AT5G05720 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G53400 | peptide upstream protein;(source:Araport11) |
AT4G30540 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
AT3G15180 | ARM repeat superfamily protein;(source:Araport11) |
AT5G35240 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative transposable element, blastp match of 47%25 identity and 9.3e-52 P-value to GP|13122426|dbj|BAB32907.1||AP003047 putative transposable element {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT2G46230 | PIN domain-like family protein;(source:Araport11) |
AT2G32905 | B3 domain protein, putative (DUF313);(source:Araport11) |
AT3G03770 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G52850 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G38020 | encodes a protein whose sequence is similar to SAM:salicylic acid carboxyl methyltransferase (SAMT) (GI:6002712)(Clarkia breweri) and to SAM:benzoic acid carboxyl methyltransferase (BAMT)(GI:9789277)(Antirrhinum majus). SABATH family methyltransferase. |
AT1G27090 | glycine-rich protein;(source:Araport11) |
AT3G05900 | neurofilament protein-like protein;(source:Araport11) |
AT4G08406 | transmembrane protein;(source:Araport11) |
AT2G13115 | pseudogene of bZIP family transcription factor |
AT5G63710 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G03370 | C2 calcium/lipid-binding and GRAM domain containing protein;(source:Araport11) |
AT3G17070 | Peroxidase family protein;(source:Araport11) |
AT1G51270 | vesicle-associated protein 1-4;(source:Araport11) |
AT1G48230 | Nucleotide/sugar transporter family protein |
AT3G47800 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
AT2G28360 | SIT4 phosphatase-associated family protein;(source:Araport11) |
AT3G49650 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G18780 | RING/U-box superfamily protein;(source:Araport11) |
AT5G66430 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G40920 | pseudogene of Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G63820 | hypothetical protein (DUF626);(source:Araport11) |
AT2G33960 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
AT2G37520 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
AT3G10439 | hypothetical protein;(source:Araport11) |
AT5G16520 | transmembrane protein;(source:Araport11) |
AT2G06906 | hypothetical protein;(source:Araport11) |
AT4G17713 | Encodes a defensin-like (DEFL) family protein. |
AT3G24518 | Natural antisense transcript overlaps with AT3G24520;(source:Araport11) |
AT1G44940 | hypothetical protein;(source:Araport11) |
AT3G27845 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT5G18710 | DNAJ heat shock amino-terminal domain protein, putative (DUF3444);(source:Araport11) |
AT1G56140 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
AT4G31020 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G49140 | NADH dehydrogenase ubiquinone 1 beta subcomplex subunit 10-B-like protein (Complex I subunit NDUFS6);(source:Araport11) |
AT3G20650 | mRNA capping enzyme family protein;(source:Araport11) |
AT1G55365 | hypothetical protein;(source:Araport11) |
AT2G30230 | 6,7-dimethyl-8-ribityllumazine synthase;(source:Araport11) |
AT5G42930 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G19530 | Encodes a TIR-NB-LRR resistance protein. Transient expression in tobacco induces cell death. |
AT2G02440 | transmembrane protein;(source:Araport11) |
AT5G35100 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT2G31560 | signal transducer/transcription protein, putative (DUF1685);(source:Araport11) |
AT4G27610 | intracellular protein transporter;(source:Araport11) |
AT2G15042 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT3G04320 | Kunitz family trypsin and protease inhibitor protein;(source:Araport11) |
AT2G35075 | hypothetical protein;(source:Araport11) |
AT4G35690 | hypothetical protein (DUF241);(source:Araport11) |
AT2G17540 | hypothetical protein;(source:Araport11) |
AT2G32788 | Encodes a Rapid ALkalinization Factor (RALF) family protein |
AT3G15980 | Coatomer, beta subunit;(source:Araport11) |
AT1G31540 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G19050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G00040 | Chalcone and stilbene synthase family protein;(source:Araport11) |
AT1G52130 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT1G52270 | hypothetical protein;(source:Araport11) |
AT3G11405 | hypothetical protein;(source:Araport11) |
AT2G17490 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.3e-199 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT4G12680 | transmembrane protein;(source:Araport11) |
AT2G02290 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT3G16850 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G44810 | F-box family protein;(source:Araport11) |
AT1G35210 | hypothetical protein;(source:Araport11) |
AT3G31312 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.1e-46 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
AT1G63855 | Putative methyltransferase family protein;(source:Araport11) |
AT1G05170 | Galactosyltransferase family protein;(source:Araport11) |
AT3G55672 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT2G28710 | C2H2-type zinc finger family protein;(source:Araport11) |
AT1G48650 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT1G77840 | Translation initiation factor IF2/IF5;(source:Araport11) |
AT2G15770 | Cupredoxin superfamily protein;(source:Araport11) |
AT4G30130 | DUF630 family protein (DUF630 and DUF632);(source:Araport11) |
AT3G29618 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.5e-16 P-value blast match to Q9SI25 /181-349 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT1G58060 | RNA helicase family protein;(source:Araport11) |
AT3G07660 | flocculation protein (DUF1296);(source:Araport11) |
AT3G50390 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G26090 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT4G01860 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT3G31909 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.0e-54 P-value blast match to Q9S9L1 /206-367 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT3G51180 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT1G73470 | hypothetical protein;(source:Araport11) |
AT4G15056 | hypothetical protein;(source:Araport11) |
AT2G34100 | nonsense-mediated mRNA decay-like protein;(source:Araport11) |
AT2G04280 | calcium ion-binding protein;(source:Araport11) |
AT4G29870 | Oligosaccharyltransferase complex/magnesium transporter family protein;(source:Araport11) |
AT2G14843 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 2.5e-35 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10) |
AT5G12010 | nuclease;(source:Araport11) |
AT1G37037 | transposable_element_gene;(source:Araport11) |
AT1G76920 | F-box family protein;(source:Araport11) |
AT5G66270 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT3G19870 | AP-5 complex subunit beta-like protein;(source:Araport11) |
AT3G57570 | ARM repeat superfamily protein;(source:Araport11) |
AT4G23970 | hypothetical protein;(source:Araport11) |
AT1G20790 | F-box family protein;(source:Araport11) |
AT5G02650 | hypothetical protein;(source:Araport11) |
AT5G36296 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.6e-14 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G24320 | Six-hairpin glycosidases superfamily protein;(source:Araport11) |
AT4G26290 | hypothetical protein;(source:Araport11) |
AT5G62960 | UDP-N-acetylglucosamine-N-acetylmuramyl-pyrophosphoryl-undecaprenol N-acetylglucosamine protein;(source:Araport11) |
AT2G27240 | aluminum activated malate transporter family protein;(source:Araport11) |
AT1G78150 | N-lysine methyltransferase;(source:Araport11) |
AT1G58643 | Inositol-pentakisphosphate 2-kinase family protein;(source:Araport11) |
AT3G13940 | DNA binding / DNA-directed RNA polymerase;(source:Araport11) |
AT5G37690 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
AT1G50270 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G36700 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G08610 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G12060 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains Pfam profile PF03384: Drosophila protein of unknown function, DUF287;(source:TAIR10) |
AT2G13580 | pseudogene of hypothetical protein;(source:Araport11) |
AT5G28897 | pseudogene of tonoplast intrinsic protein 2;(source:Araport11) |
AT1G20135 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT4G11355 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT2G01260 | hypothetical protein (DUF789);(source:Araport11) |
AT5G49780 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G26140 | hypothetical protein;(source:Araport11) |
AT3G50420 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G04972 | hypothetical protein;(source:Araport11) |
AT3G50030 | ARM-repeat/Tetratricopeptide repeat (TPR)-like protein;(source:Araport11) |
AT5G19500 | Encodes a putative amino acid transporter that localizes to the chloroplast inner envelope membrane. |
AT5G28926 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 2.3e-152 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10) |
AT1G05150 | Calcium-binding tetratricopeptide family protein;(source:Araport11) |
AT4G25310 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT1G22060 | sporulation-specific protein;(source:Araport11) |
AT3G62820 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT5G16110 | hypothetical protein;(source:Araport11) |
AT2G24310 | TPRXL;(source:Araport11) |
AT2G33940 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT1G31990 | transmembrane protein;(source:Araport11) |
AT3G55640 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT4G36980 | CLK4-associating serine/arginine-rich protein;(source:Araport11) |
AT3G07150 | amino acid-ligase;(source:Araport11) |
AT2G19270 | mitotic checkpoint protein PRCC-carboxy-term protein;(source:Araport11) |
AT4G23500 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT4G10000 | Thioredoxin family protein;(source:Araport11) |
AT5G62280 | DUF1442 family protein (DUF1442);(source:Araport11) |
AT1G58561 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.8e-219 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT5G48980 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G10590 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT1G16750 | GPI-anchored adhesin-like protein, putative (Protein of unknown function, DUF547);(source:Araport11) |
AT5G27500 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43920.1);(source:TAIR10) |
AT5G08500 | Transmembrane CLPTM1 family protein;(source:Araport11) |
AT4G18465 | RNA helicase family protein;(source:Araport11) |
AT5G33402 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT2G17300 | hypothetical protein;(source:Araport11) |
AT1G52855 | hypothetical protein;(source:Araport11) |
AT3G58975 | pseudogene of F-box family protein |
AT1G13460 | Encodes protein phosphatase 2A (PP2A) B'theta subunit. Targeted to peroxisomes. |
AT1G20240 | SWI-SNF-related chromatin binding protein;(source:Araport11) |
AT1G46336 | transmembrane protein;(source:Araport11) |
AT4G38890 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
AT5G59050 | G patch domain protein;(source:Araport11) |
AT5G19025 | Ribosomal protein L34e superfamily protein;(source:Araport11) |
AT1G42580 | transposable_element_gene;(source:Araport11);similar to DNA binding [Arabidopsis thaliana] (TAIR:AT3G47680.1);(source:TAIR10) |
AT3G51870 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT4G16008 | hypothetical protein;(source:Araport11) |
AT1G56385 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT3G10580 | Homeodomain-like superfamily protein;(source:Araport11) |
AT1G56020 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
AT2G33840 | Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial;(source:Araport11) |
AT2G18860 | Syntaxin/t-SNARE family protein;(source:Araport11) |
AT2G19130 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT2G16460 | coiled-coil 90B-like protein (DUF1640);(source:Araport11) |
AT1G78520 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT3G56880 | VQ motif-containing protein;(source:Araport11) |
AT5G45700 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G54620 | Ankyrin repeat family protein;(source:Araport11) |
AT2G41000 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT2G27315 | egg cell-secreted-like protein (DUF1278);(source:Araport11) |
AT5G41290 | Receptor-like protein kinase-related family protein;(source:Araport11) |
AT5G57150 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G33290 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G01950 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G27435 | hypothetical protein;(source:Araport11) |
AT1G27530 | ubiquitin-fold modifier-conjugating enzyme;(source:Araport11) |
AT2G13840 | Polymerase/histidinol phosphatase-like protein;(source:Araport11) |
AT1G09360 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT5G27120 | SAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; has similarity to MAR binding NOP58 protein The mRNA is cell-to-cell mobile. |
AT2G39490 | F-box family protein;(source:Araport11) |
AT1G11740 | ankyrin repeat family protein;(source:Araport11) |
AT1G66460 | Protein kinase superfamily protein;(source:Araport11) |
AT3G47590 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G31710 | Vacuolar ATPase assembly integral membrane protein VMA21-like domain-containing protein;(source:Araport11) |
AT2G38995 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
AT3G33555 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to hypothetical protein GB:AAD26889 (Arabidopsis thaliana);(source:TAIR10) |
AT2G25720 | hypothetical protein;(source:Araport11) |
AT5G38378 | Thionin-like gene involved in resistance against the beet cyst nematode (Heterodera schachtii). |
AT2G21430 | Papain family cysteine protease;(source:Araport11) |
AT5G58090 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT1G02350 | protoporphyrinogen oxidase-like protein;(source:Araport11) |
AT1G35360 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.5e-38 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT5G37590 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G32583 | A microRNA MIR400 is derived from the first intron of At1g32583 in the 5'UTR. A stress-induced alternative splicing event in At1g32583 resulted in greater accumulation of miR400 primary transcripts and a low level of mature miR400. |
AT5G42655 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT1G15060 | alpha/beta hydrolase family protein;(source:Araport11) |
AT5G26190 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G24380 | dihydrofolate reductase;(source:Araport11) |
AT1G34100 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
AT2G41830 | Uncharacterized protein;(source:Araport11) |
AT1G20270 | 2-oxoglutarate-dependent dioxygenase |
AT1G09370 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT2G04440 | MutT/nudix family protein;(source:Araport11) |
AT1G10000 | Ribonuclease H-like superfamily protein;(source:Araport11) |
AT2G04852 | Potential natural antisense gene, locus overlaps with AT2G04850 |
AT5G05795 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
AT2G17170 | Protein kinase superfamily protein;(source:Araport11) |
AT2G15017 | Pseudogene of AT4G00416; MBD3 (methyl-CpG-binding domain 3); DNA binding |
AT1G65090 | nucleolin;(source:Araport11) |
AT5G37570 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT4G01890 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G02600 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT5G65100 | Ethylene insensitive 3 family protein;(source:Araport11) |
AT4G04050 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.2e-207 P-value blast match to GB:AAD11615 prpol (gypsy_Ty3-element) (Zea mays);(source:TAIR10) |
AT3G51130 | transmembrane protein;(source:Araport11) |
AT1G69070 | nucleolar-like protein;(source:Araport11) |
AT1G72800 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G23890 | NHL domain-containing protein;(source:Araport11) |
AT1G77910 | transmembrane protein;(source:Araport11) |
AT5G46150 | LEM3 (ligand-effect modulator 3) family protein / CDC50 family protein;(source:Araport11) |
AT3G14595 | Ribosomal protein L18ae family;(source:Araport11) |
AT2G05310 | transmembrane protein;(source:Araport11) |
AT5G37170 | O-methyltransferase family protein;(source:Araport11) |
AT4G37830 | cytochrome c oxidase-like protein;(source:Araport11) |
AT4G06614 | transposable_element_gene;(source:Araport11);pseudogene, similar to Putative transposase, blastp match of 29%25 identity and 4.4e-17 P-value to GP|20042909|gb|AAM08737.1|AC025098_4|AC025098 Putative transposase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT5G28495 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 8.8e-77 P-value blast match to gb|AAL06416.1|AF378057_1 reverse transcriptase (Sorghum bicolor) (Gypsy_Ty3-family);(source:TAIR10) |
AT3G26340 | N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein;(source:Araport11) |
AT5G28960 | alpha-(1,6)-fucosyltransferase;(source:Araport11) |
AT3G17675 | Encodes a Plantacyanin/Basic blue family protein |
AT5G25420 | Xanthine/uracil/vitamin C permease;(source:Araport11) |
AT4G12450 | zinc finger (C2H2 type) family protein;(source:Araport11) |
AT5G18780 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT1G11940 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT5G64230 | 1,8-cineole synthase;(source:Araport11) |
AT4G00752 | UBX domain-containing protein;(source:Araport11) |
AT4G14460 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.2e-253 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT2G03750 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G48200 | hypothetical protein;(source:Araport11) |
AT1G03260 | SNARE associated Golgi protein family;(source:Araport11) |
AT4G26120 | Ankyrin repeat family protein / BTB/POZ domain-containing protein;(source:Araport11) |
AT4G11175 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT3G16040 | Translation machinery associated TMA7;(source:Araport11) |
AT1G33500 | tropomyosin;(source:Araport11) |
AT2G27830 | hypothetical protein;(source:Araport11) |
AT3G05810 | IGR motif protein;(source:Araport11) |
AT4G28400 | Protein phosphatase 2C family protein;(source:Araport11) |
AT1G48780 | hypothetical protein;(source:Araport11) |
AT5G12240 | octanoyltransferase;(source:Araport11) |
AT5G27590 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G03950.1);(source:TAIR10) |
AT1G36185 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT5G24600 | TRP-like ion channel protein (Protein of unknown function, DUF599);(source:Araport11) |
AT1G26530 | PIN domain-like family protein;(source:Araport11) |
AT5G62510 | F-box family protein;(source:Araport11) |
AT3G05165 | Major facilitator superfamily protein;(source:Araport11) |
AT2G14220 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.6e-167 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT1G64385 | transmembrane protein;(source:Araport11) |
AT4G09830 | nuclear receptor family 2 group C protein;(source:Araport11) |
AT3G48080 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G07675 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT2G03850 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
AT1G63550 | Receptor-like protein kinase-related family protein;(source:Araport11) |
AT5G59613 | ATP synthase;(source:Araport11) |
AT2G30310 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G50290 | hypothetical protein;(source:Araport11) |
AT1G64010 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
AT4G05526 | transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBb0043H09.1, similar to En/Spm-like transposon protein, putative;(source:TAIR10) |
AT2G47250 | RNA helicase family protein;(source:Araport11) |
AT3G44640 | transposable_element_gene;(source:Araport11);transposase IS4 family protein, contains Pfam profile: PF01609 transposase DDE domain;(source:TAIR10) |
AT5G51930 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
AT1G32970 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
AT3G56760 | Protein kinase superfamily protein;(source:Araport11) |
AT1G63730 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G53140 | Protein phosphatase 2C family protein;(source:Araport11) |
AT1G44125 | Natural antisense transcript overlaps with AT1G44120;(source:Araport11) |
AT4G14135 | Pseudogene of AT3G29785 |
AT4G13611 | Pseudogene of AT3G56530; ANAC064 (Arabidopsis NAC domain containing protein 64); transcription factor |
AT2G36260 | Iron-sulfur cluster biosynthesis family protein;(source:Araport11) |
AT3G04040 | transmembrane protein;(source:Araport11) |
AT2G02720 | Pectate lyase family protein;(source:Araport11) |
AT5G26233 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 6.2e-18 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G04430 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G14310 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G43960 | Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein;(source:Araport11) |
AT3G29255 | Putative pentacyclic triterpene synthase 7;(source:Araport11) |
AT3G03400 | EF hand calcium-binding protein family;(source:Araport11) |
AT2G23067 | Putative membrane lipoprotein;(source:Araport11) |
AT2G33170 | Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11) |
AT5G54145 | hypothetical protein;(source:Araport11) |
AT1G31485 | Natural antisense transcript overlaps with AT1G31490;(source:Araport11) |
AT1G47278 | hypothetical protein;(source:Araport11) |
AT1G64130 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT5G19920 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G17000 | neurofilament heavy protein;(source:Araport11) |
AT3G05080 | hypothetical protein;(source:Araport11) |
AT2G06914 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32775.1);(source:TAIR10) |
AT1G10750 | carboxyl-terminal peptidase, putative (DUF239);(source:Araport11) |
AT4G12370 | F-box/kelch-repeat protein;(source:Araport11) |
AT1G05430 | Hypothetical protein, expression induced by Al. |
AT5G37240 | hypothetical protein;(source:Araport11) |
AT1G71695 | Peroxidase superfamily protein;(source:Araport11) |
AT2G47280 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT4G03912 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G21245 | Protein kinase superfamily protein;(source:Araport11) |
AT5G06180 | fission ELM1-like protein (DUF1022);(source:Araport11) |
AT5G59330 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT3G03560 | hypothetical protein;(source:Araport11) |
