Araport11) |
| AT4G28020 | tRNA-thr(GGU) m(6)t(6)A37 methyltransferase;(source:Araport11) |
| AT3G02740 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G44345 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT4G02360 | transmembrane protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT5G61530 | small G protein family protein / RhoGAP family protein;(source:Araport11) |
| AT4G03410 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
| AT4G35510 | PHD finger-like protein;(source:Araport11) |
| AT5G18005 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT4G13220 | transmembrane protein;(source:Araport11) |
| AT3G15480 | fiber (DUF1218);(source:Araport11) |
| AT3G28220 | TRAF-like family protein;(source:Araport11) |
| AT5G41660 | transmembrane protein;(source:Araport11) |
| AT3G23080 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT4G35850 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G41810 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
| AT2G22440 | non-LTR retroelement reverse transcriptase;(source:Araport11) |
| AT3G62000 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G48460 | tRNA-processing ribonuclease BN;(source:Araport11) |
| AT2G20950 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT5G45790 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT1G11410 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT2G18940 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G18180 | Glycosyltransferase family 61 protein;(source:Araport11) |
| AT2G27360 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G49120 | DUF581 family protein, putative (DUF581);(source:Araport11) |
| AT3G10180 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G23205 | other_RNA;(source:Araport11) |
| AT1G45160 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G13810 | Glutaredoxin family protein;(source:Araport11) |
| AT3G15578 | hypothetical protein;(source:Araport11) |
| AT3G20300 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
| AT2G41835 | zinc finger (C2H2 type, AN1-like) family protein;(source:Araport11) |
| AT5G35170 | adenylate kinase family protein;(source:Araport11) |
| AT4G14200 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G74780 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
| AT4G40011 | hypothetical protein;(source:Araport11) |
| AT1G71710 | DNAse I-like superfamily protein;(source:Araport11) |
| AT4G36170 | hypothetical protein;(source:Araport11) |
| AT2G31990 | Exostosin family protein;(source:Araport11) |
| AT5G01790 | hypothetical protein;(source:Araport11) |
| AT3G50350 | membrane insertase, putative (DUF1685);(source:Araport11) |
| AT3G51980 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G16670 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-190 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
| AT2G21195 | hypothetical protein;(source:Araport11) |
| AT4G18660 | delay of germination protein;(source:Araport11) |
| AT4G33666 | hypothetical protein;(source:Araport11) |
| AT3G56510 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G13760 | Plasma-membrane choline transporter family protein;(source:Araport11) |
| AT3G48510 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G40530 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G25510 | Protein phosphatase 2A regulatory B subunit family protein;(source:Araport11) |
| AT1G16515 | transmembrane protein;(source:Araport11) |
| AT1G53400 | Ubiquitin domain-containing protein;(source:Araport11) |
| AT2G36854 | hypothetical protein;(source:Araport11) |
| AT4G17280 | Auxin-responsive family protein;(source:Araport11) |
| AT1G17090 | transmembrane protein;(source:Araport11) |
| AT2G02830 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-37 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G09160 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT1G19340 | Methyltransferase MT-A70 family protein;(source:Araport11) |
| AT1G11690 | BRANCHLESS TRICHOME-like protein;(source:Araport11) |
| AT1G16650 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G55960 | transmembrane protein C9orf5 protein;(source:Araport11) |
| AT2G37530 | forkhead box protein G1;(source:Araport11) |
| AT3G04780 | Encodes a protein with little sequence identity with any other protein of known structure or function. Part of this protein shows a 42% sequence identity with the C-terminal domain of the 32-kD human thioredoxin-like protein. |
| AT2G35840 | Sucrose-6F-phosphate phosphohydrolase family protein;(source:Araport11) |
| AT3G52700 | hypothetical protein;(source:Araport11) |
| AT1G17150 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G56230 | enolase (DUF1399);(source:Araport11) |
| AT5G44910 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT1G22100 | Inositol-pentakisphosphate 2-kinase family protein;(source:Araport11) |
| AT5G45430 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G35340 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
| AT1G74790 | catalytics;(source:Araport11) |
| AT1G75800 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT1G31300 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT4G37445 | calcium ion-binding protein;(source:Araport11) |
| AT4G37530 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G05640 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G58640 | Selenoprotein, Rdx type;(source:Araport11) |
| AT5G01215 | Natural antisense transcript overlaps with AT5G01210;(source:Araport11) |
| AT3G11402 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G50900 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G02480 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT2G46620 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G68330 | membrane-associated kinase regulator;(source:Araport11) |
| AT5G55530 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT1G58590 | other_RNA;(source:Araport11) |
| AT4G32020 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT4G03380 | hypothetical protein;(source:Araport11) |
| AT5G23850 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT1G06590 | anaphase-promoting complex subunit;(source:Araport11) |
| AT4G28780 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G59710 | actin cross-linking protein (DUF569);(source:Araport11) |
| AT4G02010 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G09970 | transmembrane protein;(source:Araport11) |
| AT3G43430 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G26440 | transmembrane protein, putative (DUF707);(source:Araport11) |
| AT5G05670 | signal recognition particle binding protein;(source:Araport11) |
| AT5G08139 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G04854 | hypothetical protein;(source:Araport11) |
| AT4G36640 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT4G16748 | other_RNA;(source:Araport11) |
| AT3G07470 | DUF538 protein |
| AT3G07320 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G03180 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G75360 | transmembrane protein;(source:Araport11) |
| AT2G45520 | coiled-coil protein;(source:Araport11) |
| AT1G48040 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G14350 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G44660 | ALG6, ALG8 glycosyltransferase family;(source:Araport11) |
| AT1G61667 | serine protease, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT3G15770 | hypothetical protein;(source:Araport11) |
| AT3G57930 | rho GTPase-activating gacO-like protein;(source:Araport11) |
| AT2G23300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G26160 | Metal-dependent phosphohydrolase;(source:Araport11) |
| AT1G20490 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT3G43660 | The gene encodes a putative nodulin-like21 protein. |
| AT4G27654 | transmembrane protein;(source:Araport11) |
| AT1G15760 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
| AT5G21950 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G54740 | FANTASTIC four-like protein (DUF3049);(source:Araport11) |
| AT5G15610 | Proteasome component (PCI) domain protein;(source:Araport11) |
| AT4G23620 | Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain-containing protein;(source:Araport11) |
| AT4G33310 | hypothetical protein;(source:Araport11) |
| AT2G29510 | hypothetical protein (DUF3527);(source:Araport11) |
| AT1G55200 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT3G48120 | serine/arginine-rich splicing factor;(source:Araport11) |
| AT5G13310 | hypothetical protein;(source:Araport11) |
| AT4G17215 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT2G15045 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT4G08860.1);(source:TAIR10) |
| AT5G65470 | O-fucosyltransferase family protein;(source:Araport11) |
| AT2G27935 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.2e-17 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT5G14790 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G47430 | pseudogene of Ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G65820 | microsomal glutathione s-transferase;(source:Araport11) |
| AT5G19340 | hypothetical protein;(source:Araport11) |
| AT3G22121 | Natural antisense transcript overlaps with AT3G22120. The RNA is cell-to-cell mobile. |
| AT5G01740 | Unknown gene, induced by abiotic stress treatments. |
| AT4G18900 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G26730 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT5G05250 | hypothetical protein;(source:Araport11) |
| AT3G48140 | B12D protein;(source:Araport11) |
| AT4G16146 | cAMP-regulated phosphoprotein 19-related protein;(source:Araport11) |
| AT2G23110 | Late embryogenesis abundant protein, group 6;(source:Araport11) |
| AT4G39320 | microtubule-associated protein-like protein;(source:Araport11) |
| AT2G18969 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
| AT3G04360 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT5G54760 | Translation initiation factor SUI1 family protein;(source:Araport11) |
| AT3G25120 | Mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein;(source:Araport11) |
| AT1G67105 | other_RNA;(source:Araport11) |
| AT3G17400 | F-box family protein;(source:Araport11) |
| AT5G25010 | enhanced disease resistance-like protein (DUF1336);(source:Araport11) |
| AT3G06760 | Drought-responsive family protein;(source:Araport11) |
| AT4G23510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G12040 | Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase family protein;(source:Araport11) |
| AT1G06010 | basic leucine zipper/W2 domain protein;(source:Araport11) |
| AT1G12500 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT3G51330 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G01210 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G42480 | TLR4 regulator/MIR-interacting MSAP protein;(source:Araport11) |
| AT2G46580 | Pyridoxamine 5-phosphate oxidase family protein;(source:Araport11) |
| AT5G27035 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.6e-16 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT1G70220 | RNA-processing, Lsm domain-containing protein;(source:Araport11) |
| AT1G64430 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G80280 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G39470 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G46730 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT5G59210 | myosin heavy chain-like protein;(source:Araport11) |
| AT2G41550 | Rho termination factor;(source:Araport11) |
| AT3G51340 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G15359 | hypothetical protein;(source:Araport11) |
| AT2G40095 | Alpha/beta hydrolase related protein;(source:Araport11) |
| AT5G01420 | Glutaredoxin family protein;(source:Araport11) |
| AT3G01430 | NHL domain protein;(source:Araport11) |
| AT1G01800 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G07590 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT4G00085 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT4G03480 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G55840 | PPR superfamily protein;(source:Araport11) |
| AT5G65290 | LMBR1-like membrane protein;(source:Araport11) |
| AT4G30390 | UDP-arabinopyranose mutase;(source:Araport11) |
| AT2G45610 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G69450 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT1G16930 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT4G09630 | transmembrane protein (DUF616);(source:Araport11) |
| AT1G16635 | other_RNA;(source:Araport11) |
| AT1G23440 | Peptidase C15, pyroglutamyl peptidase I-like protein;(source:Araport11) |
| AT2G48090 | hypothetical protein;(source:Araport11) |
| AT5G48270 | DUF868 family protein (DUF868);(source:Araport11) |
| AT1G05650 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G05860 | INO80 complex subunit D-like protein;(source:Araport11) |
| AT2G05786 | hypothetical protein;(source:Araport11) |
| AT3G59930 | Encodes a defensin-like (DEFL) family protein. |
| AT2G22820 | hypothetical protein;(source:Araport11) |
| AT1G45165 | Expressed protein;(source:Araport11) |
| AT4G26280 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G02580 | argininosuccinate lyase;(source:Araport11) |
| AT5G19875 | transmembrane protein;(source:Araport11) |
| AT2G42310 | ESSS subunit of NADH:ubiquinone oxidoreductase (complex I) protein;(source:Araport11) |
| AT3G61700 | helicase with zinc finger protein;(source:Araport11) |
| AT5G11820 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G15420 | hypothetical protein;(source:Araport11) |
| AT1G35513 | pseudogene of isochorismate synthase-related / isochorismate mutase-related |
| AT2G35585 | cystic fibrosis transmembrane conductance regulator;(source:Araport11) |
| AT5G43455 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT4G00895 | ATPase, F1 complex, OSCP/delta subunit protein;(source:Araport11) |
| AT2G40250 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT5G19570 | transmembrane protein;(source:Araport11) |
| AT4G13710 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G16100 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT5G14770 | PPR repeat protein;(source:Araport11) |
| AT1G03610 | plant/protein (DUF789);(source:Araport11) |
| AT1G52347 | None;(source:Araport11) |
| AT1G71070 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G01260 | Carbohydrate-binding-like fold;(source:Araport11) |
| AT4G01910 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G04810 | 26S proteasome regulatory complex, non-ATPase subcomplex, Rpn2/Psmd1 subunit;(source:Araport11) |
| AT1G78260 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G03502 | small nucleolar RNA |
| AT5G42110 | hypothetical protein;(source:Araport11) |
| AT2G34590 | Transketolase family protein;(source:Araport11) |
| AT3G03440 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G65820 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G10220 | ZCF37;(source:Araport11) |
| AT4G05150 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT4G27852 | Natural antisense transcript overlaps with AT4G27850 and AT4G27860;(source:Araport11) |
| AT1G68680 | SH3/FCH domain protein;(source:Araport11) |
| AT1G18900 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G15242 | other_RNA;(source:Araport11) |
| AT2G46060 | transmembrane protein-like protein;(source:Araport11) |
| AT3G59020 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G05812 | Natural antisense transcript overlaps with AT2G05810;(source:Araport11) |
| AT4G38552 | Natural antisense transcript overlaps with AT4G38550;(source:Araport11) |
| AT1G06002 | Natural antisense transcript overlaps with AT1G06000;(source:Araport11) |
| AT2G20480 | hypothetical protein;(source:Araport11) |
| AT2G45685 | Natural antisense transcript overlaps with AT2G45680;(source:Araport11) |
| AT3G44955 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
| AT3G14880 | transcription factor-like protein;(source:Araport11) |
| AT2G33390 | hypothetical protein;(source:Araport11) |
| AT2G38780 | cytochrome C oxidase subunit;(source:Araport11) |
| AT5G14450 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G27470 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT2G45720 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G07270 | GTP cyclohydrolase I;(source:Araport11) |
| AT2G45030 | Translation elongation factor EFG/EF2 protein;(source:Araport11) |
| AT5G28830 | calcium-binding EF hand family protein;(source:Araport11) |
| AT3G10915 | Reticulon family protein;(source:Araport11) |
| AT1G01448 | Natural antisense transcript overlaps with AT1G01450;(source:Araport11) |
| AT3G23880 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G24660 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-166 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT5G66340 | hypothetical protein;(source:Araport11) |
| AT3G07900 | O-fucosyltransferase family protein;(source:Araport11) |
| AT4G37420 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT3G14172 | GPI-anchored adhesin-like protein;(source:Araport11) |
| AT1G27030 | hypothetical protein;(source:Araport11) |
| AT1G24530 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G24230 | Pectate lyase family protein;(source:Araport11) |
| AT1G08230 | Codes for a H+-driven, high affinity gamma-aminobutyric acid (GABA) transporter. Localized at the plasma membrane. In planta, AtGAT1 expression was highest in flowers and under conditions of elevated GABA concentrations such as wounding or senescence. |
| AT3G51220 | WEB family protein (DUF827);(source:Araport11) |
| AT3G27520 | cryptic loci regulator;(source:Araport11) |
| AT4G26095 | Natural antisense transcript overlaps with AT4G26090;(source:Araport11) |
| AT3G05936 | hypothetical protein;(source:Araport11) |
| AT1G36940 | myotubularin-like protein;(source:Araport11) |
| AT1G73400 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G62220 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G69485 | Ribosomal L32p protein family;(source:Araport11) |
| AT3G56590 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G15500 | Ankyrin repeat family protein;(source:Araport11) |
| AT4G05087 | Pseudogene of AT5G16486 |
| AT1G68440 | Transmembrane protein;(source:Araport11). Expression induced by abiotic stressors such as ABA, drought, heat, light, NaCl, osmotic stress and wounding. |
| AT1G16870 | mitochondrial 28S ribosomal protein S29-like protein;(source:Araport11) |
| AT5G06865 | Natural antisense transcript overlaps with AT5G06860;(source:Araport11) |
| AT5G45472 | Potential natural antisense gene, locus overlaps with AT5G45470 |
| AT2G45023 | other_RNA;(source:Araport11) |
| AT3G06240 | F-box family protein;(source:Araport11) |
| AT5G23750 | Remorin family protein;(source:Araport11) |
| AT3G06433 | pseudogene of nodulin MtN3 family protein |
| AT3G51700 | PIF1 helicase;(source:Araport11) |
| AT5G66560 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT1G20890 | caveolin-1 protein;(source:Araport11) |
| AT4G38940 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G15220 | Ribosomal protein L27 family protein;(source:Araport11) |
| AT3G01520 | Encodes a universal stress protein (USP)-like protein that has been crystallized in complex with AMP, suggesting that it belongs to the ATP-binding USP subfamily. The mRNA is cell-to-cell mobile. |
| AT2G17680 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT1G18610 | Galactose oxidase/kelch repeat superfamily protein, induced by calcium. |
| AT5G01850 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G26810 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G13730 | Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein;(source:Araport11) |
| AT1G10100 | hypothetical protein;(source:Araport11) |
| AT1G11050 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G77780 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT1G70870 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G80290 | a member of the Glycosyltransferase Family 64 (according to CAZy Database) |
| AT3G14960 | Galactosyltransferase family protein;(source:Araport11) |
| AT4G39150 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT1G77040 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
| AT1G70944 | transmembrane protein;(source:Araport11) |
| AT1G15640 | transmembrane protein;(source:Araport11) |
| AT5G44418 | pseudogene of cytochrome P450;(source:Araport11) |
| AT1G79529 | Natural antisense transcript overlaps with AT1G79530;(source:Araport11) |
| AT2G41170 | F-box family protein;(source:Araport11) |
| AT2G01840 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.6e-34 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G58570 | transmembrane protein;(source:Araport11) |
| AT5G14690 | transmembrane protein;(source:Araport11) |
| AT5G01595 | Natural antisense transcript overlaps with AT5G01600;(source:Araport11) |
| AT5G53050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G01800 | saposin B domain-containing protein;(source:Araport11) |
| AT3G63003 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
| AT3G15356 | Legume lectin family protein;(source:Araport11) |
| AT5G11970 | ABC family ABC transporter, putative (DUF3511);(source:Araport11) |
| AT2G34340 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT5G46190 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT5G01732 | Natural antisense transcript overlaps with AT5G01730;(source:Araport11) |
| AT3G26630 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G63450 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G22510 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G71520 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT1G30440 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT5G22780 | Adaptor protein complex AP-2, alpha subunit;(source:Araport11) |
| AT1G55035 | pseudogene of importin alpha isoform 1;(source:Araport11) |
| AT2G28105 | replication factor-A carboxy-terminal domain protein;(source:Araport11) |
| AT2G34655 | hypothetical protein;(source:Araport11) |
| AT3G10986 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT1G56720 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G59865 | transmembrane protein;(source:Araport11) |
| AT1G15757 | Encodes a defensin-like (DEFL) family protein. |
| AT4G18460 | D-Tyr-tRNA(Tyr) deacylase family protein;(source:Araport11) |
| AT2G25280 | AmmeMemoRadiSam system protein B;(source:Araport11) |
| AT5G47380 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT3G15351 | P53/DNA damage-regulated protein;(source:Araport11) |
| AT1G35350 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT4G14930 | Survival protein SurE-like phosphatase/nucleotidase;(source:Araport11) |
| AT2G05518 | other_RNA;(source:Araport11) |
| AT2G16270 | transmembrane protein;(source:Araport11) |
| AT2G38610 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT4G02580 | NADH-ubiquinone oxidoreductase 24 kDa subunit;(source:Araport11) |
| AT2G40050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G54000 | TIP41-like protein;(source:Araport11) |
| AT1G10650 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT2G42485 | other_RNA;(source:Araport11) |
| AT1G64610 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G09950 | hypothetical protein;(source:Araport11) |
| AT5G04700 | Ankyrin repeat family protein;(source:Araport11) |
| AT2G47010 | calcium/calcium/calmodulin-dependent Serine/Threonine-kinase;(source:Araport11) |
| AT2G33051 | Natural antisense transcript overlaps with AT2G33050;(source:Araport11) |
| AT1G16630 | transmembrane protein;(source:Araport11) |
| AT4G34630 | prostatic spermine-binding-like protein;(source:Araport11) |
| AT5G56430 | F-box/FBD-like domains containing protein;(source:Araport11) |
| AT1G74510 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G10625 | flowering-promoting factor-like protein;(source:Araport11) |
| AT4G39970 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G26483 | nicotianamine synthase;(source:Araport11) |
| AT1G11710 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G14330 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G37980 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G07940 | dentin sialophosphoprotein-like protein;(source:Araport11) |
| AT3G24068 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G05610 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G02680 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G02340 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G30590 | RNA polymerase I specific transcription initiation factor RRN3 protein;(source:Araport11) |
| AT2G38260 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT2G14860 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
| AT5G59960 | K-stimulated pyrophosphate-energized sodium pump protein;(source:Araport11) |
| AT5G67510 | Translation protein SH3-like family protein;(source:Araport11) |
| AT4G00560 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G18240 | Rer1 family protein;(source:Araport11) |
| AT1G54120 | hypothetical protein;(source:Araport11) |
| AT3G48440 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G77620 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G16760 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G20635 | protein kinase and Mad3-BUB1-I domain-containing protein;(source:Araport11) |
| AT3G02760 | Class II aaRS and biotin synthetases superfamily protein;(source:Araport11) |
| AT2G44920 | Encodes a pentapeptide-repeat protein (PRP) composed of 25 repeats capped by N- and C-terminal a-helices. Unlike other PRPs, At2g44920 consists exclusively of type II b-turns |
| AT4G18815 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
| AT3G52920 | transcriptional activator (DUF662);(source:Araport11) |
| AT3G47550 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT2G15580 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G23100 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G68500 | hypothetical protein;(source:Araport11) |
| AT4G27020 | inositol-1,4,5-trisphosphate 5-phosphatase;(source:Araport11) |
| AT5G24990 | enhanced disease resistance-like protein (DUF1336);(source:Araport11) |
| AT5G62130 | Per1-like family protein;(source:Araport11) |
| AT5G03668 | Natural antisense transcript overlaps with AT5G03670;(source:Araport11) |
| AT2G44220 | NEP-interacting protein (DUF239);(source:Araport11) |
| AT4G03300 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G27780.1);(source:TAIR10) |
| AT1G64330 | myosin heavy chain-like protein;(source:Araport11) |
| AT3G20015 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G61200 | myosin heavy chain-like protein;(source:Araport11) |
| AT2G32850 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G15190 | hypothetical protein;(source:Araport11) |
| AT1G79260 | nitrobindin heme-binding domain protein;(source:Araport11) |
| AT3G19560 | F-box family protein;(source:Araport11) |
| AT4G21740 | transmembrane protein;(source:Araport11) |
| AT3G50840 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT5G03700 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11) |
| AT1G20015 | snoRNA;(source:Araport11) |
| AT3G62430 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
| AT4G28290 | hypothetical protein;(source:Araport11) |
| AT5G14035 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT1G62650 | pseudogene of P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G15350 | DUF4050 family protein;(source:Araport11) |
| AT3G62640 | DUF3511 domain protein (DUF3511);(source:Araport11) |
| AT5G46080 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G45490 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G05060 | PapD-like superfamily protein;(source:Araport11) |
| AT5G11000 | hypothetical protein (DUF868);(source:Araport11) |
| AT3G45310 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G77770 | forkhead box protein, putative (DUF1644);(source:Araport11) |
| AT2G45530 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G78250 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT5G26960 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G47240 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G54926.1);(source:TAIR10) |
| AT3G50845 | MIP18 family protein (DUF59);(source:Araport11) |
| AT4G12000 | SNARE associated Golgi protein family;(source:Araport11) |
| AT5G46915 | transcriptional factor B3 family protein;(source:Araport11) |
| AT2G22200 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT2G22821 | Natural antisense transcript overlaps with AT2G22820. The RNA is cell-to-cell mobile. |
| AT3G18560 | hypothetical protein;(source:Araport11) |
| AT3G25805 | transmembrane protein;(source:Araport11) |
| AT1G53860 | Encodes a protein that is highly methylated in a WT DML background. |
| AT4G32475 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT2G16610 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 6.1e-89 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
| AT2G35345 | hypothetical protein;(source:Araport11) |
| AT1G05700 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT1G10640 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G20880 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT4G01870 | tolB protein-like protein;(source:Araport11) |
| AT5G40540 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G18150 | Methyltransferase-related protein;(source:Araport11) |
| AT2G39440 | ribonuclease H2 subunit C-like protein;(source:Araport11) |
| AT3G19030 | transcription initiation factor TFIID subunit 1b-like protein;(source:Araport11) |
| AT2G43180 | Phosphoenolpyruvate carboxylase family protein;(source:Araport11) |
| AT2G24870 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT2G43300 | pre-tRNA tRNA-Thr (anticodon: TGT);(source:Araport11, TAIR10) |
| AT1G76240 | DUF241 domain protein (DUF241);(source:Araport11) |
| AT3G03826 | transmembrane protein;(source:Araport11) |
| AT2G27310 | F-box family protein;(source:Araport11) |
| AT5G43830 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
| AT1G71760 | hypothetical protein;(source:Araport11) |
| AT1G75960 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT5G51580 | hypothetical protein;(source:Araport11) |
| AT3G11890 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
| AT1G06645 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G30780 | ATP-dependent DNA helicase;(source:Araport11) |
| AT4G27250 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G26430 | Encodes a functioning member of the GDS(L) lipase family with preference for long chain substrates that does not hydrolyze choline esters. |
| AT5G57670 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G30180 | hypothetical protein;(source:Araport11) |
| AT5G14120 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G15830 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G49215 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G57120 | nucleolar/coiled-body phosphoprotein;(source:Araport11) |
| AT5G64600 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G67510 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G57910 | ribosomal RNA small subunit methyltransferase G;(source:Araport11) |
| AT1G28660 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G11580 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT3G24517 | hypothetical protein;(source:Araport11) |
| AT2G34580 | cytomegalovirus UL139 protein;(source:Araport11) |
| AT3G19970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G51350 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G01935 | insulin-induced protein;(source:Araport11) |
| AT4G39360 | hypothetical protein;(source:Araport11) |
| AT3G06435 | Expressed protein;(source:Araport11) |
| AT3G45320 | transmembrane protein;(source:Araport11) |
| AT5G61450 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G63510 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
| AT5G57100 | Nucleotide/sugar transporter family protein;(source:Araport11) |
| AT1G54820 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G55680 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G45638 | other_RNA;(source:Araport11) |
| AT2G41178 | Natural antisense transcript overlaps with AT2G41180;(source:Araport11) |
| AT1G16180 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
| AT5G42250 | Zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
| AT2G32430 | Galactosyltransferase family protein;(source:Araport11) |
| AT2G32150 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G80640 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G13100 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G29450 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G48315 | Natural antisense transcript overlaps with AT1G48320;(source:Araport11) |
| AT5G44415 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G09370.1);(source:TAIR10) |
| AT5G45475 | other_RNA;(source:Araport11) |
| AT5G37280 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G35180 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT2G29600 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G19390 | Uncharacterized protein family (UPF0114);(source:Araport11) |
| AT1G71000 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G20310 | syringolide-induced protein;(source:Araport11) |
| AT3G61610 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT2G02370 | SNARE associated Golgi protein family;(source:Araport11) |
| AT5G05210 | Surfeit locus protein 6;(source:Araport11) |
| AT1G79070 | SNARE-associated protein-like protein;(source:Araport11) |
| AT1G35465 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-27 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G38700 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT1G52180 | Aquaporin-like superfamily protein;(source:Araport11) |
| AT1G18335 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT4G23530 | ROH1, putative (DUF793);(source:Araport11) |
| AT5G66580 | PADRE protein. |
| AT3G26935 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT5G65240 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G29670 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G29025 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G63835 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-17 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT1G19110 | inter-alpha-trypsin inhibitor heavy chain-like protein;(source:Araport11) |
| AT3G08620 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT3G55870 | ADC synthase superfamily protein;(source:Araport11) |
| AT2G29065 | GRAS family transcription factor;(source:Araport11) |
| AT5G53880 | hypothetical protein;(source:Araport11) |
| AT5G01610 | hypothetical protein (Protein of unknown function, DUF538);(source:Araport11) |
| AT1G06610 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT3G50123 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G01960 | transmembrane protein;(source:Araport11) |
| AT4G20365 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-254 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT1G22330 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G47370 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT2G27090 | bZIP transcription factor (DUF630 and DUF632);(source:Araport11) |
| AT4G32870 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT2G42975 | myosin-G heavy chain-like protein;(source:Araport11) |
| AT5G51360 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT3G52110 | interferon-activable protein;(source:Araport11) |
| AT1G20320 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT3G56360 | hypothetical protein;(source:Araport11) |
| AT5G54950 | Aconitase family protein;(source:Araport11) |
| AT2G46780 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G55600 | Membrane fusion protein Use1;(source:Araport11) |
| AT1G70160 | zinc finger MYND domain protein;(source:Araport11) |
| AT5G15845 | Natural antisense transcript overlaps with AT5G15850;(source:Araport11) |
| AT2G45600 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G44470 | ribonuclease H superfamily polynucleotidyl transferase;(source:Araport11) |
| AT5G18130 | transmembrane protein;(source:Araport11) |
| AT3G25727 | non-LTR retrolelement reverse transcriptase;(source:Araport11) |
| AT3G12710 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G76700 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT1G05350 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G38700 | cotton fiber protein;(source:Araport11) |
| AT1G49000 | transmembrane protein;(source:Araport11) |
| AT1G28390 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G19630 | Radical SAM superfamily protein;(source:Araport11) |
| AT2G35470 | ribosome maturation factor;(source:Araport11) |
| AT5G54480 | hypothetical protein (DUF630 and DUF632);(source:Araport11) |
| AT3G19035 | transmembrane protein;(source:Araport11) |
| AT1G14260 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT5G41400 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G61997 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G39420 | spatacsin carboxy-terminus protein;(source:Araport11) |
| AT5G50450 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
| AT1G74630 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G64618 | other_RNA;(source:Araport11) |
| AT2G39130 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT2G02700 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G22426 | hypothetical protein;(source:Araport11) |
| AT1G69150 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G06980 | PADRE protein |
| AT5G49440 | hypothetical protein;(source:Araport11) |
| AT1G67910 | hypothetical protein;(source:Araport11) |
| AT1G48450 | alanine-tRNA ligase, putative (DUF760);(source:Araport11) |
| AT3G45840 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G12230 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G23450 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G02430 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G61545 | pre-tRNA tRNA-Glu (anticodon: CTC);(source:Araport11, TAIR10) |
| AT5G10525 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
| AT3G26510 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G37870 | Protein with RING/U-box and TRAF-like domain;(source:Araport11) |
| AT1G53935 | hypothetical protein;(source:Araport11) |
| AT1G77750 | Ribosomal protein S13/S18 family;(source:Araport11) |
| AT4G30000 | Dihydropterin pyrophosphokinase / Dihydropteroate synthase;(source:Araport11) |
| AT3G58700 | Ribosomal L5P family protein;(source:Araport11) |
| AT3G43520 | Transmembrane proteins 14C;(source:Araport11) |
| AT1G11220 | cotton fiber, putative (DUF761);(source:Araport11) |
| AT1G45230 | DCL protein (DUF3223);(source:Araport11) |
| AT3G57780 | nucleolar-like protein;(source:Araport11) |
| AT3G26950 | transmembrane protein;(source:Araport11) |
| AT4G37480 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT3G60520 | zinc ion-binding protein;(source:Araport11) |
| AT4G13530 | transmembrane protein;(source:Araport11) |
| AT5G44375 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT2G19460 | DUF3511 domain protein (DUF3511);(source:Araport11) |
| AT5G62865 | hypothetical protein;(source:Araport11) |
| AT5G40680 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G30090 | golgin family A protein;(source:Araport11) |
| AT3G57070 | Glutaredoxin family protein;(source:Araport11) |
| AT2G41082 | hypothetical protein;(source:Araport11) |
| AT2G18850 | SET domain-containing protein;(source:Araport11) |
| AT1G14470 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G61950 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT2G40280 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G08050 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT5G51560 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G38020 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
| AT5G51980 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G77020 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT3G15040 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT5G15110 | Pectate lyase family protein;(source:Araport11) |
| AT3G10415 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT3G57400 | transmembrane protein;(source:Araport11) |
| AT5G57340 | ras guanine nucleotide exchange factor Q-like protein;(source:Araport11) |
| AT5G19760 | Encodes a novel mitochondrial carrier capable of transporting both dicarboxylates (such as malate, oxaloacetate, oxoglutarate, and maleate) and tricarboxylates (such as citrate, isocitrate, cis-aconitate, and trans-aconitate). |
| AT4G05230 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G46780 | VQ motif-containing protein;(source:Araport11) |
| AT1G52618 | hypothetical protein;(source:Araport11) |
| AT2G02960 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT1G50590 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT4G32030 | hypothetical protein;(source:Araport11) |
| AT5G02350 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G10830 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.1e-39 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G38390 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G27285 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G39950 | flocculation protein;(source:Araport11) |
| AT5G11700 | ephrin type-B receptor;(source:Araport11) |
| AT1G66880 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G25050 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G05330 | Encodes a protein with a putative HMG-box domain. The high-mobility group (HMG) proteins are chromatin-associated proteins that act as architectural factors in various nucleoprotein structures, which regulate DNA-dependent processes such as transcription and recombination. Expression of this gene was not detected according to Grasser et al. (J. Mol. Biol. 2006:358, 654-664). |
| AT3G15760 | cytochrome P450 family protein;(source:Araport11) |
| AT2G19100 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.2e-33 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT4G17765 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT3G17580 | SsrA-binding protein;(source:Araport11) |
| AT5G14110 | peroxidase (DUF 3339);(source:Araport11) |
| AT5G05230 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G77250 | RING/FYVE/PHD-type zinc finger family protein;(source:Araport11) |
| AT4G01595 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G35859 | Natural antisense transcript overlaps with AT2G35860;(source:Araport11) |
| AT3G26100 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT3G14250 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G74940 | cyclin-dependent kinase, putative (DUF581);(source:Araport11) |
| AT3G12870 | transmembrane protein;(source:Araport11) |
| AT1G77100 | peroxidase superfamily protein;(source:Araport11) |
| AT2G25070 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G19990 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT1G77145 | transmembrane protein, putative (DUF506);(source:Araport11) |
| AT5G55855 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G58340 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
| AT1G69252 | other_RNA;(source:Araport11) |
| AT5G57480 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G15800 | hypothetical protein;(source:Araport11) |
| AT5G07610 | F-box family protein;(source:Araport11) |
| AT5G07620 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G58520 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G05932 | Potential natural antisense gene, locus overlaps with AT3G05930 |
| AT4G33540 | metallo-beta-lactamase family protein;(source:Araport11) |
| AT4G17100 | poly(U)-specific endoribonuclease-B protein;(source:Araport11) |
| AT4G27810 | hypothetical protein;(source:Araport11) |
| AT5G25030 | ATP-binding protein (DUF2431);(source:Araport11) |
| AT3G21620 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
| AT5G56745 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT2G43110 | U3 containing 90S pre-ribosomal complex subunit;(source:Araport11) |
| AT2G18090 | PHD finger family protein / SWIB complex BAF60b domain-containing protein / GYF domain-containing protein;(source:Araport11) |
| AT1G27020 | plant/protein;(source:Araport11) |
| AT3G01830 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT5G28145 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.1e-195 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT4G38300 | glycosyl hydrolase family 10 protein;(source:Araport11) |
| AT3G51560 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G21400 | Thiamin diphosphate-binding fold (THDP-binding) superfamily protein;(source:Araport11) |
| AT5G18850 | Low-density receptor-like protein;(source:Araport11) |
| AT4G25680 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
| AT2G37160 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G09590 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT1G48690 | Auxin-responsive GH3 family protein;(source:Araport11) |
| AT3G56420 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G68185 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G46970 | pectin methylesterase inhibitor |
| AT1G06050 | ENHANCED DISEASE RESISTANCE-like protein (DUF1336);(source:Araport11) |
| AT1G27050 | Encodes a protein with a RNA recognition motif. Previously annotated as ATHB54, a homeodomain leucine zipper (HD-Zip) family protein. In the TAIR10 genome release (2010), this locus was split into two loci: AT1G27045 (containing homeodomain and leucine zipper domains) and AT1G27050 (containing a RNA recognition motif). AT1G27045 is now named ATHB54. Note that Affymetrix ATH1 Probe Set linked to symbol ATHB54 is in fact directed against the product of the AT1G27050 locus (the mRNA coding for the RNA-recognition-motif protein). |
| AT4G33625 | vacuole protein;(source:Araport11) |
| AT2G29628 | hypothetical protein;(source:Araport11) |
| AT3G50650 | GRAS family transcription factor;(source:Araport11) |
| AT5G09880 | Splicing factor, CC1-like protein;(source:Araport11) |
| AT1G55210 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT4G36370 | hypothetical protein;(source:Araport11) |
| AT1G23052 | other_RNA;(source:Araport11) |
| AT4G32140 | EamA-like transporter family;(source:Araport11) |
| AT2G29590 | Thioesterase superfamily protein;(source:Araport11) |
| AT1G74840 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G66652 | fip1 motif-containing protein;(source:Araport11) |
| AT1G28815 | hypothetical protein;(source:Araport11) |
| AT2G27930 | PLATZ transcription factor family protein;(source:Araport11) |
| AT1G65830 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT3G05835 | pre-tRNA tRNA-Ile (anticodon: TAT);(source:Araport11, TAIR10) |
| AT5G01870 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT5G41460 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT5G18920 | Cox19-like CHCH family protein;(source:Araport11) |
| AT4G02630 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G05753 | hypothetical protein;(source:Araport11) |
| AT3G14060 | hypothetical protein;(source:Araport11) |
| AT5G02700 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G64420 | DNA polymerase V family;(source:Araport11) |
| AT5G11020 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G20060 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G11760 | structural maintenance of chromosomes flexible hinge domain protein;(source:Araport11) |
| AT4G37240 | PADRE protein down-regulated after infection by S. sclerotiorun. |
| AT5G57760 | hypothetical protein;(source:Araport11) |
| AT1G30090 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G66053 | hypothetical protein;(source:Araport11) |
| AT2G31130 | hypothetical protein;(source:Araport11) |
| AT2G36295 | hypothetical protein;(source:Araport11) |
| AT3G05400 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G14270 | CAAX amino terminal protease family protein;(source:Araport11) |
| AT4G28330 | pyrroline-5-carboxylate reductase;(source:Araport11) |
| AT5G56544 | pseudogene of arginyl-tRNA synthetase |
| AT3G05425 | hypothetical protein;(source:Araport11) |
| AT1G06640 | encodes a protein whose sequence is similar to a 2-oxoglutarate-dependent dioxygenase The mRNA is cell-to-cell mobile. |
| AT4G05040 | ankyrin repeat family protein;(source:Araport11) |
| AT3G50685 | anti-muellerian hormone type-2 receptor;(source:Araport11) |
| AT4G40042 | Microsomal signal peptidase 12 kDa subunit (SPC12);(source:Araport11) |
| AT5G56840 | myb-like transcription factor family protein;(source:Araport11) |
| AT1G01310 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT3G06995 | Encodes a Defensin-like (DEFL) family protein [pseudogene] |
| AT4G37380 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G21187 | Natural antisense transcript overlaps with AT2G21185;(source:Araport11) |
| AT2G43320 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G59390 | XH/XS domain-containing protein;(source:Araport11) |
| AT5G05180 | myosin heavy chain, striated protein;(source:Araport11) |
| AT1G77670 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT1G25230 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT3G13677 | hypothetical protein;(source:Araport11) |
| AT4G20880 | ethylene-responsive nuclear protein / ethylene-regulated nuclear protein (ERT2);(source:Araport11) |
| AT1G17350 | NADH:ubiquinone oxidoreductase intermediate-associated protein 30;(source:Araport11) |
| AT1G50630 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
| AT3G22440 | FRIGIDA-like protein;(source:Araport11) |
| AT1G52010 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.8e-81 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT1G75140 | membrane protein;(source:Araport11) |
| AT4G10910 | hypothetical protein;(source:Araport11) |
| AT4G24790 | AAA-type ATPase family protein;(source:Araport11) |
| AT2G17760 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G42425 | other_RNA;(source:Araport11) |
| AT1G13360 | hypothetical protein;(source:Araport11) |
| AT3G06840 | hypothetical protein;(source:Araport11) |
| AT1G62870 | hypothetical protein;(source:Araport11) |
| AT4G22830 | YCF49-like protein;(source:Araport11) |
| AT1G35255 | transmembrane protein;(source:Araport11) |
| AT1G12340 | Cornichon family protein;(source:Araport11) |
| AT2G36026 | Ovate family protein;(source:Araport11) |
| AT5G01250 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
| AT4G36500 | hypothetical protein;(source:Araport11) |
| AT2G42900 | Plant basic secretory protein (BSP) family protein;(source:Araport11) |
| AT3G23530 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
| AT5G57655 | xylose isomerase family protein;(source:Araport11) |
| AT1G08900 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G33960 | hypothetical protein;(source:Araport11) |
| AT2G11140 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.0e-71 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G29195 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT1G08890 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G60340 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G17390 | Ribosomal protein L23/L15e family protein;(source:Araport11) |
| AT3G59765 | None;(source:Araport11) |
| AT1G10020 | formin-like protein (DUF1005);(source:Araport11) |
| AT1G70150 | zinc ion binding protein;(source:Araport11) |
| AT5G52890 | AT hook motif-containing protein;(source:Araport11) |
| AT5G50890 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G54440 | glycoside hydrolase family 2 protein;(source:Araport11) |
| AT5G24170 | Got1/Sft2-like vescicle transport protein family;(source:Araport11) |
| AT1G72240 | hypothetical protein;(source:Araport11) |
| AT4G15140 | hypothetical protein;(source:Araport11) |
| AT5G23370 | GRAM domain-containing protein / ABA-responsive protein-like protein;(source:Araport11) |
| AT5G44417 | pseudogene of FAD-binding Berberine family protein;(source:Araport11) |
| AT5G67350 | hypothetical protein;(source:Araport11) |
| AT1G14170 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT1G72100 | late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11) |
| AT5G15870 | glycosyl hydrolase family 81 protein;(source:Araport11) |
| AT3G06750 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G50560 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G41620 | Nucleoporin interacting component (Nup93/Nic96-like) family protein;(source:Araport11) |
| AT3G05180 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G30480 | hypothetical protein;(source:Araport11) |
| AT1G66173 | other_RNA;(source:Araport11) |
| AT4G14240 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
| AT3G07580 | hypothetical protein;(source:Araport11) |
| AT4G26488 | Natural antisense transcript overlaps with AT4G26490;(source:Araport11) |
| AT1G29650 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-28 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G10580 | plant/protein (Protein of unknown function, DUF599);(source:Araport11) |
| AT3G42950 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G27210 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G32110 | Beta-1,3-N-Acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G76250 | transmembrane protein;(source:Araport11) |
| AT1G09870 | histidine acid phosphatase family protein;(source:Araport11) |
| AT5G41900 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G26860 | Putative pyridoxal phosphate-dependent enzyme, YBL036C type;(source:Araport11) |
| AT1G69760 | suppressor SRP40-like protein;(source:Araport11) |
| AT3G27540 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT4G31110 | Wall-associated kinase family protein;(source:Araport11) |
| AT1G01355 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT2G40260 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G44569 | other_RNA;(source:Araport11) |
| AT5G47445 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.6e-84 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT2G29780 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G64405 | hypothetical protein;(source:Araport11) |
| AT2G45750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G05090 | Inositol monophosphatase family protein;(source:Araport11) |
| AT5G16200 | 50S ribosomal protein-like protein;(source:Araport11) |
| AT2G28460 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G10720 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT1G69543 | Pseudogene of AT1G74220 |
| AT3G12170 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G19000 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G47490 | HNH endonuclease;(source:Araport11) |
| AT5G08055 | Encodes a defensin-like (DEFL) family protein. |
| AT5G05480 | Peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase A protein;(source:Araport11) |
| AT2G35050 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
| AT2G21990 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT1G13910 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT4G16490 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G77880 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G21670 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
| AT1G24440 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G03850 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT3G47830 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G61750 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT5G67170 | SEC-C motif-containing protein / OTU-like cysteine protease family protein;(source:Araport11) |
| AT1G21835 | Thionin-like gene involved in resistance against the beet cyst nematode (Heterodera schachtii). |
| AT1G47860 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-40 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G07550 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G45960 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G51990 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G10290 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
| AT4G02820 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G33790 | jacalin lectin family protein;(source:Araport11) |
| AT1G75400 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G12790 | DNA ligase-like protein;(source:Araport11) |
| AT5G43140 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
| AT3G42570 | peroxidase family protein;(source:Araport11) |
| AT1G17850 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT3G30737 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, blastp match of 48%25 identity and 0. P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT2G47720 | hypothetical protein;(source:Araport11) |
| AT5G65910 | BSD domain-containing protein;(source:Araport11) |
| AT3G63006 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
| AT3G11673 | pseudogene of F-box family protein |
| AT1G66510 | AAR2 protein family;(source:Araport11) |
| AT5G14700 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G21722 | transmembrane protein;(source:Araport11) |
| AT1G35150 | General transcription factor 2-related zinc finger protein;(source:Araport11) |
| AT1G01570 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT4G21420 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.9e-06 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
| AT3G11780 | MD-2-related lipid recognition domain-containing protein / ML domain-containing protein;(source:Araport11) |
| AT4G16970 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G36290 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G19572 | Potential natural antisense gene, locus overlaps with AT2G19570 |
| AT3G55646 | TPRXL;(source:Araport11) |
| AT2G20410 | RNA-binding ASCH domain protein;(source:Araport11) |
| AT5G20790 | transmembrane protein;(source:Araport11) |
| AT2G47440 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G24760 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G60286 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G22730 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT2G39650 | cruciferin (DUF506);(source:Araport11) |
| AT1G30030 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.5e-30 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
| AT4G14230 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
| AT1G68490 | translocase subunit seca;(source:Araport11) |
| AT4G25390 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G07830 | ribosomal protein L29 family protein;(source:Araport11) |
| AT3G61920 | PADRE protein. |
| AT4G14490 | SMAD/FHA domain-containing protein;(source:Araport11) |
| AT5G24100 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G57940 | GNAT acetyltransferase (DUF699);(source:Araport11) |
| AT1G19310 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G48990 | Oleosin family protein;(source:Araport11) |
| AT3G07280 | None;(source:Araport11) |
| AT2G04622 | transmembrane protein;(source:Araport11) |
| AT5G20050 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G13950 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G66490 | hypothetical protein;(source:Araport11) |
| AT5G01390 | DNAJ heat shock family protein;(source:Araport11) |
| AT5G20500 | Glutaredoxin family protein;(source:Araport11) |
| AT1G16210 | coiled-coil protein;(source:Araport11) |
| AT5G25520 | SPOC domain / Transcription elongation factor S-II protein;(source:Araport11) |
| AT3G46320 | Histone superfamily protein;(source:Araport11) |
| AT1G02610 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT5G52130 | hypothetical protein;(source:Araport11) |
| AT1G21080 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT5G65676 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-191 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT2G37240 | Thioredoxin superfamily protein;(source:Araport11) |
| AT2G05765 | snoRNA;(source:Araport11) |
| AT1G15410 | aspartate-glutamate racemase family;(source:Araport11) |
| AT5G22355 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G55410 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G61810 | Glycosyl hydrolase family 17 protein;(source:Araport11) |
| AT2G04220 | DUF868 family protein (DUF868);(source:Araport11) |
| AT3G56085 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT3G26910 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G78480 | Prenyltransferase family protein;(source:Araport11) |
| AT5G08060 | furry;(source:Araport11) |
| AT2G27870 | transposable_element_gene;(source:Araport11);similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT2G22350.1);(source:TAIR10) |
| AT4G31100 | wall-associated kinase;(source:Araport11) |
| AT1G70740 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G39865 | transmembrane protein;(source:Araport11) |
| AT2G02170 | Remorin family protein;(source:Araport11) |
| AT1G70420 | DNA ligase-like protein, putative (DUF1645);(source:Araport11) |
| AT1G31920 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G17140 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G10745 | transmembrane protein;(source:Araport11) |
| AT5G01780 | 2-oxoglutarate-dependent dioxygenase family protein;(source:Araport11) |
| AT1G77280 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT3G30733 | pseudogene of RING/U-box superfamily protein;(source:Araport11) |
| AT3G13000 | ubiquinone biosynthesis protein (Protein of unknown function, DUF547);(source:Araport11) |
| AT4G30900 | DNAse I-like superfamily protein;(source:Araport11) |
| AT1G33360 | Encodes ClpX3, a subunit of the Clp protease complex. |
| AT5G23170 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G01300 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
| AT1G04570 | Similar to plastid solute transporters. |
| AT1G18550 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT5G24010 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G03810 | 18S pre-ribosomal assembly protein gar2-like protein;(source:Araport11) |
| AT4G18380 | F-box family protein;(source:Araport11) |
| AT3G43960 | Encodes a putative cysteine proteinase. Mutants exhibit shorter root hairs under phosphate-deficient conditions. |
| AT5G15340 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G25680 | SLH domain protein;(source:Araport11) |
| AT4G40085 | Natural antisense transcript overlaps with AT4G40080;(source:Araport11) |
| AT4G25280 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G25700 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G44680 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT5G23690 | Polynucleotide adenylyltransferase family protein;(source:Araport11) |
| AT3G01360 | plant viral-response family protein (DUF716);(source:Araport11) |
| AT2G23690 | PADRE protein. |
| AT1G22180 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT4G31760 | peroxidase superfamily protein;(source:Araport11) |
| AT5G57500 | Galactosyltransferase family protein;(source:Araport11) |
| AT3G05327 | Cyclin family protein;(source:Araport11) |
| AT3G17780 | B-cell receptor-associated-like protein;(source:Araport11) |
| AT5G53500 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G08680 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G52360 | transmembrane protein;(source:Araport11) |
| AT1G79160 | filamentous hemagglutinin transporter;(source:Araport11) |
| AT1G29790 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G02055 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT3G13650 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT4G28060 | Cytochrome c oxidase, subunit Vib family protein;(source:Araport11) |
| AT3G47160 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G04540 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT5G07360 | Amidase family protein;(source:Araport11) |
| AT3G62110 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G22241 | hypothetical protein;(source:Araport11) |
| AT1G51230 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G50150 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT5G09620 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G51380 | RNI-like superfamily protein;(source:Araport11) |
| AT3G09060 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G03620 | ELMO/CED-12 family protein;(source:Araport11) |
| AT4G23740 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G32172 | other_RNA;(source:Araport11) |
| AT1G67792 | Natural antisense transcript overlaps with AT1G67790;(source:Araport11) |
| AT4G34975 | pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10) |
| AT1G19970 | ER lumen protein retaining receptor family protein;(source:Araport11) |
| AT1G03935 | snoRNA;(source:Araport11) |
| AT1G18560 | BED zinc finger and hAT dimerization domain-containing protein;(source:Araport11) |
| AT1G26930 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G01500 | Erythronate-4-phosphate dehydrogenase family protein;(source:Araport11) |
| AT1G47900 | filament-like protein (DUF869);(source:Araport11) |
| AT1G74370 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G22980 | molybdenum cofactor sulfurase-like protein;(source:Araport11) |
| AT1G71080 | RNA polymerase II transcription elongation factor;(source:Araport11) |
| AT4G29310 | DUF1005 family protein (DUF1005);(source:Araport11) |
| AT4G29680 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT1G21680 | DPP6 N-terminal domain-like protein;(source:Araport11) |
| AT5G15320 | ATP synthase E chain;(source:Araport11) |
| AT2G32560 | F-box family protein;(source:Araport11) |
| AT2G18210 | hypothetical protein;(source:Araport11) |
| AT4G29560 | fanconi anemia group E protein FANCE protein;(source:Araport11) |
| AT4G22850 | SNARE associated Golgi protein family;(source:Araport11) |
| AT2G45315 | Natural antisense transcript overlaps with AT2G45310;(source:Araport11) |
| AT3G50340 | hypothetical protein;(source:Araport11) |
| AT3G20340 | Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT1G58110 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT5G42825 | hypothetical protein;(source:Araport11) |
| AT4G16630 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT2G38300 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
| AT4G01130 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G01335 | TATA box-binding protein associated factor RNA polymerase I subunit B-like protein;(source:Araport11) |
| AT3G47250 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT1G52750 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G59395 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
| AT1G32160 | beta-casein (DUF760);(source:Araport11) |
| AT2G17670 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G14240 | Subtilase family protein;(source:Araport11) |
| AT5G25920 | hypothetical protein;(source:Araport11) |
| AT5G06440 | polyketide cyclase/dehydrase/lipid transport superfamily protein;(source:Araport11) |
| AT5G63410 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G11740 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT4G18810 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G24260 | prolyl oligopeptidase family protein;(source:Araport11) |
| AT5G57210 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT1G27350 | Ribosome associated membrane protein RAMP4;(source:Araport11) |
| AT2G30700 | GPI-anchored protein;(source:Araport11) |
| AT1G48440 | B-cell receptor-associated 31-like protein;(source:Araport11) |
| AT1G78940 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT5G56350 | Pyruvate kinase family protein;(source:Araport11) |
| AT1G62421 | hypothetical protein;(source:Araport11) |
| AT4G08038 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to reverse transcriptase, putative;(source:TAIR10) |
| AT5G62830 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT5G60570 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G59540 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G21590 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
| AT4G28025 | hypothetical protein;(source:Araport11) |
| AT3G04903 | Encodes a defensin-like (DEFL) family protein. |
| AT1G35610 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G28660 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G29090 | Ribonuclease H-like superfamily protein;(source:Araport11) |
| AT5G44690 | RING finger PFF0165c-like protein;(source:Araport11) |
| AT3G24614 | Encodes a Z4 snoRNA. Gb: AJ240073 |
| AT5G37540 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G40045 | transmembrane protein;(source:Araport11) |
| AT3G57062 | transmembrane protein;(source:Araport11) |
| AT3G60110 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT4G13230 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT5G43020 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G04690 | Ankyrin repeat family protein;(source:Araport11) |
| AT2G03690 | Ubiquinone biosynthesis protein COQ4 homolog. |
| AT1G02890 | AAA-type ATPase family protein;(source:Araport11) |
| AT5G23350 | GRAM domain protein/ABA-responsive-like protein;(source:Araport11) |
| AT5G23950 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT1G19860 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT5G65440 | transmembrane protein;(source:Araport11) |
| AT3G22750 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G13380 | sodium/hydrogen exchanger (DUF1218);(source:Araport11) |
| AT3G10760 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G24840 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G07010 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G66052 | transmembrane protein;(source:Araport11) |
| AT2G46000 | LDL receptor wingless signaling/trafficking chaperone;(source:Araport11) |
| AT4G22250 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G04135 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G33303.1);(source:TAIR10) |
| AT3G29180 | DUF1336 family protein (DUF1336);(source:Araport11) |
| AT1G28100 | hypothetical protein;(source:Araport11) |
| AT5G20740 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G30340 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G01430 | Got1/Sft2-like vescicle transport protein family;(source:Araport11) |
| AT5G46380 | Serine/Threonine-kinase, putative (DUF1296);(source:Araport11) |
| AT1G78030 | hypothetical protein;(source:Araport11) |
| AT2G42480 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT5G18015 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT3G23930 | troponin T, skeletal protein;(source:Araport11) |
| AT5G52580 | RabGAP/TBC domain-containing protein;(source:Araport11) |
| AT1G63840 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G44700 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G30490 | AFG1-like ATPase family protein;(source:Araport11) |
| AT2G37960 | myosin-M heavy protein;(source:Araport11) |
| AT2G44770 | ELMO/CED-12 family protein;(source:Araport11) |
| AT1G20940 | F-box family protein;(source:Araport11) |
| AT5G44170 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G01820 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G78230 | Outer arm dynein light chain 1 protein;(source:Araport11) |
| AT3G56350 | Iron/manganese superoxide dismutase family protein;(source:Araport11) |
| AT5G56520 | hypothetical protein;(source:Araport11) |
| AT1G53040 | tRNA (met) cytidine acetyltransferase, putative (DUF616);(source:Araport11) |
| AT5G03660 | transcriptional activator (DUF662);(source:Araport11) |
| AT1G72510 | DUF1677 family protein (DUF1677);(source:Araport11) |
| AT3G15260 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT1G62981 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT1G32650 | hypothetical protein;(source:Araport11) |
| AT1G77660 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT2G27950 | Ring/U-Box superfamily protein;(source:Araport11) |
| AT4G39160 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT4G26770 | Phosphatidate cytidylyltransferase family protein;(source:Araport11) |
| AT5G65925 | hypothetical protein;(source:Araport11) |
| AT4G14900 | FRIGIDA-like protein;(source:Araport11) |
| AT1G18990 | myosin-binding protein, putative (Protein of unknown function, DUF593);(source:Araport11) |
| AT3G50800 | PADRE protein. |
| AT1G19500 | hypothetical protein;(source:Araport11) |
| AT5G57123 | hypothetical protein;(source:Araport11) |
| AT5G66290 | hypothetical protein;(source:Araport11) |
| AT5G14020 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT3G17800 | mRNA level of the MEB5.2 gene (At3g17800) remains unchanged after cutting the inflorescence stem |
| AT3G19274 | hypothetical protein;(source:Araport11) |
| AT3G59670 | elongation factor;(source:Araport11) |
| AT1G16489 | Natural antisense transcript overlaps with AT1G16490;(source:Araport11) |
| AT5G51370 | RNI-like superfamily protein;(source:Araport11) |
| AT2G26730 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G10090 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT2G21185 | transmembrane protein;(source:Araport11) |
| AT1G67190 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT4G27790 | Calcium-binding EF hand family protein;(source:Araport11) |
| AT4G14819 | hypothetical protein (DUF1677);(source:Araport11) |
| AT4G03820 | transmembrane protein, putative (DUF3537);(source:Araport11) |
| AT2G12462 | sterile alpha motif (SAM) domain protein;(source:Araport11) |
| AT3G59923 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT2G38500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G49730 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G13845 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
| AT2G24645 | Transcriptional factor B3 family protein;(source:Araport11) |
| AT5G53010 | calcium-transporting ATPase;(source:Araport11) |
| AT3G27050 | plant/protein;(source:Araport11) |
| AT5G15546 | Represents a small remnant of a former expansin family pseudogene. According to Sampedro et al. (Plant J 44:409-419, 2005), AT5G15546 does not qualify as a bona fide gene since it has so badly degraded. |
| AT1G19570 | Encodes a member of the dehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica.Encodes about 50-60% of extractable leaf GSH-dependent DHAR activity, but single knockout mutants show unaltered ascorbate and glutathione status in optimal and oxidative stress conditions (PMID:28381499). Acts redundantly with DHAR2 to oxidize glutathione in response to increased intracelullar hydrogen peroxide (catalase deficiency) . Complementation of a cat2 dhar1 dhar2 dhar3 quadruple mutant with DHAR1 fully restores cat2 phenotype and pathogenesis-related responses |
| AT1G03410 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G09570 | Lung seven transmembrane receptor family protein;(source:Araport11) |
| AT5G42090 | Lung seven transmembrane receptor family protein;(source:Araport11) |
| AT5G24810 | ABC1 family protein;(source:Araport11) |
| AT5G19140 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
| AT1G76010 | Alba DNA/RNA-binding protein;(source:Araport11) |
| AT3G07030 | Alba DNA/RNA-binding protein;(source:Araport11) |
| AT5G02530 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT4G00370 | Encodes an inorganic phosphate transporter (PHT4;4) that can transport ascorbate and is located in the chloroplast envelope membrane. It has been shown to play a role in the xanthophyll cycle during photosynthesis and may be required for tolerance to strong light stress. |
| AT4G03070 | Encodes a possible 2-oxoglutarate-dependent dioxygenase that is involved in glucosinolate biosynthesis. The gene is expressed in all ecotypes examined but the enzymatic activity has not been determined experimentally. In Col, there is one copy of this gene (aka AOP1.1) but Ler contains two copies, AOP1.1 and a tightly linked AOP1.2. |
| AT2G30020 | Encodes AP2C1. Belongs to the clade B of the PP2C-superfamily. Acts as a MAPK phosphatase that negatively regulates MPK4 and MPK6. |
| AT1G07570 | Protein kinase capable of phosphorylating tyrosine, serine, and threonine residues |
| AT4G18020 | Encodes pseudo-response regulator 2 (APRR2) that interacts with a calcium sensor (CML9). |
| AT5G43780 | sulfate adenylyltransferase, ATP sulfurylase |
| AT2G26530 | Pheromone receptor-like protein involved in the early elicitor signaling events which occur within minutes and include ion fluxes across the plasma membrane, activation of MPKs and the formation of ROS related to PGPS1 and WRKY33. |
| AT5G67360 | Encodes a subtilisin-like serine protease essential for mucilage release from seed coats. |
| AT2G43130 | encodes a protein belonging to the Rab/Ypt family of small GTPases, which are implicated in intracellular vesicular traffic. |
| AT3G54840 | Encodes a novel Rab-like GTP-ase that is localized to the peripheral membrane of the endosome. . In its active state interferes with the assembly of GDP-bound ARA7, PUF2, and VPS9a by competitively binding to PUF2 to diminish endosomal transport mediated by canonical RAB5. |
| AT1G28670 | Arabidopsis thaliana lipase |
| AT3G63350 | member of Heat Stress Transcription Factor (Hsf) family |
| AT4G16640 | Matrix metalloprotease. |
| AT5G64400 | CHCH domain protein;(source:Araport11) involved in mechanotransduction. Loss of both At12cys-1 and At12cys-2 lead to enhanced tolerance to drought and light stress and increased anti-oxidant capacity. |
| AT5G03545 | Expressed in roots in response to phosphate starvation, this response is enhanced by the presence of IAA. Additionally, its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. The mRNA is cell-to-cell mobile. |
| AT1G75940 | encodes a protein similar to the BGL4 beta-glucosidase from Brassica napus. The ATA27 protein is predicted to have an ER retention signal and an acidic isoelectric point, suggesting that it may be localized to the ER lumen. |
| AT1G01720 | Belongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA. The mRNA is cell-to-cell mobile. |
| AT5G08790 | induced by wounding, belongs to a large family of putative transcriptional activators with NAC domain. |
| AT5G65990 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT1G17720 | type 2A protein serine/threonine phosphatase 55 kDa B |
| AT2G34810 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G20820 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G20830 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). It is involved in plant immunity. Overexpressing plants are more resistant to B. cinerea. |
| AT4G20840 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
| AT5G44360 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44390 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44410 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G30700 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G65780 | Encodes a chloroplast branched-chain amino acid aminotransferase, can complement the yeast leu/iso-leu/val auxotrophy mutant. Note that the AT5G65780.2 gene model (TAIR10) has been obsoleted due to the lack of experimental support. The mRNA is cell-to-cell mobile. |
| AT1G51160 | TRAPP protein BET5 homolog. |
| AT1G12240 | Encodes a vacuolar invertase betaFruct4. betaFruct4 is transported from the endoplasmic reticulum through the intermediate compartments as a membrane protein. The N-terminal cytoplasmic domain contains multiple sequence motifs that are involved at various stages in the trafficking of betaFruct4 from the ER to the central vacuole. The mRNA is cell-to-cell mobile. |
| AT3G13790 | Encodes a protein with invertase activity. |
| AT1G61660 | Encodes a transcriptional activator that regulates the expression of genes by binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT1G66810 | Encodes a tandem CCCH zinc finger (TZF) protein that can bind DNA and RNA, function as a transcriptional activator, and is involved in secondary wall biosynthesis. |
| AT2G02160 | Non- tandem CCCH zinc finger protein. |
| AT3G19450 | Encodes a catalytically active cinnamyl alcohol dehydrogenase which uses p-coumaryl aldehyde as a preferred substrate. It can also use caffeyl, coniferyl and d-hydroxyconiferyl aldehydes as substrates. The mRNA is cell-to-cell mobile. |
| AT4G25780 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT4G25790 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT3G59440 | Encodes an endomembrane localized member of the CML subfamily VII. Contains a canonical CaM domain and unique N-terminal extension that distinguishes it from other members of the subfamily. |
| AT5G56340 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G27840 | Encodes a DDB1a interacting protein ATCSA-1 required for UV-B tolerance and genomic integrity. |
| AT5G03760 | encodes a beta-mannan synthase that is required for agrobacterium-mediated plant genetic transformation involves a complex interaction between the bacterium and the host plant. 3' UTR is involved in transcriptional regulation and the gene is expressed in the elongation zone of the root. |
| AT2G25900 | Encodes a protein with two tandem-arrayed CCCH-type zinc fingers that binds RNA and is involved in RNA turnover. The mRNA is cell-to-cell mobile. |
| AT5G44050 | MATE efflux family protein;(source:Araport11) |
| AT3G08970 | J domain protein localized in ER lumen. Can compensate for the growth defect in jem1 scj1 mutant yeast. Also shows similarity to HSP40 proteins and is induced by heat stress. At high temperatures, mutant alleles are not transmitted through the pollen due to defects in pollen tube growth. |
| AT1G22810 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. Overexpression leands to delayed senescence and delayed flowering. Negatively regulates plant resistance to P. parasitica by suppressing PAMP-triggered immunity. |
| AT5G48460 | Encodes a member of the fimbrin family. Different members of the fimbrin/plastin family have diverged biochemically during evolution to generate either tight actin bundles or loose networks with distinct biochemical and biophysical properties. FIM4 generates both actin bundles and branched actin filaments whereas FIM5 only generates actin bundles. |
| AT5G55400 | Encodes a member of the fimbrin family. Different members of the fimbrin/plastin family have diverged biochemically during evolution to generate either tight actin bundles or loose networks with distinct biochemical and biophysical properties. FIM4 generates both actin bundles and branched actin filaments whereas FIM5 only generates actin bundles. |
| AT3G11730 | Encodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. It has also been identified as an isoprenylated protein. |
| AT2G05630 | in the Arabidopsis autophagy pathway |
| AT5G66030 | Involved in golgi protein trafficking. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner. Localized to the golgi apparatus, tyrosine 717 in AtGRIP is crucial for Golgi localization. |
| AT1G69780 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein which is expressed during the seed-to-seedling transition, regulates some of the network nodes, and affects late seedling establishment. Knock-out mutants for athb13 showed increased primary root length as compared with wild type (Col-0) seedlings, suggesting that this transcription factor is a negative regulator of early root growth, possibly repressing cell division and/or cell elongation or the length of time cells elongate. |
| AT4G03520 | Encodes a redox activated co-chaperone, chloroplast localized thioredoxin, similar to prokaryotic types. |
| AT2G15570 | chloroplast protein similar to prokaryotic thioredoxin. |
| AT4G10250 | Columbia endomembrane-localized small heat shock protein |
| AT4G17905 | Putative RING-H2 finger protein ATL4H. |
| AT1G76410 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G57160 | Encodes the Arabidopsis orthologue of the yeast and mammalian DNA ligase IV. Involved in the repair of DNA damage but, unlike in yeast, not required for T-DNA integration. Interacts with the Arabidopsis homologue of XRCC4. |
| AT1G53165 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G01910 | Binds microtubules. Induces a crisscross mesh of microtubules, not bundles. Not involved in microtubule polymerization nor nucleation. Localizes to mitochondria. The mRNA is cell-to-cell mobile. |
| AT4G24970 | MORC7 is a member of a family of GHKL ATPases. It is localized in the nuceloplasm and adjacent to chromocenters. Along with MORC4, it appears to repress the expression of genes involved in defense against pathogens. |
| AT1G18150 | Encodes mitogen-activated protein kinase 8 (MPK8). MPK8 connects protein phosphorylation, Ca2+, and ROS in the wound-signaling pathway. |
| AT3G05830 | Encodes alpha-helical IF (intermediate filament)-like protein.NEAP1 is a member of a small family containing coiled-coil domains, a nuclear localization signal and a C-terminal predicted transmembrane domain. It localizes to the nuclear periphery. Mutants have altered nuclear morphology and chromatin structure. |
| AT1G09470 | NEAP3 is a member of a small family containing coiled-coil domains, a nuclear localization signal and a C-terminal predicted transmembrane domain. It localizes to the nuclear periphery. Mutants have altered nuclear morphology and chromatin structure. |
| AT1G07620 | GTP-binding protein Obg/CgtA;(source:Araport11) |
| AT3G27580 | D6PK family kinase involved in pulse-induced phototropism but also for time-dependent second positive phototropism, and continuous light-induced hypocotyl phototropism.D6PKL3 is polarly localized within the plasma membrane. It is involved in pollen aperture formation. The protein is localized within distinct regions of the pollen plasma membrane and mutants are also defective in pollen aperture formation. |
| AT5G46960 | Pectin methylesterase inhibitor that is involved in resistance to Botrytis cinerea. Affects PME activity during infection to prevent disease. Closely related paralog of AT5G46950 (InvINH2). |
| AT2G43050 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G02270 | pseudogene of phloem protein 2-B2;(source:Araport11) |
| AT5G21280 | Seed plant lineage specific gene that is expressed in response to oxidative and abiotic stresses. |
| AT1G19230 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
| AT4G25090 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
| AT1G32200 | Encodes a chloroplast glycerol-3-phosphate acyltransferase.Involved in the biosynthesis of chloroplast phosphatidylglycerol. |
| AT4G01810 | Sec23 homolog , forms a distinct clade with SEC23D.Mutants have defects in pollen exine patterning, tapetal development and pollen intine formation. |
| AT5G43670 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
| AT3G08760 | Encodes an osmotic stress-inducible kinase that functions as a negative regulator of osmotic stress signaling in plants. |
| AT3G05840 | Glycogen synthase kinase-3 member which encodes a SHAGGY-like kinase involved in meristem organization. Regulates flowering through mediating CONSTANS stability. |
| AT2G17980 | member of SLY1 Gene Family The mRNA is cell-to-cell mobile. |
| AT3G47460 | member of SMC subfamily |
| AT5G08335 | Encodes an isoprenyl cysteine methylatransferase (ICMT) involved in the post-translational processing of proteins that have a C-terminal CaaX box. This protein appears to have higher catalytic activity and a higher transcript expression level than the other ICMT present in Arabidopsis (At5g23320). Analysis of ICMT RNAi lines suggests that this protein is involved in flower and stem development. |
| AT2G16860 | GCIP-interacting family protein;(source:Araport11) |
| AT5G51460 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
| AT1G68020 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain and a trehalose phosphatase (TPP)-like domain. It can complement a yeast mutant lacking both of these activities suggesting that this is a bifunctional enzyme. |
| AT1G80420 | Encodes a component of plant break excision repair and functions at several stages during active DNA demethylation in Arabidopsis. |
| AT3G62830 | Encodes a Golgi localized isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
| AT1G78690 | Encodes a lysoglycerophospholipid O-acyltransferase that acylates 1-acyl lyso PE and 1-acyl lyso PG but not PE or PG. |
| AT5G44380 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G24240 | Encodes PI4Kc3, localizes to the nucleus and has autophosphorylation activity, but no lipid kinase activity. Overexpression mutants display late-flowering phenotype. |
| AT3G24315 | Sec20 family protein;(source:Araport11) |
| AT4G21430 | protein B160;(source:Araport11) |
| AT3G59660 | Encodes a C2-GRAM domain-containing protein that is induced by B. cinerea infection. It is required for cleavage of BAG6 and thus plays a role in mediating resistance to fungal infection. |
| AT3G06850 | dihydrolipoamide branched chain acyltransferase |
| AT1G66280 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT5G51780 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G03040 | Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT1G22490 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT2G43140 | bHLH129 is a nuclear localized basic helix loop helix protein. It has been shown to function as a transcriptional repressor. Overexpression of bHLH129 regulates root elongation and ABA response. |
| AT2G42300 | Together with bHLH60 associates with phytochrome interacting factor 7 to regulate hypocotyl elongation. |
| AT3G57800 | Together with bHLH48 associates with phytochrome interacting factor 7 to regulate hypocotyl elongation. |
| AT5G49130 | MATE efflux family protein;(source:Araport11) |
| AT2G39760 | Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). |
| AT3G09360 | Cyclin/Brf1-like TBP-binding protein. Double mutants with BRF1 show defects in pollen development. Controls FES1A regulated thermosensitivity. |
| AT2G42270 | Similar to yeast Brr2p DEAD/DExH box ATP-dependent RNA helicase. |
| AT4G37390 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. May function as a negative component in auxin signaling by regulating auxin activity. |
| AT3G12300 | Similar to Bug22p in Paramecium, a conserved centrosomal/ciliary protein. This protein is widespread in eukaryotes harboring centrioles/cilia at some stage of their life cycles. Among eukaryotes devoid of centrioles/cilia, plants possess BUG22 genes whereas some fungi (at least ascomycetes) do not. |
| AT2G42380 | Encodes a member of the BZIP family of transcription factors. Forms heterodimers with the related protein AtbZIP61. Binds to G-boxes in vitro and is localized to the nucleus in onion epidermal cells. |
| AT3G58120 | Encodes a member of the BZIP family of transcription factors. Forms heterodimers with the related protein AtbZIP34. Binds to G-boxes in vitro and is localized to the nucleus in onion epidermal cells. |
| AT5G28770 | BASIC LEUCINE ZIPPER protein which regulates the circadian oscillator gene PSEUDO RESPONSE REGULATOR7 (PRR7) to change the circadian phase in response to sugars. It upregulates PRR7 in response to low energy. bZIP63 and PRR7 are required for correct oscillator phase under light/dark cycles. bZIP protein BZO2H3 mRNA, partial cds |
| AT5G40880 | Involved in seed germination, seedling/seed development, interacting with PPPDE family protein Desi1. |
| AT5G06830 | Conserved reticulophagy receptor that bridges the gap betweenselective autophagy and ribosome stalling at the endoplasmic reticulum. Interacts directly with ATG8. Recruited to phagophores, precursors to autophagosomes, during ER stress in an autophagy-dependent manner. Forms a receptor complex with UFL1, the E3 ligase that mediates ufmylation, and its adaptor protein, DDRGK1. |
| AT3G57060 | Similar to mamalian condensin. Mutants have reduced fertility. |
| AT5G14060 | lysine-sensitive aspartate kinase |
| AT5G57580 | Calmodulin-binding protein;(source:Araport11) |
| AT1G59510 | Encodes CF9. |
| AT2G33510 | CFL1 is a negative regulator of cuticle development. Overexpression of CFL1 causes defects in cuticle formation. Interacts with FBH1, FBH3 and HDG1 to regulate cuticle formation. The physical interaction requires the C terminal 50 amino acids. |
| AT1G62820 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G12130 | Encodes a mitochondrial COG0354 protein that requires folate for its function in Fe/S cluster biogenesis. |
| AT4G33320 | DUF641 domain protein, probable psuedogene. |
| AT4G36100 | DUF641 domain protein, probable psuedogene. |
| AT5G18820 | Encodes a subunit of chloroplasts chaperonins that are involved in mediating the folding of newly synthesized, translocated, or stress-denatured proteins. Cpn60 subunits are: Cpn60alpha1 (At2g28000), AtCpn60alpha2 (At5g18820), AtCpn60beta1 (At1g55490), AtCpn60beta2 (At3g13470), AtCpn60beta3 (At5g56500), AtCpn60beta4 (At1g26230). |
| AT2G04530 | Encodes a protein with RNAse Z activity suggesting a role in tRNA processing. Protein contains a signal sequence for import into the chloroplast. |
| AT1G19750 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G60940 | Member of CstF complex. |
| AT2G29720 | Encodes CTF2B. |
| AT5G24870 | Ubiquitin E3 ligase, works with WDL7 in module which regulates microtubule disassembly to mediate stomatal closure in response to drought stress and ABA treatment. MREL57 interacts with, ubiquitinates and degrades WDL7, effect is enhanced by ABA. |
| AT4G31450 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G67120 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G73760 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G17970 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G46390 | C-terminal peptidase |
| AT3G48690 | Encodes a protein with carboxylesterase whose activity was tested using both pNA and 2,4-D-methyl. |
| AT5G06150 | Encodes a cyclin whose expression is reduced in response to high salt. |
| AT5G48640 | Cyclin family protein;(source:Araport11) |
| AT5G54290 | Encodes CcdA, a thylakoid membrane protein required for the transfer of reducing equivalents from stroma to thylakoid lumen. |
| AT1G62500 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G29200 | Over-expressed by salt stress. |
| AT1G64620 | Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis. |
| AT3G01420 | Encodes an alpha-dioxygenase involved in protection against oxidative stress and cell death. Induced in response to Salicylic acid and oxidative stress. Independent of NPR1 in induction by salicylic acid. The mRNA is cell-to-cell mobile. |
| AT5G02470 | core cell cycle genes |
| AT4G39520 | Encodes a member of the DRG (developmentally regulated G-protein) family. Has GTPase activity. |
| AT2G41750 | Involved in posttranscriptional modification of tRNA. Can form acp3U20b on a tRNA expressed in yeast cells. The aspartate and tryptophan residues in the DXTW motif of this protein are required for modification activity. Required for the acp3U20a modification of cytosolic tRNA. |
| AT1G47530 | MATE efflux family protein;(source:Araport11) |
| AT1G69890 | Encodes a member of a conserved DUF domain family that is induced by NO. Based on mutant phenotype may be involved in NO stress response. |