AT3G45110 | hypothetical protein;(source:Araport11) |
AT3G58360 | TRAF-like family protein;(source:Araport11) |
AT1G34510 | Peroxidase superfamily protein;(source:Araport11) |
AT3G26760 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G14640 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
AT2G42390 | kinase C substrate, heavy chain-like protein;(source:Araport11) |
AT2G25130 | ARM repeat superfamily protein;(source:Araport11) |
AT1G52060 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT1G44020 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G11190 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT4G18820 | AAA-type ATPase family protein;(source:Araport11) |
AT1G25430 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 8.0e-45 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G03510 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
AT4G19460 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G08810 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G33386 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative retroelement pol polyprotein;(source:TAIR10) |
AT1G55700 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G48350 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT3G42550 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT5G66590 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
AT4G17940 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G64150 | RNA methyltransferase family protein;(source:Araport11) |
AT2G28320 | Pleckstrin homology (PH) and lipid-binding START domains-containing protein;(source:Araport11) |
AT1G62480 | Vacuolar calcium-binding protein-like protein;(source:Araport11) |
AT3G46370 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G29103 | transmembrane protein;(source:Araport11) |
AT3G52220 | leukocyte immunoglobulin-like receptor family A protein;(source:Araport11) |
AT1G72410 | COP1-interacting protein-like protein;(source:Araport11) |
AT4G16010 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-185 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT5G06990 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT1G80610 | hypothetical protein;(source:Araport11) |
AT4G08874 | transmembrane protein;(source:Araport11) |
AT4G10130 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT1G48090 | calcium-dependent lipid-binding family protein;(source:Araport11) |
AT5G57400 | transmembrane protein;(source:Araport11) |
AT3G51190 | Ribosomal protein L2 family;(source:Araport11) |
AT1G47300 | F-box family protein;(source:Araport11) |
AT5G35800 | transposable_element_gene;(source:Araport11);pseudogene, similar to simiar to ribosomal protein, similar to unknown protein (gb|AAD32760.1);(source:TAIR10) |
AT2G15910 | CSL zinc finger domain-containing protein;(source:Araport11) |
AT4G15955 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G44000 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-07 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT1G63850 | BTB/POZ domain-containing protein;(source:Araport11) |
AT3G27640 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G13380 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.1e-234 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT3G27090 | DCD (Development and Cell Death) domain protein;(source:Araport11) |
AT1G68160 | ZZ-type zinc finger protein, putative (DUF3755);(source:Araport11) |
AT1G64590 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G17850 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
AT5G18210 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G10150 | Carbohydrate-binding protein;(source:Araport11) |
AT2G15440 | polysaccharide biosynthesis protein (DUF579);(source:Araport11) |
AT4G21170 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G40960 | transmembrane protein, putative (DUF 3339);(source:Araport11) |
AT1G26430 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
AT1G48745 | hypothetical protein;(source:Araport11) |
AT5G19420 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
AT1G43660 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G48290.1);(source:TAIR10) |
AT1G77525 | defensin-like protein;(source:Araport11) |
AT3G29620 | transposable_element_gene;(source:Araport11);transposase IS4 family protein, contains Pfam profile: PF01609 transposase DDE domain;(source:TAIR10) |
AT1G63750 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT2G34280 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT5G35413 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.6e-41 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G28260 | acyl-UDP-N-acetylglucosamine O-acyltransferase;(source:Araport11) |
AT5G16920 | Fasciclin-like arabinogalactan family protein;(source:Araport11) |
AT1G34160 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G54355 | Natural antisense transcript overlaps with AT1G54350;(source:Araport11) |
AT5G12300 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT5G49950 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G40350 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
AT3G18600 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G36200 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.7e-150 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10) |
AT1G07680 | transmembrane protein;(source:Araport11) |
AT3G43230 | RING/FYVE/PHD-type zinc finger family protein;(source:Araport11) |
AT4G17140 | pleckstrin homology (PH) domain-containing protein;(source:Araport11) |
AT4G33290 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G20085 | similarity to Retrotransposon - like protein (Copia-like retroelement pol polyprotein-like). |
AT1G44130 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G04392 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.7e-51 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT5G43040 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G46192 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 7.4e-69 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G08035 | other_RNA;(source:Araport11) |
AT5G55610 | isopentenyl-diphosphate delta-isomerase;(source:Araport11) |
AT3G46260 | kinase-like protein;(source:Araport11) |
AT2G26780 | ARM repeat superfamily protein;(source:Araport11) |
AT4G17098 | Natural antisense transcript overlaps with AT4G17100;(source:Araport11) |
AT3G05675 | BTB/POZ domain-containing protein;(source:Araport11) |
AT4G37620 | transposable_element_gene;(source:Araport11);similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT4G09490.1);(source:TAIR10) |
AT4G33945 | ARM repeat superfamily protein;(source:Araport11) |
AT1G66830 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G67300 | Major facilitator superfamily protein;(source:Araport11) |
AT5G24316 | proline-rich family protein;(source:Araport11) |
AT2G43530 | Encodes a defensin-like (DEFL) family protein. The mRNA is cell-to-cell mobile. |
AT4G35030 | Protein kinase superfamily protein;(source:Araport11) |
AT1G42590 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G00467 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT2G20150 | hypothetical protein;(source:Araport11) |
AT5G67010 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT1G68875 | hypothetical protein;(source:Araport11) |
AT3G49350 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT5G05030 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT5G40630 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT1G14460 | AAA-type ATPase family protein;(source:Araport11) |
AT5G18730 | DNAJ heat shock amino-terminal domain protein;(source:Araport11) |
AT2G03350 | DUF538 family protein (Protein of unknown function, DUF538);(source:Araport11) |
AT5G58200 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
AT5G41530 | transmembrane protein;(source:Araport11) |
AT5G59662 | Natural antisense transcript overlaps with AT5G59660;(source:Araport11) |
AT1G52155 | transmembrane protein;(source:Araport11) |
AT3G23910 | reverse transcriptase-like protein;(source:Araport11) |
AT1G23700 | Protein kinase superfamily protein;(source:Araport11) |
AT2G36090 | F-box family protein;(source:Araport11) |
AT1G52450 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT5G60930 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G54370 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
AT1G15730 | Cobalamin biosynthesis CobW-like protein;(source:Araport11) |
AT1G11340 | G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11) |
AT3G21330 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G33170 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT2G11240 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.1e-38 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G47030 | Encodes the mitochondrial ATP synthase subunit delta. |
AT1G17510 | hypothetical protein;(source:Araport11) |
AT4G33700 | CBS domain protein (DUF21);(source:Araport11) |
AT5G28850 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT5G47570 | NADH dehydrogenase ubiquinone 1 beta subcomplex subunit;(source:Araport11) |
AT1G59570 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
AT1G21330 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G40680.1);(source:TAIR10) |
AT3G01860 | hypothetical protein;(source:Araport11) |
AT4G11300 | ROH1, putative (DUF793);(source:Araport11) |
AT1G54530 | Calcium-binding EF hand family protein;(source:Araport11) |
AT5G40645 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
AT2G43960 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
AT1G51120 | AP2/B3 transcription factor family protein;(source:Araport11) |
AT2G26520 | transmembrane protein;(source:Araport11) |
AT3G09505 | pre-tRNA tRNA-Arg (anticodon: TCG);(source:Araport11, TAIR10) |
AT1G03280 | Transcription factor TFIIE, alpha subunit;(source:Araport11) |
AT5G65520 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G56160 | Sodium Bile acid symporter family;(source:Araport11) |
AT5G65205 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G26110 | bromodomain protein (DUF761);(source:Araport11) |
AT4G13955 | Encodes a defensin-like (DEFL) family protein. |
AT4G04692 | pseudogene of expressed protein;(source:Araport11) |
AT1G77765 | transmembrane protein;(source:Araport11) |
AT2G39320 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT4G34035 | pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10) |
AT5G26350 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G33393.1);(source:TAIR10) |
AT1G22140 | zinc finger CCCH domain protein;(source:Araport11) |
AT2G13463 | hypothetical protein;(source:Araport11) |
AT2G36680 | Modifier of rudimentary (Mod(r)) protein;(source:Araport11) |
AT1G15860 | defective in cullin neddylation protein (DUF298);(source:Araport11) |
AT5G49960 | ion channel protein;(source:Araport11) |
AT2G12000 | transposable_element_gene;(source:Araport11);pseudogene, fragment of a MADS-box protein;(source:TAIR10) |
AT1G55546 | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase;(source:Araport11) |
AT2G36255 | Encodes a defensin-like (DEFL) family protein. |
AT1G31220 | N10-formyltetrahydrofolate-dependent phosphoribosylglycinamide formyltransferase that catalyzes the conversion of phosphoribosyl glycineamide to phosphoribosyl N-formylglycineamide |
AT4G31980 | PPPDE thiol peptidase family protein;(source:Araport11) |
AT1G42520 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 5.3e-69 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G33300 | chromosome-associated kinesin-like protein;(source:Araport11) |
AT1G72060 | serine-type endopeptidase inhibitor;(source:Araport11) |
AT5G48500 | pathogenic type III effector avirulence factor Avr AvrRpt-cleavage: cleavage site protein;(source:Araport11) |
AT5G10920 | L-Aspartase-like family protein;(source:Araport11) |
AT3G43890 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G03440 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT2G21237 | transmembrane protein;(source:Araport11) |
AT2G17280 | Phosphoglycerate mutase family protein;(source:Araport11) |
AT5G08480 | VQ motif-containing protein;(source:Araport11) |
AT2G02910 | transmembrane protein (DUF616);(source:Araport11) |
AT4G11730 | Cation transporter/ E1-E2 ATPase family protein;(source:Araport11) |
AT1G24060 | hypothetical protein;(source:Araport11) |
AT5G35688 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT2G15029 | hypothetical protein;(source:Araport11) |
AT3G63320 | Protein phosphatase 2C family protein;(source:Araport11) |
AT1G23560 | OBP32pep, putative (DUF220);(source:Araport11) |
AT1G31430 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT2G43610 | Chitinase family protein;(source:Araport11) |
AT1G65940 | pseudogene of Dof-type zinc finger domain-containing protein;(source:Araport11) |
AT3G50730 | Protein kinase superfamily protein;(source:Araport11) |
AT1G71480 | Nuclear transport factor 2 (NTF2) family protein;(source:Araport11) |
AT4G33910 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT1G58248 | Encodes a Plant thionin family protein |
AT5G19170 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT3G57110 | exonuclease V;(source:Araport11) |
AT2G07100 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.2e-42 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT5G47360 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G04235 | hypothetical protein;(source:Araport11) |
AT1G51860 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G30740 | QWRF motif protein;(source:Araport11) |
AT2G35170 | Histone H3 K4-specific methyltransferase SET7/9 family protein;(source:Araport11) |
AT3G26486 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G21620 | glycine-rich protein;(source:Araport11) |
AT4G36970 | Remorin family protein;(source:Araport11) |
AT3G21940 | Receptor protein kinase-like protein;(source:Araport11) |
AT1G14590 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
AT5G42232 | Encodes a defensin-like (DEFL) family protein. |
AT3G43715 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
AT2G31425 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT2G41905 | transmembrane protein;(source:Araport11) |
AT1G43140 | Cullin family protein;(source:Araport11) |
AT2G46995 | hypothetical protein;(source:Araport11) |
AT2G46420 | helicase with zinc finger protein;(source:Araport11) |
AT1G10490 | GNAT acetyltransferase (DUF699);(source:Araport11) |
AT2G36410 | transcriptional activator (DUF662);(source:Araport11) |
AT3G31317 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.9e-32 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G18661 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT2G13710 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 3.3e-55 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
AT3G63220 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G77885 | hypothetical protein;(source:Araport11) |
AT1G14210 | Ribonuclease T2 family protein;(source:Araport11) |
AT2G42460 | MATH domain/coiled-coil protein;(source:Araport11) |
AT1G01250 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
AT3G02910 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
AT2G13180 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.1e-23 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT1G69020 | Prolyl oligopeptidase family protein;(source:Araport11) |
AT3G14820 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G79570 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
AT4G28570 | Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11) |
AT3G60910 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G75230 | DNA glycosylase superfamily protein;(source:Araport11) |
AT1G11362 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT2G41890 | curculin-like (mannose-binding) lectin family protein / PAN domain-containing protein;(source:Araport11) |
AT1G51520 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G11911 | STAY-GREEN-like protein;(source:Araport11) |
AT1G33785 | pseudogene of photosynthetic electron transfer B;(source:Araport11) |
AT1G45015 | MD-2-related lipid recognition domain-containing protein;(source:Araport11) |
AT3G47100 | hypothetical protein;(source:Araport11) |
AT4G07380 | hypothetical protein;(source:Araport11) |
AT3G48220 | F-box protein;(source:Araport11) |
AT3G26742 | hypothetical protein;(source:Araport11) |
AT3G48515 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT4G22900 | transmembrane protein, putative (DUF1191);(source:Araport11) |
AT2G19210 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
AT2G10608 | transmembrane protein;(source:Araport11) |
AT1G12660 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant thionin (PR-13) family with the following members: At1g66100, At5g36910, At1g72260, At2g15010, At1g12663, At1g12660. |
AT3G42714 | transposable_element_gene;(source:Araport11);pseudogene, similar to unnamed protein product, similar to putative helicase;(source:TAIR10) |
AT1G01225 | NC domain-containing protein-like protein;(source:Araport11) |
AT2G17600 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G22380 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
AT1G24265 | bZIP transcription factor, putative (DUF1664);(source:Araport11) |
AT4G19800 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
AT4G00905 | NC domain-containing protein-like protein;(source:Araport11) |
AT2G30050 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT1G10865 | cytochrome C oxidase assembly factor;(source:Araport11) |
AT5G05200 | Protein kinase superfamily protein;(source:Araport11) |
AT2G36470 | DUF868 family protein, putative (DUF868);(source:Araport11) |
AT2G34760 | pseudogene of tubulin beta-9 chain;(source:Araport11) |
AT5G53020 | Ribonuclease P protein subunit P38-like protein;(source:Araport11) |
AT1G36650 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, blastp match of 26%25 identity and 8.3e-12 P-value to GP|20279456|gb|AAM18736.1|AC092548_14|AC092548 putative reverse transcriptase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT4G03950 | Nucleotide/sugar transporter family protein;(source:Araport11) |
AT2G03240 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT5G44020 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
AT3G19663 | hypothetical protein;(source:Araport11) |
AT5G52540 | keratin-associated protein, putative (DUF819);(source:Araport11) |
AT3G10185 | Encodes a Gibberellin-regulated GASA/GAST/Snakin family protein |
AT2G14370 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.2e-116 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT3G42796 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-31 P-value blast match to reverse transcriptase (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G04930 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G44740 | hypothetical protein;(source:Araport11) |
AT1G29320 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G09170 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
AT3G28958 | Cupredoxin superfamily protein;(source:Araport11) |
AT4G19950 | polyadenylate-binding protein 1-B-binding protein;(source:Araport11) |
AT5G54095 | proteoglycan-like protein;(source:Araport11) |
AT1G80120 | LURP-one-like protein (DUF567);(source:Araport11) |
AT1G35830 | VQ motif-containing protein;(source:Araport11) |
AT3G44280 | peptidyl-prolyl cis-trans isomerase G;(source:Araport11) |
AT5G59860 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G58400 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
AT1G66060 | hypothetical protein (DUF577);(source:Araport11) |
AT1G69550 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
AT5G28641 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.3e-21 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G07565 | histone H2A deubiquitinase (DUF3755);(source:Araport11) |
AT2G03960 | pseudogene of hypothetical protein (DUF239);(source:Araport11) |
AT1G47640 | seven transmembrane domain protein;(source:Araport11) |
AT4G11340 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G22470 | Hypothetical protein;(source:Araport11). Target of SR45. |
AT1G21800 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
AT1G53780 | 26S proteasome regulatory complex ATPase;(source:Araport11) |
AT2G31985 | lipoprotein (DUF1264);(source:Araport11) |
AT5G18750 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT1G20875 | hypothetical protein;(source:Araport11) |
AT2G19360 | tRNA-splicing ligase, putative (DUF239);(source:Araport11) |
AT4G17440 | chromogranin (DUF1639);(source:Araport11) |
AT5G45520 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT1G23040 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT2G14605 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.9e-29 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
AT4G02140 | hypothetical protein;(source:Araport11) |
AT4G31860 | Protein phosphatase 2C family protein;(source:Araport11) |
AT3G62050 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
AT5G05310 | TLC ATP/ADP transporter;(source:Araport11) |
AT4G11410 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G60700 | glycosyltransferase family protein 2;(source:Araport11) |
AT2G23834 | hypothetical protein;(source:Araport11) |
AT4G32420 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT4G10530 | Subtilase family protein;(source:Araport11) |
AT2G13895 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G04180 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.6e-05 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G57830 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G07336 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 7.8e-10 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G26090 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
AT4G27900 | CCT motif family protein;(source:Araport11) |
AT3G58230 | Ubiquitin-specific protease family C19-related protein;(source:Araport11) |
AT5G55060 | Rab3 GTPase-activating protein catalytic subunit;(source:Araport11) |
AT3G49190 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
AT5G56880 | hypothetical protein;(source:Araport11) |
AT1G11990 | O-fucosyltransferase family protein;(source:Araport11) |
AT2G03565 | hypothetical protein;(source:Araport11) |
AT5G09290 | Inositol monophosphatase family protein;(source:Araport11) |
AT2G07550 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-313 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G15260 | ribosomal protein L34e superfamily protein;(source:Araport11) |
AT4G00750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT2G31480 | hypothetical protein;(source:Araport11) |
AT1G53420 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
AT1G21500 | hypothetical protein;(source:Araport11) |
AT2G41960 | hypothetical protein;(source:Araport11) |
AT2G20460 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT4G23840 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT4G22050 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G53470 | 2,3-bisphosphoglycerate-independent phosphoglycerate mutase;(source:Araport11) |
AT2G44710 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G09863 | hypothetical protein;(source:Araport11) |
AT2G14700 | hypothetical protein;(source:Araport11) |
AT1G22110 | structural constituent of ribosome;(source:Araport11) |
AT5G19190 | hypothetical protein;(source:Araport11) |
AT3G46910 | Cullin family protein;(source:Araport11) |
AT5G36010 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G52410.1);(source:TAIR10) |
AT1G47350 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT5G44860 | polyadenylate-binding protein 1-B-binding protein;(source:Araport11) |
AT2G33140 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
AT2G02430 | pseudogene of Arginyl-tRNA synthetase;(source:Araport11) |
AT3G21540 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT4G32000 | Protein kinase superfamily protein;(source:Araport11) |
AT2G42150 | DNA-binding bromodomain-containing protein;(source:Araport11) |
AT3G06280 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT5G65660 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G50175 | transmembrane protein;(source:Araport11) |
AT4G00305 | RING/U-box superfamily protein;(source:Araport11) |
AT5G26270 | transmembrane protein;(source:Araport11) |
AT3G56460 | GroES-like zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
AT4G08510 | mediator of RNA polymerase II transcription subunit-like protein;(source:Araport11) |
AT3G15470 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G49870 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT3G17020 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT1G74250 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT1G80960 | F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT3G42922 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to Mutator-like transposase;(source:TAIR10) |
AT3G42460 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G05570.1);(source:TAIR10) |
AT2G39795 | Mitochondrial glycoprotein family protein;(source:Araport11) |
AT1G60590 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G23690 | hypothetical protein (Domain of unknown function DUF220);(source:Araport11) |
AT1G64340 | Serine/Threonine-kinase;(source:Araport11) |
AT5G09270 | transmembrane protein;(source:Araport11) |
AT1G68620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G44175 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT1G79720 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G70270 | transcription factor;(source:Araport11) |
AT3G58660 | Ribosomal protein L1p/L10e family;(source:Araport11) |
AT3G59250 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G63040 | hypothetical protein;(source:Araport11) |
AT4G32765 | pre-tRNA tRNA-Ser (anticodon: CGA);(source:Araport11, TAIR10) |
AT5G27550 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G10116 | COBRA-like extracellular glycosyl-phosphatidyl inositol-anchored protein family;(source:Araport11) |
AT4G14280 | ARM repeat superfamily protein;(source:Araport11) |
AT5G55010 | hypothetical protein;(source:Araport11) |
AT5G26717 | Encodes a Plant thionin family protein |
AT5G63940 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT2G37290 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT2G12040 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 4.5e-96 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT4G36000 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT2G24615 | Encodes a defensin-like (DEFL) family protein. |
AT4G15430 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
AT1G10410 | CW14 protein (DUF1336);(source:Araport11) |
AT5G03858 | Pseudogene of AT5G03960; IQD12 (IQ-domain 12); calmodulin binding protein |
AT2G06870 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.3e-49 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT3G49310 | Major facilitator superfamily protein;(source:Araport11) |
AT3G47295 | hypothetical protein;(source:Araport11) |
AT5G11660 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT1G78265 | Natural antisense transcript overlaps with AT1G78270;(source:Araport11) |
AT2G06950 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-243 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT2G46320 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT5G57970 | DNA glycosylase superfamily protein;(source:Araport11) |
AT3G23360 | Protein phosphatase 2C family protein;(source:Araport11) |
AT2G43620 | Chitinase family protein;(source:Araport11) |
AT1G06240 | diiron containing four-helix bundle family ferritin protein, putative (Protein of unknown function DUF455);(source:Araport11) |
AT4G39570 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT3G26730 | RING/U-box superfamily protein;(source:Araport11) |
AT1G48145 | plant mobile domain protein;(source:Araport11) |
AT5G26286 | pseudogene of TRAF-like family protein;(source:Araport11) |
AT5G27340 | hypothetical protein;(source:Araport11) |
AT5G61445 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT4G31890 | ARM repeat superfamily protein;(source:Araport11) |
AT3G53403 | Pseudogene of AT3G53410; zinc finger (C3HC4-type RING finger) family protein |
AT2G25690 | DUF581 family protein, putative (DUF581);(source:Araport11) |
AT2G30710 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT1G28630 | transcriptional regulator EFH1-like protein;(source:Araport11) |
AT3G58320 | Ubiquitin-specific protease family C19-related protein;(source:Araport11) |
AT5G13980 | Glycosyl hydrolase family 38 protein;(source:Araport11) |
AT5G23400 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT3G55060 | CAP-gly domain linker;(source:Araport11) |
AT2G12408 | pseudogene of zinc knuckle (CCHC-type) family protein |
AT3G55900 | F-box family protein;(source:Araport11) |
AT3G51750 | hypothetical protein;(source:Araport11) |
AT1G76955 | Expressed protein;(source:Araport11) |
AT5G38510 | Rhomboid-related intramembrane serine protease family protein;(source:Araport11) |
AT5G28262 | other_RNA;(source:Araport11) |
AT4G40065 | other_RNA;(source:Araport11) |
AT2G15670 | transmembrane protein;(source:Araport11) |
AT1G18810 | phytochrome kinase substrate-like protein;(source:Araport11) |
AT1G21670 | DPP6 amino-terminal domain protein;(source:Araport11) |
AT4G01090 | Hypothetical protein; participates in wound-induced lateral root development. |
AT4G33440 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G40089 | pseudogene of fructose-2;(source:Araport11) |
AT3G53430 | Ribosomal protein L11 family protein;(source:Araport11) |
AT1G28350 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
AT3G62570 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G20300 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G41761 | other_RNA;(source:Araport11) |
AT1G15900 | transmembrane protein;(source:Araport11) |
AT5G25360 | hypothetical protein;(source:Araport11) |
AT1G12120 | hypothetical protein (DUF863);(source:Araport11) |
AT1G56165 | Natural antisense transcript overlaps with AT1G56160;(source:Araport11) |
AT1G12150 | weak chloroplast movement under blue light protein (DUF827);(source:Araport11) |
AT3G25090 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT1G45100 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G35710 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.5e-48 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
AT1G11440 | hypothetical protein;(source:Araport11) |
AT1G29020 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT4G00350 | MATE efflux family protein;(source:Araport11) |
AT1G01840 | AP2-like ethylene-responsive transcription factor SNZ;(source:Araport11) |
AT5G67488 | Natural antisense transcript overlaps with AT5G67490;(source:Araport11) |
AT1G19420 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G60420 | phosphoglycerate mutase family protein;(source:Araport11) |
AT3G30110 | pseudogene of DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
AT1G29640 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT4G02655 | transmembrane protein;(source:Araport11) |
AT1G03960 | Calcium-binding EF hand family protein;(source:Araport11) |
AT5G62780 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT3G02160 | Bromodomain transcription factor;(source:Araport11) |
AT4G37570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G52410.1);(source:TAIR10) |
AT3G11860 | sterile alpha motif (SAM) domain protein;(source:Araport11) |
AT1G73210 | hypothetical protein (DUF789);(source:Araport11) |
AT4G14368 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT4G03113 | transmembrane protein;(source:Araport11) |
AT3G54750 | downstream neighbor of Son;(source:Araport11) |
AT3G52480 | transmembrane protein;(source:Araport11) |
AT3G07000 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G28305 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT2G05220 | Ribosomal S17 family protein;(source:Araport11) |
AT5G35475 | General transcription factor 2-related zinc finger protein;(source:Araport11) |
AT1G62680 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G17908 | pseudogene of ubiquitin-specific protease |
AT4G35680 | selection/upkeep of intraepithelial T-cells protein;(source:Araport11) |
AT1G53690 | Protein of unknown function that is homologous to At5g41010, which encodes a non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB12. |
AT1G01970 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G22550 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT2G34123 | Encodes a defensin-like (DEFL) family protein. |
AT1G18980 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT1G77520 | O-methyltransferase family protein;(source:Araport11) |
AT1G54500 | RBD1 is a thylakoid membrane-bound iron-binding protein that is required for the proper assembly of photosystem II in Arabidopsis. It is found in all oxygenic photoautotrophic organisms (plants, algae and cyanobacteria). |
AT5G22100 | RNA cyclase family protein;(source:Araport11) |
AT1G33160 | pseudogene of actin 7;(source:Araport11) |
AT4G08520 | SNARE-like superfamily protein;(source:Araport11) |
AT3G42100 | transposable_element_gene;(source:Araport11);similar to AT hook motif-containing protein-related [Arabidopsis thaliana] (TAIR:AT1G35940.1);(source:TAIR10) |
AT3G50910 | netrin receptor DCC;(source:Araport11) |
AT2G29660 | zinc finger (C2H2 type) family protein;(source:Araport11) |
AT5G63990 | Inositol monophosphatase family protein;(source:Araport11) |
AT1G05950 | hypothetical protein;(source:Araport11) |
AT5G26330 | Cupredoxin superfamily protein;(source:Araport11) |
AT4G31130 | keratin-associated protein (DUF1218);(source:Araport11) |
AT4G39190 | nucleolar-like protein;(source:Araport11) |
AT1G80720 | Mitochondrial glycoprotein family protein;(source:Araport11) |
AT2G16960 | ARM repeat superfamily protein;(source:Araport11) |
AT4G13030 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G26610 | C2H2-like zinc finger protein;(source:Araport11) |
AT4G02230 | Ribosomal protein L19e family protein;(source:Araport11) |
AT3G11720 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT5G40900 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
AT2G19060 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
AT3G25670 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT5G16900 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G24430 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT3G45690 | Encodes a member of the NAXT NPF subfamily. |
AT5G44065 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT3G28193 | transmembrane protein;(source:Araport11) |
AT2G43745 | jacalin lectin-like protein;(source:Araport11) |
AT1G29780 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G67020 | transmembrane protein;(source:Araport11) |
AT3G49055 | ATP-binding protein;(source:Araport11) |
AT1G06470 | Nucleotide/sugar transporter family protein;(source:Araport11) |
AT1G69680 | ran guanine nucleotide release factor, putative (Mog1/PsbP/DUF1795-like photosystem II reaction center PsbP family protein);(source:Araport11) |
AT4G16800 | 3-methylglutaconyl-CoA hydratase localized to mitochondria. Knockout displays accelerated senescence when subjected to extended dark conditions;knockout senescing leaves and knockout seeds accumulate leu, ile, and val. |
AT1G34150 | Pseudouridine synthase family protein;(source:Araport11) |
AT1G10050 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
AT1G24405 | hypothetical protein;(source:Araport11) |
AT3G28855 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G28990 | RNA-binding protein-like protein;(source:Araport11) |
AT4G30993 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
AT5G08690 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. The mRNA is cell-to-cell mobile. |
AT4G07595 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G46320 | Mutants accumulate proline in response to drought. Potential QTL for drought tolerance. |
AT5G20310 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT5G08200 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
AT1G58050 | RNA helicase family protein;(source:Araport11) |
AT1G51172 | hypothetical protein;(source:Araport11) |
AT3G23300 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G38760 | nucleoporin (DUF3414);(source:Araport11) |
AT1G20820 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT2G02490 | transmembrane protein;(source:Araport11) |
AT3G51710 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11) |
AT1G66010 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT5G29015 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.3e-121 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
AT5G36223 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT2G36885 | translation initiation factor;(source:Araport11) |
AT4G16580 | Protein phosphatase 2C family protein;(source:Araport11) |
AT4G14746 | neurogenic locus notch-like protein;(source:Araport11) |
AT1G48400 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT4G17310 | hypothetical protein;(source:Araport11) |
AT4G32480 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
AT2G01360 | pentatricopeptide (PPR) repeat protein;(source:Araport11) |
AT1G64870 | hypothetical protein;(source:Araport11) |
AT1G52550 | transmembrane protein;(source:Araport11) |
AT3G19595 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G70380 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT5G35337 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G73750 | alpha/beta hydrolase family protein;(source:Araport11) |
AT5G02830 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G26500 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G08610 | NADH dehydrogenase ubiquinone 1 alpha subcomplex subunit;(source:Araport11) |
AT1G15740 | Leucine-rich repeat family protein;(source:Araport11) |
AT3G01961 | hypothetical protein;(source:Araport11) |
AT4G18080 | transmembrane protein;(source:Araport11) |
AT2G36200 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G03430 | phosphoadenosine phosphosulfate (PAPS) reductase family protein;(source:Araport11) |
AT1G12810 | proline-rich family protein;(source:Araport11) |
AT3G08020 | PHD finger family protein;(source:Araport11) |
AT4G30940 | BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11) |
AT5G08695 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G44940 | enabled-like protein (DUF1635);(source:Araport11) |
AT1G07700 | Thioredoxin superfamily protein;(source:Araport11) |
AT1G60750 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT1G06690 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT1G15970 | DNA glycosylase superfamily protein;(source:Araport11) |
AT1G56423 | hypothetical protein;(source:Araport11) |
AT4G04404 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
AT3G57470 | Insulinase (Peptidase family M16) family protein;(source:Araport11) |
AT2G20820 | hypothetical protein;(source:Araport11) |
AT2G12330 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.1e-219 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G12410 | THUMP domain-containing protein;(source:Araport11) |
AT3G43546 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.5e-10 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G29150 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G19500 | nucleoside-triphosphatase/transmembrane receptor/nucleotide binding/ATP binding protein;(source:Araport11) |
AT1G11540 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
AT1G47570 | RING/U-box superfamily protein;(source:Araport11) |
AT3G51090 | coiled-coil 90B-like protein (DUF1640);(source:Araport11) |
AT2G01460 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G44820 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
AT3G07570 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11) |
AT1G58130 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT4G25170 | Uncharacterized conserved protein (UCP012943);(source:Araport11) |
AT5G25210 | hypothetical protein;(source:Araport11) |
AT3G19120 | PIF / Ping-Pong family of plant transposase;(source:Araport11) |
AT1G17232 | Natural antisense transcript overlaps with AT1G17230;(source:Araport11) |
AT1G06880 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
AT3G44420 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G16267 | Encodes a Plant thionin family protein [pseudogene] |
AT2G36920 | B3 domain protein;(source:Araport11) |
AT1G10380 | Putative membrane lipoprotein;(source:Araport11) |
AT3G54070 | LOW protein: ankyrin repeat protein;(source:Araport11) |
AT4G04545 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT3G09170.1);(source:TAIR10) |
AT2G38800 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
AT1G65481 | transmembrane protein;(source:Araport11) |
AT2G22122 | hypothetical protein;(source:Araport11) |
AT5G50310 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G65032 | COMPLEX 1 LYR-like protein;(source:Araport11) |
AT1G74050 | Ribosomal protein L6 family protein;(source:Araport11) |
AT2G37035 | transmembrane protein;(source:Araport11) |
AT3G14700 | SART-1 family;(source:Araport11) |
AT3G54290 | hemerythrin HHE cation-binding domain protein;(source:Araport11) |
AT5G37750 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT4G00170 | Plant VAMP (vesicle-associated membrane protein) family protein;(source:Araport11) |
AT3G49640 | Aldolase-type TIM barrel family protein;(source:Araport11) |
AT2G40200 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G30974 | Encodes a Plant thionin family protein |
AT1G01270 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
AT2G16990 | Major facilitator superfamily protein;(source:Araport11) |
AT1G43120 | pseudogene of Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G51650 | ATP synthase epsilon chain;(source:Araport11) |
AT4G04316 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 9.6e-40 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G05525 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
AT5G38440 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT1G72080 | hypothetical protein;(source:Araport11) |
AT5G28892 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, blastp match of 40%25 identity and 7.3e-142 P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT4G33820 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT5G49990 | Xanthine/uracil permease family protein;(source:Araport11) |
AT1G32700 | PLATZ transcription factor family protein;(source:Araport11) |
AT1G49750 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT4G32130 | ER membrane protein complex subunit-like protein (DUF2012);(source:Araport11) |
AT1G40081 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains similarity to hypothetical proteins from Arabidopsis.;(source:TAIR10) |
AT5G37795 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
AT5G54090 | DNA mismatch repair protein MutS, type 2;(source:Araport11) |
AT2G32160 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G00920 | COP1-interacting protein-like protein;(source:Araport11) |
AT3G21910 | cysteine-rich repeat secretory protein, putative (DUF26);(source:Araport11) |
AT1G71970 | hypothetical protein;(source:Araport11) |
AT1G12890 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
AT3G26550 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G42210 | Major facilitator superfamily protein;(source:Araport11) |
AT3G58430 | MATH domain/coiled-coil protein;(source:Araport11) |
AT5G08310 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G01610 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT2G30830 | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
AT1G47625 | pseudogene of seven transmembrane domain protein |
AT1G12570 | Ortholog of maize IPE1 gene which is involved in pollen exine development. |
AT4G37920 | endoribonuclease E-like protein;(source:Araport11) |
AT3G57840 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT1G49740 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
AT3G13370 | formin-like protein;(source:Araport11) |
AT4G39380 | TSL-kinase interacting-like protein;(source:Araport11) |
AT5G41890 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT4G30830 | myosin-like protein (Protein of unknown function, DUF593);(source:Araport11) |
AT1G58460 | hypothetical protein;(source:Araport11) |
AT2G27900 | coiled-coil protein;(source:Araport11) |
AT5G52882 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G52260 | Pseudouridine synthase family protein;(source:Araport11) |
AT4G02090 | PADRE protein. |
AT5G46820 | carboxyl-terminal proteinase-like protein, putative (DUF239);(source:Araport11) |
AT4G31330 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
AT5G36190 | F-box protein interaction domain protein;(source:Araport11) |
AT1G09440 | Protein kinase superfamily protein;(source:Araport11) |
AT2G13770 | nuclease;(source:Araport11) |
AT1G14770 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT2G07788 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 6.5e-221 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT2G11320 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, blastp match of 41%25 identity and 1.7e-199 P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT1G52360 | Coatomer, beta subunit;(source:Araport11) |