| AT1G29550 | Eukaryotic initiation factor 4E protein;(source:Araport11) |
| AT4G13800 | magnesium transporter NIPA (DUF803);(source:Araport11) |
| AT4G32620 | Polycomb related protein that is part of a protein complex involved in histone deacetylation and heterochromatin silencing. |
| AT5G04670 | Polycomb related protein that is part of a protein complex involved in histone deacetylation and heterochromatin silencing. |
| AT5G66470 | GTP-binding protein Era-like protein;(source:Araport11) |
| AT3G05210 | encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10. |
| AT5G07580 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT2G37640 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT4G13050 | Acyl-ACP thioesterase;(source:Araport11) |
| AT1G52343 | Similar to GET2, transmembrane protein that interacts with GET1. |
| AT3G51820 | Encodes a protein with chlorophyll synthase activity. This enzyme has been shown to perform the esterification of chlorophyllide (a and b), the last step of chlorophyll biosynthesis. Although it can use either geranylgeranyl pyrophosphate (GGPP) or phytyl pyrophosphate (PhyPP) as substrates, the esterification reaction was faster with GGPP than with PhyPP. |
| AT1G27120 | Encodes a Golgi-localized hydroxyproline-O-galactosyltransferase. |
| AT5G62620 | Encodes a Golgi-localized hydroxyproline-O-galactosyltransferase. Mutants display multiple phenotypes including reduced seed coat mucilage and accelerated leaf senescence. |
| AT3G13040 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
| AT2G23170 | encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. |
| AT1G13120 | nucleoporin GLE1-like protein;(source:Araport11) |
| AT2G40690 | Encodes a putative dihydroxyacetone phosphate (DHAP) reductase involved in glycerol-3-phosphate supply within the chloroplast for synthesis of glycerolipids. Mutants have reduced levels of hexadecatrienoic acid, which is rescued by exogenous glycerol-3-phosphate. This gene appears to be involved in the flux of fatty acids in the prokaryotic glyerolipid biosynthesis pathway. |
| AT2G41540 | Encodes a protein with NAD-dependent glycerol-3-phosphate (G3P) dehydrogenase which was shown to complement an Escherichia coli strain: BB20-14, auxotrophic for glycerol/G3P due to a loss-of-function mutation in the gpsA gene. |
| AT1G12230 | Aldolase superfamily protein;(source:Araport11) |
| AT1G76890 | encodes a plant trihelix DNA-binding protein |
| AT4G01070 | the glycosyltransferase (UGT72B1) is involved in metabolizing xenobiotica (chloroaniline and chlorophenole). Comparison between wild type and knock-out mutant demonstrates the central role of this gene for metabolizing chloroaniline but significantly less for chlorophenole. The glucosyltransferase preferred UDP-xylose over UDP-glucose indicating its (additional) functioning as a xylosyltransferase in planta |
| AT1G27440 | IRX10 was identified as MUCI69 in a reverse genetic screen for MUCILAGE-RELATED genes. Mutations in this gene did not disrupt mucilage properties, likely due to the presence of the functionally redundant IRX10-L. |
| AT1G08880 | Encodes HTA5, a histone H2A protein. H2AX is a meiosis-specific isoform of histone H2A. Upon DSB formation, rapid accumulation of phosphorylated H2AX (γ-H2AX) occurs around the break site. H2AX foci accumulate in early G2. Immunolocalization studies in spread preparations of wild-type meiocytes at G2/early leptotene revealed the accumulation of numerous rather diffuse γ-H2AX foci throughout the chromatin. However, their accumulation is not contemporaneous with that of AtSPO11-1. At 3 h post-S, no γ-H2AX foci are detected. During the 3- to 5-h window when AtSPO11-1 foci rapidly disappear, there is an equally swift accumulation of γ-H2AX to a maximum of >50 diffuse foci. The level of γH2AX then remains constant for a further 13 h before undergoing a gradual decrease to 10?20 foci in the 18- to 24-h post-S period. By 30 h the foci have disappeared from the chromatin. |
| AT4G36710 | GRAS family transcription factor;(source:Araport11) |
| AT4G17460 | Encodes a class II HD-ZIP protein that regulates meristematic activity in different tissues, and that it is necessary for the correct formation of the gynoecium. |
| AT5G47370 | homeobox-leucine zipper genes induced by auxin, but not by other phytohormones. Plays opposite roles in the shoot and root tissues in regulating auxin-mediated morphogenesis. |
| AT4G37790 | Encodes homeobox protein HAT22, member of the HD-Zip II family. The mRNA is cell-to-cell mobile. |
| AT2G22800 | Encodes homeobox protein HAT9. |
| AT2G27840 | Belongs to the plant specific HD2 type proteins; similar to nucleolar Zea mays histone deacetylase; HD2-p39 |
| AT1G09940 | Encodes glutamyl-tRNA reductase. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins |
| AT3G14930 | Uroporphyrinogen decarboxylase;(source:Araport11) |
| AT1G68670 | HHO2 is a HRS1 homolog. Nitrate-inducible expression. Also induced in roots by low Pi and is likely involved in maintaining phosphate homeostasis. It is target of PHR1.Both HHO2 and HRS1 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
| AT5G26690 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G24580 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G18035 | A linker histone like protein |
| AT4G36830 | ELO family protein. |
| AT5G49760 | Leucine rich receptor kinase. Encodes a receptor of extracellular reactive oxygen species. |
| AT2G29500 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT5G02570 | Histone superfamily protein;(source:Araport11) |
| AT3G46030 | Histone superfamily protein;(source:Araport11) |
| AT5G59910 | Histone superfamily protein;(source:Araport11) |
| AT2G37470 | Histone superfamily protein;(source:Araport11) |
| AT1G01370 | Encodes a centromere-identifying protein histone H3 variant. Localized at centromeres in both mitotic and meiotic cells. Aurora3 phosphorylates CENH3 at S65; this post-translational modification is required for the proper development of the floral meristem. |
| AT1G75600 | Histone superfamily protein;(source:Araport11) |
| AT5G02490 | Heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
| AT2G23430 | Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. |
| AT1G49620 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Binds to D type cyclins and may inhibit cell cycle. |
| AT1G62310 | Encodes a probable H3K9me2 demethylase. Functions in trichome morphogenesis via regulation of GL3. |
| AT3G08960 | Ran effector. |
| AT4G10920 | Transcriptional co-activator. Forms homodimers or heterodimers with the kiwi protein. Both proteins are involved in gene activation during pathogen defense and plant development. |
| AT3G12130 | KHZ1 is a CCCH zinc-finger and KH domain protein belonging to the VII subfamily. It is expressed throughout the plant. Highly similar to KHZ2. khz1 mutants are late flowering and double mutants with khz2 are even more late flowering. Overexpression leads to increased rates of leaf senescence. |
| AT5G06770 | KHZ2 is a CCCH zinc-finger and KH domain protein belonging to the VII subfamily. It is expressed throughout the plant. Highly similar to KHZ1.Double mutants with khz1 are late flowering. Overexpression leads to increased rates of leaf senescence. |
| AT3G50240 | Encodes a kinesin-related protein. |
| AT3G16630 | Kinesin-13A localized to entire Golgi stacks. Involved in trichome development. |
| AT1G24170 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT1G25570 | Di-glucose binding protein with Leucine-rich repeat domain-containing protein;(source:Araport11) |
| AT3G05990 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G22400 | Encodes lipoxygenase5 (LOX5). LOX5 activity in roots facilitates green peach aphid colonization of Arabidopsis foliage by promoting green peach aphid feeding from sieve element and water consumption from xylem. |
| AT1G09970 | RLK7 belongs to a leucine-rich repeat class of receptor-likekinase (LRR-RLKs). It is involved in the control of germination speed and the tolerance to oxidant stress. The mRNA is cell-to-cell mobile. |
| AT1G32080 | Encodes a plant LrgAB/CidAB protein localized to the chloroplast envelope that is involved in chloroplast development, carbon partitioning, ABA/drought response, and leaf senescence. The gene may have evolved from gene fusion of bacterial lrgA and lrgB. |
| AT1G18680 | HNH endonuclease domain-containing protein;(source:Araport11) |
| AT4G02800 | GRIP/coiled-coil protein;(source:Araport11) |
| AT1G30050 | tropomyosin;(source:Araport11) |
| AT2G30530 | zinc finger CCCH domain protein;(source:Araport11) |
| AT5G13240 | Global repressor of RNA polymerase III (Pol III). Maf1 repressor activity is critical for plant survival during environmental stresses, and is regulated by its phosphorylation/dephosphorylation through the activity of TOR and PP4/PP2A phosphatases. |
| AT3G62860 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G11650 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G16120 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G19290 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G18360 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G73480 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G77420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G39420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G03090 | MCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion. |
| AT5G03630 | Pyridine nucleotide-disulfide oxidoreductase family protein;(source:Araport11) |
| AT4G13020 | Encodes a member of the cdc2+ family of protein kinases MHK. Similar to the mak genes of rats. mak encodes a protein kinase that may play a role in spermatogenesis. |
| AT1G74440 | Similar to MPH1, can complement mph1-1 salt sensitivity phenotype. |
| AT1G18720 | Contains DUF962 domain. Localizes to ER and cam complement yeast Mpo1 dioxygenase function. Interacts with ABI1. May be involved in ER stress response. |
| AT4G32060 | Encodes an EF-hand protein with homology to constituents of the mitochondrial Ca2+ uniporter machinery in mammals. MICU binds Ca2+ and localizes to the mitochondria in Arabidopsis. It is a negative regulator of mitochondrial calcium uptake. Mutants display elevated matrix calcium at steady state and modified calcium transient kinetics in vivo. |
| AT5G24020 | Encodes a Ca2+ dependent ATPase required for correct positioning of the chloroplast division apparatus. Its ATPase activity is stimulated by AtMinE1, a topological specificity factor. |
| AT1G78830 | In combination with MYB4, MAN3, and Mannose part of signaling cascade which regulates cadmium tolerance. Mannose is able to bind to the GNA-related domain of MNB1; mannose binding to the GNA-related domain of MNB1 is required for MAN3-mediated Cd tolerance. |
| AT4G19045 | Member of a conserved family of proteins. Functions redundantly with MOB1A to regulate cell proliferation and JA metabolism. |
| AT1G78930 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT5G06810 | transcription termination factor family protein;(source:Araport11) |
| AT1G61960 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT2G39450 | Encodes a Golgi-localized manganese transporter that is involved in Mn tolerance. When expressed into yeast cells, this gene confer Mn2+ and Cu2+ tolerance. |
| AT2G04620 | Encodes a Zn transporter that localizes to the Golgi apparatus and forms a functional complex with AtMTP5t1 to transport Zn into the Golgi. |
| AT5G05100 | R3H RNA binding protein that interacts with AGO2 and miRNA. |
| AT1G63680 | Encodes AtMurE, a homolog of the bacterial MurE that catalyze the ATP-dependent formation of UDP-N-acetylmuramic acid-tripeptide in bacterial peptidoglycan biosynthesis. Localized to plastids. AtMurE is involved in chloroplast biogenesis. |
| AT2G40970 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G70000 | Encodes a MYB-like Domain transcription factor that plays a positive role in anthocyanin accumulation in response to light and cytokinin via repression of MYBL2.MYBD expression increased in response to light or cytokinin, and MYBD enhanced anthocyanin biosynthesis via the repression of MYBL2 encoding for a transcription factor that had a negative effect on this process. In addition, MYBD can bind in vivo to the MYBL2 promoter and a lower level of histone H3K9 acetylation (H3K9ac) at upstream region of MYBL2 in MYBD-OX in comparison to wild-type plants, implies that MYBD represses MYBL2 expression via an epigenetic mechanism. |
| AT5G08520 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT1G32640 | Encodes a MYC-related transcriptional activator with a typical DNA binding domain of a basic helix-loop-helix leucine zipper motif. Binds to an extended G-Box promoter motif and interacts with Jasmonate ZIM-domain proteins. MYC2 interacts with EIN3 and EIL1 to repress hook curvature and resistance to Botrytis cinera.Its transcription is induced by dehydration stress, ABA treatment and blue light via CRY1. Negative regulator of blue light-mediated photomorphogenic growth and blue and far-red-light-regulated gene expression. Positive regulator of lateral root formation. Regulates diverse JA-dependent functions. Negatively regulates Trp metabolism and biosynthesis of Trp-derived secondary metabolites. Positively regulates flavonoid biosynthesis, resistance to insects, and response to oxidative stress. Regulates other transcription factors, and negatively regulates its own expression. For example it binds to and regulates the expression of NST1. Its stability is modulated by PUB10 through polyubiquitination. |
| AT5G06560 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT2G22770 | Regulates the development of ER bodies. also involves in response to the endophytic fungus Piriformospora indica. |
| AT5G02290 | Encodes a candidate protein kinase NAK that is similar to the oncogenes met and abl. |
| AT3G54630 | kinetochore protein;(source:Araport11) |
| AT5G13950 | nuclear factor kappa-B-binding protein;(source:Araport11) |
| AT4G05220 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT2G41930 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G73600 | Encodes a S-adenosyl-L-methionine-dependent phosphoethanolamine N-methyltransferase whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in roots. It catalyzes the three sequential P-base methylation of phosphoethanolamine to phosphocholine. Homologous biochemical function to NMT1 (At3g18000). Double mutants of NMT1 and NMT3 are defective in leaf, root, flower, seed, and pollen development. |
| AT5G55850 | NOI protein |
| AT5G18230 | transcription regulator NOT2/NOT3/NOT5 family protein;(source:Araport11) |
| AT2G28540 | RNA binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G20800 | Cell differentiation, Rcd1-like protein;(source:Araport11) |
| AT2G32550 | Cell differentiation, Rcd1-like protein;(source:Araport11) |
| AT3G45710 | Encodes a chloride permeable transporter. Modulates chloride efflux from roots. |
| AT1G22540 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G72130 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
| AT1G72140 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
| AT1G22550 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
| AT1G67900 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT1G49670 | molecular function has not been defined. Was shown involved in oxidative stress tolerance. |
| AT4G17300 | Asparaginyl-tRNA synthetase protein involved in amino acid activation/protein synthesis. |
| AT1G51130 | δ-kleisin component of the SMC5/6 complex, possibly involved in synaptonemal complex formation. |
| AT3G14590 | Ca2+-dependent lipid-binding protein |
| AT3G61690 | Putative TNAase |
| AT3G10650 | Encodes a nucleoporin involved in mRNA export from the nucleus. It is also involved in the regulation of nuclear morphology. |
| AT3G57990 | Encodes a ?-barrel protein, named OEP40, locates in in the outer envelope of chloroplasts, and functions as a solute channel which is selectively permeable for glucose. |
| AT5G51740 | Mitochondrial ATP-independent protease .Important for maintenance of proper function of the oxphos system. |
| AT1G74930 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. The mRNA is cell-to-cell mobile. |
| AT5G54580 | Encodes an RNA recognition motif (RRM) and is involved in C-> U RNA editing in mitochondria. |
| AT1G32090 | early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT4G35870 | early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT1G65080 | Structurally distinct member of Oxa1 superfamily , has tetratricopeptide repeat (TPR) domain at the C terminus. Paralog of OXA2b.Involved in maturation of mitochondrial cytochrome c. |
| AT5G16680 | PHD protein which cooperates with AIPP2 and BAH domain protein AIPP3 to read H3K4 histone marks. The BAH-PHD bivalent histone reader complex silences a substantial subset of H3K27me3-enriched loci, including development and stress response-related genes. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
| AT5G03030 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT3G22640 | cupin family protein;(source:Araport11) |
| AT1G72160 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G30690 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT4G09160 | PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells. |
| AT5G14710 | proteasome assembly chaperone-like protein;(source:Araport11) |
| AT1G76360 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G24710 | Encodes an AAA+ ATPase that mediates meiotic chromosome remodeling and crossover maturation. |
| AT1G77600 | One of 5 PO76/PDS5 cohesion cofactor orthologs of Arabidopsis. |
| AT1G04330 | A proline/serine rich protein of unknown function. It interacts with defense related MAP kinase MPK6 and others. May be involved in signaling during defense or stress response. |
| AT5G19390 | Encodes a protein with similarity to REN1, a Rho GTPase activating protein.It is cytoplasmic and plasma membrane associated in interphase, but during mitosis localizes to the CDZ/CDS in a POK-dependent manner. |
| AT4G40080 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT5G65370 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT1G14910 | ANTH domain-containing protein which functions as adaptor protein for clathrin-mediated endocytosis (CME) of the secretory vesicle-associated longintype R-SNARE VAMP72 group. Interacts with the SNARE domain of VAMP72 and clathrin at the plasma membrane. Required for recycling of R-SNARE proteins. |
| AT5G57200 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT4G25940 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT2G25430 | AP180 N-terminal homology domain, TPLATE complex protein involved in clathrin-mediated endocytosis. |
| AT1G25240 | ENTH/VHS/GAT family protein;(source:Araport11) |
| AT3G17340 | Ran effector. |
| AT1G21000 | PLATZ transcription factor family protein;(source:Araport11) |
| AT4G17900 | PLATZ transcription factor family protein;(source:Araport11) |
| AT1G76590 | PLATZ transcription factor family protein;(source:Araport11) |
| AT4G24780 | Encodes a pectate lyase involved in response to nematodes. |
| AT1G11590 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G04470 | 22-kD peroxisomal membrane protein, an integral membrane protein embedded in the lipid bilayer. |
| AT1G78650 | Similar to DNA polymerase delta (POLD3), which in other organism was shown to be involved in the elongation of DNA replication. |
| AT1G55190 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
| AT3G13720 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
| AT5G44572 | transmembrane protein;(source:Araport11) |
| AT5G44574 | transmembrane protein;(source:Araport11) |
| AT2G40650 | PRP38 family protein;(source:Araport11) |
| AT5G46400 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G39580 | Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
| AT5G64100 | Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
| AT4G21960 | Encodes AT4g21960 (AT4g21960/T8O5_170). The mRNA is cell-to-cell mobile. |
| AT3G12530 | PSF2;(source:Araport11) |
| AT5G01830 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G67340 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G37490 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G65920 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT3G49060 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G61560 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G61550 | U-box domain-containing protein kinase family protein;(source:Araport11) |
| AT1G01660 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G56030 | RING/U-box protein;(source:Araport11) |
| AT2G40640 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT3G05230 | Signal peptidase subunit;(source:Araport11) |
| AT1G66700 | A member of the Arabidopsis SABATH methyltransferase gene family. Encodes PXMT1, a methyltransferase that methylates 1,7-paraxanthine. |
| AT2G44610 | Golgi-localized small GTPase, participates in the trafficking of CESA6 to the plasma membrane, maintaining Golgi organization and morphology, possible role in exocytosis. Plays and important role in hypocotyl growth by influencing cell elongation/growth and deposition of cellulose microfibrils in the cell wall. Plays an important role in cellulose synthesis. Influences both the distribution and velocity of cellulose synthase complexes in the plasma membrane. Encodes a GTP-binding protein with similarity to yeast YPT6 . RAB6 can complement the yeast YTP mutant. |
| AT2G28560 | Encodes a protein of the RAD51B family involved in double stranded DNA repair. Homozygous mutant plants show increased sensitivity to mitomycin which induces DS breaks. |
| AT1G70200 | Encodes a RNA-Binding Protein RBD1. Promotes chilling tolerance through 23S rRNA processing. |
| AT4G11230 | NADPH-oxidase RbohI is expressed highly in seeds and roots. Mutants have inreased sensitivity to osmotic stress suggesting a role in mediating cellular response to stress in roots. |
| AT3G19184 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT3G06160 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G41170 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT4G26540 | Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11) |
| AT4G19700 | Encodes BOI (Botrytis Susceptible 1 Interactor). Has E3 ubiquitin ligase activity. Interacts with and ubiquitinates BOS1 (Botrytis Susceptible 1). It prevents caspase activation and attenuates cell death. |
| AT5G10380 | Encodes a RING finger domain protein with E3 ligase activity that is localized to the lipid rafts of the plasma membrane. Expression is increased in response to fungal pathogen. May be involved in regulation of programmed cell death by facilitating degredation of regulation of PDC activators. The mRNA is cell-to-cell mobile. |
| AT1G71980 | RMR2 is a secretory pathway protein localized to the trans-golgi network. It belongs to a family of vacuolar sorting receptors. If forms heterodimers with RMR1. |
| AT3G13740 | Encodes one of two chloroplast Mini-RNase III-like enzymes in Arabidopsis. Double mutants display imprecise maturation of 23S rRNA and other rRNAs. |
| AT1G74450 | Plants overexpressing At1g74450 are stunted in height and have reduced male fertility. |
| AT5G18600 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT5G14070 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. ROXY2, together with ROXY1 (AT3G02000), controls anther development. roxy1 roxy2 double mutants are sterile and do not produce pollen. |
| AT4G33040 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
| AT3G02920 | Replication protein A, subunit RPA32;(source:Araport11) |
| AT5G56670 | Ribosomal protein S30 family protein;(source:Araport11) |
| AT3G61620 | exonuclease RRP41 (RRP41) |
| AT3G02250 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G22070 | Putative glycosyltransferase that negatively regulates leaf senescence in a SID2 dependent manner. |
| AT2G28620 | Mutants have radially swollen roots but do not exhibit defects in abundance or orientation of cortical microtubules, nor are microfibrils reduced. Cellulose synthesis is also unchanged with respect to wild type. There is a disruption in the normal pattern of cell wall placement. |
| AT1G58520 | GDSL-like lipase/acylhydrolase superfamily protein;(source:Araport11) |
| AT5G62460 | RZFP is a zinc finger protein involved in mediating abiotic stress tolerance. |
| AT1G61930 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT5G09460 | transcription factor bHLH143;(source:Araport11) |
| AT5G63980 | Encodes a bifunctional protein that has 3'(2'),5'-bisphosphate nucleotidase and inositol polyphosphate 1-phosphatase activities and rescues sulfur assimilation mutants in yeast. It is involved in the response to cold, drought (negative regulator of drought tolerance), and ABA. Mutants in this gene exhibit enhanced induction of stress genes in response to cold, ABA, salt and dehydration and increased levels of 3'-phosphoadenosine 5'-phosphate (PAP). Involved in degradation of small mRNAs. Mutants also affect the accumulation of miRNA target cleavage products. Regulates light-dependent repression of hypocotyl elongation and flowering time via its 3'(2'),5'-bisphosphate nucleotidase activity. Its activity is sensitive to the redox state of its environment, decreasing under oxidative conditions and is regulated by dimerization and intra and inter-molecular disulfide bond formation. |
| AT2G47820 | arginine-glutamic acid dipeptide repeat protein;(source:Araport11) |
| AT5G51340 | SCC4 is a tetratricopeptide repeat containing protein and a likely component of a plant cohesion loading complex along with its partner SSC2 It is expressed primarily in dividing cells. Loss of function mutants are embryo lethal, arresting by globular stage. |
| AT4G12120 | member of KEULE Gene Family |
| AT1G18830 | Together with SEC31B a component of the coat protein complex II (COPII) which promotes the formation of transport vesicles from the endoplasmic reticulum (ER). |
| AT3G63460 | Together with SEC31A a component of the coat protein complex II (COPII) which promotes the formation of transport vesicles from the endoplasmic reticulum (ER). |
| AT1G71820 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
| AT3G48900 | Encodes one of two GEN1 homologs in Arabidopsis. It is a member of the class IV Rad2/XPG family of nucleases that processes Holliday junctions in a manner analogous to the HJ resolvases of phages, archaea, and bacteria. |
| AT2G34980 | Encodes a putative phosphatidylinositol-glycan synthase subunit C gene. It is involved in the first step of the glycosylphosphatidylinositol (GPI) biosynthetic pathway. |
| AT4G14342 | Splicing factor 3B subunit 5/RDS3 complex subunit 10;(source:Araport11) |
| AT5G27350 | Encodes a sugar-porter family protein that is induced during leaf senescence. The increase in its gene expression during leaf senescence is paralleled by an accumulation of monosaccharides. The mRNA is cell-to-cell mobile. |
| AT5G58575 | Component of the deubiquitination module of the SAGA complex. |
| AT5G54840 | Monomeric G protein. Expressed in the root quiescent center, flowers, and leaf guard cells and hydathodes. |
| AT3G21700 | Monomeric G protein. Expressed in root epidermal cells that are destined to become atrichoblasts. Also expressed during pollen development and in the pollen tube tip. |
| AT1G78880 | Plasma membrane-localized proteins that negatively regulate cellulose synthesis by inhibiting the exocytosis of CESAs. |
| AT4G22290 | Paralog of SHOU4-like. Predicted transmembrane protein. |
| AT1G69220 | Encodes serine/threonine kinase 1 (SIK1), a Hippo homolog. Regulates cell proliferation and cell expansion. |
| AT4G27880 | Encodes an E3 ubiquitin ligase that functions in 26S proteosome pathway. Targeting of proteins for degradation such RD21A results in indirect effects such as loss of drought induced stomatal immunity. |
| AT1G76630 | SKI3 encodes a cytplasmically localized component of the SKI complex which is involved in exosome mediated RNA decay. |
| AT4G12420 | Encodes a protein of unknown function involved in directed root tip growth. It is a member of 19-member gene family and is distantly related structurally to the multiple-copper oxidases ascorbate oxidase and laccase, though it lacks the copper-binding domains. The protein is glycosylated and GPI-anchored. It is localized to the plasma membrane and the cell wall. The gene is expressed most strongly in expanding tissues. |
| AT3G07590 | SmD1a is one of two Yeast SmD1 orthologs, lower levels than SmD1b.It is localized to the nucleus and may play a minor role in RNA splicing and indirectly facilitating PTGS. |
| AT2G28870 | cyclin-dependent kinase inhibitor SMR1-like protein;(source:Araport11) |
| AT2G37610 | hypothetical protein;(source:Araport11) |
| AT5G02420 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
| AT5G40460 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
| AT1G10690 | cyclin-dependent kinase inhibitor;(source:Araport11) |
| AT4G29160 | SNF7 family protein;(source:Araport11) |
| AT1G14200 | E3 ligase involved in the regulation of the homeostasis of sensor NLR immune receptors. |
| AT5G24150 | squalene monooxygenase gene homolog |
| AT5G44568 | Secreted peptide which functions in plant growth and pathogen defense. |
| AT4G08810 | Calcium binding protein involved in cryptochrome and phytochrome coaction |
| AT5G65300 | Gene of unknown function. Expression is induced by a variety of biotic (P. syringae) and abiotic stresses (salt, ABA,IAA, and more.)Member of a small family that includes AT1G35210, AT1G72240, and AT1G22470.Mutants have no obvious loss of function phenotype but overexpressors are early flowering. |
| AT3G16690 | Nodulin MtN3 family protein;(source:Araport11) |
| AT4G15920 | Encodes a vacuolar fructose transporter expressed in parenchyma and xylem that controls leaf fructose content. When its expression is reduced, fructose accumulates in leaves. |
| AT3G48600 | SWIB complex BAF60b domain-containing protein;(source:Araport11) |
| AT5G40840 | Cohesion family protein SYN2 (SYN2). Plays a role in somatic DNA double strand break damage repair. |
| AT5G56680 | Encodes a putative cytosolic asparaginyl-tRNA synthetase. The mRNA is cell-to-cell mobile. |
| AT5G11100 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G19100 | Encodes a protein kinase that positively regulates gibberellic acid (GA) signaling by inactivating the E3 ubiquitin ligase GARU. GARU mediates ubiquitin-dependent degradation of GID1s, which are GA receptors. |
| AT4G23050 | PAS domain-containing protein tyrosine kinase family protein;(source:Araport11) |
| AT5G54770 | Encodes a thiamine biosynthetic gene that has a dual function in thiamine biosynthesis and mitochondrial DNA damage tolerance. It appears to be involved in producing the thiazole portion of thiamine (vitamin B1). A crystal structure of the protein reveals that it forms a 2-ring homo-octamer. The mRNA is cell-to-cell mobile. |
| AT5G09860 | Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. One of the pathways affected by THO1 is the miRNA399-PHO2 pathway that regulates root APase activity. |
| AT1G74950 | Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators. |
| AT1G70700 | JAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. The mRNA is cell-to-cell mobile. |
| AT1G02510 | Encodes AtTPK4, a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK4 is targeted to the plasma membrane. In contrast other members of the AtTPK proteins are located in tonoplast. AtTPK4 forms a voltage-independent K+ channel that is blocked by extracellular calcium ions. May form homomeric ion channels in vivo. |
| AT5G15510 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
| AT1G80500 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
| AT5G02280 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
| AT1G78010 | tRNA modification GTPase;(source:Araport11) |
| AT1G14205 | Member of the uL18 RNA-binding protein family. uL18 proteins share a short structurally conserved domain that binds the 5S rRNA and allow its incorporation into ribosomes. Essential for the splicing of the first intron of rps12 in plastid. |
| AT5G42820 | U2 auxiliary factor small subunit. The atU2AF35b protein and its homolog, atU2AF35a, contain most of the conserved domains of hsU2AF35, including the psiRRM, one RS domain, two zinc fingers, and the two regions for interacting with U2AF large subunit. Both proteins lack the stretch of glycines present in human U2AF35. The sequences are overall 83% identical, and each Arabidopsis homolog shows approximately 70% similarity to hsU2AF35. U2AF(35) homologs were also identified from maize, rice and other plants with large-scale EST projects. Both genes are expressed in all major tissues, with atU2AF(35)a expressed at a higher level than atU2AF(35)b in most tissues. The expression patterns were different in roots: atU2AF(35)b expressed strongly in whole young roots and root tips and atU2AF(35)a limited to root vascular regions. |
| AT2G22090 | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. As with UBP1, transient overexpression of UBA1a in protoplasts increases the steady-state levels of reporter mRNAs in a promoter-dependent manner. Along with UBP1 and UBA2a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus. |
| AT2G41160 | ATI3A interacting protein containing a large N-terminal rhomboid-like transmembrane domain and a UBA domain at their C terminus, localized in the ER with a role in plant heat tolerance. UBAC2 proteins may act as both cargo receptors and inducers of an ATI3-mediated selective autophagy pathway, where ATI3 and UBAC2 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
| AT5G66690 | UGT72E2 is an UDPG:coniferyl alcohol glucosyltransferase which glucosylates sinapyl- and coniferyl aldehydes as well as sinapyl- and coniferyl alcohol. The enzyme is thought to be involved in lignin metabolism. A knockdown mutant line (72E2KD) was obtained using RNAi silencing. A twofold reduction in coniferyl alcohol 4-O-glucoside and sinapyl alcohol 4-O-glucoside was detected in this line compared to wildtype. In comparison, both knockout and knockdown lines of UGT72E1 and UGT72E3, respectively, failed to display the same reduction in phenylpropanoid 4-O-glucosides. The mRNA is cell-to-cell mobile. |
| AT1G22400 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G06000 | encodes a flavonol-7-O-rhamnosyltransferase involved in the formation of rhamnosylated flavonols |
| AT2G43310 | Member of the uL18 RNA-binding protein family. uL18 proteins share a short structurally conserved domain that binds the 5S rRNA and allow its incorporation into ribosomes. |
| AT1G61180 | Coiled-coil nucleotide-binding leucine-rich-repeat protein involved in disease resistance. |
| AT2G39260 | Nonsense mediated decay (NMD)factor. |
| AT3G61800 | ENTH/VHS protein;(source:Araport11) |
| AT4G24060 | Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis. |
| AT4G32530 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
| AT4G02620 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
| AT5G63880 | SNF7 family protein;(source:Araport11) |
| AT5G22950 | SNF7 family protein;(source:Araport11) |
| AT3G19770 | Guanine nucleotide exchange factor VPS9a. Can activate all Rab5 members to GTP-bound forms in vitro. Required for embryogenesis. Regulates the localization of ARA7 and ARA6. Involved in postembryonic root development. |
| AT2G22880 | VQ motif-containing protein;(source:Araport11) |
| AT3G14370 | The WAG2 and its homolog, WAG1 each encodes protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT1G29170 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
| AT4G27260 | encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. It is involved in camalexin biosynthesis via conjugating indole-3-carboxylic acid (ICA) and cysteine (Cys). The mRNA is cell-to-cell mobile. |
| AT1G49160 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its |
| AT4G01720 | member of WRKY Transcription Factor; Group II-b |
| AT1G62300 | Encodes a transcription factor WRKY6. Regulates Phosphate1 (Pho1) expression in response to low phosphate (Pi) stress. |
| AT2G04240 | Encodes a small protein with an N-terminal trans-membrane domain and a RING-H2 zinc finger motif located at the C-terminus. Gene expression is induced by salt and osmotic stress. Transcrips levels are induced by DELLA proteins and repressed by gibberellic acid. Involved in ABA metabolism. |
| AT1G58440 | Encodes a putative protein that has been speculated, based on sequence similarities, to have squalene monooxygenase activity. |
| AT4G33200 | member of Myosin-like proteins |
| AT5G20490 | Encodes a member of the type XI myosin protein family involved in root hair growth, trichome development, and organelle trafficking. Required for fast root hair growth. This gene appears to be expressed at low levels throughout the plant. |
| AT2G46520 | cellular apoptosis susceptibility protein, putative / importin-alpha re-exporter;(source:Araport11) |
| AT1G51510 | This gene is predicted to encode a protein involved in the exon junction complex. Though there is a predicted RNA binding motif, in the Drosophila ortholog (33% identity), this motif mediates interactions with Mago and is not available for RNA binding. The Arabidopsis Y14 protein appears to be predominantly nucleolar, but there is also some evidence for its presence in the cytoplasm. |
| AT5G21920 | One of four Arabidopsis homologs of bacterial ymlg proteins. |
| AT3G53600 | Nuclear C2H2 zinc finger protein.Expression is induced by cold, osmotic, salt, and drought stress. Over expression confers some drought tolerance whereas mutants display some drought sensitivity. |
| AT3G46090 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT5G38600 | Proline-rich spliceosome-associated (PSP) family protein / zinc knuckle (CCHC-type) family protein;(source:Araport11) |
| AT3G57640 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G03205 | Coproporphyrinogen III oxidase;(source:Araport11) |
| AT5G14220 | Encodes PPO2, a putative protoporphyrinogen oxidase based on sequence homology. Also known as MEE61 (maternal effect embryo arrest 61). mee61 mutant shows arrested endosperm development. |
| AT2G20960 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT3G48050 | Encodes a large protein with N-terminal bromo-adjacent homology (BAH) and transcription elongation factor S-II (TFS2N) domains and two C-terminal GW (glycine and tryptophan) repeats. It is nuclear and colocalizes with the processing-body component DCP1 in the cytoplasm. SOU is a component of the miRNA pathway and is involved in translational repression. |
| AT3G47020 | E3 ubiquitin ligase involved in SGS3 degradation leading to inhibited biosynthesis of tasiRNA. The heat-induced activation of SGIP1 is inherited in the progeny. |
| AT1G01480 | a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family, isolated from a flower-specific cDNA library. |
| AT4G37770 | Encodes an auxin inducible ACC synthase. |
| AT4G11280 | encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family The mRNA is cell-to-cell mobile. |
| AT2G31360 | Encodes a protein homologous to delta 9 acyl-lipid desaturases of cyanobacteria and acyl-CoA desaturases of yeast and mammals. expression up-regulated by cold temperature. It is involved in the synthesis of the 24:1n-9 and 26:1n-9 components of seed lipids, sphingolipids and the membrane phospholipids phosphatidylserine (PS), and phosphatidylethanolamine (PE). |
| AT5G47760 | serine/threonine protein kinase |
| AT1G53850 | Encodes alpha5 subunit of 20s proteosome involved in protein degradation and RNA degradation. |
| AT3G14290 | Encodes 20S proteasome subunit PAE2 (PAE2) that has RNase activity. |
| AT2G27020 | Encodes 20S proteasome alpha 7 subunit PAG1. |
| AT3G22630 | Encodes 20S proteasome beta subunit PBD1 (PBD1). |
| AT2G20580 | encoding the RPN subunits of the 26S proteasome The mRNA is cell-to-cell mobile. |
| AT2G26250 | epidermis-specific, encodes KCS10, a putative 3-ketoacyl-CoA synthase. probably involved in the synthesis of long-chain lipids found in the cuticle. |
| AT2G26640 | Encodes KCS11, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT2G28630 | Encodes KCS12, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT2G46720 | Encodes KCS13, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT5G43760 | Encodes KCS20, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). The mRNA is cell-to-cell mobile. |
| AT1G25450 | Encodes KCS5, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT2G16280 | Encodes KCS9, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G17745 | encodes a 3-Phosphoglycerate dehydrogenase The mRNA is cell-to-cell mobile. |
| AT1G51680 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. In addition to 4-coumarate, it also converts ferulate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, ferulic acid, caffeic acid and 5-OH-ferulic acid. At4CL1 was unable to use sinapic acid as substrate. |
| AT2G18250 | At2g18250 encodes pantetheine-phosphate adenylyltransferase catalyzing the formation of dephospho-CoA from pantetheine 4'-phosphate. The enzyme is involved in coenzyme A biosynthesis. |
| AT1G72370 | acidic protein associated to 40S ribosomal subunit of ribosomes. Involved in polysome formation during active protein synthesis. Expressed in actively growing tissue. |
| AT5G08530 | 51 kDa subunit of complex I;(source:Araport11) |
| AT1G13700 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
| AT3G49360 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
| AT5G24410 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
| AT1G01100 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
| AT4G00810 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
| AT5G67030 | Encodes a single copy zeaxanthin epoxidase gene that functions in first step of the biosynthesis of the abiotic stress hormone abscisic acid (ABA). Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. |
| AT5G57050 | Encodes a protein phosphatase 2C and is involved in ABA signal transduction. Binds fibrillin preprotein in vitro and in vivo. |
| AT2G36270 | Encodes a member of the basic leucine zipper transcription factor family, involved in ABA signalling during seed maturation and germination. The Arabidopsis abscisic acid (ABA)-insensitive abi5 mutants have pleiotropic defects in ABA response, including decreased sensitivity to ABA inhibition of germination and altered expression of some ABA-regulated genes. Comparison of seed and ABA-inducible vegetative gene expression in wild-type and abi5-1 plants indicates that ABI5 regulates a subset of late embryogenesis-abundant genes during both developmental stages. Responsible for reducing cadmium uptake, mediated by interaction with MYB49 . |
| AT5G01520 | Encodes a cytosolic RING-type E3 ubiquitin (Ub) ligase that is critical for ABA and high salinity responses during germination. AtAIRP2 and SDIR1 likely play a combinatory role in ABA signaling and the response to high salt in Arabidopsis. |
| AT5G58787 | Encodes a cytosolic protein with E3 ligase activity that is involved in positive regulation of ABA responses. |
| AT1G66600 | A member of WRKY Transcription Factor; Group III. Involved in the regulation of plant responses to ABA and drought stress. |
| AT5G64750 | Encodes a putative transcription factor containing an AP2 domain. Is a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. Expressed in response to ABA, osmotic stress, sugar stress and drought. Mutants are hypersensitive to these stresses. May be involved in regulation of ABA mediated stress response. The mRNA is cell-to-cell mobile. |
| AT4G38480 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G51760 | Encodes AHG1 (ABA-hypersensitive germination 1), a putative protein phosphatase 2C (PP2C). Expressed in seeds. AHG1 functions in seed development and germination. |
| AT1G55870 | Encodes a poly(A)-specific ribonuclease, AtPARN. Expression of AtPARN is upregulated by ABA or stress treatment. Mutant is hypersensitivity to salicylic acid as well as ABA. Functions with AGS1 to regulate the poly(A) status of mitochondrial mRNA. |
| AT5G63350 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT3G18950 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G49450 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G46510 | Encodes a nuclear localized BLH domain containing transcriptional activator involved in response to ABA. Overexpression confers enhanced ABA responsiveness while loss of function mutants are ABA sensitive.bHLH17 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH13 and bHLH14 to negatively regulate jasmonate responses. |
| AT5G13680 | A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1?ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. Mutants have no ncm5U (5-carbamoylmethyluridine). |
| AT3G54770 | Encodes a putative RNA binding protein that is localized in the nucleus and affects ABA-regulated seed germination of Arabidopsis. |
| AT1G05805 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT2G40090 | member of ATH subfamily |
| AT5G11030 | alf4-1 mutation blocks initiation of lateral roots as well as callus formation. Cannot be rescued by IAA. Protein belongs to a plant-specific gene family and is localized to the nucleus. |
| AT1G69260 | ABI five binding protein;(source:Araport11) |
| AT1G13740 | Encodes a member of a small plant-specific gene family whose members interact with ABI5 and appear to be involved in mediating stress responses. AFP2 mutants affect a number of ABA mediated processes such as germination and response to osmotic and sugar stress. AFP2 nuclear localization is stress dependent. |
| AT3G29575 | ABI five binding protein 3;(source:Araport11) |
| AT2G46225 | Encodes a subunit of the WAVE complex. The WAVE complex is required for activation of ARP2/3 complex which functions in actin microfilament nucleation and branching. One of four ABI-like proteins. |
| AT5G20910 | Encodes an E3 ligase that can interact with and polyubiquitinate ABI3 in vitro. AIP2 likely negatively regulates ABA signaling by targeting ABI3 for post-translational destruction. |
| AT5G42030 | ABL interactor-like protein 4;(source:Araport11) |
| AT2G45190 | Encodes a member of the YABBY family of transcriptional regulators that is involved in abaxial cell type specification in leaves and fruits. YAB1 acts in a non-cell autonomous fashion within the meristem to affect phyllotactic patterning. The non-autonomous effect on the central region of the meristem is mediated through the activity if Lateral Suppressor (LAS). |
| AT2G20300 | Encodes ABNORMAL LEAF SHAPE 2 (ALE2), a receptor-like protein kinase (RLK) with a cluster of basic amino acid residues followed by a cysteine-containing sequence in the putative extracellular domain. Function together with ACR4 (Arabidopsis homolog of the Crinkly4) and ALE1 in positively regulating protoderm-specific gene expression and for the formation of leafy organs. ale2 mutants have various epidermal defects, including disorganization of epidermis-related tissues, defects in the leaf cuticle and the fusion of organs. |
| AT2G36080 | Encodes a plant-specific B3 DNA-binding domain transcription factor. Has transcription repressor activity. |
| AT1G80070 | Encodes a factor that influences pre-mRNA splicing and is required for embryonic development. Mutations result in an abnormal suspensor and embryo lethality. The mRNA is cell-to-cell mobile. |
| AT1G45249 | Leucine zipper transcription factor that binds to the abscisic acid (ABA)?responsive element (ABRE) motif in the promoter region of ABA-inducible genes. Enhances drought tolerance in vegetative tissues. Required for normal glucose response. Localized in the nucleus. Expressed constitutively in roots, leaf vascular tissues, and hydathodes or in all tissues under stress conditions. It's phosphorylated by a ABA-activated 42-KDa kinase. Overexpression of the phosphorylated active form of AREB1 expressed many ABA-inducible genes, such as RD29B, without ABA treatment. |
| AT4G34000 | Encodes an ABA-responsive element-binding protein with similarity to transcription factors that is expressed in response to stress and abscisic acid. |
| AT1G62380 | Encodes a protein similar to 1-aminocyclopropane-1-carboxylic oxidase (ACC oxidase). Expression of the AtACO2 transcripts is affected by ethylene. |
| AT1G77330 | similar to 1-aminocyclopropane-1-carboxylate oxidase GI:3386565 from (Sorghum bicolor) |
| AT1G62960 | Encodes an aminotransferase with broad specificity for aspartate and aromatic amino aids such as tyrosine and phenylalanine. It does not act on branched chain amino acids and does not have ACC synthase activity. |
| AT5G65800 | 1-aminocyclopropane-1-carboxylate synthase (ACS) is encoded by a multigene family consisting of at least five members whose expression is induced by hormones, developmental signals, and protein synthesis inhibition. |
| AT3G44880 | Encodes a pheide a oxygenase (PAO). Accelerated cell death (acd1) mutants show rapid, spreading necrotic responses to both virulent and avirulent Pseudomonas syringae pv. maculicola or pv. tomato pathogens and to ethylene. |
| AT2G34690 | Gene product transports the glycolipid precursor sphingosine between membranes in vitro. Mutant constitutively expresses defense-related genes that accompany the hypersensitive response normally triggered by avirulent pathogens. The mRNA is cell-to-cell mobile. |
| AT4G37000 | Mutants have spontaneous spreading cell death lesions and constitutive activation of defenses in the absence of pathogen infection. Its product was shown to display red chlorophyll catabolite reductase (RCCR), which catalyzes one step in the breakdown of the porphyrin component of chlorophyll. The enzyme was further assessed to be a Type-1 (pFCC-1-producing) RCCR.Upon P. syringae infection, ACD2 localization shifts from being largely in chloroplasts to partitioning to chloroplasts, mitochondria, and to a small extent, cytosol. Overexpression of ACD2 delayed cell death and the replication of P. syringae. |
| AT1G75010 | Encodes ARC3 (Accumulation and Replication of Chloroplast 3), a chloroplast division factor functioning in the initiation of chloroplast division. ARC3 is a chimera of the prokaryotic FtsZ and part of the eukaryotic phosphatidylinositol-4-phosphate 5-kinase (PIP5K). Located on the outer surface of the chloroplast in a ring-like structure at the early stage of chloroplast division. The arc3 mutant has a small number of abnormally large chloroplasts in the cell. |
| AT2G31810 | ACT domain-containing small subunit of acetolactate synthase protein;(source:Araport11) |
| AT2G38040 | encodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis |
| AT5G65890 | Member of ACT domain containing protein family. ACT domains are amino acid binding domains. Shows strongest expression in flowers and siliques. |
| AT1G76990 | ACT domain repeat 3;(source:Araport11) |
| AT2G03730 | Member of a small family of ACT domain containing proteins. ACT domains are thought to be involved in amino acid binding. |
| AT4G22780 | Member of a family of ACT domain containing proteins . ACT domains are involved in amino acid binding . |
| AT1G12420 | ACT domain repeat 8;(source:Araport11) |
| AT1G16880 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. The mRNA is cell-to-cell mobile. |
| AT5G04740 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. |
| AT2G39570 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. |
| AT3G18780 | Encodes an actin that is constitutively expressed in vegetative structures but not pollen. ACT2 is involved in tip growth of root hairs. |
| AT5G09810 | Member of Actin gene family.Mutants are defective in germination and root growth. The mRNA is cell-to-cell mobile. |
| AT1G49240 | Member of a subclass of actins composed of ACT2 and ACT8. Its mRNA is strongly expressed in strongly expressed in leaves, roots, stems, flowers, pollen, and siliques. However, protein expression, assayed by a ACT8:GUS fusion reporter, is very low in pollen. |
| AT3G46010 | Actin-depolymerizing factor (ADF) and cofilin define a family of actin-binding proteins essential for the rapid turnover of filamentous actin in vivo. |
| AT3G46000 | Encodes depolymerizing factor 2. |
| AT5G59880 | Encodes actin depolymerizing factor 3 (ADF3). |
| AT5G59890 | actin depolymerizing factor 4 (ADF4) mRNA, complete cds |
| AT2G16700 | Encodes actin depolymerizing factor 5 (ADF5). |
| AT2G31200 | Encodes actin depolymerizing factor 6 (ADF6). The mRNA is cell-to-cell mobile. |
| AT4G34970 | A member of actin polymerizing factors (ADFs)family, ADF9 primarily functions as an actin bundling protein. |
| AT3G12110 | Encodes an actin that is expressed predominantly during reproductive development. |
| AT2G01330 | nucleotide binding protein;(source:Araport11) |
| AT1G18450 | Encodes a gene similar to actin-related proteins in other organisms. Member of nuclear ARP family of genes. Component of chromatin remodeling complexes, involved in chromatin-mediated gene regulation. Phenotype of the arp4-1 mutant allele revealed partial sterility due to defects in anther development. Targeting the distinct, 3' UTR of AtARP4 transcripts with RNA interference caused a drastic reduction in the level of AtARP4 protein expression, and resulted in strong pleiotropic phenotypes such as altered organization of plant organs, early flowering, delayed flower senescence and high levels of sterility. Western blot analysis and immunolabelling demonstrated a clear correlation between reductions in the level of AtARP4 expression and severity of the phenotypes. |
| AT3G33520 | Encodes ACTIN-RELATED PROTEIN6 (ARP6), a putative component of a chromatin-remodeling complex. Required for both histone acetylation and methylation of the FLC chromatin in Arabidopsis. Along with PIE1 forms a complex to deposit modified histone H2A.Z at several loci within the genome. This modification alters the expression of the target genes (i.e. FLC, MAF4, MAF6). Incorporation of this variant histone into chromatin mediates the ambient temperature response. Located at specific regions of the nuclear periphery. Expression throughout plants shown by in-situ and immunolocalization methods. Mutants show defects in fertility, leaf, flower and inflorescence development and shorter flowering times. ARP6 also is involved in globally controlling developmental responses to ambient temperature through incorporation of variant histone H2A.Z into chromatin. |
| AT5G56180 | encodes a protein whose sequence is similar to actin-related proteins (ARPs) in other organisms. Member of nuclear ARP family of genes. |
| AT1G33560 | Encodes a NBS-LRR disease resistance protein that possesses N-terminal kinase subdomains. Activation tagged mutant of ADR1 showed elevated levels of SA and reactive oxygen species in addition to number of defense gene transcripts. Exhibits resistance to number of microbial pathogens. |
| AT4G29140 | Encodes Activated Disease Susceptibility 1 (ADS1), a putative MATE (multidrug and toxic compound extrusion) transport protein that negatively regulates plant disease resistance. |
| AT5G16370 | acyl activating enzyme 5;(source:Araport11) |
| AT3G48990 | Encodes an oxalyl-CoA synthetase and is required for oxalate degradation, for normal seed development, and for defense against an oxalate-producing fungal pathogen. |
| AT3G16910 | Encodes a peroxisomal protein with acetyl-CoA synthetase activity that is responsible for the activation of acetate for entry into the glyoxylate cycle. |
| AT5G16240 | Redundant Δ9 stearoyl-ACP desaturase gene which together with FAB2 and AAD5 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with FAB2, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase. |
| AT5G16230 | Encodes one of two ∆9 palmitoyl-ACP desaturases responsible for the biosynthesis of ω-7 fatty acids in the maturing endosperm. |
| AT4G27780 | Encodes acyl-CoA-binding protein with ankyrin repeats The mRNA is cell-to-cell mobile. |
| AT3G05420 | Acyl-CoA binding protein with high affinity for oleoyl-CoA. Expressed in all plant organs. Involved in fatty acid transport. Plays a role in determining seed oil content. |
| AT5G65110 | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. |
| AT1G06290 | Encodes an acyl-CoA oxidase with specificity for medium chain fatty acids. The mRNA is cell-to-cell mobile. |
| AT2G35690 | Encodes an acyl-CoA oxidase. Involved in jasmonate biosynthesis. Expressed uniformly in seedlings and throughout development. |
| AT1G06310 | Encodes a putative acyl-CoA oxidase. However, no transcripts have been detected for this gene and no altered phenotypes have been detected in plants mutant for this gene. This suggests that ACX6 does not significantly contribute to seedling beta-oxidation of fatty acids or indole-3-butyric acid in vivo. |
| AT4G24230 | acyl-CoA-binding protein ACBP3. Localized extracellularly in transiently expressed tobacco BY-2 cells and onion epidermal cells. Binds arachidonyl-CoA with high affinity. Microarray data shows up-regulation of many biotic- and abiotic-stress-related genes in an ACBP3 OE-1 in comparison to wild type. |
| AT1G31812 | Acyl-CoA-binding protein. Bind acyl-CoA esters and protect acyl-CoAs from degradation by microsomal acyl-hydrolases. Plays a role in determining seed oil content. |
| AT1G06120 | Membrane bound acyl-lipid desaturases which can perform Δ9 desaturation. |
| AT1G35250 | Thioesterase superfamily protein;(source:Araport11) |
| AT1G31730 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
| AT1G27450 | Adenosine phosphoribosyl transferase(E.C:2.4.2.7), involved in the one-step salvage of adenine to AMP. |
| AT5G11160 | adenine phosphoribosyltransferase 5;(source:Araport11) |
| AT2G37250 | encodes adenylate kinase that is located in the chloroplast involved in the coordination of metabolism and growth |
| AT5G03300 | Encodes adenosine kinase 2 (ADK2), a typical, constitutively expressed housekeeping enzyme. Shows a high sequence identity with ADK1. Involved in salvage synthesis of adenylates and methyl recycling. Enzyme activity is substantially inhibited in roots, siliques and dry seeds by an unknown compound. May contribute to cytokinin interconversion. The mRNA is cell-to-cell mobile. |
| AT5G67520 | Provides activated sulfate for the sulfation of secondary metabolites, including the glucosinolates. Redundant with APK3. |
| AT5G48300 | Encodes the small subunit of ADP-glucose pyrophosphorylase. The small subunit is the catalytic isoform responsible for ADP-glucose pyrophosphorylase activity. The presence of the small subunit is required for large subunit stability. Two isoforms of the small subunit (ApS1 and ApS2) have been described. ApS1 is the major small subunit isoform present in all plant tissues tested. The mRNA is cell-to-cell mobile. |
| AT5G19220 | Encodes the large subunit of ADP-glucose pyrophosphorylase which catalyzes the first, rate limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms (ApL1-4) have been identified. ApL1 is the major large subunit isoform present in leaves. Mutational analysis of APS1 suggests that APL1 and APL2 can compensate for loss of APS1 catalytic activity,suggesting both have catalytic as well as regulatory functions. |
| AT3G62290 | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. The mRNA is cell-to-cell mobile. |
| AT5G67560 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. Possible pseudogene because it lacks an N-terminal part that is conserved among the other ARL8 proteins. The mRNA is cell-to-cell mobile. |
| AT4G33300 | Encodes a member of the ADR1 family nucleotide-binding leucine-rich repeat (NB-LRR) immune receptors. |
| AT5G37415 | Encodes a MADS-box gene AGL105 (AGAMOUS-LIKE 105). Note that previous reports (Plant Cell 2003,15:1538; PNAS 2003, 100:13407) have incorrectly named AT5G37420 as AGL105. Current nomenclature is based on Plant Cell 2003, 15:1538 where the GenBank accession number given for AGL105 is AY141227 (Supplemental Table 3), which corresponds to AT5G37415. |
| AT1G71692 | Encodes a member of the MADS box family of transcription factors. Involved in root cell differentiation and flowering time. Loss of function mutations have abnormal cellular differentiation in the roots and are late flowering. AGL12 along with AGL14, and AGL17 is preferentially expressed in root tissues and represent the only characterized MADS box genes expressed in roots. |
| AT3G57230 | MADS-box transcription factor. Expressed in leaf, root and stem, with higher RNA accumulation in guard cells and trichomes. AGL16 can directly interact with SVP and indirectly interact with FLC. Furthermore, the accumulation of AGL16 transcripts is modulated by miR824 (AT4G24415). The flowering time effect for the miR824/AGL16 module is more obvious in the Col-FRI background than in the Col-0 background. AGL16 controls flowering via a allelic dosage effect in long-day non-vernalized conditions. |
| AT2G45660 | Controls flowering and is required for CO to promote flowering. It acts downstream of FT. Overexpression of (SOC1) AGL20 suppresses not only the late flowering of plants that have functional FRI and FLC alleles but also the delayed phase transitions during the vegetative stages of development. AGL20/SOC1 acts with AGL24 to promote flowering and inflorescence meristem identity.AGL20 upregulates expression of AGL24 in response to GA. |
| AT4G37940 | encodes a MADS box protein, highly expressed in the root. |
| AT2G14210 | MADS box gene, transcription factor |
| AT2G45650 | Sequence suggests this encodes a MADS-box transcription factor. Negatively regulates the FLC/MAF clade genes and positively regulates FT in Arabidopsis. |
| AT1G18750 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL65 is expressed in pollen.It forms heterodimers with other MICK family members (AGL104). Involved in late stages of pollen development and pollen tube growth. |
| AT5G51870 | Encodes a MADS-box transcription factor involved in floral transition. |
| AT5G58890 | AGAMOUS-like 82;(source:Araport11) |
| AT5G26950 | AGAMOUS-like 93;(source:Araport11) |
| AT1G69540 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. |
| AT2G36350 | Member of AGC VIIIa Kinase gene family. |
| AT3G44610 | Kinase involved in the first positive phototropism and gravitropism. Phosphorylates serine residues in the cytoplasmic loop of PIN1 and shares phosphosite preferences with D6PK. Critical component for both hypocotyl phototropism and gravitropism, control tropic responses mainly through regulation of PIN-mediated auxin transport by protein phosphorylation. |
| AT5G03640 | AGCVIII kinase involved in the pulse-induced first positive phototropism. |
| AT1G79450 | ALA-interacting subunit 5;(source:Araport11) |
| AT2G13360 | Encodes a peroxisomal photorespiratory enzyme that catalyzes transamination reactions with multiple substrates. It is involved in photorespiration. |
| AT4G39660 | alanine:glyoxylate aminotransferase 2 homolog (AGT2). The mRNA is cell-to-cell mobile. |
| AT2G36230 | Encodes a BBMII isomerase involved in histidine biosynthesis. |
| AT1G74920 | ALDH10A8 encodes a protein that has not been functionally characterized, but it is similar to an Arabidopsis protein that has betaine aldehyde dehydrogenase and aminoaldehyde dehydrogenase activity. ALDH10A8 localizes to leucoplasts. aldh10a8 mutant plants are more susceptible to NaCl and dehydration stress. |
| AT2G24270 | Encodes a protein with non-phosphorylating NADP-dependent glyceraldehyde-3-phosphate dehydrogenase activity. The activity of the enzyme was determined from leaf extracts; the enzyme has not been purified to confirm activity. |
| AT5G62530 | Encodes mitochondrial Delta-pyrroline-5- carboxylate dehydrogenase. Involved in the catabolism of proline to glutamate. Involved in protection from proline toxicity. Induced at pathogen infection sites. P5CDH and SRO5 (an overlapping gene in the sense orientation) generate 24-nt and 21-nt siRNAs, which together are components of a regulatory loop controlling reactive oxygen species (ROS) production and stress response. |
| AT3G48000 | Encodes a putative (NAD+) aldehyde dehydrogenase. |
| AT3G24503 | Arabidopsis thaliana aldehyde dehydrogenase AtALDH1a mRNA. a sinapaldehyde dehydrogenase catalyzes both the oxidation of coniferylaldehyde and sinapaldehyde forming ferulic acid and sinapic acid, respectively |
| AT4G36250 | Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures. |
| AT1G44170 | Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. It is also able to oxidize beta-unsaturated aldehydes, but not aromatic aldehydes. Activity of ALDH3H1 is NAD +-dependent. |
| AT4G34240 | Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. It is also able to oxidize beta-unsaturated aldehydes, but not aromatic aldehydes. ALDH3I1 was able to use both NAD+ and NADP+ as cofactors. |
| AT1G79440 | Encodes a mitochondrial succinic semialdehyde dehydrogenase (SSADH). Nomenclature according to Kirch, et al (2004). |
| AT1G54100 | Aldehyde dehydrogenase |
| AT5G60360 | Encodes a senescence-associated thiol protease. The mRNA is cell-to-cell mobile. |
| AT3G06500 | Encodes an alkaline/neutral invertase which localizes in mitochondria. It may be modulating hormone balance in relation to the radicle emergence. Mutants display severely reduced shoot growth and reduced oxygen consumption. Mutant root development is not affected as reported for A/N-InvA mutant (inva) plants. The mRNA is cell-to-cell mobile. |
| AT4G20070 | The gene encoding Arabidopsis thaliana Allantoate Amidohydrolase (AtAAH)which catalyzes the allantoate deiminase reaction (EC 3.5.3.9)is expressed in all parts of the plant being consistent with a function in purine turnover in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT4G04955 | Encodes an allantoinase which is involved in allantoin degradation and assimilation. Gene expression was induced when allantoin was added to the medium. The insertion mutant, ataln m2-1, did not grow well on the MS medium where allantoin, instead of ammonium nitrate, was supplied. |
| AT3G25760 | encodes allene oxide cyclase. One of four genes in Arabidopsis that encode this enzyme, which catalyzes an essential step in jasmonic acid biosynthesis. Gene expression is induced during senescence, a process that involves jasmonic acid signalling pathway. The mRNA is cell-to-cell mobile. |
| AT3G25770 | Encodes allene oxide cyclase. One of four genes in Arabidopsis that encode this enzyme, which catalyzes an essential step in jasmonic acid biosynthesis. Gene expression is induced during senescence, a process that involves jasmonic acid signalling pathway. Note: Nomenclature for Arabidopsis allene oxide cyclase 2 (AOC2, AT3G25770) gene is based on Stenzel et al. 2003 Plant Molecular Biology 51:895-911. AOC2 (AT3G25770) is also referred to as AOC3 in He et al. 2002 Plant Physiology, 128:876-884. The mRNA is cell-to-cell mobile. |
| AT1G13280 | Encodes allene oxide cyclase. One of four genes in Arabidopsis that encode this enzyme, which catalyzes an essential step in jasmonic acid biosynthesis. Gene expression is reduced during senescence, a process that involves jasmonic acid signalling pathway. |
| AT5G42650 | Encodes a member of the cytochrome p450 CYP74 gene family that functions as an allene oxide synthase. This enzyme catalyzes dehydration of the hydroperoxide to an unstable allene oxide in the JA biosynthetic pathway. It shows a dual catalytic activity, the major one being a 13-AOS but also expressing a 9-AOS activity. CFA-Leu, CFA-Val, CFA-Met and CFA-Ala can induce the expression of AOS. |
| AT3G52720 | Encodes an alpha carbonic anhydrase (CAH1) located in the chloroplast stroma. Most chloroplast proteins are encoded by the nuclear genome and imported with the help of sorting signals that are intrinsic parts of the polypeptides. CAH1 takes an alternative route through the secretory pathway, and becomes N-glycosylated before entering the chloroplast. Glycosylation and intra-molecular disulfide bridge fromation are necessary for the correct folding, ER export, trafficking and activity of the protein. |
| AT5G04180 | alpha carbonic anhydrase 3;(source:Araport11) |
| AT1G73680 | Encodes an alpha dioxygenase. Recombinant protein catalyzes the conversion of a wide range of fatty acids into 2(R)-hydroperoxy derivatives. |
| AT5G22770 | AP-2 complex subunit alpha-1. Part of endomembrane trafficking system. |
| AT3G10740 | Encodes a bifunctional alpha-l-arabinofuranosidase/beta-d-xylosidase that belongs to family 51 of glycoside hydrolases. It may be involved in cell wall modification. |
| AT3G56190 | Encodes one of two alpha-SNAPs (soluble NSF attachment protein) in Arabidopsis |
| AT1G18460 | Alpha/beta hydrolase |
| AT2G24100 | ATP-dependent DNA helicase;(source:Araport11) |
| AT5G10940 | ASG2 is farnesylated protein and this post-translational modification impacts its subcellular localization. It is the homolog of the human anti-obesity factor WDTC1 and is involved in the negative regulation of fatty acid biosynthesis. The non-farnesylated form displays a nucleo-cytosolic subcellular localization. The farnesylated form displays a cytosolic subcellular localization. Interaction with At4g05420 (DDB1a) was shown using BiFC approach. |
| AT1G20650 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G40475 | hypothetical protein;(source:Araport11) |
| AT3G22370 | Encodes AOX1a, an isoform of alternative oxidase that is expressed in rosettes, flowers, and root. The alternative oxidase of plant mitochondria transfers electrons from the ubiquinone pool to oxygen without energy conservations. It is regulated through transcriptional control and by pyruvate. Plays a role in shoot acclimation to low temperature. Also is capable of ameliorating reactive oxygen species production when the cytochrome pathway is inhibited. AOX1a also functions as a marker for mitochondrial retrograde response. The mRNA is cell-to-cell mobile. |
| AT5G64210 | encodes an isoform of alternative oxidase, which is expressed in rosettes, stems, and roots. Transcript accumulates in dry seeds and decreased upon germination and is not affected by actinomycin A. Protein is localized to mitochondria. |
| AT3G21430 | DNA binding protein;(source:Araport11) |
| AT1G08980 | Encodes an enzyme with similarity to bacterial acylamidohydrolases and exhibits indole-3-acetamide amidohydrolase activity in vitro. This enzyme may be involved in the in vivo biosynthesis of indole-acetic acid from indole-3-acetamide, a native metabolite of A. thaliana. It appears to exist as a monomer. |
| AT4G14940 | atao1 gene of Arabidopsis thaliana encodes an extracellular copper amine oxidase expressed during early stages of vascular tissue development. |
| AT1G58360 | Encodes AAP1 (amino acid permease 1), a neutral amino acid transporter expressed in seeds. Functions in amino acid uptake into embryos. The transporter also functions in acquisition of glutamate and neutral amino acids by the root. |
| AT1G44100 | amino acid permease 5 |
| AT5G23810 | Encodes nonfunctional amino acid transporter. AAP7 is the most distantly related member of the AAP family, a group of well characterized amino acid transporters within the ATF1 superfamily. Expression of this gene has not been detected with RNA gel blots or promoter GUS studies. |
| AT1G10010 | Encodes a high affinity amino acid transporter that is probably responsible for import of organic nitrogen into developing seeds. One of eight gene family members that encode amino acid permeases. Most closely related to AAP1 (75%) identity. |
| AT1G59820 | Encodes a phospholipid translocase. Involved in secretory vesicle formation from trans-Golgi in peripheral columella cells at the root tip. Mutants have short primary roots and grow slower. The mRNA is cell-to-cell mobile. |
| AT2G38290 | encodes a high-affinity ammonium transporter, which is expressed in shoot and root. Expression in root and shoot is under nitrogen and carbon dioxide regulation, respectively. |
| AT3G05870 | Subunit of the anaphase promoting complex, a ubiquitin ligase complex that regulates progression through the cell cycle. |
| AT5G28640 | Encodes a protein with similarity to mammalian transcriptional coactivator that is involved in cell proliferation during leaf and flower development. Loss of function mutations have narrow, pointed leaves and narrow floral organs. AN3 interacts with members of the growth regulating factor (GRF) family of transcription factors. |
| AT2G38750 | Annexins are a family of calcium dependent membrane binding proteins though to be involved in Golgi mediated secretion. This is one of four annexins identified in Arabidopsis. |
| AT4G00730 | Encodes a homeodomain protein of the HD-GLABRA2 group. Involved in the accumulation of anthocyanin and in root development. Loss of function mutants have increased cell wall polysaccharide content. |
| AT1G25220 | Catalyzes the first step of tryptophan biosynthesis: Chorismate L-Glutamine = Anthranilate Pyruvate L-Glutamate. Functions as a heterocomplex with anthranilate synthase alpha subunit (ASA1 or ASA2). |
| AT5G10760 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G78860 | curculin-like (mannose-binding) lectin family protein, low similarity to Ser/Thr protein kinase (Zea mays) GI:2598067; contains Pfam profile PF01453: Lectin (probable mannose binding) but not the protein kinase domain of the Z. mays protein |
| AT3G03860 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. The mRNA is cell-to-cell mobile. |
| AT4G08930 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. The mRNA is cell-to-cell mobile. |
| AT3G04080 | Encodes an Golgi-localized integral membrane enzyme with nucleoside diphosphate activity that when mutated in combination with ATAPY2 causes a complete inhibition of pollen germination.With respect to substrate specificity, APY1 shows the following preferences UTP>IDP>GDP. |
| AT2G02970 | Encodes a putative apyrase involved in pollen exine pattern formation and anther dehiscence. |
| AT3G14180 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT2G01440 | Encodes an ortholog of the bacterial RecG translocase, an organellar protein with multiple roles in mtDNA maintenance. The protein is targeted to mitochondria and plastids and is required for recombination-dependent repair and for suppression of ectopic recombination in mitochondria, most likely because of its role in recovery of stalled replication forks. |
| AT1G78790 | Encodes a protein with high similarity to mammalian MHF2 that acts in the same pathway as FANCM to restrain class II meiotic crossing over. |
| AT2G37990 | ribosome biogenesis regulatory protein (RRS1) family protein;(source:Araport11) |
| AT3G01310 | Encodes a functional VIP1/PPIP5K-type ATP-grasp kinase that is involved in both InsP6 to InsP7 conversion and InsP7 to InsP8 conversion, producing the InsP8 cofactor of the ASK1-COI1-JAZ-jasmonate co-receptor complex. It is the major isoform in plants, is required for jasmonate-dependent defenses, and plays an important role in plant defenses against necrotrophic fungi and insect herbivores. |
| AT3G54020 | Inositol phosphorylceramide synthase |
| AT5G18270 | NAC domain containing protein 87;(source:Araport11) |
| AT4G38520 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G02760 | Encodes a phosphatase that functions in sustaining proper leaf longevity and preventing early senescence by suppressing or perturbing SARK-mediated senescence signal transduction. |
| AT2G44690 | A member of ROP GTPase gene family; promotes autophagy. |
| AT5G65530 | Encodes a protein kinase involved in mediating resistance to fungi and also trichome branch number. Kinase activity is increased by ROP6 which also affects its sub-cellular localization (becomes localized to the cell periphery_ |
| AT2G28130 | NSE5 subunit of the SMC5/6 complex. |
| AT4G30400 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G35840 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G40070 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G37580 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09120 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09130 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G34990 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G40250 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G23980 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G57750 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G46160 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G61550 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G10150 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G49200 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G49210 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G18773 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G47610 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G24015 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G33565 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G44578 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G60966 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G20395 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G78440 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins. |
| AT1G17860 | Member of Kunitz trypsin inhibitor (KTI) family involved in plant defense response against spider mites. |
| AT5G61670 | Encodes a close homolog of the Cauliflower OR (Orange) protein that is located in the chloroplast of light grown organs but in the nucleus of etiolated cotyledons. The function of OR is to induce the differentiation of proplastids or other noncolored plastids into chromoplasts for carotenoid accumulation. Both proteins contain a Cysteine-rich zinc finger domain that is highly specific to DnaJ-like molecular chaperons. The AtOR protein interacts directly with the PSY (phytoene synthase) protein and acts as a positive posttranscriptional regulator of its expression, thereby affecting carotenoid biosynthesis. |
| AT1G22500 | Gene encodes a putative C3HC4-type RING zinc finger factor. it is induced in response to light and ascorbate stimulus. |
| AT3G05200 | Encodes a putative RING-H2 zinc finger protein ATL6 (ATL6). The mRNA is cell-to-cell mobile. |
| AT2G35000 | ATL9 is an E3 ligase-like protein that is induced by chitin oligomers and contributes to fungal resistance.It differs from other members of the ATL family in that it has a PEST domain. It is a short lived protein that is subject to proteosome mediated degradation. It is expressed in many aerial tissues in a pattern that varies with developmental stage. |
| AT4G37450 | AGP18 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP17 and AGP19, other lysine-rich AGPs. It is expressed in young leaves, shoots, roots and flowers and is active in the regulation of the selection and survival of megaspores. |
| AT5G64310 | Encodes arabinogalactan-protein (AGP1). The mRNA is cell-to-cell mobile. |
| AT3G13520 | Encodes a GPI-anchored arabinogalactan (AG) peptide with a short 'classical' backbone of 10 amino acids, seven of which are conserved among the 4 other Arabidopsis AG peptides. These peptides may be involved in cell signaling. |
| AT4G26320 | arabinogalactan protein 13;(source:Araport11) |
| AT5G56540 | Encodes arabinogalactan protein (AGP14). Mutants exhibit longer root hairs. The mRNA is cell-to-cell mobile. |
| AT5G11740 | Encodes arabinogalactan protein (AGP15). The mRNA is cell-to-cell mobile. |
| AT2G23130 | AGP17 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP18 and AGP19, other lysine-rich AGPs. 84% of its proline residues are hydroxylated to hydroproline and its heavy glycosylation accounts for appr. 69% of the molecular weight. The main glycosyl residues are arabinose (30.1%) and galactose (55.1%). Glycosyl linkages are consistent with type II arabinogalactans. AGP17 is predicted to have a glycosylphosphatidylinositol (GPI)anchor and is localized to the plasma membrane and Hechtian strands. It is expressed in young/old leaves, shoots, suspension cultures and flowers. |
| AT2G22470 | Encodes arabinogalactan-protein (AGP2). |
| AT3G61640 | arabinogalactan protein 20;(source:Araport11) |
| AT1G55330 | Encodes a putative arabinogalactan-protein (AGP21). |
| AT5G53250 | arabinogalactan protein 22;(source:Araport11) |
| AT5G40730 | Encodes an arabinogalactan-protein (AGP24). |
| AT5G18690 | arabinogalactan protein 25;(source:Araport11) |
| AT2G47930 | arabinogalactan protein 26;(source:Araport11) |
| AT4G40090 | arabinogalactan protein 3;(source:Araport11) |
| AT5G10430 | Encodes arabinogalactan-protein (AGP4) that is expressed in female reproductive tissues. It is involved in promoting degeneration of the persistent synergid after fertilization. In mutant ovules, the persistent synergid does not degrade resulting in polytuby. |
| AT5G24105 | Encodes a putative arabinogalactan-protein (AGP41). |
| AT5G65390 | arabinogalactan protein 7;(source:Araport11) |
| AT2G14890 | putative proline-rich protein (At2g14890) mRNA, complete The mRNA is cell-to-cell mobile. |
| AT4G16130 | Arabinokinase. |
| AT3G45230 | Encodes the arabinogalactan protein core of plant cell wall proteoglycan that contains arabinogalactan and cell wall matrix glycan pectin and/or xylan domains. |
| AT5G36925 | hypothetical protein;(source:Araport11) |
| AT3G17660 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes; AGD15 belongs to the class 4, together with AGD14. |
| AT1G10870 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD4 belongs to the Class 1, together with AGD1, AGD2, and AGD3. |
| AT5G54310 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. Regulates membrane trafficking and organ separation. |
| AT4G17890 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT1G24120 | encodes a DnaJ-like protein similar to ARG1 and ARL2 that are both involved in root and hypocotyl gravitropism response. However, null mutation in this gene does not result in defects in gravitropism. Gene is expressed in all tissues examined. |
| AT2G16500 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Promoter region of ADC1 contains 742-bp AT-rich transposable element, called AtATE, that belongs to the MITE families of repetitive elements. |
| AT4G34710 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1. |
| AT2G46610 | Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT4G25500 | Encodes an arginine/serine-rich splicing factor. The transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. RS40 binds to HYL1 and co-localizes to the nuclear dicing body. Along with RS41, it appears to be involved in pri-miRNA processing and miRNA biogenesis (DOI:10.1093/nar/gkv751). |
| AT1G48410 | Encodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus. |
| AT2G32940 | Encodes a nuclear localized 879-amino-acid protein that contains conserved PAZ and PIWI domains that is important for the accumulation of specific heterochromatin-related siRNAs, and for DNA methylation and transcriptional gene silencing. |
| AT2G31760 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G63760 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G01950 | Encodes a member of the armadillo/beta-catenin repeat kinesin motor family. Mutants have twisted roots due to abnormal cell file rotation; the phenotype is dependent on microtubules. |
| AT5G66200 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT4G36030 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT1G11790 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT5G22630 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile. |
| AT1G08250 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Although this enzyme has sequence similarity to prephenate dehydratases, it is 98 times more active with arogenate than prephenate in enzymatic assays. |
| AT3G11900 | encodes an amino acid transporter that transports aromatic and neutral amino acids, IAA, and 2,4-D. Expressed in all tissues with highest abundance in flowers and cauline leaves. a member of a small gene family in Arabidopsis and represents a new class of amino acid transporters. |
| AT1G07890 | Encodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. The mRNA is cell-to-cell mobile. |
| AT4G35000 | Encodes a microsomal ascorbate peroxidase APX3. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. The APX3 protein interacts with AKR2 (ankyrin-containing protein that interacts with AFT1) and AFT1, a 14-3-3 protein. |
| AT1G05970 | Anti-silencing factor. Forms a complex with ASI1-EDM2 that is required for expression of some nonintronic HC-TRE genes |
| AT3G02890 | PHD protein which cooperates with PAIPP2 and BAH domain protein AIPP3 to read H3K4 histone marks. The BAH-PHD bivalent histone reader complex silences a substantial subset of H3K27me3-enriched loci, including development and stress response-related genes. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
| AT4G11560 | BAH domain protein which cooperates with PHD protein AIPP2 to read H3K27me3 histone marks. The BAH-PHD bivalent histone reader complex silences a substantial subset of H3K27me3-enriched loci, including development and stress response-related genes. Responsible for preventing flowering by suppressing the expression of flowering genes. Binding of BDT1 to the H3K27me3 peptide, which is enhanced by PHD proteins, is critical for preventing early flowering. |
| AT1G62800 | Encodes aspartate aminotransferase (Asp4). |
| AT4G19710 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
| AT4G16144 | Encodes AMSH3, a deubiquitinating enzyme that hydrolyzes K48- and K63-linked ubiquitin chains in vitro. Required for intracellular trafficking and vacuole biogenesis. |
| AT2G42440 | Lateral organ boundaries (LOB) domain family protein;(source:Araport11) |
| AT1G67370 | Meiotic asynaptic mutant 1 (ASY1). ASY1 protein is initially distributed as numerous foci throughout the chromatin. During early G2, the foci are juxtaposed to the nascent chromosome axes to form a continuous axis associated signal. |
| AT2G46980 | Encodes ASY3, a coiled-coil domain protein that is required for normal meiosis. |
| AT1G63480 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT5G49700 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
| AT4G22770 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT4G22810 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
| AT5G62260 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT4G00200 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT2G45850 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT3G55560 | AT-hook protein of GA feedback 2;(source:Araport11) |
| AT3G04570 | AT-hook motif nuclear-localized protein 19;(source:Araport11) |
| AT4G14465 | AT-hook protein. Overexpression results in early flowering in short and long days. |
| AT2G46040 | Encodes a transcriptional activator that is involved in pollen development. ARID1 is expressed in nuclear bodies of microspore, vegetative and generative cells, and binds to and activates DUO during microgametogenesis. |
| AT4G36090 | oxidoreductase, 2OG-Fe(II) oxygenase family protein;(source:Araport11) |
| AT4G32830 | Encodes a member of a family of Ser/Thr kinases whose activities peak during cell division. Transcripts are abundant in tissues rich in dividing cells like roots and flowers but are low or absent in fully expanded leaves and stems. In interphase cells, the protein is predominantly nuclear. During mitosis, the protein associates with plant-specific cytoskeletal structures (preprophase band, phragmoplast, nascent cell plate) that are necessary for cytokinesis as well as with the microtubule spindle. It specifically phosphorylates Ser10 of histone H3 and colocalizes with phosphorylated histone H3 during mitosis. |
| AT3G48190 | Encodes a homolog of the human ATM gene, which is mutated in ataxia telangiectasia, a chromosome instability disorder. Suppresses leaf senescence triggered by DNA double-strand break through epigenetic control of senescence-associated genes. Characterization of mutants suggest a role homologous recombination for DNA damage repair in response to ionizing radiation as well as during meiosis. The protein has kinase domains and shows kinase activity in orthologs. There is also evidence that ATM might be involved in the telomerase-independent process known as Alternative Lengthening of Telomeres. |
| AT3G06590 | Encodes RITF1, a bHLH transcription factor that regulates the transcription of several genes involved in the detoxification of reactive oxygen species generated by salt stress. |
| AT3G17100 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT1G09250 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G05800 | AtBS1(activation-tagged BRI1 suppressor 1)-interacting factor 1;(source:Araport11) |
| AT3G62690 | Encodes a RING-H2 zinc finger protein related to ATL2. The ATL gene family is represented by fifteen sequences that contain, in addition to the RING, a transmembrane domain which is located in most of them towards the N-terminal end. |
| AT5G49460 | One of the two genes encoding subunit B of the cytosolic enzyme ATP Citrate Lyase (ACL) |
| AT5G44110 | Encodes a member of the NAP subfamily of ABC transporters whose expression pattern is regulated by light and sucrose. |
| AT3G28860 | Encodes a member of the ATP-binding cassette (ABC) transporter family that is involved in auxin transport and is involved in postembryonic organ separation. Also known as AtMDR11 and PGP19. Possibly regulates auxin-dependent responses by influencing basipetal auxin transport in the root. Acts upstream of phyA in regulating hypocotyl elongation and gravitropic response. Exerts nonredundant, partially overlapping functions with the ABC transporter encoded by AtPGP1. |
| AT4G28630 | Half-molecule ABC transporter ATM1. Arabidopsis thaliana has three ATM genes, namely ATM1, ATM2 and ATM3. Only ATM3 has an important function for plant growth. |
| AT5G39040 | Encodes a member of TAP subfamily of ABC transporters that is located in the vacuole. Mutants are hypersensitive to aluminum and the gene product may be important for intracellular movement of some substrate, possibly chelated Al, as part of a mechanism of aluminum sequestration. |
| AT4G25450 | member of NAP subfamily |
| AT4G01820 | member of MDR subfamily |
| AT2G39480 | P-glycoprotein 6;(source:Araport11) |
| AT3G62700 | member of MRP subfamily |
| AT3G21250 | member of MRP subfamily |
| AT3G13640 | member of RLI subfamily |
| AT4G30300 | member of NAP subfamily |
| AT1G17840 | Encodes a plasma membrane-localized ATP-binding cassette transporter, that is required for cutin transport to the extracellular matrix. The mRNA is cell-to-cell mobile. |
| AT5G06530 | Encodes ABCG22, an ABC transporter gene. Mutation results in increased water transpiration and drought susceptibility. |
| AT1G53390 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G26910 | Encodes a member of the PLEIOTROPIC DRUG RESISTANCE family of ATP binding cassette transporters. Required for the formation of a functional cuticle. |
| AT2G36380 | pleiotropic drug resistance 6;(source:Araport11) |
| AT1G15210 | pleiotropic drug resistance 7;(source:Araport11) |
| AT4G15233 | ABC-2 and Plant PDR ABC-type transporter family protein;(source:Araport11) |
| AT4G15236 | ABC-2 and Plant PDR ABC-type transporter family protein;(source:Araport11) |
| AT3G21580 | cobalt ion transmembrane transporter;(source:Araport11) |
| AT5G02270 | member of NAP subfamily |
| AT1G60810 | One of the three genes encoding subunit A of the trimeric enzyme ATP Citrate lyase |
| AT3G06650 | One of the two genes encoding subunit B of the trimeric enzyme ATP Citrate lyase |
| AT5G61810 | Encodes the predominant of three APC isoforms in Arabidopsis, a calcium-dependent mitochondrial ATP-Mg/Pi transporter. |
| AT1G13690 | AtE1 - stimulates the ATPase activity of DnaK/DnaJ |
| AT3G22150 | Involved in RNA editing of plastid atpF and mitochondrial nad5. |
| AT1G56310 | DEDDy-type 3′ -> 5′ exoribonuclease involved in miRNA degradation. |
| AT5G06160 | Encodes a protein with similarity to pre-mRNA splicing factor SF3a60 that is involved in gametic cell fate determination. Loss of function results in the ectopic expression of egg cell makers suggesting a role in restriction of gametic cell fate. Expressed strongly in gametophytes and weakly in sporophytes. |
| AT2G24540 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G40800 | TIM domain protein. Associates with components of mitochondrial complex I and III. May be involved in biogenesis of respiratory chain components. |
| AT3G56430 | TIM domain protein. Associates with components of mitochondrial complex I and III. May be involved in biogenesis of respiratory chain components. |
| AT4G29670 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase. |
| AT1G08570 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase. The mRNA is cell-to-cell mobile. |
| AT5G61440 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. The mRNA is cell-to-cell mobile. |
| AT2G32980 | HAUS augmin-like complex subunit;(source:Araport11) |
| AT5G17620 | nuclear matrix protein;(source:Araport11) |
| AT2G41560 | Encodes a calmodulin-regulated Ca(2+)-ATPase that improves salt tolerance in yeast. Localized to the vacuole. Lesion mimic phenotype when mutation in the gene is combined with a mutation in ACA11. Lesion mimic phenotype of double knockout can be suppressed by nutritional supplements that increase anion levels (e.g. 15 mM Nitrate, Chloride, or Phosphate). |
| AT5G57110 | Arabidopsis-autoinhibited Ca2+ -ATPase, isoform 8, contains all of the characteristic motifs of Ca2+ -transporting P-type Ca2+ -ATPases and is localized to the plasma membrane. |
| AT3G57330 | Lesion mimic phenotype when mutation in the gene is combined with a mutation in ACA4. Lesion mimic phenotype of double knockout can be suppressed by nutritional supplements that increase anion levels (e.g. 15 mM Nitrate, Chloride, or Phosphate) |
| AT1G54210 | Autophagy protein. |
| AT3G13970 | Autophagy protein. |
| AT3G19190 | Encodes autophagy-related 2 (ATG2). The mRNA is cell-to-cell mobile. |
| AT2G44140 | Autophagy protein |
| AT5G17290 | Autophagy protein ATG5. Forms a conjugate with ATG12 with an essential role in plant nutrient recycling. Mutants missing ATG5 display early senescence and are hypersensitive to nitrogen or carbon starvation, accompanied by a more rapid loss of organellar and cytoplasmic proteins. |