AT3G04150 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT1G08940 | Phosphoglycerate mutase family protein;(source:Araport11) |
AT5G45480 | transmembrane protein, putative (DUF594);(source:Araport11) |
AT5G46115 | hypothetical protein;(source:Araport11) |
AT2G10120 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-18 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT2G23985 | hypothetical protein;(source:Araport11) |
AT1G68905 | Encodes a defensin-like (DEFL) family protein. |
AT2G31945 | transmembrane protein;(source:Araport11) |
AT5G37150 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G44250 | peptidase, S9A/B/C family, catalytic domain protein (Protein of unknown function DUF829, transmembrane 53);(source:Araport11) |
AT5G54150 | hypothetical protein;(source:Araport11) |
AT3G20430 | phosphorylated adapter RNA export-like protein;(source:Araport11) |
AT3G27865 | snoRNA;(source:Araport11) |
AT1G17390 | transposable_element_gene;(source:Araport11);similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT5G36905.1);(source:TAIR10) |
AT1G58170 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT5G27880 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
AT3G47660 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT2G03932 | Encodes a defensin-like (DEFL) family protein. |
AT3G23350 | ENTH/VHS family protein;(source:Araport11) |
AT1G67430 | Ribosomal protein L22p/L17e family protein;(source:Araport11) |
AT2G45710 | Zinc-binding ribosomal protein family protein;(source:Araport11) |
AT4G39195 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT2G30505 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT3G15810 | LURP-one-like protein (DUF567);(source:Araport11) |
AT1G25422 | hypothetical protein;(source:Araport11) |
AT4G13730 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT4G31520 | SDA1 family protein;(source:Araport11) |
AT5G05510 | Mad3/BUB1 homology region 1;(source:Araport11) |
AT4G14105 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G06700 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.7e-54 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
AT3G49140 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G74680 | Exostosin family protein;(source:Araport11) |
AT2G05171 | Pseudogene of AT3G18310 |
AT1G48680 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-298 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G53930 | transcriptional regulator ATRX-like protein;(source:Araport11) |
AT4G25433 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
AT2G42710 | Ribosomal protein L1p/L10e family;(source:Araport11) |
AT2G33255 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT4G08022 | pseudogene of ECA1 gametogenesis family protein (DUF784);(source:Araport11) |
AT5G01700 | Protein phosphatase 2C family protein;(source:Araport11) |
AT4G14103 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT2G09994 | pseudogene of U-box domain-containing protein / armadillo/beta-catenin repeat family protein |
AT5G48900 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G25820 | Exostosin family protein;(source:Araport11) |
AT1G04230 | rRNA-processing EFG1-like protein (DUF2361);(source:Araport11) |
AT1G07280 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G59950 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT2G01680 | Ankyrin repeat family protein;(source:Araport11) |
AT1G34545 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.0e-112 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT3G22410 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT2G18193 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G06640 | PAS domain-containing protein tyrosine kinase family protein;(source:Araport11) |
AT5G02940 | ion channel POLLUX-like protein, putative (DUF1012);(source:Araport11) |
AT4G26375 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
AT1G78922 | transmembrane protein;(source:Araport11) |
AT3G02750 | Protein phosphatase 2C family protein;(source:Araport11) |
AT4G26190 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT2G34670 | benzoyl-CoA reductase subunit C, putative (DUF630 and DUF632);(source:Araport11) |
AT5G15710 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT4G19452 | pseudogene of F-box family protein |
AT3G57020 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT2G43560 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT5G23340 | RNI-like superfamily protein;(source:Araport11) |
AT1G53180 | hypothetical protein;(source:Araport11) |
AT1G36936 | transposable_element_gene;(source:Araport11);pseudogene, similar to Putative copia-type polyprotein, blastp match of 43%25 identity and 2.1e-28 P-value to GP|15209144|gb|AAK91877.1|AC091665_3|AC091665 Putative copia-type polyprotein {Oryza sativa};(source:TAIR10) |
AT5G04120 | Encodes a cofactor-dependent phosphoglycerate mutase (dPGM) - like protein with phosphoserine phosphatase activity that may be responsible for serine anabolism. |
AT5G48335 | hypothetical protein;(source:Araport11) |
AT2G22940 | hypothetical protein;(source:Araport11) |
AT1G19650 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT4G18180 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G26070 | Encodes a protein with 23.5% proline residues and proline-rich extensin domains, INTERPRO:IPR002965; similar to root nodule extensin (Pisum sativum) gi:15021750/gb:AAK77902; Common family members: At5g19800, At5g57070, At1g72790 (Arabidopsis thaliana) |
AT3G04545 | Encodes a defensin-like (DEFL) family protein. |
AT5G61400 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G54190 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G45340 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G12220 | hypothetical protein;(source:Araport11) |
AT2G43660 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT1G73066 | Leucine-rich repeat family protein;(source:Araport11) |
AT2G13295 | Encodes a Protease inhibitor/seed storage/LTP family protein |
AT3G13240 | hypothetical protein;(source:Araport11) |
AT2G05435 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.5e-19 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G24860 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G58640 | Mitogen activated protein kinase kinase kinase-like protein;(source:Araport11) |
AT3G54570 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
AT5G47210 | Hyaluronan / mRNA binding family;(source:Araport11) |
AT5G40348 | Natural antisense transcript overlaps with AT5G40350;(source:Araport11) |
AT2G36724 | transmembrane protein;(source:Araport11) |
AT3G02690 | Nucleotide/sugar transporter family protein |
AT1G79630 | Protein phosphatase 2C family protein;(source:Araport11) |
AT1G16360 | LEM3 (ligand-effect modulator 3) family protein / CDC50 family protein;(source:Araport11) |
AT3G06880 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G07090 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43920.1);(source:TAIR10) |
AT4G29905 | hypothetical protein;(source:Araport11) |
AT4G23915 | Encodes an alanine tRNA with the anticodon CGC that recognizes the alanine codon GCG. |
AT5G60380 | transmembrane protein, putative (DUF239);(source:Araport11) |
AT3G45510 | RING/U-box protein;(source:Araport11) |
AT3G56280 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
AT3G09100 | mRNA capping enzyme family protein;(source:Araport11) |
AT4G25330 | SAWADEE protein;(source:Araport11) |
AT5G54520 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G10405 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.3e-19 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
AT1G68410 | Protein phosphatase 2C family protein;(source:Araport11) |
AT3G30580 | hypothetical protein;(source:Araport11) |
AT1G31390 | TRAF-like family protein;(source:Araport11) |
AT1G03540 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT3G26040 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT1G65985 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT2G32235 | hypothetical protein;(source:Araport11) |
AT3G46911 | pseudogene of CUL4 (protein binding / ubiquitin-protein ligase) |
AT4G06599 | ubiquitin family protein;(source:Araport11) |
AT2G32785 | Encodes a Rapid ALkalinization Factor (RALF) family protein |
AT5G41980 | nuclease;(source:Araport11) |
AT1G75670 | DNA-directed RNA polymerase;(source:Araport11) |
AT1G65000 | F-box only protein;(source:Araport11) |
AT4G15000 | Ribosomal L27e protein family;(source:Araport11) |
AT5G22620 | encodes a putative 2-carboxy-D-arabinitol 1-phosphate phosphatase |
AT5G21070 | Fe(3+) dicitrate transport system permease;(source:Araport11) |
AT5G15010 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G58280 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT5G22850 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G33830 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
AT3G25870 | hypothetical protein;(source:Araport11) |
AT2G16380 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT5G53775 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.4e-39 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
AT4G13400 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT3G46616 | hypothetical protein;(source:Araport11) |
AT2G05632 | hypothetical protein;(source:Araport11) |
AT1G55750 | BSD domain (BTF2-like transcription factors, Synapse-associated proteins and DOS2-like proteins);(source:Araport11) |
AT5G50910 | hypothetical protein;(source:Araport11) |
AT3G53070 | Putative membrane lipoprotein;(source:Araport11) |
AT5G18900 | 2-oxoglutarate-dependent dioxygenase |
AT2G40316 | autophagy-like protein;(source:Araport11) |
AT5G60460 | Preprotein translocase Sec, Sec61-beta subunit protein;(source:Araport11) |
AT2G17460 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 5.5e-22 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT4G22490 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT5G35607 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 8.6e-07 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT5G23110 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
AT3G43291 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT2G16010 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G07630.1);(source:TAIR10) |
AT1G29620 | Cytochrome C oxidase polypeptide VIB family protein;(source:Araport11) |
AT1G22410 | Class-II DAHP synthetase family protein;(source:Araport11) |
AT3G47070 | thylakoid soluble phosphoprotein;(source:Araport11) |
AT5G08540 | ribosomal RNA small subunit methyltransferase J;(source:Araport11) |
AT4G29240 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT5G19485 | transferases/nucleotidyltransferase;(source:Araport11) |
AT2G14440 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G55430 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT1G28323 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.9e-140 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT5G55900 | Sucrase/ferredoxin-like family protein;(source:Araport11) |
AT2G42640 | Mitogen activated protein kinase kinase kinase-like protein;(source:Araport11) |
AT1G61080 | Hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT4G15960 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G08660 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT2G46220 | DUF2358 family protein (DUF2358);(source:Araport11) |
AT1G47405 | transposable_element_gene;(source:Araport11);pseudogene, similar to SAE1-S9-protein, similar to putative non-LTR retroelement reverse transcriptase GB:AAC63678 (Arabidopsis thaliana) from (;(source:TAIR10) |
AT1G18270 | ketose-bisphosphate aldolase class-II family protein;(source:Araport11) |
AT3G57500 | fission regulator-like protein;(source:Araport11) |
AT2G07710 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32410.2);(source:TAIR10) |
AT3G28412 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-08 P-value blast match to GB:AAC34906 reverse transcriptase (LINE-element) (Forficula auricularia);(source:TAIR10) |
AT5G39995 | pseudogene of myb domain protein 110;(source:Araport11) |
AT1G54920 | hypothetical protein;(source:Araport11) |
AT1G20065 | DNA-directed RNA polymerase I subunit RPA12-like protein;(source:Araport11) |
AT1G56418 | keratin-associated protein;(source:Araport11) |
AT1G67420 | Zn-dependent exopeptidases superfamily protein;(source:Araport11) |
AT3G25460 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G08580 | hypothetical protein;(source:Araport11) |
AT3G18530 | ARM repeat superfamily protein;(source:Araport11) |
AT1G80540 | envelope glycoprotein B;(source:Araport11) |
AT3G20555 | hypothetical protein;(source:Araport11) |
AT3G50580 | transmembrane protein;(source:Araport11) |
AT4G31960 | hypothetical protein;(source:Araport11) |
AT2G11630 | pseudogene of hAT transposon superfamily protein;(source:Araport11) |
AT5G19750 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
AT4G32750 | transmembrane protein;(source:Araport11) |
AT3G50200 | hypothetical protein (DUF247);(source:Araport11) |
AT5G28698 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.1e-28 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT3G54240 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G10015 | pre-tRNA tRNA-Leu (anticodon: TAA);(source:Araport11, TAIR10) |
AT3G58193 | snoRNA;(source:Araport11) |
AT1G23965 | transcription factor;(source:Araport11) |
AT5G43200 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
AT4G27100 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT5G34780 | Putative ketopantoate reductase (KPR). This enzyme is speculated to be the missing enzyme in the biosynthesis of pantothenate. |
AT3G52350 | D111/G-patch domain-containing protein;(source:Araport11) |
AT3G22100 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G68470 | Exostosin family protein;(source:Araport11) |
AT5G64270 | splicing factor;(source:Araport11) |
AT4G16040 | transmembrane protein;(source:Araport11) |
AT1G18960 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
AT2G29910 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT4G14250 | This locus is annotated as a protein-coding gene in TAIR10. Based on communication with Jean-Luc GALLOIS (April 2013), this gene is split into two UBX domain-containing pseudogenes: one retains the original name: AT4G14250 (Chr4:8213237..8211984), one given a new locus identifier AT4G14245 (Chr4:8210231..8208985). Note that the Map Detail Image on the locus detial page and in GBrowse will not be updated until after the next genome release. |
AT1G16040 | phosphatidylinositol-glycan biosynthesis class F-like protein;(source:Araport11) |
AT1G30290 | unknown protein |
AT2G44730 | Alcohol dehydrogenase transcription factor Myb/SANT-like family protein;(source:Araport11) |
AT2G36280 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT1G77855 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT5G40000 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G09820 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT4G23090 | transmembrane protein;(source:Araport11) |
AT2G25800 | elongation factor Ts (DUF810);(source:Araport11) |
AT4G36945 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
AT3G32425 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.5e-44 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT1G55770 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT3G54800 | Pleckstrin homology (PH) and lipid-binding START domains-containing protein;(source:Araport11) |
AT1G30940 | pseudogene of F-box family protein;(source:Araport11) |
AT2G35738 | Natural antisense transcript overlaps with AT2G35740;(source:Araport11) |
AT5G28165 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 3.1e-142 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10) |
AT5G36297 | pseudogene of aspartyl protease family protein |
AT3G02832 | other_RNA;(source:Araport11) |
AT3G09550 | Ankyrin repeat family protein;(source:Araport11) |
AT5G07430 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G33120 | Ribosomal protein L6 family;(source:Araport11) |
AT3G10780 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT1G76892 | Natural antisense transcript overlaps with AT1G76890;(source:Araport11) |
AT1G05840 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G17360 | LOW protein: protein phosphatase 1 regulatory subunit-like protein;(source:Araport11) |
AT1G19715 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT3G07230 | wound-responsive protein-like protein;(source:Araport11) |
AT1G61600 | DUF1262 family protein (DUF1262);(source:Araport11) |
AT3G13410 | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase;(source:Araport11) |
AT5G47530 | Auxin-responsive family protein;(source:Araport11) |
AT5G37650 | hypothetical protein (DUF577);(source:Araport11) |
AT1G75530 | Forkhead-associated (FHA) domain-containing protein;(source:Araport11) |
AT5G46105 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT3G15970 | NUP50 (Nucleoporin 50 kDa) protein;(source:Araport11) |
AT5G01175 | Natural antisense transcript overlaps with AT5G01180;(source:Araport11) |
AT5G50130 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G38396 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT1G20990 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G55560 | Protein kinase superfamily protein;(source:Araport11) |
AT4G10690 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-256 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT3G02080 | Ribosomal protein S19e family protein;(source:Araport11) |
AT5G10320 | ATP synthase subunit B;(source:Araport11) |
AT1G54095 | DUF1677 family protein, putative (DUF1677);(source:Araport11) |
AT3G21465 | adenylyl cyclase;(source:Araport11) |
AT4G26650 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G08505 | Encodes a defensin-like (DEFL) family protein. |
AT3G15680 | Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11) |
AT1G55550 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G36750 | Quinone reductase family protein;(source:Araport11) |
AT1G06420 | DNA ligase-like protein;(source:Araport11) |
AT3G55470 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT3G53040 | late embryogenesis abundant protein, putative / LEA protein;(source:Araport11) |
AT3G42875 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative transposase, similar to En/Spm-like transposon protein, putative;(source:TAIR10) |
AT5G35525 | PLAC8 family protein;(source:Araport11) |
AT3G57160 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
AT4G26810 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
AT1G67340 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
AT2G25964 | hypothetical protein;(source:Araport11) |
AT5G48440 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
AT5G41401 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G42560 | Abscisic acid-responsive (TB2/DP1, HVA22) family protein;(source:Araport11) |
AT2G02770 | 4-phosphopantetheinyl transferase domain protein;(source:Araport11) |
AT1G26940 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT3G22250 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT4G03770 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.8e-206 P-value blast match to GB:AAD11615 prpol (gypsy_Ty3-element) (Zea mays);(source:TAIR10) |
AT5G32136 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.2e-29 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
AT1G56233 | Encodes a defensin-like (DEFL) family protein. |
AT1G24290 | AAA-type ATPase family protein;(source:Araport11) |
AT1G78820 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11) |
AT3G30840 | hypothetical protein;(source:Araport11) |
AT4G13996 | Pseudogene of AT2G35345; unknown protein |
AT5G19175 | Encodes a defensin-like (DEFL) family protein. |
AT5G55670 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G45850 | hypothetical protein (DUF688);(source:Araport11) |
AT4G14225 | A20/AN1-like zinc finger family protein;(source:Araport11) |
AT4G06513 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G31080 | F-box family protein;(source:Araport11) |
AT5G62290 | nucleotide-sensitive chloride conductance regulator (ICln) family protein;(source:Araport11) |
AT5G25940 | early nodulin-like protein;(source:Araport11) |
AT1G30140 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
AT5G18910 | Protein kinase superfamily protein;(source:Araport11) |
AT1G30150 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 2.2e-24 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
AT2G17710 | Big1;(source:Araport11) |
AT1G59453 | B-block-binding subunit of TFIIIC protein;(source:Araport11) |
AT1G80170 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G56260 | Ribonuclease E inhibitor RraA/Dimethylmenaquinone methyltransferase;(source:Araport11) |
AT1G17910 | Wall-associated kinase family protein;(source:Araport11) |
AT5G54780 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT5G63630 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G01990 | hypothetical protein;(source:Araport11) |
AT1G50040 | formin-like protein, putative (DUF1005);(source:Araport11) |
AT1G02070 | zinc ion-binding protein;(source:Araport11) |
AT1G79100 | arginine/serine-rich protein-like protein;(source:Araport11) |
AT2G10260 | Ulp1 protease family protein;(source:Araport11) |
AT5G18220 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT3G59926 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT1G67880 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT2G20993 | Pseudogene of AT2G21045 |
AT1G73200 | testis-expressed sequence 2-like protein (DUF2404);(source:Araport11) |
AT5G38380 | zinc transporter;(source:Araport11) |
AT5G35116 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.7e-85 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G08790 | 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase epsilon-1, putative (DUF1685);(source:Araport11) |
AT2G26500 | cytochrome b6f complex subunit (petM);(source:Araport11) |
AT5G67430 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT1G32385 | snoRNA;(source:Araport11) |
AT4G36960 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G04480 | F-box protein with a domain protein;(source:Araport11) |
AT1G68430 | hypothetical protein;(source:Araport11) |
AT5G64980 | transcription factor;(source:Araport11) |
AT4G26790 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G21020 | transmembrane protein;(source:Araport11) |
AT4G14358 | high affinity nitrate transporter;(source:Araport11) |
AT2G14475 | pseudogene of hypothetical protein;(source:Araport11) |
AT4G30975 | None;(source:Araport11) |
AT1G70010 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.2e-289 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT5G08780 | winged-helix DNA-binding transcription factor family protein;(source:Araport11) |
AT1G48080 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
AT2G15030 | pseudogene of WD40/YVTN repeat and Bromo-WDR9-I-like domain-containing protein;(source:Araport11) |
AT4G13110 | BSD domain-containing protein;(source:Araport11) |
AT1G02540 | hypothetical protein;(source:Araport11) |
AT3G56410 | hypothetical protein (DUF3133);(source:Araport11) |
AT2G06902 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 4.2e-39 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
AT5G37473 | Encodes a defensin-like (DEFL) family protein. |
AT5G59450 | GRAS family transcription factor;(source:Araport11) |
AT1G33530 | F-box family protein;(source:Araport11) |
AT1G66940 | kinase-like protein;(source:Araport11) |
AT1G23910 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT1G36690 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.8e-68 P-value blast match to O80466 /172-336 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT1G71490 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G57270 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT2G13300 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.8e-11 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT1G50530 | hypothetical protein;(source:Araport11) |
AT3G19200 | hypothetical protein;(source:Araport11) |
AT1G10417 | Encodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens. |
AT5G10710 | centromere protein O;(source:Araport11) |
AT2G46572 | Natural antisense transcript overlaps with AT2G46570;(source:Araport11) |
AT5G14890 | potassium transporter;(source:Araport11) |
AT4G24330 | hypothetical protein (DUF1682);(source:Araport11) |
AT4G21903 | MATE efflux family protein;(source:Araport11) |
AT1G80220 | hypothetical protein (DUF1644);(source:Araport11) |
AT4G02110 | transcription coactivator;(source:Araport11) |
AT5G27945 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G38820 | hypothetical protein;(source:Araport11) |
AT5G58300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G66770 | GRAS family transcription factor;(source:Araport11) |
AT3G03040 | F-box/RNI-like superfamily protein. Idenfitied in GWAS as locus involved in response to the defense molecule, allyl glucosinolate. |
AT3G45560 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT4G01925 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G66810 | Ran-binding protein in the microtubule-organising centre protein;(source:Araport11) |
AT1G27100 | Actin cross-linking protein;(source:Araport11) |
AT1G68140 | zinc finger/BTB domain protein, putative (DUF1644);(source:Araport11) |
AT3G50130 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT1G58055 | Encodes a defensin-like (DEFL) family protein. |
AT3G13760 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G50130 | pseudogene of ATP binding/leucine-tRNA ligases/aminoacyl-tRNA ligase;(source:Araport11) |
AT5G04235 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.2e-38 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G52490 | Fibrillarin family protein;(source:Araport11) |
AT1G50440 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT4G37860 | SPT2 chromatin protein;(source:Araport11) |
AT1G08530 | chitinase-like protein;(source:Araport11) |
AT3G16750 | hypothetical protein;(source:Araport11) |
AT4G24880 | snurportin-1 protein;(source:Araport11) |
AT3G03240 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G19150 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G03050 | knotted 1-binding protein;(source:Araport11) |
AT4G10750 | Phosphoenolpyruvate carboxylase family protein;(source:Araport11) |
AT5G06430 | Thioredoxin superfamily protein;(source:Araport11) |
AT2G28080 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT5G26600 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT3G23540 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G27570 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G28500 | rubisco accumulation factor-like protein;(source:Araport11) |
AT1G50400 | Eukaryotic porin family protein;(source:Araport11) |
AT2G41810 | imidazolonepropionase (Protein of unknown function, DUF642);(source:Araport11) |
AT3G01085 | Protein kinase superfamily protein;(source:Araport11) |
AT1G08340 | Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11) |
AT2G31800 | Integrin-linked protein kinase family;(source:Araport11) |
AT1G08440 | aluminum activated malate transporter family protein;(source:Araport11) |
AT3G13840 | GRAS family transcription factor;(source:Araport11) |
AT5G59055 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT1G74830 | myosin-binding protein, putative (Protein of unknown function, DUF593);(source:Araport11) |
AT1G13310 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
AT2G12461 | hypothetical protein;(source:Araport11) |
AT4G17850 | hypothetical protein;(source:Araport11) |
AT5G65340 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT5G65575 | Natural antisense transcript overlaps with AT5G65580;(source:Araport11) |
AT4G08347 | pseudogene of Ta11-like non-LTR retrotransposon;(source:Araport11) |
AT2G09890 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, PIF1 family of mitochondrial helicases;(source:TAIR10) |
AT5G10946 | hypothetical protein;(source:Araport11) |
AT1G13605 | Encodes a defensin-like (DEFL) family protein. |
AT1G53790 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G67650 | SRP72 RNA-binding domain-containing protein;(source:Araport11) |
AT2G20690 | A synthetic gene encoding the catalytic domain of the Arabidopsis thaliana gene At2g20690 was recombinant expressed in E. coli demonstrating the molecular function of riboflavin synthase. The mRNA is cell-to-cell mobile. |
AT5G45170 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT2G32730 | 26S proteasome regulatory complex, non-ATPase subcomplex, Rpn2/Psmd1 subunit;(source:Araport11) |
AT5G35698 | Encodes a Plant thionin family protein |
AT5G05090 | Homeodomain-like superfamily protein;(source:Araport11) |
AT2G42365 | Natural antisense transcript overlaps with AT2G42360 and AT2G42370;(source:Araport11) |
AT3G61500 | BPS1-like protein;(source:Araport11) |
AT1G42300 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G02725 | pre-tRNA tRNA-Ser (anticodon: CGA);(source:Araport11, TAIR10) |
AT3G27327 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.7e-320 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G13070 | CBS domain-containing protein / transporter associated domain-containing protein;(source:Araport11) |
AT3G58220 | TRAF-like family protein;(source:Araport11) |
AT4G06592 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G39880 | Ribosomal protein L23/L15e family protein;(source:Araport11) |
AT5G58595 | snoRNA;(source:Araport11) |
AT3G13845 | transmembrane protein;(source:Araport11) |
AT5G22320 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT1G52780 | PII, uridylyltransferase (DUF2921);(source:Araport11) |
AT2G18970 | hypothetical protein;(source:Araport11) |
AT5G56990 | proteinase inhibitor I25, cystatin, motif protein;(source:Araport11) |
AT2G31740 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G24170 | ATP binding microtubule motor family protein;(source:Araport11) |
AT3G53270 | Small nuclear RNA activating complex (SNAPc), subunit SNAP43 protein;(source:Araport11) |
AT1G58280 | Phosphoglycerate mutase family protein;(source:Araport11) |
AT5G50970 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT2G46940 | fold protein;(source:Araport11) |
AT5G21535 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G21660 | proline-rich spliceosome-associated (PSP) family protein;(source:Araport11) |
AT2G36370 | ubiquitin-protein ligase;(source:Araport11) |
AT2G31820 | Ankyrin repeat family protein;(source:Araport11) |
AT2G38255 | hypothetical protein (DUF239);(source:Araport11) |
AT3G02740 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G47970 | nucleolin;(source:Araport11) |
AT1G38149 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-51 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT4G35510 | PHD finger-like protein;(source:Araport11) |
AT3G20460 | Major facilitator superfamily protein;(source:Araport11) |
AT4G37685 | hypothetical protein;(source:Araport11) |
AT4G18255 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
AT3G15480 | fiber (DUF1218);(source:Araport11) |
AT5G41660 | transmembrane protein;(source:Araport11) |
AT3G60060 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G52547 | hypothetical protein;(source:Araport11) |
AT2G42730 | F-box/FBD/LRR protein;(source:Araport11) |
AT4G36190 | Serine carboxypeptidase S28 family protein;(source:Araport11) |
AT5G65495 | hypothetical protein;(source:Araport11) |
AT2G18690 | transmembrane protein;(source:Araport11) |
AT5G51510 | jagunal-like protein;(source:Araport11) |
AT2G17070 | hypothetical protein (DUF241);(source:Araport11) |
AT5G18550 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT1G08350 | Endomembrane protein 70 protein family;(source:Araport11) |
AT5G44760 | C2 domain-containing protein;(source:Araport11) |
AT5G48575 | mediator of RNA polymerase II transcription subunit-like protein, putative (DUF1216);(source:Araport11) |
AT3G20300 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
AT5G13560 | structural maintenance of chromosomes protein;(source:Araport11) |
AT3G21390 | Encodes a mitochondrial thiamin diphosphate carrier. |
AT4G22440 | hypothetical protein;(source:Araport11) |
AT3G19300 | Protein kinase superfamily protein;(source:Araport11) |
AT1G54445 | Encodes a defensin-like (DEFL) family protein. |
AT4G04957 | RRM in demeter (DUF1985);(source:Araport11) |
AT5G34770 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 3.2e-131 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
AT2G16670 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-190 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
AT3G14780 | callose synthase;(source:Araport11) |
AT4G18660 | delay of germination protein;(source:Araport11) |
AT3G48950 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G14570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G48290.1);(source:TAIR10) |
AT3G49710 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G30740 | pseudogene of Ribosomal protein S25 family protein;(source:Araport11) |
AT4G10620 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G39750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G17280 | Auxin-responsive family protein;(source:Araport11) |
AT1G09160 | Protein phosphatase 2C family protein;(source:Araport11) |
AT1G33180 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-05 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT5G51520 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT2G35840 | Sucrose-6F-phosphate phosphohydrolase family protein;(source:Araport11) |
AT2G01580 | transmembrane protein;(source:Araport11) |
AT3G07820 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G47680 | DNA binding protein;(source:Araport11) |
AT1G27565 | hypothetical protein;(source:Araport11) |
AT1G35340 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
AT2G19890 | hypothetical protein;(source:Araport11) |
AT3G01160 | pre-rRNA-processing ESF1-like protein;(source:Araport11) |
AT2G04790 | PTB domain engulfment adapter;(source:Araport11) |
AT3G43825 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.3e-106 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G33680 | KH domain-containing protein;(source:Araport11) |
AT5G50900 | ARM repeat superfamily protein;(source:Araport11) |
AT1G68330 | membrane-associated kinase regulator;(source:Araport11) |
AT1G70581 | other_RNA;(source:Araport11) |
AT1G58590 | other_RNA;(source:Araport11) |
AT3G28153 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.3e-30 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT4G09970 | transmembrane protein;(source:Araport11) |
AT5G48657 | defense protein-like protein;(source:Araport11) |
AT4G14096 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT4G26980 | RNI-like superfamily protein;(source:Araport11) |
AT5G09560 | RNA-binding KH domain-containing protein;(source:Araport11) |
AT5G09490 | Ribosomal protein S19 family protein;(source:Araport11) |
AT1G61475 | ATP binding / protein kinase;(source:Araport11) |
AT4G16748 | other_RNA;(source:Araport11) |
AT5G13410 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT1G75360 | transmembrane protein;(source:Araport11) |
AT3G04330 | Kunitz family trypsin and protease inhibitor protein;(source:Araport11) |
AT1G61667 | serine protease, putative (Protein of unknown function, DUF538);(source:Araport11) |
AT2G25590 | Plant Tudor-like protein;(source:Araport11) |
AT4G33140 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G21010 | PADRE proteinup-regulated after infection by S. sclerotiorun. |
AT3G02715 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
AT2G23300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G34925 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 7.3e-38 P-value blast match to O80466 /172-336 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT3G29120 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.8e-98 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G21950 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G60760 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT5G39473 | pseudogene of DC1 (domain-containing protein) |
AT3G04980 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT1G07520 | GRAS family transcription factor;(source:Araport11) |
AT4G21895 | DNA binding protein;(source:Araport11) |
AT3G58210 | TRAF-like family protein;(source:Araport11) |
AT3G02670 | Glycine-rich protein family;(source:Araport11) |
AT5G47350 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G26730 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT1G35790 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.3e-42 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT4G34412 | EKC/KEOPS complex subunit tprkb-like protein;(source:Araport11) |
AT4G27680 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G44713 | hypothetical protein;(source:Araport11) |
AT4G32630 | ArfGap/RecO-like zinc finger domain-containing protein;(source:Araport11) |
AT2G13900 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G11745 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G54410 | hypothetical protein;(source:Araport11) |
AT2G18969 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
AT1G54217 | Ribosomal protein L18ae family;(source:Araport11) |
AT1G12000 | Phosphofructokinase family protein;(source:Araport11) |
AT3G05950 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT4G03745 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 9.4e-105 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G05210 | Transmembrane protein 97, Putative;(source:Araport11) |
AT5G24690 | plant/protein, putative (DUF3411);(source:Araport11) |
AT2G20362 | transmembrane protein;(source:Araport11) |
AT5G01210 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT3G57030 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT5G39785 | hypothetical protein (DUF1666);(source:Araport11) |
AT4G10170 | SNARE-like superfamily protein;(source:Araport11) |
AT5G25860 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G20670 | DUF1677 family protein (DUF1677);(source:Araport11) |
AT1G44835 | YbaK/aminoacyl-tRNA synthetase-associated domain-containing protein;(source:Araport11) |
AT2G11690 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 4.8e-34 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
AT1G01800 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G69450 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
AT1G16840 | hypothetical protein;(source:Araport11) |
AT1G15560 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 3.8e-130 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G14190 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G14315 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G24440 | selenium binding protein;(source:Araport11) |
AT2G44250 | tRNA-splicing ligase, putative (DUF239);(source:Araport11) |
AT4G19400 | Profilin family protein;(source:Araport11) |
AT3G23175 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
AT1G44191 | Encodes a ECA1 gametogenesis related family protein |
AT1G61320 | FBD / Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT5G42290 | transcription activator-like protein;(source:Araport11) |
AT5G39430 | DUF1336 family protein, putative (DUF1336);(source:Araport11) |
AT2G40250 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
AT4G13710 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G15930 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
AT5G33406 | hAT dimerization domain-containing protein / transposase-like protein;(source:Araport11) |
AT1G71070 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT5G01260 | Carbohydrate-binding-like fold;(source:Araport11) |
AT3G26539 | hypothetical protein;(source:Araport11) |
AT2G03958 | Encodes a defensin-like (DEFL) family protein. |
AT5G35050 | hypothetical protein (DUF1985);(source:Araport11) |
AT3G28005 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT2G13690 | PRLI-interacting factor;(source:Araport11) |
AT3G10530 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G18900 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G05812 | Natural antisense transcript overlaps with AT2G05810;(source:Araport11) |
AT3G29265 | transposable_element_gene;(source:Araport11);similar to zinc knuckle (CCHC-type) family protein [Arabidopsis thaliana] (TAIR:AT5G32482.1);(source:TAIR10) |
AT4G18220 | Drug/metabolite transporter superfamily protein;(source:Araport11) |
AT2G14520 | CBS domain protein (DUF21);(source:Araport11) |
AT3G04860 | hypothetical protein (DUF868);(source:Araport11) |
AT2G15260 | RING/U-box superfamily protein;(source:Araport11) |
AT2G25040 | pseudogene of casein lytic proteinase B4;(source:Araport11) |
AT1G20795 | F-box family protein;(source:Araport11) |
AT1G05730 | FAM136A-like protein (DUF842);(source:Araport11) |
AT2G25482 | Encodes a ECA1 gametogenesis related family protein |
AT3G20260 | DUF1666 family protein (DUF1666);(source:Araport11) |
AT3G07270 | GTP cyclohydrolase I;(source:Araport11) |
AT4G34550 | F-box protein;(source:Araport11) |
AT5G18475 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G38005 | other_RNA;(source:Araport11) |
AT2G25350 | Phox (PX) domain-containing protein;(source:Araport11) |
AT1G35400 | hypothetical protein (DUF1184);(source:Araport11) |
AT3G57820 | pseudogene of Translation protein SH3-like family protein;(source:Araport11) |
AT1G63830 | PLAC8 family protein;(source:Araport11) |
AT3G58480 | calmodulin-binding family protein;(source:Araport11) |
AT1G60180 | pseudogene of F-box family protein |
AT1G64380 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
AT5G01960 | RING/U-box superfamily protein;(source:Araport11) |
AT5G44830 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G51220 | WEB family protein (DUF827);(source:Araport11) |
AT3G07273 | hypothetical protein;(source:Araport11) |
AT1G69210 | Uncharacterized protein family UPF0090;(source:Araport11) |
AT2G25735 | hypothetical protein;(source:Araport11) |
AT1G15772 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
AT1G69650 | TRAF-like family protein;(source:Araport11) |
AT4G10420 | FBD / Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT3G07950 | rhomboid protein-like protein;(source:Araport11) |
AT1G61650 | pseudogene of chromomethylase 1;(source:Araport11) |
AT3G47530 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G72880 | Survival protein SurE-like phosphatase/nucleotidase;(source:Araport11) |
AT2G27720 | 60S acidic ribosomal protein family;(source:Araport11) |
AT2G05800 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.1e-19 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT2G31540 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G01520 | Encodes a universal stress protein (USP)-like protein that has been crystallized in complex with AMP, suggesting that it belongs to the ATP-binding USP subfamily. The mRNA is cell-to-cell mobile. |
AT4G40050 | signal transducer, putative (DUF3550/UPF0682);(source:Araport11) |
AT4G34150 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT3G43930 | BRCT domain-containing DNA repair protein;(source:Araport11) |
AT5G26810 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G28705 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.8e-25 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G22170 | transmembrane protein;(source:Araport11) |
AT2G32885 | Encodes a Rapid ALkalinization Factor (RALF) family protein |
AT1G43330 | Homeodomain-like superfamily protein;(source:Araport11) |
AT4G01170 | hypothetical protein;(source:Araport11) |
AT1G26710 | transmembrane protein;(source:Araport11) |
AT5G53815 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.6e-26 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G27170 | transmembrane receptors / ATP binding protein;(source:Araport11) |
AT1G77040 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
AT1G70944 | transmembrane protein;(source:Araport11) |
AT1G35420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G44418 | pseudogene of cytochrome P450;(source:Araport11) |
AT2G41170 | F-box family protein;(source:Araport11) |
AT1G69580 | Homeodomain-like superfamily protein;(source:Araport11) |
AT5G03450 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G42803 | transposable_element_gene;(source:Araport11);pseudogene, similar to P0707D10.17, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
AT3G29773 | pseudogene of nuclease;(source:Araport11) |
AT4G18450 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
AT5G28560 | hypothetical protein;(source:Araport11) |
AT4G15980 | ProPME pectin methylesterase |
AT4G06612 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G11970 | ABC family ABC transporter, putative (DUF3511);(source:Araport11) |
AT5G41310 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
AT1G20540 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G07322 | other_RNA;(source:Araport11) |
AT4G08134 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.6e-103 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10) |
AT3G43573 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.7e-27 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT4G23670 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT1G05136 | hypothetical protein;(source:Araport11) |