| AT4G21980 | Encodes APG8, a component of autophagy conjugation pathway. Delivered to the lumens of vacuole under nitrogen-starvation condition. Highest expression in flowers. mRNA abundance increased during dark-induced carbon starvation. Predominantly cytoplasmic with or without N starvation. Upon concanamycin A the protein accumulates in the central vacuole as punctuate structures that resemble autophagic bodies. This localization is more abundant upon N starvation. The mRNA is cell-to-cell mobile. |
| AT1G62040 | Autophagy protein. |
| AT2G45170 | Involved in autophagy. Under nutrient starvation the protein localizes to autophagosomes. Involved in submergence (hypoxia) tolerance; ethanol induces autophagy. |
| AT4G16520 | Autophagy protein. |
| AT3G60640 | Autophagy protein. |
| AT3G15580 | Encodes APG8, a component of autophagy conjugation pathway. Delivered to the lumens of vacuole under nitrogen-starvation condition. |
| AT5G05150 | autophagy-related protein 18E;(source:Araport11) |
| AT3G61960 | autophagy gene |
| AT1G21660 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT4G36520 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G30280 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G49980 | auxin F-box protein 5;(source:Araport11) |
| AT5G43700 | Auxin inducible protein similar to transcription factors. |
| AT2G38120 | Encodes an auxin influx transporter. AUX1 resides at the apical plasma membrane of protophloem cells and at highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning. Shoot supplied ammonium targets AUX1 and inhibits lateral root emergence. The mRNA is cell-to-cell mobile. |
| AT1G04250 | Transcription regulator acting as repressor of auxin-inducible gene expression. Auxin-inducible AUX/IAA gene. Short-lived nuclear protein with four conserved domains. Domain III has homology to beta alpha alpha dimerization and DNA binding domains. Involved in auxin signaling and is a positive modulator of natural leaf senescence. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. |
| AT2G28350 | Involved in root cap cell differentiation. |
| AT2G46530 | auxin response factor 11;(source:Araport11) |
| AT1G30330 | Encodes a member of the auxin response factor family. Mediates auxin response via expression of auxin regulated genes. Acts redundantly with ARF8 to control stamen elongation and flower maturation. Expression of ARF6 is controlled by miR167. |
| AT5G37020 | Encodes a member of the auxin response factor family. Mediates auxin response via expression of auxin regulated genes. Acts redundantly with ARF6 to control stamen elongation and flower maturation. Expression of ARF8 is controlled by miR167. |
| AT1G12820 | Auxin receptor involved in primary and lateral root growth inhibition in response to nitrate. Target of miR393. Induced by nitrate in primary roots. |
| AT4G24390 | RNI-like superfamily protein;(source:Araport11) |
| AT1G78100 | F-box family protein;(source:Araport11) |
| AT3G07390 | isolated from differential screening of a cDNA library from auxin-treated root culture. sequence does not show homology to any known proteins and is predicted to be extracellular. The mRNA is cell-to-cell mobile. |
| AT2G33310 | Auxin induced gene, IAA13 (IAA13). |
| AT4G12980 | Activated by OXS2 under the treatment of salt. |
| AT1G33960 | Identified as a gene that is induced by avirulence gene avrRpt2 and RPS2 after infection with Pseudomonas syringae pv maculicola strain ES4326 carrying avrRpt2 |
| AT2G32410 | Involved in chiasma distribution, affects expression of key DNA repair and meiotic genes, signifcant role in DNA repair. |
| AT3G10960 | Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2). |
| AT2G33500 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT1G28050 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT1G49130 | Regulated by heat shock. |
| AT1G75540 | Encodes a B-box zinc finger transcription factor BBX21 (also named STH2/salt tolerance homolog2 and LHUS/long hypocotyl under shade). Interacts with COP1 to control de-etiolation. Also genetically interacts with COP1 to regulate shade avoidance. The mRNA is cell-to-cell mobile. |
| AT4G10240 | B-box zinc finger family protein;(source:Araport11) |
| AT1G68190 | B-box zinc finger family protein;(source:Araport11) |
| AT4G27310 | Encodes an atypical B-box domain protein that negatively regulates photomorphogenic development by interfering with the binding of the transcription factor HY5 to target gene promoters. Degradation of BBX28 in darkness is dependent on COP1 and occurs via the 26S proteasome pathway. BBX28 acts as a key factor in the COP1-HY5 regulatory hub by maintaining proper HY5 activity to ensure normal photomorphogenic development in plants. Interacts with CO via B-box domain resulting in decreased FT expression and delayed flowering. |
| AT5G54470 | B-box type zinc finger family protein;(source:Araport11) |
| AT3G21890 | B-box type zinc finger family protein;(source:Araport11) |
| AT5G48250 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT3G18080 | B-S glucosidase 44;(source:Araport11) |
| AT4G34700 | Encodes the B22 subunit of eukaryotic mitochondrial Complex I. Mutation in the gene display pleiotropic phenotypes including shorter roots, smaller plants and delayed flowering. The mRNA is cell-to-cell mobile. |
| AT3G23750 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G27190 | Activated by TCP8/14/15/22, involved in modulation of GA-dependent stamen filament elongation. |
| AT2G35260 | CAAX protease self-immunity protein;(source:Araport11) |
| AT3G45260 | BIB is a member of the BIRD family of zinc finger proteins that includes JKD. BIB functions redundantly with JKD to retain SHR in the nucleus and thereby restrict SHR movement in root tissues. |
| AT4G29100 | Member of basic helix loop helix protein family. Expressed primarily in vascular system. Overexpression causes ABA sensitivity. Together with PFA1 and PFA2 governs the competence of pericycle cells to initiate lateral root primordium formation. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT2G31220 | Encodes a bHLH transcription factor that together with bHLH089 and bHLH091 is important for the normal transcriptome of the developing Arabidopsis anther, possibly by forming a feed-forward loop with DYT1. |
| AT2G31210 | Encodes a bHLH transcription factor that together with bHLH089 and bHLH010 is important for the normal transcriptome of the developing Arabidopsis anther, possibly by forming a feed-forward loop with DYT1. |
| AT1G51070 | bHLH115 is a basic helix loop helix protein of the IVc subgroup that plays a role in iron homeostasis. It interacts with related family members and targets PYE and other genes involved in response to Fe. |
| AT3G23210 | bHLH34 is a basic helix loop helix transcription factor. It can bind GAGA and E-box cis elements.It is induced by abiotic stressors including ABA, salt and glucose. PGR, a plasma membrane glucose responsive regulator is a target of bHLH34. Involved in Fe regulation. |
| AT2G41240 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT3G54620 | bZIP transcription factor-like protein mRNA |
| AT5G49450 | Encodes a transcription activator is a positive regulator of plant tolerance to salt, osmotic and drought stresses. |
| AT2G40620 | Basic leucine zipper transcription factor. Localizes from cytoplasm to the nucleus under heat stress. |
| AT2G18160 | Encodes a b-ZIP transcription factor. |
| AT4G38900 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT1G75390 | basic leucine-zipper 44;(source:Araport11) |
| AT1G06850 | bZIP protein involved in heat stress response. Under heat stress localization moves exclusively to nucleus. |
| AT2G22850 | basic leucine-zipper 6;(source:Araport11) |
| AT1G06070 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT1G14685 | Encodes a member of the BASIC PENTACYSTEINE (BPC) proteins. BPC proteins are plant-specific transcription factors present throughout land plants. BPC transcription factor family is integral for a wide range of processes that support normal growth and development.Along with BPC1, BPC2 binds to the promoter of and represses GALS1 thereby reducing beta 1,4- galactan accumulation. |
| AT2G01930 | BASIC PENTACYSTEINE1 (BPC1) is a regulator of the homeotic Arabidopsis thaliana gene SEEDSTICK (STK), which controls ovule identity. BPC1 induces conformational changes by cooperative binding to purine-rich elements present in the STK regulatory sequence. STK is upregulated in bpc1 mutant.Along with BPC2, BPC1 binds to the promoter of and represses GALS1 thereby reducing beta 1,4- galactan accumulation. |
| AT3G08670 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT3G51540 | mucin-5AC-like protein;(source:Araport11) |
| AT3G62420 | Encodes a group-S bZIP transcription factor. Forms heterodimers with group-C bZIP transcription factors. The heterodimers bind to the ACTCAT cis-element of proline dehydrogenase gene. |
| AT3G56660 | basic region/leucine zipper motif protein 49;(source:Araport11) |
| AT3G60080 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G52060 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT5G62100 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT5G07220 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT5G62390 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. Localized to the ER. Necessary for the proper maintenance of the unfolded protein response during heat and cold tolerance. |
| AT2G35940 | Encodes a member of the BEL-like homeodomain protein family. Ecotopic expression in the embryo sac leads to defects in nuclear migration and cellularization and embryo sacs with multiple egg cells. Loss of function alleles have no female gametophyte defects. The ecotopic expression phenotype requires KNAT3 because it can be suppressed by loss of KNAT3 function alleles. Localized to the nucleus but interaction with OFP1 relocates it to the cytoplasm. |
| AT1G19700 | Encodes a member of the BEL family of homeodomain proteins. Its interaction with PLP (PAS/LOV PROTEIN) is diminished by blue light. |
| AT4G36870 | Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw1/saw2 may act redundantly to repress BP in leaves. Regulates together with BLH4 demethylesterification of homogalacturonan in seed mucilage. |
| AT1G75410 | BEL1-like homeodomain 3 (BLH3) |
| AT2G16400 | BEL1-like homeodomain 7;(source:Araport11) |
| AT5G41410 | Homeodomain protein required for ovule identity.Loss of function mutations show homeotic conversion of integuments to carpels.Forms heterodimers with STM and KNAT1. Interacts with AG-SEP heterodimers is thought to restrict WUS expression. BEL interacts with MADS box dimers composed of SEP1(or SEP3) and AG, SHP1, SHP2 and STK. The interaction of BEL1 with AG-SEP3 is required for proper integument development and specification of integument identity. |
| AT1G69010 | Encodes BES1-INTERACTING MYC-LIKE 2 (BIM2), a PAR1 (PHYTOCHROME RAPIDLY REGULATED 1)-interacting protein that positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT5G08130 | Encodes a basic helix-loop-helix (bHLH) family protein BIM1 (BES1-INTERACTING MYC-LIKE 1), involved in brassinosteroid signaling. It synergistically interacts with BES1 to bind to E box sequences (CANNTG). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT3G50750 | BES1/BZR1 homolog 1;(source:Araport11) |
| AT4G36780 | BES1/BZR1 homolog 2;(source:Araport11) |
| AT4G18890 | BES1/BZR1 homolog 3;(source:Araport11) |
| AT1G78700 | BES1/BZR1 homolog 4;(source:Araport11) |
| AT3G61320 | Encodes a bestrophin-like protein (Best1). Located in the stroma thylakoid membrane. Functions as a chloride ion channel. Proposed to modulate proton motive force partitioning by mediating chloride ion influx in the thylakoid lumen. Major isoform (based on transcript analysis), redundant function with AtBest2. |
| AT3G58170 | Encodes a Bet1/Sft1-like SNARE protein which fully suppresses the temperature-sensitive growth defect in sft1-1 yeast cells; however, it cannot support the deletion of the yeast BET1 gene (bet1Δ). |
| AT1G70410 | Encodes a putative beta-carbonic anhydrase betaCA4. Together with betaCA1 (At3g01500) regulates CO2-controlled stomatal movements in guard cells, as well as attenuates immunity. Differential CA gene expression in response to changing atmospheric CO2 conditions contribute to altered disease resistance levels. |
| AT4G27830 | Encodes a beta-glucosidase that may be responsible for acyl-glucose-dependent anthocyanin glucosyltransferase activity in Arabidopsis. In vitro efforts to demonstrate AAGT activity for BGLU10 have been unsuccessful but experiments with mutants in this gene suggest at least an indirect involvement in anthocyanin formation. |
| AT3G60130 | beta glucosidase 16;(source:Araport11) |
| AT2G44480 | beta glucosidase 17;(source:Araport11) |
| AT1G52400 | encodes a member of glycosyl hydrolase family 1, located in inducible ER bodies which were formed after wounding, required in inducible ER body formation The mRNA is cell-to-cell mobile. |
| AT3G03640 | Encodes beta-glucosidase (GLUC). |
| AT3G60120 | beta glucosidase 27;(source:Araport11) |
| AT3G18070 | beta glucosidase 43;(source:Araport11) |
| AT1G61820 | beta glucosidase 46;(source:Araport11) |
| AT4G27820 | beta glucosidase 9;(source:Araport11) |
| AT5G65640 | bHLH093/NFL encodes a bHLH transcription factor involved in GA mediated control of flowering time. Mutants are non-flowering in short days and phenotype can be reversed with GA application. Based on the expression of GA biosynthetic genes in the mutant, it likely acts through regulation of GA metabolism. Its expression shows developmental stage and tissue specificity. In short days it is expressed mainly in root tips and SAM, with weak expression in cotyledons throughout development. In LD GUS activity was observed in the hypocotyl and in root tips and SAM throughout the developmental stages. |
| AT1G62710 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteases that is expressed specifically in seeds and is essential for the proper processing of storage proteins. |
| AT5G42100 | encodes a plasmodesmal (Pd)-associated membrane protein involved in plasmodesmal callose degradation, i.e. beta-1,3-glucanase (EC 3.2.1.39), and functions in the gating of Pd |
| AT3G52060 | Encodes a plasmodesmal glycosyltransferase-like protein. Mutation results in defects in seed germination and delayed plant growth. |
| AT5G18670 | putative beta-amylase BMY3 (BMY3) |
| AT5G52570 | Converts β-carotene to zeaxanthin via cryptoxanthin. |
| AT4G35010 | putative beta-galactosidase (BGAL11 gene) |
| AT1G77410 | beta-galactosidase 16;(source:Araport11) |
| AT3G52840 | beta-galactosidase 2;(source:Araport11) |
| AT5G56870 | beta-galactosidase 4;(source:Araport11) |
| AT5G20710 | beta-galactosidase 7;(source:Araport11) |
| AT1G61810 | beta-glucosidase 45;(source:Araport11) |
| AT4G21760 | beta-glucosidase 47;(source:Araport11) |
| AT3G55260 | Encodes a protein with β-hexosaminidase activity (the enzyme is active with p-nitrophenyl-β-N-acetylglucosaminide as substrate but displayed only a minor activity toward p-nitrophenyl-β-N-acetylgalactosaminide). The enzyme displays no distinct preference for a specific terminal GlcNAc residue and indeed cleaved the asialoagalactodabsylglycopeptide GnGn to a mixture of products. |
| AT1G65590 | Encodes a protein with beta-hexosaminidase activity. Located on the plasma membrane. |
| AT5G65940 | hydrolyzes beta-hydroxyisobutyryl-CoA |
| AT4G25700 | Converts beta-carotene to zeaxanthin via cryptoxanthin. |
| AT1G67730 | Encodes one of the two Arabidopsis homologues to YBR159w encoding a S. cerevisiae beta-ketoacyl reductase (KCR), which catalyzes the first reduction during VLCFA (very long chain fatty acids, >18 carbon) elongation: KCR1 (At1g67730), KCR2 (At1g24470). Complementation of the yeast ybr159Delta mutant demonstrated that the two KCR proteins are divergent and that only AtKCR1 can restore heterologous elongase activity similar to the native yeast KCR gene. The mRNA is cell-to-cell mobile. |
| AT5G64370 | PYD3 encodes a beta-ureidopropionase which, when expressed in E. coli, has been shown to convert beta-ureidopropionate into beta-alanine. It localizes to the cytosol and plays an important role in uracil degradation. |
| AT1G02640 | encodes a protein similar to a beta-xylosidase located in the extracellular matrix. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
| AT4G31490 | Required for plant growth, salt tolerance, and maintenance of the structure of the Golgi apparatus. |
| AT1G75380 | Encodes a nuclease involved in ABA-mediated callose deposition. It has been shown to interact with JAZ proteins, binds to a jasmonic acid-responsive element (JARE) and repress AtJMT expression. |
| AT1G19660 | Wound-responsive family protein;(source:Araport11) |
| AT5G12050 | rho GTPase-activating protein;(source:Araport11) |
| AT1G69160 | suppressor;(source:Araport11) |
| AT1G59640 | A basic helix-loop-helix encoding gene (BIGPETAL, BPE) involved in the control of petal size. BPE is expressed via two mRNAs derived from an alternative splicing event. The BPEub (AT1G59640.1)transcript is expressed ubiquitously, whereas the BPEp (AT1G59640.2) transcript is preferentially expressed in petals. Plants that lack the petal-expressed variant BPEp have larger petals as a result of increased cell size. BPEp is positively regulated downstream of APETALA3, PISTILLATA, APETALA1 and PISTILLATA3 and is negatively regulated downstream of AGAMOUS. |
| AT4G22840 | Sodium Bile acid symporter family;(source:Araport11) |
| AT1G78560 | Chloroplast inner membrane, pantothenate transporter. |
| AT2G26900 | Sodium Bile acid symporter family;(source:Araport11) |
| AT5G57590 | Encodes a bifunctional enzyme with both dethiobiotin synthetase and diaminopelargonic acid aminotransferase activities that is involved in biotin synthesis. |
| AT5G15530 | biotin carboxyl carrier protein isoform 2 (BCCP2) mRNA, |
| AT5G04620 | The cDNA encoding 7-keto-8-aminopelargonic acid (KAPA) synthase, the first committed enzyme of the biotin synthesis pathway has been cloned and its molecular function confirmed (functional complementation of an E. coli mutant). The subcellular localization of the enzyme (cytosol) proves that the biotin biosynthesis in plants takes place in different compartments which differs from the biosynthetic route found in microorganisms. |
| AT4G13590 | Chloroplast manganese transporter required for chloroplast manganese homeostasis and photosynthetic function. |
| AT3G57130 | Encodes BOP1. Contains Pfam domain, PF00023: Ankyrin repeat and Pfam domain, PF00651: BTB/POZ domain. Lines carrying recessive mutations exhibit a number of visible defects, most pronounced being ectopic outgrowths of in leaf petioles of rosette leaves. Along with BOP2, BOP1 is required for nectary development and formation of normal abscission zones.Forms homodimers and heterodimers with BOP2. Nuclear localization is required for activity which includes positive regulation of AS2 in leaves. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP1 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP1 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP1 expression is restricted to pedicel axils by BP and PNY. BOP1 promotes KNAT6 (At1g23380) expression.BOP1 Interacts with BIL1/BZR1 and Inhibits BIL1/BZR1 transport into the nucleus. |
| AT2G41370 | Encodes BOP2, a cytoplasmic and nuclear-localized NPR1 like protein with BTB/POZ domain and ankyrin repeats. Interacts with BOP1 and appears to be genetically redundant with BOP1.bop1/bop2 double mutants have longer leaves, often with leaflets on the petiole, asymmetric flowers with extra organs and no nectaries. Also defective in floral organ abscission. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP2 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP2 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP3 expression is restricted to pedicel axils by BP and PNY; promotes KNAT6 (At1g23380) expression. |
| AT2G30330 | Putative homolog of mammalian BLOC-1 Subunit 1. Protein - protein interaction with BLOS2 and also with SNX1.Located in endomembrane system and hypothesized to be involved in endomembrane transport. |
| AT4G18950 | BHP1 is a Raf-like protein kinase involved in mediating blue light dependent stomatal opening. |
| AT3G54810 | Encodes a protein containing a GATA type zinc finger domain that is expressed in the embryo axis and involved in germination. Mutants have a reduced rate of germination even when stratified. |
| AT1G14580 | C2H2-like zinc finger protein;(source:Araport11) |
| AT5G53400 | Encodes BOBBER1 (BOB1), a non-canonical small heat shock protein required for both development and thermotolerance. BOB1 is cytoplasmic at basal temperatures but forms heat shock granules containing canonical small heat shock proteins at high temperatures. The mRNA is cell-to-cell mobile. |
| AT1G79110 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT3G12920 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT5G07300 | Encodes a copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. |
| AT1G08860 | Encodes a copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Overexpression of this gene suppresses bon1-1 phenotypes. Double mutant analyses with bon1-1 suggest that BON1 and BON3 have overlapping functions in maintaining cellular homeostasis and inhibiting cell death. |
| AT2G39660 | Encodes a plasma membrane-localized ser/thr protein kinase that is a crucial component of host response signaling required to activate the resistance responses to Botrytis and A. brassicicola infection. It is likely a negative regulator of salicylic acid accumulation and basal defense against virulent bacterial pathogens. Together with ER plays opposing roles in leaf morphogenesis and inflorescence architecture. Required to maintain appropriate auxin response during leaf margin morphogenesis. Interacts with ER-family proteins and directly phosphorylates ER. |
| AT1G79420 | C-type mannose receptor (DUF620);(source:Araport11) |
| AT3G19540 | glutamyl-tRNA (Gln) amidotransferase subunit A (DUF620);(source:Araport11) |
| AT1G49840 | glutamyl-tRNA (Gln) amidotransferase subunit A (DUF620);(source:Araport11) |
| AT5G05840 | replication factor C subunit, putative (DUF620);(source:Araport11) |
| AT3G01210 | ACD11 binding partner, may be involved in negative regulation of ROS-mediated defense response. |
| AT4G17720 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G14340 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
| AT1G18400 | Encodes the brassinosteroid signaling component BEE1 (BR-ENHANCED EXPRESSION 1). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT4G36540 | Encodes the brassinosteroid signaling component BEE2 (BR-ENHANCED EXPRESSION 2). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT1G73830 | Encodes the brassinosteroid signaling component BEE3 (BR-ENHANCED EXPRESSION 3). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT4G31910 | Encodes an acyltransferase that can modify brassinosteroids (BRs) by acylation and may modulate endogenous BR levels. |
| AT3G03460 | One of two paralogous GLTSCR domain containing proteins and a core component of SWI/SNF complexes. Interacts with BRM and may be responsible for ensuring proper complex assembly and association with chromatin. Function is dependent upon the GLTSCR domain. |
| AT1G10060 | encodes a mitochondrial branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. |
| AT1G10070 | Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. Involved in cell wall development. |
| AT4G39400 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction. BRI1 ligand is brassinolide which binds at the extracellular domain. Binding results in phosphorylation of the kinase domain which activates the BRI1 protein leading to BR responses. Residue T-1049 and either S-1044 or T-1045 were essential for kinase function in vitro and normal BRI1 signaling in planta. The structure of BRI1 ligand-binding domain has been determined at 2.5A resolution. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. BRI1 appears to be involved in the autonomous pathway that regulates the transition to flowering, primarily through its effects on FLC expression levels, as uncovered by double mutant analyses. This most likely occurs as a result of BRI1-dependent effects on histone acetylation, but not histone triMeH3K4 methylation, at the FLC locus. The mRNA is cell-to-cell mobile. |
| AT5G38970 | Encodes a polypeptide involved in the C-6 oxidation of brassinosteroids. Heterologous expression of the protein in yeast conferred the ability to catalyze multiple reactions in which the C-6 position of 6-deoxocastasterone, 6-deoxotyphasterol, 3-dehydro-6-deoxoteasterone and 6-deoxoteasterone are oxidized. |
| AT3G30180 | Encodes a cytochrome p450 enzyme that catalyzes the last reaction in the production of brassinolide. It is capable of converting 6-deoxocastasterone into castasterone, a C-6 oxidation, as well as the further conversion of castasterone into brassinolide by a Baeyer-Villinger oxidation reaction at C-6, resulting in the formation of an unusual seven-membered lactone ring. The enzyme possesses high affinity for both C28- and C27-Brassinosteroids. The expression of the gene using a CYP85A2 promoter:LUC fusion construct was shown to be under circadian and light control. |
| AT4G18710 | Encodes BIN2, a member of the ATSK (shaggy-like kinase) family. BIN2 functions in the cross-talk between auxin and brassinosteroid signaling pathways. BIN2 regulates root epidermal cell fate specification by phosphorylating EGL3 and TTG1. BIN2-mediated phosphorylation appears to promote BZR1 export from the nucleus. KIB1 interacts with BIN2 blocking its interaction with substrates and promotes BIN2 degradation. |
| AT3G61460 | Encodes a novel ring finger protein and forms an N-terminal hydrophobic domain and a C-terminal RING-H2 signature. Expression is down regulated by brassinolide. |
| AT4G35230 | Encodes BR-signaling kinase 1 (BSK1), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
| AT4G00710 | Encodes BR-signaling kinase 3 (BSK3), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
| AT1G63500 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
| AT5G41260 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
| AT3G15120 | Encodes BRP1, an ATPase domain-containing protein that interacts with BRAT1 to negatively regulate transcriptional silencing at methylated genomic regions. |
| AT4G00020 | Ortholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with either AtRad51 or AtDmc1 and ATDSS1(I). Involved in embryo sac development and defense gene transcription during plant immune responses. |
| AT1G04020 | Encodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein-protein interactions. Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression. |
| AT1G31880 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. BRX encodes a key regulator of cell proliferation and elongation in the root, which has been implicated in the brassinosteroid (BR) pathway as well as regulation of auxin-responsive gene expression. Also involved in cytokinin-mediated inhibition of lateral root initiation. A loss-of-function allele, named brx-2 in Rodrigues et al. (2009) Plant Physiol. but changed to brx-3 to resolve nomenclature conflict (Li et al. Planta 2009:229(3):593-603), shows enhanced response to ABA-mediated inhibition of root growth. Plasma-membrane-associated element of a molecular rheostat that modulates auxin flux through developing protophloem sieve elements (PPSEs) while interacting with PAX, thereby timing PPSE differentiation. Dampens PIN-mediated auxin efflux. |
| AT5G20540 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
| AT5G42750 | Encodes a plasma-membrane associated phosphoprotein that interacts directly with the kinase domain of BRI1 through the evolutionarily conserved C-terminal BIM motif binding to the C-lobe of the BRI1 kinase domain. It interferes with the interaction between BRI1 with its signalling partner, the plasma membrane localised LRR-receptor kinase BAK1 by inhibiting the transphosphorylation to keep BRI1 at a basal level of activity. It is phosphorylated by BRI1 at Ser270 & Ser274 and at tyrosine site Tyr211 and dissociates from plasma membrane to end up in the cytosol after phosphorylation. Its loss-of-function mutant shows higher sensitivity to BR treatment. |
| AT1G03445 | encodes a serine?threonine protein phosphatase with an N-terminal Kelch-repeat domain, which is nuclear localized and expressed preferentially in elongating cells. Genetic evidence suggest that this gene plays a redundant role (along with other members of the same gene family) in modulating growth in response to brassinosteroid. |
| AT1G08420 | Protein phosphatase which promotes stomatal ACD by establishing kinase-based signalling asymmetry in the two daughter cells. |
| AT2G45400 | involved in the regulation of brassinosteroid metabolic pathway |
| AT2G38740 | HAD-type phosphosugar phosphatase. |
| AT1G61215 | Bromodomain protein with a DNA binding motif |
| AT1G05910 | Encodes an acetylated histone-binding protein BRAT1. BRAT1 forms a complex with BRP1 to prevent transcriptional silencing. |
| AT5G55040 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
| AT5G59570 | Encodes BOA (BROTHER OF LUX ARRHYTHMO), a component of the circadian clock. The mRNA is cell-to-cell mobile. |
| AT1G03457 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G74770 | zinc ion binding protein;(source:Araport11) |
| AT3G48360 | Encodes a protein (BT2) that is an essential component of the TAC1-mediated telomerase activation pathway. Acts redundantly with BT3 and BT1 during female gametophyte development and with BT3 during male gametophyte development. BT2 also mediates multiple responses to nutrients, stresses, and hormones. |
| AT5G67480 | BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves. |
| AT1G50280 | BTB/POZ protein that forms a complex with CUL3a. Involved in repression of ABA responses. |
| AT3G19590 | Encodes a protein that may have a role in the spindle assembly checkpoint. |
| AT3G17590 | Encodes the Arabidopsis homologue of yeast SNF5 and represents a conserved subunit of plant SWI/SNF complexes. |
| AT1G01550 | Encodes a protein with no functionally characterized domains that to prevent the synthesis of a novel substance that moves from the root to the shoot, where it modifies shoot growth by interfering with auxin signaling. Synthesis and delivery of this substance requires neither phloem nor endodermis. |
| AT2G46080 | Encodes a protein related to BYPASS1 (BPS1). Regulates production of mobile compound: bps signal. |
| AT1G18740 | DUF793 domain containing protein. Expression is induced by cold. Loss of function mutations are more sensitive to freezing and have reduced levels of CBFs. May act by preventing degradation of CBFs. |
| AT1G19490 | Putative bZIP transcription factor. Expression is induced by drought and mutants are sensitive to drought. |
| AT4G39070 | Encodes BZS1, a brassinosteroids-regulated BZR1 target (BRBT) gene. BZS1 is a putative zinc finger transcription factor. Expression of BZS1 was increased under BR-deficient condition and repressed by BR. Transgenic Arabidopsis plants overexpressing BZS1 showed a hypersensitivity to the BR biosynthetic inhibitor brassinazole (BRZ). In contrast, transgenic plants expressing reduced level of BZS1 had longer hypocotyls than wild type when grown on BRZ. |
| AT5G51990 | encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF4). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to drought stress and abscisic acid treatment, but not to low temperature. |
| AT4G25490 | Transcriptional activator that binds to the DRE/CRT regulatory element and induces COR (cold-regulated) gene expression increasing plant freezing tolerance. It encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. |
| AT4G25470 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature, abscisic acid, and circadian rhythm. Overexpressing this gene leads to increased freeze tolerance and induces the expression level of 85 cold-induced genes and reduces the expression level of 8 cold-repressed genes, which constitute the CBF2 regulon. Mutations in CBF2 increases the expression level of CBF1 and CBF3, suggesting that this gene may be involved in a negative regulatory or feedback circuit of the CBF pathway. |
| AT4G21670 | encodes a a novel transcriptional repressor harboring two double-stranded RNA-binding domains and a region homologous to the catalytic domain of RNA polymerase II C-terminal domain phosphatases found in yeast and in animals that regulate gene transcription. Protein exhibits innate phosphatase activity in vitro. Mutants exhibit hyperresponsiveness to ABA, cold, and NaCl. |
| AT1G59835 | DNA-directed RNA polymerase II subunit RPB1-like protein;(source:Araport11) |
| AT3G17980 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT1G70790 | C2-domain ABA-related (CAR) protein, involved in the recruitment of ABA receptors to the plasma membrane to facilitate ABA signaling. Its stability and dynamic localization is regulated by LOT1. |
| AT5G46370 | Encodes AtTPK2 (KCO2), a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK2 is targeted to the vacuolar membrane. May form homomeric ion channels in vivo. |
| AT4G01840 | Encodes AtTPK5, a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK5 is targeted to the vacuolar membrane. May form homomeric ion channels in vivo. |
| AT4G18160 | Encodes AtTPK3 (KCO6), a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK3 is found in the thylakoid stromal lamellae. May form homomeric ion channels in vivo. It modulates the partitioning of the proton motive force (pmf) between the delta psi and delta pH in chloroplasts in vivo at physiological light intensities. Vacuolar K+-conducting TPC1 and TPK1/TPK3 channels act in concert to provide for Ca2+- and voltageinduced electrical excitability to the central organelle of plant cells. |
| AT5G49480 | AtCP1 encodes a novel Ca2+-binding protein, which shares sequence similarities with calmodulins. The expression of AtCP1 is induced by NaCl. The mRNA is cell-to-cell mobile. |
| AT4G27280 | EF-hand Ca2 + -binding protein, which is a Ca2+-dependent transducer of auxin-regulated gene expression and interacts with ICR1. |
| AT5G44070 | Phytochelatin synthase gene confers tolerance to cadmium ions. Catalyzes phytochelatin (PC) synthesis from glutathione (GSH) in the presence of Cd2+, Zn2+, Cu2+ and Fe3+, but not by Co2+ or Ni2+. The mRNA is cell-to-cell mobile. |
| AT4G34050 | Methyltransferase in the lignin biosynthetic pathway. |
| AT4G17615 | Member of AtCBL (Calcineurin B-like Calcium Sensor Proteins) family. Protein level is increased upon high salt, mannitol, and cold stresses. CBL1 interacts with CIPK23 and recruits the kinase to the plasma membrane where the substrate(s) of CIPK23 may reside. CBL1 localization is regulated by protein modification including myristolation and acylation. |
| AT1G64480 | calcineurin B-like protein 8, member of plant-specific family of calcium sensor proteins containing 3 EF-hand motifs |
| AT4G32820 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G16020 | vacuolar fusion protein (DUF1712);(source:Araport11) |
| AT5G04870 | A calcium-dependent protein kinase that can phosphorylate phenylalanine ammonia lyase (PAL), a key enzyme in pathogen defense.Phosphorylates, in vivo, the transcription factor ORE1, a master regulator of senescence. |
| AT2G17290 | Encodes calcium dependent protein kinase 6 (CPK6), a member of the Arabidopsis CDPK gene family. CDPKs contain an intrinsic Ca2+-activation domain with four EF hand Ca2+-binding sites. CDPKs protein kinases have been proposed to function in multiple plant signal transduction pathways downstream of [Ca2+]cyt elevations, thus transducing various physiological responses. CPK6 is expressed in both guard cells and mesophyll cells. Functions in guard cell ion channel regulation. ABA and Ca(2+) activation of slow-type anion channels and, interestingly, ABA activation of plasma membrane Ca(2+)-permeable channels were impaired in independent alleles of single and double cpk3cpk6 mutant guard cells. Furthermore, ABA- and Ca(2+)-induced stomatal closing were partially impaired in these cpk3cpk6 mutant alleles. The protein kinase CPK6 is shown in biochemical assays to be directly activated by elevations in calcium concentrations in the physiological range (Laanements et al., 2013 PlantPhys.; PMID: 23766366). These data correlate with the in vivo function of CPK6 in Ca2+ and ABA activation of S-type anion channels (Mori et al., 2006 PLoS Biol.; PMID: 17032064) and the ability of CPK6 to mediate ABA activation of SLAC1 (Brandt et al., 2012 PNAS; PMID: 22689970). The mRNA is cell-to-cell mobile. |
| AT5G17860 | Cation/Ca2+ exchanger family member. Double mutants with CCX4 show delayed greening and defects in ROS response. |
| AT4G22120 | Calcium-permeable stretch activated cation channel. |
| AT4G38810 | SnRK2-Interacting Calcium Sensor. Encodes two different isoforms that can both inhibit SnRK2. The longer form (AT4G38810.2) is calcium dependant, the other is not. |
| AT2G17990 | Calcium-dependent protein kinase 1 adaptor protein involved in vacuolar transport and lytic vacuole biogenesis. |
| AT2G41860 | member of Calcium Dependent Protein Kinase |
| AT1G61950 | member of Calcium Dependent Protein Kinase |
| AT2G35890 | member of Calcium Dependent Protein Kinase |
| AT4G04700 | member of Calcium Dependent Protein Kinase |
| AT5G66210 | Calcium Dependent Protein Kinase. Functions in the BIK1 innate immune response pathway. |
| AT3G57530 | Calcium-dependent Protein Kinase. ABA signaling component that regulates the ABA-responsive gene expression via ABF4. AtCPK32 has autophosphorylation activity and can phosphorylate ABF4 in vitro |
| AT1G05570 | Encodes a callose synthase 1 catalytic subunit . Member of Glycosyltransferase Family- 48. |
| AT2G41010 | Encodes a novel calmodulin binding protein whose gene expression is induced by dehydration and ionic (salt) and non-ionic (mannitol) osmotic stress. Lines over-expressing this gene are more sensitive and anti-sense lines are more tolerant to osmotic stress, suggesting this gene may be a negative regulator of response to osmotic stress. |
| AT5G37780 | encodes a calmodulin that is involved in thigmomorphogenesis. Gene expression is rapidly induced upon a variety of abiotic stimuli, including water spray, subirrigation, wind, touch, wounding, or darkness. |
| AT2G41110 | Encodes a touch-inducible calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. The mRNA is cell-to-cell mobile. |
| AT3G56800 | encodes a calmodulin |
| AT2G27030 | encodes a calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. The mRNA is cell-to-cell mobile. |
| AT3G51920 | encodes a divergent member of calmodulin, which is an EF-hand family of Ca2+-binding proteins. This gene is expressed in leaves, flowers and siliques. The gene functionally complements yeast calmodulin 1 (CAM1) but only when selected against the plasmid harboring wild-type yeast sequences. Also the protein does not form formed a complex with a basic amphiphilic helical peptide in the presence of Ca2+ in vitro. Authors suggest that this gene may represent a Ca2+-binding sensor protein that interacts with a more limited set of target proteins than do more conventional CaM isoforms. Mutations in this gene alter plant responses to abiotic stress and abscisic acid. |
| AT2G41090 | Encodes a cytoplasmic, calcium binding calmodulin variant. CML10 interacts with phosphomannomutase (PMM)in vivo and increases its activity thereby affecting ascorbic acid biosynthesis. Its expression is induced by oxidative and other stress. The mRNA is cell-to-cell mobile. |
| AT3G25600 | Calmodulin like protein. Paralog of CML15. |
| AT1G66400 | Encodes a calmodulin-like protein. Regulates nitric oxide levels and transition to flowering. |
| AT5G42380 | calmodulin like 37;(source:Araport11) |
| AT4G20780 | Calcium sensor involved in trichome branching. |
| AT4G00330 | high overall homology to CRCK1 |
| AT5G64220 | CAMTA2 proteins bind to the AtALMT1 promoter at in vitro. The gene itself is Al inducible, and AtALMT1 expression is partially repressed in camta2 mutant. The mRNA is cell-to-cell mobile. |
| AT4G16150 | CATMA5 is a transcriptional activator. It acts in the cold response pathway, it can bind to and activate the expression of DREB1 genes. |
| AT4G35310 | calmodulin-domain protein kinase CDPK isoform 5 (CPK5) |
| AT3G20410 | calmodulin-domain protein kinase CDPK isoform 9 (CPK9) |
| AT3G10660 | predicted to encode calcium-dependent protein kinase and is localized to the ER. Protein is myristoylated in a cell-free extract. Changing the proposed myristoylated site, G residue in the amino terminal, to A prevented the meristoylation . The G to A mutation decreased AtCPK2 membrane association by approximately 50%. |
| AT3G10190 | Encodes a protein with sequence similarity to calmodulins. Loss of function mutations have decreased response to chitin elicitors suggesting a role in plant response to fungal pathogens. |
| AT1G09210 | Encodes one of three Arabidopsis calreticulins.Post-transcriptionally regulates together with CRT1 VAMP721/722 levels under ER stress. |
| AT1G04260 | Encodes protein that interacts with CaMV movement protein. Colocalizes in the cytoplasm with the movement protein. Has similarity to mammalian proteins (such as the rat PRA1) which have been described as rab acceptors. |
| AT1G57680 | plasminogen activator inhibitor;(source:Araport11) |
| AT3G59090 | tobamovirus multiplication protein;(source:Araport11) |
| AT5G18520 | Encodes a candidate G-protein Coupled Receptor that is involved in the regulation of root growth by bacterial N-acyl-homoserine lactones (AHLs) and plays a role in mediating interactions between plants and microbes. The mRNA is cell-to-cell mobile. |
| AT2G46410 | Nuclear-localized R3-type MYB transcription factor. Positive regulator of hair-cell differentiation. Preferentially transcribed in hairless cells. Moves from atrichoblasts into trichoblast via plasmodesmata in a tissue-specific mode. N-terminus and part of the Myb domain are required for this movement, with W76 playing a crucial role. Capability to increase the size-exclusion limit of plasmodesmata. Regulated by WEREWOLF. |
| AT4G01060 | Encodes a Myb-related protein similar to CPC. Involved in epidermal cell differentiation. Mutants have reduced numbers of root hairs and increased trichome branching. Involved in endoreduplication. Loss of function mutants are hypertrophic and early flowering. |
| AT5G27420 | Encodes CNI1 (Carbon/Nitrogen Insensitive1) (also named as ATL31), a RING type ubiquitin ligase that functions in the Carbon/Nitrogen response for growth phase transition in Arabidopsis seedlings. The mRNA is cell-to-cell mobile. |
| AT3G48700 | carboxyesterase 13;(source:Araport11) |
| AT1G49660 | Encodes a protein with carboxylesterase whose activity was tested using pNA. |
| AT1G80000 | CASC3/Barentsz eIF4AIII binding protein;(source:Araport11) |
| AT5G67380 | Casein kinase II (CK2) catalytic subunit (alpha 1). One known substrate of CK2 is Phytochrome Interacting Factor 1 (PIF1). CK2-mediated phosphorylation enhances the light-induced degradation of PIF1 to promote photomorphogenesis. |
| AT5G57015 | Member of CKL gene family (member of CKL-B group). |
| AT4G28880 | Member of CKL gene family (CKL-A group) |
| AT5G44100 | Member of CKL gene family. Expression up-regulated under high temperature in anthers. Transcription activated by MYB24. |
| AT1G04440 | Member of CKL gene family (CKL-C group). |
| AT1G03700 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G15610 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT5G62820 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT2G38480 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G23200 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G50810 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G11550 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT2G27370 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT1G20630 | Catalyzes the reduction of hydrogen peroxide using heme group as cofactor. Protects cells from toxicity by H2O2. |
| AT1G20620 | Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen. The mRNA is cell-to-cell mobile. |
| AT1G54115 | Involved in cation (Na and K) homeostasis. |
| AT3G14070 | Involved in cation (K, Na and Mn) homeostasis and transport |
| AT5G17850 | CCX2 is a putative cation/Ca2+ exchange protein. It is located in the endoplasmic reticulum. It plays a role in salt induced calcium signaling. Loss of function results in decreased cytosolic and increased ER Ca2+ concentrations. |
| AT3G17630 | member of Putative Na+/H+ antiporter family |
| AT5G04770 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. Expressed in sink tissues. Induced during infestation of roots by the plant parasitic root-knot nematode, Meloidogyne incognita. Localized in the plasma membrane. |
| AT3G10600 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. |
| AT1G17120 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. |
| AT1G48260 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.21), which has also been reported as a member of the CBL-interacting protein kinases (CIPK17). |
| AT4G18700 | Encodes CBL-interacting protein kinase 12 (CIPK12). |
| AT2G34180 | Encodes CBL-interacting protein kinase 13 (CIPK13). |
| AT5G01810 | Encodes a CBL-interacting serine/threonine protein kinase, also has similarities to SOS2 kinase. |
| AT2G25090 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.18), which has also been reported as a member of the CBL-interacting protein kinases (CIPK16) and is involved in salinity tolerance. |
| AT1G29230 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.20), which has also been reported as a member of the CBL-interacting protein kinases (CIPK18). |
| AT5G57630 | CBL-interacting protein kinase.When mutated plants are hypersensitive to salt and osmotic stress. |
| AT2G38490 | member of AtCIPKs |
| AT5G25110 | salt- and anoxia-induced member of AtCIPK family. |
| AT5G10930 | Encodes CBL-interacting protein kinase 5 (CIPK5). |
| AT1G01140 | Encodes a CBL-interacting protein kinase with similarity to SOS2 |
| AT5G10860 | Encodes a single cystathionine beta-Synthase domain-containing protein. Modulates development by regulating the thioredoxin system. |
| AT4G27460 | Cystathionine beta-synthase (CBS) family protein;(source:Araport11) |
| AT2G33590 | Encodes a protein with homology to members of the dihydroflavonol-4-reductase (DFR) superfamily. The expression pattern of AtCRL1 indicates that CRL1 has a role in embryogenesis and seed germination. AtCRL1 is induced by ABA, drought and heat, and is highly expressed in seeds. The mRNA is cell-to-cell mobile. |
| AT3G44260 | Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses. |
| AT5G10960 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT5G02800 | Encodes CDL1, a homolog of CDG1. CDL1 positively regulates brassinosteroid signaling and plant growth. |
| AT1G62430 | Encodes a CDP-diacylglycerol synthase, involved in phospholipid biosynthesis. |
| AT3G50530 | CDPK-related kinase |
| AT2G46700 | CDPK-related kinase 3;(source:Araport11) |
| AT3G48750 | A-type cyclin-dependent kinase. Together with its specific inhibitor, the Kip-related protein, KRP2 they regulate the mitosis-to-endocycle transition during leaf development. Dominant negative mutations abolish cell division. Loss of function phenotype has reduced fertility with failure to transmit via pollen. Pollen development is arrested at the second mitotic division. Expression is regulated by environmental and chemical signals. Part of the promoter is responsible for expression in trichomes. Functions as a positive regulator of cell proliferation during development of the male gametophyte, embryo and endosperm. Phosphorylation of threonine 161 is required for activation of its associated kinase. |
| AT3G01610 | AAA-type ATPase - Over 90% homologous to CDC48a |
| AT5G64620 | Plant cell wall (CWI) and vacuolar invertases (VI) play important roles in carbohydrate metabolism, stress responses and sugar signaling. |
| AT1G17630 | Encodes a PPR protein involved in mitochondrial functioning. Mutants suppress cell wall defects caused by C17 chemical inhibitor. Mutants are defective in cytochrome c maturation and activation of mitochondrial retrograde signalling. |
| AT3G22120 | Cell wall-plasma membrane linker protein homolog (CWLP) |
| AT1G22880 | cellulase 5;(source:Araport11) |
| AT4G32410 | Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. |
| AT5G09870 | Encodes a cellulose synthase CESA5 that produces seed mucilage cellulose.Mutants are defective in seed coat mucilage.Involved in the regulation of mucilage composition and/or mucilage synthesis. |
| AT4G39350 | Encodes a cellulose synthase isomer, related to CESA6. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. The mRNA is cell-to-cell mobile. |
| AT2G35650 | a member of Glycosyltransferase- Family 2 and encodes a beta-mannan synthase based on in vitro enzyme assays from heterologously expressed protein. Mutants exhibit defects in pollen tube growth and embryo development. The defective embryonic development was associated with reduced proliferation and failed cellularization of the endosperm. |
| AT5G16190 | encodes a gene similar to cellulose synthase |
| AT3G56000 | encodes a gene similar to cellulose synthase |
| AT1G55850 | encodes a protein similar to cellulose synthase The mRNA is cell-to-cell mobile. |
| AT4G24010 | encodes a protein similar to cellulose synthase |
| AT4G16590 | encodes a gene similar to cellulose synthase |
| AT5G22740 | Encodes a beta-mannan synthase based on in vitro enzyme assays from heterologously expressed protein. CSLA2 synthesizes the backbone of galactoglucomannan in seed coat epidermal cells. Both CSLA2 and MUCI10, which may be part of a protein complex, are critical for mucilage architecture. |
| AT2G32530 | encodes a gene similar to cellulose synthase |
| AT2G32540 | encodes a gene similar to cellulose synthase The mRNA is cell-to-cell mobile. |
| AT3G03050 | encodes a cellulose synthase like protein. mutations initiate root hairs that rupture at their tip soon after initiation. is required for the synthesis of a noncellulosic wall polysaccharide. |
| AT1G02730 | Encodes a gene similar to cellulose synthase. Knock-out mutant has reduced growth, reduced xylan level and reduced xylan synthase activity in stems.It's expression is cell cycle dependent and it appears to function in cell plate formation. |
| AT3G28180 | encodes a gene similar to cellulose synthase The mRNA is cell-to-cell mobile. |
| AT4G31590 | encodes a XyG glucan synthase; gene similar to cellulose synthase |
| AT3G07330 | encodes a XyG glucan synthase; gene similar to cellulose synthase |
| AT4G37010 | Encodes a member of the Centrin family. Mutants are hypersensitive to UV and prone to UV induced DNA damage. Based on sequence similarity and mutant phenotype CEN2 is thought to be involved in nucelotide excision repair/DNA repair. |
| AT1G15660 | Encodes a homologue of the human centromeric protein C (CENP-C). CENP-C co-localizes with the 180 bp centromeric regions of chromosomes throughout the cell cycle, but does not completely cover the 180 bp regions. |
| AT1G34750 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT2G30370 | Encodes a small, potentially secreted protein that acts as an inhibitor of stomatal production though likely not through direct interaction with the TMM receptor. It is homologous to known stomatal regulators EPF1 and EPF2. Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT4G14723 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT5G20720 | Encodes a chloroplast co-chaperonin with similarity to CPN21 from spinach, E.coli GroES. |
| AT5G20890 | TCP-1/cpn60 chaperonin family protein;(source:Araport11) |
| AT3G18190 | TCP-1/cpn60 chaperonin family protein;(source:Araport11) |
| AT3G02530 | TCP-1/cpn60 chaperonin family protein;(source:Araport11) |
| AT3G62080 | Encodes a charged multi-vesicular body protein (CHMP7) homolog, that is an ESCRT-III-related protein and functions in the endosomal sorting pathway in humans. The Brassica homolog has been shown to be involved in plant growth and leaf senescence. |
| AT3G14870 | hypothetical protein (DUF641);(source:Araport11) |
| AT3G60680 | DUF641 family protein (DUF641);(source:Araport11) |
| AT3G21630 | LysM receptor-like kinase, based on protein sequence alignment analysis, it has a typical RD signaling domain in its catalytic loop and possesses autophosphorylation activity. Involved in the perception and transduction of the chitin oligosaccharide elicitor. Located in the plasma membrane. CERK1 phosphorylates LIK1, a LLR-RLK that is involved in innate immunity, |
| AT3G16920 | Encodes a chitinase-like protein expressed predominantly in stems. Mutants accumulate ligning in etiolated hypocotyls. |
| AT5G40890 | Encodes a member of the voltage-dependent chloride channel. Also functions as a NO3-/H+ exchanger that serves to accumulate nitrate nutrient in vacuoles. Mutants homozygous for the T-DNA insertion mutation have reduced nitrate uptake capacity in high nitrate environment and exhibit hypersensitivity to chlorate. Role in cytosolic pH homeostasis. |
| AT3G27170 | member of Anion channel protein family The mRNA is cell-to-cell mobile. |
| AT1G44446 | Encodes chlorophyllide a oxygenase which converts chlorophyllide a to chlorophyllide b by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide a . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll b and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22. |
| AT1G29920 | Encodes lhcb1.1 a component of the LHCIIb light harvesting complex associated with photosystem II. |
| AT1G19670 | Chlorophyllase is the first enzyme involved in chlorophyll degradation. It catalyzes the hydrolysis of the ester bond to yield chlorophyllide and phytol. AtCLH1 lacks a typical signal sequence for the chloroplast. Its expression is induced rapidly by methyljasmonate, a known promoter of senescence and chlorophyll degradation. |
| AT3G04000 | ChlADR is an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. The N-terminal region of this protein directs GFP to the chloroplast where where ChlADR likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation. In addition, this enzyme can also reduce cis-3-hexenal, a major plant volatile compound that contributes to green leaf odor, as well as methylglyoxal in vitro. |
| AT4G13010 | Oxidoreductase, zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT2G47390 | Prolyl oligopeptidase family protein;(source:Araport11) |
| AT2G20270 | Thioredoxin superfamily protein;(source:Araport11) |
| AT5G57180 | Transcription regulator responsible for specific upregulation of the translocon genes atToc33 and atToc75 in leaves. Involved in protein import into chloroplast. |
| AT1G23400 | Promotes the splicing of chloroplast group II introns. |
| AT3G63140 | Encodes a protein with ribonuclease activity that is involved in plastid rRNA maturation. |
| AT4G26500 | Sulfur acceptor that interacts with and activates the cysteine desulfurases, AtSufS in plastids and AtNifS1 in mitochondria, and both activations are vital during embryogenesis. Dual localization in mitochondria and chloroplasts. Involved in Fe-S cluster biogenesis in mitochondria and plastids. Expressed in all major tissues, with higher expression in green parts. Its expression is light-dependent and regulated at the mRNA level. Activates the cysteine desulfurase activity of CpNifS for chloroplastic iron-sulfur cluster biogenesis. |
| AT3G25690 | actin binding protein required for normal chloroplast positioning The mRNA is cell-to-cell mobile. |
| AT2G25625 | Histone deacetylase-like protein;(source:Araport11). Induced by senescence and abiotic stresses. |
| AT5G16390 | Encodes for the biotin carboxyl-carrier subunit of the multi-enzyme plastidial acetyl-coenzyme A carboxylase complex. |
| AT1G76080 | Encodes a thioredoxin like protein. Localizes to the chloroplast and is redistributed to the chloroplast envelope under heat stress. It is involved in non host resistance and thermotolerance. |
| AT1G08490 | Chloroplastic NifS-like protein that can catalyze the conversion of cysteine into alanine and elemental sulfur (S(0)) and of selenocysteine into alanine and elemental Se (Se(0)). Overexpression enhances selenium tolerance and accumulation. |
| AT2G45350 | Encodes a member of a PCMP (plant combinatorial and modular protein) family (PCMP-E subfamily) with 11 pentatricopeptide (PPR) repeats. The protein is involved in RNA editing of the initiation codon of ndhD in the chloroplast. |
| AT5G20935 | Chloroplast NADH dehydrogenase assembly protein. Mutants are defective in the accumulation of subcomplex A. |
| AT4G21445 | CRR9 gene encodes a novel stromal protein without any known functional domains or motifs. It is highly conserved in cyanobacteria and land plants but not in green algae. |
| AT1G71697 | Encodes choline kinase. mRNA levels are increased in response to wounding. The mRNA is cell-to-cell mobile. |
| AT3G15380 | Encodes a member of a choline transporter-like protein family that facilitates choline transport, localizes to the trans-Golgi network, and during cytokinesis is associated with the phragmoplast. Loss-of-function results in an altered choline metabolite profile, defects in sieve plate and sieve pore formation and impaired phloem transport. |
| AT5G10870 | Encodes chorismate mutase AtCM2. |
| AT5G44800 | Interacts with transcription factors involved in floral meristem identity and affects the expression of key floral regulators. Affects H3K27me3 and H3K4me3 levels at a subset of loci in the genome. |
| AT5G18620 | Encodes a member of the A. thaliana imitation switch (AtISWI) subfamily of chromatin remodeling factors. Double mutation in CHR17 and CHR11 results in the loss of the evenly spaced nucleosome pattern in gene bodies, but does not affect nucleosome density. |
| AT3G23690 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT2G30490 | Encodes a cinnamate-4-hydroxylase. Mutations in this gene impact phenylpropanoid metabolism, growth and development. |
| AT1G80820 | Encodes an cinnamoyl CoA reductase isoform. Involved in lignin biosynthesis. |
| AT1G15950 | Encodes a cinnamoyl CoA reductase. Involved in lignin biosynthesis. The mRNA is cell-to-cell mobile. |
| AT4G34230 | Encodes a catalytically active cinnamyl alcohol dehydrogenase which uses p-coumaryl aldehyde as a preferred substrate. It can also use sinapyl, caffeyl, coniferyl and d-hydroxyconiferyl aldehydes as substrates. |
| AT4G39330 | cinnamyl alcohol dehydrogenase 9;(source:Araport11) |
| AT2G46830 | Encodes a transcriptional repressor that performs overlapping functions with LHY in a regulatory feedback loop that is closely associated with the circadian oscillator of Arabidopsis. Binds to the evening element in the promoter of TOC1 and represses TOC1 transcription. CCA1 and LHY colocalize in the nucleus and form heterodimers in vivo. CCA1 and LHY function synergistically in regulating circadian rhythms of Arabidopsis. CCA1 binds the GI promoter. |
| AT5G58770 | AtCPT7 synthesizes medium-chain polyprenols of approximately 55 carbons in length. The enzyme utlizes geranylgeranyl pyrophosphate (GGPP) and isopentenyl pyrophosphate (IPP) as substrates. The enzymatic product accumulates into plastdial membranes (DOI:10.1105/tpc.16.00796). |
| AT2G42790 | Encodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development. |
| AT1G68110 | An ENTH (Epsin NH2 terminal homology)/ANTH/VHS superfamily protein with adenylate cyclase activity and a role in clathrin assembly and endocytosis. |
| AT2G20760 | Clathrin light chain protein;(source:Araport11) |
| AT2G40060 | Encodes a clathrin that is localized to the cortical division zone and the cell plate and colocalizes with TPLATE during cell plate anchoring. The mRNA is cell-to-cell mobile. |
| AT3G51890 | Clathrin light chain protein;(source:Araport11) |
| AT1G75820 | Putative receptor kinase with an extracellular leucine-rich domain. Controls shoot and floral meristem size, and contributes to establish and maintain floral meristem identity. Negatively regulated by KAPP (kinase-associated protein phosphatase). CLV3 peptide binds directly CLV1 ectodomain. |
| AT5G65480 | CCL1 is induced by WUS and binds to the kinase domains of BAM1 and CLV1. Localizes to lipid rich plasma membrane rafts. Likely to be involved in WUS/CLV signaling pathway. |
| AT4G38060 | hypothetical protein;(source:Araport11) |
| AT1G73965 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. |
| AT1G70895 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT3G25905 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT1G06225 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT1G26600 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. |
| AT2G20190 | Encodes a microtubule-associated protein that is involved in both cell division and cell expansion. It likely promotes microtubule stability. |
| AT3G44340 | homologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions. |
| AT4G15560 | Encodes a protein with 1-deoxyxylulose 5-phosphate synthase activity involved in the MEP pathway. It is essential for chloroplast development in Arabidopsis |
| AT3G04680 | Encodes a nuclear protein that functions in mRNA processing. Mutations in this gene cause embryo lethality and reduced transmission through the female gametophyte. Over-expression of a CLPS3:TAP protein changes the relative levels of two alternatively processed FCA transcripts. It also causes abnormal phyllotaxy and flower development, early flowering under long and short days, and increased levels of CUC1 and WUS expression. |
| AT1G53000 | Encodes a mitochondrial-localized CMP-KDO (3-deoxy-D-manno-octulosonate) synthetase. This is the enzyme activating KDO as a nucleotide sugar prior to its incorporation into rhamnogalacturonan-II. Heterozygous mutants are defective in pollen development and in pollen tube elongation. |
| AT5G60920 | Encodes a glycosylphosphatidylinositol-anchored protein localized primarily in the plasma membrane of the longitudinal sides of root cells. Necessary for oriented cell expansion in Arabidopsis. Cob mutants have abnormal roots that expand radially rather than longitudinally under certain growth conditions. |
| AT1G59840 | cofactor assembly of complex C;(source:Araport11) |
| AT1G01290 | COFACTOR OF NITRATE REDUCTASE AND XANTHINE DEHYDROGENASE 3. Encodes a protein involved in molybdenum cofactor biosynthesis. Homologous to E.coli MoaC. Expression is low in all tissues examined, except in roots. Appears to have targeting signals for chloroplast or mitochondria |
| AT1G13030 | Encodes a plant coilin, a protein that in other organisms is a major structural scaffolding protein necessary for Cajal body formation, composition and activity. It has been shown to bind both U1 and U1 snRNAs in vitro. |
| AT1G29395 | Integral membrane protein in the inner envelope of chloroplasts. Provide freezing tolerance. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. involved in response to salt tolerance |
| AT1G29390 | Integral membrane protein in the inner envelope of chloroplasts. Provide freezing tolerance. |
| AT4G36020 | Encodes a cold shock domain protein. Involved in cold acclimation by blocking the secondary structure of mRNA which in turn facilitates translation at cold temperature. |
| AT2G21660 | Encodes a small glycine-rich RNA binding protein that is part of a negative-feedback loop through which AtGRP7 regulates the circadian oscillations of its own transcript. Gene expression is induced by cold. GRP7 appears to promote stomatal opening and reduce tolerance under salt and dehydration stress conditions, but, promotes stomatal closing and thereby increases stress tolerance under conditions of cold tolerance. Loss of function mutations have increased susceptibility to pathogens suggesting a role in mediating innate immune response. Mutants are also late flowering in a non-photoperiodic manner and are responsive to vernalization suggesting an interaction with the autonomous flowering pathway. There is a reduction of mRNA export from the nucleus in grp7 mutants. GRP7:GFP fusion proteins can be found in the cytosol and nucleus. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). |
| AT3G50830 | cold acclimation protein WCOR413-like protein beta form. Transcript is not detectable. |
| AT1G20440 | Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. Cold regulated gene, amino acid sequence homology with Group II LEA (late embryogenesis abundant) proteins. Also responds to osmotic stress, ABA, dehydration and inhibits e.coli growth while overexpressed. COR47 and RAB18 double overexpressor plants are cold tolerant. Regulated by heat shock. |
| AT1G45688 | CC1 is a plant specific gene that interacts with with the cellulose synthase complex and microtubules. It appears to play a role in localizing CESA to the membrane, microtuble dynamics , particularly during salt stress. |
| AT5G42860 | CC2 is a plant specific gene that interacts with with the cellulose synthase complex and microtubules. It appears to play a role in localizing CESA to the membrane, microtuble dynamics , particularly during salt stress. |
| AT2G25240 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11). Involved in stress response regulated cell death. |
| AT5G67370 | DUF1230 family protein (DUF1230);(source:Araport11) |
| AT1G67930 | Golgi transport complex protein-like protein;(source:Araport11) |
| AT5G03190 | peptide upstream protein;(source:Araport11) |
| AT5G15850 | Homologous to the flowering-time gene CONSTANS. |
| AT5G57660 | CONSTANS-like 5;(source:Araport11) |
| AT3G07650 | This gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO. The mRNA is cell-to-cell mobile. |
| AT4G12560 | Encodes CPR1 (Constitutive Expresser of PR Genes 1, also known as CPR30), a F-Box protein that functions as a negative regulator of defense response and targets resistance proteins. |
| AT5G05170 | Encodes a cellulose synthase isomer. CESA3 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA3, along with CESA1 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. The xylem cells in primary root have reduced cell expansion and higher than normal lignification. |
| AT5G03730 | Homologous to the RAF family of serine/threonine protein kinases. Negative regulator in the ethylene signal transduction pathway. Interacts with the putative ethylene receptors ETR1 and ERS. Constitutively expressed. |
| AT3G01490 | Belongs to the Raf-like kinase subfamily of the mitogen-activated protein kinase kinase kinase (MAPKKK) family. Negatively regulates stomatal opening by negatively regulating plasma membrane H+-ATPase phosphorylation. |
| AT5G63440 | Encodes a single copy protein in Arabidopsis containing a DUF167 domain that is conserved in eukaryotes. Genetically CSU suppresses mutations in COP1. In vitro, it interacts with CACTIN and in vivo with CCA1. CSU4 promotes photomorphogenesis via negative regulation of CCA1 and PIF4 expression. |
| AT5G41790 | encodes a protein that physically interacts specifically with the putative coiled-coil region of COP1 in vitro. In hypocotyl and cotyledon protoplasts, it is associated to the cytoskeleton, but not in the root. expression is not regulated by light. The mRNA is cell-to-cell mobile. |
| AT1G71230 | Encodes a subunit of the COP9 complex, similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Involved in protein deneddylation. Double mutants with CSN5A are constitutively photomorphogenic (de-etiolated) and have abnormal auxin responses. |
| AT4G12290 | Copper amine oxidase. Induced by ABA and involved in stomatal closure. |
| AT1G31710 | Copper amine oxidase family protein;(source:Araport11) |
| AT3G43670 | Copper amine oxidase family protein;(source:Araport11) |
| AT2G42490 | Peroxisome-localized copper amine oxidase involved in lateral root formation. |
| AT1G62810 | Encodes COPPER AMINE OXIDASE1 (CuAO1). Contributes to abscisic acid- and polyamine-induced nitric oxide biosynthesis and abscisic acid signal transduction. |
| AT3G56240 | CCH protein belongs to a family of eukaryotic proteins that participate in intracellular copper homeostasis by delivering this metal to the secretory pathway; mainly located along the vascular bundles of senescing leaves and petioles as well as in stem sieve elements; hypothesized to have a role in copper mobilization from decaying organs towards reproductive structures, as a result of metalloprotein breakdown. The plant-specific C-terminal domain of the CCH protein forms amyloid-like fibrils in vitro. |
| AT1G12520 | Copper-zinc superoxide dismutase copper chaperone (delivers copper to the Cu-Zn superoxide dismutase). Localized to the chloroplast. Expressed in roots and shoots. Up-regulated in response to copper and senescence. The AtACC activates all three CuZnSOD activities located in three different subcellular compartments. Contains three domains, central, ATX-1 like and C-terminal. ATX-1 like domain essential for the copper chaperone function of AtCCS in planta. |
| AT3G56940 | Encodes a putative ZIP protein with varying mRNA accumulation in leaves, stems and roots. Has a consensus carboxylate-bridged di-iron binding site. The mRNA is cell-to-cell mobile. |
| AT5G13290 | Encodes a protein with predicted Ser/Thr kinase activity and membrane localization that is involved in the CLV3 signaling pathway that represses WUS expression in the meristem. Loss of function of CRN can suppress the phenotype caused by overexpression of CLV3. SOL2 isolated as a suppressor of root- specific overexpression of CLE19, a clavata3 like gene. sol2 partially suppresses the short root phenotype caused by CLE19 overexpression. Mutant flowers have extra carpels. |
| AT1G05470 | Encodes an inositol polyphosphate 5' phosphatase (5PTase) that is required for the proper recruitment of cells into developing vascular tissue in leaves and cotyledons. It is most similar to Type I 5PTases that are known to cleave a phosphate from IP3 or IP4. cvp2 mutants have elevated levels of IP3 and are hypersensitive to ABA in seed germination assays. |
| AT1G28680 | Catalyses trans-cis isomerization and lactonization in the biosynthesis of coumarins in roots. |
| AT2G47400 | CP12-1 encodes a small peptide found in the chloroplast stroma. It belongs to the CP12 gene family thought to be involved in the formation of a supramolecular complex with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) embedded in the Calvin cycle. The mRNA is cell-to-cell mobile. |
| AT1G76560 | CP12 domain-containing protein 3;(source:Araport11) |
| AT3G09780 | CRINKLY4 related 1;(source:Araport11) |
| AT3G55950 | CRINKLY4 related 3;(source:Araport11) |
| AT3G01370 | Encodes a protein containing a CRM domain that is involved in group I and group II intron splicing. |
| AT4G39040 | RNA-binding CRS1 / YhbY (CRM) domain protein;(source:Araport11) |
| AT5G19380 | Encodes one of the CRT-Like transporters (CLT1/AT5G19380, CLT2/AT4G24460, CLT3/AT5G12170). Required for glutathione homeostasis and stress responses. Mutants lacking these transporters are heavy metal-sensitive, glutathione(GSH)-deficient, and hypersensitive to Phytophthora infection. |
| AT5G12170 | Encodes one of the CRT-Like transporters (CLT1/AT5G19380, CLT2/AT4G24460, CLT3/AT5G12170). Required for glutathione homeostasis and stress responses. Mutants lacking these transporters are heavy metal-sensitive, glutathione(GSH)-deficient, and hypersensitive to Phytophthora infection. The mRNA is cell-to-cell mobile. |
| AT5G48560 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G10120 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G32790 | RNA-binding protein, putative, similar to RNA-binding protein GB:CAB40027 GI:4539439 from (Arabidopsis thaliana).Member of a family of PAB2 binding domain proteins. |
| AT5G24440 | RNA-binding protein, putative. Contains PAM2, PABC binding domain. |
| AT3G14010 | hydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2. |
| AT4G20320 | Cytidine triphosphate synthase. |
| AT3G18210 | Belongs to the 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily proteins and contains an oxoglutarate/iron-dependent oxygenase domain (InterPro:IPR005123) of the prolyl 4-hydroxylase, alpha subunit subtype (P4Hc; InterPro:IPR006620), participates in epigenetic repression of flowering genes, works redundantly with ICU11 to repress several members of the MADS-box transcription factors family, during vegetative development via histone modification. |
| AT5G43660 | Belongs to the 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily proteins and contains an oxoglutarate/iron-dependent oxygenase domain (InterPro:IPR005123) of the prolyl 4-hydroxylase, alpha subunit subtype (P4Hc; InterPro:IPR006620). |
| AT1G48700 | Belongs to the 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily proteins and contains an oxoglutarate/iron-dependent oxygenase domain (InterPro:IPR005123) of the prolyl 4-hydroxylase, alpha subunit subtype (P4Hc; InterPro:IPR006620). |
| AT4G01150 | Integral thylakoid membrane protein required for proper grana stack curvature. |
| AT2G39360 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G23490 | Encodes a cyanase that catalyzes the bicarbonate-dependent breakdown of cyanate to ammonia and bicarbonate. CYN forms a hexadecamer and is believed to be a cytosolic protein. Long-term exposure to NaCl increases CYN transcript levels. It is also expressed at higher levels in flowers relative to stems, roots, and seedlings. |
| AT3G17690 | member of Cyclic nucleotide gated channel family |
| AT5G54250 | member of Cyclic nucleotide gated channel family, downstream component of the signaling pathways leading to HR resistance. mutant plants exhibit gene-for-gene disease resistance against avirulent Pseudomonas syringae despite the near-complete absence of the hypersensitive response (HR). Salicylic acid accumulation in dnd2 mutants is completely PAD4-independent. |
| AT2G46440 | Member of Cyclic nucleotide gated channel family. Positive regulator of resistance against avirulent fungal pathogen. The mRNA is cell-to-cell mobile. |
| AT2G46450 | Member of Cyclic nucleotide gated channel family.Positive regulator of resistance against avirulent fungal pathogen.Suppresses the phenotype conferred by cpr22 in a dosage-dependent manner. |
| AT1G17330 | cGMP-activated phosphodiesterase responsible for UVA induced decrease in cGMP. |
| AT1G44110 | Cyclin A1;(source:Araport11) |
| AT1G80370 | Encodes a A2-type cyclin. Contributes to the fine-tuning of local proliferation during plant development. |
| AT1G70210 | Encodes a D-type cyclin that physically interacts with CDC2A. Its expression is upregulated early during germination. |
| AT5G67260 | Encode CYCD3;2, a CYCD3 D-type cyclin. Important for determining cell number in developing lateral organs and mediating cytokinin effects in apical growth and development. With PPD and NINJA, it plays a crucial role in leaf morphogenesis. |
| AT3G50070 | Encode CYCD3;3, a CYCD3 D-type cyclin. Important for determining cell number in developing lateral organs. Mediating cytokinin effects in apical growth and development. |
| AT5G65420 | Encodes a D-type cyclin CYCD4;1 that physically interacts with CDC2A and is expressed during vascular tissue development, embryogenesis, and formation of lateral root primordia. Its expression is upregulated early during germination.Involved in stomatal cell lineage proliferation in the hypocotyl. |
| AT4G37630 | core cell cycle genes; a quantitative trait gene for endoreduplication. |
| AT2G01905 | cyclin J18 (cycJ18) |
| AT3G21870 | cyclin p2;(source:Araport11) |
| AT3G60550 | cyclin p3;(source:Araport11) |
| AT2G44740 | cyclin p4;(source:Araport11) |
| AT1G20930 | Cyclin-dependent kinase, expressed in flowers and suspension cell culture, expression peaks during M phase in synchronized cultures. Required for proper organization of the shoot apical meristem and for hormone signaling. Expressed in the shoot apical meristem. Involved in regulation of the G2/M transition of the mitotic cell cycle. |
| AT5G63610 | significant sequence similarity to plant and animal cyclin-dependent protein kinases, and was classified as an E-type CDK with a SPTAIRE cyclin binding motif in the kinase domain. |
| AT5G62430 | Dof-type zinc finger domain-containing protein, similar to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Represses expression of Constans (CO), a circadian regulator of flowering time. Interacts with LKP2 and FKF1. Expression oscillates under constant light conditions. Mainly expressed in the vasculature of cotyledons, leaves and hypocotyls, but also in stomata. Localized to the nucleus and acts as a repressor of CONSTANS through binding to the Dof binding sites in the CO promoter. Protein gets degraded by FKF1 in the afternoon. CDF1 binds to the TOPLESS co-repressor protein through an N-terminal motif which is conserved across CDF-like proteins throughout land-plants. This interaction is important for the repression of CO and FT genes during the morning. Loss of CDF1 dependent repression through omission of TPL coordinating residues or through the loss of TPL function in phloem companion cells results in early flowering due to an up regulation of FT. |
| AT5G39660 | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions. |
| AT3G47500 | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions. |
| AT1G26790 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
| AT2G07050 | Involved in the biosynthesis of brassinosteroids. Catalyzes the reaction from epoxysqualene to cycloartenol. |
| AT3G01480 | Encodes a chloroplast cyclophilin functioning in the assembly and maintenance of photosystem II (PSII) supercomplexes. The mRNA is cell-to-cell mobile. |
| AT1G53720 | Encodes a cyclophilin, member of a family modular proteins consisting of a peptidyl-prolyl cis? trans isomerase (PPIase) domain, followed by an RNA recognition motif (RRM), and a C-terminal domain enriched in charged amino acids. Interacts with with SCL33/SR33 and with a majority of Arabidopsis SR proteins and the largest subunit of RNA polymerase II. Localizes to the nucleus, but it does not significantly colocalize with SR proteins in nuclear speckles. |
| AT4G34960 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT5G64660 | CYS, MET, PRO, and GLY protein 2;(source:Araport11) |
| AT3G48350 | Involved in starvation-related responses that curtail primary root growth under severe nutrient limitation. |
| AT4G11320 | Papain family cysteine protease;(source:Araport11) |
| AT5G47550 | Putative phytocystatin expressed in seedlings and induced by heat stress and abscisic acid. Overexpression increases germination rate and heat stress tolerance. CYS5 is a target of ABF1 and ABF3 transcriptional regulators which bind to its promoter. |
| AT3G03630 | Encodes a protein that possesses S-sulfocysteine synthase activity and lacks O-acetylserien(thiol)lyase activity. |
| AT3G61440 | Encodes a cysteine synthase isomer CysC1. The isomer is however less effective in cysteine biosynthesis. It is involved in beta-cyanoalanine biosynthesis, an intermediate of cyanide detoxification pathway. The mRNA is cell-to-cell mobile. |
| AT3G04940 | Encodes cysteine synthase CysD1. |
| AT4G23190 | Encodes putative receptor-like protein kinase that is induced by the soil-borne vascular bacteria, Ralstonia solanacearum. Naming convention from Chen et al 2003 (PMID 14756307) |
| AT4G23260 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23270 | Encodes a cysteine-rich receptor-like protein kinase. The mRNA is cell-to-cell mobile. |
| AT4G38830 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G21410 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT1G70530 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G11530 | Encodes a cysteine-rich receptor-like protein kinase. The mRNA is cell-to-cell mobile. |
| AT4G04570 | Encodes a cysteine-rich receptor-like protein kinase. The mRNA is cell-to-cell mobile. |
| AT1G70520 | Encodes a cysteine-rich receptor-like protein kinase located to the plasma membrane. Involved in regulating microbe-associated molecular pattern-triggered ROS production and stress induced callose deposition at the plasmodesmata in roots. Required for MAMP-triggered responses and resistance to Pseudomonas syringae pv. tomato 118 DC3000 . |
| AT4G33660 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
| AT2G32190 | cysteine-rich/transmembrane domain A-like protein;(source:Araport11) |
| AT2G32200 | cysteine-rich/transmembrane domain A-like protein;(source:Araport11) |
| AT2G19570 | Encodes a cytidine deaminase that deaminates cytidine and deoxycytidine and is competitively inhibited by cytosine-containing compounds. |
| AT2G32720 | Participates with ELO2 in VLCFA synthesis. |
| AT5G48810 | Encodes a cytochrome b5 isoform that localizes to the ER. The C-terminal portion of the protein appears to be capable of inserting into a plant microsomal membrane in vitro and the protein appears to be subject to glycosylation. The mRNA is cell-to-cell mobile. |
| AT1G02410 | Encodes a member of the cytochrome c oxidase 11 protein family. It is an integral mitochondrial protein and likely plays an important role as a mitochondrial chaperone in COX complex assembly, affecting plant growth and pollen germination. |
| AT5G56090 | Encodes a homolog of COX15. Microarray analysis show a 3.2 fold increase in transcription after treatment with rotenone, an electron transport chain inhibitor. |
| AT1G17060 | Encodes a protein with similarity to other cytochrome P450's and is a homolog of BAS1. Over expression causes a dwarf phenotype resembling brassinolide resistant mutants. Double mutant analysis of sob7/bas1 loss of function mutants suggests these genes have redundant functions in light responsiveness. SOB7 may function in metabolizing brassinolides. Expressed in leaf, root, stem and silique but expression highest in flower and cauline leaves. Dominant overexpressing plants have dwarf phenotype, short siliques/seeds, rounded dark green leaves and short hypocotyls in light and dark. Loss of function alleles result in plants with long hypocotyls. |
| AT5G04330 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT1G01280 | member of CYP703A CYP703A2 is expressed specifically in anthers of land plants, catalyzing the in-chain hydroxylation at the C-7 position of medium-chain saturated fatty acids (lauric acid in-chain hydroxylase) which is involved in pollen development (sporopollenin synthesis). |
| AT1G69500 | Encodes a cytochrome P450, designated CYP704B1. Expressed in the developing anthers. Essential for pollen exine development. Mutations in CYP704B1 result in impaired pollen walls that lack a normal exine layer and exhibit a characteristic striped surface, termed zebra phenotype. Heterologous expression of CYP704B1 in yeast cells demonstrated that it catalyzes omega-hydroxylation of long-chain fatty acids, implicating these molecules in sporopollenin synthesis. |
| AT4G19230 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. CYP707A1 appears to play an important role in determining the ABA levels in dry seeds. Gene involved in postgermination growth. Overexpression of CYP707A1 leads to a decrease in ABA levels and a reduction in after-ripening period to break dormancy. |
| AT2G29090 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. This gene predominantly accumulates in dry seeds and is up-regulated immediately following imbibition. CYP707A2 appears to play a major role in the rapid decrease in ABA levels during early seed imbibition. |
| AT2G46950 | cytochrome P450, family 709, subfamily B, polypeptide 2;(source:Araport11) |
| AT4G27710 | member of CYP709B The mRNA is cell-to-cell mobile. |
| AT1G13110 | member of CYP71B The mRNA is cell-to-cell mobile. |
| AT5G25130 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT5G25140 | putative cytochrome P450 |
| AT1G13080 | cytochrome P450 monooxygenase |
| AT3G26180 | putative cytochrome P450 |
| AT3G26190 | putative cytochrome P450 |
| AT3G26210 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT1G13090 | putative cytochrome P450 |
| AT1G13100 | putative cytochrome P450 |
| AT3G26220 | cytochrome P450 monooxygenase |
| AT3G26300 | putative cytochrome P450 |
| AT3G26310 | putative cytochrome P450 |
| AT2G34500 | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze in the presence of NADPH the conversion of β-sitosterol to stigmasterol, but not that of 24-epi-campesterol to brassicasterol (unlike CYP710A2). |
| AT2G26170 | Encodes a protein with similarity to thromboxane-A synthase, member of the CYP711A cytochrome P450 family. MAX1 is a specific repressor of vegetative axillary buds generated by the axillary meristem. Expressed in vascular traces in the rosette stem and axillary buds throughout plant development. Mutants have increased axillary branches. Along with MAX3,4 thought to mediate control of shoot branching via synthesis of a signal molecule which is transported over long distance mediated by MAX2. cDNA supports the existence of the longer transcript predicted for this locus, no cDNA isolated for shorter transcript. MAX1 downregulates 11 genes involved in flavonoid pathway (CHS, CHI, F3H, F3'H, FLS, DFR, ANS, UFGT, RT, AAC and GST). |
| AT5G24910 | Member of CYP714A. Encodes one of the two tandemly duplicated gene pair ELA1 (CYP714A1) and ELA2 (CYP714A2), homologs of the rice cytochrome P450 monooxygenase gene EUI1. Double mutation of ELA1 and ELA2 results in increased biomass and enlarged organs. |
| AT5G24900 | Member of CYP714A. Encodes one of the two tandemly duplicated gene pair ELA1 (CYP714A1) and ELA2 (CYP714A2), homologs of the rice cytochrome P450 monooxygenase gene EUI1. Double mutation of ELA1 and ELA2 results in increased biomass and enlarged organs. |
| AT3G14640 | putative cytochrome P450 |
| AT3G14650 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT3G14680 | putative cytochrome P450 |
| AT1G75130 | member of CYP721A |
| AT3G52970 | member of CYP76G |
| AT2G46660 | Encodes a member of CYP78A cytochrome P450 monooxygenase protein family that is required in the sporophytic tissue of the mother plant to promote seed growth. |
| AT1G79370 | member of CYP79C |
| AT4G37320 | member of CYP81D |
| AT4G37310 | member of CYP81H |
| AT5G10600 | member of CYP81K |
| AT2G25160 | cytochrome P450, family 82, subfamily F, polypeptide 1;(source:Araport11) |
| AT4G31500 | Encodes an oxime-metabolizing enzyme in the biosynthetic pathway of glucosinolates. Is required for phytochrome signal transduction in red light. Mutation confers auxin overproduction. |
| AT4G00360 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems. |
| AT1G63710 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at highest level in mature stems and flowers. |
| AT2G45970 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems.Mutant seeds have reduced seed longevity, higher tetrazolium salt uptake and reduction, and reduced lipid polyester barriers (PMID:32519347). |
| AT3G03470 | P450 monooxygenase CYP89A9. Involved in NDCC accumulation during Arabidopsis leaf senescence. |
| AT1G05160 | Encodes an ent-kaurenoic acid hydroxylase, a member of the CYP88A cytochrome p450 family. |
| AT5G63450 | AtWRKY33 regulates root apoplastic barrier formation by controlling AtCYP94B1 leading to increased salt tolerance of Arabidopsis plants. Regulation by WRKY33 to control apoplastic barrier formation in roots to confer salt tolerance. |
| AT3G48520 | CYP94B3 is a jasmonoyl-isoleucine-12-hydroxylase that catalyzes the formation of 12-OH-JA-Ile from JA-Ile. By reducing the levels of this the biologically active phytohormone, CYP94B3 attenuates the jasmonic acid signaling cascade. CYP94B3 transcript levels rise in response to wounding. |
| AT2G23180 | member of CYP96A |
| AT4G39510 | member of CYP96A |
| AT4G39480 | member of CYP96A |
| AT2G39770 | Encodes a GDP-mannose pyrophosphorylase/ mannose-1-pyrophosphatase. This enzyme provides GDP-mannose, which is used for cell wall carbohydrate biosynthesis and protein glycosylation as well as for ascorbate (vitamin C) biosynthesis. Mutations in this gene confer hypersensitivity to NH4+. |
| AT1G75450 | This gene used to be called AtCKX6. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT5G21482 | This gene used to be called AtCKX5. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. Enzyme assays show preference for N6 -(2-isopentenyl)adenine 9-glucoside substrate. |
| AT4G11140 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT1G68550 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT4G23750 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Monopteros target gene. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT5G53290 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT4G27950 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT2G46310 | CRF5 encodes one of the six cytokinin response factors. It is transcriptionally upregulated in response to cytokinin. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves. |
| AT3G61630 | CRF6 encodes one of the six cytokinin response factors. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves. |
| AT3G44326 | Cytokinin induced F-Box protein. Forms a unique F-Box family with AT2G27310 and AT2G36090. It is primarily expressed in the root. |
| AT2G29560 | Encodes a putative phosphoenolpyruvate enolase that is localized both to the nucleus and the cytoplasm. The mRNA is cell-to-cell mobile. |
| AT1G35580 | CINV1 / A/N-InvG is an alkaline/neutral invertase that breaks sucrose down into fructose and glucose (GH100). The exact localization of CINV1 remains under investigation but there is evidence that fluorescently-tagged CINV1 localizes to the cytoplasm. atinvg mutants have reduced root growth, reduced invertase activity, and increased expression of antioxidant genes under basal conditions. The levels of CINV1 / A/N-InvG transcripts rise in response to a hydrogen peroxide treatment. The protein has been shown to interact with PIP5K9. |
| AT4G09510 | CINV2 appears to function as a neutral invertase based on the phenotype of a cinv1(AT1G35580)/cinv2 double mutant. It is predicted to be a cytosolic enzyme. CINV1, CINV2, and possibly other cytosolic invertases may play an important role in supplying carbon from sucrose to non-photosynthetic tissues. |
| AT1G65930 | Encodes a NADP+-isocitrate dehydrogenase that is believed to function in the cytosol. It appears to contribute to NADPH production under oxidative stress, and thereby to participate in redox signalling linked to defense responses. The mRNA is cell-to-cell mobile. |
| AT3G04620 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT3G12620 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G51370 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT4G39800 | ** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT5G55910 | Member of AGC VIIIa Kinase family. D6PK is a protein kinase involved that plays a role in polar auxin transport. Most likely acts redundantly with the related proteins: D6PKL1,D6PKL2,and D6PKL3. PIN1 is a target of D6PK phosphorylation. D6PK is associated with sterol enriched membrane rafts and may be involved in regulation of the switch from basal to planar polarity during root hair initiation. Involved in pulse-induced phototropism but also for time-dependent second positive phototropism. Works with PIN3 in the same genetic pathway of hypocotyl phototropism under all light conditions. Involved in the generation of auxin asymmetrical distribution induced by phototropic stimulation. |
| AT5G17890 | Encodes a protein that appears to be involved in defense responses. Contains TIR, NB-LRR and LIM domains. A gain of function allele exhibits cold dependent phenotypes including apparent activation of defense responses and an increased freezing tolerance. The mRNA is cell-to-cell mobile. |
| AT5G66610 | DA1-related protein 7;(source:Araport11) |
| AT1G30370 | Encodes a mitochondria-localized class III phospholipase A1 that plays a role in seed viability. |
| AT3G10910 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G01880 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G58760 | Encodes a DDB1a interacting protein DDB2 required for UV-B tolerance and genomic integrity. |
| AT3G49620 | encodes a protein similar to 2-oxoacid-dependent dioxygenase. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT3G19140 | DAY NEUTRAL FLOWERING (DNF) is a membrane-bound E3 ligase involved in the regulation of flowering time in Arabidopsis. It negetively regulate the early flowering under Short Day condition. |
| AT5G03210 | Encodes a small polypeptide contributing to resistance to potyvirus. |
| AT2G38050 | Similar to mammalian steroid-5-alpha-reductase. Involved in the brassinolide biosynthetic pathway. |
| AT1G77030 | Required for functional maturation of male and female gametophytes. |
| AT1G03310 | Encodes a protein with strong similarity to isoamylase (EC:3.2.1.68) however lacks critical residues known to be important for activity. Appears to co localize with ISA1 in the chloroplast isoamylase complex. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. It has been postulated that AtISA2 interacts with AtISA1 to form the Iso1 complex. |
| AT5G61590 | Encodes an AP2/ERF-type transcription factor that is preferentially expressed in the epidermis and induced by darkness and negatively regulates cuticular wax biosynthesis. |
| AT1G72490 | DRO1 is a member of the IGT gene family and has a unknown function . It is expressed in roots and involved in leaf root architecture, specifically the orientation of lateral root angles. Involved in determining lateral root branch angle. |
| AT2G41610 | Transmembrane protein from a plant specific gene family. Overexpression causes abnormal cell wall composition and defects in cell growth. |
| AT1G19100 | Encodes a member of the conserved Microrchidia (MORC) adenosine triphosphatase (ATPase) family, predicted to catalyze alterations in chromosome superstructure. Required for heterochromatin condensation and gene silencing. |
| AT4G18750 | Encodes a pentatricopeptide (PPR) protein involved in leaf and root development. dot4 mutants have an aberrant midgap venation pattern in juvenile leaves and cotyledons. |
| AT1G32210 | Encodes protein involved in suppression of apoptosis. Complements a mammalian apoptosis suppressor mutation. |
| AT5G15410 | 'defense, no death' gene (DND1) encodes a mutated cyclic nucleotide-gated cation channel; Same as CNGC2 (article ID 229): Cyclic nucleotide gated channel, activated by cAMP, conducts K+ and other monovalent cations but excludes Na+, does not contain the GYG amino acid sequence found in other channels with this conductivity profile. Conducts Ca2+ into cells which is linked to the generation of NO and the NO signaling pathway involved in the innate immune response to pathogens. CNGC2 could be the key step mediating bulk Ca2+ influx into leaf cells after unloading from the vascular and have no direct roles in the leaf development and HR. |
| AT2G47940 | Encodes DegP2 protease (DEGP2); nuclear gene for chloroplast product. |
| AT5G40200 | Encodes a putative DegP protease. The mRNA is cell-to-cell mobile. |
| AT4G25480 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF3). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. |
| AT1G54410 | Encodes a KS-type dehydrin can reduce the formation of reactive oxygen species (ROS) from Cu. |
| AT5G45830 | Encodes DOG1 (DELAY OF GERMINATION 1). A quantitative trait locus involved in the control of seed dormancy. Belongs to a novel plant-specific gene family whose members include: DOG1-like 1-4 (DOGL1-4, At4g18660, At4g18680, At4g18690, At4g18650 respectively) and DOG1. DOG1 expression is seed-specific. |
| AT3G12930 | Encodes a novel conserved chloroplast protein that interacts with components of the PEP complex. Mutants show delayed greening and reduced photosynthetic capcity. |
| AT3G55610 | encodes delta 1-pyrroline-5-carboxylate synthetase B. Gene expression is induced by dehydration, high salt and ABA. Knock-out mutations in P5CS2 are embryo-lethal. P5CS2 appears to be present in different cells and/or different subcellular locations from P5CS1 in a tissue-dependent manner. Mutants are defective in pollen development. |
| AT3G16240 | Delta tonoplast intrinsic protein, functions as a water channel and ammonium (NH3) transporter. Highly expressed in flower, shoot, and stem. Expression shows diurnal regulation and is induced by ammonium (NH3). Protein localized to vacuolar membrane. The mRNA is cell-to-cell mobile. |
| AT1G65520 | encodes a peroxisomal delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation |
| AT5G04560 | Encodes a DNA glycosylase DEMETER (DME). Responsible for endosperm maternal-allele-specific hypomethylation at the MEDEA (MEA) gene. DME can excise 5-methylcytosine in vitro and when expressed in E. coli. DME establishes MEA imprinting by removing 5-methylcytosine to activate the maternal allele. |
| AT2G36490 | A repressor of transcriptional gene silencing. Functions by demethylating the target promoter DNA. Interacts physically with RPA2/ROR1. In the ros1 mutants, an increase in methylation is observed in a number of gene promoters. Among the loci affected by ros1, a few (RD29A and At1g76930) are affected in cytosine methylation in all sequence contexts (CpG, CpNpG or CpNpN), although many others are affected primarily in non-CpG contexts. The ros1 mutant is more susceptible to biotrophic pathogens and is repressed in its responsiveness of salyclic acid-dependent defence genes. |
| AT1G07645 | Ortholog of HC205/ Xhdsi-1voc from Xerophyta humilis. Member of VOC metalloenzyme superfamily. Not involved in response to abiotic stress, unlike its Xerophyta ortholog. |
| AT4G25640 | Encodes a multidrug and toxin efflux family transporter. Involved in flavonoid metabolism, affecting Root growth, seed development and germination, and pollen development, release and viability. |
| AT3G23637 | Member of a family of small polypeptides found only in angiosperm lineages.Contains a conserved 29 amino acid domain (RTF or DVL domain). |
| AT3G10160 | Encodes a protein with tetrahydrofolylpolyglutamate synthase activity that is located in the mitochondrial matrix. One of the three folylpolyglutamate synthetase isoforms (FPGSs): FPGS1 (At5g05980, plastidic), FPGS2 (At3g10160, mitochondrial) and FPGS3 (At3g55630, cytosolic). |
| AT3G55630 | Encodes one of the three folylpolyglutamate synthetase isoforms (FPGSs): FPGS1 (At5g05980, plastidic), FPGS2 (At3g10160, mitochondrial) and FPGS3 (At3g55630, cytosolic). |
| AT1G48320 | Encodes one of the two functional DHNA-CoA (1,4-dihydroxy-2-naphthoyl-CoA) thioesterases found in Arabidopsis. |
| AT5G63770 | a member of the diacylglycerol kinase gene family. Encodes a functional diacylglycerol kinase. Involved in root elongation and plant development. Gene expression is induced by wounding or cold. |
| AT2G18730 | diacylglycerol kinase 3;(source:Araport11) |
| AT5G57690 | Involved in nitric oxide-dependent pollen tube guidance and fertilization. |
| AT2G20900 | diacylglycerol kinase 5;(source:Araport11) |
| AT4G30340 | encodes a diacylglycerol kinase. Applying a specific diacylglycerol kinase inhibitor to the growth media resulted in reduced root elongation and plant growth. Gene is expressed throughout the plant but is strongest in flowers and young seedlings. |
| AT5G07920 | Encodes a putative diacylglycerol kinase that is mainly expressed in roots, shoots and leaves, but its enzyme product was not active in vitro. |
| AT5G64290 | dicarboxylate transport 2.1;(source:Araport11) |
| AT1G01040 | Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state, others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs. The mRNA is cell-to-cell mobile. |
| AT3G11670 | Responsible for the final assembly of galactolipids in photosynthetic membranes. Provides stability to the PS I core complex (e.g. subunits PsaD, PsaE). |
| AT4G00550 | encodes a UDP-galactose-dependent digalactosyldiacylglycerol(DGDG) synthase. Located in chloroplast outer membrane. |
| AT2G45440 | Encodes a protein that likely has dihydropicolinate synthase activity based on its mutant phenotype of decreased lysine levels and increased aspartate levels. The mutant also has increased levels of threonine. The enzyme is predicted to localize to the chloroplast. |
| AT1G27980 | Encodes an ER-localized sphingoid long-chain base-1-phosphate lyase involved in the dehydration stress response. |
| AT2G45180 | nsLTP family-related gene. Expression is strongly suppressed by bacterial pathogens. Mutants are more susceptible to pathogens and abiotic stressors suggesting a function in basal stress response. |
| AT5G64860 | Encodes a maltotriose-metabolizing enzyme with chloroplastic α-1,4-glucanotransferase activity. Mutant has altered starch degradation. |
| AT3G22880 | Expression of the AtDMC1 is restricted to pollen mother cells in anthers and to megaspore mother cells in ovules. Similar to meiosis-specific yeast DMC gene. |
| AT5G58900 | R-R-type MYB protein |
| AT5G04760 | R-R-type MYB protein which plays negative roles in salt stress and is required for ABA signaling in Arabidopsis. |
| AT2G17880 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT3G13310 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G59610 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT2G42750 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT5G25480 | Encodes a DNA methyltransferase homolog. Human Dnmt2 methylates tRNA-Asp and can methylate Arabidopsis tRNA-Asp in vitro. |
| AT2G42120 | DNA polymerase delta small subunit;(source:Araport11) |
| AT2G25620 | Encodes DBP1, a member of the DBP factors (DNA-binding protein phosphatases) featuring sequence-specific DNA-binding and protein phosphatase activity. DBP1 is involved in plant-potyvirus interactions. Loss-of-function of DBP1 renders resistance to potyviruses. Negatively regulates drought and salt tolerance through altering leaf surface permeability. |
| AT4G21080 | Dof-type zinc finger domain-containing protein;(source:Araport11) |
| AT3G12610 | Plays role in DNA-damage repair/toleration. Partially complements RecA- phenotypes. |
| AT5G18070 | encodes a novel protein involved in DNA repair from UV damage. Isolated by functional complementation of E. coli UV-sensitive mutants (UVR genes). |
| AT4G36040 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT2G46590 | Encodes a protein containing Dof zinc finger motifs that is a positive regulator of light-mediated seed germination. Its expression is limited to vascular system of the mother plant. A recessive mutation is inherited as maternal-effect and expression is not detected in the embryo. Mutants are defective in seed germination and are more dependent on light and cold treatment and less sensitive to gibberellin during seed germination. It plays its main role downstream of PIL5 and DAG1 in the phytochrome B (phyB)-mediated pathway. |
| AT3G45610 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT1G51700 | Encodes dof zinc finger protein (adof1). The mRNA is cell-to-cell mobile. |
| AT3G45040 | Encodes a putative dolichol kinase that is localized to the endoplasmic reticulum and involved in pollen tube reception in the female gametophyte. |
| AT1G74340 | Encodes a subunit of the dolichol phosphate mannase synthase (DPMS) complex that may serve as membrane anchors for the catalytic core, DPMS1, or provide catalytic assistance. It is localized in the ER and mediates isoprenyl-linked glycan biogenesis. |
| AT1G03300 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
| AT3G62300 | Encodes a protein with Agenet/Tudor and DUF724 domains. It can interact with ABAP1, a negative regulator of DNA replication and transcription, with the plant histone modification 'reader' LHP1, and with non-modified histones. It may act as a link between DNA replication, transcription and chromatin remodeling during flower development. Loss of function mutant has a WT phenotype. |
| AT2G33830 | Negative regulator of local and systemic acquired resistance; target of FLD for activation of SAR. |
| AT1G28330 | dormancy-associated protein (DRM1) |
| AT4G25670 | stress response NST1-like protein;(source:Araport11) |
| AT2G45830 | downstream target of AGL15 2;(source:Araport11) |
| AT1G79760 | Identified as target of the AGL15 binding motif CArG. |
| AT5G24530 | Encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility to downy mildew. The mRNA is cell-to-cell mobile. |
| AT5G67190 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT2G23340 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT5G17460 | glutamyl-tRNA (Gln) amidotransferase subunit C;(source:Araport11) |
| AT3G05700 | Encodes a DNA binding protein with transcription activation activity. It is expressed in response to osmotic, drought and ABA stress. |
| AT5G55970 | Drought-induced gene encoding an ER-localized RING-type E3 Ub ligase. |
| AT3G26932 | dsRNA-binding protein 3;(source:Araport11) |
| AT5G45010 | Member of the intrinsically disordered protein family, interacts with different protein partners forming complexes involved in diverse biological mechanisms such as DNA repair, regulation of protein homeostasis, mRNA export. Role in the post-translational protein modification named DSSylation. Involved in molecular mechanisms underlying plant abiotic stress responses. |
| AT1G03930 | Phosphorylates serine, threonine, and tyrosine |
| AT4G17505 | carboxyl-terminal proteinase-like protein (DUF239);(source:Araport11) |
| AT4G14260 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G53240 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G25460 | Encodes a DUF642 cell wall protein. |
| AT1G64110 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT3G62230 | Target promoter of the male germline-specific transcription factor DUO1. Increases seed oil content by attenuating GL2 inhibition. Overexpression results in reduced trichome numbers. |
| AT5G39650 | Target promoter of the male germline-specific transcription factor DUO1. Knock down mutants result in an aborted seed phenotype that is transmitted through the male, together with loss-of-function mutation in DMP9 induces maternal haploids, with an average haploid induction rate of 2.1 ? 1.1%. |
| AT4G35560 | Target promoter of the male germline-specific transcription factor DUO1. The mRNA is cell-to-cell mobile. |
| AT4G35280 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT4G35700 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT3G03990 | Encodes an alpha/beta hydrolase essential for strigolactone signaling. Degradation of the protein is promoted by strigolactone. The mRNA is cell-to-cell mobile. |
| AT3G50660 | Encodes a 22α hydroxylase whose reaction is a rate-limiting step in brassinosteroid biosynthetic pathway. The protein is a member of CYP90B gene family. CLM is an epi-allele with small, compressed rosette, reduced internode length, and reduced fertility, appears in selfed ddm mutant plants possibly due to loss of cytosine methylation. Transcripts accumulate in actively growing tissues, and GUS expression is negatively regulated by brassinosteroids. Localized in the endoplasmic reticulum. The in vitro expressed protein can perform the C-22 hydroxylation of a variety of C27-, C28- and C29-sterols. Cholesterol was the best substrate, followed by campesterol. Sitosterol was a poor substrate. |
| AT1G50430 | Mutants are defective in Brassinosteroid biosynthesis (delta7-sterol-C7 reduction step) and have a dwarf phenotype. EXO70 interactor and presumed negative secretion regulator. |
| AT1G12610 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (DDF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. Overexpression of this gene results in delayed flowering and dwarfism, reduction of gibberellic acid biosynthesis, and increased tolerance to high levels of salt. This gene is expressed in all tissues examined, but most abundantly expressed in upper stems. Overexpression of this gene is also correlated with increased expression of GA biosynthetic genes and RD29A (a cold and drought responsive gene). Under salt stress it induces the expression of GAOX7, which encodes ad C20-GA inhibitor. |
| AT4G03400 | Encodes a GH3-related gene involved in red light-specific hypocotyl elongation. Analysis of sense and antisense transgenic plants suggests that DFL2 is located downstream of red light signal transduction and determines the degree of hypocotyl elongation. |
| AT1G76260 | DWD (DDB1-binding WD40 protein) hypersensitive to ABA 2;(source:Araport11) |
| AT1G61210 | DWA3 encodes a DWD(DDB1 binding WD40) protein. Invitro analyses suggest its involvement in the negative regulation of ABA responses.One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
| AT3G61760 | DYNAMIN-like 1B;(source:Araport11) |
| AT5G42080 | Encodes a dynamin-like protein related to phragmoplastin. Mutations in this gene, in combination with mutation in ADL1E, result in defects in embryogenesis, cell plate formation and trichome branching. Also controls vascular patterning in combination with VAN3 and GNOM. DRP2B and DRP1A participate together in clathrin-coated vesicle formation during endocytosis. |
| AT4G33650 | Encodes a protein with high sequence similarity to the dynamin superfamily. Among those members ADL2 was most closely related to Dnm1p of yeast and likely a member of the Vps1p subfamily. Widely expressed in various tissues with highest expression in flower tissues. Localizes to the chloroplast, mitochondrion and peroxisome. Involved in peroxisome and mitochondria fission in combination with DRP3B. |
| AT5G27930 | EGR2 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress. EGR2 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
| AT3G16800 | EGR3 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress, EGR3 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
| AT5G19180 | Encodes a subunit of a RUB-activating enzyme analogous to the E1 ubiquitin-activating enzyme. ECR1 functions as a heterodimer with AXR1 to activate RUB, a ubiquitin-related protein. |
| AT2G40550 | Encodes a nuclear localized target of E2Fa-DPa, transcription factors controlling cell cycle progression. Required for sister chromatid cohesion and DNA repair. |
| AT2G33850 | Stigmatic factor that plays a role during the early post-pollination stages. |
| AT2G40080 | Encodes a novel nuclear 111 amino-acid phytochrome-regulated component of a negative feedback loop involving the circadian clock central oscillator components CCA1 and LHY. ELF4 is necessary for light-induced expression of both CCA1 and LHY, and conversely, CCA1 and LHY act negatively on light-induced ELF4 expression. ELF4 promotes clock accuracy and is required for sustained rhythms in the absence of daily light/dark cycles. It is involved in the phyB-mediated constant red light induced seedling de-etiolation process and may function to coregulate the expression of a subset of phyB-regulated genes. |
| AT1G79730 | Encodes a PAF1 homolog that is involved in the control of flowering time by elevating FLC expression to a level that creates the vernalization-responsive, winter-annual habit. Yeast PAF1 is a component of a five-member complex that associates with RNA pol II and is thought to regulate gene expression by recruiting SET1 (a histone 3 Lys 4 [H3-K4] methyl transferase) to the initially transcribed [5'] regions of target chromatin. Mutants display reduced H3-K4 methylation in both FLC and FLM chromatin. Member of PAF-C complex. |
| AT5G16260 | Encodes a RNA binding protein ELF9 (EARLY FLOWERING9). Loss of ELF9 function in the Wassilewskija ecotype causes early flowering in short days. ELF9 reduces SOC1 (SUPPRESSOR OF OVEREXPRESSION OF CO1) transcript levels, possibly via nonsense-mediated mRNA decay. The mRNA is cell-to-cell mobile. |
| AT3G22840 | Encodes an early light-inducible protein. |
| AT5G57920 | early nodulin-like protein 10;(source:Araport11) |
| AT3G01070 | early nodulin-like protein 16;(source:Araport11) |
| AT5G15350 | early nodulin-like protein 17;(source:Araport11) |
| AT1G08500 | early nodulin-like protein 18;(source:Araport11) |
| AT5G14345 | Encodes a Uclacyanin/Basic blue family protein |
| AT4G32490 | early nodulin-like protein 4;(source:Araport11) |
| AT1G76180 | Encodes a dehydrin protein whose expression is induced early on in response to dehydration stress. This gene's expression to cold occurs in two waves, with early induction occurring within 1 h and secondary induction occurring 5 h after the beginning of cold stress. Expression is also induced in response to ABA but not in response to 2,4-D, BA, and GA3. ERD14 protein is capable of binding Ca2+, especially when the protein is phosphorylated. |
| AT1G08930 | encodes a putative sucrose transporter whose gene expression is induced by dehydration and cold. The mRNA is cell-to-cell mobile. |
| AT5G51070 | ATP-dependent Clp protease regulatory subunit The mRNA is cell-to-cell mobile. |
| AT1G20450 | Encodes a gene induced by low temperature and dehydration. Inhibits e.coli growth while overexpressed. Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. LTI29 and LTI30 double overexpressors confer cold tolerance. Localized to membranes and cytoplasm. |
| AT2G41430 | Encodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2. |
| AT3G30775 | Encodes a proline oxidase that is predicted to localize to the inner mitochondrial membrane, its mRNA expression induced by high levels of Al and by osmotic stress. The promoter contains an L-proline-inducible element. |
| AT1G18330 | EARLY-PHYTOCHROME-RESPONSIVE1 |
| AT4G19120 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G30360 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT2G17840 | Identified as drought-inducible gene by differential hybridization. Upregulated by high light, drought, cold and salt stress determined by microarray analysis. |
| AT1G02205 | Expression of the CER1 gene associated with production of stem epicuticular wax and pollen fertility. Biochemical studies showed that cer1 mutants are blocked in the conversion of stem wax C30 aldehydes to C29 alkanes, and they also lack the secondary alcohols and ketones. These suggested the CER1 protein is an aldehyde decarbonylase, but the exact molecular function of this protein remains to be determined. |
| AT4G24510 | Encodes a component of the fatty acid elongation machinery required for C28 to C30 fatty acid elongation. It does not require the acyltransferase catalytic site for biological function. |
| AT4G13840 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G57800 | encodes a transmembrane protein with similarity to the sterol desaturase family at the N-terminus and to the short-chain dehydrogenase/reductase family at the C-terminus. Mutant analyses indicate this protein is involved in cuticle membrane and wax biosynthesis. The mRNA is cell-to-cell mobile. |
| AT4G34100 | Encodes a putative E3 ubiquitin ligase that is involved in cuticular wax biosynthesis and regulates 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) activity. HMGR catalyzes the major rate-limiting step of the mevalonic acid (MVA) pathway from which sterols and other isoprenoids are synthesized. Lines carrying a recessive mutation in this locus have reduced chain-length distribution, weakly glaucous stem surface, and has reduced fertility in early flowers, non-spreading floret, downward cupped leaves, leaf waxes nearly pure C24 and C26 acid. |
| AT1G80350 | encodes a p60 katanin protein that is expressed throughout the plant. Required for the specification of cell fates from early in development (in the meristem) through differentiation and for normal postmitotic organization of cortical microtubules into transverse arrays in root epidermis cells. Mutants display cytoskeletal defects. |
| AT3G55830 | A member of the Glycosyltransferase Family 64, homologous to Poplar cambium-expressed GT64 gene. The EPC1 protein plays a critical role during plant development in maintaining the integrity of organs via cell-cell adhesion, thereby providing mechanical strength and facilitating the movement of metabolites throughout the plant.Loss of function specifically affects glycosylinositolphosphorylceramide (GIPC) mannosylation. |
| AT2G24860 | Loss-of-function mutant of EIJ1 presents normal growth, but a stronger resistance to Pst DC3000 compared with the wild type. |
| AT5G20480 | Encodes a predicted leucine-rich repeat receptor kinase (LRR-RLK). Functions as the receptor for bacterial PAMP (pathogen associated molecular patterns) EF-Tu. |
| AT5G15440 | EID1-like 1;(source:Araport11) |
| AT5G39360 | EID1-like 2;(source:Araport11) |
| AT4G24800 | MA3 domain-containing protein;(source:Araport11) |
| AT3G18980 | EIN2 targeting protein1;(source:Araport11) |
| AT2G25490 | Encodes an F-box protein involved in the ubiquitin/proteasome-dependent proteolysis of EIN3. The mRNA is cell-to-cell mobile. |
| AT1G72630 | ELF4-like 2;(source:Araport11) |
| AT5G64890 | elicitor peptide 2 precursor;(source:Araport11) |
| AT5G64905 | elicitor peptide 3 precursor;(source:Araport11) |
| AT2G22000 | elicitor peptide 6 precursor;(source:Araport11) |
| AT1G75000 | ELO family protein. |
| AT5G11260 | Basic leucine zipper (bZIP) transcription factor. Nuclear localization. Involved in light-regulated transcriptional activation of G-box-containing promoters. Negatively regulated by Cop1. Although cytokinins do not appear to affect the gene's promoter activity, they appear to stabilize the protein. HY5 plays a role in anthocyanin accumulation in far-red light and blue light, but not in red light or in the dark. Mutant studies showed that the gene product is involved in the positive regulation of the PHYA-mediated inhibition of hypocotyl elongation. Binds to G- and Z-boxes, and other ACEs, but not to E-box. Loss of function mutation shows ABA resistant seedling phenotypes suggesting involvement for HY5 in mediating ABA responses. Binds to the promoter of ABI5 and regulates its expression.Involved in the regulation of response to nutrient levels. |
| AT5G22350 | fission ELM1-like protein (DUF1022);(source:Araport11) |
| AT1G79350 | Encodes the Arabidopsis thaliana orthologue of metazoan Strawberry notch, a highly conserved co-activator of the developmental regulator Notch. It mediates stress-induced chromatin memory by modulating nucleosome occupancy by interacting with chromatin remodeling proteins of the ISWI and SWI/SNF classes. |
| AT4G23250 | cysteine-rich receptor-like protein kinase 17;(source:Araport11) |
| AT1G21690 | ATPase family associated with various cellular activities (AAA);(source:Araport11) |
| AT2G22870 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G05680 | Encodes a splicing/methylation factor that is a homologue to the mammalian VIRILIZER, is member of a core set of mRNA m6A writer proteins and is required for N6-adenosine methylation of mRNA. Analysis of transcriptional profiles of the vir-1 mutant suggests that VIR is likely involved in regulation of gene expression, but the function of VIR is rather general than specific and knock-down of VIR does not affect overall splicing rates. |
| AT5G24400 | Encodes a protein with 6-phosphoglucunolactonase activity that localizes to the chloroplasts and the peroxisome. However, mutant phenotypes observed in pgl3 mutant plants can be complemented with a chloroplast-targeted version of the protein. PGL3 likely functions in the oxidative branch of the pentose phosphate pathway. pgl3 mutant phenotypes suggest that it is important in pathogen defense and maintenance of cellular redox homeostasis. |
| AT1G21390 | embryo defective 2170;(source:Araport11) |
| AT5G16715 | protein EMBRYO DEFECTIVE 2247;(source:Araport11) |
| AT1G30610 | Pentatricopeptide repeat protein .Mutations in this locus result in embryo lethality due to defects in chloroplast development. Embryo shape at seed maturity is globular. |
| AT3G04340 | Functions in maintaining the cellular redox balance and regulates photorespiratory metabolism.Strong interaction with TIC inner envelope protein translocon which consists of Tic20/Tic56/Tic100/Tic214(Ycf1)(DOI:10.1105/tpc.18.00357). |
| AT3G12670 | Cytidine triphosphate synthase; essential for CTP supply in developing embryos. |
| AT5G63420 | Encodes a member of the metallo-beta-lactamase protein family that plays a vital role in embryo morphogenesis and apical-basal pattern formation by regulating chloroplast development. In bacteria, RNase J plays an important role in rRNA maturation and in the 5′ stability of mRNA. |
| AT1G34550 | transmembrane protein (DUF616);(source:Araport11) |
| AT4G29860 | Encodes a WD repeat protein with seven WD repeat motifs, predicted to function in protein-protein interaction. Mutations caused defects in both embryo and seedling development. |
| AT4G33990 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G63050 | embryo defective 2759;(source:Araport11) |
| AT2G38770 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G15540 | Encodes Adherin SCC2. Essential for viability. Required for normal seed development. Plays a role in the establishment of sister-chromatid cohesion and chromosome organization during meiosis. |
| AT1G34430 | 2-oxoacid dehydrogenases acyltransferase family protein;(source:Araport11) |
| AT3G04790 | Ribose 5-phosphate isomerase, type A protein;(source:Araport11) |
| AT4G02790 | Encodes a GTPase that is targeted to chloroplasts and co-fractionated with chloroplast ribosomes. Mutants are embryo lethal due to this essential function being lost. |
| AT5G11890 | harpin-induced protein;(source:Araport11) |
| AT5G50390 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT5G64580 | Strong interaction with TIC inner envelope protein translocon which consists of Tic20/Tic56/Tic100/Tic214(Ycf1)(DOI:10.1105/tpc.18.00357). |
| AT2G01860 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G27270 | P-type PPR chloroplast localized protein required for group II intron splicing in chloroplasts. |
| AT2G35950 | embryo sac development arrest 12;(source:Araport11) |
| AT3G03810 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G62210 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT4G33050 | Encodes a calmodulin-binding protein involved in stomatal movement. |
| AT4G37890 | Involved in shoot regenaration from root explants. |
| AT3G23440 | embryo sac development arrest 6;(source:Araport11) |
| AT1G10717 | Encodes a Maternally expressed gene (MEG) family protein |
| AT3G48110 | glycine-tRNA ligase |
| AT2G41475 | Embryo-specific protein 3, (ATS3);(source:Araport11) |
| AT5G11530 | Involved in regulating reproductive development |
| AT4G02440 | EID1 is an F-box protein that functions as a negative regulator in phytochrome A (phyA)-specific light signalling. Expressed at all stages of plant development independently of light conditions, localizes to the nucleus, and forms nuclear speckles under continuous far-red light. Forms stable dimeric and trimeric complexes with several ASK proteins and Cullin1 in yeast and in planta. |
| AT1G71220 | Encodes UDP-glucose:glycoprotein glucosyltransferase. Non-receptor component required for EFR-mediated immunity. Mutants show de-repressed anthocyanin accumulation in the presence of elf18, and EFR accumulation and signalling. |
| AT1G18260 | Encodes an Arabidopsis homolog of the yeast Hrd3/mammlian Sel1L protein. Involved in ERAD (Endoplasmic reticulum-associated degradation). |
| AT5G62500 | Encodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis. |
| AT5G66460 | Encodes a endo-beta-mannanase involved in seed germination and silique dehiscence. |
| AT1G07670 | TPLATE complex protein involved in clathrin-mediated endocytosis. |
| AT1G72280 | Encodes an oxidoreductin required for oxidative protein folding in the ER and exists in two distinct oxidized isoforms (Ox1 and Ox2), which are determined by the formation or breakage of the putative regulatory disulfide. AtERO1 is mainly present in the Ox1 redox state. |
| AT1G29330 | Encodes a protein similar in sequence to animal and yeast endoplasmic reticulum retention signal receptor. This protein can functionally complement the yeast homologue. Transcript is detected in flower buds, stems, root, and leaves. |
| AT3G09030 | EAP3 is a cytolsolic BTB/POZ-domain protein involved in trafficking of PEN3. |
| AT1G10130 | Encodes a golgi localized P2A-type Ca2+ ATPase involved in Mn nutrition and homeostasis. |
| AT2G01850 | EXGT-A3 has homology to xyloglucan endotransglucosylases/hydrolases (XTHs). Mutants in this gene show a lesion mimic phenotype associated with leaf maturation and a reduction in the number of tertiary veins. Individual tracheary elements in the mutants are shorter, but phloem transport activity is not severely affected. EXGT-A3 plays a role in xyloglucan degradation in the differentiating tracheary elements of rosette leaves. The mRNA is cell-to-cell mobile. |
| AT4G19040 | Encodes a PH and START domain-containing protein that mediates resistance to pathogenic fungi. Resistance requires salicylic acid signalling. Mutants are resistant to E. cichoracearum. Expressed throughout plant tissues and possibly localized to membranes /mitochondrion. |
| AT3G48090 | Component of R gene-mediated disease resistance in Arabidopsis thaliana with homology to eukaryotic lipases. |
| AT4G39030 | Encodes an orphan multidrug and toxin extrusion transporter. Essential component of salicylic acid-dependent signaling for disease resistance. Member of the MATE-transporter family. Expression induced by salicylic acid. Mutants are salicylic acid-deficient. |
| AT5G67160 | Encodes a member of the BAHD acyltransferase superfamily. Mutants have enhanced susceptibility to virulent and avirulent pathogens and are defective in pathogen induced SA biosynthesis. EPS1 may act upstream of SA biosynthesis as application of SA can rescue the mutant phenotype. |
| AT5G40280 | encodes a beta subunit of farnesyl-trans-transferase, which is involved in meristem organization and ABA-mediated signal transduction pathway. Mutant phenotypes have been observed in meristem organization, and response to abscisic acid and drought. The mRNA is cell-to-cell mobile. |
| AT1G73840 | Resembles the CstF64 family of RNA processing factors that are conserved between yeast and mammals. In mammals, CstF64 is a component of the CstF complex which is required for mRNA 3'end formation along with other factors. |
| AT5G01400 | Encodes a Symplekin/Pta1 homologue which would have the potential to interact with either ESP1 or AtCstF64. |
| AT5G22090 | EAR1 is a negative regulator of ABA signaling that enhances the activity of all six clade A PP2Cs (ABI1, ABI2, HAB1, HAB2, AHG1, AHG3) by interacting with and releasing the N-terminal autoinhibition of these proteins. EAR1 indirectly affects OST1 activity through enhancing ABI1 activity. The EAR1 141-287 fragment is sufficient for the functioning of EAR1 in ABA responses; the 131-248 region harbors an intrinsically disordered region and only 249-278 can form a predicted regular structure. EAR1 is located in the ER, nuclei, and cytoplasm; ABA signaling promotes the translocation of EAR1 from the ER and/or cytoplasm to the nucleus. Mutations showed that it functions in seed germination, primary root growth, and drought tolerance. |
| AT3G12680 | Member of the floral homeotic AGAMOUS pathway. |
| AT3G17668 | DnaJ/Hsp40 cysteine-rich domain superfamily protein;(source:Araport11) |
| AT1G01380 | ETC1 is involved in trichome and root hair patterning in Arabidopsis. |
| AT1G34245 | Encodes a secretory peptide EPF2 expressed in proliferating cells of the stomatal lineage, known as meristemoids, and in guard mother cells, the progenitors of stomata. Controls asymmetric cell divisions during stomatal development. EPF2 is related to EPF1, also involved in stomatal development. Its transcript levels change after inducing MUTE expression in a mute background. EPF2 binds to the ER receptor triggering MAPK activation that in turn inhibits stomatal development. EPF2 competes with STOMAGEN for binding to receptor protein kinases ER, and TMM. |
| AT3G20290 | Encodes AtEHD1, one of the Arabidopsis Eps15 homology domain proteins involved in endocytosis (AtEHD2, At4g05520). |
| AT1G30630 | Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation. |
| AT3G59290 | Involved in plant trans-Golgi network (TGN) transport. |
| AT4G00900 | Type IIA (SERCA-type) Ca2+ ATPase, catalyzes the efflux of calcium from the cytoplasm. |
| AT1G08920 | Encodes ESL1, a transporter for monosaccharides. |
| AT1G75220 | Encodes a vacuolar glucose exporter that is induced in response to factors that activate vacuolar glucose pools like darkness, heat stress and wounding and repressed during conditions that trigger glucose accumulation in the vacuole like cold stress and external sugar supply. |
| AT5G62230 | Encodes a receptor-like kinase that, together with ER and ERL2 governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. It is important for maintaining stomatal stem cell activity and preventing terminal differentiation of the meristemoid into the guard mother cell. Along with erl2 functionally compensates for loss of erecta during integument development. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT5G07180 | Encodes a receptor-like kinase that, together with ER and ERL1 governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. It is also important for maintaining stomatal stem cell activity and preventing terminal differentiation of the meristemoid into the guard mother cell. When heterozygous in an er/erl1 null background, plants are female sterile due to cell division defect in the integuments. |
| AT2G20880 | Encodes ERF53, a drought-induced transcription factor. Belongs to the AP2/ERF superfamily, and has a highly conserved AP2 domain. Regulates drought-responsive gene expressions by binding to the GCC box and/or dehydration-responsive element (DRE) in the promoter of downstream genes. Overexpression of AtERF53 driven by the CaMV35S promoter resulted in an unstable drought-tolerant phenotype in T2 transgenic plants. Involved in heat shock response. |
| AT1G03800 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-10). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT1G28360 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ERF12). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. Regulates floral development. |
| AT5G44210 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-9). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT1G19400 | Tail-anchored (TA) OEP membrane protein which possesses a single C-terminal transmembrane domain targeting post-translationally to plastids. |
| AT5G43060 | Peptidase, activity detected in extracts of root, leaf and cell culture. |
| AT5G42950 | EXA1 is a GYF domain-containing gene of the SMY2 subgroup. Mutants exhibit resistance to potexviruses. |
| AT1G31660 | Encodes a protein that is a ribosome biogenesis co-factor. Mutants display aberrant RNA processing and male and female gametophyte development. |
| AT5G25190 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT5G03280 | Involved in ethylene signal transduction. Acts downstream of CTR1. Positively regulates ORE1 and negatively regulates mir164A,B,C to regulate leaf senescence. A maternally expressed imprinted gene. Mutations in ein2 block ethylene stimulation of flavonol synthesis. The mRNA is cell-to-cell mobile. |
| AT5G57090 | Encodes an auxin efflux carrier that is similar to bacterial membrane transporters. Root-specific role in the transport of auxin. Acts downstream of CTR1 and ethylene biosynthesis, in the same pathway as EIN2 and AUX1, and independent from EIN3 and EIN5/AIN1 pathway. In the root, the protein localizes apically in epidermal and lateral root cap cells and predominantly basally in cortical cells. Functions may be regulated by phosphorylation status. EIR1 expression is induced by brassinolide treatment in the brassinosteroid-insensitive br1 mutant. Gravistimulation results in asymmetric PIN2 distribution, with more protein degraded at the upper side of the gravistimulated root. Membrane sterol composition is essential for the acquisition of PIN2 polarity. Its expression is downregulated at hypoxic conditions. RAP2.12 overexpression inhibits this downregulation. |
| AT3G23150 | Involved in ethylene perception in Arabidopsis The mRNA is cell-to-cell mobile. |
| AT5G21960 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT5G61600 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture. |
| AT1G53170 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT1G33760 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT1G04310 | encodes an ethylene receptor related to bacterial two-component histidine kinases. |
| AT4G17500 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. The mRNA is cell-to-cell mobile. |
| AT5G47220 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-2). The protein contains one AP2 domain. Functions as activator of GCC box?dependent transcription. Positive regulator of JA-responsive defense genes and resistance to F. oxysporum and enhances JA inhibition of root elongation. |
| AT3G15210 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-4). The protein contains one AP2 domain. Acts as a negative regulator of JA-responsive defense gene expression and resistance to the necrotrophic fungal pathogen Fusarium oxysporum and antagonizes JA inhibition of root elongation. The mRNA is cell-to-cell mobile. |
| AT5G47230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-5). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. The mRNA is cell-to-cell mobile. |
| AT4G17490 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-6). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. It is involved in the response to reactive oxygen species and light stress. Involved in regulating root architecture and the response to cold stress. |
| AT1G17870 | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442?454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171?179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria. Mediates chloroplastic ROS homeostasis and promotes retrograde signaling in response to salt stress. |
| AT2G27050 | ethylene-insensitive3-like1 (EIL1) The mRNA is cell-to-cell mobile. |
| AT1G04370 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT2G31230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT4G16750 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT1G13950 | Encodes eukaryotic translation initiation factor 5A (EIF-5A).In mammalian cells it functions as a shuttle protein that translocates mRNA from the nucleus to cytoplasmic ribosomes. Overexpression results in an increase in both primary and secondary xylem formation. In RNAi suppressed lines, xylem formation is reduced. |
| AT1G69410 | Encodes eIF5A-2, a putative eukaryotic translation initiation factor. There are three eIF5A coding genes in Arabidopsis: eIF5A-1/At1g13950, eIF5A-2/At1g26630 and eIF5A-3/At1g69410. |
| AT3G55620 | Translation initiation factor IF6;(source:Araport11) |
| AT3G19760 | Encodes an RNA helicase that may be a component of the Exon Junction Complex. Subcellular localization is modulated by stress. Under normal conditions it is localized to the nuceloplasm but under hyopoxic conditions it localizes to the nucleolus and splicing speckles. |
| AT1G13020 | Encodes eIF4B2, eukaryotic initiation factor 4B2. |
| AT2G39990 | translation initiation factor eIF2 p47 subunit homolog |
| AT5G20920 | protein synthesis initiation factor eIF2 beta |
| AT5G06000 | One of the 2 genes that code for the G subunit of eukaryotic initiation factor 3 (EIF3). |
| AT3G13920 | eukaryotic translation initiation factor 4A-1 |
| AT3G26400 | member of eIF4B - eukaryotic initiation factor 4B The mRNA is cell-to-cell mobile. |
| AT1G29590 | translation initiation factor;(source:Araport11) |
| AT5G57870 | Encodes a putative eukaryotic translation initiation factor The mRNA is cell-to-cell mobile. |
| AT3G53890 | Cytosolic ribosomal protein. Mutants enhance the varigation effect of var2 mutations suggesting a link between cytosolic translation and chloroplast development. |
| AT3G13060 | evolutionarily conserved C-terminal region 5;(source:Araport11) |
| AT3G17330 | evolutionarily conserved C-terminal region 6;(source:Araport11) |
| AT1G79270 | evolutionarily conserved C-terminal region 8;(source:Araport11) |
| AT5G07280 | Encodes EMS1 (EXCESS MICROSPOROCYTES1), a putative leucine-rich repeat receptor protein kinase that controls somatic and reproductive cell fates in Arabidopsis anther. |
| AT4G17680 | Encodes an S-ribonuclease binding protein specifically involved in plant tolerance to NaHCO3. |
| AT4G33630 | Encodes one of the two plastid proteins EXECUTER (EX1, AT4G33630) and EX2 (AT1G27510). Mediates singlet oxygen induced programmed cell death. |
| AT4G02350 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. The mRNA is cell-to-cell mobile. |
| AT5G03540 | AtEXO70A1 is a member of EXO70 gene family, putative exocyst subunits, conserved in land plants. It plays a central role in Casparian strip formation, generating a transient positional information that will be translated into a precisely localized cell wall modification. |
| AT1G07000 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G13150 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. This particular member is expressed in pollen and, together with EXO70C2, is involved in pollen tube elongation. Found in the cytoplasm and surprisingly, not found in the plasma membrane. |
| AT1G72470 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT1G54090 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G50380 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G59730 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. The mRNA is cell-to-cell mobile. |
| AT4G08950 | Phosphate-responsive 1 family protein;(source:Araport11) |
| AT5G64260 | EXORDIUM like 2;(source:Araport11) |
| AT5G51550 | EXORDIUM like 3;(source:Araport11) |
| AT5G09440 | EXORDIUM like 4;(source:Araport11) |
| AT3G15370 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT1G69530 | Member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT1G26770 | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT3G03220 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT5G56320 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT2G03090 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G28950 | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G40610 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT5G02260 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT2G20750 | member of BETA-EXPANSINS. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT4G28250 | putative beta-expansin/allergen protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT3G45970 | member of EXPANSIN-LIKE. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) The mRNA is cell-to-cell mobile. |
| AT2G43150 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT1G70990 | Short extensin family protein required during the first phase of dark-grown hypocotyl elongation, regulates the moment and extent of the growth acceleration by modulating cell wall extensibility. |
| AT3G57630 | Encodes a glycoprotein glycosyl transferase ExAD. Knockout mutants show truncated root hair phenotype. |
| AT2G23460 | encodes a novel G-alpha protein that shares similarity to plant, yeast, and animal G-alpha proteins at the C-terminus. It contains an N-terminus that is as large as the C-terminus, is a member of a small family, and is expressed in all tissues examined, including roots, leaves, stems, flowers, and fruits. |
| AT1G31930 | Encodes XLG3 (extra-large G protein 3) that shows significant similarity to the G protein alpha subunit in its C terminal region. Involved in the regulation of root morphological and growth responses. |
| AT3G14100 | Triple RNA Recognition Motif protein involved in the dynamic and reversible aggregation of translationally repressed mRNAs during hypoxia.During hypoxia, UBP1C association with non? uracil-rich mRNAs is enhanced concomitant with its aggregation into microscopically visible cytoplasmic foci, referred to as UBP1 stress granules (SGs). This mRNA association occurs as global levels of protein synthesis decline during hypoxia. Upon reoxygenation, rapid UBP1 SG disaggregation coincides with the return of the stabilized mRNAs to polysomes. |
| AT1G21760 | This gene is predicted to encode an F-box protein that is evolutionarily conserved between Arabidopsis and other eukaryotes including S.cerevisiae and humans. It may play a role in regulating translation under conditions of temperature stress. FBP7 transcript levels are increased at high and low temperatures. The mRNA is cell-to-cell mobile. |
| AT1G61340 | Encodes a F-box protein induced by various biotic or abiotic stress. |
| AT4G21510 | F-box family protein;(source:Araport11) |
| AT4G05010 | F-box family protein;(source:Araport11) |
| AT4G35930 | F-box family protein;(source:Araport11) |
| AT2G24250 | LOW protein: F-box/kelch-repeat protein (DUF295);(source:Araport11) |
| AT5G60060 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT1G10110 | F-box family protein;(source:Araport11) |
| AT4G10820 | F-box family protein;(source:Araport11) |
| AT3G52940 | Encodes a sterol C-14 reductase required for cell division and expansion and is involved in proper organization of the embryo. |
| AT1G80790 | Belongs to a subgroup of SGS3-like proteins that act redundantly in RNA-directed DNA methylation: AT1G15910 (FDM1), AT4G00380 (FDM2), AT3G12550 (FDM3), AT1G13790 (FDM4), AT1G80790 (FDM5). The mRNA is cell-to-cell mobile. |
| AT1G03170 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
| AT5G19260 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
| AT5G02200 | Encodes a small plant-specific protein with both nuclear localization and nuclear export signals that is specifically required, together with FHY1, for the light-regulated nuclear accumulation of phyA. |
| AT4G19990 | FAR1-related sequence 1;(source:Araport11) |
| AT2G32250 | FAR1-related sequence 2;(source:Araport11) |
| AT1G52520 | FAR1-related sequence 6;(source:Araport11) |
| AT1G80010 | FAR1-related sequence 8;(source:Araport11) |
| AT5G58560 | FOLK is a farnesol kinase that can phosphorylate farnesol using an NTP donor. It can also phosphorylate geraniol, or geranylgeraniol, but it prefers farnesol in experiments performed using yeast membranes. folk loss-of-function mutants show ABA hypersensitivity in a seed germination assay and the mutants also exhibit abnormal flower development, including extra carpel formation, when subjected to water stress. The mRNA is cell-to-cell mobile. |
| AT5G47770 | Encodes a protein with farnesyl diphosphate synthase activity. |
| AT5G63530 | Farnesylated protein that binds metals. |
| AT4G38580 | putative farnesylated protein (At4g38580) mRNA, complete |
| AT4G12730 | AF333971 Arabidopsis thaliana fasciclin-like arabinogalactan-protein 2 (Fla2) mRNA, complete cds. Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT3G52370 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT2G35860 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT5G06390 | FASCICLIN-like arabinogalactan protein 17 precursor;(source:Araport11) |
| AT3G11700 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT1G15190 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT5G06920 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT1G03870 | fasciclin-like arabinogalactan-protein 9 (Fla9). Possibly involved in embryogenesis and seed development. |
| AT3G25110 | Encodes a FatA acyl-ACP thioesterase |
| AT1G74960 | Encodes a plastidic beta-ketoacyl-ACP synthase II, involved in fatty acid elongation from 16:0-ACP to 18:0-ACP. Homozygous knock-out mutants are embryo lethal, indicating early embryo development is sensitive to elevated 16:0. |
| AT3G12120 | Major enzyme responsible for the synthesis of 18:2 fatty acids in the endoplasmic reticulum. Contains His-rich motifs, which contribute to the interaction with the electron donor cytochrome b5. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
| AT2G29980 | Endoplasmic reticulum enzyme responsible for the synthesis of 18:3 fatty acids from phospholipids. Uses cytochrome b5 as electron donor. |
| AT4G27030 | Encodes an unusual palmitate desaturase that is highly substrate specific. It introduces a delta-3 trans double bond at palmitate at the sn-2 position of phosphatidylglycerol. The mRNA is cell-to-cell mobile. |
| AT2G38550 | Mediates fatty acid transport from plastid. |
| AT2G34770 | encodes a fatty acid hydroxylase, required for the AtBI-1-mediated suppression of programmed cell death. |
| AT1G08510 | Encodes an acyl-acyl carrier protein thioesterase. Hydrolyzes primarily saturated acyl-ACPs with chain lengths that vary between 8 and 18 carbons. Involved in saturated fatty acid synthesis. Nuclear-encoded, plastid-targeted globular protein that is functional as dimer. |
| AT5G63560 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G78020 | FCS like zinc finger 6 is induced during energy starvation through SnRK1 signaling. Mutants accumulate more SnRK1alpha1 which results in the inhibition of seedling growth under favorable growth conditions. Increased SnRK1 activity in the mutant also results in the downregulation of TOR signaling (DOI:10.1111/tpj.13854). |
| AT4G25100 | Fe-superoxide dismutase |
| AT2G35620 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots.Mucilage is easily detached from fei2 mutants seeds, and forms a capsule that is >50% smaller relative to wild-type. |
| AT2G28160 | Encodes a putative transcription factor that regulates iron uptake responses. mRNA is detected in the outer cell layers of the root and accumulates in response to iron deficiency. The expression of many iron-regulated genes is dependent on FIT1. It specifically regulates FRO2 at the level of mRNA accumulation and IRT1 at the level of protein accumulation.Similar to FER in tomato and is a regulator of iron uptake. It is post-transcriptionally controlled. |
| AT3G51550 | Encodes a synergid-expressed, plasma-membrane localized receptor-like kinase that accumulates asymetrically in the synergid membrnane at the filiform apparatus and mediates male-female gametophyte interactions during pollen tube reception. Also involved in powdery mildew infection. Mutants show faster root elongation under dim light, the protein is required for intracellular accumulation of AHA2 under dim-light growth conditions. Positively regulates flowering by modulating the transcript accumulation and mRNA alternative splicing of certain flowering-related genes, including FLOWERING LOCUS C (FLC) and its homolog MADS AFFECTING FLOWERING (MAF). However, the RALF1 ligand negatively regulates flowering compared with FER. |
| AT4G14890 | 2Fe-2S ferredoxin-like superfamily protein;(source:Araport11) |
| AT5G66190 | Encodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the thylakoid. The affinity of this enzyme for ferredoxin is slightly, but significantly, higher than AtLFNR2, an isoform of the same enzyme. AtLFNR1 forms a heterodimer with AtFNR2 and is also a prerequisite to attach AtFNR2 to the thylakoid membrane. |
| AT1G20020 | Encodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the stroma The mRNA is cell-to-cell mobile. |
| AT5G01600 | Encodes a ferretin protein that is targeted to the chloroplast. Member of a Ferritin gene family. Gene expression is induced in response to iron overload and by nitric oxide. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT1G23020 | Encodes a ferric chelate reductase whose transcription is regulated by FIT1. Expressed in the root, shoot, flower and cotyledon. |
| AT5G49730 | Encodes a plasma membrane-located ferric chelate reductase. Its mRNA is expressed in green aerial tissues (shoot, flower and cotyledon) in a light- and cell differentiation-specific manner. |
| AT3G56090 | Encodes FERRITIN 3, AtFER3. Ferritins are a class of 24-mer multi-meric proteins found in all kingdoms of life. Function as the main iron store in mammals. Evidence suggests that Arabidopsis ferritins are essential to protect cells against oxidative damage, but they do not constitute the major iron pool. |
| AT3G53800 | Encodes one of the Arabidopsis orthologs of the human Hsp70-binding protein 1 (HspBP-1) and yeast Fes1p: Fes1A (AT3G09350), Fes1B (AT3G53800), Fes1C (AT5G02150). |
| AT1G28200 | VirF-interacting protein FIP1 |
| AT4G22240 | Involved in photoprotection of photosystem II. The RVSI and twin-positive motifs in the transit peptide are necessary for efficient leucoplast import of prFB. |
| AT5G19940 | Enables plants to cope with moderate light stress and affects cadmium tolerance. |
| AT4G26700 | Encodes a member of the fimbrin family. Different members of the fimbrin/plastin family have diverged biochemically during evolution to generate either tight actin bundles or loose networks with distinct biochemical and biophysical properties. FIM4 generates both actin bundles and branched actin filaments whereas FIM5 only generates actin bundles. |
| AT1G07050 | FITNESS encodes a protein with a single CCT domain and belongs to the CCT motif family genes (CMF). FITNESS acts upstream JUB1 thereby controlling H2O2 levels. FITNESS has a role in cellular redox homeostasis controlling H2O2 levels, due to changes in enzymes, metabolites and transcripts related to ROS detoxification. |
| AT5G13840 | FIZZY-related 3;(source:Araport11) |
| AT5G46330 | Encodes a leucine-rich repeat serine/threonine protein kinase that is expressed ubiquitously. FLS2 is involved in MAP kinase signalling relay involved in innate immunity. Essential in the perception of flagellin, a potent elicitor of the defense response. FLS2 is directed for degradation by the bacterial ubiquitin ligase AvrPtoB. The mRNA is cell-to-cell mobile. |
| AT3G51240 | Encodes flavanone 3-hydroxylase that is coordinately expressed with chalcone synthase and chalcone isomerases and is involved in flavonoid biosynthesis. Not responsive to auxin or ethylene stimulus (qRT-PCR). |
| AT1G68050 | Encodes FKF1, a flavin-binding kelch repeat F box protein, is clock-controlled, regulates transition to flowering. Forms a complex with GI on the CO promoter to regulate CO expression. |
| AT5G54500 | Encodes a flavin mononucleotide-binding flavodoxin-like quinone reductase that is a primary auxin-response gene. |
| AT5G63590 | flavonol synthase 3;(source:Araport11) |
| AT5G63595 | flavonol synthase 4;(source:Araport11) |
| AT5G63600 | encodes a protein whose sequence is similar to flavonol synthase |
| AT5G64870 | Belongs to the group of plant flotillins, which are plasma membrane proteins. Flot3 is found in membrane nanodomains. |
| AT3G19980 | Encodes catalytic subunit of serine/threonine protein phosphatase 2A. It can associate with phytochromes A and B in vitro. Mutant plants display an accelerated flowering phenotype.Acts antagonistically to SnRK2 to regulate ABI5 phosphorylation. It inteacts with NRP which results in tethering to endosomes leading to its degradation. |
| AT4G09180 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G51140 | Encodes a basic helix-loop-helix-type transcription factor involved in photoperiodism flowering. Binds to the E-box cis-element in the CONSTANS (CO) promoter to regulate flowering. Interacts with CFL1 and along with CFLAP2 negatively regulates cuticle development. Binds to the potassium channel gene KAT1 as a dimer. The DNA-binding capacity is inhibited in response to ABA through phosphorylation-dependent monomerization. |
| AT4G16280 | Involved in the promotion of the transition of the vegetative meristem to reproductive development. Four forms of the protein (alpha, beta, delta and gamma) are produced by alternative splicing. Involved in RNA-mediated chromatin silencing. At one point it was believed to act as an abscisic acid receptor but the paper describing that function was retracted. |
| AT2G41705 | Encodes a fluoride export protein. |
| AT3G14750 | structural maintenance of chromosomes domain protein;(source:Araport11) |
| AT5G43870 | FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT4G14740 | FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT4G17350 | FORKED-LIKE family member, part of Group 3 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT5G47440 | FORKED-LIKE family member, part of Group 3 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT5G57770 | FORKED-LIKE family member, part of Group 2 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT5G14780 | Encodes a NAD-dependent formate dehydrogenase. |
| AT1G70140 | Encodes a group I formin. Binds to F-actin barbed ends. Has severing actin filaments activity. Binds profilin. Involved in the initiation and tip growth of root hairs through regulation of actin cytoskeleton. |
| AT5G48360 | Actin-binding FH2 (formin homology 2) family protein;(source:Araport11) |
| AT5G67470 | formin homolog 6;(source:Araport11) |
| AT1G59910 | Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. |
| AT1G34260 | Encodes a protein that is predicted to act as a phosphatidylinositol-3P 5-kinase, but, because it lacks a FYVE domain, it is unlikely to be efficiently targeted to membranes containing the porposed phosphatidylinositol-3P substrate. Therefore, its molecular function remains unknown. The mRNA is cell-to-cell mobile. |
| AT3G14270 | Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant. |
| AT1G71010 | Encodes a protein that is predicted to act as a phosphatidylinositol-3P 5-kinase, but, because it lacks a FYVE domain, it is unlikely to be efficiently targeted to membranes containing the proposed phosphatidylinositol-3P substrate. Therefore, its molecular function remains unknown. The mRNA is cell-to-cell mobile. |
| AT4G31380 | encodes a small protein with unknown function and is similar to flower promoting factor 1. This gene is not expressed in apical meristem after floral induction but is expressed in roots, flowers, and in low abundance, leaves. |
| AT5G22940 | Homolog of FRA8 (AT2G28110), a member of a member of glycosyltransferase family 47; exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. |
| AT2G28110 | Homolog to AT5G22940, a member of glycosyltransferase family 47 that is involved in secondary cell wall biosynthesis. It exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. Protein has a domain that shares significant similarity with the pfam03016 domain. It is expressed specifically in developing vessels and fiber cells, and FRA8 is targeted to Golgi. Mutants have irregular xylem formation, reduced cellulose levels and plants are smaller than normal siblings. |
| AT5G01100 | O-fucosyltransferase family protein;(source:Araport11) |
| AT4G00650 | Encodes a major determinant of natural variation in Arabidopsis flowering time. Dominant alleles of FRI confer a vernalization requirement causing plants to overwinter vegetatively. Many early flowering accessions carry loss-of-function fri alleles .Twenty distinct haplotypes that contain non-functional FRI alleles have been identified and the distribution analyzed in over 190 accessions. The common lab strains- Col and Ler each carry loss of function mutations in FRI. |
| AT1G31814 | family member of FRI-related genes that is required for the winter-annual habit. Genbank accession BK004885 |
| AT5G51830 | Encodes one of the several Arabidopsis fructokinases. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). Important for seed oil accumulation and vascular development. |
| AT2G31390 | Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). |
| AT1G07110 | Encodes the bifunctional enzyme fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase. |
| AT4G26530 | Aldolase superfamily protein;(source:Araport11) |
| AT2G36460 | Aldolase superfamily protein;(source:Araport11) |
| AT3G52930 | Aldolase superfamily protein;(source:Araport11) |
| AT1G07510 | encodes an FtsH protease that is localized to the mitochondrion |
| AT2G29080 | encodes an FtsH protease that is localized to the mitochondrion |
| AT5G58870 | encodes an FtsH protease that is localized to the chloroplast |
| AT5G02160 | Zinc-finger domain containing protein involved in abiotic stress response. Possesses an N-terminal transit peptide followed by a hydrophobic domain and a zinc-finger domain. Despite the presence of a zinc-finger domain (C4-type) with two CXXCXGXG conserved repeats, characteristic of DNAJ protein, the conserved J domain is absent in FIP. Interacts with FtsH5. Gene expression levels are reduced and negatively regulates stress response genes during stress conditions. |
| AT1G17220 | Encodes a chloroplast localized protein with similarity to translation initiation factor 2. Can complement loss of INFB in E.coli suggesting FUG1 does function as a translation initiation factor in vivo. Identified as a suppressor of the leaf variegation mutant var2-6. Suppression is only seen in hypomorphs as complete loss of function alleles are embryo lethal. The mRNA is cell-to-cell mobile. |
| AT1G14080 | Encodes an alpha-(1,2)-fucosyltransferase. |
| AT1G14100 | member of Glycosyltransferase Family- 37. FUT8 was previously associated to AT1G14110 |
| AT4G05120 | Encodes an equilibrative nucleoside transporter AtENT3. Mutations of this locus allow mutants to grow on uridine analogue fluorouridine. |
| AT3G16700 | Fumarylacetoacetate hydrolase homolog. |
| AT4G24740 | a LAMMER-type protein kinase that co-precipitates with serine/arginine-rich (SR) proteins in vitro, interaction modulated by phosphorylation of the proteins. |
| AT3G61140 | Represses photomorphogenesis and induces skotomorphogenesis in the dark. Component of the nuclear-localized COP9 complex. Mutants display striking purple coloration due to anthocyanin accumulation in their cotyledons, first become defective during embryogenesis and exhibit limited seedling development. |
| AT3G13550 | Encodes a protein similar to ubiquitin-conjugating enzyme (E2) variant proteins (UEV); lacks catalytic cysteine residue found in ubiquitin-conjugating enzyme E2. Represses photomorphogenesis and induces skotomorphogenesis in the dark. |
| AT4G36730 | member of a gene family encoding basic leucine zipper proteins (GBFs) which bind the G-box |
| AT4G01120 | bZIP (basic leucine zipper) transcription factor that binds to the G-box regulatory element found in many plant promoters. GBF2 nuclear localization is increased by blue light |
| AT2G46270 | encodes a bZIP G-box binding protein whose expression is induced by ABA. It has been shown to bind to Adh that contains the G-box and is induced by cold and water deprivation. GBF3 has been shown to be expressed mostly in the root and dark-grown leaves. GBF3 can act as homodimers and as heterodimers with GFB1, GBF2 and GBF4. In addition, GBF3!?s DNA binding activity is enhanced by GIP1, GPRI1 and GPRI2. |
| AT4G34590 | Encodes a basic domain leucine zipper (bZip) transcription factor bZIP11. Translation is repressed by sucrose. Directly regulates gene expression of ASN1 and ProDH2, which are enzyme-coding genes involved in amino acid metabolism. Susceptibility factor during Pseudomonas syringae infection. |
| AT3G63010 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. The mRNA is cell-to-cell mobile. |
| AT5G27320 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. |
| AT1G74670 | Gibberellin-regulated family protein;(source:Araport11) |
| AT2G33570 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT5G44670 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT4G20170 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT1G56600 | GolS2 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS2 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS2 have increased tolerance to salt, chilling, and high-light stress. |
| AT1G09350 | Predicted to encode a galactinol synthase |
| AT1G60450 | Predicted to encode a galactinol synthase. |
| AT5G14470 | GHMP kinase family protein;(source:Araport11) |
| AT3G53950 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT1G75620 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT1G14430 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT5G19580 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT1G26810 | Encodes a protein with β1,3-galactosyltransferase activity involved in the biosynthesis of the Lewis a epitope of certain glycoproteins. |
| AT1G06780 | Encodes a protein with putative galacturonosyltransferase activity. Required for synthesis of native homogalacturonan in growing pollen tubes; critical role in pollen tube growh and male fertility. |
| AT3G28340 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT3G50760 | Encodes a protein with putative galacturonosyltransferase activity. The mRNA is cell-to-cell mobile. |
| AT1G02720 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT4G02130 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT3G62660 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT1G19580 | Encodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex. |
| AT3G52115 | Induced in response to ionizing radiation, shows basal expression in mitotically active cells and high expression in endoreduplicating cells. May be involved in DNA damage-induced growth arrest. Protein sequence contains a PEST destruction box. |
| AT2G33040 | gamma subunit of Mt ATP synthase;(source:Araport11) |
| AT2G36830 | Encodes a tonoplast intrinsic protein, which functions as water channel. It has also been shown to be able to facilitate the transport of urea and hydrogen peroxide. Highly expressed in vascular tissues of the root, stem, cauline leaves and flowers but not in the apical meristems. The mRNA is cell-to-cell mobile. |
| AT1G23900 | Encodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane. |
| AT1G78660 | The Arabidopsis protein AtGGH1 is a gamma-glutamyl hydrolase cleaving pentaglutamates to yield di- and triglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. |
| AT1G78680 | The Arabidopsis protein AtGGH2 is a gamma-glutamyl hydrolase acting specifically on monoglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. |
| AT1G78670 | gamma-glutamyl hydrolase 3;(source:Araport11) |
| AT4G30530 | Encodes a gamma-glutamyl peptidase, outside the GGT family, that can hydrolyze gamma-glutamyl peptide bonds. The mRNA is cell-to-cell mobile. |
| AT4G39650 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in the apoplast of young siliques (within the ovules of the carpel) and is involved in the degradation of glutathione. The encoded enzyme also acts as part of a GSH pumping gamma-glutamyl cycle in this tissue and may also be involved in gamma-glutamyl amino acid formation. |
| AT4G29210 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in the vacuole and is most active in roots. The encoded enzyme is involved in the initial degradation of glutathione conjugates in this cell compartment. It is also induced by xenobiotics and contributes to xenobiotics metabolism. Note that conflicting nomenclature exists in the literature: At4g29210 is named as GGT3 in Plant J. 2007 Mar 49(5):878-88; At4g29210 is named as GGT4 and At1g69820 as GGT3 in Plant Physiol. 2007 Aug 144(4):1715-32. |
| AT5G44700 | Encodes GASSHO2 (GSO2), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO2 and a homolog GSO1 (At4g20140) are required for the formation of a normal epidermal surface during embryogenesis. |
| AT4G20140 | Encodes GASSHO1 (GSO1), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO1 and a homolog GSO2 (At5g44700) are required for the formation of a normal epidermal surface during embryogenesis. Necessary for localizing CASPARIAN STRIP DOMAIN PROTEINS (CASPs) - major players of endodermal differentiation - into an uninterrupted, ring-like domain. |
| AT5G15230 | Encodes gibberellin-regulated protein GASA4. Promotes GA responses and exhibits redox activity. |
| AT3G02885 | GASA5, is involved in the regulation of seedling thermotolerance. |
| AT3G24050 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT5G49300 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT3G16870 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT5G66320 | Encodes GATA transcription factor gene GNC, involved in regulating carbon and nitrogen metabolism. Expression occurs in aerial tissue at an early stage of development and is inducible by nitrate. |
| AT5G56860 | Encodes a member of the GATA factor family of zinc finger transcription factors. Modulate chlorophyll biosynthesis and glutamate synthase (GLU1/Fd-GOGAT) expression. |
| AT4G16141 | GATA type zinc finger transcription factor family protein;(source:Araport11) |
| AT2G20570 | Encodes GLK1, Golden2-like 1, one of a pair of partially redundant nuclear transcription factors that regulate chloroplast development in a cell-autonomous manner. GLK2, Golden2-like 2, is encoded by At5g44190. GLK1 and GLK2 regulate the expression of the photosynthetic apparatus. GLK1 is also a member of the GARP transcription factor family. |
| AT4G19985 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT2G06025 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT4G28030 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT5G65280 | Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor. Loss of function mutations in GCL1 show no ABA response defects based on assays of seed germination and seedling development.GCL1 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase. |
| AT2G20770 | Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor.GCL2 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase. |
| AT5G40990 | Component of plant resistance. Contains lipase signature motif and GDSL domain. Directly interferes with the fungal infection process by acting on fungal cell walls through its action as a antimicrobial compound. Critical component for both local and systemic resistance responses in the incompatible interaction with Alternaria brassicicola in the ethylene-dependent pathway. |
| AT1G53940 | Encodes a lipase, has in vitro lipase activity with p-nitrophenyl acetate and p-nitrophenyl butyrate, gene expression induced by hormones, negatively regulates auxin signaling, involved in disease resistance |
| AT4G10950 | GDSL-type esterase/lipase. Required for pollen development. |
| AT2G36340 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT4G09000 | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available. |
| AT1G26480 | 14-3-3 protein GF14iota (grf12) |
| AT1G78300 | G-box binding factor GF14 omega encoding a 14-3-3 protein The mRNA is cell-to-cell mobile. |
| AT5G65430 | member of 14-3-3 proteins. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 |
| AT4G36810 | Encodes a protein with geranylgeranyl pyrophosphate synthase activity involved in isoprenoid biosynthesis. The enzyme appears to be targeted to the chloroplast in epidermal cells and guard cells of leaves, and in etioplasts in roots. The mRNA is cell-to-cell mobile. |
| AT1G72610 | germin-like protein (GLP1) |
| AT1G09560 | Encodes a plasodesmata-located protein involved in regulating primary root growth by controlling phloem-mediated allocation of resources between the primary and lateral root meristems. The mRNA is cell-to-cell mobile. |
| AT3G05930 | germin-like protein (GLP8) |
| AT1G35160 | GF14 protein phi chain member of 14-3-3 protein family. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 The mRNA is cell-to-cell mobile. |
| AT1G14920 | Similar to a putative transcription factor and transcriptional coactivators. Repressor of GA responses and involved in gibberellic acid mediated signaling. Member of the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. GAI may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. |
| AT1G47990 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins. AtGA2OX4 expression is responsive to cytokinin and KNOX activities. |
| AT1G02400 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins but not C20 gibberellins. |
| AT4G21200 | Encodes a protein with gibberellin 2-oxidase activity which acts specifically on C-20 gibberellins. |
| AT5G51810 | Encodes gibberellin 20-oxidase. Involved in gibberellin biosynthesis. Up-regulated by far red light in elongating petioles. Not regulated by a circadian clock. Mutation of GA20ox2 delays flowering. |
| AT1G15550 | Involved in later steps of the gibberellic acid biosynthetic pathway. Activated by AGAMOUS in a cal-1, ap1-1 background. Deletion of 208 bp from -1016 to -809 (Δ-808) resulted in loss of GA-negative feedback (this sequence, which contains a 43-bp sequence GNFEI, was shown to be sufficient for GA-negative feedback). |
| AT1G22770 | Together with CONSTANTS (CO) and FLOWERING LOCUS T (FT), GIGANTEA promotes flowering under long days in a circadian clock-controlled flowering pathway. GI acts earlier than CO and FT in the pathway by increasing CO and FT mRNA abundance. Located in the nucleus. Regulates several developmental processes, including photoperiod-mediated flowering, phytochrome B signaling, circadian clock, carbohydrate metabolism, and cold stress response. The gene's transcription is controlled by the circadian clock and it is post-transcriptionally regulated by light and dark. Forms a complex with FKF1 on the CO promoter to regulate CO expression. The mRNA is cell-to-cell mobile. |
| AT1G79840 | Glabra 2, a homeodomain protein affects epidermal cell identity including trichomes, root hairs, and seed coat. It also down-regulates seed oil content. Expressed in atrichoblasts and required to suppress root hair development. Also expressed abundantly during early seed development. Directly regulated by WER. |
| AT2G37585 | Encodes GlcAT14C. Has glucuronosyltransferase activity adding glucuronic acid residues to beta-1,3- and beta-1,6-linked galactans. |
| AT4G34740 | Encodes glutamine 5-phosphoribosylpyrophosphate amidotransferase. Mutants are deficient in leaf, but not cotyledon, plastid and palisade cell development. Mutants exhibit defective chloroplast development under non-low light, suggesting that the defect in chloroplast development is caused by photo-oxidative damage. Plays role in differential development of vascular-associated cells. Demonstrates a cell-specific difference in chloroplast development.Mutant leaves are highly reticulate with a green vascular pattern. |
| AT5G10550 | This gene is predicted to encode a bromodomain-containing protein. A plant line expressing RNAi constructs targeted against GTE7 shows some resistance to agrobacterium-mediated root transformation. |
| AT1G06230 | This gene is predicted to encode a bromodomain-containing protein. Plant lines expressing RNAi constructs targeted against GTE4 show some resistance to agrobacterium-mediated root transformation. |
| AT3G27260 | Kinase like protein with similarity to yeast BDF1 and human RING3 protein, which have two bromodomains GTE8 has a single bromodomain |
| AT4G04970 | encodes a gene similar to callose synthase The mRNA is cell-to-cell mobile. |
| AT3G59100 | encodes a protein similar to callose synthase |
| AT4G03550 | Encodes a callose synthase that is required for wound and papillary callose formation in response to fungal pathogens Erysiphe and Blumeria. Mutants are resistant to P. parasitica and exhibit an exaggerated PR1 response.Contributes to PAMP-induced basal defense. The mRNA is cell-to-cell mobile. |
| AT2G36850 | Encodes GSL8, a member of the Glucan Synthase-Like (GSL) family believed to be involved in the synthesis of the cell wall component callose. GSL8 is required for male gametophyte development and plant growth. Has a role in entry of microspores into mitosis. Also refer to GSL10 (At3g07160). |
| AT5G54800 | Encodes glucose6-Phosphate/phosphate transporter 1. Essential for pollen maturation and embryo sac development. The mRNA is cell-to-cell mobile. |
| AT1G70090 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT5G07830 | Belongs to the plant glycoside hydrolase family 79. Encodes a protein with several posttranslational modification sites including O-β-GlcNAc attachment sites and serine-, threonine- and tyrosine-phosphorylation sites, suggesting that this protein is extensively modified posttranslationally. The protein is predicted (WoLF PSORT program) to be membrane-associated. It is involved in cell elongation. The mRNA is cell-to-cell mobile. |
| AT5G34940 | The protein is predicted (WoLF PSORT program) to be membrane-associated. |
| AT3G01640 | AtGlcAK is a sugar kinase able to phosphorylate D-GlcA to D-GlcA-1-phosphate in the presence of ATP. |
| AT1G33800 | Encodes a glucuronoxylan(GX)-specific 4-O-methyltransferase responsible for methylating GlcA residues in GX. Reduced methylation of GX ingxmt1-1 plants is correlated with altered lignin composition. The mRNA is cell-to-cell mobile. |
| AT1G65960 | glutamate decarboxylase (GAD2) The mRNA is cell-to-cell mobile. |
| AT2G32390 | Encodes a ionotropic glutamate receptor ortholog, a member of a putative ligand-gated ion channel subunit family. |
| AT5G48410 | member of Putative ligand-gated ion channel subunit family |
| AT4G31710 | member of Putative ligand-gated ion channel subunit family |
| AT1G42540 | member of Putative ligand-gated ion channel subunit family |
| AT2G32400 | Glr5 |
| AT5G04140 | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation. The mRNA is cell-to-cell mobile. |
| AT2G41220 | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression is most abundant in root. The mRNA is cell-to-cell mobile. |
| AT5G63570 | Encodes a protein with homology to glutamate-1-semialdehyde 2,1-aminomutase catalyzing the conversion of glutamate-1-semialdehyde (GSA) into 5-amino levulinate. The expression of this gene was demonstrated to be light-induced. The mRNA is cell-to-cell mobile. |
| AT1G15040 | Encodes a nitrogen regulated putative glutamine amidotransferase that represses shoot branching. |
| AT4G25760 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
| AT5G37600 | encodes a cytosolic glutamine synthetase, the enzyme has high affinity with substrate ammonium |
| AT3G17820 | encodes a cytosolic glutamine synthetase, the enzyme has low affinity with substrate ammonium The mRNA is cell-to-cell mobile. |
| AT1G48470 | Encodes cytosolic glutamine synthase isozyme. Expression of mRNA is not detectable in roots. |
| AT3G47340 | encodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT1G10270 | glutamine-rich protein 23;(source:Araport11) |
| AT4G28730 | Encodes a glutaredoxin GrxC5. GrxC5 exists as two forms when expressed in Escherichia coli. The monomeric apoprotein possesses deglutathionylation activity mediating the recycling of plastidial methionine sulfoxide reductase B1 and peroxiredoxin IIE, whereas the dimeric holoprotein incorporates a [2Fe-2S] cluster. |
| AT2G25080 | Encodes glutathione peroxidase. The mRNA is cell-to-cell mobile. |
| AT2G31570 | glutathione peroxidase GPx |
| AT2G43350 | Glutathione peroxidase. Functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses. Interacts with ABI2 and ABI1. |
| AT1G49860 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). The mRNA is cell-to-cell mobile. |
| AT2G30870 | early dehydration-induced gene ERD13 homologous to tobacco and maize glutathione S-transferases. Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002) |
| AT4G02520 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
| AT2G47730 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G27130 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). GSTU13 acts in the pathogen triggered pathway for indole glucosinolate metabolisms that involves also PENETRATION2 myrosinase. It is likely the enzyme that conjugates GSH with unstable indol-3-ylmethyl-ITCs formed upon PEN2-mediated IG hydrolysis, particularly in the branch of this pathway in which 4-substituted IGs are processed. |
| AT1G59700 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). The mRNA is cell-to-cell mobile. |
| AT1G78380 | Encodes a glutathione transferase that is a member of Tau GST gene family. Expression is induced by drought stress, oxidative stress, and high doses of auxin and cytokinin. naming convention according to Wagner et al. (2002) The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
| AT3G24170 | Encodes a cytosolic glutathione reductase. |
| AT1G79530 | Encodes one of the chloroplast/plastid localized GAPDH isoforms (GAPCp1/At1g79530 and GAPCp2/At1g16300). gapcp double mutants display a drastic phenotype of arrested root development, dwarfism and sterility. GAPCps are important for the synthesis of serine in roots. |
| AT1G80380 | encodes a glycerate kinase which catalyzes the last step of photorespiration C2 cycle. |
| AT4G25840 | glycerol-3-phosphatase 1;(source:Araport11) |
| AT5G60620 | Glycerol-3-phosphate acyltransferase localized to the ER. Similar to mammalian cells involved in storage oil formation. ER-localized GPAT enzyme responsible for plant membrane lipid and oil biosynthesis. |
| AT1G30560 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). |
| AT1G02390 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT4G01950 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT5G41080 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
| AT5G17650 | glycine/proline-rich protein;(source:Araport11) |
| AT4G33010 | glycine decarboxylase P-protein 1;(source:Araport11) |
| AT4G38680 | Encodes a glycine-rich protein that binds nucleic acids and promotes DNA melting. Its transcript and protein levels are up-regulated in response to cold treatment with protein levels peaking earlier in shoots (~10-14 days) than in roots (~21 days). It is normally expressed in meristematic regions and developing tissues where cell division occurs. RNAi and antisense lines with lower levels of CSP2/GRP2 transcripts flower earlier than wild type plants and have some defects in anther and seed development. |
| AT2G22660 | Encodes a member of a family of DUF1399 domain containing proteins. GRDP1 is involved in germination and response to ABA. Loss of function mutants have reduced germination in the presence of osmotic stressors. |
| AT2G21060 | Glycine-rich protein (AtGRP2b). Also named as CSP4 (cold shock domain protein 4) containing a well conserved cold shock domain (CSD) and glycine-rich motifs interspersed by two retroviral-like CCHC zinc fingers. AtCSP4 is expressed in all tissues but accumulates in reproductive tissues and those undergoing cell divisions. Overexpression of AtCSP4 reduces silique length and induces embryo lethality. |
| AT2G05520 | Encodes a glycine-rich protein that is expressed mainly in stems and leaves. AtGRP3 functions in root size determination during development and in Al stress. mRNA levels are upregulated in response to ABA, salicylic acid and ethylene but downregulated in response to desiccation. The mRNA is cell-to-cell mobile. |
| AT2G16260 | pseudogene of glycine-rich RNA-binding protein |
| AT3G14420 | Encodes a glycolate oxidase that modulates reactive oxygen species-mediated signal transduction during nonhost resistance. The mRNA is cell-to-cell mobile. |
| AT3G14415 | Encodes a glycolate oxidase that modulates reactive oxygen species-mediated signal transduction during nonhost resistance. The mRNA is cell-to-cell mobile. |
| AT2G33470 | glycolipid transfer protein 1;(source:Araport11) |
| AT1G21360 | glycolipid transfer protein 2;(source:Araport11) |
| AT3G21260 | Glycolipid transfer protein (GLTP) family protein;(source:Araport11) |
| AT5G49720 | Encodes a membrane-bound endo-1,4-beta-D-glucanase, involved in cellulose biosynthesis. Loss-of-function mutants have severe cellulose-deficient phenotypes. During cell elongation, KOR1 is associated with Golgi apparatus and early endosome. Inhibition of cellulose biosynthesis promoted a redistribution of KOR1 in subcellular locations. These observations suggest that deposition of cellulose involves the intracellular cycling of KOR1. |
| AT1G70710 | endo-1,4-beta-glucanase. Involved in cell elongation. |
| AT4G39010 | Cellulase involved in cell wall modification during valve dehiscence. |
| AT1G75680 | glycosyl hydrolase 9B7;(source:Araport11) |
| AT2G32990 | glycosyl hydrolase 9B8;(source:Araport11) |
| AT1G64390 | glycosyl hydrolase 9C2;(source:Araport11) |
| AT2G44290 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G22570 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G14815 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G18280 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G70250 | Encodes a Protease inhibitor/seed storage/LTP family protein. |
| AT1G73550 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT5G62220 | Encodes a Golgi apparatus-localized galactosyltransferase involved in galactosyl-substitution of xyloglucan at position 2. |
| AT4G37690 | Unlike its close paralog MUCI10 (At2g22900), GT6 is not required for the biosynthesis of seed coat mucilage. GT6 is preferentially expressed in sub-epidermal cell layers of the seed coat. |
| AT1G32930 | Galactosyltransferase family protein;(source:Araport11) |
| AT2G31350 | Encodes a mitochondrial glyoxalase 2 that can accommodate a number of different metal centers and with the predominant metal center being Fe(III)Zn(II). |
| AT1G11840 | Encodes Ni+ dependent glyoxalase I homolog ATGLX1. |
| AT5G41650 | Vicinal oxygen chelate (VOC) superfamily member. Responds to NaCl stress. |
| AT5G57040 | Vicinal oxygen chelate (VOC) superfamily member. Responds to NaCl,drought and high light stress. |
| AT2G32090 | Lactoylglutathione lyase / glyoxalase I family protein;(source:Araport11) |
| AT1G53580 | Mononuclear Fe(II)-containing member of the b-lactamase fold superfamily. ETHE1 is homodimeric in solution, exhibits low-level esterase activity, and specifically binds a single Fe(II) atom in the active site. |
| AT1G15380 | Glyoxalase which affects ABA?JA crosstalk. |
| AT3G25530 | Encodes gamma-hydroxybutyrate dehydrogenase (AtGHBDH). Contains a NADP-binding domain. GHBDH is proposed to function in oxidative stress tolerance. |
| AT1G13980 | Encodes a GDP/GTP exchange factor for small G-proteins of the ADP ribosylation factor (RAF) class, and as regulator of intracellular trafficking. Homologous to Sec7p and YEC2 from yeast. Involved in the specification of apical-basal pattern formation. Essential for cell division, expansion and adhesion. It appears that heteotypic binding between the DCB and C-terminal domains of two GNOM proteins is required for membrane association, however, GNOM appears to exist predominantly as a heterodimer formed through DCB-DCB interactions. BFA inhibits GNOM trafficking and BFA resistant lines are more resistant to cold stress. |
| AT5G44190 | Encodes GLK2, Golden2-like 2, one of a pair of partially redundant nuclear transcription factors that regulate chloroplast development in a cell-autonomous manner. GLK1, Golden2-like 1, is encoded by At2g20570. GLK1 and GLK2 regulate the expression of the photosynthetic apparatus. |
| AT5G19980 | Encodes a Golgi-localized nucleotide-sugar transporter. |
| AT1G21870 | Encodes a Golgi-localized nucleotide-sugar transporter. |
| AT2G19950 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC1 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (558-715 aa) portion of the protein. |
| AT1G18190 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC2 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (508?668 aa) portion of the protein. |
| AT1G50900 | Encodes GDC1 (Grana Deficient Chloroplast 1), an ankyrin domain containing protein required fro chloroplast thylakoid grana formation. The mRNA is cell-to-cell mobile. |
| AT1G55325 | Encodes the Arabidopsis homolog of the transcriptional regulator MED13, is dynamically expressed during embryogenesis and regulates both developmental timing and the radial pattern formation. |
| AT1G32900 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G28130 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. |
| AT2G22840 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower |
| AT2G36400 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower. |
| AT4G24150 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in shoot and flower. |
| AT1G06390 | encodes a GSK3/shaggy-like protein kinase. Gene expression is induced by NaCl and ABA but not KCl, suggesting that this gene may be involved in response to osmotic stress. This protein can interact with the BZR1 protein involved in brassinosteroid-mediated signaling in a Y2H assay and promotes BZR1 phosphorylation in protoplasts. |
| AT1G13450 | Encodes GT-1, a plant transcription factor that binds to one of the cis-acting elements, BoxII, which resides within the upstream promoter region of light-responsive genes. GT-1 was assumed to act as a molecular switch modulated through Ca(2+)-dependent phosphorylation/dephosphorylation in response to light signals. |
| AT1G33240 | Encodes a plant transcriptional activator that contains two separate, but similar, trihelix DNA-binding domains, similar to GT-2. Gene is expressed in all aerial parts of the plant, with higher level of expression in siliques. At-GTL2 was thought to be a duplicated copy of this gene but is likely to be a cloning artefact, the result of a chimeric clone. Regulates ploidy-dependent cell growth in trichome. |
| AT5G28300 | Encodes a Ca(2+)-dependent CaM-binding protein. AtGT2L specifically targets the nucleus and possesses both transcriptional activation and DNA-binding abilities, implicating its function as a nuclear transcription factor. |
| AT5G64300 | encodes GTP cyclohydrolase II that can functionally complement E. coli mutant deficient in this gene. It also has 3,4-dihydroxy-2-butanone-4-phosphate synthase activity which makes it a bifunctional enzyme involved in the formation of the pyrimidine and of the carbohydrate from GTP and ribulose-5-phosphate, respectively The mRNA is cell-to-cell mobile. |
| AT3G57550 | guanylate kinase |
| AT2G41880 | Guanylate kinase. Involved in nucleotide metabolism. |
| AT1G03830 | Assembles liquid?liquid phase separation (LLPS)-driven condensates within the nucleus to protect against infection and autoimmunity. Pseudo-GTPase which sequesters catalytically active GBPL3 under basal conditions but is displaced by GBPL3 LLPS when it enters the nucleus following immune cues to drive the formation of unique membraneless organelles. |
| AT2G38840 | Guanylate-binding family protein;(source:Araport11) |
| AT4G16444 | GET1 membrane receptor homolog . ER localized protein that Interacts with GET3a and GET2 orthologs. Disruption of both genes results in a decreased membrane localization of the SNARE proteinSYP123 and defects in root hair elongation. |
| AT5G62670 | H[+]-ATPase 11;(source:Araport11) |
| AT4G30190 | Belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal domain. Its plasma membrane localization is light-dependent. |
| AT3G60330 | H[+]-ATPase 7;(source:Araport11) |
| AT1G17100 | Encodes a cytosolic heme binding protein(cHBP)that can reversibly bind tetrapyrroles including heme, protoporphyrin IX and Mg-protoporphyrin IX dimethyl ester with distinct binding affinities. |
| AT5G20140 | Encodes a haem-binding protein, HBP5. HBP5 binds haem and interacts with the haem oxygenase, HY1. Disrupting the binding of HBP5 to HY1 leads to oxidative stress. |
| AT1G28440 | HAESA-like 1;(source:Araport11) |
| AT5G65710 | Encodes a protein controlling the separation step of floral organ abscission.Necessary for pathogen-triggered leaf abscission. |
| AT2G45160 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
| AT4G00150 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
| AT5G56250 | hapless 8;(source:Araport11) |
| AT2G36450 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Ectopic overexpression of HRD increases the density of the root network and improves water and salt stress tolerance in Arabidopsis. Overexpression of HRD in rice causes an increase in plant biomass and drought resistance. |
| AT2G43920 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G61590 | F-box protein that is involved in some aspect of regulation of gene silencing by miRNA. Loss of function mutations have increased levels of some miRNAs. Its activity depends on the presence of functional F-box. |
| AT1G06840 | Homomultimers interact with cytoplasmic signaling molecule PBL27, resulting in herbivory resistance, in an ethylene-dependent manner. |
| AT5G10010 | myosin-H heavy protein;(source:Araport11) |