AT2G46560 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT4G05475 | RNI-like superfamily protein;(source:Araport11) |
AT5G27530 | Member of pectin lyase gene family. |
AT4G19720 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
AT4G04745 | hypothetical protein;(source:Araport11) |
AT1G23180 | ARM repeat superfamily protein;(source:Araport11) |
AT4G02580 | NADH-ubiquinone oxidoreductase 24 kDa subunit;(source:Araport11) |
AT1G62886 | Nucleotide excision repair, TFIIH, subunit TTDA;(source:Araport11) |
AT4G01000 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT1G36570 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, blastp match of 46%25 identity and 2.5e-78 P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT5G52680 | Copper transport protein family;(source:Araport11) |
AT3G24850 | B3 domain protein (DUF313);(source:Araport11) |
AT2G45300 | encodes 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase involved in chorismate biosynthesis The mRNA is cell-to-cell mobile. |
AT1G24159 | Interleukin-1 receptor-associated kinase 4 protein;(source:Araport11) |
AT1G05291 | GPI inositol-deacylase C, putative (DUF1218);(source:Araport11) |
AT1G18871 | hypothetical protein;(source:Araport11) |
AT2G04031 | Encodes a ECA1 gametogenesis related family protein |
AT1G44770 | elongation factor;(source:Araport11) |
AT1G43724 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.1e-61 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G18596 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT1G30920 | F-box family protein;(source:Araport11) |
AT4G37080 | ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547);(source:Araport11) |
AT2G33720 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT2G11891 | hypothetical protein;(source:Araport11) |
AT2G23360 | filament-like protein (DUF869);(source:Araport11) |
AT1G73170 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G02023 | hypothetical protein;(source:Araport11) |
AT4G35410 | Clathrin adaptor complex small chain family protein;(source:Araport11) |
AT1G29179 | cysteine/histidine-rich C1 domain protein;(source:Araport11) |
AT3G01175 | transmembrane protein;(source:Araport11) |
AT1G03743 | snoRNA;(source:Araport11) |
AT5G33315 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-20 P-value blast match to GB:AAC24836 pol polyprotein (Ty1_Copia-element) (Candida albicans);(source:TAIR10) |
AT1G23640 | OBP32pep protein;(source:Araport11) |
AT5G35605 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
AT1G30921 | pseudogene of F-box family protein;(source:Araport11) |
AT4G24300 | Peptidase C50, separase;(source:Araport11) |
AT5G67290 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
AT3G27680 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT5G19710 | histidine containing phosphotransfer protein;(source:Araport11) |
AT5G08670 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. |
AT3G19515 | apoptosis inhibitor;(source:Araport11) |
AT2G13469 | pseudogene of putative nucleic-acid protein;(source:Araport11) |
AT2G39280 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT2G10420 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.7e-82 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
AT1G64330 | myosin heavy chain-like protein;(source:Araport11) |
AT5G12900 | DNA double-strand break repair RAD50 ATPase;(source:Araport11) |
AT4G32380 | pectin lyase superfamily protein;(source:Araport11) |
AT1G07840 | Sas10/Utp3/C1D family;(source:Araport11) |
AT4G23330 | hypothetical protein;(source:Araport11) |
AT1G62650 | pseudogene of P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G65687 | Major facilitator superfamily protein;(source:Araport11) |
AT4G19440 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G31380 | TRAF-like family protein;(source:Araport11) |
AT1G51410 | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), apple tree, PIR:T16995; NOT a cinnamyl-alcohol dehydrogenase |
AT1G77770 | forkhead box protein, putative (DUF1644);(source:Araport11) |
AT1G48180 | target of trans acting-siR480/255 protein;(source:Araport11) |
AT4G24160 | Encodes a soluble lysophosphatidic acid acyltransferase with additional triacylglycerol lipase and phosphatidylcholine hydrolyzing enzymatic activities. Plays a pivotal role in maintaining the lipid homeostasis by regulating both phospholipid and neutral lipid levels. |
AT4G25610 | C2H2-like zinc finger protein;(source:Araport11) |
AT4G09690 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G40981 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G12000 | SNARE associated Golgi protein family;(source:Araport11) |
AT3G04500 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G12100 | Cullin family protein;(source:Araport11) |
AT3G25805 | transmembrane protein;(source:Araport11) |
AT3G57340 | DnaJ heat shock amino-terminal domain protein (DUF1977);(source:Araport11) |
AT2G06822 | Pseudogene of AT2G06822 |
AT4G08136 | pseudogene of purple acid phosphatase 10;(source:Araport11) |
AT5G56960 | basic helix-loop-helix (bHLH) DNA-binding family protein;(source:Araport11) |
AT1G76210 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
AT1G18030 | Protein phosphatase 2C family protein;(source:Araport11) |
AT2G04036 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 2.6e-169 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
AT3G22210 | transmembrane protein;(source:Araport11) |
AT2G15025 | Beta-galactosidase related protein;(source:Araport11) |
AT3G30320 | hypothetical protein;(source:Araport11) |
AT5G05110 | Cystatin/monellin family protein;(source:Araport11) |
AT4G04293 | transposable_element_gene;(source:Araport11);pseudogene, similar to P0703B11.15, blastp match of 38%25 identity and 2.2e-25 P-value to GP|18844826|dbj|BAB85296.1||AP003302 P0703B11.15 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT5G66720 | Protein phosphatase 2C family protein;(source:Araport11) |
AT5G09500 | Ribosomal protein S19 family protein;(source:Araport11) |
AT5G08750 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT2G28280 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G43300 | pre-tRNA tRNA-Thr (anticodon: TGT);(source:Araport11, TAIR10) |
AT3G61010 | Ferritin/ribonucleotide reductase-like family protein;(source:Araport11) |
AT3G59800 | stress response protein;(source:Araport11) |
AT2G24040 | Low temperature and salt responsive protein family;(source:Araport11) |
AT1G04830 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT4G00130 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
AT1G51210 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G13010 | hAT transposon superfamily protein;(source:Araport11) |
AT3G46585 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
AT4G30780 | ATP-dependent DNA helicase;(source:Araport11) |
AT3G32091 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.3e-109 P-value blast match to F1M23 reverse transcriptase (from Dan Voytas http://www.public.iastate.edu/~voytas) (Gypsy_Ty3-family);(source:TAIR10) |
AT1G17790 | DNA-binding bromodomain-containing protein;(source:Araport11) |
AT5G57567 | GCK domain protein;(source:Araport11) |
AT1G53450 | epstein-barr nuclear antigen;(source:Araport11) |
AT1G13608 | Encodes a defensin-like (DEFL) family protein. |
AT5G64600 | O-fucosyltransferase family protein;(source:Araport11) |
AT4G03620 | myosin heavy chain-like protein;(source:Araport11) |
AT2G34580 | cytomegalovirus UL139 protein;(source:Araport11) |
AT1G66610 | TRAF-like superfamily protein;(source:Araport11) |
AT5G17930 | MIF4G domain-containing protein / MA3 domain-containing protein;(source:Araport11) |
AT3G45320 | transmembrane protein;(source:Araport11) |
AT4G25235 | Encodes a ECA1 gametogenesis related family protein [pseudogene] |
AT5G35775 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT2G03410 | Mo25 family protein;(source:Araport11) |
AT5G28950 | nuclease;(source:Araport11) |
AT2G10910 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-24 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT5G49770 | Leucine rich receptor kinase. |
AT3G57580 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G16905 | pseudogene of MATE efflux family protein;(source:Araport11) |
AT2G06541 | TTF-type zinc finger protein with HAT dimerization domain-containing protein;(source:Araport11) |
AT4G06550 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 9.8e-107 P-value blast match to gb|AAL06420.1|AF378078_1 reverse transcriptase (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10) |
AT4G35140 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G06500 | hAT family dimerization domain-containing protein;(source:Araport11) |
AT4G08250 | GRAS family transcription factor;(source:Araport11) |
AT4G24644 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT2G02670 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G27270 | Quinone reductase family protein;(source:Araport11) |
AT1G55964 | pseudogene of myb family transcription factor |
AT3G24465 | Encodes a Plant thionin family protein |
AT2G25220 | Protein kinase superfamily protein;(source:Araport11) |
AT5G05210 | Surfeit locus protein 6;(source:Araport11) |
AT3G13205 | pseudogene of vacuolar protein sorting-associated protein |
AT3G08990 | Yippee family putative zinc-binding protein;(source:Araport11) |
AT2G14930 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.9e-255 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT4G23120 | Bromo-adjacent homology (BAH) domain-containing protein;(source:Araport11) |
AT4G11970 | YTH family protein;(source:Araport11) |
AT3G60070 | Major facilitator superfamily protein;(source:Araport11) |
AT3G44330 | M28 Zn-peptidase nicastrin;(source:Araport11) |
AT1G19110 | inter-alpha-trypsin inhibitor heavy chain-like protein;(source:Araport11) |
AT5G20580 | TMEM192 family protein;(source:Araport11) |
AT2G18600 | Ubiquitin-conjugating enzyme family protein;(source:Araport11) |
AT5G09225 | transmembrane protein;(source:Araport11) |
AT3G55870 | ADC synthase superfamily protein;(source:Araport11) |
AT2G13450 | Ta11-like non-LTR retrotransposon;(source:Araport11) |
AT5G16340 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT2G19350 | transmembrane protein (DUF872);(source:Araport11) |
AT5G38195 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT3G58250 | TRAF-like family protein;(source:Araport11) |
AT5G24620 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT3G28295 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.4e-29 P-value blast match to aF23C08 reverse transcriptase (from Dan Voytas http://www.public.iastate.edu/~voytas) (Gypsy_Ty3-family);(source:TAIR10) |
AT1G61780 | postsynaptic protein-like protein;(source:Araport11) |
AT1G48870 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G42975 | myosin-G heavy chain-like protein;(source:Araport11) |
AT4G02930 | GTP binding Elongation factor Tu family protein;(source:Araport11) |
AT2G23720 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 6.7e-76 P-value blast match to Q9SI25 /181-349 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT2G41415 | Encodes a Maternally expressed gene (MEG) family protein |
AT1G10040 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G61280 | Remorin family protein;(source:Araport11) |
AT4G36440 | G-protein coupled receptor;(source:Araport11) |
AT3G58520 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT5G15845 | Natural antisense transcript overlaps with AT5G15850;(source:Araport11) |
AT4G13150 | transmembrane protein;(source:Araport11) |
AT5G46610 | aluminum activated malate transporter family protein;(source:Araport11) |
AT2G39500 | hexose transporter;(source:Araport11) |
AT2G42885 | Encodes a defensin-like (DEFL) family protein. |
AT1G17744 | hypothetical protein;(source:Araport11) |
AT3G20240 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT4G35165 | egg cell-secreted-like protein (DUF1278);(source:Araport11) |
AT3G59780 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
AT3G59390 | glycosyltransferase family protein;(source:Araport11) |
AT2G02590 | small multi-drug export protein;(source:Araport11) |
AT5G49840 | ATP-dependent Clp protease;(source:Araport11) |
AT2G26970 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT3G28780 | transmembrane protein, putative (DUF1216);(source:Araport11) |
AT2G39130 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT5G13940 | aminopeptidase;(source:Araport11) |
AT3G44205 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.5e-40 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT5G37000 | glycosyltransferase family exostosin protein;(source:Araport11) |
AT5G49440 | hypothetical protein;(source:Araport11) |
AT3G45730 | hypothetical protein;(source:Araport11) |
AT1G38131 | O-fucosyltransferase family protein;(source:Araport11) |
AT4G32920 | glycine-rich protein;(source:Araport11) |
AT5G39471 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G40750 | FBD / Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT1G14010 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT3G50710 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G35945 | F-box/LRR protein;(source:Araport11) |
AT3G43520 | Transmembrane proteins 14C;(source:Araport11) |
AT5G38980 | transmembrane protein;(source:Araport11) |
AT3G21000 | Gag-Pol-related retrotransposon family protein;(source:Araport11) |
AT5G35995 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT1G45230 | DCL protein (DUF3223);(source:Araport11) |
AT1G72190 | D-isomer specific 2-hydroxyacid dehydrogenase family protein;(source:Araport11) |
AT4G37480 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT4G13530 | transmembrane protein;(source:Araport11) |
AT4G10330 | glycine-rich protein;(source:Araport11) |
AT1G62510 | Expressed in the root cortex. |
AT4G06682 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-196 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT2G11480 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G05310 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G07080 | Thioredoxin superfamily protein;(source:Araport11) |
AT5G61950 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT1G08050 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT4G38020 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
AT5G50940 | RNA-binding KH domain-containing protein;(source:Araport11) |
AT3G15040 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT3G02700 | NC domain-containing protein-like protein;(source:Araport11) |
AT5G15110 | Pectate lyase family protein;(source:Araport11) |
AT4G08395 | hypothetical protein;(source:Araport11) |
AT3G53980 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT5G23035 | Encodes a defensin-like (DEFL) family protein. |
AT3G28956 | RNA polymerase II, Rpb4, core protein;(source:Araport11) |
AT1G09010 | glycoside hydrolase family 2 protein;(source:Araport11) |
AT4G08760 | hypothetical protein;(source:Araport11) |
AT5G11700 | ephrin type-B receptor;(source:Araport11) |
AT3G30812 | pseudogene of lysyl-tRNA synthetase 1;(source:Araport11) |
AT5G37330 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G25050 | Major facilitator superfamily protein;(source:Araport11) |
AT3G45443 | hypothetical protein;(source:Araport11) |
AT4G19970 | nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
AT1G48325 | Expressed protein;(source:Araport11) |
AT2G35859 | Natural antisense transcript overlaps with AT2G35860;(source:Araport11) |
AT1G67310 | Calmodulin-binding transcription activator protein with CG-1 and Ankyrin domain;(source:Araport11) |
AT3G28580 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G79890 | RAD3-like DNA-binding helicase protein;(source:Araport11) |
AT1G23100 | GroES-like family protein;(source:Araport11) |
AT5G58340 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
AT3G22560 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT2G37370 | centrosomal protein of 135 kDa-like protein;(source:Araport11) |
AT2G03490 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
AT3G11950 | publications Tian et al (2007) and Sadre et al (2006) refer to At3g11950. The prenyltransferase gene studied is actually At3g11945 which arises from a split of the previous At3g11950 gene model. |
AT4G17100 | poly(U)-specific endoribonuclease-B protein;(source:Araport11) |
AT1G17820 | testis-expressed sequence 2-like protein (DUF2404);(source:Araport11) |
AT3G05155 | Major facilitator superfamily protein;(source:Araport11) |
AT5G07810 | SNF2 domain-containing protein / helicase domain-containing protein / HNH endonuclease domain-containing protein;(source:Araport11) |
AT1G70280 | NHL domain-containing protein;(source:Araport11) |
AT2G17723 | Encodes a defensin-like (DEFL) family protein. |
AT4G14149 | Pseudogene of AT2G24480; zinc finger (C3HC4-type RING finger) family protein |
AT3G09590 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
AT3G54450 | Major facilitator superfamily protein;(source:Araport11) |
AT5G60050 | BTB/POZ domain-containing protein;(source:Araport11) |
AT3G17720 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT3G45770 | Polyketide synthase, enoylreductase family protein;(source:Araport11) |
AT4G33625 | vacuole protein;(source:Araport11) |
AT3G62310 | RNA helicase family protein;(source:Araport11) |
AT2G05530 | Glycine-rich protein family;(source:Araport11) |
AT1G16500 | filamentous hemagglutinin transporter;(source:Araport11) |
AT4G31230 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT5G54220 | Encodes a defensin-like (DEFL) family protein. |
AT4G05523 | nucleoporin GLE1-like protein;(source:Araport11) |
AT5G28773 | transposable_element_gene;(source:Araport11);pseudogene, similar to Putative retroelement, similar to putative reverse transcriptase;(source:TAIR10) |
AT3G11745 | transmembrane protein;(source:Araport11) |
AT1G65830 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
AT3G05835 | pre-tRNA tRNA-Ile (anticodon: TAT);(source:Araport11, TAIR10) |
AT5G21080 | Uncharacterized protein;(source:Araport11) |
AT5G64816 | Thionin-like gene. |
AT3G43580 | Beta-galactosidase related protein;(source:Araport11) |
AT3G07522 | hypothetical protein;(source:Araport11) |
AT3G32455 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.5e-24 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT3G20370 | TRAF-like family protein;(source:Araport11) |
AT1G07728 | Natural antisense transcript overlaps with AT1G07725;(source:Araport11) |
AT4G02630 | Protein kinase superfamily protein;(source:Araport11) |
AT5G38070 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT3G18720 | F-box family protein;(source:Araport11) |
AT5G48970 | Encodes a mitochondrial thiamin diphosphate carrier. |
AT1G13130 | Cellulase (glycosyl hydrolase family 5) protein;(source:Araport11) |
AT1G03100 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G36550 | haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
AT2G29800 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G37475 | Translation initiation factor eIF3 subunit;(source:Araport11) |
AT2G39590 | 40S ribosomal protein S15a;(source:Araport11) |
AT3G18700 | transmembrane protein;(source:Araport11) |
AT3G05425 | hypothetical protein;(source:Araport11) |
AT1G48290 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43660.1);(source:TAIR10) |
AT4G06637 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G07523.1);(source:TAIR10) |
AT2G27980 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
AT4G04630 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT3G62350 | F-box/associated interaction domain protein;(source:Araport11) |
AT5G61910 | DCD (Development and Cell Death) domain protein;(source:Araport11) |
AT5G52070 | Agenet domain-containing protein;(source:Araport11) |
AT5G04910 | DNA repair REX1-B protein;(source:Araport11) |
AT5G38910 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT3G03870 | transmembrane protein;(source:Araport11) |
AT3G25716 | transmembrane protein;(source:Araport11) |
AT1G50630 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
AT2G44800 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT3G22440 | FRIGIDA-like protein;(source:Araport11) |
AT1G09880 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
AT3G20280 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT2G31550 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
AT4G24790 | AAA-type ATPase family protein;(source:Araport11) |
AT2G17760 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G03565 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT1G12244 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT2G26360 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT1G16700 | Alpha-helical ferredoxin;(source:Araport11) |
AT5G44350 | ethylene-responsive nuclear protein-like protein;(source:Araport11) |
AT4G13918 | Natural antisense transcript overlaps with AT4G13920;(source:Araport11) |
AT1G47520 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.3e-256 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G52330 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT3G60790 | F-box family protein;(source:Araport11) |
AT4G33960 | hypothetical protein;(source:Araport11) |
AT3G59130 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G14980 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G06910 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 4.3e-100 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
AT1G69250 | Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein;(source:Araport11) |
AT5G24170 | Got1/Sft2-like vescicle transport protein family;(source:Araport11) |
AT3G18510 | ATP-dependent helicase/nuclease subunit;(source:Araport11) |
AT1G72100 | late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11) |
AT4G20450 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G18540 | transmembrane protein;(source:Araport11) |
AT2G22690 | zinc ion binding protein;(source:Araport11) |
AT4G14240 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
AT4G26488 | Natural antisense transcript overlaps with AT4G26490;(source:Araport11) |
AT5G10580 | plant/protein (Protein of unknown function, DUF599);(source:Araport11) |
AT1G77270 | hypothetical protein;(source:Araport11) |
AT5G22810 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G68030 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT1G17680 | tetratricopeptide repeat (TPR)-containing protein;(source:Araport11) |
AT4G11860 | FAM63A-like protein (DUF544);(source:Araport11) |
AT5G51280 | DEAD-box protein abstrakt;(source:Araport11) |