| AT5G02500 | Encodes a member of heat shock protein 70 family. Hsc70-1 negatively regulates the expression of Hsp101 through HsfA1d, HsfA1e and HsfA2. During non-HS condition, Hsc70-1 attenuates the activity of HsfAs and finally affects the expression of HsfA2 and Hsp101 genes. hsc70-1 mutant showed thermotolerance phenotype due to higher expression of Hsp101 and other HS inducible genes. |
| AT5G16820 | Encodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes. |
| AT5G12030 | Encodes a cytosolic small heat shock protein with chaperone activity that is induced by heat and osmotic stress and is also expressed late in seed development. |
| AT5G59720 | encodes a low molecular weight heat shock protein that contains the heat shock element in the promoter region. Expression is induced in response to heat shock. |
| AT1G11660 | heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
| AT3G07770 | HEAT SHOCK PROTEIN 89.1;(source:Araport11) |
| AT5G43840 | member of Heat Stress Transcription Factor (Hsf) family |
| AT3G22830 | member of Heat Stress Transcription Factor (Hsf) family |
| AT3G51910 | member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. |
| AT1G67970 | member of Heat Stress Transcription Factor (Hsf) family |
| AT5G62020 | member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. |
| AT3G24520 | member of Heat Stress Transcription Factor (Hsf) family |
| AT3G02990 | member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. |
| AT5G03720 | Member of Heat Stress Transcription Factor (Hsf) family. Expression is regulated by DREB2A and in turn HSFA3 regulates the expression of hsps Hsp18.1-CI and Hsp26.5-MII35S. Involved in establishing thermotolerence. |
| AT1G22990 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G35060 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT2G18196 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT2G36950 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G05220 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G05920 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G06130 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G24450 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G16380 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G19090 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G23000 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G30120 | encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc |
| AT2G19110 | Encodes a protein with similarity to Zn ATPase. Can rescue Zn deficiency in yeast and Cd resistance, suggesting a role in Zn and Cd transport. The mRNA is cell-to-cell mobile. |
| AT1G01490 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G67060 | Encodes a bHLH transcription factor that is involved in transmitting tract and stigma development and acts as a local modulator of auxin and cytokinin responses to control gynoecium development. HEC1 affects auxin transport by acting as a transcriptional regulator of PIN1 and PIN3. Inhibits thermomorphogenesis. |
| AT5G09750 | Encodes a bHLH transcription factor that is involved in transmitting tract and stigma development. |
| AT2G24150 | heptahelical transmembrane protein HHP3 |
| AT4G30850 | heptahelical transmembrane protein homologous to human adiponectin receptors and progestin receptors |
| AT3G46290 | Encodes HERCULES1 (HERK1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
| AT5G63620 | Encodes an oxidoreductase involved in transducing the perception of E-2-hexenal, which changes the redox status of the mitochondria. |
| AT4G29130 | Encodes a hexokinase (HXK1) in the plant glucose-signaling network. Functions as a glucose sensor to interrelate nutrient, light, and hormone signaling networks for controlling growth and development in response to the changing environment. |
| AT2G19860 | Encodes a protein with hexokinase activity (AtHXK2) and acts as a sensor for plant sugar responses. |
| AT1G50460 | Involved in glucose-ethylene crosstalk. |
| AT5G14570 | Encodes ATNRT2.7, a nitrate transporter that controls nitrate content in seeds. Expression is detected in reproductive organs and peaks in seeds. Localized to the vacuolar membrane. |
| AT5G62940 | HCA2 induces the formation of interfascicular cambium and regulates vascular tissue development in the aerial parts of the plant. Evidence from both gain of function and dominant negative alleles. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT3G15095 | Encodes HCF243 (high chlorophyll fluorescence), a chloroplast-localized protein involved in the D1 protein stability of the photosystem II complex1. |
| AT4G35250 | HCF244 is a member of the atypical short-chain dehydrogenase/reductase superfamily, a modified group, which has lost enzyme activity.HCF244 interacts with unknown partners in a 200-400 kD membrane associated complex. |
| AT3G17040 | It is a RNA tetratricopeptide repeat-containing protein required for normal processing of transcripts from the polycistronic chloroplast psbB-psbT-psbH-petB-petD operon coding for proteins of the photosystem II and cytochrome b6/f complexes. Localizes to the chloroplast membrane. Involved in regulating plastidial gene expression and biogenesis. It binds in the psbT?psbH intercistronic region and blocks the progression of 5′ → 3′ exoribonucleases, which defines the 5′ end of processed psbH transcripts and also stabilizes the downstream RNA segment. In addition, HCF107 binding remodels the structure of the psbH 5′ UTR in a way that can account for its ability to enhance psbH translation. |
| AT5G36170 | Required for normal processing of polycistronic plastidial transcripts |
| AT1G14900 | Encodes a protein belonging to the subgroup of HMGA (high mobility group A) proteins that interact with A/T-rich stretches of DNA. |
| AT1G48620 | This gene is predicted to encodes a histone H1/H5 family member. A plant line expressing an RNAi construct targeted against HON5 shows a reduced level of agrobacterium-mediated root transformation. |
| AT3G51880 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated. |
| AT3G24430 | Encodes chloroplast protein HCF101 (high chlorophyll fluorescence 101). Serves as a chloroplast scaffold protein that specifically assembles [4Fe-4S] clusters and transfers them to the chloroplast membrane and soluble target proteins. |
| AT2G30470 | HSI2 is a member of the ABI3 family of B3 domain proteins and functions as an active repressor of the Spo minimal promoter through the EAR motif. It contains a plant-specific B3 DNA-binding domain. It is expressed at similar levels in all organs. Treatment with 6% sucrose showed a slight increase in transcript levels after 24 h. No changes were observed after treatment with 50?M ABA. It is localized in the nucleus via a nuclear localization sequence located in the fourth conserved region of the C-terminal B3 domain. HSI2 is also an epigenetic repressor as it also contains functional plant homeodomain-like (PHD-L) and zinc-finger Cys- and Trp-containing (CW) domains associated with epigenetic regulation. The PHD-L domain of HSI2 is connected to promoting trimethylation of Lys-27 on histone 3 (H3K27me3), while the CW domain can bind directly to H3K4me3. Through these domains, HSI2 represses the seed maturation program during seed germination by repressing transcription of the core LAFL (LEC1, ABI3, FUS3, and LEC2) seed developmental transcriptional regulators. In developing A. thaliana embryos, HSI2 suppresses expression of a large number of genes, many identified as targets of FUS3. However, the absence of HSI2 had no effect on transcript levels of the LAFL regulators and the levels of measured metabolites and phytohormones (ABA, auxin, and JA derivatives) in developing Arabidopsis embryos. HSI2 likely fine-tunes seed maturation by repressing genes involved in early embryogenesis that are not required later for seed maturation and desiccation. |
| AT1G18370 | Encodes a kinesin HINKEL. Required for cytokinesis in pollen. Mutant has cytokinesis defects; seedling lethal. |
| AT3G56490 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
| AT5G35750 | Encodes histidine kinase AHK2. |
| AT1G80100 | AHP6 lacks the conserved histidine residue (Asn83 in AHP6b), which is required for phosphotransfer, present in the other AHPs. AHP6 does not appear to have phosphotransfer activity. Acts as an inhibitor of cytokinin signaling by interacting with the phosphorelay machinery. Expressed in developing protoxylem and associated pericycle cell files. Negative regulator of cytokinin signaling. Expression is down-regulated by cytokinins. There are two alternatively spliced genes for this locus, AHP6a and AHP6b, differing in the length of the first exon. In ahp6-2 seedlings, only the AHP6a transcript is present. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
| AT5G48545 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
| AT4G16566 | Encodes a protein that has an unexpected bifunctional capability in vitro. The purified enzyme has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) and ADP-sulfurylase activity (E.C. 2.7.7.5). The latter is activated at low pH. The enzyme can exert it phosphorylase activity on a range of related substrates in vitro, but it acts best with APS (adenosine 5'-phsophosulfate). This protein appears to function as a homodimer. |
| AT1G03430 | Encodes AHP5, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
| AT3G21510 | Encodes AHP1, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
| AT3G46100 | histidyl-tRNA synthetase |
| AT5G65350 | histone 3 11;(source:Araport11) |
| AT3G27360 | Histone superfamily protein;(source:Araport11) |
| AT4G40040 | Histone superfamily protein;(source:Araport11) |
| AT3G54610 | Encodes a histone acetyltransferase that plays a role in the determination of the embryonic root-shoot axis. It is also required to regulate the floral meristem activity by modulating the extent of expression of WUS and AG. In addition, it is involved in stem cuticular wax accumulation by modulating CER3 expression via H3K9/14 acetylation. In other eukaryotes, this protein is recruited to specific promoters by DNA binding transcription factors and is thought to promote transcription by acetylating the N-terminal tail of histone H3. The enzyme has indeed been shown to catalyse primarily the acetylation of H3 histone with only traces of H4 and H2A/B being acetylated. Non-acetylated H3 peptide or an H3 peptide that had been previously acetylated on K9 both serve as excellent substrates for HAG1-catalyzed acetylation. However, prior acetylation of H3 lysine 14 blocks radioactive acetylation of the peptide by HAG1. HAG1 is specific for histone H3 lysine 14. |
| AT5G56740 | Encodes an enzyme with histone acetyltransferase activity. Histone H4 is the primary substrate for the enzyme. Prior acetylation of lysine 12 of histone H4 reduces radioactive acetylation by HAG2. HAG2 acetylates histone H4 lysine 12. |
| AT5G64610 | Encodes an enzyme with histone acetyltransferase activity. HAM1 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM1. HAM1 acetylates histone H4 lysine 5. |
| AT4G33470 | Encodes HDA14, a member of the histone deacetylase family proteins that can deacetylate a-tubulin, associates with a/b-tubulin and is retained on GTP/taxol-stabilized microtubules, at least in part, by direct association with the PP2A-A2 subunit. The association of a histone deacetylase with PP2A suggests a direct link between protein phosphorylation and acetylation. Class II RPD3-like family HDAC member which controls negative responses to salinity stress. |
| AT5G03740 | HD2-type histone deacetylase HDAC. Involved in the ABA and stress responses. Mediates transcriptional repression via histone modification. |
| AT1G51060 | Encodes HTA10, a histone H2A protein. The mRNA is cell-to-cell mobile. |
| AT5G02560 | Encodes HTA12, a histone H2A protein. |
| AT5G27670 | Encodes HTA7, a histone H2A protein. |
| AT2G38810 | Encodes HTA8, a histone H2A protein. Loss of all H2A.Z (triple mutant with HTA9 and HTA11) results in a reduction in DNA methylation of transposons but not that of genes. Loss of H2A.Z causes misregulation of many genes involved in the response to developmental and environmental cues, and that these genes tend to have high levels of gene-body H2A.Z. |
| AT3G59960 | histone-lysine N-methyltransferase ASHH4;(source:Araport11) |
| AT3G01470 | Encodes a homeodomain leucine zipper class I (HD-Zip I) transcriptional activator involved in leaf and hypocotyl development. Its promoter is bound by PIF1 which likely regulates its expression. Its translation is regulated by a conserved upstream ORF (CPuORF33). |
| AT3G61890 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Loss of function mutant has abnormally shaped leaves and stems. |
| AT2G46680 | encodes a putative transcription factor that contains a homeodomain closely linked to a leucine zipper motif. Transcript is detected in all tissues examined. Is transcriptionally regulated in an ABA-dependent manner and may act in a signal transduction pathway which mediates a drought response. |
| AT4G32880 | member of homeodomain-leucine zipper family, acting as a differentiation-promoting transcription factor of the vascular meristems. |
| AT4G40060 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT4G16780 | Encodes a homeodomain-leucine zipper protein that is rapidly and strongly induced by changes in the ratio of red to far-red light. It is also involved in cell expansion and cell proliferation and in the response to auxin. The mRNA is cell-to-cell mobile. |
| AT3G01220 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Expressed during seed germination in the micropylar endosperm and in the root cap, and increases ABA sensitivity and seed dormancy when mutated. The mRNA is cell-to-cell mobile. |
| AT1G26960 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Participates in the gene regulatory network controlling root branching by mediating the regulation of LAX3 by ARF7/19. |
| AT5G39760 | Functions together with TZP in co-regulation of the expression of blue-light dependent transcriptional regulators. Coassociates with and regulates the expression of light-regulated loci as well as transcriptional regulators to shape plant development in response to environmental stimuli with targets in RNA processing factors as well as proteins involved in salt stress and ABA signaling, in addition to embryo development. Acts downstream of TZP action with regard to blue-light-regulated hypocotyl elongation. |
| AT2G18350 | homeobox protein 24;(source:Araport11) |
| AT3G28920 | homeobox protein 34;(source:Araport11) |
| AT5G65310 | Encodes a class I HDZip (homeodomain-leucine zipper) protein that is a positive regulator of ABA-responsiveness, mediating the inhibitory effect of ABA on growth during seedling establishment. |
| AT5G53980 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT1G27045 | Encodes ATHB54, a member of the homeodomain leucine zipper (HD-Zip) family protein. Please note that this locus was split from AT1G27050 in the TAIR10 genome release (2010). Affymetrix ATH1 Probe Set linked to symbol ATHB54 is in fact directed against the product of the AT1G27050 locus (the mRNA coding for the RNA-recognition-motif protein). |
| AT2G22430 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein that is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis. |
| AT5G46880 | homeobox-7;(source:Araport11) |
| AT3G60390 | Encodes homeobox protein HAT3. |
| AT2G44910 | Encodes a homeodomain protein whose expression displays a dependence on phyB for both red and far-red light response. Also involved in the shade avoidance syndrome. |
| AT3G61150 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT1G73360 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. It is involved in trichome branching. The transcription factor directly upregulates the expression of several cell-wall-loosening protein genes and reveals the important role that these target genes play in coordinating cell-wall extensibility with root development. |
| AT2G32370 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. Together with ATML1 and PDF2, it is involved in cotyledon development. |
| AT2G18950 | Encodes homogentisate phytyltransferase involved in tocopherol biosynthesis. Has impact on seed longevity and plays a role in the adaptation to low temperature stress, notably phloem loading. |
| AT2G18300 | DNA-binding bHLH protein involved in positive regulation of cell elongation and proliferation and, negative control of plant immunity.One component of PRE-IBH1-HBI1 tripartite module. |
| AT4G25540 | encodes a DNA mismatch repair homolog of human MutS gene, MSH6. There are four MutS genes in Arabidopsis, MSH2, MSH3, MSH6, and MSH7, which all act as heterodimers and bind to 51-mer duplexes. MSH2*MSH3 heterodimers bound 'insertion-deletion' DNA with three nucleotides (+AAG) or one nucleotide (+T) looped out much better than they bound DNA with a base/base mispair (T/G). |
| AT5G17560 | BolA-like family protein;(source:Araport11) |
| AT5G03160 | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast. |
| AT3G50450 | Homolog of RPW8 |
| AT4G22970 | Encodes a separase (ESP), homologous to human and mouse separase protein. Separase is a capase family protease required for the release of sister chromatid cohesion during meiosis and mitosis. Arabidopsis separase contains a predicted 2Fe2S-ferredoxin domain that is not present in the proteins of other organisms. Also contains a putative EF-hand calcium binding domain. Mutant seeds exhibited embryo arrest at the globular stage. The endosperm also exhibited a weak titan-like phenotype. Transgenic plants expressing AESP RNA interference (RNAi) from the meiosis-specific DMC1 promoter exhibited alterations in chromosome segregation during meiosis I and II that resulted in polyads containing from one to eight microspores. Plays an essential role in embryo development. Required for the removal of cohesin from meiotic chromosomes and establishment of meiotic nuclear domains. This gene was also identified through the rsw4 mutant. Lines carrying recessive, temperature-sensitive mutations exhibit reduced anisotropic growth at 30 degrees Celsius. Microtubules and cellulose microfibrils are not depleted or disoriented in the mutants at the restrictive temperature. |
| AT5G02410 | Encodes ALG10, an ER-resident alpha1,2-glucosyltransferase that is required for lipid-linked oligosaccharide biosynthesis and subsequently for normal leaf development and abiotic stress response. |
| AT3G56440 | yeast autophagy 18 D-like protein;(source:Araport11) |
| AT1G10030 | Encodes a protein that functions as a scaffolding platform for coassembling the sterol C4 demethylation enzyme complex. It also plays an essential role in the maintenance of polar auxin transport (PAT) by restricting the release and accumulation of 4-carboxy-4-methyl-24-methylenecycloartanol (CMMC), a PAT inhibitor. |
| AT4G04330 | Encodes a chloroplast thylakoid localized RbcX protein that acts as a chaperone in the folding of Rubisco. |
| AT3G57150 | Encodes a putative pseudouridine synthase (NAP57). |
| AT2G17265 | Encodes a homoserine kinase (HSK) which produces O-phospho-L-homoserine (HserP), a compound at the branching point of methionine and threonine biosynthesis. HSK is found in the stromal fraction of chloroplasts. Mutation of this gene results in higher level of the amino acid homoserine and resistance to downy mildew pathogen Hyaloperonospora arabidopsidis. |
| AT4G31750 | Encodes HopW1-1-Interacting protein 2 (WIN2). Interacts with the P. syringae effector HopW1-1. WIN2 has protein phosphatase activity. Modulates plant defenses against bacteria. Three WIN proteins are identified so far (WIN1: AT1G80600; WIN2: AT4G31750; WIN3: AT5G13320). |
| AT3G16360 | Encodes AHP4, a histidine-containing phosphotransmitter involved in Histidine (His)-to-Aspartate (Asp) phosphorelay signal transduction. AHP4 is one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
| AT1G25550 | Member of HHO/HRS GARP type transcriptional repressor family. Involved in Pi uptake and Pi starvation signaling. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
| AT5G10630 | Transcripts of this gene are alternatively spliced to encode either HBS1, a decoding factor translational GTPase, or SKI7, a component of the cytosolic RNA exosome. |
| AT2G06990 | Encodes a putative DExH-box RNA helicase that acts redundantly with HEN1, HUA1, and HUA2 in the specification of floral organ identity in the third whorl. |
| AT5G64390 | encodes a K homology (KH) domain-containing, putative RNA binding protein that interacts with HUA1, a CCCH zinc finger RNA binding protein in the nucleus. HEN4 acts redundantly with HUA1 and HUA2 in the specification of floral organ identity in the third whorl. The mRNA is cell-to-cell mobile. |
| AT5G08230 | HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. |
| AT3G49660 | Encodes a structural core component of a COMPASS-like H3K4 histone methylation complex. |
| AT4G02730 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G62490 | Part of the AtHVA22 family. Protein expression is ABA- and stress-inducible. |
| AT4G24960 | Homologous to a eukaryote specific ABA- and stress-inducible gene first isolated from barley. Groups in one subfamily with ATHVA22E. Along with other members of the ATHVA22 family, it may be involved in regulation of autophagy during development. The mRNA is cell-to-cell mobile. |
| AT1G75700 | HVA22-like protein G;(source:Araport11) |
| AT1G19950 | HVA22-like protein H (ATHVA22H);(source:Araport11) |
| AT3G24715 | HCR1 belongs to the B4 group of Raf-like MAPKKKs. It corresponds to a root hydraulic pressure QTL between Col-0 and Bur-0 accessions and appears to contribute to variation in root pressure in different haplotypes. It is involved in potassium-dependent response to hypoxia. |
| AT1G76490 | Encodes a 3-hydroxy-3-methylglutaryl coenzyme A reductase, which is involved in melavonate biosynthesis and performs the first committed step in isoprenoid biosynthesis. Expression is activated in dark in leaf tissue but not controlled by light in the root (confine The mRNA is cell-to-cell mobile. |
| AT5G48930 | At5g48930 has been shown to encode for the hydroxycinnamoyl-Coenzyme A shikimate/quinate hydroxycinnamoyltransferase (HCT) both synthesizing and catabolizing the hydroxycinnamoylesters (coumaroyl/caffeoyl shikimate and quinate) involved in the phenylpropanoid pathway. Influence on the accumulation of flavonoids which in turn inhibit auxin transport and reduce plant growth. The mRNA is cell-to-cell mobile. |
| AT4G11820 | Encodes a protein with hydroxymethylglutaryl-CoA synthase activity which was characterized by phenotypical complementation of the S. cerevisiae mutant. Involved in glucosinolate biosynthesis. |
| AT2G25260 | Hyp O-arabinosyltransferase-like protein;(source:Araport11) |
| AT1G68010 | Encodes hydroxypyruvate reductase. |
| AT1G12550 | Encodes a hydroxypyruvate reductase that reduces HP to glycerate and shows even more activity with glyoxylate, a more upstream intermediate of the photorespiratory cycle. It is likely targeted to the chloroplast where it could provide a compensatory bypass for the reduction of HP and glyoxylate within this compartment. Together with HPPR2 and TAT1 involved in the biosynthesis of pHPL from tyrosine. |
| AT3G01290 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT5G51570 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT1G13300 | Encodes a nuclear localized member of the GARP family of transcription factors. Involved in nitrate/phosphate signaling in roots. It is transcriptionally regulated by nitrate and post transcriptionally by phosphate and functions to integrate these two nutrient signaling pathways in the root. HRS1 and HHO2 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance. |
| AT4G26670 | Member of PRAT protein family which has a unique system for importing and exporting proteins from chloroplasts. Role in protein import into chloroplasts. |
| AT1G71750 | Encodes a protein with hypoxanthine-guanine-phosphoribosyltransferase activity. Unlike some related enzymes, it does not appear to act on xanthine in vitro. The enzyme catalyzes reactions occurring in both directions, but appears to prefer acting on guanine, followed by hypoxanthine, in vitro. The enzyme is likely to function in purine salvage pathways and appears to be important for seed germination. |
| AT3G27770 | plant/protein;(source:Araport11) |
| AT4G27450 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
| AT3G10020 | plant/protein;(source:Araport11) |
| AT3G10040 | Encodes HRA1 (HYPOXIA RESPONSE ATTENUATOR1), a low oxygen-inducible transcription factor. |
| AT3G03270 | HRU1 is a hypoxia induced universal stress protein. It exists as two splice variants with AT3G03270.2 , which contains a putative dimerization domain, the predominant transcript found under anoxia. It is induced by RAP2.12. Subcellular localization is dynamic; under anoxia the localization of HRU1 shifts from cytoplasm to the plasma membrane. |
| AT5G27760 | Hypoxia-responsive family protein;(source:Araport11) |
| AT5G55250 | Encodes an enzyme which specifically converts IAA to its methyl ester form MelIAA. This gene belongs to the family of carboxyl methyltransferases whose members catalyze the transfer of the methyl group from S-adenosyl-L-methionine to carboxylic acid-containing substrates to form small molecule methyl esters. Expression of TCP genes is downregulated in mutant iamt1-D. SABATH methyltransferase. |
| AT1G68100 | member of IAA-alanine resistance protein 1 |
| AT1G24180 | Arabidopsis thaliana pyruvate dehydrogenase E1a-like subunit. 81% identical to a previously characterized Arabidopsis mitochondrial PDH E1a-subunit, At1g59900. Serine 296 phosphorylation of IAR4 has critical function in root hair formation and root development. Changing Ser296 in IAR4 to Ala resulted in a phenotype intermediate between mutant and wild-type, while substitution to Asp was either lethal or caused an extreme dwarf phenotype. |
| AT5G56650 | encodes a protein similar to IAA conjugate hydrolases. Enzyme assays with purified GST-tagged protein shows some activity in vitro but too low to be physiologically significant. |
| AT1G44350 | encodes a protein similar to IAA amino acid conjugate hydrolase. |
| AT3G02875 | Hydrolyzes amino acid conjugates of the plant growth regulator indole-3-acetic acid (IAA), including IAA-Leu and IAA-Phe. Uses Mg and Co ions as cofactors. |
| AT5G54140 | encodes a protein similar to IAA amino acid conjugate hydrolase |
| AT4G30410 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT2G31580 | ICA1 is a nuclear localized member of the tRNA(His) guanylyl transferase superfamily. Loss of function alleles show increased sensitivity to growth at high temperatures defects in cell cycle progression and DNA repair. |
| AT2G43060 | ILI1 binding bHLH 1;(source:Araport11) |
| AT3G22425 | Encodes imidazoleglycerolphosphate dehydratase. |
| AT1G33970 | IAN9 is a member of a small family of proteins. It's expression is repressed upon pathogen infection and loss of function mutants show increased resistance to bacterial pathogens. |
| AT1G18670 | Encodes a cyclin-dependent kinase-like protein with a ser/thr protein kinase domain and an N-terminal myristoylation sequence. Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. |
| AT4G16143 | Protein interacts with Agrobacterium proteins VirD2 and VirE2. Is not individually essential for Agrobacterium-mediated root transformation, but when overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT1G09270 | Protein interacts with Agrobacterium proteins VirD2 and VirE2. |
| AT5G49310 | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT5G52000 | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. Target promoter of the male germline-specific transcription factor DUO1. |
| AT5G03070 | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT3G07610 | IBM1 likely encodes a protein with histone H3mK9 demethylation activity. It may preferentially demethylate H3mK9 at low-copy loci to protect them from silencing by nearby heterochromatin by preventing the spread of cytosine methylation. BONSAI (At1g73177) is hypermethylated in ibm1 mutants. ibm1 mutants have morphological defects that become apparent at the F3 generation, including small narrow leaves, arrested flower development, and faulty pollen development. These phenotypes cannot result solely from the BONSAI hypermethylation. Aberrant phenotypes in ibm1 mutants in both DNA methylation and plant development can be suppressed by mutations in the KYP H3K9 methyltransferase or the CMT3 non CG-cytosine methylase. |
| AT1G20870 | Encodes an anti-silencing factor that prevents gene repression and DNA hypermethylation. |
| AT3G12360 | Encodes a protein with an ankyrin motif and transmembrane domains that is involved in salt tolerance. Expressed throughout the plant and localized to the plasma membrane. Loss of function mutations show an increased tolerance to salt based on assaying seedling growth in the presence of salt. In the mutants, induction of genes required for production of reactive oxygen species is reduced suggesting that itn1 promotes ROS production. It interacts with RCN1 in vivo and may regulate its subcellular localization. The mRNA is cell-to-cell mobile. |
| AT5G66730 | C2H2-like zinc finger protein;(source:Araport11) |
| AT3G13810 | indeterminate(ID)-domain 11;(source:Araport11) |
| AT1G68130 | Encodes the longer of two splice variants of a transcription factor involved in regulating starch metabolism in response to cold. |
| AT2G02080 | C2H2 BIRD transcription factor family. |
| AT2G02070 | RAVEN is part of the network regulated by BLJUEJAY, JACKDAW, SACRECROW and SHORT-ROOT to regulate root tissue patterning through cell lineage specification and asymmetric cell division. RAVEN is directly activated by SHORT-ROOT and directly repressed by JACKDAW. |
| AT1G21100 | O-methyltransferase family protein;(source:Araport11) |
| AT4G15550 | UDP-glucose:indole-3-acetate beta-D-glucosyltransferase |
| AT1G52830 | An extragenic dominant suppressor of the hy2 mutant phenotype. Also exhibits aspects of constitutive photomorphogenetic phenotype in the absence of hy2. Mutants have dominant leaf curling phenotype shortened hypocotyls and reduced apical hook. Induced by indole-3-acetic acid. |
| AT3G23050 | Transcription regulator acting as repressor of auxin-inducible gene expression. Plays role in the control of gravitropic growth and development in light-grown seedlings. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. Pseudomonas syringae type III effector AvrRpt2 stimulates AXR2 protein turnover. |
| AT4G14560 | auxin (indole-3-acetic acid) induced gene (IAA1) encoding a short-lived nuclear-localized transcriptional regulator protein. The mRNA is cell-to-cell mobile. |
| AT4G28640 | Auxin induced gene, IAA11 (IAA11). Check the Comments field on the locus page to view updated sequence annotation. |
| AT1G04550 | IAA12/BDL plays a role in auxin-mediated processes of apical-basal patterning in the embryo. bdl mutants lack a primary root meristem |
| AT4G14550 | IAA14 is a member of the Aux/IAA protein family. Involved in lateral root development. Gain of function mutation decreases auxin-inducible gene expression. Protein is localized to the nucleus. Expressed in stele and root tip epidermis. Functions as a negative regulator of ARF7/19. |
| AT3G15540 | Primary auxin-responsive gene. Involved in the regulation stamen filaments development. |
| AT3G23030 | auxin inducible gene expressed in the nucleus |
| AT2G46990 | Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA20 lacks the conserved degron (domain II) found in many family members, and IAA20 fusion proteins are stable in Arabidopsis seedlings. IAA20 transcripts are induced by auxin treatment, and overexpression of IAA20 leads to defects in gravitropism, root development, root meristem maintenance, etiolation, and cotyledon vascular development. |
| AT1G15050 | Belongs to auxin inducible gene family. |
| AT1G15580 | auxin induced protein |
| AT5G65670 | auxin (indole-3-acetic acid) induced gene The mRNA is cell-to-cell mobile. |
| AT4G14430 | Encodes a peroxisomal delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation. This enzyme might also be involved in the conversion of indole-3-butyric acid to indole-3-acetic acid via a beta-oxidation-like pathway. |
| AT2G04550 | Encodes a protein phosphatase that interacts with MPK12, but not with other MAP kinases. It can dephosphorylate a dually phosphorylated MPK12 in vitro and can inactivate MPK12 in vivo. ibr5 mutants have reduced sensitivity to auxin and abscisic acid. IBR5 promotes auxin responses, including auxin-inducible transcription, differently than the TIR1 auxin receptor and without destabilizing Aux/IAA repressor proteins. It plays a role in male gametophyte development, auxin and TCP growth regulatory pathways. Regulates leaf serrations development via modulation of the expression of PIN1. |
| AT2G22670 | Encodes a transcriptional repressor of the auxin response that is auxin inducible and is involved in lateral root formation. The mRNA is cell-to-cell mobile. |
| AT3G26744 | Encodes a MYC-like bHLH transcriptional activator that binds specifically to the MYC recognition sequences in the CBF3 promoter. It also binds to and inhibits the expression of ABI3. Mutants are defective in cold-regulated gene expression and ABA signaling druing seed germination.. Cold stress triggers protein degradation of nuclear GFPICE1 protein, and the RING finger protein HOS1 is required. Sumoylation of ICE1 controls CBF3/DREB1A expression and freezing tolerance. Together with ZOU, ICE1 determines primary seed dormancy depth independently of their joint role in endosperm development.ICE1 interacts with ABI5. Also members of the DELLA family, which repress ICE1 function. |
| AT3G56370 | LRR-RLK with distinct polar localization within the plasma membrane in different cell types of the root. Mutants show defects in cell divisions within the root ground tissue. |
| AT2G01900 | Encodes an inositol polyphosphate phosphatidylinositol 5-phosphatase that is expressed in roots and is involved in mediating salt tolerance through endocytosis. |
| AT2G43330 | Encodes a tonoplast-localized myo-inositol exporter, involved in efflux of myo-inositol from the vacuole to the cytosol. The gene is ubiquitously expressed. Reduced root growth in knock-out mutants grown on low inositol agar medium. |
| AT4G16480 | Encodes a high affinity H+:myo-inositol symporter. The only other compound shown to be transported was pinitol, a methylated derivative of myo-inositol. The mRNA is cell-to-cell mobile. |
| AT4G18010 | Encodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not appear to be active against phosphatidylinositol 4,5 bisphosphate. Overexpression of this gene renders plants insensitive to ABA in germination and growth assays. |
| AT1G05630 | Encodes an inositol polyphosphate 5-phosphatase with phosphatase activity toward only Ins(1,4,5)P3. Induced in response to ABA and wounding treatments. Expressed in young seedlings and flowers, while no transcripts were detectable in maturated roots, stems, and rosette leaves Modulates the development of cotyledon veins through its regulation of auxin homeostasis. Involved in blue light light?stimulated increase in cytosolic calcium ion. |
| AT2G43850 | Integrin-linked protein kinase family;(source:Araport11) |
| AT1G17140 | Encodes a ROP/RAC effector, designated interactor of constitutive active ROPs 1 (ICR1), that interacts with GTP-bound ROPs. ICR1 is a scaffold mediating formation of protein complexes that are required for cell polarity. ICR1 is comprised of coiled-coil domains and forms complexes with itself and the exocyst vesicle-tethering complex subunit SEC3. |
| AT4G25550 | Cleavage/polyadenylation specificity factor, 25kDa subunit;(source:Araport11) |
| AT1G48280 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G09710 | Ca(2+)-dependent calmodulin-binding protein. Targeted to the nucleus. Involved in glucosinolate metabolism in response to biotic challenge. Expressed in vascular tissue.Member of IQ67 (CaM binding) domain containing family. |
| AT3G15050 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G59690 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G49380 | Member of IQ67 (CaM binding) domain containing family. |
| AT1G01110 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G14750 | Member of IQ67 (CaM binding) domain containing family. |
| AT5G03040 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G49260 | IQ-domain 21;(source:Araport11) |
| AT4G23060 | Member of IQ67 (CaM binding) domain containing family. |
| AT5G62070 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G29150 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G16490 | Member of IQ67 (CaM binding) domain containing family. |
| AT1G14380 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
| AT3G52290 | Member of IQ67 (CaM binding) domain containing family. |
| AT1G19870 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
| AT3G22190 | Member of IQ67 (CaM binding) domain containing family. |
| AT1G60960 | Encodes a plasma membrane localized zinc/iron transporter. |
| AT5G26820 | Mutations in MAR1 confer resistance, while MAR1 overexpression causes hypersensitivity to multiple aminoglycoside antibiotics. Localizes to the chloroplast envelope. MAR1 may act as a plastid transporter involved in cellular iron homeostasis. The mRNA is cell-to-cell mobile. |
| AT4G36890 | IRX14 was identified as MUCI64 in a reverse genetic screen for MUCILAGE-RELATED genes. IRX14/MUCI64 is a GT43 protein essential for xylan elongation in seed coat mucilage. The xylan backbone maintains the attachment of mucilage to the seed surface and the distribution of cellulose. It was identified based on its gene expression co-variance with the IRX3 gene involved in secondary cell wall synthesis. A biochemical assay using the irx14 mutant indicates that IRX14 might function in xylose chain elongation. |
| AT5G67230 | Encodes a member of the GT43 family glycosyltransferases involved in glucuronoxylan biosynthesis: AT2G37090 (IRX9) and AT1G27600 (IRX9-L or I9H, IRX9 homolog); AT4G36890 (IRX14) and AT5G67230 (IRX14-L or I14H, IRX14 homolog). They form two functionally non-redundant groups essential for the normal elongation of glucuronoxylan backbone. I9H functions redundantly with IRX9, I14H is redundant with IRX14. IRX9 or I9H do not complement IRX14, IRX14 or I14H do not complement IRX9. |
| AT4G30370 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G39930 | Encodes an isoamylase-type debranching enzyme. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. Mutants have reduced starch content and abnormally structured amylopectins and phytoglycogens. It has been postulated that AtISA1 interacts with AtISA2 to form the Iso1 complex. |
| AT1G18870 | Encodes a protein with isochorismate synthase activity involved in phylloquinone biosynthesis. Mutant studies of this gene's function suggest that its function is redundant with that of ICS1 (AT1G7410). |
| AT4G35260 | Encodes a regulatory subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase. |
| AT5G03290 | Encodes a catalytic subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase. The mRNA is cell-to-cell mobile. |
| AT5G19040 | Encodes cytokinin synthase. |
| AT3G23630 | Encodes an isopentenyl transferase involved in cytokinin biosynthesis. |
| AT5G14200 | The AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. Encodes methylthioalkylmalate dehydrogenase. Involved in glucosinolate biosynthesis, in methionine chain elongation. The mRNA is cell-to-cell mobile. |
| AT2G43100 | Small subunit, which together with IPMI SSU2, IPMI SSU3 and IPMI LSU1, is a member of heterodimeric isopropylmalate isomerase (IPMI). Together with IPMI SSU3 participates in the Met chain elongation pathway. |
| AT3G45300 | Encodes isovaleryl-coenzyme a dehydrogenase. Mutants have increases in 12 seed free amino acids, accumulation of seed homomethionine and 3-isovaleroyloxypropyl-glucosinolate, with a concomitant decrease in seed 3-benzoyloxypropyl-glucosinolate. The mRNA is cell-to-cell mobile. |
| AT1G34220 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT4G29440 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT3G16450 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT3G16460 | Mannose-binding protein |
| AT5G03150 | JKD is a nuclear-localized putative transcription factor of the BIRDS/IDD C2H2 zinc finger family. JKD and its homologue BIB, restrict SHR movement to a single layer, the endodermis, and delimit tissue boundaries in the root meristem through a process that involves nuclear retention through protein complex formation. JKD mutation leads to periclinal divisions in the cortex, increased cell numbers in the circumference of the cortical and epidermal layers, a disrupted QC marker expression pattern, and disorganized QC and columella cells. This effect is enhanced in jkd bib double mutants where tissue boundaries cannot be maintained due to excessive SHR movement. JKD and BIB restrict CYCIND6 expression to cortex and endodermis stem cells to prevent formative divisions in the ground tissue. JKD physically interacts with cell fate determinants SCR and SHR in a cell type specific manner. Native FRET-FLIM analysis showed higher JKD-SCR complex in the endodermis and predominant JKD-SHR in the QC and cortex/endodermis stem cells. In addition, JKD, SCR and SHR form a ternary complex whose conformation is cell type dependent, conformational changes of this complex differentially regulate SCR and WOX5 expression to specify endodermal cell fate and QC function respectively. Its mRNA is cell-to-cell mobile. |
| AT3G16470 | Encodes a JA-responsive gene that coordinates with GRP7 in shaping plant development through the regulation of RNA processing in Arabidopsis. AtJAC1 interacts with RNA binding protein GRP7 specifically in the cytoplasm to regulate its nucleocytoplasmic distribution. |
| AT3G22160 | VQ motif-containing protein. JAV1 is a repressor of jasmonate-mediated defense responses. |
| AT5G13220 | Plants overexpressing At5g13220.3, but not At5g13220.1 showed enhanced insensitivity to MeJa. |
| AT3G43440 | jasmonate-zim-domain protein 11;(source:Araport11) |
| AT5G20900 | jasmonate-zim-domain protein 12;(source:Araport11) |
| AT3G17860 | JAZs are direct targets of the SCFCOI1 E3 ubiquitin-ligase and JA treatment induces their proteasome-mediated degradation. Furthermore, JAI3 negatively regulates the key transcriptional activator of JA responses, AtMYC2. The C-terminal portion of JAZ3, including the Jas domain, appears to be important for JAZ3-COI1 binding in the presence of coronatine. |
| AT1G17380 | jasmonate-zim-domain protein 5;(source:Araport11) |
| AT1G72450 | JAZ6 transcript levels rise in response to a jasmonate stimulus and a GFP:JAZ6 fusion protein localizes to the nucleus. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ6:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. |
| AT2G34600 | Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators. |
| AT5G05600 | Encodes a protein with similarity to flavonol synthases that is involved in the detoxifcation polycyclic aromatic hydrocarbons.One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT5G10650 | JUL1 encode a RING-type E3 ubiquitin ligase that is involved in JA responses. It ubiquitinates the JAV1 jasmonic acid response repressor which is then degraded by the proteosome. Participates in ABA-mediated microtubule depolymerization, stomatal closure, and tolerance response to drought stress. |
| AT5G46910 | H3K27me3 demethylase involved in temperature and photoperiod dependent repressing of flowering. |
| AT3G20810 | JMJD5 encodes a protein which contains a jumonji-C (jmjC) domain. jmjd5 mutant plants have a short-period circadian phenotype. JMJD5 has histone demethylase activity and interacts with EFM to repress FT. |
| AT1G63490 | Histone demethylase belonging to the KDM5/JARID1 family which plays crucial roles in response to dehydration stress and abscisic acid (ABA). Directly binds the chromatin of OPEN STOMATA 1 (OST1) and demethylated H3K4me3 for the regulation of OST1 mRNA abundance, thereby modulating the dehydration stress response. |
| AT1G30810 | JMJ18 encodes a novel JmjC domain- containing histone H3K4 demethylase. PHD finger-containing protein. |
| AT5G06550 | Encodes a HR demethylase that acts as a positive regulator of seed germination in the PHYB-PIL5-SOM pathway. |
| AT1G01790 | Encodes a member of the cation/proton antiporters-2 antiporter superfamily, the K efflux antiporter KEA1 that is localized to the chloroplast envelope. |
| AT4G00630 | Encodes a K(+)/H(+) antiporter that modulates monovalent cation and pH homeostasis in plant chloroplasts or plastids. |
| AT4G04850 | Encodes a potassium efflux antiporter; has three splice forms KEA3.1, KEA3.2, and KEA3.3, KEA3.2 is the most abundant splice form in all plant organs (silique, flower, leaf and root). KEA3.1 and KEA3.3 are minor variants that can be found in flowers and in leaves. KEA3 is localized to the thylakoid membrane and enriched in the stromal lamellae. It allows proton efflux from the thylakoid lumen by proton/potassium antiport. |
| AT1G31120 | potassium transporter |
| AT4G33530 | potassium transporter |
| AT1G70300 | potassium transporter |
| AT4G19960 | Encodes a potassium ion transmembrane transporter. Also mediates cesium uptake when expressed in E. coli. The mRNA is cell-to-cell mobile. |
| AT5G16560 | Encodes a KANADI protein (KAN) that regulates organ polarity in Arabidopsis. KAN is required for abaxial identity in both leaves and carpels, and encodes a nuclear-localized protein in the GARP family of putative transcription factors. Together with KAN2, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN2 and KAN4, KAN1 appears to be required for proper regulation of PIN1 in early embryogenesis. |
| AT4G17695 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G31350 | KAR-UP F-box 1;(source:Araport11) |
| AT4G37470 | HTL belonging to the alpha/beta fold hydrolase superfamily. Mutant and over-expression studies indicates its involvement in seedling de-etiolation process. Involved in the perception of karrikins. Interacts with MAX2. Important for cotyledon expansion. |
| AT1G11160 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
| AT5G23430 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
| AT4G01575 | Encodes a putative Kazal-type serine proteinase inhibitor that is highly expressed in seeds, mature roots and flowers. |
| AT1G23390 | A kelch domain-containing F-box protein. Its N terminus contains a typical F-box motif but its C-terminal domain only consists of one predicted kelch motif. Predicted to be stu Interacts with chalcone synthase CHS to mediate CHS ubiquitination and degradation. |
| AT1G26945 | Encodes a basic helix-loop-helix (bHLH) protein involved in blue/far-red light signaling. Physically interacts with HFR1 and negatively regulates its activity. |
| AT4G14950 | KMS1 encode a endoplasmic reticulum protein involved in the early secretory pathway. |
| AT1G05360 | KMS2 encode a endoplasmic reticulum protein involved in the early secretory pathway. |
| AT3G02880 | Probable inactive receptor kinase; Commonly-enriched candidate LPS-interacting PM-associated proteins from the three affinity chromatography systems with LPS chemotype Xcc 8530 as ligand. |
| AT5G19280 | kinase associated protein phosphatase composed of three domains: an amino-terminal signal anchor, a kinase interaction (KI) domain, and a type 2C protein phosphatase catalytic region |
| AT4G32295 | histone acetyltransferase;(source:Araport11) |
| AT3G24150 | hypothetical protein;(source:Araport11) |
| AT5G54670 | Encodes a truncated KatC polypeptide (KatC(207-754)), which includes the carboxyl-terminal region of KatC. This was expressed in Escherichia coli and was shown to possess microtubule-stimulated ATPase activity. |
| AT1G21730 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G12020 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G10470 | Kinesin that binds cyclin-dependent kinase CDKA;1 as homodimer or as heterodimer with KCA2. Demarcates the division site in plant cells. |
| AT5G02520 | Arabidopsis KNL2 localizes at chromocenters during all stages of the mitotic cell cycle, except from metaphase to mid-anaphase, and its level is strictly regulated by the proteasome degradation pathway. Knockout of KNL2 via a T-DNA insertion resulted in a reduced amount of centromeric cenH3, mitotic and meiotic abnormalities, and reduced growth and fertility. |
| AT3G50630 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Gene was isolated from a yeast two hybrid screen as an interacting protein of CDC2A. Recombinant protein has a strong kinase inhibitor activity in vitro. Transcript is expressed in all tissues examined but is differentially distributed from ICK1. Controls the onset of the endoreduplication cycle through inhibition of CDKA;1. The KRP2 protein abundance is regulated by proteolysis through CDKB1;1 phosphorylation. |
| AT2G32710 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI). A member of seven KRP genes found in Arabidopsis thaliana. Negative regulator of cell division. Expressed in actively dividing cells. |
| AT3G19150 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type cyclins. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. KRP6 appears to be targeted for degradation by RHF1a and RHF2a to allow mitotic divisions during gametogenesis. In addition, KRP6 transcript levels rise prior to and drop following the meitotic divisions of gametogenesis. Elevated levels of KRP6 negatively affect plant development and fertility. |
| AT1G80440 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB20, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. The mRNA is cell-to-cell mobile. |
| AT2G44130 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family. Component of SCF ubiquitin protein ligase, interacts with phenylalanine ammonia-lyase. AtKFB39 is a homolog of previously identified AtKFB50 (At3g59940) and specifically interacts with Arabidopsis PAL3 and PAL4 in vitro. In planta, together with AtKFB01, KFB20 and KFB50, it regulates PAL protein stability thus controlling phenylpropanoid biosynthesis . |
| AT4G08150 | A member of class I knotted1-like homeobox gene family (together with KNAT2). Similar to the knotted1 (kn1) homeobox gene of maize. Normally expressed in the peripheral and rib zone of shoot apical meristem but not in the leaf primordia. It is also expressed in the fourth floral whorl, in the region that would become style, particularly in the cell surrounding the transmitting tissue. No expression was detected in the first three floral whorls. Expression is repressed by auxin and AS1 which results in the promotion of leaf fate. |
| AT1G62990 | Encodes a homeodomain transcription factor of the Knotted family. May be involved in secondary cell wall biosynthesis. Mutants have moderately irregular xylem development. Expression of this gene is upregulated by SND1 and MYB46. |
| AT5G25220 | A member of class II knotted1-like homeobox gene family (together with KNAT4 and KNAT5). Expressed in: hypocotyl-root boundary, anther-filament junction in flowers, ovule-funiculus and peduncle-silique boundaries, petioles and root. Light-regulated expression with differential response to red/far-red light. KNAT3 promoter activity showed cell-type specific pattern along longitudinal root axis, restricted mainly to the differentiation zone of the root, namely in the cortex and pericycle. Not detected in lateral root primordia |
| AT5G11060 | A member of Class II KN1-like homeodomain transcription factors (together with KNAT3 and KNAT5), with greatest homology to the maize knox1 homeobox protein. Expression regulated by light. Detected in all tissues examined, but most prominent in leaves and young siliques. Transient expression of GFP translational fusion protein suggests bipartite localization in nucleus and cytoplasm. KNAT4 promoter activity showed cell-type specific pattern along longitudinal root axis; GUS expression pattern started at the elongation zone, predominantly in the phloem and pericycle cells, extending to endodermis toward the base of the root. |
| AT5G14010 | Encodes KNUCKLES (KNU), a C2H2-type zinc finger protein with a conserved transcriptional repression motif. Mediates the repression of WUS in floral meristem determinacy control. |
| AT1G74910 | KONJAC1 is imilar to sugar pyrophosphorylases but has an insertion of 2 AA in the pyrophosphorylase consensus motif that is highly conserved in GMPPs. It lacks GDP-mannose pyrophosphorylase activity but can simulate the GDP-mannose pyrophosphorylase activity of VTC1. |
| AT5G11540 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
| AT2G46740 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
| AT5G14760 | At5g14760 encodes for L-aspartate oxidase involved in the early steps of NAD biosynthesis. In contrary to the EC 1.4.3.16 (l-aspartate oxidase - deaminating) the enzyme catalyzes the reaction L-aspartate + O2 = iminoaspartate (alpha-iminosuccinate) + H2O2. Flavoenzyme-encoding gene. |
| AT4G33670 | Encodes a L-galactose dehydrogenase, involved in ascorbate biosynthesis |
| AT3G10050 | first enzyme in the biosynthetic pathway of isoleucine |
| AT5G60310 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G60270 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G60300 | Encodes a legume-type lectin receptor kinase that is structurally distinct from the mammalian extracellular ATP receptors and acts as an extracellular ATP receptor in Arabidopsis. Extracellular ATP acts as a damage-associated molecular pattern in plants, and its signaling through P2K1 is important for mounting an effective defense response against various pathogenic microorganisms. It also plays a role in cell wall-plasma membrane adhesion. |
| AT2G37710 | Induced in response to Salicylic acid. The mRNA is cell-to-cell mobile. |
| AT4G02410 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G10530 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G32800 | protein kinase family protein;(source:Araport11) |
| AT5G42120 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G55830 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G53380 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G03140 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G01190 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT2G29130 | Putative laccase, knockout mutant had reduced root elongation under PEG-induced dehydration.miR397b regulates root lignin deposition by regulating LACCASE2 expression during drought and phosphate deficiency. |
| AT2G40370 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). Together with DP1/DIR12 involved in neolignan biosynthesis via sinapoylcholine/feruloylcholine. |
| AT3G25540 | Encodes a ceramide synthase that together with LOH3 is essential for production of ceramides containing Very Long Chain Fatty acid VLCFA-Ceramides(mainly C 22 to 26). |
| AT1G15420 | Encodes a novel plant specific protein that is co-expressed with components of pre-rRNA processing complex. Co-localizes with NuGWD1 and SWA1. |
| AT1G01470 | Encodes late-embryogenesis abundant protein whose mRNA levels are induced in response to wounding and light stress. Might be involved in protection against desiccation. |
| AT2G35300 | Encodes LEA4-2/LEA18, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. |
| AT2G46140 | Late embryogenesis abundant protein;(source:Araport11) |
| AT5G06760 | Encodes LEA4-5, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. Most of the diverse set of LEA proteins can be grouped according to properties such as high hydrophilicity and high content of glycine or other small amino acids in what has been termed hydrophilins. LEA4-5 protects enzyme activities from the adverse effects induced by freeze-thaw cycles in vitro. |
| AT2G40170 | Encodes a group 1 LEA gene that is activated by direct binding of ABI5 to its promoter and is involved in response to ABA. Is required for normal seed development. Involved in regulating the timing of desiccation tolerance and rate of water loss during seed maturation. |
| AT3G21420 | LATERAL BRANCHING OXIDOREDUCTASE (LBO), encodes an oxidoreductase-like enzyme of the 2-oxoglutarate and Fe(II)-dependent dioxygenase superfamily. It is involved in the biosynthesis of strigolactones. |
| AT2G42430 | LOB-domain protein gene LBD16. This gene contains one auxin-responsive element (AuxRE). Regluates lateral root formation. |
| AT3G58190 | This gene contains two auxin-responsive element (AuxRE). Required for triggering cell reprogramming during callus formation. |
| AT5G12330 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Expressed in lateral root primordia and induced by auxin. SWP1 is involved in the repression of LRP1 via histone deacetylation. |
| AT1G55580 | Encodes a member of the GRAS family of putative transcriptional regulators. It is involved in the initiation of axillary meristems during both the vegetative and reproductive growth phases and functions upstream of REV and AXR1 in the regulation of shoot branching. |
| AT4G38360 | LAZ1 is a DUF300 domain protein that appears to function in vacuolar transport effecting brassinosteroid and programmed cell dealth signaling pathways. |
| AT1G67360 | Encodes a small rubber particle protein homolog. Plays dual roles as positive factors for tissue growth and development and in drought stress responses. |
| AT1G25390 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G61850 | Encodes transcriptional regulator that promotes the transition to flowering.Involved in floral meristem development. LFY is involved in the regulation of AP3 expression, and appears to bring the F-box protein UFO to the AP3 promoter. Amino acids 46-120 define a protein domain that mediates self-interaction. |
| AT1G28300 | Transcription factor that contains a B3 domain, a DNA-binding motif unique to plants and characteristic of several transcription factors. Plays critical roles both early and late during embryo development. LEC2 RNA accumulates primarily during seed development. LEC2 is required for the maintenance of suspensor morphology, specification of cotyledon identity, progression through the maturation phase, and suppression of premature germination. It establishes a cellular environment sufficient to initiate embryo development - ectopic, postembryonic expression of LEC2 in transgenic plants induces the formation of somatic embryos and other organ-like structures and often confers embryonic characteristics to seedlings and to reproductive and vegetative organs of mature plants. |
| AT5G01560 | Encodes LecRKA4.3, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. |
| AT1G03475 | Encodes coproporphyrinogen III oxidase, a key enzyme in the biosynthetic pathway of chlorophyll and heme, a tetrapyrrole pathway. Mutants express cytological and molecular markers associated with the defense responses, usually activated by pathogen infection. |
| AT5G16590 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G24480 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT4G18670 | Leucine rich extensin protein involved in cell wall biogenesis and organization. Interacts with several members of the RALF family of ligand peptides. |
| AT1G07650 | Leucine-rich repeat receptor-like kinase with extracellular malectin-like domain, which possesses cell death induction activity in plant leaves. |
| AT1G62440 | encodes a paralog of LRX1 (LEUCINE-RICH REPEAT/EXTENSIN 1) which acts synergistically with LRX1 in root hair cell morphogenesis. |
| AT4G13340 | Leucine rich extensin protein involved in cell wall biogenesis and organization. Interacts with several members of the RALF family of ligand peptides. |
| AT4G32551 | LEUNIG regulates floral organ identity,gynoecium and ovule development. Negatively regulates AGAMOUS . Encodes a glutamine-rich protein with seven WD repeats similar to transcriptional corepressors. |
| AT5G02840 | Encodes RVE4, a homolog of the circadian rhythm regulator RVE8. rve4 rve6 rve8 triple mutants display an extremely long circadian period, with delayed and reduced expression of evening-phased clock genes. Involved in heat shock response. |
| AT4G14730 | Stress induced membrane protein. Mutants show enhanced cell death under stress. |
| AT1G03070 | Bax inhibitor-1 family protein;(source:Araport11) |
| AT3G08940 | Lhcb4.2 protein (Lhcb4.2, protein involved in the light harvesting complex of photosystem II The mRNA is cell-to-cell mobile. |
| AT2G40100 | Lhcb4:3 protein (Lhcb4.3, light harvesting complex of photosystem II The mRNA is cell-to-cell mobile. |
| AT1G15820 | Lhcb6 protein (Lhcb6), light harvesting complex of photosystem II. |
| AT5G64813 | The LIP1 gene encodes a small GTPase that influences the light input pathway of the plant circadian network. An MBP:LIP1 fusion protein has GTP hydrolyzing abilities in vitro. In plants, LIP1 seems to play a negative role in regulating circadian period that can be suppressed by light. LIP1 also seems to negatively affect light-pulse-dependent resetting of the clock, especially during the first portion of the subjective evening. LIP1 expression levels are not significantly affected by the circadian clock in seedlings grown under LL conditions. The levels of the YFP:LIP1 protein expressed under the control of the 35S promoter, shows a low amplitude variation, with protein levels peaking near the beginning of subjective night under LL conditions. In hypocotyl epidermal cells of dark and light-grown seedlings, a YFP:LIP1 fusion protein can be seen in the cytoplasm and the nucleus, and does not cluster in nuclear speckles. LIP1 may also be involved in photomorphogenesis. The mRNA is cell-to-cell mobile. |
| AT2G42610 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT3G04510 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT2G31160 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT1G07090 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT4G18610 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT5G47110 | Encodes a light-harvesting-like protein that is involved in chlorophyll and tocopherol biosynthesis anchoring geranylgeranyl reductase in the thylakoid membrane. |
| AT3G26640 | Encodes LIGHT-REGULATED WD1 (LWD1), a clock proteins regulating circadian period length and photoperiodic flowering. |
| AT1G78600 | light-regulated zinc finger protein 1;(source:Araport11) |
| AT2G46260 | Involvement in protein ubiquitylation is predicted based on physical interaction with CULLIN 3 proteins. LRBs physically interact with photoexcited and phosphorylated CRY2, at the CCE domain of CRY2, to facilitate polyubiquitination and degradation of CRY2 in response to blue light. |
| AT5G19740 | LAMP is an AMP paralog that overlaps in expression within the vascular system. Along with LAMP it suppresses meristem activity within the peripheral zone of the shoot apical meristem. LAMP is localized to the endoplasmic reticulum. |
| AT1G77690 | Encodes an auxin influx carrier LAX3 (Like Aux1) that promotes lateral root emergence. Auxin-induced expression of LAX3 in turn induces a selection of cell-wall-remodelling enzymes, which are likely to promote cell separation in advance of developing lateral root primordia. |
| AT5G01240 | Encodes LAX1 (LIKE AUXIN RESISTANT), a member of the AUX1 LAX family of auxin influx carriers. Required for the establishment of embryonic root cell organization. |
| AT2G21050 | Encodes LAX2 (LIKE AUXIN RESISTANT), a member of the AUX1 LAX family of auxin influx carriers. Required for the establishment of embryonic root cell organization. |
| AT2G20130 | like COV 1;(source:Araport11) |
| AT1G15080 | Encodes phosphatidic acid phosphatase. Involved in ABA signaling. Functions as a negative regulator upstream of ABI4. Expressed during germination and seed development. Expressed overall in young seedlings, in roots, hypocotyls, and vascular cells of cotyledons and leaves of 10 day-old seedlings, in flower filaments and stem elongation zones. Not expressed in anthers, pollen nor petals. |
| AT4G22550 | Phosphatidic acid phosphatase (PAP2) family protein;(source:Araport11) |
| AT5G03080 | Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene, LPPgamma appears to be more important for diacylglycerol formation than LPPepsilon1 and LPPepsilon2 in the plastids. Heterozygous lppgamma mutants produce pollen that have defects in pollen tube germination and no homozygous mutants have been recovered. The mRNA is cell-to-cell mobile. |
| AT2G38530 | Involved in lipid transfer between membranes and plays a role in maintaining the integrity of the cuticle-cell wall interface. Belongs to a family of Lipid transfer proteins. Sequence similarity to other plant/Arabidopsis LPT genes but highest similarity to LPT1. Stress and pathogen-inducible motifs found in the upstream region. Expressed in flower, leaves and siliques but absent in roots. Predicted to be a member of PR-14 pathogenesis-related protein family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT4G21220 | Trimeric LpxA-like enzymes superfamily protein;(source:Araport11) |
| AT1G17420 | LOX3 encode a Lipoxygenase. Lipoxygenases (LOXs) catalyze the oxygenation of fatty acids (FAs). |
| AT1G67560 | PLAT/LH2 domain-containing lipoxygenase family protein;(source:Araport11) |
| AT1G67230 | Encodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
| AT1G13220 | Encodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
| AT5G65770 | Encodes a protein that localizes to the nuclear periphery and affects nuclear morphology. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
| AT2G45450 | ZPR1, a small leucine zipper-containing protein that interacts with REV HD-ZIPIII and is involved in the establishment of leaf polarity. |
| AT4G30980 | Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair and sperm cell development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3). |
| AT2G28500 | LOB domain-containing protein 11;(source:Araport11) |
| AT2G45420 | LOB domain-containing protein 18;(source:Araport11) |
| AT4G00210 | LOB domain-containing protein 31;(source:Araport11) |
| AT5G67420 | Encodes a LOB-domain protein involved in nitrogen metabolism and affecting leaf morphogenesis. |
| AT3G49940 | LOB domain-containing protein 38;(source:Araport11) |
| AT1G31320 | LOB domain-containing protein 4;(source:Araport11) |
| AT3G02550 | LOB domain-containing protein 41;(source:Araport11) |
| AT2G19820 | LOB domain-containing protein 9;(source:Araport11) |
| AT5G19080 | Paralog of LOG2 (At3g09770), a ubiquitin ligase that regulates amino acid export. |
| AT2G28305 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT5G06300 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT5G11950 | Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At2G37210. |
| AT3G55850 | Encodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids. |
| AT1G77590 | Encodes major plastidic long chain acyl-CoA synthetase with a slight substrate preference of oleic acid over any of the other fatty acids. |
| AT2G02450 | NAC domain containing protein 35;(source:Araport11) |
| AT1G64400 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT2G46090 | Encodes a putative sphingosine kinase (SphK) containing the five conserved domains (C1-C5) previously identified in SphKs. |
| AT5G55370 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT5G15580 | Encodes LONGIFOLIA1 (LNG1). Regulates leaf morphology by promoting cell expansion in the leaf-length direction. The LNG1 homologue LNG2 (At3g02170) has similar function. |
| AT1G15370 | TPLATE adaptor complex subunit. |
| AT4G34120 | Encodes a single cystathionine beta-Synthase domain-containing protein. Modulates development by regulating the thioredoxin system. The mRNA is cell-to-cell mobile. |
| AT4G36910 | Encodes a single cystathionine beta-synthase domain-containing protein. Modulates development by regulating the thioredoxin system. |
| AT1G73060 | Low PSII Accumulation 3;(source:Araport11) |
| AT3G53110 | Encodes a putative DEAD-Box RNA Helicase and has RNA-dependent ATPase activity. Mutant is Sensitive to chilling stress and heat stress. Germination of the mutant is inhibited by ABA. LOS4 may be involved in temperature sensing. Is enriched in the nuclear envelope and also located in the cytoplasm. LOS4 is involved in export of poly A RNA. The mRNA is cell-to-cell mobile. |
| AT1G71040 | Encodes LPR2. Function together with LPR1 (AT1G23010) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
| AT5G48910 | Encodes LPA66, a chloroplast protein of the pentatricopeptide repeat family. In lpa66 mutants, editing of psbF that converts serine to phenylalanine is specifically impaired. lpa66 mutants also display a high chlorophyll fluorescence phenotype. |
| AT1G75690 | Thylakoid Thiol/Disulfide-Modulating Protein. |
| AT5G48543 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT1G28335 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G28405 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G07005 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G28355 | low-molecular-weight cysteine-rich 5;(source:Araport11) |
| AT2G20208 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G30064 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G30067 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G02100 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. The mRNA is cell-to-cell mobile. |
| AT4G22210 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT5G63460 | Enhances ABA response and plant drought tolerance by modulating the stability and localization of c2-domain ABA-related proteins.LOT1 regulates plant tolerance to drought stress by affecting ABA signaling through regulating the stability and dynamic localization of CAR9 (PMID:31102784). |
| AT1G32540 | Encodes a protein with 3 plant-specific zinc finger domains that acts as a positive regulator of cell death. |
| AT4G21610 | Contains the same novel zinc finger motif with LSD1, a negative regulator of cell death and defense response. Due to differential splicing, it encodes two different proteins, one of which contains an additional, putative DNA binding motif. Northern analysis demonstrated that LOL2 transcripts containing the additional DNA binding motif are predominantly upregulated after treatment with both virulent and avirulent Pseudomonas syringae pv maculicola strains. |
| AT3G13682 | Encodes a homolog of human Lysine-Specific Demethylase1. Involved in H3K4 methylation of target genes including the flowering loci FLC and FWA. |
| AT4G35760 | Encodes a bimodular enzyme comprising an integral domain homologous to the catalytic subunit of mammalian vitamin K epoxide reductase (VKORC1, EC 1.1.4.1) that is fused to a soluble thioredoxin-like moiety. Using yeast microsomes as a recombinant system, it was shown that the VKORC1 domain of At4g35760 functions as a stringent naphthoquinone reductase, and that its reduced Trx-like partner can serve as its electron donor. Located in plastid. Required for the assembly of photosystem II. Can catalyze disulfide bond formation in vitro. |
| AT2G24330 | Encodes one of two LUNAPARK proteins in Arabidopsis. Both LNPA and LNPB are predominantly distributed throughout the ER, but not preferentially localized at the three-way junctions. Mutation of both LNPA and LNPB together caused the cortical ER to develop poor ER cisternae and a less dense tubular network. E3 ligase involved in degradation of RHD3 to maintain a tubular ER network. |
| AT4G31080 | Encodes one of two LUNAPARK proteins in Arabidopsis. Both LNPA and LNPB are predominantly distributed throughout the ER, but not preferentially localized at the three-way junctions. Mutation of both LNPA and LNPB together caused the cortical ER to develop poor ER cisternae and a less dense tubular network. E3 ligase involved in degradation of RHD3 to maintain a tubular ER network. |
| AT1G78970 | Lupeol synthase. Converts oxidosqualene to multiple triterpene alcohols and a triterpene diols. This conversion proceeds through the formation of a 17β-dammarenyl cation. |
| AT1G77630 | Encodes a lysin-motif protein mediating bacterial peptidoglycan sensing and immunity to bacterial infection. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. It contains a C-terminal GPI anchor signal and is an ortholog of OsLYP4 and OsLYP6. |
| AT1G14030 | Encodes a lysine methyltransferase whose main soluble physiological substrates are chloroplastic fructose 1,6-bisphosphate aldolases, FBA1, FBA2, and FBA3. Lysines near the C-terminal end of the target proteins are trimethylated. |
| AT3G01760 | Encodes an amino acid transporter expressed in the root that is involved in the uptake of acidic amino acids, glutamine and alanine, and probably phenylalanine. |
| AT4G33150 | This is a splice variant of the LKR/SDH locus. It encodes a bifunctional polypeptide lysine-ketoglutarate reductase and saccharopine dehydrogenase involved in lysine degradation. There is another splice variant that encodes a mono saccharopine dehydrogenase protein. Gene expression is induced by abscisic acid, jasmonate, and under sucrose starvation. |
| AT3G14840 | Encodes LRR-RLK protein that is localized to the plasma membrane and is involved in regulation of plant innate immunity to microbes. LIK1 is phosphorylated by CERK1, a kinase involved in chitin perception. The mRNA is cell-to-cell mobile. |
| AT1G21880 | Encodes a lysin-motif protein mediating bacterial peptidoglycan sensing and immunity to bacterial infection. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. It contains a C-terminal GPI anchor signal and is an ortholog of OsLYP4 and OsLYP6. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT3G01840 | Encodes a putative LysM-containing receptor-like kinase. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. Based on protein sequence alignment analysis, it was determined to be a pseudo kinase since lack of the ATP-binding P-loop in the kinase domain. |
| AT1G51940 | Encodes a LysM-containing receptor-like kinase. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. Based on protein sequence alignment analysis, it has a typical RD signaling domain in its catalytic loop and possesses autophosphorylation activity.It is required for the suppression of defense responses in absence of pathogen infection or upon abscisic acid treatment. Loss-of-function mutants display enhanced resistance to Botrytis cinerea and Pectobacterium carotovorum. Its expression is repressed by pathogen infection and biological elicitors and is induced abscisic acid.Expression is strongly repressed by elicitors and fungal infection, and is induced by the hormone abscisic acid (ABA). Insertional mutants show increased expression of PHYTOALEXIN-DEFICIENT 3 (PAD3), enhanced resistance to Botrytis cinerea and Pectobacterium carotovorum infection and reduced physiological responses to ABA, suggesting that LYK3 is important for the cross-talk between signaling pathways activated by ABA and pathogens (PMID:24639336). |
| AT2G23770 | Encodes a putative LysM-containing receptor-like kinase LYK4. Shares overlapping function with LYK5 in mediating chitin-triggered immune responses. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain. |
| AT1G75020 | lysophosphatidyl acyltransferase 4;(source:Araport11) |
| AT2G45670 | Encodes an acyl-CoA: lysophosphatidylethanolamine acyltransferase with 20:0-CoA being the best acyl donor. Mutations adversely affect the growth of plants and result in decreased lipid content in roots and seeds. |
| AT1G12640 | Encodes a lysophosphatidylcholine acyltransferase (LPCAT). Participates in the Lands cycle in developing seeds. |
| AT5G63190 | Encodes a member of the MRF (MA3 DOMAIN-CONTAINING TRANSLATION REGULATORY FACTOR) gene family under TOR control that is transcriptionally induced by dark and starvation. MRF1 can be phosphorylated in vitro by S6K1 and S6K2. |
| AT1G22730 | MA3 domain-containing protein;(source:Araport11) |
| AT5G50850 | Transketolase family protein;(source:Araport11) |
| AT5G65070 | Encodes MADS-box containing FLC paralog. Five splice variants have been identified but not characterized with respect to expression patterns and/or differing function. Overexpression of the gene in the Landsberg ecotype leads to a delay in flowering, transcript levels of MAF4 are reduced after a 6 week vernalization. |
| AT5G22830 | Transmembrane magnesium transporter that is essential for chloroplast development and photosynthesis. One of nine family members. |
| AT1G16010 | Transmembrane magnesium transporter. One of nine family members. |
| AT3G19640 | Transmembrane magnesium transporter. One of nine family members. |
| AT4G25080 | Encodes a protein with methyltransferase activity responsible for the methylation of magnesium protoporphyrin IX. Mutants defective in this gene are affected in chlorophyll biosynthesis and show a reduction in the accumulation of a number of major thylakoid-associated proteins including components of PSI (LHCI), PSII (LHCII, D1, CP43) and the cytochrome b6f complex (Cytf). By contrast, no significant changes were detected for the proteins of the stroma and the chloroplast envelope. |
| AT4G34950 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G68990 | MGP3 (male gametophyte-defective 3) belongs to a small family of nuclear-encoded Phage type RNA polymerases (RPOTs) involved in the transcription of mitochondrial genes in Arabidopsis thaliana. Mutation in MGP 3 significantly retarded pollen tube growth and caused defective embryo development. |
| AT4G01220 | Encodes MGP4 (MALE GAMETOPHYTE DEFECTIVE 4), a rhamnogalacturonan II xylosyltransferase important for growth of pollen tubes and roots. |
| AT1G66170 | Encodes a PHD-domain containing protein required for male meiosis. Gene is expressed in developing male meiocytes and protein is localized to nuclear euchromatin specifically during diplotene. Required to regulate microtubule organization and cell cycle transitions during male meiosis, and functions as a direct transcription activator of the meiotic gene TDM1. |
| AT1G19890 | histone 3.3, male-gamete-specific expression. Direct target promoter of the male germline-specific transcription factor DUO1. |
| AT1G72250 | Malectin domain kinesin. |
| AT2G22610 | Malectin domain kinesin. Possible role in cell division, with a possible secondary function in the nuclei. |
| AT3G10920 | manganese superoxide dismutase (MSD1) |
| AT4G27940 | manganese tracking factor for mitochondrial SOD2;(source:Araport11) |
| AT1G78850 | curculin-like (mannose-binding) lectin family protein, low similarity to ser/thr protein kinase from Zea mays (GI:2598067); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein. Belongs to GNA domain lectin family. Enhances PAP26 function to facilitate Pi-scavenging by Pi-starved plants. |
| AT5G43710 | Glycosyl hydrolase family 47 protein;(source:Araport11) |
| AT1G01560 | Member of MAP Kinase family. Flg22-induced activation is blocked by AvrRpt2. |
| AT1G73670 | member of MAP Kinase The mRNA is cell-to-cell mobile. |
| AT2G01450 | MPK17 Map kinase family member. Mutants have increased numbers of peroxisomes a phenotype that can be suppressed by mutations in PMD1. This and other treatments, suggests a function in control of peroxisome proliferation in salt stress. |
| AT3G14720 | member of MAP Kinase The mRNA is cell-to-cell mobile. |
| AT2G42880 | member of MAP Kinase |
| AT2G18170 | MAP kinase 7;(source:Araport11) |
| AT3G18040 | Encodes a protein with similarity to MAP kinases (MAPK9).Expressed preferentially in guard cells and appears to be involved in reactive oxygen species mediated ABA signaling. |
| AT3G06230 | member of MAP Kinase Kinase |
| AT1G73500 | member of MAP Kinase Kinase family. Autophosphorylates and also phosphorylates MPK3 and MPK6. Independently involved in ethylene and calmalexin biosynthesis. Induces transcription of ACS2, ACS6, ERF1, ERF2, ERF5, ERF6, CYP79B2, CYP79B3, CYP71A13 and PAD3. |
| AT3G18690 | Encodes a nuclear-localized member of a plant specific gene family involved in mediating responses to pathogens. Interacts with WRKY transcriptional regulators. |
| AT1G80180 | Encodes a substrate of the MAPK kinases. Phenotypic analyses of Arabidopsis expressing phosphorylation site mutant forms of At1g80180.1 showed clustered stomata and higher stomatal index in cotyledons expressing the phosphomimetic form of At1g80180.1. Tightly connected with MAPK signaling to fine-tune stomatal production and patterning. |
| AT1G15400 | Tightly connected with MAPK signaling to fine-tune stomatal production and patterning. |
| AT2G15890 | Encodes CBP1, a regulator of transcription initiation in central cell-mediated pollen tube guidance. |
| AT2G18650 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G35340 | helicase domain-containing protein;(source:Araport11) |
| AT3G02570 | Encodes a protein with phosphomannose isomerase activity. |
| AT4G00060 | Nucleotidyltransferase family protein;(source:Araport11) |
| AT1G06220 | Encodes a protein with similarity to splicing factor Snu114. Snu114 is thought to be involved in activation of the splicosome. Loss of GFA1 function results in reduced female fertility. Approximately 50% of ovules abort due to defects in the female gametophyte. In mutant gametophytes antipodal cells express egg cell markers suggesting a defect in specification of cell fate.GFA1 is also required to restrict the expression of LIS. The mRNA is cell-to-cell mobile. |
| AT5G45800 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G01280 | Involved in regulation of thermo tolerance. |
| AT1G70170 | Matrix metalloprotease. Expression induced by fungal and bacterial pathogens. Mutants are late flowering with early senescence. |
| AT4G34830 | Encodes MRL1, a conserved pentatricopeptide repeat protein, required for stabilization of rbcL mRNA. |
| AT3G59350 | Pti-like protein. Interacts with CLV1 and functions in CLE peptide signaling pathway in root development. Membrane localization is dependent on palmytolation. |
| AT5G23820 | ML3 can be modified by NEDD8 and ubiquitin. ML3 expression is regulated by NAI1. ML3 expression is regulated by MeJA, ethylene and wounding. ml3-3 is more susceptible against infections with Alternaria brassicicola and more resistant against infections with Pseudomonas syringae DC3000. |
| AT4G08850 | MIK1 encodes a receptor kinase that forms a complex with MDIS1/MIK2 and binds LURE1, the female pollen guidance chemi-attractant. MIK1 phosphorylates MDIS1 and is autophosphorylated. |
| AT1G53470 | mechanosensitive channel of small conductance-like 4;(source:Araport11) |
| AT3G14810 | mechanosensitive channel of small conductance-like 5;(source:Araport11) |
| AT1G78610 | mechanosensitive channel of small conductance-like 6;(source:Araport11) |
| AT4G34040 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G03220 | Encodes together with its paralog MED7B a subunit of the middle module of the transcriptional co-regulator Mediator complex. Regulates genes required for normal development of etiolated seedlings. |
| AT5G03500 | Encodes together with its paralog MED7A a subunit of the middle module of the transcriptional co-regulator Mediator complex. Regulates genes required for normal development of etiolated seedlings. |
| AT1G02580 | Encodes the imprinted gene MEA that belongs to Polycomb Repressive Complex 2 (PRC2) and has a SET domain for methyltransferase activity and is involved in the stable transcriptional silencing of target genes. It negatively regulates seed development in the absence of fertilization. Mutations in this locus result in embryo lethality. MEA is imprinted in the endosperm. The maternal allele is expressed and the paternal allele is silent. MEA is controlled by DEMETER (DME), a DNA glycosylase required to activate MEA expression, and METHYLTRANSFERASE I (MET1), which maintains CG methylation at the MEA locus. MEA is involved in the negative regulation of its own imprinted gene expression; the effect is not only allele-specific but also dynamically regulated during seed development. In the ovule, the MEA transcripts are accumulated at their highest level before fertilization and gradually decrease after fertilization |
| AT1G26665 | Mediator complex, subunit Med10;(source:Araport11) |
| AT3G01435 | Expressed protein;(source:Araport11) |
| AT5G09850 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT5G63480 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
| AT2G03070 | Encodes a subunit of the Mediator complex. Regulates plant defense and flowering. |
| AT5G38990 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT5G39000 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT5G07930 | A member of mei2-like gene family; phylogenetic analysis revealed that it belongs to the fourth clade of mei2-like proteins, with conserved C-terminal RNA recognition motif (RRM) only. |
| AT2G42890 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML2 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. AML2 is expressed during early embryo development (heart and torpedo stage) and predominantly in vegetative organs; no significant accumulation was detected in floral apices. |
| AT5G07290 | AML4 A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML4 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM14. AML4 is expressed during embryo development (heart and torpedo stage) and in vegetative and floral apices. |
| AT5G61960 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML1 is a member of two sister clades of mei2-like gene family, AML1 through AML5 and belongs to the clade named ALM14. AML1 is expressed during early embryo development, particularly along embryonic axis at torpedo stage, in shoot apex (weaker expression) and in the organogenic regions of floral apices. |
| AT1G29400 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML5 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. Among mei2-like genes, AML5 is the transcript with highest frequency of alternative splicing. Expression was detected during embryo development (heart and torpedo stage) and in vegetative and floral apices. |
| AT3G02980 | Encodes MEIOTIC CONTROL OF CROSSOVERS1 (MCC1), a GCN5-related histone N-acetyltransferase. MCC1 appeared to be required in meiosis for normal chiasma number and distribution and for chromosome segregation. Activation tagging line has increased level of histone H3 acetylation. |
| AT5G54260 | DNA repair and meiotic recombination protein, component of MRE11 complex with RAD50 and NBS1 |
| AT5G45420 | The gene encodes a MYB transcription factor belons to R2R3-MYB family of transcription factors. Knock-down mutant analysis indicates its role in root hair elongation. |
| AT4G27860 | vacuolar iron transporter (VIT) family protein;(source:Araport11) |
| AT5G24290 | Vacuolar iron transporter (VIT) family protein;(source:Araport11) |
| AT1G77870 | membrane-anchored ubiquitin-fold protein 5 precursor;(source:Araport11) |
| AT1G22050 | membrane-anchored ubiquitin-fold protein 6 precursor;(source:Araport11) |
| AT5G52900 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT5G54110 | Encodes a highly polar protein with more than 60% hydrophilic amino acid residues that is associated with the plasma membrane. It has limited secondary structure similarity to VAP-33 from Aplysia, which may be involved in membrane trafficking. The mRNA is cell-to-cell mobile. |
| AT4G14965 | membrane-associated progesterone binding protein 4;(source:Araport11) |
| AT4G21750 | Encodes a homeobox protein similar to GL2. It is expressed in both the apical and basal daughter cells of the zygote as well as their progeny. Expression is detected starting the two-celled stage of embryo development and is later restricted to the outermost, epidermal cell layer from its inception. Its promoter is highly modular with each region contributing to specific aspects of the gene's spatial and temporal expression. Double mutant analysis with PDF2, another L1-specific gene, suggests that their functions are partially redundant and the absence of both of the genes result in abnormal shoot development. |
| AT5G04200 | Encodes a putative metacaspase. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
| AT3G12100 | Cation efflux family protein;(source:Araport11) |
| AT1G07600 | metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage. |
| AT3G09390 | metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage |
| AT3G15353 | metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage |
| AT2G36880 | methionine adenosyltransferase 3;(source:Araport11) |
| AT1G13270 | Encodes a methionine aminopeptidase formerly called MAP1B, renamed to MAP1C. |
| AT1G64660 | Encodes a functional methionine gamma-lyase, a cytosolic enzyme catalyzes the degradation of methionine into methanethiol, alpha-ketobutyrate and ammonia. The catabolism of excess methionine is important to methionine homeostasis. The mRNA is cell-to-cell mobile. |
| AT4G29840 | threonine synthase |
| AT3G17390 | S-adenosylmethionine synthetase |
| AT2G18030 | Peptide methionine sulfoxide reductase family protein;(source:Araport11) |
| AT4G04830 | methionine sulfoxide reductase B5;(source:Araport11) |
| AT4G21850 | methionine sulfoxide reductase B9;(source:Araport11) |
| AT3G29770 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
| AT5G10300 | Encodes a protein with R-selective hydroxynitrile lyase activity. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
| AT4G22745 | Protein containing methyl-CpG-binding domain. |
| AT1G15340 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT3G15790 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT3G01460 | Encodes a protein with a methyl-CpG-binding domain. Has sequence similarity to human MBD proteins. Involved in the modification of the FLC chromatin acetylation state to affect FLC expression. Mutants show an early flowering, and enhanced shoot branching phenotypes. |
| AT3G12290 | MTHFD1 encodes a cytoplasmic bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase that is involved in one carbon metabolism and control of DNA methylation. |
| AT3G59970 | methylenetetrahydrofolate reductase MTHFR1 mRNA, complete |
| AT1G11580 | methylesterase PCR A;(source:Araport11) |
| AT4G34840 | Encodes one of the 5'-methylthioadenosine nucleosidases (AT4G38800/MTN1; AT4G34840/MTN2). Double mutant, mtn1-1mtn2-1, retains approximately 14% of the MTN enzyme activity present in the wild type and displays a pleiotropic phenotype that includes altered vasculature and impaired fertility. |
| AT1G18500 | Encodes an active Arabidopsis isopropylmalate synthase IPMS1. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS1 can be compensated by a second isopropylmalate synthase gene IPMS2 (At1g74040). The mRNA is cell-to-cell mobile. |
| AT5G49160 | Encodes a cytosine methyltransferase MET1. Required for silencing of FWA paternal allele in endosperm. Two lines with RNAi constructs directed against DMT1 have reduced agrobacterium-mediated tumor formation. The mRNA is cell-to-cell mobile. |
| AT2G38700 | Encodes mevalonate diphosphate decarboxylase, the enzyme that catalyzes the synthesis of isopentenyl diphosphate, used in sterol and isoprenoid biosynthesis. The protein appears to form a homodimeric complex. Incidentally, it was shown that the Arabidopsis MVD protein could also interact with its yeast homolog to form a heterodimer. |
| AT5G27450 | Encodes a protein with mevalonate kinase activity involved in the mevalonate pathway. |
| AT5G10945 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC |
| AT5G55835 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAAAGAGAGCAC |
| AT3G10745 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCCCAAAUGUAGACAAAGCA. Pri-mRNA coordinates for MIR158a (converted to TAIR10 based on PMID19304749): Chr3: 3366553-3366019 (reverse), length: 535 bp; exon coordinates: exon 1: 3366553 to 3366303, exon 2: 3366185 to 3366019; mature miRNA and miRNA* are located on exon 1. |
| AT1G73687 | Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUUGGAUUGAAGGGAGCUCUA. Functions redundantly with MIR159B. Plants that are doubly mutated for MIR159AB have curled leaves and reduced stature. Pri-mRNA coordinates for MIR159a (converted to TAIR10 based on PMID19304749): Chr1: 27713700-27712893 (reverse), length: 808 bp; exon coordinates: exon 1: 27713700 to 27712893, mature miRNA and miRNA* are located on exon 1. |
| AT2G39175 | Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). Hypomorphic mutants exhibit defects in embryo, vegetative and floral development.MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA. Pri-mRNA coordinates for MIR160a (converted to TAIR10 based on PMID19304749): Chr2: 16339853-16341886 (forward), length: 2034 bp; exon coordinates: exon 1: 16339853 to 16340469, exon 2: 16341621 to 16341886; mature miRNA and miRNA* are located on exon 1. |
| AT1G66725 | Encodes a microRNA that targets several SAMT family members. miR163, is highly expressed in A. thaliana diploids but down-regulated in A. thaliana autotetraploids and repressed in A. arenosa and A. suecica. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGAAGAGGACUUGGAACUUCGAU |
| AT2G46685 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. This particular miRNA is involved in the regulation of vascular development in inflorescence stems, primarily through the regulation of mRNA cleavage of the class III homeodomain-leucine zipper transcription factor ATHB15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC. Pri-mRNA coordinates for MIR166a (converted to TAIR10 based on PMID19304749): Chr2: 19175959-19177071 (forward), length: 1113 bp; exon coordinates: exon 1: 19175959 to 19176341, exon 2: 19176820 to 19177071; mature miRNA and miRNA* are located on exon 1. |
| AT5G08717 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC |
| AT3G22886 | Encodes a microRNA that targets ARF family members ARF6 and ARF8. Essential for fertility of both ovules and anthers. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGAAGCUGCCAGCAUGAUCUA. Pri-mRNA coordinates for MIR167a (converted to TAIR10 based on PMID19304749): Chr3: 8108021-8108622 (forward), length: 602 bp; exon coordinates: exon 1: 8108021 to 8108622; mature miRNA and miRNA* are located on exon 1. |
| AT4G19395 | Encodes a microRNA that targets AGO1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCGCUUGGUGCAGGUCGGGAA. MIR168a is highly expressed and predominantly produces a 21-nt miR168 species. By contrast, MIR168b is expressed at low levels and produces an equal amount of 21- and 22-nt miR168 species. Only the 21-nt miR168 is preferentially stabilized by AGO1, and consequently, the accumulation of the 22-nt but not the 21-nt miR168 is reduced when DCL1 activity is impaired. mir168a mutants with strongly reduced levels of 21-nt miR168 are viable but exhibit developmental defects, particularly during environmentally challenging conditions. |
| AT3G13405 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: CAGCCAAGGAUGACUUGCCGA |
| AT1G62035 | Encodes a microRNA that targets several SCL family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGAGCCGUGCCAAUAUCACG. Pri-mRNA coordinates for MIR171c (converted to TAIR10 based on PMID19304749): Chr1: 22930427-22929567 (reverse), length: 861 bp; exon coordinates: exon 1: 22930427 to 22930342, exon 2: 22930233 to 22930047, exon 3: 22929839 to 22929567; mature miRNA and miRNA* are located on exon 1. |
| AT5G35407 | Encodes a microRNA that targets several GRF family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCCACAGCUUUCUUGAACUU. Expression increased with leaf development, antagonizing with expression of GRFs. Transcript accumulates in the distal zone of young developing seeds, restricing the expression of GRF2 to the proximal part. miR396 attenuates cell proliferation in developing leaves through the repression of GRF activity and a decrease in the expression of cell cycle genes. |
| AT2G03445 | Encodes a microRNA that targets both CSD and CytC oxidase family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGUGUUCUCAGGUCACCCCUU. Down-regulated by biotic and abiotic stress. |
| AT5G14565 | Encodes a microRNA that targets both CSD and CytC oxidase family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGUGUUCUCAGGUCACCCCUG. Down-regulated by biotic and abiotic stress. |
| AT5G62162 | Encodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCAAAGGAGAGUUGCCCUG |
| AT1G31358 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:ATTAACGCTGGCGGTTGCGGCAGC |
| AT2G47015 | Encodes a microRNA that targets both a Laccase and Plantacyanin-like family member. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AUGCACUGCCUCUUCCCUGGC |
| AT3G13724 | Encodes a microRNA that targets CMT3. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGGUGGUGAUCAUAUAAGAU |
| AT4G03039 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UAGUCCGGUUUUGGAUACGUG |
| AT5G08210 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGUAGCAGUAGCGGUGGUAA |
| AT5G40384 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: ACAAAAUCCGUCUUUGAAGA |
| AT5G46795 | microspore-specific promoter 2;(source:Araport11) |
| AT1G23060 | hypothetical protein;(source:Araport11) |
| AT3G47690 | Encodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis. |
| AT5G44610 | Encodes a protein with seven repeated VEEKK motifs. RNAi and overexpression experiments suggest that the gene is not involved in cell division but might be consequential for cell shape of epidermal and cortical cells. The protein encoded by this gene binds to cortical microtubules and inhibits tubulin polymerization. Associates to the plasma membrane and interacts with calmodulin and phosphatidylinositol phosphates, indicating an involvement in cellular signal transduction. Expression is enhanced by abiotic and hormonal factors. Induced during senescence.Interacts with Ca2+/calmodulin complex, phosphatidylinositol phosphates, and free Ca2+. |
| AT4G26760 | microtubule-associated protein 65-2;(source:Araport11) |
| AT2G38720 | microtubule-associated protein 65-5;(source:Araport11) |
| AT1G14690 | microtubule-associated protein 65-7;(source:Araport11) |
| AT1G14840 | Encodes a microtubule associated protein (MAP70-4). Expressed in all tissues. |
| AT4G35920 | Encodes an integral plasma membrane protein. Functionally complements the yeast mid1 mutant, a deficiency of Ca2+ influx. Involved in Ca2+ influx and mechanical sensing in roots. An over-expression line showed increased Ca2+ uptake than the wild type plant. The primary root of a knock-out mutant failed to penetrate a harder agar medium from a softer medium. |
| AT3G51660 | Chemokine-like MDL protein; modulate flowering time and innate immunity in plants. |
| AT5G65970 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO10 belongs to the clade III, with AtMLO5, AtMLO7, AtMLO8, and AtMLO9. The gene is expressed in root and cotyledon vascular system, in root-shoot junction and lateral root primordia and in developing siliques, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s |
| AT5G53760 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO11 belongs to the clade I, with AtMLO4 and AtMLO14. The gene is expressed during early seedling growth (in primary root), in root tips and lateral root primordia, and in very young leaves, and in flowers and fruit abscission zone, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT2G39200 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in root tips and cotyledon vascular system, in floral organs (anthers and stigma), and in fruit abscission zone, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G11310 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO2 belongs to the clade IV, with AtMLO3, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in roots, in vascular system of cotyledons and young leaves,and in fruit abscission zone; it was not expressed in anthers and pollen, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). mlo resistance in A. thaliana does not involve the signaling molecules ethylene, jasmonic acid or salicylic acid, but requires a syntaxin, glycosyl hydrolase and ABC transporter. It is a novel virulence target of the P. syringae type III secreted effector HopZ2. |
| AT1G11000 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO4 belongs to the clade I, with AtMLO11 and AtMLO14. The gene is expressed during early seedling growth, in roots and lateral root primordia, in flower and fruit abscission zone, in vascular system of root, cotyledons and young leaves, it was not expressed in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G18835 | Encodes a small zinc finger protein whose overexpression induces ectopic meristem formation on leaf margins. |
| AT2G20980 | Similar to MCM10, which in other organism was shown to be involved in the initiation of DNA replication. |
| AT2G16440 | Regulates DNA replication via interaction with BICE1 and MCM7. |
| AT3G63150 | Encodes a calcium binding GTPases that is localized to the mitochondrion and is involved in salt stress response. |
| AT1G26800 | MPSR1 is cytoplasmic E3 ligase that senses misfolded proteins independently of chaperones and targets those proteins for degradation via the 26S proteasome. Involved in the regulation of the homeostasis of sensor NLR immune receptors. |
| AT4G21090 | MITOCHONDRIAL FERREDOXIN 2;(source:Araport11) |
| AT1G09575 | Mitochondrial calcium channel. |
| AT3G07480 | Forms an accessory complex I subunit that is part of the bridge domain, which connects the membrane and the peripheral arm of mitochondrial complex I. |
| AT3G18970 | Encodes a pentatricopeptide repeat protein (PPR) protein involved in mitochondrial mRNA editing. |
| AT2G46050 | E-PPR protein involved in mitochondrial RNA editing.It is involved in editing of the mitochondrial tatC transcript at site 581. |
| AT4G04750 | Putative mitochondrial F1F0-ATPase. |
| AT5G09590 | heat shock protein 70 (Hsc70-5); nuclear |
| AT5G23395 | Encodes Mia40, a component of the mitochondrial intermembrane space assembly machinery involved in the import pathway of the small intermembrane space proteins. |
| AT4G01400 | Pentatricopeptide Repeat Protein involved in splicing of nad4, nad 5, nad 1 and nad2 introns which affects biogenesis of the respiratory complex I. |
| AT3G15020 | Lactate/malate dehydrogenase family protein;(source:Araport11) |
| AT3G16480 | mitochondrial processing peptidase alpha subunit;(source:Araport11) |
| AT3G13930 | Encodes a subunit of the mitochondrial pyruvate dehydrogenase complex. |
| AT4G35490 | mitochondrial ribosomal protein L11;(source:Araport11) |
| AT5G01340 | Transports citrate, isocitrate and aconitate, succinate and fumarate. Catalyzes a fast counter-exchange transport as well as a low uniport of substrates, exhibits a higher transport affinity for tricarboxylates than dicarboxylates. Might be involved in storage oil mobilization 78 at early stages of seedling growth and in nitrogen assimilation in root tissue by 79 catalyzing citrate/isocitrate or citrate/succinate exchanges. |
| AT1G74120 | Encodes a mitochondrial transcription termination factor mTERF15. Required for mitochondrial nad2 intron 3 splicing and functional complex I activity. |
| AT1G10210 | Encodes ATMPK1. Kinase is activated by wounding. |
| AT2G46070 | Encodes a MAP kinase protein. MPK12 interacts with the IBR5 protein phosphatase in vitro and in vivo, and it can be dephosphorylated and inactivated by IBR5. MPK12 appears to be a negative regulator of auxin signlaing. MPK12 RNAi lines are hypersensitive to auxin in root elongation and transcriptional response assays, but they appear to have normal sensitivity to ABA. MPK12 is a nuclear protein and its kinase activity is increased following auxin treatment. MPK12 transcripts are widely expressed in seedlings, but MPK12 expression is stronger in guard cells than in other cell types in mature plants. |
| AT5G19010 | member of MAP Kinase |
| AT3G45640 | Encodes a mitogen-activated kinase whose mRNA levels increase in response to touch, cold, salinity stress and chitin oligomers.Also functions in ovule development. Heterozygous MPK3 mutants in a homozygous MPK6 background are female sterile due to defects in integument development. MPK3 can be dephosphorylated by MKP2 in vitro. The mRNA is cell-to-cell mobile. |
| AT2G30040 | Member of MEKK subfamily. Induced by jasmonic acid and wounding in involved in insectivory response signaling. Iinteracts with At5g40440, and activates At1g59580. |
| AT2G32510 | Member of MEKK subfamily involved in wound and JA induced signaling.Interacts with At5g40440, and activates At1g59580. |
| AT5G67080 | member of MEKK subfamily |
| AT3G50310 | Encodes a member of MEKK subfamily. Target promoter of the male germline-specific transcription factor DUO1. Involved in osmotic stress response via regulation of MPK6 activity. It also plays an important role in regulating cell division and cell elongation in the primary root meristematic and elongation areas. Mutants show defects in root microtubule organization.It phosphorylates MPK18 and MKK3.It is a positive regulator of ABA-induced stomatal closure that acts by phosphorylating MKK5. |
| AT4G36950 | member of MEKK subfamily |
| AT1G53570 | Encodes a member of the MEKK subfamily that functions redundantly with MAPKKK3 to activate MPK3/6 downstream of multiple pattern recognition receptors and confer resistance to both bacterial and fungal pathogens. |
| AT5G66850 | Encodes a member of the MEKK subfamily that functions redundantly with MAPKKK3 to activate MPK3/6 downstream of multiple pattern recognition receptors and confer resistance to both bacterial and fungal pathogens. |
| AT2G41660 | Essential for hydrotropism in roots. Mutant roots are defective in hydrotropism, and have slightly reduced phototropism and modified wavy growth response. Has normal gravitropism and root elongation. |
| AT1G35260 | MLP-like protein 165;(source:Araport11) |
| AT1G70890 | MLP-like protein 43;(source:Araport11) |
| AT5G45550 | Encodes a gene product involved in both sporogenesis and gametogenesis and is required for the normal progression of megasporogenesis and microsporogenesis. Additional alleles were isolated in a screen for enhancers of PID and genetic analysis indicates a role for MOB1A in auxin mediated signaling. |
| AT1G54030 | Encodes a vacuolar protein. Mutation causes organizational defects in the endoplasmic reticulum and aberrant protein trafficking in the plant secretory pathway. The mRNA is cell-to-cell mobile. |
| AT4G24680 | Encodes MOS1 (MODIFIER OF snc1). MOS1 contains a BAT2 domain that is conserved in plants and animals. MOS1 associates with the promoter of SNC1 and regulates its expression. |
| AT3G18165 | Encodes MOS4 (Modifier of snc1, 4), a nuclear protein homologous to human Breast Cancer-Amplified Sequence (BCAS2). MOS4 interacts with AtCDC5 and PRL1. All three proteins are essential for plant innate immunity. |
| AT1G80310 | MOT2 encodes a molybdate transporter which locates to the vacuolar membrane. Loss-of-function (knock out) mutants show elevated molydate levels in rosette leaves and in fully senescent leaves, but decreased MoO4 levels in seeds. Under conditions of molybdate deficiency leaves from mot2::tDNA mutants show strongly reduced nitrate reductase activity. The mot2 gene is slightly expressed in young and mature leaves, but strongly in senescing leaves. This observation points to a function of MOT2 in molybdate transfer from leaves to seeds during plant senescence. |
| AT3G09940 | Encodes a member of the monodehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica. |
| AT3G27820 | Encodes a peroxisome membrane-bound monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2 |
| AT2G11810 | MGD3 is the major enzyme for galactolipid metabolism during phosphate starvation. Does not contribute to galactolipid synthesis under P1-sufficient conditions. |
| AT4G15760 | Encodes a protein with similarity to monooxygenases that are known to degrade salicylic acid (SA). |
| AT1G02740 | MRG1 and MRG2 proteins act as readers of H3K4me3/H3K36me3 marked chromatin. They interact with each other as well as several other protein classes, to modulate the activity of flowering genes. |
| AT1G21920 | MRF1 is related to SET7/9 proteins but contains an atypical SET domain. It is expressed in phloem and mutants have a weak late flowering phenotype. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G08060 | Encodes a transcriptional silencer that is required for proper expression of PRR/NLR immune receptor genes. |
| AT4G18640 | Required for root hair elongation during tip growth. The mRNA is cell-to-cell mobile. |
| AT1G28280 | VQ motif-containing protein;(source:Araport11) |
| AT5G53830 | VQ motif-containing protein;(source:Araport11) |
| AT5G10490 | A member of MscS-like gene family, structurally very similar to MSL3, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL2-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. |
| AT5G63800 | Involved in mucilage formation. Mutants form columella and outer cell wall architecture of the mucilage cells resembles wild-type. However, mum2 seeds completely lack seed coat mucilage. This mutation appears to represent a later step in the development of this cell-type. Encodes a beta-galactosidase involved in seed coat mucilage biosynthesis. Member of Glycoside Hydrolase Family 35 |
| AT2G22900 | Encodes MUCI10, a galactomannan-1,6-galactosyltransferase. MUCI10 likely decorates glucomannan, synthesized by CSLA2, with galactose residues in vivo. The degree of galactosylation is essential for the synthesis of the GGM backbone, the structure of cellulose, mucilage density, as well as the adherence of pectin. |
| AT4G35050 | Encodes a WD-40 repeat protein similar to yeast MSI1. The predicted protein has a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT2G43290 | Calmodulin-like MSS3.Encodes an endomembrane localized member of the CML subfamily VII. Contains a canonical CaM domain and unique N-terminal extension that distinguishes it from other members of the subfamily. |
| AT1G04150 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT3G03680 | Member of a family of Multiple C2 Domain and Transmembrane Region Proteins. |
| AT5G17980 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT3G57880 | Required for maintenance of inflorescence and shoot SAMs and normal development of the derived vascular cambium, functions in the SAM to promote continuous organogenesis, affects SAM development through STM, where it affects intracellular localization of STM in SAM cells in the peripheral region and prevents STM localization toward the cell wall of SAM cells in the peripheral region. |
| AT1G22610 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G00700 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT5G44780 | Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
| AT1G11430 | Encodes a protein involved in RNA editing in chloroplasts. The mRNA is cell-to-cell mobile. |
| AT2G20370 | Encodes a xyloglucan galactosyltransferase located in the membrane of Golgi stacks that is involved in the biosynthesis of fucose. It is also involved in endomembrane organization. It is suggested that it is a dual-function protein that is responsible for actin organization and the synthesis of cell wall materials. The mRNA is cell-to-cell mobile. |
| AT4G36180 | LRR-RLK which regulates lateral root development. |
| AT3G06120 | Encodes a basic helix-loop-helix (bHLH) protein that controls meristemoid differentiation during stomatal development. In the absence of MUTE, meristemoids abort after excessive asymmetric divisions and fail to differentiate stomata. MUTE expression in the meristemoid is required for SLGCs differentiation as pavement cells. Epidermal cells lose their competence to respond to MUTE overexpression during cotyledon development. |
| AT3G24320 | Encodes a DNA binding protein that promotes re-arrangements of mitochondrial genome. Mutations affects mitochondrial gene expression, and impairs mitochondrial function. Dual targeting of the protein to mitochondria and chloroplasts caused by alternative translation initiation. Plastid MSH1 depletion results in variegation, abiotic stress tolerance, variable growth rate, and delayed maturity. |
| AT4G02070 | encodes a DNA mismatch repair homolog of human MutS gene, MSH6. There are four MutS genes in Arabidopsis, MSH2, MSH3, MSH6, and MSH7, which all act as heterodimers and bind to 51-mer duplexes. MSH2*MSH6 bound the (+T) substrate strongly, (T/G) well, and (+AAG) no better than it did a (T/A) homoduplex. |
| AT3G09230 | member of MYB3R- and R2R3- type MYB- encoding genes |
| AT3G06490 | Encodes a MYB transcription factor involved in regulating anther dehiscence as well as regulating cell death, and cuticle-related Botrytis immunity. |
| AT3G55730 | putative transcription factor MYB109 (MYB109) mRNA, |
| AT3G62610 | Member of the R2R3 factor gene family. Together with MYB12 and MYB111 redundantly regulates flavonol biosynthesis. |
| AT5G49330 | Member of the R2R3 factor gene family. Together with MYB11 and MYB111 redundantly regulates flavonol biosynthesis. |
| AT3G27785 | MYB118 encodes a myb transcription factor that represses endosperm maturation and, along with MYB115, regulates glucosinolate biosynthesis. |
| AT3G23250 | Member of the R2R3 factor gene family. Key regulator of lignin biosynthesis in effector-triggered immunity |
| AT1G66230 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
| AT3G27810 | Encodes a member of the R2R3-MYB transcription factor gene family. Induced by jasmonate. Involved in jasmonate response during stamen development. MYB21 interacts with JAZ proteins, and functions redundantly with MYB24 and MYB57 to regulate stamen development. Promotes flavonol biosynthesis through regulation of FLS1 gene expression. |
| AT5G61420 | Encodes a nuclear localized member of the MYB transcription factor family. Involved in positive regulation of aliphatic glucosinolate biosynthesis.Expression is induced by touch, wounding and glucose. |
| AT1G22640 | MYB-type transcription factor (MYB3) that represses phenylpropanoid biosynthesis gene expression |
| AT3G28910 | Encodes a MYB family transcriptional regulator.It is a a positive regulator of the pathogen-induced hypersensitive response and of brassinosteroid and abscisic acid signaling and a negative regulator of photomorphogenesis. Accumulation of MYB30 is light regulated and activity is modulated by SUMOlaytion. MYB30 can for complexes with different bHLH components to regulate expression of different pathways. |
| AT4G34990 | Member of the R2R3 factor gene family. |
| AT5G60890 | Myb-like transcription factor that modulates expression of ASA1, a key point of control in the tryptophan pathway; mutant has deregulated expression of ASA1 in dominant allele. Loss of function allele suggests ATR1 also functions at a control point for regulating indole glucosinolate homeostasis. |
| AT3G09370 | C-myb-like transcription factor (MYB3R3) mRNA. It is a target of CDK phosphorylation and blocks cell division in response to DNA damage. |
| AT5G02320 | Encodes a putative c-MYB-like transcription factor of the MYB3R factor gene family (MYB3R5). |
| AT4G38620 | Encodes a R2R3 MYB protein which is involved in the response to UV-B. It functions as a repressor of target gene expression. One of its target genes encodes cinnamate 4-hydroxylase; mutants accumulate sinapate esters in their leaves. MYB4 binds to its own promoter and represses its own expression. Nuclear localization of MYB4 depends on the action of the beta importin SAD2. The mRNA is cell-to-cell mobile. |
| AT5G14340 | Member of the R2R3 factor gene family. |
| AT5G16600 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
| AT3G48920 | Member of the R2R3 factor gene family. |
| AT1G18710 | Member of the R2R3 factor gene family. Promotes seed longevity (viability of seed over time.) Expressed in the chalazal seed coat. Overexpresion enhances resistance of seed to deterioration (PMID:32519347). |
| AT3G18100 | Member of the R2R3 transcription factor gene family. |
| AT1G16490 | Member of the R2R3 factor gene family. |
| AT5G59780 | Encodes a putative transcription factor (MYB59). In roots it is involved in K+/NO3- transport and expression of the NPF7.3 transporter. |
| AT4G09460 | Encodes myb6 DNA-binding protein. The mRNA is cell-to-cell mobile. |
| AT1G08810 | putative transcription factor of the R2R3-MYB gene family. Transcript increases under conditions that promote stomatal opening (white and blue light, abi1-1 mutation) and decreases under conditions that trigger stomatal closure (ABA, desiccation, darkness), with the exception of elevated CO2. Expressed exclusively in guard cells of all tissues. It is required for light-induced opening of stomata. Mutant shows reduced stomatal aperture which helps to limit water loss during drought. |
| AT1G09540 | Encodes putative transcription factor. Mutants lack of mucilage extrusion from the seeds during imbibition. Reduced quantities of mucilage are deposited during the development of the seed coat epidermis in myb61 mutants. Expressed in guard cells,loss of function mutations show an increase in stomatal pore opening suggesting a role in ABA independent regulation of stomatal pore size. |
| AT1G68320 | putative transcription factor: R2R3-MYB transcription family. Involved in regulation of phosphate starvation responses and gibberellic acid biosynthesis. |
| AT2G16720 | Encodes a member of MYB3R- and R2R3- type MYB- encoding gene family that acts as a repressor of flavonol biosynthesis. AtMYB7 gene expression is induced by salt treatment. |
| AT2G23290 | Member of the R2R3 factor gene family. |
| AT1G56160 | Encodes a member of the R2R3 transcription factor gene family that is involved in mediating induced systemic resistance. Genetic analysis of loss of function mutants and overexpressor lines indicates MYB72 is necessary but not sufficient for ISR.Interacts in vivo with EIL3. |
| AT4G37260 | Member of the R2R3 factor gene family. The mRNA is cell-to-cell mobile. |
| AT4G05100 | Member of the R2R3 factor gene family. |
| AT1G74430 | Encodes a putative transcription factor (MYB95). The mRNA is cell-to-cell mobile. |
| AT5G62470 | Encodes a R2R3 type Myb transcription factor whose expression is strongly induced by abscisic acid. Mediates abscisic acid signaling during drought stress response. |
| AT5G67300 | Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. The mRNA is cell-to-cell mobile. |
| AT5G47390 | Encodes a circadian-regulated transcription factor which specifically controls cell expansion during leaf development by controlling ROS homeostasis. The mRNA is cell-to-cell mobile. |
| AT4G21440 | Encodes a MYB transcription factor involved in wounding and osmotic stress response. Member of the R2R3 factor gene family. |
| AT1G71030 | Encodes a putative myb family transcription factor. In contrast to most other myb-like proteins its myb domain consists of a single repeat. A proline-rich region potentially involved in transactivation is found in the C-terminal part of the protein. Its transcript accumulates mainly in leaves. |
| AT5G18240 | Encodes MYR1 (MYR1). |
| AT3G61950 | MYC-type transcription factor which interacts with ICE1 and negatively regulates cold-responsive genes and cold tolerance. |
| AT4G39120 | Encodes a chloroplast-localized member of the myo-inositol monophosphatase family, IMPL2 (myo-Inositol monophosphatase like 2) that seems to have multiple enzymatic activities. It contributes to histidine biosynthesis based on it histidinol-phosphate phosphatase activity. In addition, the protein can act as an inositol monophosphatase and an L-galactose-1-phosphate phosphatase in vitro. |
| AT1G14520 | Encodes MIOX1. Belongs to myo-inositol oxygenase gene family. |
| AT2G19800 | Encodes a myo-inositol oxygenase family gene. |
| AT2G22240 | ** Referred to as MIPS1 in Mitsuhashi et al 2008. Myo-inositol-1-phosphate synthase isoform 2. Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT5G10170 | myo-inositol-1-phosphate synthase isoform 3.Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT5G54280 | Type VII myosin gene |
| AT1G08800 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT1G70750 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT5G16720 | caldesmon-like protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT5G66890 | RPW8 -CNL gene. |
| AT4G37670 | N-acetyl-l-glutamate synthase 2;(source:Araport11) |
| AT1G31070 | Encodes a protein that functions as an N-acetylglucosamine-1-phosphate uridylyltransferase that catalyzes the formation of UDP-N-acetylglucosamine (UDP-GlcNAc). This is an essential precursor for glycolipid and glycoprotein synthesis and is also used for regulatory protein modification in signaling pathways. The enzyme can also catalyze the reverse reaction using both UDP-GlcNAc and the less common UDP-N-acetylgalactosamine as substrates. |
| AT5G56750 | AGB1/AGG dimmer interacting protein, response to water deficit. |
| AT2G44170 | pseudogene of myristoyl-CoA:protein N-myristoyltransferase;(source:Araport11) |
| AT1G53210 | Encodes a Na+/Ca 2+ exchanger-like protein that participates in the maintenance of Ca 2+ homeostasis. The mRNA is cell-to-cell mobile. |
| AT1G49810 | member of Na+/H+ antiporter-Putative family |
| AT1G80410 | Encodes the catalytic subunit of a N-terminal acetyltransferase. |
| AT1G33060 | NAC 014;(source:Araport11) |
| AT3G15510 | Note of caution: not to be confused with another protein (AtNAC6 locus AT5G39610) which on occasion has also been referred to as AtNAC2. |
| AT5G39610 | Encodes a NAC-domain transcription factor. Positively regulates aging-induced cell death and senescence in leaves. This gene is upregulated in response to salt stress in wildtype as well as NTHK1 transgenic lines although in the latter case the induction was drastically reduced. It was also upregulated by ABA, ACC and NAA treatment, although in the latter two cases, the induction occurred relatively late when compared with NaCl or ABA treatments. Note: this protein (AtNAC6) on occasion has also been referred to as AtNAC2, not to be confused with the AtNAC2 found at locus AT3G15510. |
| AT1G56010 | Encodes a transcription factor involved auxin-mediated lateral root formation. Acts downstream of TIR1 and is regulated post-transcriptionally by miRNA164 and by SINAT5-dependent ubiquitination. |
| AT5G63790 | Encodes a member of the NAC family of transcription factors. ANAC102 appears to have a role in mediating response to low oxygen stress (hypoxia) in germinating seedlings. Its expression can be induced by beta-cyclocitral, an oxidized by-product of beta-carotene generated in the chloroplasts, mediates a protective retrograde response that lowers the levels of toxic peroxides and carbonyls, limiting damage to intracellular components. |
| AT5G66300 | Encodes a NAC-domain transcription factor. Expressed in the vascular tissue. |
| AT1G52890 | encodes a NAC transcription factor whose expression is induced by drought, high salt, and abscisic acid. This gene binds to ERD1 promoter in vitro. |
| AT5G04410 | NAC family member, functions as a transcriptional activator, regulates flavonoid biosynthesis under high light. The mRNA is cell-to-cell mobile. |
| AT1G54330 | NAC domain containing protein 20;(source:Araport11) |
| AT1G02220 | NAC domain transcription factor which functions as a negative regulator of the TDIF-PXY module and fine-tunes TDIF signaling in vascular development. Controls the balance of xylem formation and cambial cell divisions. |
| AT3G29035 | Encodes a protein with transcription factor activity. Note: this protein (AT3G29035) on occasion has also been referred to as AtNAC3, not to be confused with the AtNAC3 found at locus AT3G15500. The mRNA is cell-to-cell mobile. |
| AT3G15500 | Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3. The mRNA is cell-to-cell mobile. |
| AT1G77450 | NAC domain transcriptional regulator that is induced by ROS in roots where it regulates the expression of downstream genes such as MYB30. |
| AT1G02230 | NAC domain containing protein 4;(source:Araport11) |
| AT2G33480 | NAC domain containing protein 41;(source:Araport11) |
| AT2G43000 | Encodes a NAC transcription factor induced by hydrogen peroxide (H2O2). Involved in senescence. Over expression of the gene strongly delays senescence and enhances tolerance to various abiotic stresses. |
| AT3G01600 | NAC domain containing protein 44;(source:Araport11) |
| AT3G03200 | NAC domain containing protein 45;(source:Araport11) |
| AT3G04060 | NAC046 is a member of the NAC domain containing family of transcription factors. It was identified in a screen for regulators of chlorophyll protein gene expression. Mutants in NAC046 have delayed senescence and increased CHL content suggesting a role in regulation of senescence and chlorophyll degradation. |
| AT3G04070 | NAC domain containing protein 47;(source:Araport11) |
| AT3G04420 | NAC domain containing protein 48;(source:Araport11) |
| AT3G04430 | NAC domain containing protein 49;(source:Araport11) |
| AT1G02250 | Encodes a member of the NAC family of transcription factors. ANAC005 contains sequences specifying both nuclear and plasma membrane targeting. Overexpression results in increased xylem differentiation suggesting ANAC005 promotes xylem formation. |
| AT3G10490 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. |
| AT3G10500 | Encodes a transcriptional activator that is associated with the plasma membrane in a dormant form and is proteolytically cleaved to create a form that can enter the nucleus. It is thought to promote ROS production by binding directly to the promoters of genes encoding ROS biosynthetic enzymes during drought-induced leaf senescence. The mRNA is cell-to-cell mobile. |
| AT3G49530 | Transcription factor that serves as a molecular link between cold signals and pathogen resistance responses. Undergoes proteolytic processing triggered by cold-induced changes in membrane fluidity.It relocates from the plasma membrane to the nucleus in response to ER stress. NAC062 is phosphorylated by SnRK2.8 at Thr-142. |
| AT4G01520 | NAC domain containing protein 67;(source:Araport11) |
| AT4G28530 | Member of NAC family of transcription factors. Along with NAC2, KIR1 positively regulates programmed cell death of stigmatic tissue. |
| AT5G04400 | NAC domain protein;(source:Araport11) |
| AT5G17260 | NAC domain containing protein 86;(source:Araport11) |
| AT4G35580 | Encodes a calmodulin-binding NAC protein (CBNAC). Contains calmodulin-binding domain in the C-terminus of the protein. Functions as a calmodulin-regulated transcriptional repressor. |
| AT1G69490 | Encodes a member of the NAC transcription factor gene family. It is expressed in floral primordia and upregulated by AP3 and PI. Its expression is associated with leaf senescence. The mRNA is cell-to-cell mobile. |
| AT3G21070 | Encodes a protein with NAD(H) kinase activity. |
| AT1G04280 | Encodes a mitochondrial CaM/Ca2+-dependent NAD+ kinase. |
| AT1G78590 | Encodes a NADH kinase which can synthesize NADPH from NADH; also utilizes NAD+ as substrate although NADH is the preferred substrate. |
| AT4G05020 | Miitochondrial alternative NADH dehydrogenase. |
| AT2G47490 | Encodes a chloroplast-localized NAD+ transporter that transports NAD+ in a counter exchange mode with ADP and AMP in vitro. |
| AT1G25380 | Encodes a mitochondrial-localized NAD+ transporter that transports NAD+ in a counter exchange mode with ADP and AMP in vitro. |
| AT4G00570 | Encodes an NAD-dependent malic enzyme (NAD-ME) that does not act on oxaloacetate, indicating that it belongs to EC 1.1.1.39. It is a member of the beta family of NAD-MEs in plants. It appears to function as a homodimer or as a heterodimer with the alpha-type NAD-ME2 (At2g13560). NAD-ME2 transcript and protein levels are higher during the night than during the day. |
| AT1G74880 | Encodes subunit NDH-O of NAD(P)H:plastoquinone dehydrogenase complex (Ndh complex) present in the thylakoid membrane of chloroplasts. This subunit is thought to be required for Ndh complex assembly. |
| AT5G53460 | NADH-dependent glutamate synthase The mRNA is cell-to-cell mobile. |
| AT5G17770 | Encodes NADH:cytochrome (Cyt) b5 reductase that displayed strict specificity to NADH for the reduction of a recombinant Cyt b5 (AtB5-A), whereas no Cyt b5 reduction was observed when NADPH was used as the electron donor. |
| AT5G58330 | lactate/malate dehydrogenase family protein;(source:Araport11) |
| AT5G11670 | The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME2 is presumably a cytosolic enzyme involved in malate metabolism and possibly assisting the oxidative pentose phosphate pathway. AtNADP-ME2 counts for the major part of NADP-ME activity in mature tissues of Arabidopsis. |
| AT1G79750 | The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME4 is localized to chloroplasts. The gene is expressed throughout the whole plant and during embryogenesis and germination. A possible involvement in the fatty acid biosynthesis has been proposed. |
| AT4G15545 | NAI1 interacting protein, involved in ER body formation. |
| AT1G16520 | NAI1 interacting protein, involved in ER body and vesicle formation. |
| AT5G67440 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
| AT4G37590 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
| AT5G13850 | nascent polypeptide-associated complex subunit alpha-like protein 3;(source:Araport11) |
| AT5G67330 | Encodes a member of the Nramp2 metal transporter family; like its homolog Atnramp3, localized in vacuolar membrane. Seedlings of double mutant, atnramp3-1 atnramp4-1, were arrested at early germination. The mRNA is cell-to-cell mobile. |
| AT1G80830 | Thought to be involved in iron homeostasis. Induced in leaves in response to iron deficiency. Transgenic plants accumulate toxic levels of iron. Gene complements yeast iron uptake mutants. |
| AT1G55370 | NDH-dependent cyclic electron flow 5;(source:Araport11) |
| AT2G27080 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G06320 | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus, spermine and Pseudomonas syringae pv. tomato DC3000. The gene product is localized to the plasma membrane. |
| AT1G28380 | This gene is predicted to encode a protein involved in negatively regulating salicylic acid-related defense responses and cell death programs. nsl1 mutants develop necrotic lesions spontaneously and show other features of a defense response, such as higher levels of SA and disease resistance-related transcripts, in the absence of a biotic stimulus. The NSL1 protein is predicted to have a MACPF domain, found in proteins that form a transmembrane pore in mammalian immune responses. NSL1 transcript levels do not appear to change in response to biotic stresses, but are elevated by cycloheximide in seedlings, and by sodium chloride in roots. The mRNA is cell-to-cell mobile. |
| AT1G53430 | Probable LRR receptor-like ser/thr-protein kinase; Commonly-enriched candidate LPS-interacting PM-associated proteins for both LPS chemotypes subsequent to the polymyxin B affinity chromatography strategy. |
| AT1G03470 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It colocalizes with filamentous actin and is localized to the nuclear membrane and the vacuolar membrane. |
| AT2G47920 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT5G58320 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It colocalizes with filamentous actin and is localized to the tonoplast membrane. It is expressed in the epidermis of the root meristem and the early expansion zone. |
| AT2G30500 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT3G51050 | NERD1 is a single copy locus encoding a protein of unknown function that is localized to the nucleus. Single mutants show defects in root hair growth, root meristem function, cell elongation. NERD1 appears to act synergistically with the exocyst in root development. |
| AT4G24690 | Encodes NBR1, a selective autophagy substrate. The mRNA is cell-to-cell mobile. |
| AT4G01940 | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU2 and 3 than to NFU4 and 5. Targeted to the chloroplast. |
| AT4G25910 | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU1 and 2 than to NFU4 and 5. Targeted to the chloroplast. The mRNA is cell-to-cell mobile. |
| AT1G51390 | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU4 than to NFU1,2, and 3. Targeted to the mitochondrion. The mRNA is cell-to-cell mobile. |
| AT5G05660 | Encodes a homolog of the mammalian zinc finger transcription factor NF-X1. |
| AT3G11580 | SOD7 encodes nuclear localized B3 DNA binding domain and a transcriptional repression motif. Belongs to the RAV gene family. Functions in regulation of seed size and binds to and represses KLU. Transcription repressor involved in regulation of inflorescence architecture. |
| AT5G04950 | Encodes a nicotianamide synthase. |
| AT1G42470 | Patched family protein;(source:Araport11) |
| AT4G38350 | Patched family protein;(source:Araport11) |
| AT3G54500 | Member of a small family (4 proteins) in Arabidopsis that have some overlap in function. LNK2 along with LNK1 functions in the integration of light signaling and circadian clock. It is regulated by the clock TOC1 complex. Functions as a transcriptional coactivator. |
| AT3G12320 | Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK4 in having affects on biomass accumulation and phototrophism. |
| AT5G06980 | Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK3 in having affects on biomass accumulation and phototrophism. |
| AT1G02450 | NIMIN1 modulates PR gene expression according the following model: NPR1 forms a ternary complex with NIMIN1 and TGA factors upon SAR induction that binds to a positive regulatory cis-element of the PR-1 promoter, termed LS7. This leads to PR-1 gene induction. NIMIN1 decreases transcriptional activation, possibly through its EAR motif, which results in fine-tuning of PR-1 gene expression. |
| AT3G44200 | Encodes AtNek5, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.Interacts physically with plant kinesins ARK1 and ARK2. Mutants show defects in root epidermal cell morphology, trichome branching and other epidermal cell abnormalities suggesting a rol e in epidermal cell differentiation. NEK6 co-localizes with cortical microtubules. |
| AT3G04810 | Encodes AtNek2, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
| AT3G20860 | Encodes a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
| AT2G33160 | Gene structure annotation for AT2G33160.1 is inaccurate in TAIR10, see PMID:23709666 and Comments field on the locus page for updated annotation. |
| AT4G24020 | Encodes NIN Like Protein 7 (NLP7). Modulates nitrate sensing and metabolism. Mutants of NLP7 show features of nitrogen-starved plants and are tolerant to drought stress. Localized in the nucleus and functions as a putative transcription factor. The mRNA is cell-to-cell mobile. |
| AT2G43500 | Plant regulator RWP-RK family protein;(source:Araport11) |
| AT4G18350 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
| AT3G14440 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane. |
| AT3G60320 | bZIP domain class transcription factor (DUF630 and DUF632);(source:Araport11) |
| AT3G16180 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
| AT3G44310 | Mutants are resistant to indole-3-acetonitrile (IAN). NIT1 catalyzes the terminal activation step in indole-acetic acid biosynthesis. Predominantly expressed isoform of nitrilase isoenzyme family. Aggregation of NIT1 in cells directly abutting wound sites is one of the earliest events associated with wound and herbicide-induced cell death. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. It is also involved in the conversion of IAN to IAM (indole-3-acetamide) and other non-auxin-related metabolic processes. The mRNA is cell-to-cell mobile. |
| AT3G44300 | Encodes an enzyme that catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (nitrile aminohydrolase, EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. Mutants have reduced sensitivity to IAN and are sensitive to IAA. This enzyme likely participates in other non-auxin-related metabolic pathways. The mRNA is cell-to-cell mobile. |
| AT3G16400 | Encodes a nitrile-specifier protein NSP1 responsible for constitutive and herbivore-induced simple nitrile formation in rosette leaves. NSP1 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. The mRNA is cell-to-cell mobile. |
| AT3G16390 | Encodes a nitrile-specifier protein NSP3. NSP3 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. The mRNA is cell-to-cell mobile. |
| AT3G16350 | MYB-like transcription factor involved in nitrate signaling trough regulation of CHL1. |
| AT3G47450 | Encodes a protein with similarity to the bacterial YqeH GTPase required for proper ribosome assembly. Mutant analyses show that this protein regulates growth and hormonal signaling and attenuates oxidative stress and reactive oxygen species (ROS). It also seems to be involved in regulating leaf senescence, cell death, nitric oxide biosynthesis in response to ABA but not exogenous H2O2. This protein also appears to be required for proper plastid biogenesis. Levels of several plastid-localized proteins, including RBCL, ClpP1, and the MEP biosynthesis enzymes DXS and DXR are altered in rif1-1 mutants. This protein was originally characterized as a mitrochondrial-localized nitric oxide synthase, but, the synthase activity was later disproven. In addition, new studies with GFP fusion proteins and chloroplast import assays suggest that this protein is found in chloroplasts. Its localization to the chloroplast is enhanced by S-acylation. |
| AT4G10380 | Boric acid channel. Essential for efficient boron uptake and plant development under boron limitation. Also functions in arsenite transport and tolerance. Localized preferentially in outer membrane domains of root cells. |
| AT5G45410 | Plastid localized protein of unknown function. Mutants are more susceptible to P. syringae and produce less callose upon infection. |
| AT4G25030 | Plastid localized protein of unknown function. Mutants are more susceptible to P. syringae and produce less callose upon infection. |
| AT3G20600 | Required for non-race specific resistance to bacterial and fungal pathogens.Mediates systemic acquired resistance (SAR) response. The mRNA is cell-to-cell mobile. |
| AT2G37010 | member of NAP subfamily |
| AT3G10670 | Plastidic SufC-like ATP-binding cassette/ATPase essential for Arabidopsis embryogenesis. Involved in the biogenesis and/or repair of oxidatively damaged Fe?S clusters. Expressed in embryos and meristems. |
| AT5G64330 | Involved in blue light response signaling pathway; interacts with the blue light photoreceptor NPH1. Null mutations abolish phototrophic responses of etiolated seedlings to low fluence blue light. Protein contains multiple protein-protein interaction domains. |
| AT1G07230 | non-specific phospholipase C1;(source:Araport11) |
| AT3G48610 | Non-specific phospholipase C6 involved in gametophyte development. |
| AT4G22920 | Similar to the tomato senescence-inducible chloroplast stay-green protein 1. It is upregulated during maximal senescence in the Arabidopsis life cycle, especially in senescent leaves. Acts antagonistically with SGR2 to balance chlorophyll catabolism in chloroplasts with the dismantling and remobilizing of other cellular components in senescing leaf cells. |
| AT1G80460 | Encodes a protein similar to glycerol kinase, which converts glycerol to glycerol 3-phosphate and performs a rate-limiting step in glycerol metabolism. This gene is required for both general and specific resistance against bacteria and fungi. Arabidopsis thaliana glycerol kinase (GLR1) mRNA.Involved in flagellin-induced non-host resistance to Pseudomonas. Coronatine partially suppresses flagellin-induced expression of NHO1. |
| AT5G11630 | The mutant is insensitive to oxylipin 9-HOT treatment. Involved in plant defense. |
| AT5G52820 | Encodes a NOTCHLESS homolog, a non-ribosomal protein involved in the maturation and assembly of the 60S ribosomal subunit, that is required for female gametogenesis. The mRNA is cell-to-cell mobile. |
| AT1G62720 | Encodes a PPR protein gene that localizes to the mitochondrion and is required for seed germination. |
| AT4G28910 | Encodes a transcriptional repressor that functions in the jasmonic acid (JA) signalling pathway, root development, and has a key role in leaf development, likely due to the transcriptional regulation of CYCD3 expression. Transcriptional repressor that accumulates in short-day conditions. Regulates together with FRS7 and FRS12 glucosinolate biosynthesis. |
| AT1G48240 | member of NPSN Gene Family |
| AT3G17440 | member of NPSN Gene Family |
| AT3G06030 | NPK1-related protein kinase 3 |
| AT3G63000 | NPL4-like protein 1;(source:Araport11) |
| AT5G45110 | Encodes NPR3, a paralog of NPR1. Involved in negative regulation of defense responses against bacterial and oomycete pathogens. npr3 mutants has elevated level of PR1 expression. Interacts with TGA2, TGA3, TGA5 and TGA6 in yeast two hybrid assays. NPR3 and NPR4 are receptors for the immune signal salicylic acid. The mRNA is cell-to-cell mobile. |
| AT4G19660 | Encodes NPR4, a ankyrin repeat BTB/POZ domain-containing protein with 36% sequence identity with NPR1. Mutants are more susceptible to the bacterial pathogen Pseudomonas syringe pv. tomato DC3000 and to the fungal pathogen Erysiphe cichoracearum, but do not differ markedly from wild type in interaction with virulent and avirulent strains of the oomycete Peronospora parasitica. NPR4 is required for basal defense against pathogens, and may be implicated in the cross-talk between the SA- and JA-dependent signaling pathways. NPR3 and NPR4 are receptors for the immune signal salicylic acid. |
| AT5G67385 | Encodes a phototropin-interacting NRL protein that is an early signaling component in the phototrophic response and is essential for the phototropin-mediated chloroplast accumulation response but is not involved in the chloroplast avoidance response or stomatal opening. |
| AT1G52190 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
| AT3G47960 | Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds. |
| AT1G69870 | Encodes a low affinity nitrate transporter NRT1.7. Expressed in phloem. Responsible for source-to-sink remobilization of nitrate. The mRNA is cell-to-cell mobile. |
| AT3G45650 | Encodes a nitrate efflux transporter NAXT1 (for NITRATE EXCRETION TRANSPORTER1). Localized to the plasma membrane. NAXT1 belongs to a subclass of seven NAXT members from the large NITRATE TRANSPORTER1/PEPTIDE TRANSPORTER family and is mainly expressed in the cortex of mature roots. |
| AT1G68570 | NPF3.1 is a membrane localized GA transporter that is expressed in the root endodermis. |
| AT1G59740 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G69850 | Encodes an inducible component of low-affinity nitrate uptake. mRNA found primarily in root hairs and the epidermis of roots. It also acts as an ABA importer at the site of ABA biosynthesis and is important for the regulation of stomatal aperture in inflorescence stems. |
| AT1G72125 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G46050 | Encodes a di- and tri-peptide transporter involved in responses to wounding, virulent bacterial pathogens, and high NaCl concentrations. The protein is predicted to have 12 transmembrane helicies. |
| AT2G26690 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G12110 | Encodes NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is expressed in guard cells and function in stomatal opening. Mutants have less transpiration and are more tolerant to drought. Expressed in lateral roots. Involved in nitrate signaling which enables the plant root system to detect and exploit nitrate-rich soil patches. Comparing to the wild type, the mutant displays a strongly decreased lateral root proliferation phenotype in nitrate rich patches on growth medium. Affects flowering time via interaction with the FLC dependent flowering pathway to influence its target gene FT. |
| AT3G54140 | Encodes a di- and tri-peptide transporter that recognizes a variety of different amino acid combinations. GFP-tagged PTR1 localizes to the plasma membrane and has 8 to 11 predicted transmembrane domains. PTR1 is expressed in a number of different vascular tissues throughout the plant based on promoter:GUS expression analysis. ptr1 mutants have a lower dry weight than wild type plants when both are grown with Pro-Ala or Ala-Ala dipeptides as their nitrogen source, suggesting that PTR1 plays a role in dipeptide uptake in the roots. Furthermore N content of ptr1 mutants is lower than that of wild type plants when grown with Pro-Ala or a mixture of dipeptides as nitrogen source |
| AT1G62200 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G13350 | Encodes a GTPase that interacts with nuclear shuttle proteins (NSPs) from a number of different plant viruses. The gene is widely expressed and NIG transcript levels do not rise in response to viral infection. This cytoplasmic protein does not directly interact with a viral movement protein (MP), but, it does promote the movement of NSP from the nucleus to the cytoplasm. Overexpression of NIG in Arabidopsis plants renders them more sensitive to geminivirus infection. |
| AT5G16000 | NSP-interacting kinase (NIK1), receptor-like kinase, involved in defense response against geminivirus It acts as a virulence target of the begomovirus nuclear shuttle protein (NSP). |
| AT1G60800 | Encodes one of a group of LRR-RLKs, designated as CLAVATA3 INSENSITIVE RECEPTOR KINASES (CIKs), that act as co-receptors and have essential roles in regulating CLV3-mediated stem cell homeostasis. |
| AT1G03530 | nuclear assembly factor 1;(source:Araport11) |
| AT4G14350 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT1G03920 | Protein kinase family protein;(source:Araport11) |
| AT2G20470 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT4G33080 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT1G30640 | Protein kinase family protein;(source:Araport11) |
| AT5G09890 | Protein kinase family protein;(source:Araport11) |
| AT5G12840 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. |
| AT5G06510 | nuclear factor Y, subunit A10;(source:Araport11) |
| AT3G05690 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. |
| AT2G34720 | nuclear factor Y, subunit A4;(source:Araport11) |
| AT1G30500 | nuclear factor Y, subunit A7;(source:Araport11) |
| AT2G38880 | Encodes a transcription factor from the nuclear factor Y (NF-Y) family, AtNF-YB1. Confers drought tolerance. |
| AT5G47640 | Involved in the regulation of response to nutrient levels. |
| AT4G14540 | nuclear factor Y, subunit B3;(source:Araport11) |
| AT3G12480 | nuclear factor Y, subunit C11;(source:Araport11) |
| AT1G56170 | Encodes a protein with similarity to a subunit of the CCAAT promoter motif binding complex of yeast.One of two members of this class (HAP5B) and expressed in vegetative and reproductive tissues. Involved in the regulation of response to nutrient levels. |
| AT5G63470 | Encodes a member of class of transcription regulators that his highly conserved across many plant species.In Arabidopsis and rice, NF-YC4 interacts with other members of this class and CO to regulate flowering. In Arabidopsis, it interacts with QQS to regulate C/N partitioning. |
| AT1G31470 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G19520 | Ribosomal pentatricopeptide repeat protein |
| AT5G58740 | Member of the family of NudC proteins. Over-expression improves free radical sacenving activity and antioxidant status, promotes root growth and branching under abiotic stress. |
| AT5G63320 | Encodes NPX1 (Nuclear Protein X1), a nuclear factor regulating abscisic acid responses. |
| AT1G06790 | Encodes a subunit of RNA polymerase III involved in maintaining global RNA homeostasis, not just that of genes transcribed by RNA pol III. |
| AT3G18090 | Encodes a subunit of RNA polymerase IV (aka RNA polymerase D). NRPD2b is closely related to NRPD2a, but has lower levels of transcription and does not affect endogenous siRNA when mutated. |
| AT1G27970 | Encodes an ortholog of yeast NTF2, a nuclear envelop transport protein that functions as the nuclear import receptor for RanGDP, an essential player in nucleocytoplasmic transport. The mRNA is cell-to-cell mobile. |
| AT1G74350 | Encodes nMAT4, a maturase factor required for nad1 pre-mRNA processing and maturation. Essential for holocomplex I biogenesis in Arabidopsis mitochondria. |
| AT2G27810 | Encodes a plasma-membrane localized nucleobase transporter capable of transporting adenine, guanine, uracil and hypoxanthine. Likely to be a proton-nucleobase symporter. |
| AT1G79150 | binding protein;(source:Araport11) |
| AT1G48920 | Encodes ATNUC-L1 (NUCLEOLIN LIKE 1), the predominant form of the two nucleolin proteins found in Arabidopsis. This protein is involved in rRNA processing, ribosome biosynthesis, and vascular pattern formation. PARL1 localizes to the nucleolus and parl1 mutants accumulate elevated levels of the unspliced 35S pre-rRNA. parl1 mutants also have defects in cotyledon, leaf, sepal, and petal vein patterning and have reduced stature, reduced fertility, increased bushiness, and reduced root length. The sugar-induced expression of ribosome proteins is also reduced in parl1 mutants. The mRNA is cell-to-cell mobile. |
| AT1G14850 | Encodes a protein similar to nucleoporin, a a major component of the nuclear pore complex (NPC) involved in cellular nucleo-cytoplasmic transport |
| AT5G56950 | Encodes a member of a small gene family of proteins with similarity to nucleosome assembly proteins.May function in nucleotide excision repair. Loss of function mutations have no obvious visible phenotypes but do seem to affect transcription of NER related genes. Plants mutated in three ubiquitously expressed NAP1 genes (NAP1;1~NAP1;3) and organ-specifically expressed NAP1;4 gene show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. The NAP1 genes act synergistically with NRP genes in promoting somatic homologous recombination. |
| AT4G39390 | Encodes a golgi localized nucleotide sugar transporter. |
| AT1G80300 | Encodes an ATP/ADP transporter. The mRNA is cell-to-cell mobile. |
| AT3G12600 | nudix hydrolase homolog 16;(source:Araport11) |
| AT2G01670 | nudix hydrolase homolog 17;(source:Araport11) |
| AT1G14860 | nudix hydrolase homolog 18;(source:Araport11) |
| AT5G47650 | Encodes an ADP-ribose pyrophosphatase that confers enhanced tolerance to oxidative stress. |
| AT1G73540 | nudix hydrolase homolog 21;(source:Araport11) |
| AT1G30110 | Encodes a ppGpp pyrophosphohydrolase. |
| AT1G18300 | nudix hydrolase homolog 4;(source:Araport11) |
| AT2G34160 | Alba DNA/RNA-binding protein;(source:Araport11) |
| AT4G14880 | Encodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis and for the fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA. Lines carrying semi-dominant mutations exhibit early senescence. Required for pollen tube growth and/or fertilization. |
| AT3G05320 | Golgi localized protein with similarity to protein O-fucosyltransferases. Mutants show lower seed set/reduced fertility. Mutant pollen fails to compete with wild type due to the inability to penetrate the stigma-style boundary. |
| AT5G54160 | A caffeic acid/5-hydroxyferulic acid O-methyltransferase. Interacts with 14-4-3 proteins in yeast 2 hybrid assay. AtOMT1 (At5g54160) encodes a flavonol 3?-O-methyltransferase that is highly active towards quercetin and myricetin. The substrate specificity identifies the enzyme as flavonol 3?-methyltransferase which replaces the former annotation of the gene to encode a caffeic acid/5-hydroxyferulic acid O-methyltransferase The mRNA is cell-to-cell mobile. |
| AT3G07780 | Encodes a nuclear PHD finger protein that is functionally redundant with OBE2 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems. The mRNA is cell-to-cell mobile. |
| AT5G60850 | Encodes a zinc finger protein. |
| AT5G53450 | OBP3-responsive protein 1;(source:Araport11) |
| AT1G06160 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT3G09070 | Encodes a polarly localised membrane-associated protein that regulates phloem differentiation entry. |
| AT5G01170 | hypothetical protein (DUF740);(source:Araport11) |
| AT5G58930 | hypothetical protein (DUF740);(source:Araport11) |
| AT5G55920 | Encodes a homolog of the S. cerevisiae Nop2 that is involved in ribosome biogenesis and plays a role on organ size control by promoting cell proliferation and preventing compensation in normal leaf development. |
| AT4G16370 | Encodes a phloem-specific iron transporter that is essential for systemic iron signaling and redistribution of iron and cadmium. It loads iron into the phloem, facilitates iron recirculation from the xylem to the phloem, and regulates both shoot-to-root iron signaling and iron redistribution from mature to developing tissues. |
| AT4G27730 | oligopeptide transporter |
| AT5G64410 | oligopeptide transporter |
| AT1G34000 | Encodes a novel member of the Lhc family from Arabidopsis with one predicted transmembrane alpha-helix closely related to helix I of Lhc protein from PSI (Lhca4). Gene expression is triggered by light stress and both transcript and protein accumulate in a light intensity-dependent manner. Ohp2 is associated with PSI under low- or high-light conditions. Together with OHP1, OHP2 is essential for the formation of photosystem II reaction center, even though neither is a part of the final PSII RC. It forms a complex with OHP1 and HCF244, D1, D2, PsbI, and cytochrome b559 at an early stage of PSII de novo assembly and of PSII repair under high-light conditions. |
| AT1G20510 | OPC-8:0 CoA ligase1;(source:Araport11) |
| AT1G31040 | ORE15 is a nuclear localized member of the PLATZ family of transcription factors. Based on over expression and loss of function phenotypes, ORE15 functions in regulation of leaf cell proliferation and senescence. |
| AT4G25270 | Encodes OTP70, a pentatricopeptide repeat protein of the E subgroup involved in splicing of the plastid transcript rpoC1. |
| AT3G13880 | Encodes a pentatricopeptide repeat (PPR) protein involved in RNA editing in mitochondria. |
| AT5G59200 | Encodes a chloroplast RNA editing factor. |
| AT2G29760 | Encodes a chloroplast RNA editing factor. |
| AT3G57430 | Encodes a chloroplast RNA editing factor. |
| AT1G79360 | organic cation/carnitine transporter 2;(source:Araport11) |
| AT1G16370 | organic cation/carnitine transporter 6;(source:Araport11) |
| AT1G79410 | organic cation/carnitine transporter5;(source:Araport11) |
| AT4G29910 | Origin Recognition Complex subunit 5. Involved in the initiation of DNA replication. Interacts strongly with all ORC subunits. |
| AT5G16690 | Origin Recognition Complex subunit 3. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with all ORC subunits except ORC1b. |
| AT2G40000 | ortholog of sugar beet HS1 PRO-1 2;(source:Araport11) |
| AT2G31020 | OSBP(oxysterol binding protein)-related protein 1A;(source:Araport11) |
| AT4G22540 | OSBP(oxysterol binding protein)-related protein 2A;(source:Araport11) |
| AT2G28120 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G38025 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT3G52540 | ovate family protein 18;(source:Araport11) |
| AT4G18830 | Member of the ovate protein family.Interacts with BLH1 and KNAT3. Regulates the subcellular localization of BLH1.I May also directly affect microtubule organization via interactions with TON2. |
| AT5G11270 | Encodes a homeodomain transcription factor involved in mediating resistance to infection by necrotrophic pathogens dependent on perception of jasmonic acid through COI1. Expressed in the nucleus. Downregulated upon fungal infection. Also involved in drought tolerance. |
| AT2G20330 | DDB1-CUL4 ASSOCIATED FACTOR (DCAF) protein. |
| AT3G13490 | Encodes a dual targeted lysyl-tRNA ligase that is found both in the mitochondrion and the chloroplast. Plants mutated in this gene exhibit an ovule abortion phenotype. |
| AT2G19810 | Encodes Oxidation-related Zinc Finger 1 (OZF1), a plasma membrane protein involved in oxidative stress. |
| AT4G29190 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT2G41900 | AtOXS2 specifcally entered the nuclear under salt stress. Te specifc nuclear localization of AtOXS2 could play a role in salt tolerance at the molecular level. Tese results implied that AtOXS2 might target some downstream cis-elements which are required for salt stress responses |
| AT5G56550 | Encodes OXIDATIVE STRESS 3 (OXS3)， involved in tolerance to heavy metals and oxidative stress. |
| AT2G06050 | Encodes a 12-oxophytodienoate reductase that is required for jasmonate biosynthesis. Mutants are male sterile and defective in pollen dehiscence. Shows activity towards 2,4,6-trinitrotoluene. CFA-Ile, CFA-Leu, CFA-Val, CFA-Met and CFA-Ala can restore the fertility of opr3 plants by inducing filament elongation and anther dehiscence. |
| AT5G37830 | Encodes a 5-oxoprolinase that acts in the glutathione degradation pathway and in 5-oxoproline metabolism. |
| AT5G21930 | P-Type ATPase, mediates copper transport to chloroplast thylakoid lumen. Required for accumulation of copper-containing plastocyanin in the thylakoid lumen and for effective photosynthetic electron transport |
| AT5G57780 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
| AT3G29370 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
| AT5G39860 | Encodes PRE1 (PACLOBUTRAZOL RESISTANCE1). PRE1 and IBH1 form a pair of antagonistic HLH/bHLH transcription factors that function downstream of BZR1 to mediate brassinosteroid regulation of cell elongation. BNQ1 is directly and negatively regulated by AP3 and PI in petals.Required for appropriate regulation of flowering time. |
| AT2G32240 | PAMP induced protein involved in defense response. Interaction with UBAC2 proteins in the ER, is necessary for PAMP mediated accumulation of the callose synthase PMR4. |
| AT1G60440 | The gene AT1G60440 encodes pantothenate kinase 1. Its molecular function was shown to phosphorylate pantothenate to form 4?-phosphopantothenate. |
| AT4G17410 | PQT3 is a nuclear localized E3 ligase involved in negative regulation of stress tolerance.PRMT4b is a substrate of PQT3. |
| AT1G19300 | The PARVUS/GLZ1 gene encodes a putative family 8 glycosyl transferase that contributes to xylan biosynthesis. Its gene expression shows good co-variance with the IRX3 gene involved in secondary cell wall synthesis. PARVUS/GLZ1 is predicted to have galacturonosyltransferase activity and may be involved in the formation of the complex oligosaccharide sequence present at the reducing end of xylan. PARVUS is expressed in cells undergoing secondary wall thickening, and parvus mutants have thinner cell walls. |
| AT2G02710 | Encodes a putative blue light receptor protein. |
| AT5G10480 | Protein tyrosine phosphatase-like involved in cell division and differentiation. Interacts with CDKA;1 only in its phosphorylated form, preventing dephosphorylation. Overexpression slowed down cell division in suspension cell cultures at the G2-to-M transition and early mitosis and inhibited Arabidopsis seedling growth. Localized in the cytoplasm of dividing cells but moved into the nucleus upon cell differentiation. Based on complementation of yeast mutant PAS2 has acyl-CoA dehydratase activity. It interacts with CER10, a component of the microsomal fatty acid elongase complex, suggesting a role in synthesis of VLCFAs (very long chain fatty acids). |
| AT3G63200 | PATATIN-like protein 9;(source:Araport11) |
| AT1G72150 | novel cell-plate-associated protein that is related in sequence to proteins involved in membrane trafficking in other eukaryotes The mRNA is cell-to-cell mobile. |
| AT1G22530 | PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells. |
| AT1G05240 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G29940 | Homeodomain protein (PRHA). Expression of the gene differs in various vegetative and floral plant tissues and is positively influenced by the phytohormone auxin. It is often associated with regions of developing vascular tissue. The prha promoter is highly responsive to the synthetic auxin, naphthalene acetic acid, in transient assays using tobacco protoplasts. The PRHA protein has the capacity to bind to TAATTG core sequence elements but requires additional adjacent bases for high-affinity binding. |
| AT5G03320 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G55450 | PBS1-like 1;(source:Araport11) |
| AT1G61590 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G76370 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G01300 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G28940 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G21750 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily; isoform contains non-consensus GA donor splice site at intron 9. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response. The mRNA is cell-to-cell mobile. |
| AT5G60640 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). However, the level of transcripts for this gene is slightly elevated in atbzip60 mutants. |
| AT1G52260 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). |
| AT5G04310 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G05910 | Pectinacetylesterase family protein;(source:Araport11) |
| AT3G09410 | Pectinacetylesterase family protein;(source:Araport11) |
| AT4G19420 | Pectinacetylesterase family protein;(source:Araport11) |
| AT5G23870 | Encodes a pectin acetylesterase that removes cell wall acetate associated with pectin formation in Arabidopsis leaves. |
| AT1G53840 | encodes a pectin methylesterase |
| AT2G26440 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT1G53830 | encodes a pectin methylesterase |
| AT3G14310 | encodes a pectin methylesterase, targeted by a cellulose binding protein (CBP) from the parasitic nematode Heterodera schachtii during parasitism. |
| AT3G49220 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G33220 | pectin methylesterase 44;(source:Araport11) |
| AT5G47500 | predicted to encode a pectin methylesterase |
| AT4G25260 | Pectin methylesterase inhibitor. Forms pH dependent complex with PME3. |
| AT5G53370 | pectin methylesterase PCR fragment F;(source:Araport11) |
| AT4G27650 | Encodes Arabidopsis homolog of Drosophila pelota protein. Functions in RNA the non-stop decay (NSD) and no-go decay (NGD) quality control systems that act during translation. |
| AT2G44490 | Encodes a glycosyl hydrolase that localizes to peroxisomes and acts as a component of an inducible preinvasion resistance mechanism. Required for mlo resistance. The mRNA is cell-to-cell mobile. |
| AT1G59870 | ATP binding cassette transporter. Localized to the plasma membrane in uninfected cells. In infected leaves, the protein concentrated at infection sites. Contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration in a salicylic acid?dependent manner. Required for mlo resistance. Has Cd transporter activity (Cd2+ extrusion pump) and contributes to heavy metal resistance. The mRNA is cell-to-cell mobile. |
| AT4G15340 | Encodes a protein that catalyzes the production of the tricyclic triterpene arabidiol when expressed in yeast. |
| AT1G06580 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G06430 | Encodes PPR2, a pentatricopeptide repeat protein. Binds to plastid 23S rRNA and plays an important role in the first mitotic division during gametogenesis and in cell proliferation during embryogenesis. |
| AT1G52620 | Mitochondrial pentatricopeptide repeat protein required for stabilizing nad1 transcripts. |
| AT2G03380 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G73080 | Encodes a leucine-rich repeat receptor kinase. Functions as a receptor for AtPep1 to amplify innate immunity response to pathogen attacks. The mRNA is cell-to-cell mobile. |
| AT4G26000 | Encodes a novel Arabidopsis gene encoding a polypeptide with K-homology (KH) RNA-binding modules, which acts on vegetative growth and pistil development. Genetic studies suggest that PEP interacts with element(s) of the CLAVATA signaling pathway. |
| AT1G15390 | encodes a peptide deformylase-like protein. Removes N-formyl groups, a prerequisite for the action of methionine aminopeptidase during protein synthesis. Targeted to mitochondria. Requires Zn for catalysis. |
| AT3G20640 | Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT5G23940 | Encodes PERMEABLE LEAVES3 (PEL3), a putative acyl-transferase. Mutation in this locus results in altered trichome phenotype (trcichomes become tangled during leaf expansion). Additional phenotype includes altered cuticle layer. |
| AT2G41480 | Encodes a cationic cell-wall-bound peroxidase homolog that is involved in the lignification of cell walls. Regulated by COG1, involved in seed longevity. |
| AT3G32980 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G14540 | Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
| AT5G05340 | Encodes a protein with sequence similarity to peroxidases that is involved in lignin biosynthesis. Loss of function mutations show abnormal development of xylem fibers and reduced levels of lignin biosynthetic enxymes. |
| AT5G15180 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G17820 | Peroxidase superfamily protein, overexpression increases ROS. |
| AT5G42180 | Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
| AT5G64120 | Encodes a cell wall bound peroxidase that is induced by hypo-osmolarity and is involved in the lignification of cell walls. Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
| AT2G45740 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. The mRNA is cell-to-cell mobile. |
| AT3G61070 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
| AT3G18160 | Peroxin 3-1;(source:Araport11) |
| AT3G52960 | Thioredoxin superfamily protein;(source:Araport11) |
| AT5G09660 | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
| AT5G08470 | an AAA-ATPase that is the probable Arabidopsis orthologue of one of the AAA-ATPases involved in peroxisome biogenesis in yeasts and mammals. |
| AT5G61770 | A single-copy gene encoding a 346 aa protein with a single Brix domain. Similar to yeast ribosome biogenesis proteins Ssf1/2. |
| AT2G34710 | Dominant PHB mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. Has overlapping functions with PHAVOLUTA, REVOLUTA and CORONA. |
| AT3G53260 | Encodes phenylalanine lyase. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
| AT5G02460 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT1G12710 | This gene is predicted to encode a protein with a PP2 domain. This domain in present in lectins found in squash and cucumber, suggesting that this protein could potentially have carbohydrate binding capabilities. |
| AT3G61060 | phloem protein 2-A13;(source:Araport11) |
| AT5G52120 | phloem protein 2-A14;(source:Araport11) |
| AT2G02360 | Encodes an F-box protein containing a Nictaba-related lectin domain that can act as a carbohydrate-binding protein.Expression is induced by SA and pathogenic bacteria. |
| AT1G80110 | phloem protein 2-B11;(source:Araport11) |
| AT2G02280 | phloem protein 2-B4;(source:Araport11) |
| AT5G43350 | Encodes an inorganic phosphate transporter Pht1;1. Mutants display enhanced arsenic accumulation. Under high arsenate concentrations, PHT1;1 levels are reduced and it is delocalized from the plasma membrane. Members of the Pht1 family of phosphate transporters include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341).PHT1;1 expression is transcriptionally regulated by WRKY6 and by PHR1. |
| AT5G14040 | Encodes a mitochondrial phosphate transporter. Modulates plant responses to salt stress. |
| AT2G17270 | Encodes a mitochondrial phosphate transporter. Modulates plant responses to salt stress. |
| AT2G29650 | Encodes an inorganic phosphate transporter (PHT4;1) that is localized to the thylakoid membrane. |
| AT2G38060 | Encodes an inorganic phosphate transporter (PHT4;2). |
| AT5G44370 | Encodes an inorganic phosphate transporter (PHT4;6). |
| AT1G35140 | EXL1 is involved in the C-starvation response. Phenotypic changes of an exl1 loss of function mutant became evident only under corresponding experimental conditions. For example, the mutant showed diminished biomass production in a short-day/low light growth regime, impaired survival during extended night, and impaired survival of anoxia stress. |
| AT2G01180 | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves. |
| AT3G09560 | The PAH1 gene encodes a phosphatidate phosphohydrolase. Mutant analysis revealed its involvement in galactolipid synthesis pathway, and the membrane lipid remodeling. The pah1pah2 double-mutant showed enhanced Al-susceptibility under low-P conditions, but there was no significant differences in Al tolerance between pah1pah2 and wild type when they were grown in a solution containing 35 μM Pi. |
| AT4G01190 | Type I phosphatidylinositol-4-phosphate 5-kinase, subfamily A. Preferentially phosphorylates PtdIns4P. Expressed in flowers and inflorescence stems. |
| AT2G41210 | Encodes a protein with phosphatidylinositol-4-phosphate 5-kinase activity that plays a role in pollen tip growth. The enzyme localizes to the apical plasma membrane and adjacent cytosolic region of pollen tubes. Overexpression of this gene leads to increased deposition of pectin in the cell wall at the tip of the pollen tube and causes altered pollen tube morphology. |
| AT1G21980 | Type I phosphatidylinositol-4-phosphate 5-kinase. Preferentially phosphorylates PtdIns4P. Induced by water stress and abscisic acid in Arabidopsis thaliana. Expressed in procambial cells of leaves, flowers and roots. A N-terminal Membrane Occupation and Recognition Nexus (MORN)affects enzyme activity and distribution. |
| AT3G47220 | Encodes a plasma membrane-localized phosphoinositide-specific phospholipase C with a role in thermotolerance. |
| AT5G57190 | Encodes the minor form of the two non-mitochondrail phosphatidylserine decarboxylase. The gene expression level is very low. Located at the tonoplast. |
| AT1G15110 | PSS1 encodes a base-exchange-type Phosphatidylserine (PS) synthase. Mutant analysis revealed its role in pollen maturation. |
| AT4G37870 | Encodes a phosphoenolpyruvate carboxykinase that localizes to the cytosol. |
| AT1G53310 | Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins.Plays an important role in carbon and nitrogen metabolism. |
| AT2G42600 | Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins.PPC1 and PPC2 are crucial for balancing carbon and nitrogen metabolism. |
| AT3G04530 | Encodes a second Arabidopsis phosphoenolpyruvate carboxylase kinase gene product with a different expression pattern from PPCK1. Expression of the gene is upregulated by exposure of the plant to light and is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
| AT1G12580 | phosphoenolpyruvate carboxylase-related kinase 1;(source:Araport11) |
| AT4G26270 | phosphofructokinase 3;(source:Araport11) |
| AT4G32840 | phosphofructokinase 6;(source:Araport11) |
| AT5G51820 | Encodes a plastid isoform of the enzyme phosphoglucomutase involved in controlling photosynthetic carbon flow. Effective petiole movement against the direction of the gravity requires functional PGM activity that is required for full development of amyloplasts. |
| AT1G70730 | Encodes a cytosolic phosphoglucomutase (PGM). Two Arabidopsis PGM proteins (AT1G70730/PGM2 and AT1G23190/PGM3) have high sequence similarities and redundant functions. Mature plants possessing a single cPGM allele had a major reduction in cPGM activity. Whereas pgm2 and pgm3 single mutants are undistinguishable from the wild type, loss of both PGM2 and PGM3 severely impairs male and female gametophyte development. |
| AT4G24620 | The PGI1 gene encodes the plastid phospho-glucose (Glc) isomerase. While pgi1-1 mutant has a deficiency in leaf starch synthesis, it accumulates starch in root cap cells. Flowering time of the pgi1-1 mutant is significantly delayed under short-day conditions. |
| AT2G46500 | Phosphoinositide kinase which undergo autophosphorylation and phosphorylate serine/threonine residues of protein substrates. Contains phosphoinositide 3/4-kinase and ubiquitin-like domains. Phosphorylates PUFD1 and RPN10 in vitro. |
| AT2G03890 | Phosphoinositide kinase which undergo autophosphorylation and phosphorylate serine/threonine residues of protein substrates. Contains phosphoinositide 3/4-kinase and ubiquitin-like domains. The mRNA is cell-to-cell mobile. |
| AT1G52570 | member of C2-PLD subfamily |
| AT1G55180 | member of C2-PLD. subfamily Represents a phospholipase D (PLD) gene with four exons, hence it is a member of the alpha class. Its amino acid sequence is quite different from other PLDs, therefore it might possess unique structural and/or catalytic properties. |
| AT2G42010 | phospholipase D (PLDbeta) |
| AT4G35790 | Encodes a protein with phospholipase D activity. Involved in phospolipase metabolism. Mutants are affected in hydrogen peroxide mediated cell death. |
| AT3G16785 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Does not appear to be involved in root hair patterning. Not induced upon Pi starvation. |
| AT3G05630 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. Regulates vesicle trafficking. Required for auxin transport and distribution and hence auxin responses. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Plays a major role in phosphatidic acid production during phosphate deprivation. Induced upon Pi starvation in both shoots and roots. Involved in hydrolyzing phosphatidylcholine and phosphatidylethanolamine to produce diacylglycerol for digalactosyldiacylglycerol synthesis and free Pi to sustain other Pi-requiring processes. Does not appear to be involved in root hair patterning. Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT4G35110 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT1G80860 | Encodes a single-copy phospholipid N-methyltransferase, involved in phosphatidylcholine biosynthesis. Has specific activity towards phosphatidylmonomethylethanolamine and phosphatidyldimethylethanolamine, but not phosphatidylethanolamine. |
| AT1G04010 | phospholipid sterol acyl transferase 1;(source:Araport11) |
| AT2G45790 | Encodes a cytoplasmic phosphomannomutase, involved in ascorbate biosynthesis |
| AT2G44530 | Phosphoribosyltransferase family protein;(source:Araport11) |
| AT1G10700 | Encodes a P-independent phosphoribosyl pyrophosphate (PRPP) synthase. |
| AT5G05590 | Encodes phosphoribosylanthranilate isomerase which catalyzes the third step in the tryptophan biosynthetic pathway. |
| AT1G32060 | phosphoribulokinase;(source:Araport11) |
| AT4G15130 | phosphorylcholine cytidylyltransferase2;(source:Araport11) |
| AT2G16365 | PCH1 binds and stabilizes the active (Pfr) form of phytochrome B and is involved in the formation of photobodies in the nucleus. PCH1 is expressed in evenings and is associated to the evening complex through binding to phyB, and represses hypocotyl elongation and growth. Using mass spec, the existence of the At2g16365.2 isoform has been verified, however here is no evidence that any of the other three variants are present. Atg2G16365.2 will be assigned PCH1; exon 4 and 5 in the other variants are actually another gene of the F-box/DUF295 family with gene name FDA10. |
| AT1G25520 | Member of the UPF0016 family of membrane proteins, belongs to the conserved group of Mn/Ca transporters. Might act to fine tune Mn allocation into the endoplasmic reticulum of specific cell types. |
| AT1G15980 | encodes a novel subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in cyclic electron flow around photosystem I to produce ATP. |
| AT5G43750 | NAD(P)H dehydrogenase 18;(source:Araport11) |
| AT4G39710 | FK506-binding protein 16-2;(source:Araport11) |
| AT3G54890 | Encodes a component of the light harvesting complex associated with photosystem I. |
| AT2G46820 | Encodes the P subunit of Photosystem I. About 25% of the TMP14 pool appeared to be phosphorylated, and this ratio is not affected by light. Contains seven phosphorylation sites on threonine residue and chloroplast targeting signal. Located in the proximity of PSI-L, -H and -O subunits. Forms oligomers with other members of CURT1 family to modulate grana structure. |
| AT2G20260 | Encodes subunit E of photosystem I. The mRNA is cell-to-cell mobile. |
| AT1G55670 | Encodes subunit G of photosystem I, an 11-kDa membrane protein that plays an important role in electron transport between plastocyanin and PSI and is involved in the stability of the PSI complex. PSI-G subunit is bound to PSI-B and is in contact with Lhca1. The protein inserts into thylakoids by a direct or "spontaneous" pathway that does not involve the activities of any known chloroplast protein-targeting machinery. PSI-G appears to be directly or indirectly involved in the interaction between Photosystem I and plastocyanin. |
| AT3G50820 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO2 is the minor isoform in the wild-type. Mutants defective in this gene have been shown to be affected in the dephosphorylation of the D1 protein of PSII. |
| AT4G05180 | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II. |
| AT1G79040 | Encodes for the 10 kDa PsbR subunit of photosystem II (PSII). This subunit appears to be involved in the stable assembly of PSII, particularly that of the oxygen-evolving complex subunit PsbP. Mutants defective in this gene have reduced amounts of subunits PsbP and PsbQ in PSII. In turn, assembly of PsbR is dependent on the presence of PsbJ. |
| AT3G45780 | Blue-light photoreceptor. Contains a light activated serine-threonine kinase domain and LOV1 and LOV2 repeats. Mutants are defective in blue-light response. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT1 undergoes blue-light-dependent autophosphorylation. At least eight phosphorylation sites have been identified in PHOT1. Phosphorylation of serine851 in the activation loop of PHOT1 appears to be required for stomatal opening, chloroplast accumulation, leaf flattening, and phototropism, and phosphorylation of serine849 may also contribute to the regulation of these responses. Phosphorylation-dependent binding of 14-3-3 proteins to the Hinge1 region of PHOT1 appears to require serine350 and serine376. |
| AT2G25290 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT4G32070 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT3G58850 | Encodes PHYTOCHROME RAPIDLY REGULATED2 (PAR2), an atypical basic helix-loop-helix (bHLP) protein. Closely related to PAR1 (At2g42870). Up regulated after simulated shade perception. Acts in the nucleus to control plant development and as a negative regulator of shade avoidance response. Functions as transcriptional repressor of auxin-responsive genes SAUR15 (AT4G38850) and SAUR68 (AT1G29510). |
| AT2G26710 | Encodes a member of the cytochrome p450 family that serves as a control point between multiple photoreceptor systems and brassinosteroid signal transduction. Involved in brassinolide metabolism. Mediates response to a variety of light signals including hypocotyl elongation and cotyledon expansion. |
| AT3G52430 | Encodes a lipase-like gene that is important for salicylic acid signaling and function in resistance (R) gene-mediated and basal plant disease resistance. PAD4 can interact directly with EDS1, another disease resistance signaling protein. Expressed at elevated level in response to green peach aphid (GPA) feeding, and modulates the GPA feeding-induced leaf senescence through a mechanism that doesn't require camalexin synthesis and salicylic acid (SA) signaling. Required for the ssi2-dependent heightened resistance to GPA. The mRNA is cell-to-cell mobile. |
| AT1G09570 | Light-labile cytoplasmic red/far-red light photoreceptor involved in the regulation of photomorphogenesis. It exists in two inter-convertible forms: Pr and Pfr (active) and functions as a dimer.The N terminus carries a single tetrapyrrole chromophore, and the C terminus is involved in dimerization. It is the sole photoreceptor mediating the FR high irradiance response (HIR). Major regulator in red-light induction of phototropic enhancement. Involved in the regulation of de-etiolation. Involved in gravitropism and phototropism. Requires FHY1 for nuclear accumulation. |
| AT2G18790 | Red/far-red photoreceptor involved in the regulation of de-etiolation. Exists in two inter-convertible forms: Pr and Pfr (active). Involved in the light-promotion of seed germination and in the shade avoidance response. Promotes seedling etiolation in both the presence and absence of phytochrome A. Overexpression results in etiolation under far-red light. Accumulates in the nucleus after exposure to far red light. The phosphorylation state of the Ser-86 residue of the phytochrome B molecule alters dark reversion of the molecule. The mRNA is cell-to-cell mobile. |
| AT2G46970 | encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. |
| AT3G62090 | encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. |
| AT2G20180 | Encodes a novel Myc-related bHLH transcription factor that has transcriptional activation activity in the dark. It is a key negative regulator of phytochrome-mediated seed germination and acts by inhibiting chlorophyll biosynthesis, light-mediated suppression of hypocotyl elongation and far-red light-mediated suppression of seed germination, and promoting negative gravitropism in hypocotyls. Light reduces this activity in a phy-dependent manner. The protein preferentially interacts with the Pfr forms of Phytochrome A (PhyA) and Phytochrome B (PhyB), is physically associated with APRR1/TOC1 and is degraded in red (R) and far-red (FR) light through the ubiquitin (ub)-26S proteasome pathway to optimize photomorphogenic development in Arabidopsis. It also negatively regulates GA3 oxidase expression. |
| AT3G59060 | Encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. Involved in shade avoidance. Functions as negative regulator of PhyB. Protein levels are modulated by phytochrome B. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
| AT2G43010 | Isolated as a semidominant mutation defective in red -light responses. Encodes a nuclear localized bHLH protein that interacts with active PhyB protein. Negatively regulates phyB mediated red light responses. Involved in shade avoidance response. Protein abundance is negatively regulated by PhyB.Involved in the regulation of response to nutrient levels. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
| AT1G14280 | Encodes phytochrome kinase substrate 2. PKS proteins are critical for hypocotyl phototropism. Forms a complex with Phot1, Phot2 and NPH3. |
| AT5G04190 | Encodes phytochrome kinase substrate 4, a phytochrome signaling component involved in phototropism. It is phosphorylated in a phot1-dependent manner in vitro. Phosphorylation is transient and regulated by a type 2- protein phosphatase. |
| AT1G72390 | nuclear receptor coactivator;(source:Araport11) |
| AT3G46640 | Encodes a myb family transcription factor with a single Myb DNA-binding domain (type SHAQKYF) that is unique to plants and is essential for circadian rhythms, specifically for transcriptional regulation within the circadian clock. LUX is required for normal rhythmic expression of multiple clock outputs in both constant light and darkness. It is coregulated with TOC1 and seems to be repressed by CCA1 and LHY by direct binding of these proteins to the evening element in the LUX promoter. The mRNA is cell-to-cell mobile. |
| AT2G31980 | PHYTOCYSTATIN 2;(source:Araport11) |
| AT4G16500 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT1G06570 | Mutation of the PDS1 locus disrupts the activity of p-hydroxyphenylpyruvate dioxygenase (HPPDase), the first committed step in the synthesis of both plastoquinone and tocopherols in plants. |
| AT2G02220 | Encodes a protein interacting with phytosulfokine, a five amino acid sulfated peptide (YIYTQ). Contains dual guanylate cyclase and kinase catalytic activities that operate in vivo. |
| AT2G22860 | Phytosulfokine 2 precursor, coding for a unique plant peptide growth factor. The mRNA is cell-to-cell mobile. |
| AT3G44735 | Phytosulfokine 3 precursor, coding for a unique plant peptide growth factor. |
| AT3G49780 | Phytosulfokine 3 precursor, coding for a unique plant peptide growth factor. Plants overexpressing this gene (under a 35S promoter), develop normal cotyledons and hypocotyls but their growth, in particular that of their roots, was faster than that of wildtype. |
| AT1G54570 | Encodes a protein with phytyl ester synthesis and diacylglycerol acyltransferase activities that is involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. |
| AT4G31900 | chromatin remodeling factor;(source:Araport11) |
| AT2G39210 | Major facilitator superfamily transmembrane transporter responsible for the uptake of picolinate herbicides. |
| AT2G48060 | Similar to mechanically sensitive ion channel identified in mouse. Mutants display root helical growth phenotype in agar media suggesting a role in mechanoperception at the root cap. |
| AT5G12130 | integral membrane TerC family protein;(source:Araport11) |
| AT1G71720 | Encodes a chloroplast localized protein that regulates the translation of Ycf1 by binding to its mRNA. It is involved in the biogenesis of photosynthetic complexes. |
| AT2G26510 | Encodes a plasma-membrane localized nucleobase transporter capable of transporting adenine, guanine, uracil and hypoxanthine. Likely to be a proton-nucleobase symporter. |
| AT1G76620 | Serine/Threonine-kinase, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT1G70940 | A regulator of auxin efflux and involved in differential growth. PIN3 is expressed in gravity-sensing tissues, with PIN3 protein accumulating predominantly at the lateral cell surface. PIN3 localizes to the plasma membrane and to vesicles. In roots, PIN3 is expressed without pronounced polarity in tiers two and three of the columella cells, at the basal side of vascular cells, and to the lateral side of pericycle cells of the elongation zone. PIN3 overexpression inhibits root cell growth. Protein phosphorylation plays a role in regulating PIN3 trafficking to the plasma membrane. The mRNA is cell-to-cell mobile. |
| AT2G01420 | Encodes a putative auxin efflux carrier that is localized in developing and mature root meristems. It is involved in the maintenance of embryonic auxin gradients. A role for AtPIN4 in generating a sink for auxin below the quiescent center of the root meristem that is essential for auxin distribution and patterning is proposed. In the root, PIN4 is detected around the quiescent center and cells surrounding it, and localizes basally in provascular cells. PIN4 expression is upregulated in brassinosteroid-insensitive mutant (PMID 16141452). |
| AT1G23080 | Encodes a novel component of auxin efflux that is located apically in the basal cell and is involved during embryogenesis in setting up the apical-basal axis in the embryo. It is also involved in pattern specification during root development. In roots, it is expressed at lateral and basal membranes of provascular cells in the meristem and elongation zone, whereas in the columella cells it coincides with the PIN3 domain. Plasma membrane-localized PIN proteins mediate a saturable efflux of auxin. PINs mediate auxin efflux from mammalian and yeast cells without needing additional plant-specific factors. The action of PINs in auxin efflux is distinct from PGPs, rate-limiting, specific to auxins and sensitive to auxin transport inhibitors. PINs are directly involved of in catalyzing cellular auxin efflux. |
| AT2G17500 | Auxin efflux carrier family protein;(source:Araport11) |
| AT5G65980 | Auxin efflux carrier family protein;(source:Araport11) |
| AT5G54490 | Encodes a PINOID (PID)-binding protein containing putative EF-hand calcium-binding motifs. The interaction is dependent on the presence of calcium. mRNA expression is up-regulated by auxin. Not a phosphorylation target of PID, likely acts upstream of PID to regulate the activity of this protein in response to changes in calcium levels. |
| AT1G32100 | Encodes a pinoresinol reductase involved in lignan biosynthesis. Expressed strongly in roots and less strongly in stems. Shows specificity for pinoresinol and not lariciresinol. |
| AT4G13660 | Encodes a pinoresinol reductase involved in lignan biosynthesis. Expressed strongly in roots and less strongly in stems. Shows preference for pinoresinol and not lariciresinol. The mRNA is cell-to-cell mobile. |
| AT2G43120 | Encodes a member of the functionally diverse cupin protein superfamily that is involved in susceptibility to the bacterial plant pathogen Ralstonia solanacearum. It stabilizes the papain-like cysteine protease XCP2. The mRNA is cell-to-cell mobile. |