AT5G42965 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT1G38140 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 9.2e-38 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G69470 | heat shock protein-binding protein;(source:Araport11) |
AT1G51250 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT4G32510 | HCO3- transporter family;(source:Araport11) |
AT1G14810 | encodes an aspartate semialdehyde dehydrogenase, which produces the branch point intermediate for lysine and threonine/methionine biosynthesis |
AT2G27160 | hypothetical protein;(source:Araport11) |
AT2G01130 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT1G52565 | cytochrome P450 family protein;(source:Araport11) |
AT1G10586 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G35930 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT2G41440 | agamous-like MADS-box protein;(source:Araport11) |
AT5G52700 | Member of plant specific copper transport protein family. Expressed in response to Al treatment. |
AT1G24440 | RING/U-box superfamily protein;(source:Araport11) |
AT2G14710 | F-box family protein;(source:Araport11) |
AT5G46680 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT1G07175 | alternative NAD(P)H dehydrogenase;(source:Araport11) |
AT2G24230 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G19806 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 1.2e-19 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
AT2G08986 | hypothetical protein;(source:Araport11) |
AT1G42220 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 3.7e-14 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G26582 | Natural antisense transcript overlaps with AT4G26590;(source:Araport11) |
AT1G26850 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G18490 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
AT5G45960 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G45830 | nuclear factor kappa-B-binding-like protein;(source:Araport11) |
AT1G72760 | Protein kinase superfamily protein;(source:Araport11) |
AT3G42570 | peroxidase family protein;(source:Araport11) |
AT5G52990 | SNARE-like superfamily protein;(source:Araport11) |
AT4G28815 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT3G24080 | KRR1 family protein;(source:Araport11) |
AT4G21880 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G14700 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G21722 | transmembrane protein;(source:Araport11) |
AT2G22750 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT4G22580 | Exostosin family protein;(source:Araport11) |
AT2G43580 | Chitinase family protein;(source:Araport11) |
AT1G31900 | pseudogene of FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
AT1G49975 | photosystem I reaction center subunit N;(source:Araport11) |
AT4G26550 | Got1/Sft2-like vescicle transport protein family;(source:Araport11) |
AT4G18330 | Translation elongation factor EF1A/initiation factor IF2gamma family protein;(source:Araport11) |
AT2G36290 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G02100 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT2G18480 | Major facilitator superfamily protein;(source:Araport11) |
AT2G20410 | RNA-binding ASCH domain protein;(source:Araport11) |
AT4G24760 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G60286 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT3G21680 | hypothetical protein;(source:Araport11) |
AT1G50980 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT4G03000 | RING/U-box superfamily protein;(source:Araport11) |
AT5G22730 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT2G39390 | Ribosomal L29 family protein;(source:Araport11) |
AT1G68490 | translocase subunit seca;(source:Araport11) |
AT1G57830 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
AT3G15420 | Transcription factor TFIIIC, tau55-related protein;(source:Araport11) |
AT1G15125 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G06648 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.0e-181 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G03610 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G57940 | GNAT acetyltransferase (DUF699);(source:Araport11) |
AT1G26350 | hypothetical protein;(source:Araport11) |
AT4G32230 | hypothetical protein;(source:Araport11) |
AT5G25520 | SPOC domain / Transcription elongation factor S-II protein;(source:Araport11) |
AT5G16040 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT2G20555 | pseudogene of pentatricopeptide (PPR) repeat-containing protein |
AT4G04370 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G52130 | hypothetical protein;(source:Araport11) |
AT5G53620 | RNA polymerase II degradation factor;(source:Araport11) |
AT1G43280 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 6.6e-47 P-value blast match to Q9ZQM3 /24-192 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT2G20550 | HSP40/DnaJ peptide-binding protein;(source:Araport11) |
AT5G37030 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G76280 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G04220 | DUF868 family protein (DUF868);(source:Araport11) |
AT5G07790 | hypothetical protein;(source:Araport11) |
AT1G26740 | Ribosomal L32p protein family;(source:Araport11) |
AT1G62520 | sulfated surface-like glycoprotein;(source:Araport11) |
AT5G24355 | hypothetical protein;(source:Araport11) |
AT2G20625 | hypothetical protein (DUF626);(source:Araport11) |
AT1G29190 | pseudogene of hypothetical protein (DUF295);(source:Araport11) |
AT1G61840 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G52545 | RNA-binding protein-like RNA recognition motif protein;(source:Araport11) |
AT1G72960 | Root hair defective 3 GTP-binding protein (RHD3);(source:Araport11) |
AT3G29152 | Encodes a Protease inhibitor/seed storage/LTP family protein |
AT4G30020 | PA-domain containing subtilase family protein;(source:Araport11) |
AT4G30230 | hypothetical protein;(source:Araport11) |
AT5G14410 | hypothetical protein;(source:Araport11) |
AT5G19840 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT2G23970 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
AT4G32560 | paramyosin-like protein;(source:Araport11) |
AT4G12940 | hypothetical protein;(source:Araport11) |
AT1G04570 | Similar to plastid solute transporters. |
AT3G07120 | RING/U-box superfamily protein;(source:Araport11) |
AT1G16350 | Aldolase-type TIM barrel family protein;(source:Araport11) |
AT2G45840 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
AT1G63310 | hypothetical protein;(source:Araport11) |
AT2G24800 | Peroxidase superfamily protein;(source:Araport11) |
AT5G04060 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G28615 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT5G54700 | Ankyrin repeat family protein;(source:Araport11) |
AT5G44680 | DNA glycosylase superfamily protein;(source:Araport11) |
AT3G44090 | F-box family protein;(source:Araport11) |
AT2G23690 | PADRE protein. |
AT2G40460 | Major facilitator superfamily protein;(source:Araport11) |
AT1G72855 | Natural antisense transcript overlaps with AT1G72860;(source:Araport11) |
AT4G26255 | other_RNA;(source:Araport11) |
AT1G33100 | MATE efflux family protein;(source:Araport11) |
AT5G53500 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G11960 | Cleavage and polyadenylation specificity factor (CPSF) A subunit protein;(source:Araport11) |
AT5G58530 | Glutaredoxin family protein;(source:Araport11) |
AT3G53440 | Homeodomain-like superfamily protein;(source:Araport11) |
AT5G37872 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.4e-54 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G52360 | transmembrane protein;(source:Araport11) |
AT3G18291 | hypothetical protein;(source:Araport11) |
AT2G25950 | PITH domain protein (DUF1000);(source:Araport11) |
AT4G05490 | RNI-like superfamily protein;(source:Araport11) |
AT4G18680 | delay of germination protein;(source:Araport11) |
AT4G00356 | Encodes a defensin-like (DEFL) family protein. |
AT3G47160 | RING/U-box superfamily protein;(source:Araport11) |
AT4G05073 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.1e-300 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G51230 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT5G55800 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G29080 | Papain family cysteine protease;(source:Araport11) |
AT2G14255 | Ankyrin repeat family protein with DHHC zinc finger domain-containing protein;(source:Araport11) |
AT5G22480 | ZPR1 zinc-finger domain protein;(source:Araport11) |
AT3G58140 | phenylalanyl-tRNA synthetase class IIc family protein;(source:Araport11) |
AT2G19230 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
AT2G04515 | transmembrane protein;(source:Araport11) |
AT3G46345 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to non-LTR reverse transcriptase, putative;(source:TAIR10) |
AT1G56553 | Encodes a defensin-like (DEFL) family protein. |
AT5G25955 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.7e-17 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G32915 | glutamyl-tRNA(Gln) amidotransferase subunit C;(source:Araport11) |
AT2G02620 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G22485 | Encodes a Protease inhibitor/seed storage/LTP family protein |
AT1G30455 | cyclin/Brf1-like TBP-binding domain-containing protein;(source:Araport11) |
AT3G49050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G32964 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 2.7e-181 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
AT3G47580 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G72790 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G66800 | membrane-associated kinase regulator-like protein;(source:Araport11) |
AT5G27020 | hypothetical protein;(source:Araport11) |
AT5G49410 | thiamine-phosphate synthase;(source:Araport11) |
AT5G24260 | prolyl oligopeptidase family protein;(source:Araport11) |
AT5G35375 | transmembrane protein;(source:Araport11) |
AT2G30700 | GPI-anchored protein;(source:Araport11) |
AT1G21925 | Encodes a Plant thionin family protein |
AT5G56350 | Pyruvate kinase family protein;(source:Araport11) |
AT1G57765 | transmembrane protein;(source:Araport11) |
AT3G24530 | AAA-type ATPase family protein / ankyrin repeat family protein;(source:Araport11) |
AT4G14780 | Protein kinase superfamily protein;(source:Araport11) |
AT2G14760 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G41860 | transposable_element_gene;(source:Araport11);contains InterPro domain Retrotransposon gag protein;(source:TAIR10) |
AT5G42670 | Agenet domain-containing protein;(source:Araport11) |
AT5G49110 | fanconi anemia group I-like protein;(source:Araport11) |
AT1G65810 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G03620 | MATE efflux family protein;(source:Araport11) |
AT2G32020 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT4G40045 | transmembrane protein;(source:Araport11) |
AT4G13230 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
AT3G60110 | DNA-binding bromodomain-containing protein;(source:Araport11) |
AT1G12630 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
AT5G45530 | transmembrane protein, putative (DUF594);(source:Araport11) |
AT3G19310 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
AT5G02660 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (DUF627 and DUF629);(source:Araport11) |
AT1G02990 | hypothetical protein;(source:Araport11) |
AT1G24050 | RNA-processing, Lsm domain-containing protein;(source:Araport11) |
AT5G23950 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT4G23000 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
AT3G07010 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G15790 | mediator of RNA polymerase II transcription subunit 15a-like protein;(source:Araport11) |
AT1G08870 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
AT3G33055 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-282 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G75394 | Pseudogene of AT2G31305 |
AT3G29180 | DUF1336 family protein (DUF1336);(source:Araport11) |
AT3G43770 | transposable_element_gene;(source:Araport11);similar to disease resistance protein (TIR-NBS-LRR class), putative [Arabidopsis thaliana] (TAIR:AT5G45230.1);(source:TAIR10) |
AT2G14200 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.0e-133 P-value blast match to gb|AAO73523.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT1G28100 | hypothetical protein;(source:Araport11) |
AT5G55507 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G13140 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G28070 | ATP-dependent RNA helicase;(source:Araport11) |
AT2G42480 | MATH domain/coiled-coil protein;(source:Araport11) |
AT3G17261 | transmembrane protein;(source:Araport11) |
AT4G31570 | nucleoporin;(source:Araport11) |
AT2G30115 | other_RNA;(source:Araport11) |
AT2G43880 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G37960 | myosin-M heavy protein;(source:Araport11) |
AT2G29260 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G44170 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G50380 | Prolyl oligopeptidase family protein;(source:Araport11) |
AT1G79030 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G78230 | Outer arm dynein light chain 1 protein;(source:Araport11) |
AT1G53040 | tRNA (met) cytidine acetyltransferase, putative (DUF616);(source:Araport11) |
AT5G03660 | transcriptional activator (DUF662);(source:Araport11) |
AT1G64650 | Major facilitator superfamily protein;(source:Araport11) |
AT3G28700 | NADH dehydrogenase ubiquinone complex I, assembly factor-like protein (DUF185);(source:Araport11) |
AT3G15260 | Protein phosphatase 2C family protein;(source:Araport11) |
AT5G22040 | ubiquitin carboxyl-terminal hydrolase;(source:Araport11) |
AT1G18990 | myosin-binding protein, putative (Protein of unknown function, DUF593);(source:Araport11) |
AT3G50800 | PADRE protein. |
AT3G09760 | RING/U-box superfamily protein;(source:Araport11) |
AT5G57123 | hypothetical protein;(source:Araport11) |
AT1G51890 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G15610 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G05050 | Protein kinase superfamily protein;(source:Araport11) |
AT3G06000 | RNI-like superfamily protein;(source:Araport11) |
AT3G19274 | hypothetical protein;(source:Araport11) |
AT4G12840 | GTPase Der (DUF707);(source:Araport11) |
AT5G54210 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G10090 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
AT2G24760 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.9e-16 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G11910 | hypothetical protein;(source:Araport11) |
AT5G28760 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G27160.1);(source:TAIR10) |
AT4G05500 | pseudogene of RNI-like superfamily protein;(source:Araport11) |
AT5G35830 | Ankyrin repeat family protein;(source:Araport11) |
AT2G38500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT1G36250 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 7.0e-18 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G36100 | transmembrane protein;(source:Araport11) |
AT5G49465 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.0e-21 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G36445 | transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBa0026J14.30, blastp match of 62%25 identity and 5.5e-108 P-value to GP|20146463|dbj|BAB89243.1||AP004231 OSJNBa0026J14.30 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT2G42140 | VQ motif-containing protein;(source:Araport11) |
AT1G58040 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-28 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT1G11850 | transmembrane protein;(source:Araport11) |
AT1G34600 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.1e-135 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT4G03020 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT5G61340 | transmembrane protein;(source:Araport11) |
AT2G04490 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT4G03420 | hypothetical protein (DUF789);(source:Araport11) |
AT3G14025 | pseudogene of scarecrow transcription factor family protein |
AT3G46170 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G13140 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT5G66607 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G73920 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G58007 | multidrug resistance protein;(source:Araport11) |
AT2G11400 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G70780 | hypothetical protein;(source:Araport11) |
AT5G24879 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G60480 | pseudogene of ADP-ribosylation factor A1E;(source:Araport11) |
AT5G18590 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT2G05020 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative transposable element, blastp match of 61%25 identity and 9.4e-140 P-value to GP|13122426|dbj|BAB32907.1||AP003047 putative transposable element {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT5G34830 | hypothetical protein;(source:Araport11) |
AT1G56100 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT5G62580 | ARM repeat superfamily protein;(source:Araport11) |
AT1G11905 | B-cell receptor-associated protein 31-like protein;(source:Araport11) |
AT2G20320 | DENN (AEX-3) domain-containing protein;(source:Araport11) |
AT3G23320 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT4G03460 | Ankyrin repeat family protein;(source:Araport11) |
AT1G30550 | S-adenosyl-L-methionine-dependent methyltransferase superfamily protein;(source:Araport11) |
AT4G16470 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G10730 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G35730 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT4G36610 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G17410 | Nucleoside diphosphate kinase family protein;(source:Araport11) |
AT2G19660 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G78476 | hypothetical protein;(source:Araport11) |
AT2G21840 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G46690 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G32360 | Zinc finger (CCCH-type) family protein;(source:Araport11) |
AT5G64650 | Ribosomal protein L17 family protein;(source:Araport11) |
AT2G02050 | NADH-ubiquinone oxidoreductase B18 subunit;(source:Araport11) |
AT1G20132 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G04680 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G32040 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G06603.1);(source:TAIR10) |
AT1G16950 | transmembrane protein;(source:Araport11) |
AT3G54680 | proteophosphoglycan-like protein;(source:Araport11) |
AT3G12370 | Ribosomal protein L10 family protein;(source:Araport11) |
AT5G44090 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT5G21100 | Plant L-ascorbate oxidase;(source:Araport11) |
AT1G31840 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G40020 | Myosin heavy chain-related protein;(source:Araport11) |
AT4G27700 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
AT1G13410 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G51238 | Natural antisense transcript overlaps with AT3G51240;(source:Araport11) |
AT1G08005 | serine/threonine-protein phosphatase 6 regulatory subunit;(source:Araport11) |
AT3G09310 | membrane protein insertion efficiency factor;(source:Araport11) |
AT3G30834 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-90 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G47330 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G26582 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.1e-42 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT1G70720 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT3G05975 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT2G45403 | hypothetical protein;(source:Araport11) |
AT5G13250 | RING finger protein;(source:Araport11) |
AT2G29010 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G29156 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.9e-175 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G49830 | pseudogene |
AT5G23155 | None;(source:Araport11) |
AT3G03790 | ankyrin repeat family protein / regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT3G16900 | LURP-one-like protein (DUF567);(source:Araport11) |
AT3G54460 | SNF2 domain-containing protein / helicase domain-containing protein / F-box family protein;(source:Araport11) |
AT3G43180 | RING/U-box superfamily protein;(source:Araport11) |
AT2G34360 | MATE efflux family protein;(source:Araport11) |
AT1G43000 | PLATZ transcription factor family protein;(source:Araport11) |
AT2G12500 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 6.8e-208 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G46460 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G08040 | trimethylguanosine synthase (DUF707);(source:Araport11) |
AT3G44805 | TRAF-like superfamily protein;(source:Araport11) |
AT1G68970 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
AT2G43210 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT5G03775 | pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10) |
AT3G30390 | Encodes a putative amino acid transporter. |
AT3G54520 | hypothetical protein;(source:Araport11) |
AT3G12350 | F-box family protein;(source:Araport11) |
AT1G63630 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G40745 | hypothetical protein;(source:Araport11) |
AT2G38090 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
AT5G25410 | transmembrane protein, putative (DUF239);(source:Araport11) |
AT5G58150 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G42395 | hypothetical protein;(source:Araport11) |
AT5G62110 | Homeodomain-like superfamily protein;(source:Araport11) |
AT3G24490 | Alcohol dehydrogenase transcription factor Myb/SANT-like family protein;(source:Araport11) |
AT1G02405 | proline-rich family protein;(source:Araport11) |
AT1G76960 | Unknown protein, contains WRKY40 binding motifs. |
AT3G42800 | AF-like protein;(source:Araport11) |
AT3G57120 | Protein kinase superfamily protein;(source:Araport11) |
AT4G08460 | hypothetical protein (DUF1644);(source:Araport11) |
AT2G38646 | hypothetical protein;(source:Araport11) |
AT4G00980 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
AT2G04360 | transmembrane protein;(source:Araport11) |
AT5G50110 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G54600 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT3G59980 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT2G19120 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G24460 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