| AT5G20240 | Floral homeotic gene encoding a MADS domain transcription factor. Required for the specification of petal and stamen identities. |
| AT4G02075 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT1G05000 | Encodes an atypical dual-specificity phosphatase. |
| AT5G16480 | Encodes an atypical dual-specificity phosphatase. |
| AT5G15120 | 2-aminoethanethiol dioxygenase, putative (DUF1637);(source:Araport11) |
| AT5G39890 | Plant Cysteine Oxidase (PCO). Involved in controlling the stability of Group VII ethylene response factors (ERF-VIIs) via N-Arg/degron pathway through catalyzing the oxidation of their N-Cys for subsequent Arginyl-tRNA--protein transferase 1 (ATE1) mediated arginine installation. |
| AT1G18490 | 2-aminoethanethiol dioxygenase, putative (DUF1637);(source:Araport11) |
| AT4G33330 | Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. |
| AT1G08990 | plant glycogenin-like starch initiation protein 5;(source:Araport11) |
| AT2G35710 | Nucleotide-diphospho-sugar transferases superfamily protein;(source:Araport11) |
| AT5G05850 | Encodes PIRL1, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen. |
| AT1G12970 | Encodes PIRL3, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
| AT4G35470 | Encodes PIRL4, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
| AT3G11330 | Encodes PIRL9, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen. |
| AT5G58650 | Encodes PSY1, an18-aa tyrosine-sulfated glycopeptide that promotes cellular proliferation and expansion. PSY1 is widely expressed in various tissues, including shoot apical meristem, and is highly up-regulated by wounding. Perception of PSY1 depends on At1g72300, a leucine-rich repeat receptor kinase (LRR-RK). |
| AT3G54850 | Encodes a protein with a typical U-box domain followed by an Armadillo repeat region, a domain organization that is frequently found in plant U-box proteins. Displays ubiquitin ligase activity in vitro. Regulator of flowering time. |
| AT1G29340 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity. It is required for cell death and full resistance specified by Arabidopsis RPM1 and RPS4 resistance proteins against Pseudomonas syringae pv tomato. The mRNA is cell-to-cell mobile. |
| AT1G60190 | Encodes PUB19, a plant U-box armadillo repeat protein. Involved in salt inhibition of germination together with PUB18. The mRNA is cell-to-cell mobile. |
| AT3G52450 | Encodes a cytoplasmically localized U-box domain E3 ubiquitin ligase protein that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT2G35930 | Encodes a cytoplasmically localized U-box domain containing E3 ubiquitin ligase that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT3G11840 | Encodes a U-box-domain-containing E3 ubiquitin ligase that acts as a negative regulator of PAMP-triggered immunity. |
| AT3G19380 | PUB25 and PUB26 are closely related paralogs that encode functional E3 ligases. They function in immune response pathway by targeting BIK1 for degradation. |
| AT3G18710 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT3G54790 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G47820 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G62560 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G18340 | One of three tandemly located, paralogous plant U-box proteins. Mutants show increased sensitivity to water stress. E3 ligase which acts as a regulator in the heat response signaling pathway. Over-expressing AtPUB48 could induce the expression of the heat-related genes (HSP101, HSP70, HSP25.3, HSFA2, and ZAT12). Enhances plant resistance to heat stress during seed germination and seedling growth. |
| AT1G23030 | Encodes a plant U-Box protein that is capable of binding and ubiquitinating a variety of targets including MYC2,LRR1,KIN and acting as an E3 ligase. Regulates a number of physiological hormonal and environment al responses via selective degradation of targets.Unlike PUB10, its closest homolog in Arabidopsis, it does not appear to play a major role in the MeJA-mediated response. |
| AT1G71020 | Encodes a nuclear localized plant U-Box protein that interacts with MYC2 and regulates its stability by acting as an E3 ubiquitin ligase and polyubiquitinating MYC2. By this mechanism, it targets MYC2 for destruction thereby affecting JA signaling. |
| AT4G04210 | Arabidopsis thaliana CDC48-interacting UBX-domain protein (PUX4) |
| AT1G14570 | Encodes a nuclear UBX-containing protein that can bridge ubiquitin to AtCDC48A. |
| AT2G40120 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G36650 | Encodes a protein with similarity to the general transcription factor TFIIB. pBRP binds rDNA sequences in vitro. pBRP has been localized to the outer face of the plastid membrane with GFP fusion however, under conditions of proteosome inhibition it is found in the nucleus. |
| AT5G19930 | PGR is putative plasma membrane glucose- responsive regulator that is expressed in response to glucose stimulation.RNAi knockdown mutant seeds have enhanced sensitivity to glucose and 2-deoxyglucose. |
| AT4G23400 | Plasma membrane intrinsic protein, involved redundantly with PIP1;1/2/3/4 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
| AT3G61430 | a member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development. The mRNA is cell-to-cell mobile. |
| AT2G45960 | a member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development. Involved redundantly with PIP1;1/3/4/5 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
| AT1G01620 | a member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development. Involved redundantly with PIP1;1/2/4/5 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
| AT2G37170 | a member of the plasma membrane intrinsic protein subfamily PIP2. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed specifically in the vascular bundles and protein level increases slightly during leaf dev |
| AT5G60660 | A member of the plasma membrane intrinsic protein subfamily PIP2.When expressed in yeast cells can conduct hydrogen peroxide into those cells. Mutants exhibit longer root hairs. |
| AT2G16850 | plasma membrane intrinsic protein 2;(source:Araport11) |
| AT2G39010 | plasma membrane intrinsic protein 2E;(source:Araport11) |
| AT4G35100 | a member of the plasma membrane intrinsic protein PIP. functions as aquaporin. Salt-stress-inducible MIP |
| AT4G20260 | Encodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels. The mRNA is cell-to-cell mobile. |
| AT1G69295 | Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and is predicted to bind callose. |
| AT1G04520 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. |
| AT1G19880 | Encodes a regulator of chromatin condensation 1 (RCC1) family protein; confers plasticity of rosette diameter in response to changes in N availability. |
| AT3G18680 | Encodes a functional UMP Kinase located in the plastid that binds to group II intron plastid transcription products. Mutants show decreased accumulation of target transcripts/proteins. |
| AT5G53280 | An integral outer envelope membrane protein (as its homolog PDV2), component of the plastid division machinery. Similar to ARC5, PDV1 localized to a discontinuous ring at the division site in wild-type plants. PDV1 and PDV2 are required for localization of ARC5 at the chloroplast division site. Topological analysis showed that the large N-terminal region of PDV1 upstream of the transmembrane helix bearing a putative coiled-coil domain is exposed to the cytosol. Mutation of the conserved PDV1 C-terminal Gly residue did not block PDV1 insertion into the outer envelope membrane but did abolish its localization to the division site. The mRNA is cell-to-cell mobile. |
| AT3G61680 | PLIP1 encodes a plastid localized phospholipase A1 involved in seed oil biosynthesis. |
| AT1G02660 | PLIP2 is a glycerolipid A1 lipase with substrate preference for monogalactosyldiacylglycerol. Expression is induced by ABA. |
| AT1G42550 | Encodes a plant-specific protein of unknown function that appears to be conserved among angiosperms. The mRNA is cell-to-cell mobile. |
| AT3G13120 | Ribosomal protein S10p/S20e family protein;(source:Araport11) |
| AT3G54210 | Ribosomal protein L17 family protein;(source:Araport11) |
| AT5G47190 | Ribosomal protein L19 family protein;(source:Araport11) |
| AT5G65220 | Ribosomal L29 family protein;(source:Araport11) |
| AT1G80480 | plastid transcriptionally active 17;(source:Araport11) |
| AT1G21600 | Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression. essential subunit of the plastid-encoded RNA polymerase (PEP). Mediates phytochrome signaling. |
| AT4G20010 | Organellar Single-stranded DNA Binding protein. Decreases MMEJ on long ssDNA templates. |
| AT1G06870 | Peptidase S24/S26A/S26B/S26C family protein;(source:Araport11) |
| AT1G76100 | One of two Arabidopsis plastocyanin genes. Expressed at 1/10th level of PETE2. Does not respond to increased copper levels and is thought to be the isoform that participates in electron transport under copper-limiting conditions. Mutation of this gene does not have obvious effect on photosynthesis. |
| AT2G45800 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. |
| AT1G01780 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. The mRNA is cell-to-cell mobile. |
| AT3G09400 | Similar to POLTERGEIST (POL) protein phosphatase 2C. No phenotype observed in plants homozygous for a null allele. Ubiquitously expressed. |
| AT1G07630 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT1G67960 | POD1 is involved in pollen tube guidence and early embryo patterning. |
| AT2G46920 | Pol mutations are recessive, partial suppressors of meristem defects in strong clv1 and clv3 mutants, and nearly complete suppressors of weak clv1 mutants. Single mutants appear normal. Acts downstream of the CLV signaling pathway in meristem development and is required together with PLL1 for stem-cell maintenance through the regulation of WUS. |
| AT2G35350 | Encodes a protein most similar to the POLTERGEIST locus. Double mutant analysis of loss of function alleles indicate PLL1 functions redundantly with POL to regulate meristem size and pedicel length. Acts in a dose dependent manner with POL to suppress the clv1, clv2 and clv3 phenotypes. |
| AT2G28890 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT4G34110 | Putative poly-A binding protein. Member of a gene family .Expressed in stele and root meristem and post-fertilization ovules.Member of the class II family of PABP proteins. The mRNA is cell-to-cell mobile. |
| AT3G16380 | polyadenylate-binding protein, putative / PABP, putative, similar to polyadenylate-binding protein (poly(A)-binding protein) from {Arabidopsis thaliana} SP:P42731, (Cucumis sativus) GI:7528270, {Homo sapiens} SP:Q13310, {Arabidopsis thaliana} SP:Q05196; contains InterPro entry IPR000504: RNA-binding region RNP-1 (RNA recognition motif) (RRM). Member of the class III family of PABP proteins. |
| AT1G71770 | Encodes a Class I polyA-binding protein. Expressed in floral organs. Binds polyA sepharose in vitro. |
| AT5G13700 | Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants). |
| AT2G43020 | Encodes a polyamine oxidase. |
| AT3G59050 | Encodes a polyamine oxidase. |
| AT1G65840 | encodes a peroxisomal polyamine oxidase, involved in the back-conversion polyamine degradation pathway. Among the five polyamine oxidases in the Arabidopsis genome, PAO4 is the major isoform in root peroxisomes. The mRNA is cell-to-cell mobile. |
| AT4G29720 | polyamine oxidase 5;(source:Araport11) |
| AT1G31820 | Encodes POLYAMINE UPTAKE TRANSPORTER 1, an amino acid permease family protein. |
| AT1G31830 | Encodes POLYAMINE UPTAKE TRANSPORTER 2, an amino acid permease family protein. |
| AT3G19553 | Encodes POLYAMINE UPTAKE TRANSPORTER 5, an amino acid permease family protein. |
| AT1G70370 | Polygalacturonase involved in cell wall modification. |
| AT5G06860 | Encodes a polygalacturonase inhibiting protein involved in defense response. PGIPs inhibit the function of cell wall pectin degrading enzymes such as those produced by fungal pathogens. PGIP1 is induced by fungal infection. Suppressed in the proton sensitive stop1-mutant, but the transcription level was recovered by transformation of STOP2. Knockout mutant showed severe damage in the root tip in low Ca and low pH medium. |
| AT5G06870 | Encodes a polygalacturonase inhibiting protein involved in plant defense response. PGIPs inhibit the activity of pectin degrading enzymes such as those produced by fungal pathogens. PGIP2 is induced by fungal infection and methyl jasmonate.Suppressed in the proton sensitive stop1-mutant, but the transcription level was recovered by transformation of STOP2. Knockout mutant showed severe damage in the root tip in low Ca and low pH medium. |
| AT3G26610 | Encodes an apoplast-localized polygalacturonase involved in cell elongation and flower development. |
| AT4G36670 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G20160 | Terpenoid synthases superfamily protein;(source:Araport11) |
| AT4G05320 | One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. The mRNA is cell-to-cell mobile. |
| AT5G03240 | encodes ubiquitin that is attached to proteins destined for degradation. UBQ3 is most homologous with UBQ4, and is expressed in higher levels in vegetative tissue but lower levels in flowers than UBQ4. UBQ3 encodes different number of ubiquitins in different ecotypes. UBQ3 transcript level is modulated by UV-B and light/dark treatments. |
| AT1G05850 | Encodes an endo chitinase-like protein AtCTL1. Essential for tolerance to heat, salt and drought stresses. Also involved in root hair development, cell expansion and response to cytokinin. Allelic to erh2. 11 alleles described in Hauser (1995). Mutant is defective in acquired thermotolerance, appears semidwarf throughout its life cycle and has extra lateral branches. There are two EMS alleles. Expression of AtHSP101 is not affected in the mutants. |
| AT3G47640 | Encodes POPEYE (PYE), a bHLH transcription factor regulating response to iron deficiency in Arabidopsis roots. |
| AT4G24370 | hypothetical protein;(source:Araport11) |
| AT1G04690 | potassium channel beta subunit 1;(source:Araport11) |
| AT4G18290 | Encodes KAT2, a member of the Shaker family potassium ion (K+) channel. Critical to stomatal opening induced by blue light. Critical to circadian rhythm of stomatal opening. Involved in plant development in response to high light intensity. Under high light intensity, the mutant plant produced less biomass compared to the wild type. The Shaker family K+ ion channels include five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT2G40540 | putative potassium transporter AtKT2p (AtKT2) mRNA, |
| AT5G14880 | Potassium transporter family protein;(source:Araport11) |
| AT3G54920 | Powdery mildew resistant mutant encodes a pectate lyase-like protein The mRNA is cell-to-cell mobile. |
| AT3G61600 | POZ/BTB containing-protein AtPOB1. Involvement in protein ubiquitylation is predicted based on physical interaction with CULLIN 3 proteins. The mRNA is cell-to-cell mobile. |
| AT2G20630 | PP2C induced by AVRRPM1;(source:Araport11) |
| AT2G35330 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G17070 | Encodes a PP4R2 domain protein that likely functions as a regulatory subunit of PP4, a highly conserved ser/thr protein phosphatase. |
| AT3G01200 | Encodes a PPDK regulatory protein that has protein kinase activity but lacks protein phosphatase activity towards PPDK (pyruvate orthophosphate dikinase). |
| AT5G23290 | prefoldin 5;(source:Araport11) |
| AT3G11397 | prenylated RAB acceptor 1.A3;(source:Araport11) |
| AT5G05380 | prenylated RAB acceptor 1.B3;(source:Araport11) |
| AT3G13710 | prenylated RAB acceptor 1.F4;(source:Araport11) |
| AT5G56230 | prenylated RAB acceptor 1.G2;(source:Araport11) |
| AT5G15860 | Encodes a protein with prenylcysteine methylesterase activity. |
| AT2G27820 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT1G49630 | Zinc metalloprotease pitrilysin subfamily A. Signal peptide degrading enzyme targeted to mitochondria and chloroplasts. Expressed in flower, leaf and root. Not expressed in silique and shoot. |
| AT2G28610 | Encodes a homeodomain containing protein that regulates lateral axis-dependent development of Arabidopsis flowers and is required for cell proliferation. It is expressed in a restricted number of L1 cells at the lateral regions of flower primordia, floral organ primordia, and young leaf primordia. |
| AT4G38570 | Putative CDP-diacylglycerol-inositol 3-phosphatidyltransferase 2;(source:Araport11) |
| AT2G19760 | first member of the Arabidopsis profilin multigene family, expressed in all organs of Arabidopsis. Binds poly-L-proline. The first intron of PRF1 enhances gene expression in vegetative tissues. |
| AT2G19770 | Encodes profilin 5, originally named profilin 4 (PRO4/PFN4). Low-molecular weight, actin monomer-binding protein that regulates the organization of actin cytoskeleton. Pollen-specific plant profilin present predominantly in mature pollen and growing pollen tubes. |
| AT5G58750 | Putative PRISE (progesterone 5β-reductase and/or iridoid synthase-like 1,4-enone reductases). |
| AT1G03860 | prohibitin 2 |
| AT5G40770 | prohibitin 3 |
| AT4G02060 | Member of the minichromosome maintenance complex, involved in DNA replication initiation. Abundant in proliferating and endocycling tissues. Localized in the nucleus during G1, S and G2 phases of the cell cycle, and are released into the cytoplasmic compartment during mitosis. Binds chromatin. |
| AT2G39890 | Encodes a proline transporter with affinity for gly betaine, proline and GABA. Protein is expressed in the vascular tissue, specifically the phloem. |
| AT3G55740 | Encodes a proline transporter with affinity for gly betaine, proline, and GABA. Protein is expressed most highly in the roots. |
| AT1G26150 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT3G18810 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT3G62680 | Proline-rich protein The mRNA is cell-to-cell mobile. |
| AT3G23170 | PRP is a proline/serine rich protein of unknown function. It interacts with defense related MAP kinase MPK6 and others. It's expression is induced by PAMP elicitors. May play a role in response to pathogens. |
| AT5G02190 | encodes an aspartic protease, has an important role in determining cell fate during embryonic development and in reproduction processes. The loss-of-function mutation of PCS1 causes degeneration of both male and female gametophytes and excessive cell death of developing embryos during torpedo stage. |
| AT5G23720 | Encodes a protein tyrosine phosphatase Propyzamide-Hypersensitive 1 (PHS1). One of the mutant alleles, phs1-1, is hypersensitive to the microtubule-destabilizing drug propyzamide, suggesting that PHS1 may be involved in phosphorylation cascades that control the dynamics of cortical microtubules in plant cells. A second allele, phs1-3, is hypersensitive to abscisic acid, indicating a possible involvement of PHS1 in ABA signalling. |
| AT5G66140 | Encodes alpha5 subunit of 20S proteosome complex involved in protein degradation. |
| AT4G22750 | Encodes a protein S-acyltransferase that, together with PAT14, cooperatively regulates leaf senescence. |
| AT3G60800 | Encodes a protein S-acyltransferase that, together with PAT13, cooperatively regulates leaf senescence. |
| AT4G34090 | cyclin delta-3;(source:Araport11) |
| AT1G08910 | Encodes an SP-RING domain containing protein that functions in sumolaytion and is involved in positive regulation of sulfur metabolism and stress response. |
| AT5G41580 | Encodes an SP-RING domain containing protein that functions in sumolaytion and is involved in positive regulation of sulfur metabolism and stress response. |
| AT5G19680 | PP1 Regulatory Subunit3. Interacts with members of the Type One Protein Phosphatases (TOPP) family.Facilitates the nuclear localization of TOPP4 which is required for its activity in mediating ABA responses. |
| AT1G51690 | 55 kDa B regulatory subunit of phosphatase 2A mRNA, |
| AT1G10430 | Encodes one of the isoforms of the catalytic subunit of protein phosphatase 2A: AT1G59830/PP2A-1, AT1G10430/PP2A-2, At2g42500/PP2A-3, At3g58500/PP2A-4 [Plant Molecular Biology (1993) 21:475-485 and (1994) 26:523-528; Note that in more recent publications, there is mixed use of gene names for PP2A-3 and PP2A-4 - some refer to At2g42500 as PP2A-3 and some as PP2A-4]. It regulates the activation of ADF/cofilin, which, in turn, regulates actin cytoskeleton remodeling and is involved in phot2-mediated chloroplast avoidance movements. |
| AT2G33700 | Encodes a putative protein phosphatase 2C that positively regulates salt tolerance in abscisic acid-dependent manner. |
| AT3G11410 | Encodes protein phosphatase 2C. Negative regulator of ABA signalling. Expressed in seeds during germination. mRNA up-regulated by drought and ABA. |
| AT3G56930 | Protein S-acyl transferase 4 (PAT4). Mutants display defects in root hair elongation. Along with SCN1 , it may be involved in targeting of ROP2 to the plasma membrane. |
| AT2G35680 | Encodes a phosphatidylglycerophosphate (PGP) phosphatase involved in the synthesis of plastidial Phosphatidylglycerol (PG) in conjunction with PGPP1 and PTPMT2 in root. PTPMT1 levels were higher in node, cauline leaf, and flower than in root, leaf, and stem. |
| AT1G18470 | Putative C3HC4 zinc-finger ubiquitin E3 ligase that is induced by ABA and plays a positive role in ABA signaling. |
| AT4G27440 | light-dependent NADPH:protochlorophyllide oxidoreductase B The mRNA is cell-to-cell mobile. |
| AT1G03630 | Encodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent. |
| AT5G06970 | PATROL1 is a Munc13-like protein involved in mediating H[+]-ATPase translocation. It interacts with AHA1and is responsible for its translocation during stomatal movement. |
| AT2G05620 | Involved in electron flow in Photosystem I. Essential for photoprotection. |
| AT1G13350 | Paralog of PRP4KA. |
| AT4G28750 | mutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Subunit E of Photosystem I |
| AT5G02810 | PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR7 expression levels. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR5 and PRR9 to regulate hypocotyl growth under photoperiodic conditions. |
| AT4G00760 | Encodes a response-regulator like protein. |
| AT2G46790 | Pseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR5 and PRR7 to regulate hypocotyl growth under photoperiodic conditions. |
| AT2G47060 | Encodes Pto-interacting 1-4 (PTI1-4), a member of the PTI1-like serine/threonine protein kinases that share strong sequence identity to the tomato PTI1 kinase. |
| AT5G56510 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G09610 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G28230 | Encodes a transporter that transports purines,cytokinins and other adenine derivatives. Expressed in the leaf hydathodes where it may be involved in re-uptake of cytokinins during guttation. |
| AT1G09860 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G57990 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G18220 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT2G16430 | Encodes an acid phosphatase involved plant acclimation to Pi deprivation. |
| AT3G07130 | Encodes PAP15, a purple acid phosphatase with phytase activity. Expression of PAP15 is developmentally and temporally regulated, with strong expression at the early stages of seedling growth and pollen germination. The expression is also organ/tissue-specific, with strongest expression in the vasculature, pollen grains, and roots. Recombinant PAP protein exhibits broad substrate specificity with moderate phytase activity. PAP15 likely mobilizes phosphorus reserves in plants, particularly during seed and pollen germination. |
| AT3G10150 | purple acid phosphatase 16;(source:Araport11) |
| AT3G17790 | Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT1G13900 | Encodes a dual-localized acid phosphatase (mitochondria and chloroplast) that modulates carbon metabolism. |
| AT4G24890 | purple acid phosphatase 24;(source:Araport11) |
| AT5G50400 | purple acid phosphatase 27;(source:Araport11) |
| AT5G57140 | purple acid phosphatase 28;(source:Araport11) |
| AT1G14700 | purple acid phosphatase 3;(source:Araport11) |
| AT2G03450 | purple acid phosphatase 9;(source:Araport11) |
| AT3G24160 | Encodes a putative Type 1 membrane protein (PMP). |
| AT5G40340 | PWWP domain protein involved in regulation of FLC and flowering time. |
| AT3G05430 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
| AT5G02950 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
| AT3G03140 | Encodes a chromatin-associated protein that interacts with plant nuclear lamin-like components to regulate nuclear size. |
| AT1G08590 | Encodes one of the two putative eLRR kinase closely related to PXY (At1g08590/PXL1 and At4g28650/PXL2). Insertion mutants in either pxl1 or pxl2 do not exhibit an obvious phenotype in the stem; double-mutant combinations of a Col allele, of pxy (pxy-3) with pxl1 and pxl2, generate a more severe vascular phenotype than pxy-3 alone, suggesting that these genes act synergistically with PXY in regulating vascular-tissue development in the stem. |
| AT2G26040 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT2G38310 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. The mRNA is cell-to-cell mobile. |
| AT2G40330 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT4G01026 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of ABI1 and ABI2. |
| AT4G17870 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT5G05440 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT5G53580 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT5G49970 | encodes the bifunctional pyridoxine (pyridoxamine) 5?-phosphate oxidase (PPOX)(EC 1.4.3.5) that is involved in the formation of pyridoxal 5'-phosphate (member of the vitamin B6 group). NAD(P)HX epimerase (AT5G49970) interconverts the two epimers of NAD(P)HX. |
| AT3G16050 | Encodes a protein with pyridoxal phosphate synthase activity whose transcripts were detected mostly in roots and accumulate during senescence. The protein was found in very low abundance, which prevented a specific localisation. |
| AT4G22930 | Encodes dihydroorotase (PYR4). |
| AT3G17810 | Encodes a protein predicted to have dihydropyrimidine dehydrogenase activity. Its activity has not been demonstrated in vivo, but, it is required for efficient uracil catabolism in Arabidopsis. It localizes to the plastid. |
| AT3G20330 | encodes aspartate carbamoyltransferase catalyzing the second step in the de novo pyrimidine ribonucleotide biosynthesis |
| AT4G20960 | encodes diaminohydroxyphosphoribosylaminopyrimidine deaminase catalyzing the second step in the riboflavin biosynthesis |
| AT1G01050 | Encodes a soluble protein with inorganic pyrophosphatase activity that is highly specific for Mg-inorganic pyrophosphate. |
| AT2G18230 | Encodes a protein that might have inorganic pyrophosphatase activity. |
| AT2G46860 | Encodes a protein that might have inorganic pyrophosphatase activity. |
| AT5G09650 | Encodes a protein with inorganic pyrophosphatase activity. |
| AT5G54960 | pyruvate decarboxylase-2 |
| AT1G30120 | Encodes a putative plastid pyruvate dehydrogenase E1 beta subunit that is distinct from the mitochondrial pyruvate dehydrogenase E1 beta subunit. |
| AT4G30710 | QWRF motif protein (DUF566);(source:Araport11) |
| AT5G43160 | QWRF motif protein (DUF566);(source:Araport11) |
| AT3G59920 | RAB GDP DISSOCIATION INHIBITOR 2 The mRNA is cell-to-cell mobile. |
| AT1G22740 | GTP-binding protein Rab7 |
| AT2G21880 | RAB GTPase homolog 7A;(source:Araport11) |
| AT5G03520 | GTPase that colocalizes with golgi and plasma membranes. |
| AT1G16920 | small GTP-binding protein (Rab11)similar to YPT3/RAB11 proteins in yeast and mammals, respectively. YPT3/RAB11 is involved in intracellular protein trafficking. |
| AT5G45750 | RAB GTPase homolog A1C;(source:Araport11) |
| AT2G33870 | RAB GTPase homolog A1H;(source:Araport11) |
| AT3G46830 | RAB GTPase homolog A2C;(source:Araport11) |
| AT5G59150 | RAB GTPase homolog A2D;(source:Araport11) |
| AT1G01200 | RAB GTPase homolog A3;(source:Araport11) |
| AT5G65270 | RAB GTPase homolog A4A;(source:Araport11) |
| AT3G12160 | Encodes RABA4D, a member of the Arabidopsis RabA4 subfamily of Rab GTPase proteins. It is transported in exocytic vesicles to the apical tip of pollen tubes where it appears to promote tip growth. Proper localization of RabA4d depends on ROP1, RIC3, and RIC4 activity. |
| AT4G17170 | member of RAB gene family |
| AT5G03530 | Encodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. CFP:RabC2a appears to co-localize with peroxisomes. |
| AT4G20360 | Nuclear transcribed, plastid localized EF-Tu translation elongation factor. Referred to as AtRabE1b in DOI:10.1104/pp.013052. However, wider community usage and more publications assign the symbol RabE1b to At5g59840. |
| AT3G18820 | RAB7 homolog, forms retromer complex with VPS35; ES17 prevents the retromer complex to endosome anchoring, resulting in retention of RABG3f. The interaction of RABG3f?VPS35 functinons as a checkpoint in the control of traffic toward the vacuole. |
| AT5G53570 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT5G45130 | small GTP binding protein The mRNA is cell-to-cell mobile. |
| AT4G35020 | A member of ROP GTPase gene family; Encodes a Rho-like GTP binding protein. |
| AT4G36570 | RAD-like 3;(source:Araport11) |
| AT1G71100 | Encodes a ribose 5-phosphate isomerase involved in the formation of uridine used for the synthesis of UDP-sugars. Mutants of this gene are affected in cellulose biosynthesis. |
| AT1G79650 | Encodes a member of the RADIATION SENSITIVE23 (RAD23) family: AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome. |
| AT3G02540 | Encodes a member of the RADIATION SENSITIVE23 (RAD23) family: AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome. |
| AT1G32230 | Encodes a protein belonging to the (ADP-ribosyl)transferase domain-containing subfamily of WWE protein-protein interaction domain protein family. Superoxide radicals are necessary and sufficient to propagate cell death or lesion formation in rcd1 mutants. Without stress treatment, RCD1 is localized in the nucleus. Under high salt or oxidative stress, RCD1 is found not only in the nucleus but also in the cytoplasm. The mRNA is cell-to-cell mobile. |
| AT5G27920 | Encodes a nuclear F-box protein that can directly interact with the C2H2‐type zinc finger transcription factor STOP1 and promote its ubiquitination and degradation. STOP1 is crucial for aluminum (Al) resistance. |
| AT3G04735 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT3G05490 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT3G23805 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT3G25170 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT4G15800 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. The mRNA is cell-to-cell mobile. |
| AT1G28270 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. RALF4 and RALF19 act redundantly in the pollen tube to regulate pollen tube growth. |
| AT1G35467 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT1G60625 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT3G16570 | Encodes RALF23, a member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. RALF23 is significantly downregulated by brassinolide treatment of seedlings. Overexpression of AtRALF23 impairs brassinolide-induced hypocotyls elongation, and mature overexpressing plants are shorter and bushier. RALF23 overexpression produces slower growing seedlings with roots that have reduced capacity to acidify the rhizosphere. |
| AT3G05880 | Induced by low temperatures, dehydration and salt stress and ABA. Encodes a small (54 amino acids), highly hydrophobic protein that bears two potential transmembrane domains. |
| AT4G34730 | ribosome-binding factor A family protein;(source:Araport11) |
| AT5G48330 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT3G20390 | Encodes a plastidial RidA (Reactive Intermediate Deaminase A) homolog that hydrolyzes the enamines/imines formed by Thr dehydratase from Ser or Thr. RidA accelerates the deamination of reactive enamine/imine intermediates produced by threonine dehydratase (At3g10050) with threonine or serine as substrates. In the absence of RidA, the serine-derived imine inactivates BCAT3 (At3g49680). RidA thus pre-empts damage to BCAT3 by hydrolyzing the reactive imine before it does damage. |
| AT4G34220 | Encodes a receptor like kinase involved in ABA-mediated seedling development and drought tolerance.RDK1 is an atypical or pseudokinase and has no phosphorylation activity. Its expression is upregulated in response to ABA.interacts with ABI1 and other PP2C phosphatases. |
| AT5G66160 | Encodes a receptor homology region transmembrane domain, ring H2 motif protein involved in transport of storage proteins to protein storage vacuoles. Localized to endoplasmic reticulum and co-localizes with DIP positive vesicles and to the trans-golgi network when complexed with RMR2. |
| AT1G74180 | receptor like protein 14;(source:Araport11) |
| AT2G32660 | receptor like protein 22;(source:Araport11) |
| AT2G33050 | receptor like protein 26;(source:Araport11) |
| AT3G53240 | receptor like protein 45;(source:Araport11) |
| AT4G18760 | receptor like protein 51;(source:Araport11) |
| AT5G49290 | receptor like protein 56;(source:Araport11) |
| AT5G65830 | receptor like protein 57;(source:Araport11) |
| AT2G18890 | RLCK VI_A class kinase which activity is regulated by Rho-of-plants (ROP) GTPases. Controls seedling and plant growth in parallel with gibberrellin. |
| AT2G48010 | receptor-like serine/threonine kinase (RKF3) The mRNA is cell-to-cell mobile. |
| AT1G69270 | RPK1 is a leucine-rich receptor-like kinase located in the plasma membrane which is upregulated by abscisic acid, dehydration, high salt, low temperature, but not by other plant hormones. RPK1 knock-out and antisense plants show an ABA-insensitive phenotype. RPK1 plays a role in ABA-controlled cell proliferation and is a regulator of the ABA signal transduction pathway. Overexpression of the LRR domain has a dominant negative effect on RPK1. Mutations in RPK1 uncouple cotyledon anlagen and primordia by modulating epidermal cell shape and polarity. |
| AT1G67500 | Encodes the catalytic subunit of DNA polymerase zeta.Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS). |
| AT5G27680 | RECQ helicase SIM;(source:Araport11) |
| AT1G01320 | Encodes REDUCED CHLOROPLAST COVERAGE 1 (REC1) a protein with similarity to the FLOURY locus in maize. Located in the nucleus and cytosol. Contributes to establishing the size of the chloroplast compartment. |
| AT4G04340 | Encodes a plasma membrane localized hyperosmolality gated calcium channel that is expressed in guard cells and roots. |
| AT5G41040 | Encodes a feruloyl-CoA transferase required for suberin synthesis. Has feruloyl-CoA-dependent feruloyl transferase activity towards substrates with a primary alcohol. |
| AT3G15820 | Functions as phosphatidylcholine:diacylglycerol cholinephosphotransferase, a major reaction for the transfer of 18:1 into phosphatidylcholine for desaturation and also for the reverse transfer of 18:2 and 18:3 into the triacylglycerols synthesis pathway |
| AT3G18990 | Required for vernalization. Essential for the complete repression of FLC in vernalized plants. Required for the methylation of histone H3 |
| AT5G46340 | Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Has high similarity to RWA2 whose mutant displays reduced acetylation. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. |
| AT3G06550 | Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Mutants show reduced cell wall polysaccharide acetylation and increased resistance to Botrytis cinerea. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. |
| AT1G29890 | Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Has high similarity to RWA2 whose mutant displays reduced acetylation. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. |
| AT3G23590 | Encodes a protein shown to physically associate with the conserved transcriptional coregulatory complex, Mediator, and is involved in the regulation of phenylpropanoid homeostasis. Acts redundantly with REF4/MED5b (At2g48110). Required for expression of some dark-upregulated genes. RFR1 is the MED5a subunit of the mediator complex. |
| AT5G01720 | RAE1 is an F-box protein component of a SCF-type E3 ligase complex. It is part of an alumium induced regulatory loop: its activity is induced by STOP1 and it in turn ubiquitinates STOP1 which is then targeted for degradation. |
| AT5G40450 | Encodes a member of a plant gene family, APK_ORTHOMCL5144,of unknown function. RBB1 is localized to the cytosol and involved in vacuolar biogenesis and organization. RBB1 mutants have increased number of vacuolar bulbs and fewer trans-vacuolar strands. |
| AT1G01360 | Encodes RCAR1 (regulatory components of ABA receptor). Interacts with and regulates the type 2C protein phosphatases (PP2Cs) ABI1 and ABI2. Functions as abscisic acid sensor. The mRNA is cell-to-cell mobile. |
| AT2G20140 | Encodes one of the two RPT2 (26S proteasome subunit RPT2) paralogs: RPT2a (At4g29040) and RPT2b (At2g20140). RPT2b can not complement the rpt2a mutant phenotype. rpt2a rpt2b double mutants are embryo lethal. |
| AT4G38630 | Regulatory particle non-ATPase subunit of the 26S proteasome with multiubiquitin-chain-binding capabilities |
| AT5G42040 | regulatory particle non-ATPase 12B;(source:Araport11) |
| AT1G53750 | 26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA, |
| AT5G19990 | 26S proteasome AAA-ATPase subunit The mRNA is cell-to-cell mobile. |
| AT1G68840 | Rav2 is part of a complex that has been named `regulator of the (H+)-ATPase of the vacuolar and endosomal membranes' (RAVE) The mRNA is cell-to-cell mobile. |
| AT1G46768 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.1). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.9 and RAP2.10. |
| AT4G36900 | Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.10). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.9 and RAP2.1. |
| AT2G28550 | AP2 family transcription factor that is involved in regulation of flowering and innate immunity.Interacts with CRY2 to regulate CO and FT. TOE1 binds to activation domain of CO and binds CORE sequences of the FT promoter.TOE1/TOE2 are also targets of MiR172b and function in regulation of innate immunity. |
| AT3G48430 | Relative of Early Flowering 6 (REF6) encodes a Jumonji N/C and zinc finger domain-containing protein that acts as a positive regulator of flowering in an FLC-dependent pathway. REF6 mutants have hyperacetylation of histone H4 at the FLC locus. REF6 interacts with BES1 in a Y2H assay and in vitro. REF6 may play a role in brassinoteroid signaling by affecting histone methylation in the promoters of BR-responsive genes. It is most closely related to the JHDM3 subfamily of JmjN/C proteins. The mRNA is cell-to-cell mobile. |
| AT3G61260 | Lipid raft regulatory protein, crucial for plasma membrane nanodomain assembly to control plasmodesmata aperture and functionality. Negatively regulates the cell-to-cell movement of TuMV via competition with PCaP1 for binding actin filaments. |
| AT2G41870 | Remorin family protein;(source:Araport11) |
| AT5G52250 | Encodes a transducin protein whose gene expression is induced by UV-B. This induction is reduced in hy5 mutant and may be a target of HY5 during UV-B response. Functions as a repressor of UV-B signaling. |
| AT1G79670 | Encodes a receptor-like kinase that does not contain an extracellular leucine-rich repeat domain. A novel type of dominant disease-resistance protein that confers resistance to a broad spectrum of Fusarium races. |
| AT3G07040 | Contains an N-terminal tripartite nucleotide binding site and a C-terminal tandem array of leucine-rich repeats. Confers resistance to Pseudomonas syringae strains that carry the avirulence genes avrB and avrRpm1. |
| AT4G22790 | Encodes a plasma membrane localized MATE type transporter that is involved in CO2 signaling during stomatal aperture regulation. RHC1 regulates HT1 which phosphorylates OST1, a kinase that regulates the SLAC1 anion channel and thus stomatal closing. |
| AT4G26090 | Encodes a plasma membrane protein with leucine-rich repeat, leucine zipper, and P loop domains that confers resistance to Pseudomonas syringae infection by interacting with the avirulence gene avrRpt2. RPS2 protein interacts directly with plasma membrane associated protein RIN4 and this interaction is disrupted by avrRpt2. The mRNA is cell-to-cell mobile. |
| AT1G12220 | Resistance gene, mediates resistance against the bacterial pathogen Pseudomonas syringae. Contains a putative nucleotide binding site composed of kinase-1a (or P-loop), kinase-2a, and putative kinase-3a domains, 13 imperfect leucine-rich repeats, a potential leucine zipper, and two uncharacterized motifs that are well conserved in products of previously isolated R genes. Confers resistance to Pseudomonas syringae strains that express avrPphB. |
| AT5G47910 | NADPH/respiratory burst oxidase protein D (RbohD).Interacts with AtrbohF gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. The mRNA is cell-to-cell mobile. |
| AT1G64060 | Interacts with AtrbohD gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. |
| AT4G31920 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
| AT1G67710 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Affects ABA-JA crosstalk. |
| AT2G25180 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical.The retention of leaf water content, maintenance of cell membrane stability, and enhancement of anthocyanin biosynthesis were found to contribute to the enhanced drought tolerance of the arr1,10,12 triple mutant. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
| AT1G74890 | Encodes a nuclear response regulator that acts as a negative regulator in cytokinin-mediated signal transduction. Transcript accumulates in leaves and roots in response to cytokinin treatment. |
| AT5G58080 | member of Response Regulator: B- Type |
| AT3G62670 | member of Response Regulator: B- Type |
| AT1G59940 | Type A response regulator highly similar to bacterial two-component response regulators. Rapidly induced by cytokinin. Involved in red-light signaling. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
| AT2G41310 | Encodes an A- type response Regulator that is primarily expressed in the root and is involved in cytokinin-mediated signalling. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G10470 | Encodes a two-component response regulator. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
| AT3G48100 | Encodes a transcription repressor that mediates a negative feedback loop in cytokinin signalling. ARR5 expression is upregulated by Class I KNOX genes. Arr5 protein is stabilized by cytokinin in a two-component phosphorelay. |
| AT5G62920 | Encodes a Type-A response regulator that is responsive to cytokinin treatment. Its C-ter domain is very short in comparison to other Arabidopsis ARRs (17 total). Arr6 protein is stabilized by cytokinin. |
| AT1G19050 | Encodes a member of the Arabidopsis response regulator (ARR) family, most closely related to ARR15. A two-component response regulator protein containing a phosphate accepting domain in the receiver domain but lacking a DNA binding domain in the output domain. Involved in response to cytokinin and meristem stem cell maintenance. Arr7 protein is stabilized by cytokinin. |
| AT3G57040 | response regulator ARR9, A two-component response regulator-like protein with a receiver domain with a conserved aspartate residue and a possible phosphorylation site and at the N-terminal half. Appears to interact with histidine kinase like genes ATHP3 and ATHP2 |
| AT1G09950 | RESPONSE TO ABA AND SALT 1;(source:Araport11) |
| AT3G49570 | response to low sulfur 3;(source:Araport11) |
| AT5G65950 | TRAPPIII complex protein which regulates TGN integrity, by altered TGN/EE association of several residents, including SYNTAXIN OF PLANTS 61 (SYP61), and altered vesicle morphology. Involved in regulation of endosomal function and salt stress response. |
| AT4G39090 | Similar to cysteine proteinases, induced by desiccation but not abscisic acid. Required for RRS1-R mediated resistance against Ralstonia solanacearum. Interacts with the R. solanacearum type III effector PopP2. RD19 associates with PopP2 to form a nuclear complex that is required for activation of the RRS1-R?mediated resistance response. |
| AT1G47128 | Cysteine proteinase precursor-like protein/ dehydration stress-responsive gene (RD21). Has been shown to have peptide ligase activity and protease activity in vitro. RD21 is involved in immunity to the necrotrophic fungal pathogen Botrytis cinerea.Activity detected in root, leaf, flower and cell culture. |
| AT2G21620 | Encodes gene that is induced in response to desiccation; mRNA expression is seen 10 and 24 hrs after start of desiccation treatment. |
| AT5G59820 | Encodes a zinc finger protein involved in high light and cold acclimation. Overexpression of this putative transcription factor increases the expression level of 9 cold-responsive genes and represses the expression level of 15 cold-responsive genes, including CBF genes. Also, lines overexpressing this gene exhibits a small but reproducible increase in freeze tolerance. Because of the repression of the CBF genes by the overexpression of this gene, the authors speculate that this gene may be involved in negative regulatory circuit of the CBF pathway. The mRNA is cell-to-cell mobile. |
| AT2G41945 | Encodes a novel protein found only in plants. RED1 has two isoforms RED1.1 and RED1.2. It is localized to the nucleus. Loss of function mutants are embryo lethal but can be rescued before desiccation by embryo culture. |
| AT1G64090 | Reticulan like protein B3;(source:Araport11) |
| AT5G22790 | reticulata-related 1;(source:Araport11) |
| AT3G08630 | alphavirus core family protein (DUF3411);(source:Araport11) |
| AT3G08640 | alphavirus core family protein (DUF3411);(source:Araport11) |
| AT2G46170 | Reticulon family protein;(source:Araport11) |
| AT3G61560 | Reticulon family protein;(source:Araport11) |
| AT3G12280 | Encodes a retinoblastoma homologue RETINOBLASTOMA-RELATED protein (RBR or RBR1). RBR controls nuclear proliferation in the female gametophyte. Also required for correct differentiation of male gametophytic cell types. Regulates stem cell maintenance in Arabidopsis roots. Involved in the determination of cell cycle arrest in G1 phase after sucrose starvation. RBR1 is also involved in regulation of imprinted genes. Together with MSI1 it represses the expression of MET1. This in turn activates expression of the imprinted genes FIS2 and FWA. Functions as a positive regulator of the developmental switch from embryonic heterotrophic growth to autotrophic growth.ChIP studies indicate that one class of targets of RBR1 are transposable elements. |
| AT5G17300 | Myb-like transcription factor that regulates hypocotyl growth by regulating free auxin levels in a time-of-day specific manner. |
| AT5G37260 | Encodes a MYB family transcription factor Circadian 1 (CIR1). Involved in circadian regulation in Arabidopsis. |
| AT3G09600 | Encodes a MYB-like transcription factor similar to CIRCADIAN CLOCK-ASSOCIATED1 (CCA1) and ELONGATED HYPOCOTYL (LHY). Involved in the regulation of circadian clock by modulating the pattern of histone 3 (H3) acetylation. Functions as a transcriptional activator of evening element containing clock genes. Involved in heat shock response. |
| AT1G80360 | Encodes a methionine-specific aminotransferase that uses the ethylene biosynthetic intermediate methionine as an amino donor and the auxin biosynthetic intermediate indole-3-pyruvic acid as an amino acceptor to produce L-tryptophan and 2-oxo-4-methylthiobutyric acid. These actions allow VAS1 to coordinate both auxin and ethylene biosynthesis. It functions downstream of TAA1/SAV3 but upstream of YUCs to negatively modulate IAA biosynthesis directly by altering the 3-IPA pool. |
| AT3G02230 | RGP1 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1/rgp2 (at5g15650) double mutants have a male gametophyte lethal phenotype. RGP1 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. The mRNA is cell-to-cell mobile. |
| AT5G60690 | REVOLUTA regulates meristem initiation at lateral positions. a member of a small homeodomain-leucine zipper family. Has overlapping functions with PHAVOLUTA and PHABULOSA. The mRNA is cell-to-cell mobile. |
| AT1G62910 | Encodes PPR protein involved in mitochondrial 5' end processing. Ecotype variants show differences in processing. |
| AT5G15740 | RRT1 is a member of a novel glycosyltransferase famly in plants. It functions as a rhamnosyltransferase, elongating the RG-1 backbone. It functions during seed coat mucilage development. |
| AT1G19530 | Direct target of RGA, plays an essential role in GA-mediated tapetum and pollen development. |
| AT1G66350 | Negative regulator of GA responses, member of GRAS family of transcription factors. Also belongs to the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. RGL1 may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Rapidly degraded in response to GA. Involved in flower and fruit development. |
| AT3G03450 | Encodes a DELLA protein, a member of the GRAS superfamily of putative transcription factors. DELLA proteins restrain the cell proliferation and expansion that drives plant growth. Negative regulator of the response to GA in controlling seed germination. GA triggers the degradation of RGL2 protein in a process blocked by both proteasome inhibitors and serine/threonine phosphatase inhibitors. The protein undergoes degradation in response to GA via the 26S proteasome. RGL2 may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Rapidly degraded in response to GA. Regulates GA-promoted seed germination. Involved in flower and fruit development. |
| AT5G17490 | Encodes a DELLA subfamily member that acts as a negative regulator of GA signaling and as a coactivator of ABI3 to promote seed storage protein biosynthesis during the seed maturation stage. |
| AT1G34110 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT1G56550 | Encodes a rhamnogalacturonan II specific xylosyltransferase. |
| AT1G78570 | Encodes a UDP-L-Rhamnose synthase involved in the biosynthesis of rhamnose, a major monosaccharide component of pectin. Catalyzes the conversion of UDP-D-Glc to UDP-L-Rha. The dehydrogenase domain of RHM1 was shown to catalyze the conversion of UDP-D-Glc to the reaction intermediate UDP-4-keto-6-deoxy-D-Glc using recombinant protein assay but the activity of the full-length protein was not determined as it could not be expressed in E. coli. |
| AT3G09970 | Encodes a cytosolic tyrosine phosphatase. |
| AT5G07250 | RHOMBOID-like protein 3;(source:Araport11) |
| AT1G52580 | RHOMBOID-like protein 5;(source:Araport11) |
| AT1G12750 | RHOMBOID-like protein 6;(source:Araport11) |
| AT4G23070 | RHOMBOID-like protein 7;(source:Araport11) |
| AT2G02990 | Encodes a member of the ribonuclease T2 family that responds to inorganic phosphate starvation, and inhibits production of anthocyanin. Also involved in wound-induced signaling independent of jasmonic acid. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in roots. |
| AT2G39780 | Encodes the main endoribonuclease activity in plant cells and localizes to the endoplasmic reticulum (ER), ER-derived structures, and vacuoles. It is essential for normal ribosomal RNA recycling. The mRNA is cell-to-cell mobile. |
| AT2G01290 | Cytosolic ribose-5-phosphate isomerase. Knockout mutation causes chloroplast dysfunction, late flowering and premature cell death. |
| AT5G15980 | Ribosomal pentatricopeptide repeat protein |
| AT2G39460 | Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB. |
| AT3G55280 | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA and functionally redundant to it. |
| AT1G07320 | encodes a plastid ribosomal protein L4 |
| AT3G44890 | Plastid ribosomal protein CL9 The mRNA is cell-to-cell mobile. |
| AT3G44590 | cytosolic ribosomal protein gene, part of bL12 family |
| AT3G46040 | Regulated by TCP20. The mRNA is cell-to-cell mobile. |
| AT5G64140 | Encodes a putative ribosomal protein S28. |
| AT3G63190 | The gene encodes a chloroplast ribosome recycling factor homologue. Analysis of mutants revealed its role in the chloroplast development and eary stages of embryo development. |
| AT3G46620 | Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants. |
| AT5G59550 | Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants. |
| AT5G63970 | Encodes a ubiquitin ligase that is an essential upstream modulator of JA signaling in response to various stimuli. |
| AT1G79380 | Encodes a ubiquitin ligase that is an essential upstream modulator of JA signaling in response to various stimuli. |
| AT3G01650 | Encodes RGLG1 (RING domain ligase 1), a RING domain ubiquitin E3 ligase that negatively regulates the drought stress response by mediating ERF53 transcriptional activity. ABA inhibits myristoylation and induces shuttling of the RGLG1 to promote nuclear degradation of PP2CA. |
| AT4G03510 | RMA1 encodes a novel 28 kDa protein with a RING finger motif and a C-terminal membrane-anchoring domain that is involved in the secretory pathway. Has E3 ubiquitin ligase activity. |
| AT4G28270 | Encodes a RING finger E3 ubiquitin ligase. Binds and ubiquitinates ABP1 in vivo and in vitro. |
| AT4G27470 | Encodes a RING finger E3 ubiquitin ligase. |
| AT3G56580 | Encodes a functional E3 ubiquitin ligase involved in the dehydration stress response and regulation of proline biosynthesis. |
| AT5G22920 | Encodes a protein with sequence similarity to RING, zinc finger proteins. Loss of function mutations show reduced (15%) stomatal aperture under non stress conditions. |
| AT4G11370 | Encodes a putative RING-H2 finger protein RHA1a. |
| AT4G11360 | Encodes a putative RING-H2 finger protein RHA1b. The mRNA is cell-to-cell mobile. |
| AT2G17450 | Encodes a putative RING-H2 finger protein RHA3a. |
| AT4G00335 | RING-H2 finger B1A;(source:Araport11) |
| AT2G39720 | Encodes a putative RING-H2 finger protein RHC2a. |
| AT2G01150 | Encodes a RING-H2 finger protein that is expressed in vascular tissue, root tips, embryos and pistils. |
| AT5G44180 | Interacts with CHR11, CHR17, and ARID5, several known subunits of ISWI. JA biosynthesisis is positively regulated by this chromatin remodeling complex, thereby promoting stamen filament elongation. |
| AT5G06450 | RICE2 is cytoplasmically localized and has 3?- 5? exoribonuclease activity. When RICE2 and its paralog RICE1 are knocked down, miRNA levels are decreased. RICE1 interacts with AGO1 and AGO10. It may affect miRNA accumulation by clearing RISC by degrading 5? products of AGO cleavage |
| AT5G65900 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT5G63120 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G14610 | DEAD box RNA helicase family protein;(source:Araport11) |
| AT3G09720 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G45810 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G60620 | RNA polymerase I subunit 43;(source:Araport11) |
| AT3G54490 | NRPE5-like protein of unknown function; homologous to budding yeast RPB5 |
| AT4G35800 | Encodes the unique largest subunit of nuclear DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB1 and a homolog of the E. coli RNA polymerase beta prime subunit. |
| AT1G63130 | Transacting siRNA generating locus. Its derived siR9as targets AT1G62930 for cleavage. Itself is targeted by TAS2-derived ta-siR2140 for cleavage. |
| AT4G39260 | Encodes a glycine-rich protein with RNA binding domain at the N-terminus. Protein is structurally similar to proteins induced by stress in other plants. Gene expression is induced by cold. Transcript undergoes circadian oscillations that is depressed by overexpression of AtGRP7. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). |
| AT3G26420 | Zinc finger-containing glycine-rich RNA-binding protein. Cold-inducible. Contributes to the enhancement of freezing tolerance. Members of this protein family include AT3G26420 (ATRZ-1A), AT1G60650 (AtRZ-1b) and AT5G04280 (AtRZ-1c). |
| AT1G60200 | RBM25 is an alternative splicing factor involved in mediation of abiotic stress response and ABA response. Its expression is modulated by a variety of stressors and it in turn appears to affect the ratio of splice variants of stress responsive genes such as HAB1.2/HAB1.1. |
| AT1G49600 | RNA-binding protein 47A;(source:Araport11) |
| AT3G19130 | RBP47B, is a component of the stress granule proteome and interacts with 2',3'-cAMP. |
| AT1G47490 | RNA-binding protein 47C;(source:Araport11) |
| AT1G47500 | RNA-binding protein 47C;(source:Araport11) |
| AT4G03110 | Encodes a putative RNA-binding protein that is located in the cytoplasm and is involved in the hypersensitive response and positively regulates salicylic acid-mediated immunity. |
| AT3G49500 | Encodes RNA-dependent RNA polymerase. Involved in trans-acting siRNA and other siRNA biogenesis. Required for post-transcriptional gene silencing and natural virus resistance.Loss of function mutants produce ectopic megaspore mother cell and supernumary female gametophytes. |
| AT1G80650 | RNAse THREE-like protein 1;(source:Araport11) |
| AT2G35210 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT1G30510 | Encodes a root-type ferredoxin:NADP(H) oxidoreductase. |
| AT3G13870 | required for regulated cell expansion and normal root hair development. Encodes an evolutionarily conserved protein with putative GTP-binding motifs that is implicated in the control of vesicle trafficking between the endoplasmic reticulum and the Golgi compartments. Degraded by LNP1 and 2 to maintain a tubular ER network. |
| AT3G51460 | Encodes RHD4 (ROOT HAIR DEFECTIVE4), a phosphatidylinositol-4-phosphate phosphatase required for root hair development. The mRNA is cell-to-cell mobile. |
| AT1G27740 | Basic helix-loop-helix (bHLH) transcription factor that is sufficient to promote postmitotic cell growth in root-hair cells. RSL4 is a direct transcriptional target of RHD6 |
| AT1G12950 | root hair specific 2;(source:Araport11) |
| AT5G57280 | Gene encodes a methyltransferase-like protein involved in pre-rRNA processing. |
| AT4G16515 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
| AT3G02240 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
| AT5G64770 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
| AT2G31190 | Encodes RUS2 (root UVB sensitive2), a DUF647-containing protein that is homologous to the RUS1 protein. RUS2 works with RUS1 in a root UV-B sensing pathway that plays a vital role in Arabidopsis early seedling morphogenesis and development. Required for auxin polar transport. |
| AT5G01510 | root UVB sensitive protein (Protein of unknown function, DUF647);(source:Araport11) |
| AT4G38430 | Member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily, also known as DUF315). Interacts with ROP1 but the whole protein lacks Rho guanyl-nucleotide exchange factor activity in vitro. The DUF315/PRONE domain is sufficient to confer RopGEF catalytic activity. ropgef1 mutants have defects in auxin transport that result in abnormal development of embryos and growth defects. |
| AT5G19560 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT1G52240 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily . |
| AT1G31650 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT3G24620 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT1G78430 | Encodes RIP2 (ROP interactive partner 2), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants). |
| AT3G53350 | Encodes RIP3 (ROP interactive partner 3), a microtubule-binding protein that is anchored to the plasma membrane domains and promotes local microtubule disassembly, forming as specific pattern of secondary walls in xylem vessel cells. Localized at microtubules and interacts with the plant-specific kinesin AtKinesin-13A. |
| AT5G60210 | Encodes RIP5 (ROP interactive partner 5), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants). |
| AT1G27380 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Interacts with Rop1 and is involved in pollen tube growth and function. Protein most similar to RIC4 (family subgroup V). Gene is expressed in all tissues examined. |
| AT2G16600 | Encodes cytosolic cyclophilin ROC3. The mRNA is cell-to-cell mobile. |
| AT4G36380 | Encodes a cytochrome P-450 gene that is involved in leaf blade expansion by controlling polar cell expansion in the leaf length direction. Member of the CYP90C CYP450 family. ROT3 was shown to be involved in brassinosteroid biosynthesis, most likely in the conversion step of typhasterol (TY) to castasterone (CS). As 6-deoxo-CS was unable to restore the phenotype of rot3-1, it has been postulated that ROT3 might be specifically involved in the conversion of TY to CS in the C6-oxidation pathway of brassinolide. Recently, CYP90C1 was shown to catalyse the C-23 hydroxylation of several brassinosteroids (the enzyme has a broad specificity for 22-hydroxylated substrates). |
| AT1G68825 | ROTUNDIFOLIA like 15;(source:Araport11) |
| AT3G25717 | ROTUNDIFOLIA like 16;(source:Araport11) |
| AT1G13245 | ROTUNDIFOLIA like 17;(source:Araport11) |
| AT2G29125 | ROTUNDIFOLIA like 2;(source:Araport11) |
| AT1G67265 | ROTUNDIFOLIA like 21;(source:Araport11) |
| AT1G07490 | ROTUNDIFOLIA like 3;(source:Araport11) |
| AT4G35783 | ROTUNDIFOLIA like 6;(source:Araport11) |
| AT2G39705 | ROTUNDIFOLIA like 8;(source:Araport11) |
| AT5G26760 | Encodes RPAP2 IYO Mate (RIMA), a homologue of yeast and human proteins linked to nuclear import of selective cargo. Knockdown of RIMA causes delayed onset of cell differentiation. |
| AT2G20310 | Encodes RPM1 Interacting Protein 13 (RIN13), a resistance protein interactor shown to positively enhance resistance function of RPM1. |
| AT3G25070 | Encodes a member of the R protein complex and may represent a virulence target of type III pili effector proteins (virulence factors) from bacterial pathogens, which is 'guarded' by R protein complex (RPM1 and RPS2 proteins). RIN4 physically interacts with RPS2 and RPM1 in vivo. Bacterial avirulence (Avr) effectors AvrB, AvrRpm1, and AvrRpt2 induce a mobility shift in RIN4 and expression of AvrRpt2 induces rapid degradation of RIN4. RIN4 contains 2 sites for AvrRpt2 autocleavage, called RCS1 and RCS2. Overexpression of RIN4 inhibits multiple phenotypes associated with AvrRpt2 function and also inhibits PAMP-induced defense signaling. Attached to the plasma membrane at its carboxyl terminus. Cleaved by AvrRpt2 at two PxFGxW motifs, one releasing a large portion of RIN4 from the plasma membrane and both exposing amino-terminal residues that destabilized the carboxyl-terminal cleavage products by targeting them for N-end ubiquitylation and proteasomal degradation. Major virulence target of the TTSE HopF2Pto. The mRNA is cell-to-cell mobile. |
| AT2G05940 | Encodes a receptor-like cytoplasmic kinase that phosphorylates the host target RIN4, leading to the activation of a plant innate immune receptor RPM1. |
| AT1G12210 | RFL1 has high sequence similarity to the adjacent disease resistance (R) gene RPS5. |
| AT2G32415 | Polynucleotidyl transferase, ribonuclease H fold protein with HRDC domain-containing protein;(source:Araport11) |
| AT4G36800 | RUB1 conjugating enzyme that conjugates CUL1 and is involved in auxin response and embryogenesis. RCE1 protein physically interacts with RBX1, which may be the E3 for CUL1. |
| AT5G38420 | Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Activated by OXS2 under the treatment of salt. |
| AT5G38410 | Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Functions to yield sufficient Rubisco content for leaf photosynthetic capacity. |
| AT4G35590 | RWP-RK domain-containing protein;(source:Araport11) |
| AT1G75950 | SKP1 is core component of the SCF family of E3 ubiquitin ligases and serves to tether the rest of the complex to an F-box protein, which provides specificity in binding to ubiquitin ligase substrate proteins. Predominately expressed from leptotene to pachytene. Negatively regulates recombination. Interacts with P0, a silencing suppressor protein encoded by poleroviruses by means of a conserved minimal F-box motif. The mRNA is cell-to-cell mobile. |
| AT4G39460 | Encodes a plastid metabolite transporter required for the import of S-Adenosylmethionine from the cytosol. Impaired function of SAMT1 led to decreased accumulation of prenyllipids and mainly affected the chlorophyll pathway. |
| AT3G02470 | Encodes a S-adenosylmethionine decarboxylase involved in polyamine biosynthesis. |
| AT5G15950 | Adenosylmethionine decarboxylase family protein;(source:Araport11) |
| AT1G61380 | Encodes a membrane localized S-domain receptor kinase that is involved in lipopolysaccharide (LPS) sensing. SD1-29 detected LPS of Pseudomonas and Xanthomonas species for which it serves as a microbe associated molecular pattern triggering innate immunity. Loses of function mutants are hyper susceptible to P.syringae. |
| AT2G41530 | Encodes a protein with S-formylglutathione hydrolase activity. |
| AT1G49820 | encodes 5-methylthioribose kinase, involved in methionine cycle The mRNA is cell-to-cell mobile. |
| AT4G16295 | self-incompatibility (S) protein homolog, expressed at very low levels in floral buds |
| AT3G23700 | Encodes a chloroplast-localized S1 domain-containing protein with RNA chaperone activity that affects the splicing and processing of chloroplast transcripts and plays a role in seedling growth in the presence of ABA. Binds the chloroplast psbA RNA and some other chloroplast RNAs. Required for the stability of the chloroplast ndhC RNA. Inhibits ribosome association with psbA RNA and ycf1 RNA. Not required for the splicing of chloroplast trnL, as had been reported previously. |
| AT5G03350 | Belongs to the group of early SA-activated genes. Involved in resistance to Pst Avr-Rpm1 as a component of the SA35 mediated defense processes associated to the ETI response. Involved in resistance to P.syringae pv. tomato Avr-Rpm1 in Arabidopsis, as a component of the SA-mediated defense processes associated with the effector-triggered immunity response. |
| AT1G35112 | Member of Sadhu non-coding retrotransposon family |
| AT5G02020 | Encodes a protein involved in salt tolerance, names SIS (Salt Induced Serine rich). |
| AT3G46550 | Isolated in a screen for salt hypersensitive mutants. Mutants have thinner cell walls, abnormal siliques and root growth is inhibited under salt stress. The gene has similarity to arabinogalactan proteins and domains associated with cell adhesion.SOS5 is required for normal mucilage adherence to seeds. |
| AT1G06040 | Encodes salt tolerance protein (STO) which confers salt tolerance to yeast cells. Fully complements calcineurin deficient yeast but does not encode a phosphoprotein phosphatase. Sequence has similarities to CONSTANS. STO co-localizes with COP1 and plays a role in light signaling.STO transcript levels are regulated by photoperiod and phtyohormones. STO competes with FLC in the regulation of floral transition genes SOC1 and FT. |
| AT3G55530 | Encodes an intracellular membrane localized protein with E3 ligase activity, found in the ER with the C-terminus facing the cytoplasm. It is involved in regulation of ABA signaling. Loss of function alleles show decreased sensitivity to ABA. Overexpression results in increased sensitivity to ABA. |
| AT2G31870 | The gene encodes a poly(ADPribose) glycohydrolase (PARG1). Mutant analysis suggests that PARG1 plays a role in abiotic stress responses and DNA repair. Loss of function mutants accumulate poly(ADPribose) and have increased cell death when treated with bleomycin. |
| AT1G19330 | Evening-expressed key component of Sin3-HDAC complex, which bind directly to the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and PSEUDO-RESPONSE REGULATOR 9 (PRR9) promoters and catalyze histone 3 (H3) deacetylation at the cognate regions to repress expression, allowing the declining phase of their expression at dusk. |
| AT1G73805 | Encodes SAR Deficient 1 (SARD1), a key regulator for ICS1 (Isochorismate Synthase 1) induction and salicylic acid (SA) synthesis. |
| AT5G52810 | SAR-DEFICIENT4 (SARD4) alias ORNITHINE CYCLODEAMINASE/m-CRYSTALLIN (ORNCD1) is involved in the biosynthesis of pipecolic acid. The reductase converts dehydropipecolic acid intermediates generated from L-Lysine by AGD2-LIKE DEFENSE RESPONSE PROTEIN1 (ALD1) to pipecolic acid (PMID:28330936). |
| AT2G33800 | Encodes SCABRA1 (SCA1), a nuclear gene encoding a plastid-type ribosomal protein that functions as a structural component of the 70S plastid ribosome. The sca1-rps5 allele exhibits defects in plastid 16SrRNA processing and a resulting decrease in accumulation of photosynthetic proteins. Loss-of-function mutations enhance the polarity defects of the as2 mutants. |
| AT5G01730 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
| AT2G38440 | Encodes a subunit of the WAVE complex. The WAVE complex is required for activation of ARP2/3 complex which functions in actin microfilament nucleation and branching. Mutations cause defects in both the actin and microtubule cytoskeletons that result in aberrant epidermal cell expansion. itb1 mutants showed irregularities in trichome branch positioning and expansion. The SHD domain of this protein binds to BRK1 and overexpression of the SHD domain results in a dominant negative phenotype. The mRNA is cell-to-cell mobile. |
| AT3G54220 | Encodes a member of a novel family having similarity to DNA binding proteins containing basic-leucine zipper regions; scr is expressed in cortex/endodermal initial cells and in the endodermal cell lineage. Regulates the radial organization of the root. Is required cell-autonomously for distal specification of the quiescent center, which in turn regulates stem cell fate of immediately surrounding cells. SCR appears to be a direct target of SHR. SCR and SCR-LIKE 23 act redundantly in bundle sheath cell fate specification. |
| AT1G07530 | Encodes a member of the GRAS family of transcription factors. The protein interacts with the TGA2 transcription factor and affects the transcription of stress-responsive genes. The protein is found in the nucleus and is also exported to the cytoplasm. |
| AT1G50420 | Encodes a scarecrow-like protein (SCL3) Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay). |
| AT5G52510 | SCARECROW-like 8;(source:Araport11) |
| AT5G13300 | Belongs to 15-member small GTPase gene family, ARF-GAP domain proteins (AGD); corresponds to AGD3, and is one of four proteins belonging to class 1, together with AGD1, AGD2 and AGD4. The protein contains four domains: BAR domain, PH domain, an ARF-GAP domain, and two Ankyrin repeats. In sfc mutants, the secondary and tertiary veins of cotyledons, leaves, sepals and petals are largely replaced by small segments of discontinuous veins. sfc mutants have exaggerated responses to auxin. |
| AT3G54990 | Encodes a AP2 domain transcription factor that can repress flowering. SMZ and its paralogous gene, SNARCHZAPFEN (SNZ), share a signature with partial complementarity to the miR172 microRNA, whose precursor is induced upon flowering. |
| AT2G39250 | Encodes a AP2 domain transcription factor that can repress flowering. SNZ and its paralogous gene, SCHLAFMUTZE (SMZ), share a signature with partial complementarity to the miR172 microRNA, whose precursor is induced upon flowering. |
| AT5G46410 | Encodes a SCP1-like small phosphatase (SSP). Three SSPs form a unique group with long N-terminal extensions: AT5G46410 (SSP4), AT5G11860 (SSP5), AT4G18140 (SSP4b). SSP4 and SSP4b were localized exclusively in the nuclei, whereas SSP5 accumulated in both nuclei and cytoplasm. All three SSPs encodes active CTD phosphatases like animal SCP1 family proteins, with distinct substrate specificities: SSP4 and SSP4b could dephosphorylate both Ser2-PO(4) and Ser5-PO(4) of CTD, whereas SSP5 dephosphorylated only Ser5-PO(4). The mRNA is cell-to-cell mobile. |
| AT4G18140 | Encodes a SCP1-like small phosphatase (SSP). Three SSPs form a unique group with long N-terminal extensions: AT5G46410 (SSP4), AT5G11860 (SSP5), AT4G18140 (SSP4b). SSP4 and SSP4b were localized exclusively in the nuclei, whereas SSP5 accumulated in both nuclei and cytoplasm. All three SSPs encodes active CTD phosphatases like animal SCP1 family proteins, with distinct substrate specificities: SSP4 and SSP4b could dephosphorylate both Ser2-PO(4) and Ser5-PO(4) of CTD, whereas SSP5 dephosphorylated only Ser5-PO(4). |
| AT1G14182 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT2G01470 | Sec12p-like protein (GTP exchange protein) that functionally complements yeast sec12 null mutant. Protein is localized to the ER. |
| AT1G03220 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G39180 | encodes a protein that complements the function of a sec14(ts) mutant of S. cerevisiae |
| AT2G20840 | Secretory carrier membrane protein (SCAMP) family protein;(source:Araport11) |
| AT1G32050 | SCAMP family protein;(source:Araport11) |
| AT5G40390 | Encodes a protein which might be involved in the formation of verbascose. A T-DNA insertion mutant was shown to have a decreased amount of verbascose (as well as mannitol) whereas the levels of raffinose and stachyose remained unchanged. Enhances drought tolerance through raffinose synthesis or galactinol hydrolysis. |
| AT3G10420 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G00026 | Encodes SD3 (Segregation Distortion 3), a protein with high similarity to yeast translocase on the inner mitochondrial membrane 21 (TIM21). sd3 mutants show seedling-lethal phenotype in light-grown seedlings and shorter hypocotyls in dark-grown seedlings. SD3 overexpression plants show increase in cell number and cell size, as well as elevated ATP level. |
| AT4G14030 | selenium-binding protein 1;(source:Araport11) |
| AT4G14040 | selenium-binding protein 2;(source:Araport11) |
| AT3G10985 | A senescence-associated gene whose expression is induced in response to treatment with Nep1, a fungal protein that causes necrosis. The mRNA is cell-to-cell mobile. |
| AT1G20780 | Encodes a protein containing a U-box and an ARM domain. Homozygous mutant seedlings have a seedling lethal phenotype with widespread cell death lesions throughout the cotyledons and roots. |
| AT3G14067 | Encodes a protein with similarity to serine protease, subtilisin, that is upregulated during senescence and expressed in the arial portions of the plant.Loss of function mutations have increased branch number but normal silique length and seed set and therefore have increased fertility. |
| AT3G06510 | Encodes a protein with beta-glucosidase and galactosyltransferase activity, mutants show increased sensitivity to freezing. Though it is classified as a family I glycosyl hydrolase, it has no hydrolase activity in vitro. |
| AT4G04920 | Encodes a nuclear targeted protein that plays a role in the CBF pathway -downstream of CBF translation. Mutants have impaired cold responses, reduced levels of cold induced RNA transcripts, are sensitive to osmotic stress. Required for expression of CBF-controlled cold-upregulated genes and some, but not all, other cold up-regulated genes. Required for recruitment of the Mediator complex and RNA polymerase II to CBF-controlled cold-responsive genes. Required for expression of some dark-upregulated genes. SFR6 was isolated as a suppressor of cell wall defects in cob6 mutant background. |
| AT1G34370 | Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity. Cell wall of the mutant is unstable in low pH medium (pH 4.5) in low Ca solution. This would mediate Ca-alleviation of low pH stress through pectin-Ca interaction. In vitro binding and mutated-promoter-GUS assays identified that STOP1 directly activates AtALMT1 expression through the binding to the promoter by four zinc finger domains. Binding of STOP1 to promoter is an essential step of Al-inducible AtALMT1 expression. The mRNA is cell-to-cell mobile. |
| AT5G59560 | Encodes a novel protein conserved in higher eukaryotes. Normal function of the protein is required for normal oscillator function during circadian rhythm. Mutant analyses also suggest a role in phytochrome B (phyB)-mediated light signaling. |
| AT5G36180 | serine carboxypeptidase-like 1;(source:Araport11) |
| AT2G22970 | serine carboxypeptidase-like 11;(source:Araport11) |
| AT2G22980 | serine carboxypeptidase-like 13;(source:Araport11) |
| AT3G12240 | serine carboxypeptidase-like 15;(source:Araport11) |
| AT5G09640 | encodes a serine carboxypeptidase-like (SCPL) protein. Mutants accumulate sinapoylglucose instead of sinapoylcholine, and have increased levels of choline and decreased activity of the enzyme sinapoylglucose:choline sinapoyltransferase. |
| AT4G12910 | serine carboxypeptidase-like 20;(source:Araport11) |
| AT3G02110 | serine carboxypeptidase-like 25;(source:Araport11) |
| AT2G35780 | serine carboxypeptidase-like 26;(source:Araport11) |
| AT3G07990 | serine carboxypeptidase-like 27;(source:Araport11) |
| AT2G35770 | serine carboxypeptidase-like 28;(source:Araport11) |
| AT4G30810 | serine carboxypeptidase-like 29;(source:Araport11) |
| AT5G23210 | serine carboxypeptidase-like 34;(source:Araport11) |
| AT1G28110 | serine carboxypeptidase-like 45;(source:Araport11) |
| AT3G45010 | serine carboxypeptidase-like 48;(source:Araport11) |
| AT3G10410 | SERINE CARBOXYPEPTIDASE-LIKE 49;(source:Araport11) |
| AT4G13930 | Encodes a serine hydroxymethyltransferase maximally expressed in root |
| AT3G48780 | Encodes one of the two LCB2 subunits (LCB2a and LCB2b) of serine palmitoyltransferase, an enzyme involved in sphingolipid biosynthesis. LCB2a and LCB2b are functional redundant. Double mutants are gametophytic lethal. The mRNA is cell-to-cell mobile. |
| AT4G37930 | Encodes a protein with mitochondrial serine hydroxymethyltransferase activity, which functions in the photorespiratory pathway, catalyzes the conversion of serine and tetrahydrofolate to glycine and 5,10-methylene tetrahydrofolate. Involved in controlling cell damage caused by abiotic stress, such as high light and salt and the hypersensitive defense response of plants. |
| AT4G02430 | Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT5G63870 | Encodes a nuclear localized serine/threonine phosphatase that appears to be regulated by redox activity and is a positive regulator of cryptochrome mediated blue light signalling. |
| AT5G01820 | Encodes a CBL-interacting serine/threonine protein kinase. |
| AT4G35780 | ACT-like protein tyrosine kinase family protein;(source:Araport11) |
| AT4G38470 | Serine/threonine kinase that phosphorylate transit peptides of chloroplast and mitochondria targeted pre-proteins. |
| AT2G24360 | STYK serine threonine kinase that phosphorylates several oil body proteins including OLE1 and CLO4/CAL4. |
| AT5G53430 | Homology Subgroup III; Orthology Group 2 - A putative histone methyltransferase (predicted to methylate H3K4) related to the Drosophila trithorax group proteins TRX and TRR and the yeast gene SET1. A plant line expressing an RNAi construct directed against this gene has reduced agrobacterium-mediated tumor formation. |
| AT4G30860 | Encodes a member of the trxG protein family. Contains a SET domain which is known to be involved in modification of histone tails by methylation. Interacts physically with AMS, but the implications of this interaction are unknown.Overexpression results in plieotrophic developmental defects. |
| AT4G25520 | SEUSS-like 1;(source:Araport11) |
| AT4G18060 | SH3 domain-containing protein;(source:Araport11) |
| AT5G14640 | shaggy-like kinase 13;(source:Araport11) |
| AT4G00720 | Encodes ASKtheta, a group III Arabidopsis GSK3/shaggy-like kinase. Functions in the brassinosteroid signalling pathway. |
| AT5G26751 | Encodes a SHAGGY-related kinase involved in meristem organization. It regulates the redox stress response by phosphorylating glucose-6-phosphate dehydrogenase 6.Functions as a positive regulator of salt stress tolerance. Phosphorylates and enhances G6PD6 (At5g40760) activity |
| AT2G30980 | Encodes a GSK3-like protein kinase. This protein can interact with the BZR1 protein involved in brassinosteroid-mediated signaling in a Y2H assay and promotes BZR1 phosphorylation in protoplasts. |
| AT2G42830 | AGAMOUS [AG]-like MADS box protein (AGL5) involved in fruit development (valve margin and dehiscence zone differentiation). A putative direct target of AG. SHP2 has been shown to be a downstream gene of the complex formed by AG and SEP proteins (SEP4 alone does not form a functional complex with AG). |
| AT4G26690 | Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development. |
| AT1G07010 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT3G54430 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
| AT5G63780 | Encodes SHA1 (shoot apical meristem arrest), a putative E3 ligase (a RING finger protein) required for post-embryonic SAM maintenance. The mutant sha1-1 shows a primary SAM-deficient phenotype at the adult stage. |
| AT1G31480 | encodes a novel protein that may be part of a gene family represented by bovine phosphatidic acid-preferring phospholipase A1 (PA-PLA1)containing a putative transmembrane domain. SGR2 is involved in the formation and function of the vacuole. |
| AT2G01940 | Encodes a transcription factor that, together with IDD14 and IDD16, regulates auxin biosynthesis and transport and thus aerial organ morphogenesis and gravitropic responses. May be involved in an early event in shoot gravitropism such as gravity perception and/or a signaling process subsequent to amyloplast sedimentation as a putative transcription factor in gravity-perceptive cells. |
| AT2G36810 | Specifically involved in gravity perception and/or gravity signal transduction for the shoot gravitropic response. Effects gravitropism only in inflorescence stems but normal in both hypocotyls and roots. |
| AT5G02750 | Encodes an E3 ligase, SHOOT GRAVITROPISM9. Modulates the interaction between statoliths and F-Actin in gravity sensing. |
| AT1G04240 | SHY2/IAA3 regulates multiple auxin responses in roots. It is induced rapidly by IAA, and has been shown to be phosphorylated by oat phytochrome A in vitro. |
| AT4G25350 | SHB1 encodes a nuclear and cytosolic protein that has motifs homologous with SYG1 protein family members. Acts in cryptochrome signaling. Overexpression of SHB1 enhanced the expression of PHYTOCHROME-INTERACTING FACTOR4 (PIF4) under red light and promoted proteasome-mediated degradation of phytochrome A and hypocotyl elongation under far-red light. A knockout allele suppressed LONG HYPOCOTYL IN FAR-RED LIGHT1 (HFR1) expression and showed several deetiolation phenotypes. Acts upstream of HFR1. Regulates seed development. |
| AT4G39100 | Encodes a plant-specific histone reader capable of recognizing both H3K27me3 and H3K4me3 via its bromo-adjacent homology (BAH) and plant homeodomain (PHD) domains, respectively. Detailed biochemical and structural studies suggest a binding mechanism that is mutually exclusive for either H3K4me3 or H3K27me3. SHL plays a role in the repression of flowering. |
| AT1G29785 | Natural antisense transcript overlaps with AT1G29780. Has been identified as a translated small open reading frame by ribosome profiling. |
| AT2G41312 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT1G34418 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT3G06125 | Unknown gene The mRNA is cell-to-cell mobile. |
| AT4G20362 | Natural antisense transcript overlaps with AT4G20360. Has been identified as a translated small open reading frame by ribosome profiling. |
| AT3G29250 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G55290 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G45690 | Encodes a protein with similarity to yeast Pep16p, a membrane localized protein involved in peroxisome assembly and protein-trafficking. SSE1 mutant seeds do not accumulate oils and dessicated seeds have a shrunken appearance. Involved in protein and oil body biogenesis. SSE is expressed during seed development, reaching the highest peak in mature siliques. Expression in leaves and roots is low compared to cotyledons and flowers. Located in peroxisomes and endoplasmic reticulum. Homologous to the peroxin PEX16 and complements the pex16 mutants of the yeast Yarrowia lipolytica. |
| AT5G04470 | Encodes a novel nuclear 14-kD protein containing a cyclin binding motif and a motif found in ICK/KRP cell cycle inhibitor proteins. It is required for coordinating cell division and cell differentiation during the development of Arabidopsis trichomes, playing a key role in the mitosis-to-endoreduplication transition. It interacts with D-type cyclins in vivo. |
| AT5G02220 | cyclin-dependent kinase inhibitor;(source:Araport11) |
| AT1G07500 | SMR5 is a member of the SIAMESE-RELATED Cyclin-Dependent Kinase Inhibitor family. It is induced by ROS/oxidative stress. |
| AT4G24500 | Encodes a proline-rich protein SICKLE (SIC). Required for development and abiotic stress tolerance. Involved in microRNA biogenesis. It is involved in mRNA splicing. It is a single copy gene in Arabidopsis and likely specific to higher plants. Along with RCN1, it functions in regulating auxin transport processes in part by regulating the recycling of PIN1 and PIN2 auxin transporters. It is required for circadian clock temperature responses. |
| AT3G10680 | SLI1 is a heat shock like protein that is found in sieve elements, sieve plates and spherical bodies peripheral to the mitochondria. Mutants show increased phloem feeding by aphids and decreased heat tolerance. |
| AT3G01680 | Encodes a protein localized to phloem filaments that is required for phloem filament formation. The mRNA is cell-to-cell mobile. |
| AT2G41180 | VQ motif-containing protein;(source:Araport11) |
| AT2G03120 | homologous to Signal Peptide Peptidases (SPP), required for pollen development and pollen germination. No homozygotes could be recovered from a T-DNA insertion mutant. The mRNA is cell-to-cell mobile. |
| AT1G73990 | Encodes a putative protease SppA (SppA). |
| AT1G63690 | SIGNAL PEPTIDE PEPTIDASE-LIKE 2;(source:Araport11) |
| AT2G43070 | SIGNAL PEPTIDE PEPTIDASE-LIKE 3;(source:Araport11) |
| AT1G01650 | SIGNAL PEPTIDE PEPTIDASE-LIKE 4;(source:Araport11) |
| AT5G62520 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Up-regulated by NaCl. SRO5 and P5CDH (an overlapping gene in the antisense orientation) generate 24-nt and 21-nt siRNAs, which together are components of a regulatory loop controlling reactive oxygen species (ROS) production and stress response. |
| AT2G43190 | Encodes a protein involved in rRNA but not tRNA maturation. |
| AT2G22990 | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose. |
| AT5G57900 | F-box protein, interacts with SKP1/ASK1 subunit of SCF ubiquitin ligase in a glucose-dependent manner |
| AT2G45950 | SKP1-like 20;(source:Araport11) |
| AT3G60020 | SKP1-like 5;(source:Araport11) |
| AT1G06110 | SKP1/ASK-interacting protein 16;(source:Araport11) |
| AT2G17030 | Encodes a SKP1/ASK-interacting protein. |
| AT3G54480 | Encodes an SKP1 interacting partner (SKIP5). |
| AT3G13400 | SKU5 similar 13;(source:Araport11) |
| AT2G23630 | SKU5 similar 16;(source:Araport11) |
| AT5G66920 | SKU5 similar 17;(source:Araport11) |
| AT1G75790 | SKU5 similar 18;(source:Araport11) |
| AT4G22010 | SKU5 similar 4;(source:Araport11) |
| AT1G76160 | SKU5 similar 5;(source:Araport11) |
| AT4G27970 | Encodes a protein with ten predicted transmembrane helices. The SLAH2 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. But, it is not expressed in guard cells and cannot complement a slac1-2 mutant suggesting that it performs a different function. SLAH2:GFP localizes to the plasma membrane. |
| AT4G24210 | F-box protein that is involved in GA signaling. Regulates seed germination. Component of E3 ubiquitin complex. Interacts with DELLA proteins. |
| AT1G55040 | SED1 is a protein of unknown function that is located in the mitochondrion. sed1 mutants are embryo lethal. |
| AT2G43810 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT3G04090 | Belongs to a family of plant aquaporins. Similar to yeast and radish aquaporins. Located on ER. |
| AT1G55270 | SAGL1 is a member of a small family of KELCH domain containing proteins. Loss of function mutants show increased lignin and anthocyanin production suggesting a role in regulation of phenylpropanoid biosynthesis. |
| AT5G18010 | Encodes SAUR19 (small auxin up RNA 19). Note that TAIR nomenclature is based on Plant Mol Biol. 2002, 49:373-85 (PMID:12036261). In Planta (2011) 233:1223?1235 (PMID:21327815), At5g18010 is SAUR24. |
| AT5G18020 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G18030 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G18080 | Encodes SAUR24 (small auxin up RNA 24). Note that TAIR nomenclature is based on Plant Mol Biol. 2002, 49:373-85 (PMID:12036261). In Planta (2011) 233:1223?1235 (PMID:21327815), SAUR24 is At5g18010. |
| AT3G03850 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G03840 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G03830 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G03820 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G29440 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G38850 | mRNA is rapidly induced by auxin and is very short-lived. Has been used as a reporter gene in studying auxin mutants. |
| AT2G45210 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G79130 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G29490 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G12830 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G34770 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G66260 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G21220 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G38825 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G38840 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G38860 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G13790 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G34790 | Putative OXS2-binding DEGs were constitutively activated by OXS2. |
| AT4G34800 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G03310 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G37030 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G34760 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G75580 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G53250 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G21210 | Putative auxin-regulated protein whose expression is downregulated in response to chitin oligomers. |
| AT1G29420 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G29430 | SAUR762 expression is induced during pollination and expressed in pollen tubes. SAUR62 likely functions in translation of proteins required for pollen tube development/function. |
| AT1G29450 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G29500 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G29510 | This locus was referred to as SAUR68 in PMID:17948056 but the nomenclature should be SAUR67. |
| AT5G10990 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G21200 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G20810 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G03847 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G17345 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G72430 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G35290 | hypothetical protein;(source:Araport11) |
| AT4G36110 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G51174 | Encodes a C/D box snoRNA (snoR30). Gb: AJ505639 |
| AT2G30942 | Encodes a 56-amino acid polypeptide with low but significant similarity to human small subunit of serine palmitoyltransferase that localizes to the ER and physically interacts with and greatly stimulates the activity of LCB1/LCB2 heterodimer ser palmitoyltransferase complex. |
| AT4G34620 | Encodes ribosomal protein S16, has embryo-defective lethal mutant phenotype |
| AT4G30350 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. Regulates root and root hair development downstream of KAI2-mediated signaling. |
| AT5G57130 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. |
| AT1G07200 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. |
| AT2G42030 | Encodes a RING domain E3 ligase. Has overlapping function with MUSE1 in the negative regulation of defence responses. SIKIC2 (and possibly SIKIC1 and 3) is ubiquination target. |
| AT1G78290 | encodes a member of SNF1-related protein kinase (SnRK2) family whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress and dehydration. |
| AT5G63650 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. |
| AT4G40010 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. |
| AT3G48530 | SNF1-related protein kinase regulatory subunit gamma 1;(source:Araport11) |
| AT3G19570 | Encodes SCO3 (snowy cotyledon3), a member of a largely uncharacterized protein family unique to the plant kingdom. The sco3-1 mutation alters chloroplast morphology and development, reduces chlorophyll accumulation, impairs thylakoid formation and photosynthesis in seedlings, and results in photoinhibition under extreme CO(2) concentrations in mature leaves. SCO3 is targeted to the periphery of peroxisomes. Together with QWRF2 redundantly modulates cortical microtubule arrangement in floral organ growth and fertility. |
| AT5G60750 | Encodes a chloroplast endoproteinase, SNOWY COTYLEDON4 (SCO4), required for photosynthetic acclimation to higher light intensities. |
| AT1G26210 | AtSOFL1 acts redundantly with AtSOFL2 as positive regulator of cytokinin levels. |
| AT3G05030 | Encodes a vacuolar K+/H+ exchanger essential for active K+ uptake at the tonoplast and involved in regulating stomatal closure. |
| AT4G32400 | Encodes a plastidial nucleotide uniport carrier protein required to export newly synthesized adenylates into the cytosol. |
| AT2G37390 | Chloroplast-targeted copper chaperone protein;(source:Araport11) |
| AT3G53530 | Chloroplast-targeted copper chaperone protein;(source:Araport11) |
| AT2G37570 | encodes a protein that can complement the salt-sensitive phenotype of a calcineurin (CaN)-deficient yeast mutant. This gene occurs in a single-copy and is 75% identical to tobacco SLT1 gene. |
| AT1G14750 | Encodes a meiotic cyclin-like protein, distinct from all other known Arabidopsis cyclins. It is not required for meiotic DSB formation but is necessary for meiotic DSB repair via the homologous chromosome. |
| AT1G71830 | Plasma membrane LRR receptor-like serine threonine kinase expressed during embryogenesis in locules until stage 6 anthers, with higher expression in the tapetal cell layer. SERK1 and SERK2 receptor kinases function redundantly as an important control point for sporophytic development controlling male gametophyte production. SERK1 interacts with and transphosphorylates EMS1 |
| AT1G03790 | Encodes SOMNUS (SOM), a nucleus-localized CCCH-type zinc finger protein. SOM negatively regulates light-dependent seed germination downstream of PIL5 (AT2G20180). |
| AT2G30360 | Encodes a SOS2-like protein kinase that is a member of the CBL-interacting protein kinase family.Loss of function mutants show a decrease in sensitivity to high pH.Phosphorylates AHA2, a plasma membrane H+ ATPase.This phosphorylation appears to regulate the activity of the proton transporter. |
| AT2G28150 | DUF966 domain containing protein, expressed during embryogenesis. |
| AT3G15354 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA3 (and SPA4) predominantly regulates elongation growth in adult plants. |
| AT1G53090 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA4 (and SPA3) predominantly regulates elongation growth in adult plants. |
| AT4G36930 | Encodes a transcription factor of the bHLH protein family. Mutants have abnormal, unfused carpels and reduced seed dormancy. |
| AT1G23820 | Spermidine synthase. |
| AT1G70310 | Spermidine synthase. |
| AT5G53120 | encodes a novel spermine synthase and is a paralog of previously characterized spermidine synthases, SPDS1 and SPDS2. SPDS3 forms heterodimers with SDPS2, which in turn forms heterodimers with SDPS1 in vivo. The gene does not complement speDelta3 deficiency of spermidine synthase in yeast but DOES complement speDelta4 deficiency. |
| AT1G14290 | Encodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth. |
| AT3G61580 | Fatty acid/sphingolipid desaturase;(source:Araport11) |
| AT2G46210 | Fatty acid/sphingolipid desaturase;(source:Araport11) |
| AT4G21540 | Encodes a sphingosine kinase, also has enzyme activity towards other plant long-chain sphingoid bases. Involved in guard cell ABA signalling and seed germination. |
| AT1G69230 | SPIRAL1-LIKE2 belongs to a six-member gene family in Arabidopsis; all members share a high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root and organ growth as a result of defective anisotropic cell expansion. |
| AT5G15600 | SPIRAL1-LIKE4 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
| AT1G17070 | Encodes a homologue of spliceosome disassembly factor NTR1. Required for correct expression and splicing of DOG1, a regulator of seed dormancy. The mRNA is cell-to-cell mobile. |
| AT5G20150 | Expression is upregulated in the shoot of cax1/cax3 mutant. Additionally, its expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. The mRNA is cell-to-cell mobile. |
| AT4G34640 | Encodes squalene synthase, which converts two molecules of farnesyl diphosphate (FPP) into squalene via an intermediate: presqualene diphosphate (PSPP). It is generally thought to be one of the key enzymes of sterol biosynthesis, since it catalyzes the first pathway-specific reaction of the sterol branch of the isoprenoid pathway. The mRNA is cell-to-cell mobile. |
| AT1G69170 | Encodes SPL6. Required for the resistance mediated by the TIR-NB-LRR RPS4 against Pseudomonas syringae carrying the avrRps4 effector. Transcriptome analysis indicates that SPL6 positively regulates a subset of defense genes. |
| AT1G27370 | In conjunction with SPL11 and SPL2, SPL10 redundantly controls proper development of lateral organs in association with shoot maturation in the reproductive phase. SPL2, SPL10, and SPL11, suppress root regeneration with age by inhibiting wound-induced auxin biosynthesis. SPL10 also controls lamina shape during vegetative development. |
| AT5G43270 | Member of the SPL (squamosa-promoter binding protein-like) gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. In conjunction with SPL10 and SPL11, SPL2 redundantly controls proper development of lateral organs in association with shoot maturation in the reproductive phase. SPL2, SPL10, and SPL11, suppress root regeneration with age by inhibiting wound-induced auxin biosynthesis. |
| AT5G18830 | Encodes a member of the Squamosa Binding Protein family of transcriptional regulators. SPL7 is expressed highly in roots and appears to play a role in copper homeostasis. Mutants are hypersensitive to copper deficient conditions and display a retarded growth phenotype. SPL7 binds to the promoter of the copper responsive miRNAs miR398b and miR389c. |
| AT1G02065 | Encodes an SBP-box gene, a member of the SPL gene family. Mutants are affected in micro- and megasporogenesis, trichome formation on sepals, and stamen filament elongation. |
| AT3G60030 | squamosa promoter-binding protein-like 12;(source:Araport11) |
| AT2G15790 | SQN encodes the Arabidopsis homolog of cyclophilin 40 (CyP40). It is specifically required for the vegetative but not the reproductive maturation of the shoot. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT4G03430 | Encodes a nuclear protein similar to the human U5 small ribonucleoprotein-associated 102-kD protein and to the yeast pre-mRNA splicing factors Prp1p and Prp6p. STA1 expression is upregulated by cold stress, and the sta1-1 mutant is defective in the splicing of the cold-induced COR15A gene. Luciferase imaging was used to isolate a recessive mutant, sta1-1, with enhanced stability of the normally unstable luciferase transcript. This mutation also causes the stabilization of some endogenous gene transcripts and has a range of developmental and stress response phenotypes. |
| AT4G01970 | Encodes a a raffinose and high affinity stachyose synthase as well as a stachyose and Gol specific galactosylhydrolase enzyme activity.AtRS4 is a sequential multifunctional RafS and StaS as well as a high affinity StaS, accepting only Raf and Gol for Sta product formation. AtRS4 possesses a Sta and Gol specific galactosylhydrolase enzyme activity. |
| AT2G36390 | Encodes a starch branching enzyme (EC.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout plant tissues. The mRNA is cell-to-cell mobile. |
| AT5G03650 | Encodes starch branching enzyme (E.C.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout the plant and highest in seedlings and cauline leaves. |
| AT5G24300 | SSI is a plastidial enzyme and crucial for the synthesis of normal amylopectin in the leaves of Arabidopsis. The absence of SSI results in a deficiency in the number of shorter glucans which in turn affect the formation and connection of the amylopectin clusters in starch. |
| AT5G19690 | encodes an oligosaccharyl transferase involved response to high salt. Mutants are hypersensitive to high salt conditions The mRNA is cell-to-cell mobile. |
| AT3G57420 | Regulates the assembly and trafficking of cellulose synthase complexes. |
| AT5G35770 | A recessive mutation in the Arabidopsis STERILE APETALA (SAP) causes severe aberrations in inflorescence and flower and ovule development. |
| AT5G56040 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT3G07020 | encodes a 3beta-hydroxy sterol UDP-glucosyltransferase. ugt80a2 mutant plants have reduced steryl glycoside and acyl steryl glycoside levels and reduced seed size. ugt80a2/b1 double mutants have normal levels of celluose and normal cold stress tolerance. |
| AT5G13710 | SMT1 controls the level of cholesterol in plants |
| AT1G20330 | Encodes a sterol-C24-methyltransferases involved in sterol biosynthesis. Mutants display altered sterol composition, serrated petals and sepals and altered cotyledon vascular patterning as well as ectopic endoreduplication. This suggests that suppression of endoreduplication is important for petal morphogenesis and that normal sterol composition is required for this suppression. |
| AT1G76090 | Encodes S-adenosyl-methionine-sterol-C-methyltransferase, an enzyme in the sterol biosynthetic pathway. |
| AT4G12110 | Encodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha-methyl oxidase. Works together with SMO1-2 to maintain correct sterol composition and balance auxin and cytokinin activities during embryogenesis. |
| AT4G12970 | Encodes a cysteine-rich peptide, a secretory factor that is produced in the mesophyll cells and acts on the epidermis to increase stomatal formation. Its mature form is a 45-aa peptide with three intramolecular disulfide bonds. It is proposed that STOMAGEN increases stomatal number by competing with two negative regulators of stomatal density, EPF1 and EPF2. STOMAGEN has been shown to compete with EPF2 for binding to the ER and TMM receptor kinases.Binding of STOMAGEN to ER prevents induction of the EPF2-ER MAPK cascade. It's transcript levels change after inducing MUTE expression in a mute background. |
| AT2G26770 | Encodes a plant-specific actin binding protein SCAB1 (STOMATAL CLOSURE-RELATED ACTIN BINDING PROTEIN1). SCAB1 stabilizes actin filaments and regulates stomatal movement. |
| AT3G56480 | myosin heavy chain-like protein;(source:Araport11) |
| AT1G49040 | Encodes soluble protein containing N-terminal DENN domain and eight C-terminal WD-40 repeats. Involved in cytokinesis of guard mother cells and leaf epidermal cells. The overall growth and development of mutant plants is severely affected, they are smaller than wt, with defects in seedling development, leaf expansion and flower morphology which renders the mutant conditionally sterile. |
| AT3G12630 | Encodes a protein with E3 ligase activity that acts as a positive regulator of stress responses in Arabidopsis. |
| AT4G22820 | A member of the A20/AN1 zinc finger protein family involved in stress response.Expression is increased in response to water, salt , pathogen and other stressors.SAP9 can pull down both K48-linked and K63- linked tetraubiquitin chains and functions as a E3 ubiquitin ligase suggesting a role in proteasome-dependent protein degradation. |
| AT4G25380 | stress-associated protein 10;(source:Araport11) |
| AT2G41290 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
| AT5G06820 | STRUBBELIG-receptor family 2;(source:Araport11) |
| AT4G03390 | STRUBBELIG-receptor family 3;(source:Araport11) |
| AT5G07660 | Encodes SMC6A (STRUCTURAL MAINTENANCE OF CHROMOSOMES 6A), a component of the SMC5/6 complex. SMC5/6 complex promotes sister chromatid alignment and homologous recombination after DNA damage. |
| AT5G04940 | Encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. SUVH1 has been shown to have a preference for binding methylated DNA. |
| AT5G13960 | Encodes a histone 3 lysine 9 specific methyltransferase involved in the maintenance of DNA methylation. SUVH4/KYP is a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. In kyp mutants, there is a loss of CpNpG methylation. The protein was shown to bind to methylated cytosines of CG, CNG and CNN motifs via its SRA domain but has a preference for the latter two. There is also evidence that KYP/SUVH4 might be involved in the telomerase-independent process known as Alternative Lengthening of Telomeres. |
| AT2G35160 | Encodes SU(var)3-9 homologue 5 (SUVH5). SUVH5 has histone methyltransferase (MTase) activity in vitro and contributes to the maintenance of H3 mK9 (methylation of histone H3 at Lys-9) and CMT3-mediated non-CG methylation in vivo. This is a member of a subfamily of SET proteins that shares a conserved SRA domain. |
| AT2G05920 | Subtilase family protein;(source:Araport11) |
| AT5G67090 | Encodes a subtilisin-like serine protease with in vitro protease activity. |
| AT4G34980 | Serine protease similar to subtilisin. |
| AT3G27380 | One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Expressed during germination and post-germinative growth. |
| AT5G40650 | One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Expressed during germination and post-germinative growth. |
| AT1G47420 | predicted to encode subunit 5 of mitochondrial complex II and to participate in the respiratory chain |
| AT5G67490 | SDHAF4 acts on FAD-SDH1 and promotes its assembly with SDH2, thereby stabilizing SDH2 and enabling its full assembly with SDH3/SDH4 to form the SDH complex. |
| AT2G46505 | Encodes succinate dehydrogenase ,a component of mitochondrial respiratory complex II. Nuclear encoded gene which is imported into the mitochondrion. |
| AT5G66880 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. The mRNA is cell-to-cell mobile. |
| AT5G20280 | Encodes a sucrose-phosphate synthase activity. This is the major leaf isoform. |
| AT5G11110 | Encodes a sucrose-phosphate synthase involved in pollen exine formation. This is the dominant SPS isoform in leaves with respect to protein levels. |
| AT1G09960 | low affinity (10mM) sucrose transporter in sieve elements (phloem) |
| AT3G52340 | sucrose-phosphatase (SPP2) |
| AT1G71880 | Sucrose transporter gene induced in response to nematodes; member of Sucrose-proton symporter family. The mRNA is cell-to-cell mobile. |
| AT1G11260 | Encodes a H+/hexose cotransporter. The mRNA is cell-to-cell mobile. |
| AT3G19930 | Encodes a sucrose hydrogen symporter that is induced by wounding. The mRNA is cell-to-cell mobile. |
| AT4G02050 | STP7 is a monosaccharide/H+ symporter that transports arabinose and xylose. |
| AT3G57140 | sugar-dependent 1-like protein;(source:Araport11) |
| AT5G04040 | Encodes a triacylglycerol lipase that is involved in storage lipid breakdown during seed germination. The mutant plant exhibits a much slower rate of postgerminative growth than the wild type. |
| AT3G51895 | Encodes a chloroplast-localized sulfate transporter. |
| AT3G12520 | Encodes a sulfate transporter that in induced under sulfate limitation. |
| AT1G31170 | encodes a cysteine-sulfinic acid reductase (sulfiredoxin - EC 1.8.98.2) capable of reducing overoxidized plastidic 2-Cys-Prx involved in peroxide detoxification and response to oxidative stress |
| AT5G04590 | A.thaliana gene encoding sulfite reductase. |
| AT5G01220 | Encodes a UDP-sulfoquinovose:DAG sulfoquinovosyltransferase that is involved in sulfolipid biosynthesis and whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. |
| AT5G07010 | Encodes a sulfotransferase that acts specifically on 11- and 12-hydroxyjasmonic acid. Transcript levels for this enzyme are increased by treatments with jasmonic acid (JA), 12-hydroxyJA, JA-isoleucine, and 12-oxyphytodienoic acid (a JA precursor). |
| AT5G07000 | Encodes a member of the sulfotransferase family of proteins. Although it has 85% amino acid identity with ST2A (At5g07010), this protein is not able to transfer a sulfate group to 11- or 12-hydroxyjasmonic acid in vitro. It may be able to act on structurally related jasmonates. |
| AT1G13420 | Encodes a sulfotransferase. Unlike the related ST4A protein (At2g14920), in vitro experiments show that this enzyme does not act brassinosteroids. ST4B is expressed in the roots and transcript levels rise in response to cytokinin treatment. |
| AT1G13430 | Encodes a sulfotransferase. Unlike the related ST4A protein (At2g14920), in vitro experiements show that this enzyme does not act brassinosteroids. ST4C is expressed in the roots and transcript levels rise in response to cytokinin treatment. |
| AT1G04770 | SDI2 is a member of a small family of TPR proteins in Arabidopsis. Like SDI1 it is induced by low sulfer and appears to play a role in negative regulation of glucosinolate biosynthesis. |
| AT5G66170 | Encodes a thiosulfate sulfurtransferase/rhodanese. |
| AT1G77990 | Encodes a low-affinity sulfate transporter. |
| AT3G55880 | A gain-of-function mutant of SUE4 exhibited improved low sulphur tolerance. |
| AT3G57870 | Encodes a SUMO ligase that directs the attachment of the small protein SUMO to target proteins via an isopeptide bond. This enzyme is localized to the nucleus and plants with reduced levels of this protein show higher sensitivity to ABA in root growth inhibition assays. It has high similarity to the yeast UBC9 SUMO ligase and is sometimes referred to by that name. |
| AT2G20610 | Confers auxin overproduction. Mutants have an over-proliferation of lateral roots. Encodes a C-S lyase involved in converting S-alkylthiohydroximate to thiohydroximate in glucosinolate biosynthesis. Induced in epidermal cells attacked by powdery mildew. The RTY enzyme is expected to function as a dimer (or a higher order multimeric complex), as all RTY-related enzymes with a defined crystal structure are known to form dimers or tetramers. |
| AT5G64340 | Encodes a bHLH(basic helix-loop-helix)-type transcription factor SAC51 [suppressor of acaulis 51]. Upregulation of SAC51 reverses the dwarf phenotype caused by a loss-of-function mutation in ACL5 (Arabidopsis thaliana ACAULIS 5) gene, suggesting that activation of SAC51 may lead to the expression of a subset of genes required for stem elongation. |
| AT3G09630 | Ribosomal protein L4/L1 family;(source:Araport11) |
| AT5G66020 | Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. non-consensus AT donor splice site at exon 7, TA donor splice site at exon 10, AT acceptor splice at exon 13. |
| AT1G17340 | Phosphoinositide phosphatase family protein;(source:Araport11) |
| AT3G59770 | Encodes a phosphoinositide phosphatase. The sac9 null mutant accumulates elevated levels of PtdIns(4,5)P2 and Ins(1,4,5)P3. The mutant plants have characteristics of constitutive stress responses. |
| AT2G31880 | Encodes a putative leucine rich repeat transmembrane protein that is expressed in response to Pseudomonas syringae. Expression of SRRLK may be required for silencing via lsiRNAs. Regulates cell death and innate immunity. |
| AT1G02100 | Leucine carboxyl methyltransferase;(source:Araport11) |
| AT1G25580 | Encodes suppressor of gamma response 1 (SOG1), a putative transcription factor governing multiple responses to DNA damage. |
| AT3G60400 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT1G71696 | Encodes a Putative Zn2+ carboxypeptidase, 4 splice variants have been identified but not characterized for different functions and/or expression patterns.SOL1 isolated as a suppressor of root- specific overexpression of CLE19, a clavata3 like gene. sol1 partially suppresses the short root phenotype caused by CLE19 overexpression. |
| AT5G57710 | SMAX1 (SUPPRESSOR OF MAX2 1) is a member of an eight-gene family in Arabidopsis that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. SMAX1 is an important component of KAR/SL signaling during seed germination and seedling growth, but is not necessary for all MAX2-dependent responses. The mRNA is cell-to-cell mobile. |
| AT3G06670 | SMEK1 forms a catalytically active complex with PP4 proteins. The complex has been shown to target and dephosphorylate HYL1 which in turn promotes miRNA biogenesis. Mutants have pleiotrophic phenotypes and decreased production of miRNA. SMEK1 accumulation is responsive to ABA. |
| AT4G37460 | Encodes a tetratricopeptide repeat domain containing protein that shows sequence similarity to those of transcriptional repressors in other organisms. Involved in mediating effector-triggered immunity. |
| AT5G11310 | The SOAR1 gene encodes a pentatricopeptide repeat (PPR) protein which localizes to both the cytosol and nucleus. Down-regulation of SOAR1 strongly enhances, but up-regulation of SOAR1 almost completely impairs, ABA responses, revealing that SOAR1 is a critical, negative, regulator of ABA signalling. Further genetic evidence supports that SOAR1 functions downstream of ABAR and probably upstream of an ABA-responsive transcription factor ABI5. Changes in the SOAR1 expression alter expression of a subset of ABA-responsive genes including ABI5. These findings provide important information to elucidate further the functional mechanism of PPR proteins and the complicated ABA signalling network. |
| AT1G21700 | a member of the Arabidopsis SWI3 gene family. Protein physically interacts with ATSWI3B and ATSWI3A, the other two members of the SWI3 family. Homologous to yeast SWI3 & RSC8, components of the SWI/SNF and RSC chromatin remodeling complexes. Referred to as CHB3 in Zhou et al (2003). |
| AT5G51330 | Encodes novel protein involved in sister chromatid cohesion and meiotic chromosome organization during both male and female meiosis. Gene has two alternate transcripts which produce two similar proteins, one 57 aa shorter than the other. |
| AT5G05490 | Encodes a RAD21-like gene essential for meiosis. Encodes a 627 a.a. protein that is slightly longer in the N-terminus than SYN1 BP5. |
| AT2G20990 | Encodes a protein specifically localized to the ER-PM boundary with similarity to synaptotagmins, a class of membrane trafficking proteins. SYT1 is expressed in all tissues. Loss of function mutations show hypersensitivity to NaCl and electrolyte leakage from the plasma membrane. SYT1 also affects calcium dependent freezing tolerance and mechanical stress response. Regulates endocytosis endosome recycling at the plasma membrane, but not membrane traffic along the secretory pathway. SYT1 may have a role in membrane repair such as membrane resealing after freezing induced damage. SYT1 binds to phosphatidylinositol phosphates in vitro. It is distributed to immobile tubules and likely plays an important role in the formation of the tubular ER network as well as in cellular ER-PM tethering. |
| AT4G17730 | member of SYP2 Gene Family. Together with SYP23 interacts with Tobacco mosaic virus 126 kDa protein; required for normal local virus accumulation and spread. |
| AT2G18260 | member of SYP11 Gene Family |
| AT4G03330 | member of SYP12 Gene Family |
| AT1G11250 | member of SYP12 Gene Family |
| AT5G08080 | member of SYP13 Gene Family |
| AT4G02195 | Encodes a member of SYP4 Gene Family that is a plant ortholog of the Tlg2/syntaxin16 Qa-SNARE. Together with SYP43, it regulates the secretory and vacuolar transport pathways in the post-Golgi network and maintains the morphology of the Golgi apparatus and TGN and is required for extracellular resistance responses to a fungal pathogen. |
| AT3G05710 | Encodes a member of SYP4 Gene Family that is a plant ortholog of the Tlg2/syntaxin16 Qa-SNARE. Together with SYP42, it regulates the secretory and vacuolar transport pathways in the post-Golgi network and maintains the morphology of the Golgi apparatus and TGN and is required for extracellular resistance responses to a fungal pathogen. |
| AT3G45280 | syntaxin of plants 72 (SYP72) |
| AT5G44260 | Encodes a Tandem CCCH Zinc Finger protein. Interacts and co-localizes with MARD1 and RD21A in processing bodies (PBs) and stress granules (SGs). |
| AT5G58620 | Involved in control of defence gene expression post-transcriptionally through release from translation arrest within TZF9-PAB2-containing RNA granules. TZF9 shows phospho-mobility shift after flg22 treatment, inferred to be caused by phosphorylation through MPK3 and/or MPK6. The major MPK3/6-targeted phospho-sites are S181, S323, S343, S352, S356, S362 and S377. |
| AT4G24972 | Encodes a novel small protein which is similar to proteins of unknown function from other plant species. TPD1 is involved in cell specification during anther and pollen development. Identified in a screen for male steriles. Mutants lack tapetal cells and have an increased number of microsporocytes. Expressed in flower buds, leaves and young seedlings. In anthers, TPD1 is expressed throughout pollen development in parietal cells and sporocytes. Physically interacts with the LRR kinase EMS1 and that interaction results in phosphorylation of TPD1. |
| AT5G60200 | Encodes a Dof-type transcription factor. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT5G14720 | Membrane-localized protein kinase which regulates thermomorphogenesis. |
| AT2G20562 | Encodes a putative signalling peptide with similarity to TAX1. No known function has been demonstrated yet. |
| AT2G18000 | TBP-associated factor 14;(source:Araport11) |
| AT5G51910 | TCP family transcription factor;(source:Araport11) |
| AT5G08330 | Circadian oscillator protein which interacts with bZIP63 and regulates a response of the circadian oscillator to sugar. Is not required for the sugar-induced circadian phase advance in the morning; regulates a response of CCA1 to sugars. |
| AT1G35560 | Encodes a member of the TCP-P subfamily that is involved in flowering time control and plant development. Mutants present an early flowering phenotype. |
| AT5G23280 | Transcription factor which plays an important role during leaf and hypocotyl development, redundantly, with at least six class I TCPs, and regulates the expression of CYCD1;1 to affect endoreplication. |
| AT2G45680 | TCP family transcription factor;(source:Araport11) |
| AT4G28840 | Encodes TCP INTERACTOR-CONTAINING EAR MOTIF PROTEIN 1 (TIE1), an important repressor of CINCINNATA (CIN)-like TEOSINTE BRANCHED1/CYCLOIDEA/PCF (TCP) transcription factors, which are key for leaf development. |
| AT2G20080 | hypothetical protein;(source:Araport11) |
| AT5G24590 | Member of NAc protein family. Interacts with turnip crinkle virus (TCV) capsid protein. Transcription factor involved in regulating the defense response of Arabidopsis to TCV. |
| AT1G49950 | Encodes a telomeric DNA binding protein and Single Myb Histone (SMH) gene family member. In vitro, an N-terminal Myb domain enables it to interact with double-stranded telomeric repeats.Mutations in TRB1 and TRB3 enhance the lhp1 mutant phenotype. Triple mutants are more strongly affected than the respective double mutants with lhp1. TRB1 binds non-H3K27me3 target genes predominantly at the transcription start sites and its presence increases the expression of several of these targets, enriched for functions of primary metabolism. At H3K27me3 target genes, TRB1 binding is more distributed across gene bodies and at extended promoter regions, corresponding to an enrichment of putative binding sites "RMCCTAR". At these genes, TRB1 particiaptes in the repression because several direct targets are further upregulated in trb1 lhp1 double mutants as compared to lhp1 mutants. |
| AT5G13820 | Encodes a protein that specifically binds plant telomeric DNA repeats. It has a single Myb telomeric DNA-binding (SANT) domain in C-terminus that prefers the sequence TTTAGGG. Single Myb Histone (SMH) gene family member. |
| AT5G59430 | Encodes a telomeric repeat binding protein with a DNA binding domain at its C terminus. The DNA binding domain has a preference for GGTTTAG sequences and at least five of these repeats are required for recognition by a nearly full-length TRP1 protein. |
| AT5G58070 | Encodes a temperature-induced lipocalin TIL1. Involved in thermotolerance. Peripherally associated with plasma membrane. |
| AT1G30210 | TCP family protein involved in heterochronic regulation of leaf differentiation. |
| AT3G47620 | Encodes a transcription factor AtTCP14 that regulates seed germination. AtTCP14 shows elevated expression level just prior to germination. AtTCP14 is predominantly expressed in the vascular tissue of the embryo, and affects gene expression in radicles in a non-cell-autonomous manner. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
| AT1G69690 | AtTCP15 is involved in the regulation of endoreduplication. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
| AT5G48110 | The Col variant has no enzyme activity due to various substitution and deletion mutations. |
| AT2G01960 | Member of TETRASPANIN family |
| AT2G19580 | Member of TETRASPANIN family |
| AT3G45600 | Member of TETRASPANIN family |
| AT5G60220 | Member of TETRASPANIN family |
| AT4G28050 | Member of TETRASPANIN family |
| AT1G78120 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT1G04130 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808). Interacts with Hsp90/Hsp70 as co-chaperone. |
| AT1G04530 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT1G58450 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT1G53300 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. The mRNA is cell-to-cell mobile. |
| AT5G06839 | bZIP transcription factor family protein;(source:Araport11) |
| AT1G08320 | bZIP transcription factor family protein;(source:Araport11) |
| AT5G10030 | Encodes a member of basic leucine zipper transcription gene family. Nomenclature according to Xiang, et al. (1997). |
| AT3G12250 | basic leucine zipper transcription factor involved in the activation of SA-responsive genes. |
| AT5G65210 | Encodes TGA1, a redox-controlled regulator of systemic acquired resistance. TGA1 targets the activation sequence-1 (as-1) element of the promoter region of defense proteins. TGA1 are S-nitrosylated. |
| AT5G54380 | Encodes THESEUS1 (THE1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
| AT1G02880 | Encodes a thiamine pyrophosphokinase capable of producing thiamine pyrophosphate from free thiamine. |
| AT2G29630 | Encodes a protein involved in thiamin biosynthesis. The protein is an iron-sulfur cluster protein predicted to catalyze the conversion of 5-aminoimidazole ribonucleotide (AIR) to hydroxymethylpyrimidine (HMP) or hydroxymethylpyrimidine phosphate (HMP-P). A severe reduction of THIC levels in plants decreases vitamin B1 (thiamin diphosphate (TPP)) levels and also leads to changes in the levels of numerous other metabolites since so many primary metabolic enzymes require a TPP co-factor. thiC mutants are chlorotic and arrest in their development at the cotyledon stage. A N-terminal targeting sequence directs the THIC protein to the chloroplast stroma. A conserved TPP-binding site is located in the 3' UTR of the At2g29630.2 gene model, and is predicted to function as a riboswitch. The riboswitch controls the formation of transcripts with alternative 3' UTR lengths, which affect mRNA accumulation and protein production. THIC transcripts are observed in seedlings 5 or more days after germination, and light promotes the expression of this gene. Recessive mutant isolated by Redei. Leaves but not cotyledons white, lethal; restored to normal by thiamine or 2,5-dimethyl-4-aminopyrimidine. |
| AT5G10540 | Zincin-like metalloproteases family protein;(source:Araport11) |
| AT3G02730 | Encodes a type-f thioredoxin. Has a role in the short-term activation of carbon metabolism. Loss affects growth under short-day conditions. |
| AT3G15360 | encodes a prokaryotic thioredoxin The mRNA is cell-to-cell mobile. |
| AT2G35010 | Localized in mitochondria; associated with redox-active functions and effects on plant growth in constant light; joint role with Trx h2 in regulating NADPH redox balance and photosynthetic performance in fluctuating light. |
| AT1G76760 | Encodes a y-type thioredoxin (Trx-y1) localized in chloroplast stroma. |
| AT1G08630 | Encodes a threonine aldolase, involved in threonine degradation to glycine. Primarily expressed in seeds and seedlings. |
| AT4G27800 | Choroplast protein phosphatase TAP38/PPH1 is required for efficient dephosphorylation of the LHCII anthena and state transition from state 2 to state 1. |
| AT1G77490 | Encodes a chloroplastic thylakoid ascorbate peroxidase tAPX. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
| AT3G63180 | TIC-like protein;(source:Araport11) |
| AT1G08260 | Similar to POL2A, DNA polymerase epsilon catalytic subunit. Essential for Arabidopsis growth. Null homozygotes are embryo lethal, partial loss of function alleles show embryo patterning defects such as root pole displacement. Delayed progression through cell cycle results in embryos with smaller numbers of larger cells. |
| AT3G22380 | Encodes a nucleus-acting plant-specific clock regulator working close to the central oscillator and affecting the circadian gating of light responses. Circadian gating is the alteration of circadian phase according to the photoperiod of the entraining day/light cycle and the rhythmic antagonism of light responses in the early subjective night. TIC differentially regulates CCA1 and PRR9 from LHY, with LHY expression as a dominant genetic target of TIC action. Also shown to be invoved in the maintenance of Arabidopsis thaliana metabolic homeostasis. |
| AT5G61380 | Pseudo response regulator involved in the generation of circadian rhythms. TOC1 appears to shorten the period of circumnutation speed. TOC1 contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. PRR3 may increase the stability of TOC1 by preventing interactions between TOC1 and the F-box protein ZTL. Expression of TOC1 is correlated with rhythmic changes in chromatin organization. The mRNA is cell-to-cell mobile. |
| AT5G25810 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family (TINY). The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Ectopic or overexpression of this gene in a Ds tagged line has reduced cell expansion. The expression of this gene is induced by ethylene and light and appears to stimulate cytokinin biosynthesis. |
| AT1G72940 | Nucleotide-binding, leucine-rich repeat (NLR) gene regulated by nonsense-mediated mRNA decay (NMD) genes UPF1 and UPF3. |
| AT1G72950 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
| AT5G56220 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G72910 | Nucleotide-binding, leucine-rich repeat (NLR) gene regulated by nonsense-mediated mRNA decay (NMD) genes UPF1 and UPF3. |
| AT1G72920 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT2G18390 | Encodes a member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. Mutant has abnormal mitosis and cell cycle control during seed development. |
| AT4G24900 | Encodes a nuclear C2H2 domain-containing protein involved in embryo and endosperm development. Involved in brassinosteroid (BR)-mediated plant growth and catalyses the synthesis of S-allantoin, together with B1L participates in modulating plant growth and cold tolerance. |
| AT3G54670 | Encodes a member of the Arabidopsis cohesin complex that is essential for viability and sister chromatid alignment. |
| AT1G14740 | Encodes a PHD-finger protein that, with TTA1, is redundantly required for MP-dependent embryonic root meristem initiation. |
| AT3G63500 | Encodes a PHD-finger protein that, with TTA2, is redundantly required for MP-dependent embryonic root meristem initiation. |
| AT2G02180 | Necessary for the efficient multiplication of tobamoviruses. The mRNA is cell-to-cell mobile. |
| AT1G14530 | tobamovirus multiplication-like protein (DUF1084);(source:Araport11) |
| AT1G21380 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT5G63640 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT5G01760 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT4G32760 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT4G11780 | GAR2-like protein;(source:Araport11) |
| AT3G61380 | Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11) |
| AT4G00440 | GPI-anchored adhesin-like protein, putative (DUF3741);(source:Araport11) |
| AT2G20240 | GPI-anchored adhesin-like protein, putative (DUF3741);(source:Araport11) |
| AT2G39435 | Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11) |
| AT5G62170 | LOW protein: M-phase inducer phosphatase-like protein;(source:Araport11) |
| AT2G17550 | RB1-inducible coiled-coil protein;(source:Araport11) |
| AT2G36420 | nucleolin-like protein;(source:Araport11) |
| AT5G03670 | histone-lysine N-methyltransferase SETD1B-like protein;(source:Araport11) |
| AT1G18620 | Member of a small gene family in Arabidopsis. Quadruple mutants in this family display defects in cell elongation. |
| AT3G24630 | hypothetical protein;(source:Araport11) |
| AT1G74160 | Member of a small gene family in Arabidopsis. Quadruple mutants in this family display defects in cell elongation. |
| AT3G63430 | zinc finger CCCH domain protein;(source:Araport11) |
| AT4G00770 | DUF4378 domain protein;(source:Araport11) |
| AT5G47560 | Encodes a tonoplast malate/fumarate transporter. |
| AT3G26520 | gamma tonoplast intrinsic protein 2 (TIP2). expressed throughout the plant and transcript level is increased upon NaCl or ABA treatments. NaCl stress-sensitive yeast mutant strains exhibit more resistance to salt when expressing this protein. |
| AT4G17340 | tonoplast intrinsic protein 2;(source:Araport11) |
| AT5G47450 | Tonoplast intrinsic protein, transports ammonium (NH3) and methylammonium across the tonoplast membrane, gene expression shows diurnal regulation and is upregulated by ammonium (NH3). |
| AT1G20840 | The protein encoded by this gene is found in the tonoplast (vacuole membrane) of Arabidopsis cells. The gene is expressed at highest levels in juvenile (sink) and adult (source) leaves, followed by flower tissues. |
| AT1G80080 | Encodes a transmembrane leucine-repeat containing receptor-like protein that is expressed in proliferative postprotodermal cells. Recessive mutation leads to disruption of asymmetric cell division during stomata development. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT1G15750 | Encodes a protein with several WD40 repeats at the C-terminus and predicted protein-protein interaction domains at the N-terminus. Together with the TOPLESS-RELATED PROTEINS (TPRs), it is thought to be involved in transcriptional repression of root-promoting genes in the top half of the embryo during the transition stage of embryogenesis. It can also interact with IAA12 through the EAR domain of IAA12 and the CTLH domain of TPL. The ability of IAA12 to repress transcription is diminished in a tpl-1 mutant background. |
| AT1G80490 | Encodes a protein with a Lissen-cephaly type-1-like homology (LisH) domain at the N terminus,a C-terminal to LisH (CTLH) domain, and 12 WD (tryptophan-aspartic acid)-40 repeats at the C terminus. It is closely related to Topless (TPL), which mediates auxin-dependent transcriptional repression during embryogenesis. |
| AT3G16830 | TOPLESS family member which directly binds the N-terminal domain of SNC1 and interacts with TPR1. |
| AT5G27030 | TOPLESS family member involved in the negative regulation of SNC1-dependent phenotypes. |
| AT5G55540 | Encodes a large plant-specific protein of unknown function, with conserved domains also found in a variety of signaling proteins, In trn mutants, the leaf venation network had a severely reduced complexity: incomplete loops, no tertiary or quaternary veins, and vascular islands. The leaf laminas were asymmetric and narrow because of a severely reduced cell number. TRN1 is required for the maintenance of both the radial pattern of tissue differentiation in the root and for the subsequent circumferential pattern within the epidermis. Double mutant analysis showed that TRN1 and TRN2 act in the same pathway. |
| AT5G37770 | Encodes a protein with 40% similarity to calmodulin. Binds Ca(2+) and, as a consequence, undergoes conformational changes. CML24 expression occurs in all major organs, and transcript levels are increased from 2- to 15-fold in plants subjected to touch, darkness, heat, cold, hydrogen peroxide, abscisic acid (ABA), and indole-3-acetic acid. However, CML24 protein accumulation changes were not detectable. The putative CML24 regulatory region confers reporter expression at sites of predicted mechanical stress; in regions undergoing growth; in vascular tissues and various floral organs; and in stomata, trichomes, and hydathodes. CML24-underexpressing transgenics are resistant to ABA inhibition of germination and seedling growth, are defective in long-day induction of flowering, and have enhanced tolerance to CoCl(2), molybdic acid, ZnSO(4), and MgCl(2). Also regulates nitric oxide levels. |
| AT2G41100 | encodes a calmodulin-like protein, with six potential calcium binding domains. Calcium binding shown by Ca(2+)-specific shift in electrophoretic mobility. Expression induced by touch and darkness. Expression may also be developmentally controlled. Expression in growing regions of roots, vascular tissue, root/shoot junctions, trichomes, branch points of the shoot, and regions of siliques and flowers. The mRNA is cell-to-cell mobile. |
| AT5G57560 | Encodes a cell wall-modifying enzyme, rapidly upregulated in response to environmental stimuli. |
| AT5G55860 | WEB1/PMI2 related protein involved in mecahnotransduction.TREPH1 is phosphorylated at position S625 in response to touch, and this is required for mechanosensitive growth response. |
| AT5G20930 | Nuclear serine/threonine protein kinase that requires a coiled-coil region for oligomerization and catalytic activity. Required for leaf and flower development and is involved in the regulation of RNA interference. Expression localized to the developing style by stage 13. |
| AT3G60220 | Encodes a putative RING-H2 zinc finger protein ATL4 (ATL4). |
| AT5G58580 | Encodes a functional E3 ligase that is involved in membrane trafficking and regulation of salt stress responses. It is localized to membranes including the plasma membrane, pre-vacuolar compartments and Golgi. |
| AT4G11990 | TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of aurora kinase activity. |
| AT5G48920 | tracheary element differentiation-related 7;(source:Araport11) |
| AT3G17185 | Encodes a trans-acting siRNA (tasi-RNA) that regulates the expression of auxin response factor genes (ARF2, ARF4, ETT). One of 3 genomic loci that encode the TAS3 siRNA. Has been identified as a translated small open reading frame by ribosome profiling. |
| AT2G38560 | Encodes RNA polymerase II transcript elongation factor TFIIS. Complements yeast TFIIS mutation. Mutant plants display essentially normal development, but they flower slightly earlier than the wild type and show clearly reduced seed dormancy. |
| AT2G41630 | Encodes a transcription factor, TFIIB1, that plays important roles in pollen tube growth, guidance, and reception as well as endosperm development and is partially functionally different from AtTFIIB2 and AtTFIIB3/AtpBRP2. |
| AT3G10330 | Cyclin-like family protein;(source:Araport11) |
| AT4G35610 | Interacts with EIN3 to regulate transcriptional repression that leads to an inhibition of shoot growth in response to ethylene. |
| AT3G60750 | Transketolase;(source:Araport11) |
| AT3G46560 | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. Together with AtTIM10, AtTIM9 is non-redundantly essential for maintaining mitochondrial function of early embryo proper cells and endosperm free-nuclei. |
| AT1G06950 | Encodes a protein thought to be a part of the translocon at the chloroplast inner envelope. Involved in protein import into the chloroplast and chloroplast biogenesis. C-terminal half of Tic110 functions as scaffolds for protein-protein interactions. |
| AT2G47840 | Encodes a component of the TIC (translocon at the inner envelope membrane of chloroplasts) protein translocation machinery mediating the protein translocation across the inner envelope of plastids. The Arabidopsis genome encodes four Tic20 homologous proteins, AT1G04940(Tic20-I), AT2G47840(Tic20-II), AT4G03320(Tic20-IV) and AT5G55710(Tic20-V). |
| AT4G03320 | Encodes a component of the TIC (translocon at the inner envelope membrane of chloroplasts) protein translocation machinery mediating the protein translocation across the inner envelope of plastids. The Arabidopsis genome encodes four Tic20 homologous proteins, AT1G04940(Tic20-I), AT2G47840(Tic20-II), AT4G03320(Tic20-IV) and AT5G55710(Tic20-V). |
| AT4G02510 | An integral membrane GTPase that functions as a transit-sequence receptor required for the import of proteins necessary for chloroplast biogenesis. Located in the outer chloroplast membrane. Phosphorylation of the G-domains regulate translocon assembly. The mRNA is cell-to-cell mobile. |
| AT5G20300 | Encodes Toc90, part of the TOC (translocon at the outer chloroplast membrane) machinery involved in the import of nucleus-encoded proteins into the chloroplast. |
| AT5G09420 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT3G16620 | component of TOC complex, plastid protein import machinery. |
| AT1G66150 | Receptor-like transmembrane kinase I (TMK1); key regulator in auxin signaling. High auxin and TMK1 play essential and positive roles in ABA signaling through regulating ABA INSENSITIVE 1 and 2 (ABI1/2). Inhibits the phosphatase activity of ABI2 by direct phosphorylation of threonine 321 (T321), a conserved phosphorylation site in ABI2 proteins, whose phosphorylation status is important for both auxin and ABA responses. |
| AT3G59030 | Encodes a proton antiporter. Involved in the transportation of proanthocyanidin precursors into the vacuole. In vitro transport experiments showed that cyanidin-3-O-glucoside (anthocyanin) was an effective substrate, whereas the proanthocyanidin precursor epicatechin was not transported. However catechin-3-O-glucoside inhibited anthocyanin transport in a dose-dependent manner suggesting that glycosylated epicatechin is the in vivo substrate. Recessive mutation has strong reduction of proanthocyanidin deposition in vacuoles and has reduced dormancy. Expressed in the endothelium of ovules and developing seeds. |
| AT5G07990 | Required for flavonoid 3' hydroxylase activity. Enzyme abundance relative to CHS determines Quercetin/Kaempferol metabolite ratio. The mRNA is cell-to-cell mobile. |
| AT2G37260 | Encodes a protein similar to WRKY transcription factors that is expressed in the seed integument and endosperm. Mutants are defective in proanthocyanidin synthesis and seed mucilate deposition. Seeds are yellow colored. Seed size is also affected; seeds are reduced in size but only when the mutant allele is transmitted through the female parent.Loss of function alleles are associated with a reduction in interploidy lethality. |
| AT3G62980 | Encodes an auxin receptor that mediates auxin-regulated transcription. It contains leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation. Mutations in TIR1 block auxin stimulation of flavonoid synthesis. |
| AT4G24040 | Encodes a trehalase, member of Glycoside Hydrolase Family 37. |
| AT1G70290 | Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants. |
| AT4G12430 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G22590 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G39770 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G65140 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G06410 | Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants. |
| AT1G23870 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. The mRNA is cell-to-cell mobile. |
| AT3G46590 | Encodes a protein that specifically binds plant telomeric DNA (TTTAGGG)n repeats. Involved in bending DNA. Expressed throughout the plant with highest levels in flowers. |
| AT3G53790 | Arabidopsis thaliana telomere-binding protein, putative (At3g53790) |
| AT3G12560 | Encodes a telomeric DNA-binding protein. |
| AT2G19450 | Encodes Acyl-CoA:diacylglycerol acyltransferase (DGAT) catalyzes the final step of the triacylglycerol synthesis pathway. An insertion mutation in the TAG1 gene results in altered lipid phenotype. Role in senescence and seed development. Its preferred substrate is linolenoyl-CoA (C18:3-CoA). |
| AT5G06700 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). A tbr mutant is impaired in its ability to deposit secondary wall cellulose in specific cell types, most notably in trichomes. |
| AT2G40160 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT2G37720 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT4G25360 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G60790 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G01430 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers.Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G70230 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. A putative xyloglucan O-acetyltransferase. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT2G34070 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TBL37 expression is regulated by MYC2 and activated in response to JA. |
| AT1G29050 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G14850 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G78710 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT2G30010 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G62390 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G48880 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G73980 | TTM1 is a triphosphate tunnel metalloenzyme that displays pyrophosphatase activity. It contains both a uridine kinase (UK) domain,CYTH domain, a coiled-coil domain and a transmembrane domain at the C-terminal Mutants show a delay in leaf senescence. Can functionally complement TTM1 and vise versa. (PMID:28733390) |
| AT4G01880 | methyltransferase;(source:Araport11) |
| AT2G28450 | zinc finger (CCCH-type) family protein;(source:Araport11) |
| AT2G45730 | eukaryotic initiation factor 3 gamma subunit family protein;(source:Araport11) |
| AT2G43510 | Member of the defensin-like (DEFL) family. Encodes putative trypsin inhibitor protein which may function in defense against herbivory. |
| AT1G70560 | TAA1 is involved in the shade-induced production of indole-3-pyruvate (IPA), a precursor to IAA, a biologically active auxin. It is also involved in regulating many aspects of plant growth and development from embryogenesis to flower formation and plays a role in ethylene-mediated signaling. This enzyme can catalyze the formation of IPA from L-tryptophan. Though L-Trp is expected to be the preferred substrate in vivo, TAA1 also acts as an aminotransferase using L-Phe, L-Tyr, L-Leu, L-Ala, L-Met, and L-Gln. Lines carrying mutations in this gene are unaffected by auxin transporter inhibitor NPA. Double mutant analysis and exogenous auxin treatment suggest that this gene is required for auxin signaling during lateral root and root meristem development. The activity of TAA1 can be controlled by phosphorylation of residue T101, which, when phosphorylated results in loss of activity. TAA1 is a target of TMK4. |
| AT4G24670 | Encodes a protein with similarity to the TAA1 trytophan aminotransferase involved in IAA biosynthesis. Double mutant analyses suggest that this protein is involved in regulating many aspects of plant growth and development from embryogenesis to flower formation and plays a role in ethylene-mediated signaling.TAR2 is required for reprogramming root architecture in response to low nitrogen conditions. |
| AT1G34040 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT5G19200 | Encodes one of the Arabidopsis proteins (At3g06060/TSC10A and At5g19200/TSC10B) with significant similarity to the yeast 3-ketodihydrosphinganine (3-KDS) reductase, Tsc10p. Both TSC10A and TSC10B are bona fide 3-KDS reductase as shown by complementation experiment in yeast. |
| AT2G36960 | Arabidopsis thaliana myb/SANT domain protein |
| AT3G27060 | Encodes one of the 3 ribonucleotide reductase (RNR) small subunit genes. TSO2 transcription occurs predominantly at the S-phase of the cell cycle and its expression pattern is consistent with its role in dNDP biosynthesis during DNA replication in actively dividing cells. Critical for cell cycle progression, DNA damage repair and plant development. |
| AT1G50010 | Encodes alpha-2,4 tubulin. TUA2 and TUA4 encode identical proteins. The mRNA is cell-to-cell mobile. |
| AT5G19770 | tubulin 3 |
| AT1G04820 | Encodes an alpha tubulin isoform that is expressed in roots, leaves and flowers. |
| AT5G19780 | Encodes an isoform of alpha tubulin. Closely related to adjacent gene TUA3 suggesting recent duplication. The mRNA is cell-to-cell mobile. |
| AT4G14960 | Encodes an alpha-tubulin isoform required for right handed helical growth. |
| AT5G23860 | beta-tubulin, preferentially expressed in endodermal and phloem cells of primary roots and in the vascular tissues of leaves, stems, and flowers. The mRNA is cell-to-cell mobile. |
| AT5G62690 | encodes tubulin beta-2/beta-3 chain The mRNA is cell-to-cell mobile. |
| AT5G62700 | encodes tubulin beta-2/beta-3 chain The mRNA is cell-to-cell mobile. |
| AT5G44340 | beta tubulin gene |
| AT1G20010 | beta tubulin |
| AT2G29550 | Encodes a beta-tubulin that is expressed in leaves, roots and flowers. |
| AT3G02140 | Encodes a protein that acts in the nucleus and is an important negative regulator of ABA and salt stress responses, and could play a critical role in controlling root elongation, floral initiation and starch degradation. |
| AT4G03560 | Encodes a depolarization-activated Ca(2+) channel. Anti-sense experiments with this gene as well as Sucrose-H(+) symporters and complementation of yeast sucrose uptake mutant cch1 suggest that this protein mediates a voltage-activated Ca(2+ )influx. Mutants lack detectable SV channel activity suggesting TPC1 is essential component of the SV channel. Patch clamp analysis of loss of function mutation indicates TPC1 does not affect Ca2+ signaling in response to abiotic and biotic stress. |
| AT3G62260 | Type 2C protein phosphatase (PP2C) which negatively regulates AtHKT1;1 activity and thus determines systemic Na+ allocation during salt stress. |
| AT5G59160 | Encodes the catalytic subunit of a Type 1 phosphoprotein Ser/Thr phosphatase, expressed in roots, shoots and flowers. |
| AT5G36160 | Encodes a cytosolic L-tyrosine aminotransferase. AtTAT2 exhibits much broader amino donor specificity than AtTAT1 and can use not only Tyr but also Phe, Trp, His, Met, Leu, Ala, Ser, Cys, Asp, Asn, Gln, and Arg as amino donors. |
| AT5G53970 | Encodes a cytosolic tyrosine aminotransferase which is strongly induced upon aging and coronatine treatment. AtTAT1 prefers Tyr as an amino donor but can also use Phe, Trp, His, Met, and Leu. The mRNA is cell-to-cell mobile. |
| AT5G15170 | Tyrosyl-DNA phosphodiesterase 1 involved in DNA repair. TDP1 is involved the repair of Topoisomerase 1 cleavage complexes (tdp1 mutants are camptotecin hypersensitive). tdp1/wss1A double mutants show a synergistic sensitivity after camptothecin treatment. tdp1/mus81 double mutants show an elevated number of dead cells in root meristems after camptothecin treatment (compared to the single mutants). |
| AT1G08030 | Encodes a tyrosylprotein sulfotransferase (TPST). This protein is a 500-aa type I transmembrane protein that shows no sequence similarity to animal TPSTs. Activity confirmed by protein expression in yeast. TPST is expressed throughout the plant body, and the highest levels of expression are in the root apical meristem. TPST acts in the auxin pathway to maintain postembryonic root stem cell niche by defining the expression of the PLETHORA stem cell transcription factor genes. A loss-of-function mutant TPST displayed a marked dwarf phenotype accompanied by stunted roots, pale green leaves, reduction in higher order veins, early senescence, and a reduced number of flowers and siliques. TPST suppresses ethylene production through the action of PSK (phytosulfokine). |
| AT2G30260 | encodes U2B", which is a component of the U2 snRNP complex. Its precise role in pre-mRNA splicing is still unknown. It has been suggested that U2B0 may not be required for the splicing reaction itself but may have a role in U2 snRNP biogenesis. Deletion analysis of the U2B0 gene fusion has identified the N-terminal RNP-80 motif as sufficient for localization to the coiled body and the nucleus. |
| AT5G09585 | U2;(source:Araport11) |
| AT3G06900 | U4;(source:Araport11) |
| AT3G09790 | encodes a ubiquitin-like protein that contains tandem repeats of the ubiquitin coding region, but at least one repeat per gene encodes a protein with amino acid substitutions. |
| AT5G59300 | ubiquitin conjugating enzyme E2; may function together with UBC13 and UBC14 in the plant READ pathway, required in plant responses to multiple stress conditions. |
| AT1G77700 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT5G66240 | Encodes a WD40-repeat protein that interacts with the E3 Cullin Ring Ligase subunit DDB1a and is involved in secondary wall modification and thickening by regulating the degradation of specific proteins. RNAi-mediated silencing results in anther indehiscence and infertility. |
| AT3G46460 | May function together with UBC7 and UBC14 in the plant READ pathway, required in plant responses to multiple stress conditions. |
| AT3G55380 | May function together with UBC7 and UBC13 in the plant READ pathway, required in plant responses to multiple stress conditions. |
| AT1G75440 | ubiquitin-conjugating enzyme 16;(source:Araport11) |
| AT5G05080 | ubiquitin-conjugating enzyme 22;(source:Araport11) |
| AT5G62540 | Encodes a protein predicted to be an E2 ubiquitin conjugating enzyme. It appears homologous to the RAD6 protein in yeast implicated in histone ubiquitination, but, UBC3 has not been experimentally associated with this process. |
| AT1G16890 | UBC36/UBC13B encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair. It can bind to the MMZ/UEV1 proteins in vitro. |
| AT1G55860 | encodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis. |
| AT5G02880 | encodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT3G20630 | Encodes a ubiquitin-specific protease. Identical to TTN6. Loss of function mutations are embryo lethals, having development arrested at the preglobular/globular stage. Also involved in root responses to phosphate deficiency. |
| AT1G17110 | Encodes a ubiquitin-specific protease, and its activity has been confirmed in an in vitro assay. ubp15 mutants have defects in cell proliferation, and the associated processes of leaf, root, stem, flower, and silique development. UBP15 can be found in the nucleus and cytoplasm in transient assays. Though UBP15 is expressed in many tissues, UBP15 transcript levels are higher in rosette leaves and inflorescences than in other parts of the plant. Together with CUC2/CUC3-DA1 part of a regulatory module controls the initiation of axillary meristems, thereby determining plant architecture. As a direct substrate of DA1 peptidase, it represses the initiation of axillary meristems. |
| AT2G24640 | ubiquitin-specific protease 19;(source:Araport11) |
| AT4G17895 | Encodes a ubiquitin-specific protease. |
| AT4G30890 | Encodes a ubiquitin-specific protease. |
| AT1G51710 | Ubiquitin-specific protease 6 (UBP6). Deubiquinating enzyme. Interacts with calmodulin. |
| AT2G02760 | ubiquitin conjugating enzyme UBC2. Homolog of the yeast RAD6 gene. |
| AT5G03490 | Encodes a dihydroxybenzoic acid (DHBA) glycosyltransferase. The Col-0 enzyme is responsible for biosynthesis of 2,3-DHBA xyloside and 2,5-DHBA xyloside. The Col-0 enzyme is specific for UDP-xylose and the C24 enzyme uses both UDP-glucose and UDP-xylose. This difference in sugar donor specificity was shown to be largely due to a single amino acid change between the two isoforms. |
| AT2G27860 | Encodes UDP-d-apiose/UDP-d-xylose synthase that requires NAD+ for enzymatic activity and is strongly inhibited by UDP-d-galacturonate. |
| AT1G12780 | Encodes a UDP-glucose epimerase that catalyzes the interconversion of the sugar nucleotides UDP-glucose UDP-galactose via a UDP-4-keto-hexose intermediate. Responsive to stress. |
| AT1G63180 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in pollen development. |
| AT4G30440 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. |
| AT2G45310 | UDP-D-glucuronate 4-epimerase |
| AT3G11340 | Encodes a uridine diphosphate-dependent glucosyltransferase that conjugates isoleucic acid and modulates plant defense via glucosylation of N-hydroxypipecolic acid. |
| AT4G32272 | Golgi-localized nucleotide sugar (UDP-GlcNAc) transporter that delivers an essential substrate for the maturation of N-glycans and the GIPC class of sphingolipids. |
| AT3G29360 | Encodes one of four UDP-glucose dehydrogenase UGD) genes. Mutation of this gene in combination with UGD3 leads to swollen plant cell walls and severe developmental defects associated with changes in pectic polysaccharides. |
| AT5G39320 | UDP-glucose 6-dehydrogenase family protein;(source:Araport11) |
| AT3G03250 | Is thought to encode a cytosolic UDP-glucose pyrophosphorylase with strong similarity to potato UTP--glucose-1-phosphate uridylyltransferase. Downregulated by flooding. |
| AT5G54060 | Encodes a anthocyanin 3-O-glucoside: 2"-O-xylosyl-transferase involved in anthocyanin modification that converts cyanidin 3-O-glucoside to cyanidin 3-O-xylosyl(1->2)glucoside. Its preferred sugar donor is UDP-xylose. |
| AT3G21800 | UDP-glucosyl transferase 71B8;(source:Araport11) |
| AT2G29750 | UDP-glucosyl transferase 71C1;(source:Araport11) |
| AT1G07240 | Encodes a UDP-glucosyltransferase that plays a role in abscisic acid (ABA) glucosylation from ABA to ABA-glucose ester and regulates ABA homeostasis, thereby influencing the ABA signal network. |
| AT1G01420 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT3G50740 | UGT72E1 is an UDPG:coniferyl alcohol glucosyltransferase which specifically glucosylates sinapyl- and coniferyl aldehydes. The enzyme is thought to be involved in lignin metabolism. |
| AT4G34138 | UDP-glucosyl transferase 73B1;(source:Araport11) |
| AT4G34131 | UDP-glucosyl transferase 73B3;(source:Araport11) |
| AT1G24100 | Encodes a UDP-glucose:thiohydroximate S-glucosyltransferase, involved in glucosinolate biosynthesis |
| AT2G31750 | Encodes an auxin glycosyltransferase that is likely to be involved in regulation of auxin by glycosylation. |
| AT5G05870 | UDP-glucosyl transferase 76C1;(source:Araport11) |
| AT5G05860 | Encodes a cytokinin N-glucosyltransferase that is involved in cytokinin homeostasis and cytokinin response in planta through cytokinin N-glucosylation. Expression is induced by ABA, mannitol and drought stress. Analysis of overexpressors and loss of function mutants indicate a role in response to osmotic and drought stress. |
| AT5G05880 | Encodes a nicotinate-N-glycosyltransferase. |
| AT5G59580 | UDP-glucosyl transferase 76E1;(source:Araport11) |
| AT5G59590 | UDP-glucosyl transferase 76E2;(source:Araport11) |
| AT1G22360 | UDP-glucosyl transferase 85A2;(source:Araport11) |
| AT1G22380 | Encodes a putative UDP-glucosyl transferase. At1g22380 was initially identified as encoding the protein AAF87154, which has been classified as a bHLH protein (AtbHLH152). Subsequently it has been found that the AAF87154 protein appears to be encoded by the AT1G23970 genomic locus. |
| AT1G78270 | UDP-glucosyl transferase 85A4;(source:Araport11) |
| AT1G22370 | UDP-glucosyl transferase 85A5;(source:Araport11) |
| AT3G16520 | UDP-glucosyl transferase 88A1;(source:Araport11) |
| AT1G73880 | UDP-glucosyl transferase 89B1;(source:Araport11) |
| AT4G34135 | The At4g34135 gene encodes a flavonol 7-O-glucosyltransferase (EC 2.4.1.237) that glucosylates also with a 20 fold lower activity flavonols (kaempferol and quercetin) at the 3-O-position. |
| AT1G05560 | A UDP-glucose transferase localized in the phragmoplast. It has been co-purified with the callose synthase complex and may transfer UDP-glucose from sucrose synthase to the callose synthase and thus help form a substrate channel for the synthesis of callose at the forming cell plate. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. UGT1 encodes a protein with glucosyltransferase activity with high sequence homology to UGT2 (AT1G05530). It belongs to an UGT subfamily that binds UDP-glucose but not UDP-glucuronate, UDP-galactose, or UDP-rhamnose as the glycosyl donor. UGT1 was shown to be able to use abscisic acid as glycosylation substrate in the presence of UDP-glucose. UGT1/UGT75B1 catalyzes the formation of the p-aminobenzoate-glucose ester in vitro and in vivo. It appears to be the enzyme predominantly responsible for pABA-Glc formation in Arabidopsis based on assays in leaves, flowers, and siliques. |
| AT3G53520 | Encodes a Golgi localized isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
| AT4G09500 | Glycosyltransferase which negatively regulates hypoxia stress response. |
| AT5G49690 | UDP-glycosyltransferase that can act upon sulcotrione herbicide. Overexpression confers resistance to herbicide. |
| AT5G52560 | Encodes a protein with UTP:sugar 1-phosphate uridylyltransferase activity, which has been shown to use a wide range of substrates including glucose-1-P, galactose-1-P, xylose-1-P, arabinose-1-P and glucuronate-1-P. The enzyme was shown to require Mg2+ or Mn2+ for activity. Mutations in USP can lead to a complete loss of male fertility. |
| AT2G28315 | UXT1 is a member of the NST-KT subfamily of nucleotide/sugar transporters. It is localized to the golgi and ER. UXT1 functions as a UDP-Xyl transporter. The mRNA is cell-to-cell mobile. |
| AT4G02500 | Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides. The mRNA is cell-to-cell mobile. |
| AT4G37180 | UIF1 is a nuclear and cytoplasmically localized myb-domain containing member of the GARP G2-like subfamily of transcription factors. Interacts with ULT1 and binds to the WUS promoter. UIF1 binding domains are also found in CUC and AG promoters suggesting they are also direct targets. This locus was also identified as a putative cytoskeletal protein in a yeast screen. |
| AT2G20825 | Developmental regulator, ULTRAPETALA;(source:Araport11) |
| AT3G28030 | Required for repair of pyrimidine-pyrimidinone (6-4) dimers. The mRNA is cell-to-cell mobile. |
| AT1G03190 | UV damage and heat induce a common stress response in plants that leads to tissue death and reduced chloroplast function. The UVH6 product is suggested to be a negative regulator of this response. |
| AT1G29300 | intracellular protein transporter, putative (DUF641);(source:Araport11) |
| AT4G00050 | Encodes a phytochrome interacting factor that inhibits phytochrome A-mediated far-red light responses and binds to promoter regions of AT2G46970 and AT3G62090. |
| AT4G00080 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G02590 | Basic helix loop helix class transcriptional regulator. Shows ecotype specific effects on temperature dependent salicylic acid accumulation and immunity. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT4G26330 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT3G03690 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G51170 | Encodes an active AGC VIII protein kinase that interacts with the putative transcription factor ATS and regulates planar growth during integument development in the ovule. Mutants exhibit ectopic growth in filaments and petals, as well as aberrant embryogenesis. |
| AT3G20830 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT3G53990 | Encodes universal stress protein (USP). Functions as a molecular chaperone under heat shock and oxidative stress conditions. Chaperone activity and assembly into complexes is redox regulated. |
| AT2G20100 | Together with PFA1 and PFA3 governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT1G29120 | Hydrolase-like protein family;(source:Araport11) |
| AT3G53900 | Encodes UPP, a plastidial uracil phosphoribosyltransferase (UPRT) involved in uracil salvage. Loss-of-function mutation causes dramatic growth retardation, a pale-green to albino phenotype, abnormal root morphology and chloroplastic disorders. |
| AT1G05680 | Encodes a UDP-glucosyltransferase, UGT74E2, that acts on IBA (indole-3-butyric acid) and affects auxin homeostasis. The transcript and protein levels of this enzyme are strongly induced by H2O2 and may allow integration of ROS (reactive oxygen species) and auxin signaling. This enzyme can also transfer glycosyl groups to several compounds related to the explosive TNT when this synthetic compound is taken up from the environment. |
| AT3G27190 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
| AT1G55810 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
| AT5G40870 | Pseudouridine kinase from the PfkB family that generates 59-pseudouridine monophosphate. |
| AT1G05620 | Encodes a cytosolic inosine nucleoside hydrolase. It forms a heterocomplex with NSH1 with almost two orders of magnitude higher catalytic efficiency for xanthosine hydrolysis than observed for NSH1 alone. Transcript levels for this gene are elevated in older leaves suggesting that it may play a role in purine catabolism during senescence. |
| AT2G36310 | Encodes a cytoplasmic nucleoside hydrolase. It has the highest levels of activity with uridine followed by xanthosine. It shows little activity with inosine and none with cytidine. Mutant analyses indicate that it plays a role in purine and pyrimidine catabolism. |
| AT5G45370 | nodulin MtN21-like transporter family protein |
| AT3G56620 | nodulin MtN21-like transporter family protein |
| AT2G37460 | nodulin MtN21-like transporter family protein |
| AT2G37450 | nodulin MtN21-like transporter family protein |
| AT2G39510 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
| AT5G13670 | nodulin MtN21-like transporter family protein |
| AT1G21890 | nodulin MtN21-like transporter family protein |
| AT1G43650 | nodulin MtN21-like transporter family protein |
| AT4G28040 | nodulin MtN21-like transporter family protein |
| AT4G15540 | nodulin MtN21-like transporter family protein The mRNA is cell-to-cell mobile. |
| AT3G18200 | nodulin MtN21-like transporter family protein |
| AT5G40240 | nodulin MtN21-like transporter family protein |
| AT3G28130 | nodulin MtN21-like transporter family protein |
| AT3G28100 | nodulin MtN21-like transporter family protein The mRNA is cell-to-cell mobile. |
| AT5G47470 | nodulin MtN21-like transporter family protein |
| AT3G15620 | Required for photorepair of 6-4 photoproducts in Arabidopsis thaliana. |
| AT5G59920 | Isolated in a screen for UV-B insensitive mutants using a hypocotyl growth inhibition assay. Mutants are defective in a number of UV-B responses. |
| AT2G42260 | Encodes a novel plant-specific protein of unknown function. The UVI4 gene is expressed mainly in actively dividing cells. The hypocotyl cells in mutant seedlings undergo one extra round of endoreduplication. The uvi4 mutation also promoted the progression of endo-reduplication during leaf development. |
| AT2G14740 | Encodes a vacuolar sorting receptor that participates in vacuolar sorting in vegetative tissues and in seeds. The mRNA is cell-to-cell mobile. |
| AT4G25950 | V-ATPase G-subunit like protein |
| AT1G64200 | vacuolar H+-ATPase subunit E isoform 3;(source:Araport11) |
| AT1G62660 | Glycosyl hydrolases family 32 protein;(source:Araport11) |
| AT1G63010 | Encodes an SPX domain protein that transports Pi into the vacuole and is essential for phosphate homeostasis. |
| AT3G61770 | Acid phosphatase/vanadium-dependent haloperoxidase-related protein;(source:Araport11) |
| AT1G08190 | Might be involved in protein sorting to the vacuole. The mRNA is cell-to-cell mobile. |
| AT1G17730 | Encodes an ESCRT-related protein: CHMP1A/AT1G73030; CHMP1B/AT1G17730. CHMP1A and B mediate multivesicular body sorting of auxin carriers and are required for plant development. ESCRT: Endosomal Sorting Complexes Required For Transport machinery; CHMP: Charged Multivesicular Body Protein/Chromatin Modifying Protein. |
| AT1G03950 | vacuolar protein sorting-associated protein 2.3;(source:Araport11) |
| AT4G39080 | Vacuolar proton ATPase subunit VHA-a isoform 3. Localized in the tonoplast. The mRNA is cell-to-cell mobile. |
| AT2G34940 | VACUOLAR SORTING RECEPTOR 5;(source:Araport11) |
| AT3G62170 | VANGUARD-like protein;(source:Araport11) |
| AT3G21710 | transmembrane protein;(source:Araport11) |
| AT2G45870 | Encodes a bestrophin-like protein (Best2). Minor isoform (10% transcript of AtBest1). Putative chloride ion channel. Proposed to modulate proton motive force partitioning by mediating chloride ion influx in the thylakoid lumen. |
| AT4G29260 | VSP3 is a secreted acid phosphatase. |
| AT4G24220 | encodes a progesterone-5beta-reductase-like protein. It has enone reductase activity against a wide range of substrates, including 3-oxo-Δ-4,5-steroids in vitro. The in vivo substrates and product of this enzyme have not yet been elucidated but it is likely to participate in steroid metabolism. The protein contains a mammalian death domain involved in programmed cell death. The gene is expressed in the vascular system and mutants carrying a dominant mutation in the gene have defective vascular patterning. VEP1 gene expression is induced specifically by wounding. |
| AT5G57380 | Encodes a plant homeodomain protein VERNALIZATION INSENSITIVE 3 (VIN3). In planta VIN3 and VRN2, VERNALIZATION 2, are part of a large protein complex that can include the polycomb group (PcG) proteins FERTILIZATION INDEPENDENT ENDOSPERM (FIE), CURLY LEAF (CLF), and SWINGER (SWN or EZA1). The complex has a role in establishing FLC (FLOWERING LOCUS C) repression during vernalization. |
| AT4G30200 | Encodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus. |
| AT2G18870 | vernalization5/VIN3-like protein;(source:Araport11) |
| AT3G05270 | Encodes a protein that localizes at motile vesicle-like small compartments in differentiating xylem cells that is associated with microtubule plus-ends. VETH-positive compartments are unlikely to be elements in conventional endomembrane trafficking pathways. It can associate with COG2, and together these two proteins co-localize with the EXO70A1 exocyst subunit, tethering EXO70A1 to compartments associated with cortical microtubules. |
| AT1G77580 | filament-like protein (DUF869);(source:Araport11) |
| AT1G26670 | member of VTI1 Gene Family. Normally localizes to the transgolgi network and plasma membrane. A dominant mutation (zip1) alters the subcellular localization of VTI12 and suppresses loss of function mutation (zag1) of VTI11. Interacts with members of the SYP family. Involved in protein trafficking to protein storage vacuoles. |
| AT4G32150 | AtVAMP711 is a member of Synaptobrevin-like AtVAMP7C, v-SNARE (soluble N-ethyl-maleimide sensitive factor attachment protein receptors) protein family. SNAREs have been divided into four subgroups: Qa-, Qb-, Qc- and R-SNAREs. R-SNAREs are classified into three groups, the Sec22-, YKT6- and VAMP7-like R-SNAREs. One R-SNARE and three Q-SNAREs (one of each subgroup) form the trans-SNARE complex, which governs specific membrane fusions. VAMP7 proteins consist of three distinct domain, the N-terminal longin-domain (LD), the SNARE motif (SNM) and a transmembrane domain. In spite of the high similarities among the VAMP7 proteins, they show different subcellular localizations. VAMP7C is vacuolar-localized and its LD is essential for the correct localization. Generally, it is suggested that the complete LD is the determinant of subcellular sorting in both animal and plant R-SNAREs. |
| AT3G54300 | Encodes a member of Synaptobrevin -like protein family. VAMP727 is a R-SNARE and interacts with SYP22/VTI11/SYP51. It is required for trafficking of storage proteins to the protein storage vacuoles (PSV) and also for PSV organization and biogenesis. Loss of function mutations have no phenotype but double mutants with SYP22 are embryo lethal. |
| AT1G47056 | Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB2,3, and 4. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes. |
| AT3G57410 | Encodes a protein with high homology to animal villin. VLN3 is a Ca2+-regulated villin involved in actin filament bundling. |
| AT4G23630 | VIRB2-interacting protein 1;(source:Araport11) |
| AT4G11220 | VIRB2-interacting protein 2;(source:Araport11) |
| AT5G41600 | VIRB2-interacting protein 3;(source:Araport11) |
| AT5G28040 | Member of the GeBP/GPL family of leucine zipper transcription factors. VPF4 interacts with the F-box proteins from A.tumefaciens VirF and VBF. Over expression results in decreased tumor formation upon Agrobacterium infection. Mutants show changes in the level of expression of defense response genes. |
| AT1G78620 | integral membrane protein (Protein of unknown function DUF92, transmembrane);(source:Araport11) |
| AT5G04490 | Encodes a protein with phytol kinase activity involved in tocopherol biosynthesis. |
| AT3G01280 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. The mRNA is cell-to-cell mobile. |
| AT5G67500 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. The mRNA is cell-to-cell mobile. |
| AT5G57490 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. |
| AT4G21550 | VP1/ABI3-like 3;(source:Araport11) |
| AT2G17790 | Encodes a protein with similarity to yeast VPS35 which encodes a component of the retromer involved in retrograde endosomal transport. Mutants partially suppress the loss of VTI11 function in Arabidopsis and restores gravitropism in the double mutant. The mRNA is cell-to-cell mobile. |
| AT1G78310 | VQ motif-containing protein;(source:Araport11) |
| AT1G53700 | The WAG1 and its homolog, WAG2 each encodes a protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT1G79680 | Encodes a twin-domain, kinase-GC signaling molecule that may function in biotic stress responses that is critically dependent on the second messenger cGMP. |
| AT1G16120 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
| AT1G16130 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
| AT1G16140 | Encodes a predicted WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
| AT1G16150 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. Likely involved in Arabidopsis root mineral responses to Zn2+, Cu2+, K+, Na+ and Ni+. The mRNA is cell-to-cell mobile. |
| AT1G16110 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. It has been shown to be localized to the cell wall. |
| AT1G16090 | Encodes a truncated WAK-like kinase that is predicted to be a secreted protein. |
| AT1G58070 | WALLIN is an actin binding protein involved in ROP11 mediated xylem pit patterning. |
| AT1G75500 | An Arabidopsis thaliana homolog of Medicago truncatula NODULIN21 (MtN21). The gene encodes a plant-specific, predicted integral membrane protein and is a member of the Plant-Drug/Metabolite Exporter (P-DME) family (Transporter Classification number: TC 2.A.7.3) and the nodulin MtN21-like transporter family. |
| AT2G22680 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT5G65683 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT1G70950 | Microtubule-stabilizing protein. Module with MREL57 regulates microtubule disassembly to mediate stomatal closure in response to drought stress and ABA treatment. MREL57 interacts with, ubiquitinates and degrades WDL7, effect is enhanced by ABA. |
| AT5G28646 | Encodes a novel protein. The wvd2 gain-of-function mutant has impaired cell expansion and root waving, and changed root skewing. |
| AT3G23090 | Member of the microtubule regulatory protein WVD2/WDL family WDL3 stabilizes cortical microtubules and is involved in light induced hypocotyl elongation. WDL3 is ubiquinated by COP1, leading to its degadation in the dark, |
| AT4G32330 | WDL5 is an target of EIN3 that co-localizes with cortical microtubles. It its thought to function to stabilize microtubles during ethylene induced hypocotyl elongation. |
| AT2G35880 | Microtubule-stabilizing protein. |
| AT2G26570 | Encodes a coiled-coil protein WEB1 (weak chloroplast movement under blue light 1). WEB1, together with another coiled-coil protein WEB2/PMI2 (At1g66840), maintains the chloroplast photorelocation movement velocity. |
| AT3G20880 | WIP4 is a paralog of NTT and along with WIP5,acts redundantly in cell fate determination during primary root development. MP binds to AuxRE motifs within the WIP4 gene and likely regulates its expression. |
| AT3G04910 | Serine/threonine protein kinase, whose transcription is regulated by circadian rhythm. |
| AT3G22420 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
| AT5G41990 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Interacts specifically with and phosphorylates AtVHA-C, subunit C of the vacuolar H+-ATPase. |
| AT1G10200 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. |
| AT3G55770 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. |
| AT2G01830 | Histidine kinase: cytokinin-binding receptor that transduces cytokinin signals across the plasma membrane |
| AT4G28240 | Member of the wound-induced polypeptide (WIP) family. Positively regulates plant resistance against Pst DC3000 by enhancing PTI responses. |
| AT4G10270 | Member of the wound-induced polypeptide (WIP) family. |
| AT4G33560 | Member of the wound-induced polypeptide (WIP) family. |
| AT5G56210 | Encodes an outer nuclear membrane protein that anchors RanGAP1 to the nuclear envelope. It interacts with SUN proteins and is required for maintaining the elongated nuclear shape of epidermal cells. |
| AT1G47200 | WPP family members contains an NE targeting domain. This domain, called the WPP domain after a highly conserved Trp-Pro-Pro motif, is necessary for NE targeting of WPP1. RNAi suppression of WPP2 resulted in reduced mitotic activity. |
| AT3G54320 | WRINKLED1 encodes transcription factor of the AP2/ERWEBP class. Protein has two plant-specific (AP2/EREB) DNA-binding domains and is involved in the control of storage compound biosynthesis in Arabidopsis. Mutants have wrinkled seed phenotype, due to a defect in the incorporation of sucrose and glucose into triacylglycerols. Transgenic sGsL plants (21-day-old) grown on 6% sucrose for 24 hours had 2-fold increase in levels of expressions (sGsL line carries a single copy of T-DNA containing the Spomin::GUS-Spomin::LUC dual reporter genes in the upper arm of chromosome 5 of ecotype Col-0. The sporamin .minimal. promoter directs sugar-inducible expression of the LUC and GUS reporters in leaves). Regulation by LEC2 promotes fatty acid accumulation during seed maturation. Splice form 3 is the major form expressed in seedlings.Mutations in the C terminal intrinsically disordered region increase the stability of WRI1 and lead to increased oil production. |
| AT1G79700 | WRI4 encodes an AP2/ERF-type transcriptional activator that specifically controls cuticular wax biosynthesis in Arabidopsis stems. It also functions to activate transcription of genes involved fatty acid biosynthesis during seed and flower development as well as stem wax biosynthesis. Targets identified by ChIP-seq include: LACS1, KCR1, PAS2, ECR, and WSD1. |
| AT4G31550 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
| AT4G39410 | Encodes a member of the Group II-c WRKY Transcription Factor family that is involved in stem development and has been shown to directly bind to the promoter of NST2. WRKY13 binds to the promoter of DCD to upregulate its expression and hydrogen sulfide production to enhance plant cadmium tolerance. Mutants show a weak stem phenotype and show decreased expression of lignin-synthesis-related genes. |
| AT2G23320 | Encodes WRKY DNA-binding protein 15 (WRKY15). |
| AT2G24570 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
| AT4G31800 | Pathogen-induced transcription factor. Binds W-box sequences in vitro. Forms protein complexes with itself and with WRKY40 and WRKY60. Constitutive expression of WRKY18 enhanced resistance to P. syringae, but its coexpression with WRKY40 or WRKY60 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. The mRNA is cell-to-cell mobile. |
| AT5G56270 | Encodes WRKY transcription factor 2, a zinc-finger protein. In wrky2 mutants, egg cells polarize normally but zygotes fail to reestablish polar organelle positioning from a transient symmetric state, resulting in equal cell division and distorted embryo development. |
| AT2G30250 | member of WRKY Transcription Factor; Group I. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. |
| AT5G07100 | Encodes WRKY DNA-binding protein 26 (WRKY26). |
| AT5G52830 | Encodes a WRKY transcription factor WRKY27. Mutation in Arabidopsis WRKY27 results in delayed symptom development in response to the bacterial wilt pathogen Ralstonia solanacearum. |
| AT2G03340 | Encodes WRKY DNA-binding protein 3 (WRKY3). |
| AT4G30935 | member of WRKY Transcription Factor; Group I |
| AT2G38470 | Member of the plant WRKY transcription factor family. Regulates the antagonistic relationship between defense pathways mediating responses to P. syringae and necrotrophic fungal pathogens. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. Regulates cytochrome P450 gene CYP94B1 to control apoplastic barrier formation in roots to confer salt tolerance. |
| AT1G69810 | member of WRKY Transcription Factor; Group II-b |
| AT3G04670 | member of WRKY Transcription Factor; Group II-d |
| AT1G80840 | Pathogen-induced transcription factor. Binds W-box sequences in vitro. Forms protein complexes with itself and with WRKY40 and WRKY60. Coexpression with WRKY18 or WRKY60 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. The mRNA is cell-to-cell mobile. |
| AT2G46400 | Encodes a WRKY transcription factor that contributes to the feedforward inhibition of osmotic/salt stress-dependent LR inhibition via regulation of ABA signaling and auxin homeostasis. |
| AT5G49520 | Encodes WRKY48, a member of the WRKY Transcription Factor. WRKY48 is a stress- and pathogen-induced transcriptional activator that represses plant basal defense. The mRNA is cell-to-cell mobile. |
| AT5G64810 | member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses. |
| AT1G69310 | Encodes WRKY57, a member of the WRKY Transcription Factor. Activation of WRKY57 confers drought tolerance. |
| AT2G25000 | Pathogen-induced transcription factor. Forms protein complexes with itself and with WRKY40. Coexpression with WRKY18 or WRKY40 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. |
| AT1G29280 | member of WRKY Transcription Factor; Group II-e The mRNA is cell-to-cell mobile. |
| AT1G80590 | member of WRKY Transcription Factor; Group III |
| AT3G58710 | member of WRKY Transcription Factor; Group II-e |
| AT4G24240 | Encodes a Ca-dependent calmodulin binding protein. Sequence similarity to the WRKY transcription factor gene family. |
| AT3G56400 | Member of WRKY Transcription Factor; Group III. Function as activator of SA-dependent defense genes and a repressor of JA-regulated genes. WRKY70-controlled suppression of JA-signaling is partly executed by NPR1. |
| AT5G46350 | member of WRKY Transcription Factor; Group II-c |
| AT3G49210 | WSD6 can function in vitro as wax ester synthase but does not appear to be essential for cuticular wax biosynthesis. |
| AT5G12420 | WSD7 can function in vitro as wax ester synthase but does not appear to be essential for cuticular wax biosynthesis. |
| AT3G15880 | TOPLESS family protein. |
| AT3G18010 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Its mRNA is expressed in the initiating vascular primordium of the cotyledons during heart and torpedo stages. |
| AT3G04630 | Member of a small gene family which have a KLEEK domain which may be involved in protein- protein interactions. Over expression of WDL1 results in abnormal root development. |
| AT5G55820 | Encodes a plant ortholog of the inner centromere protein (INCENP), which is implicated in the control of chromosome segregation and cytokinesis in yeast and animals. Required for female gametophytic cell specification and seed development. |
| AT2G21150 | Encodes a nuclear localized XAP5 family protein involved in light regulation of the circadian clock and photomorphogenesis. XCT loss of function mutations also show decreased levels of DCL1, 3 and 4 and correspondingly lower levels of certain small RNAs suggesting a role in sRNA biogenesis. |
| AT4G14365 | hypothetical protein;(source:Araport11) |
| AT3G18000 | Encodes a N-methyltransferase-like protein. Double mutants of NMT1 and NMT3 are defective in leaf, root, flower, seed, and pollen development. |
| AT1G09850 | Arabidopsis thaliana papain-like cysteine peptidase |
| AT5G57530 | xyloglucan endotransglucosylase/hydrolase 12;(source:Araport11) |
| AT4G25820 | Encodes a xyloglucan endotransglycosylase with a clear preference for non-fucosylated xyloglucan polymer. The mRNA is cell-to-cell mobile. |
| AT1G65310 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. |
| AT4G30280 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. |
| AT4G30290 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed throughout both the main and the lateral root, with intensive expression at the dividing and elongating regions. Is expressed in lateral root primordia but expression ceases after lateral root begins to grow. Involved in cell proliferation in incised inflorescence stems. |
| AT5G57550 | xyloglucan endotransglycosylase-related protein (XTR3) |
| AT1G14720 | member of Glycoside Hydrolase Family 16 |
| AT1G32170 | xyloglucan endotransglycosylase-related protein (XTR4) The mRNA is cell-to-cell mobile. |
| AT3G44990 | Encodes a xyloglucan endotransglycosylase/hydrolase. Protein sequence and phylogenetic analysis indicates that this enzyme resides in Group III-A of the XTH family, with high similarity to Tropaeolum majus (nasturtium) xyloglucanase 1 (TmNXG1).Enzyme kinetic analysis indicates predominant xyloglucan endo-hydrolase activity (EC 3.2.1.151) with only limited potential to act as a xyloglucan endo-transglycosylase (EC 2.4.1.207). |
| AT2G06850 | endoxyloglucan transferase (EXGT-A1) gene |
| AT4G37800 | xyloglucan endotransglucosylase/hydrolase 7;(source:Araport11) |
| AT4G03210 | Encodes a member of xyloglucan endotransglucosylase/hydrolases (XTHs) that catalyze the cleavage and molecular grafting of xyloglucan chains function in loosening and rearrangement of the cell wall. Gene is expressed in shoot apex region, flower buds, flower stalks and internodes bearing flowers. |
| AT1G74380 | xyloglucan xylosyltransferase 5;(source:Araport11) |
| AT1G10550 | Encodes a membrane-localized protein that is predicted to function during cell wall modification.Overexpression of XTH33 results in abnormal cell morphology. It's expression is under epigenetic control by ATX1. |
| AT3G62720 | Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides. |
| AT5G17630 | Phosphate translocator family member which resides in the plastid inner envelope membrane. Retrieves excessive pentose phosphates from the extra-plastidial space and makes them available to the plastids. |
| AT2G21370 | Although this gene has a sequence similar to xylulose kinases, several lines of experimental evidence suggest that it does not act on xylulose or deoxy-xylulose. |
| AT1G08410 | Encodes a large 60S subunit nuclear export GTPase 1 that is required for 40S maturation and is involved in ribosome biogenesis and affects multiple auxin-regulated development processes. |
| AT5G24380 | closest Arabidopsis homolog of Zea maize metal-phytosiderophore/metal-nicotianamine transporter ZmYS1 |
| AT5G53550 | YELLOW STRIPE like 3;(source:Araport11) |
| AT5G41000 | Arabidopsis thaliana metal-nicotianamine transporter YSL4 |
| AT3G17650 | Arabidopsis thaliana metal-nicotianamine transporter YSL5 |
| AT3G27020 | Arabidopsis thaliana metal-nicotianamine transporter YSL6 |
| AT1G04610 | Encodes a member of the YUC family that is expressed in the root apex and is ethylene inducible in the root. |
| AT4G13260 | Encodes YUC2. Catalyzes conversion of IPA (indole-3-pyruvic acid) to IAA (indole-3-acetic acid) in auxin biosynthesis pathway. |
| AT3G14890 | Encodes a base excision repair protein that, together with APE2, it plays overlapping roles in the maintenance of epigenome and genome stability in plants. |
| AT5G04340 | Encodes a C2H2 zinc finger transcription factor that coordinately activates phytochelatin-synthesis related gene expression and directly targets GSH1 by binding to its promoter to positively regulate Cd accumulation and tolerance. |
| AT4G17810 | C2H2 domain regulatory protein. Functions downstream of GL2 during root hair development and regulates expression of targets RDH6, RSL2 and RSL4. |
| AT5G25160 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT1G66140 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT1G10480 | Encodes a zinc finger protein containing only a single zinc finger that acts downstream of ZFP6 in regulating trichome development by integrating GA and cytokinin signaling. |
| AT1G67030 | Encodes a novel C2H2 zinc finger protein containing only a single zinc finger which plays a key role in regulating trichome development by integrating GA and cytokinin signaling. The mRNA is cell-to-cell mobile. |
| AT2G41940 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT5G13740 | Encodes ZIF1 (ZINC-INDUCED FACILITATOR1), a member of the Major Facilitator Superfamily (MFS) of membrane proteins which are found in all organisms and transport a wide range of small, organic molecules. Involved in a mechanism of Zn sequestration, possibly by transport of a Zn ligand or Zn-ligand complex into vacuoles. The mRNA is cell-to-cell mobile. |
| AT5G13750 | zinc induced facilitator-like 1;(source:Araport11) |
| AT3G43790 | zinc induced facilitator-like 2;(source:Araport11) |
| AT3G20870 | ZIP metal ion transporter family;(source:Araport11) |
| AT1G05300 | member of Fe(II) transporter isolog family |
| AT2G46800 | Encodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis. |
| AT2G04880 | Encodes WRKY1, a member of the WRKY transcription factors in plants involved in disease resistance, abiotic stress, senescence as well as in some developmental processes. WRKY1 is involved in the salicylic acid signaling pathway. The crystal structure of the WRKY1 C-terminal domain revealed a zinc-binding site and identified the DNA-binding residues of WRKY1. The mRNA is cell-to-cell mobile. |
| AT1G49590 | Encodes a novel nucleic acid-binding protein that is required for both RdDM (RNA-directed DNA methylation) and pre-mRNA splicing. |
| AT5G67450 | Encodes zinc-finger protein. mRNA levels are elevated in response to low temperature, cold temperatures and high salt. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT1G80730 | Encodes a zinc finger protein and is expressed at high levels in the shoot apex, including the apical meristem, developing leaves and the developing vascular system. expression induced three days post germination. T-DNA insertion mutant has a dominant phenotype in leaf initiation. |
| AT3G19580 | Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild desiccation. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT5G43170 | Encodes zinc finger protein. mRNA levels are elevated in response to high salinity and low temperature. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT4G31877 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC. Pri-mRNA coordinates for MIR156c (converted to TAIR10 based on PMID19304749): Chr4: 15415873-15413295 (reverse), length: 2580 bp; exon coordinates: exon 1: 15415873 |