AT2G02330 | pseudogene of phloem protein 2-B7;(source:Araport11) |
AT5G57887 | transmembrane protein;(source:Araport11) |
AT5G64970 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT2G34110 | hypothetical protein;(source:Araport11) |
AT5G46900 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT5G23380 | hypothetical protein (DUF789);(source:Araport11) |
AT1G23830 | transmembrane protein;(source:Araport11) |
AT3G26480 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT5G14830 | transposable_element_gene;(source:Araport11);retrotransposon family;(source:TAIR10) |
AT1G19450 | Major facilitator superfamily protein;(source:Araport11) |
AT4G01670 | hypothetical protein;(source:Araport11) |
AT1G26580 | ELM2 domain protein;(source:Araport11) |
AT3G48770 | ATP/DNA binding protein;(source:Araport11) |
AT3G07840 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G57670 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
AT1G24256 | hypothetical protein;(source:Araport11) |
AT3G49030 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT5G40690 | histone-lysine N-methyltransferase trithorax-like protein;(source:Araport11) |
AT4G07806 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-124 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT3G23605 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT5G61835 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT3G59845 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
AT2G04590 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-28 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT1G56270 | RPB1a;(source:Araport11) |
AT4G26660 | kinesin-like protein;(source:Araport11) |
AT1G20750 | RAD3-like DNA-binding helicase protein;(source:Araport11) |
AT3G18450 | PLAC8 family protein;(source:Araport11) |
AT4G24480 | Protein kinase superfamily protein;(source:Araport11) |
AT5G34707 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 5.6e-142 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G32410 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G07710.1);(source:TAIR10) |
AT4G09190 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G27505 | FBD-like domain family protein;(source:Araport11) |
AT4G34170 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT3G49601 | pre-mRNA-splicing factor;(source:Araport11) |
AT1G49470 | transmembrane epididymal protein (DUF716);(source:Araport11) |
AT4G08270 | glutathione S-transferase T3-like protein;(source:Araport11) |
AT5G67140 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT4G30910 | Cytosol aminopeptidase family protein;(source:Araport11) |
AT1G15165 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT3G42620 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G06690.1);(source:TAIR10) |
AT3G12510 | MADS-box family protein;(source:Araport11) |
AT1G22910 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G28510 | Optic atrophy 3 protein (OPA3);(source:Araport11) |
AT2G40420 | Encodes a putative amino acid transporter. |
AT1G21550 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT2G24460 | C3HC4-type RING finger protein;(source:Araport11) |
AT5G18840 | Major facilitator superfamily protein;(source:Araport11) |
AT5G05965 | cell wall RBR3-like protein;(source:Araport11) |
AT2G06830 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
AT5G41970 | Metal-dependent protein hydrolase;(source:Araport11) |
AT4G30470 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G25300 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT1G47765 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G28480 | RNA-binding CRS1 / YhbY (CRM) domain protein;(source:Araport11) |
AT5G10420 | MATE efflux family protein;(source:Araport11) |
AT3G05280 | Integral membrane Yip1 family protein;(source:Araport11) |
AT1G76728 | transmembrane protein;(source:Araport11) |
AT1G34042 | hypothetical protein;(source:Araport11) |
AT5G65850 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G11310 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
AT1G57550 | Low temperature and salt responsive protein family;(source:Araport11) |
AT3G48790 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT3G44096 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.8e-23 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G05635 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.6e-58 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G27180 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
AT5G53720 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G02640 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G01970 | Endomembrane protein 70 protein family;(source:Araport11) |
AT5G27440 | transmembrane protein;(source:Araport11) |
AT5G27290 | stress regulated protein;(source:Araport11) |
AT1G32730 | electron carrier/iron ion-binding protein;(source:Araport11) |
AT1G31983 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT1G22160 | senescence-associated family protein (DUF581);(source:Araport11) |
AT1G67860 | transmembrane protein;(source:Araport11) |
AT2G21655 | ECA1 gametogenesis family protein (DUF784);(source:Araport11) |
AT2G35920 | RNA helicase family protein;(source:Araport11) |
AT5G41071 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT3G18060 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT1G04210 | Encodes a putative Raf-related kinase. |
AT5G24760 | GroES-like zinc-binding dehydrogenase family protein;(source:Araport11) |
AT3G08820 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G13500 | transmembrane protein;(source:Araport11) |
AT3G04850 | Tesmin/TSO1-like CXC domain-containing protein;(source:Araport11) |
AT4G15520 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
AT4G30990 | ARM repeat superfamily protein;(source:Araport11) |
AT4G33100 | protein phosphatase;(source:Araport11) |
AT3G19085 | F-box/RNI/FBD-like domain protein;(source:Araport11) |
AT3G14830 | epstein-barr nuclear antigen;(source:Araport11) |
AT5G33432 | similar to En/Spm-like transposon |
AT5G17130 | cysteine-type peptidase;(source:Araport11) |
AT3G06895 | syntaxin KNOLLE-like protein;(source:Araport11) |
AT1G12440 | A20/AN1-like zinc finger family protein;(source:Araport11) |
AT5G28860 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G01031.1);(source:TAIR10) |
AT5G60090 | Protein kinase superfamily protein;(source:Araport11) |
AT4G20770 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G63130 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT1G49032 | hypothetical protein;(source:Araport11) |
AT5G29635 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 7.7e-111 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
AT1G22420 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G67856 | RING/U-box superfamily protein;(source:Araport11) |
AT3G42792 | transposable_element_gene;(source:Araport11);Mutator-related transposase, temporary automated functional assignment;(source:TAIR10) |
AT5G51840 | junctophilin-like protein;(source:Araport11) |
AT3G57590 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G29252 | pseudogene of short-chain dehydrogenase/reductase (SDR) family |
AT5G07685 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.0e-118 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
AT1G15770 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
AT5G27330 | Prefoldin chaperone subunit family protein;(source:Araport11) |
AT2G03230 | GCK domain-containing protein;(source:Araport11) |
AT2G14550 | pseudogene of RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G01740 | Mitochondrial ribosomal protein L37;(source:Araport11) |
AT2G19220 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
AT3G45252 | Encodes a ECA1 gametogenesis related family protein |
AT3G60770 | Ribosomal protein S13/S15;(source:Araport11) |
AT3G56080 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G35300 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.1e-38 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G23780 | Leucine rich extensin protein involved in cell wall biogenesis and organization. Interacts with several members of the RALF family of ligand peptides. |
AT2G31730 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G55896 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.7e-49 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G25360 | RING/U-box superfamily protein;(source:Araport11) |
AT2G33710 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
AT5G42320 | Zn-dependent exopeptidases superfamily protein;(source:Araport11) |
AT4G26130 | cotton fiber protein;(source:Araport11) |
AT3G28370 | spindle assembly checkpoint component;(source:Araport11) |
AT4G13575 | hypothetical protein;(source:Araport11) |
AT5G64500 | Major facilitator superfamily protein |
AT2G34290 | Protein kinase superfamily protein;(source:Araport11) |
AT4G14905 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G63170 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
AT1G43910 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G22840 | Protein kinase superfamily protein;(source:Araport11) |
AT3G05980 | hypothetical protein;(source:Araport11) |
AT1G21090 | Cupredoxin superfamily protein;(source:Araport11) |
AT4G07693 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.1e-44 P-value blast match to O22273 /233-373 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT1G13650 | hypothetical protein;(source:Araport11) |
AT3G09860 | actin T1-like protein;(source:Araport11) |
AT4G05586 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.3e-222 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT3G11690 | hypothetical protein;(source:Araport11) |
AT1G71691 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G48450 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
AT1G31790 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G22530 | Alkaline-phosphatase-like family protein;(source:Araport11) |
AT3G45673 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G22190 | hypothetical protein;(source:Araport11) |
AT5G37940 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
AT4G39860 | hematological/neurological-like protein;(source:Araport11) |
AT1G11370 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G22790 | Low affinity potassium transport system protein;(source:Araport11) |
AT3G49890 | hypothetical protein;(source:Araport11) |
AT4G05430 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT4G04547 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-68 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT1G29220 | transcriptional regulator family protein;(source:Araport11) |
AT4G15775 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
AT5G26620 | hypothetical protein;(source:Araport11) |
AT1G65875 | pseudogene of AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT3G25725 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.3e-213 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT5G44416 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.6e-75 P-value blast match to Q9SI25 /181-349 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT3G47110 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G22770 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT3G01060 | lysine-tRNA ligase;(source:Araport11) |
AT4G22285 | Ubiquitin C-terminal hydrolases superfamily protein;(source:Araport11) |
AT5G54940 | Translation initiation factor SUI1 family protein;(source:Araport11) |
AT3G07310 | phosphoserine aminotransferase, putative (DUF760);(source:Araport11) |
AT5G65960 | GTP binding protein;(source:Araport11) |
AT1G63290 | Aldolase-type TIM barrel family protein;(source:Araport11) |
AT2G26450 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT4G06641 | Pseudogene of AT5G01080; beta-galactosidase |
AT3G58165 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
AT2G42420 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
AT2G41020 | WW domain-containing protein;(source:Araport11) |
AT5G56530 | tRNA-splicing ligase (DUF239);(source:Araport11) |
AT3G14475 | snoRNA;(source:Araport11) |
AT5G52280 | Myosin heavy chain-related protein;(source:Araport11) |
AT5G41770 | crooked neck protein, putative / cell cycle protein;(source:Araport11) |
AT4G37660 | Ribosomal protein L12/ ATP-dependent Clp protease adaptor protein ClpS family protein;(source:Araport11) |
AT5G52010 | C2H2-like zinc finger protein;(source:Araport11) |
AT3G06170 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
AT2G39805 | Integral membrane Yip1 family protein;(source:Araport11) |
AT5G37310 | Endomembrane protein 70 protein family;(source:Araport11) |
AT4G22960 | FAM63A-like protein (DUF544);(source:Araport11) |
AT4G05310 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT5G23212 | Encodes a defensin-like (DEFL) family protein. |
AT5G38580 | FBD-like domain family protein;(source:Araport11) |
AT1G65370 | TRAF-like family protein;(source:Araport11) |
AT1G32375 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G35736 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G14530 | agamous-like MADS-box protein;(source:Araport11) |
AT1G25500 | Plasma-membrane choline transporter family protein;(source:Araport11) |
AT3G54160 | RNI-like superfamily protein;(source:Araport11) |
AT4G34380 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G30345 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
AT1G30515 | GATA zinc finger protein;(source:Araport11) |
AT1G08315 | ARM repeat superfamily protein;(source:Araport11) |
AT1G32220 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G04130 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT3G42690.1);(source:TAIR10) |
AT3G44980 | hypothetical protein;(source:Araport11) |
AT3G32968 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.2e-26 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT1G73440 | calmodulin-like protein;(source:Araport11) |
AT3G27910 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G51530 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G05071 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G19150 | AT5G19150 is a dehydratase that converts (S)-NAD(P)HX to NAD(P)H. |
AT1G61170 | hypothetical protein;(source:Araport11) |
AT5G11840 | YCF36, putative (DUF1230);(source:Araport11) |
AT1G17030 | hypothetical protein;(source:Araport11) |
AT2G14950 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.5e-57 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G00160 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G12930 | inactive rhomboid protein;(source:Araport11) |
AT1G52950 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT3G24260 | paired amphipathic helix Sin3-like protein;(source:Araport11) |
AT1G16790 | ribosomal protein-like protein;(source:Araport11) |
AT1G33250 | beta-1,3-n-acetylglucosaminyltransferase radical fringe protein, putative (DUF604);(source:Araport11) |
AT1G64850 | Calcium-binding EF hand family protein;(source:Araport11) |
AT2G36325 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G27425 | Encodes a ECA1 gametogenesis related family protein |
AT3G16510 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT2G05350 | hypothetical protein;(source:Araport11) |
AT3G19390 | Granulin repeat cysteine protease family protein;(source:Araport11) |
AT5G54585 | hypothetical protein;(source:Araport11) |
AT2G16520 | RING/U-box protein with C6HC-type zinc finger protein;(source:Araport11) |
AT1G35700 | pseudogene of ubiquitin-conjugating enzyme 11;(source:Araport11) |
AT5G42280 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G20380 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT2G14070 | wound-responsive protein-like protein;(source:Araport11) |
AT2G13118 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 4.3e-08 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G29187 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.2e-08 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G19580 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT3G30867 | pseudogene of EAP30/Vps36 family protein;(source:Araport11) |
AT3G04990 | intracellular protein transporter;(source:Araport11) |
AT2G33435 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G25950 | AslB, putative (DUF239);(source:Araport11) |
AT2G23755 | transmembrane family 220 helix protein;(source:Araport11) |
AT3G49550 | hypothetical protein;(source:Araport11) |
AT1G77290 | Glutathione S-transferase family protein;(source:Araport11) |
AT2G22805 | Encodes a defensin-like (DEFL) family protein. |
AT2G28960 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G68930 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
AT5G64850 | sorbin/SH3 domain protein;(source:Araport11) |
AT4G33170 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G20160 | golgin family A protein;(source:Araport11) |
AT3G14560 | Its transcript is targeted by miR824. |
AT1G15840 | hypothetical protein;(source:Araport11) |
AT1G29840 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G19670 | RING/U-box superfamily protein;(source:Araport11) |
AT4G09965 | hypothetical protein;(source:Araport11) |
AT4G20920 | double-stranded RNA-binding domain (DsRBD)-containing protein;(source:Araport11) |
AT3G22555 | pseudogene of putative DNA methyltransferase;(source:Araport11) |
AT5G17040 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT5G41280 | Receptor-like protein kinase-related family protein;(source:Araport11) |
AT3G49970 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT1G50190 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G18755 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT5G28692 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.9e-66 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT2G01220 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
AT5G22870 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT5G38250 | Protein kinase family protein;(source:Araport11) |
AT4G29990 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
AT5G18800 | Cox19-like CHCH family protein;(source:Araport11) |
AT5G18510 | Aminotransferase-like, plant mobile domain family protein;(source:Araport11) |
AT2G01560 | Plant protein 1589 of unknown function;(source:Araport11) |
AT3G05937 | hypothetical protein;(source:Araport11) |
AT1G26950 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT5G33360.1);(source:TAIR10) |
AT2G28690 | TOX high mobility group box protein, putative (DUF1635);(source:Araport11) |
AT2G30150 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G59850 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G11240 | ribosomal RNA-processing protein;(source:Araport11) |
AT2G34190 | Xanthine/uracil permease family protein;(source:Araport11) |
AT2G23910 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G65120 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT3G52470 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT5G47020 | MraZ;(source:Araport11) |
AT4G05053 | pseudogene of ATRCY1 (arginine-rich cyclin) |
AT3G24542 | Beta-galactosidase related protein;(source:Araport11) |
AT1G33470 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G28491 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G62850 | Class I peptide chain release factor;(source:Araport11) |
AT5G07640 | RING/U-box superfamily protein;(source:Araport11) |
AT5G53750 | CBS domain-containing protein;(source:Araport11) |
AT3G54366 | Unknown gene The mRNA is cell-to-cell mobile. |
AT2G28970 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G19360 | SCD6 protein-like protein;(source:Araport11) |
AT3G59610 | F-box family protein / jacalin lectin family protein;(source:Araport11) |
AT2G15500 | RNA-binding protein;(source:Araport11) |
AT5G06060 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G28400 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT5G44630 | Encodes a sesquiterpene synthase involved in generating all of the group B sesquiterpenes found in the Arabidopsis floral volatile blend. Strongly expressed in intrafloral nectaries. |
AT1G10890 | arginine/glutamate-rich 1 protein;(source:Araport11) |
AT3G18150 | RNI-like superfamily protein;(source:Araport11) |
AT3G20620 | F-box family protein-like protein;(source:Araport11) |
AT1G50890 | ARM repeat superfamily protein;(source:Araport11) |
AT4G11400 | ARID/BRIGHT DNA-binding , ELM2 domain and myb-like DNA-binding domain-containing protein;(source:Araport11) |
AT4G14548 | other_RNA;(source:Araport11) |
AT1G57770 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
AT1G63400 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G51790 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G35805 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G01700.1);(source:TAIR10) |
AT2G21530 | SMAD/FHA domain-containing protein;(source:Araport11) |
AT2G43740 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT5G44010 | fanconi anemia group F protein (FANCF);(source:Araport11) |
AT2G35215 | plant/protein;(source:Araport11) |
AT3G24070 | Zinc knuckle (CCHC-type) family protein;(source:Araport11) |
AT2G36360 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G45200 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT4G29630 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
AT5G07800 | Flavin-binding monooxygenase family protein;(source:Araport11) |
AT3G18310 | TATA box-binding protein associated factor RNA polymerase I subunit C;(source:Araport11) |
AT1G72820 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT1G31110 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
AT1G71015 | PADRE protein. |
AT1G51310 | tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase;(source:Araport11) |
AT1G01770 | propionyl-CoA carboxylase;(source:Araport11) |
AT3G52460 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G51040 | Protein kinase superfamily protein;(source:Araport11) |
AT4G08800 | Protein kinase superfamily protein;(source:Araport11) |
AT5G59400 | PGR5-like A protein;(source:Araport11) |
AT1G42440 | pre-rRNA-processing TSR1-like protein;(source:Araport11) |
AT5G42220 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT5G44590 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G34920 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
AT1G29240 | transcription initiation factor TFIID subunit, putative (DUF688);(source:Araport11) |
AT5G47455 | hypothetical protein;(source:Araport11) |
AT1G76580 | Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein;(source:Araport11) |
AT4G21910 | MATE efflux family protein;(source:Araport11) |
AT1G24640 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-37 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G61795 | PAK-box/P21-Rho-binding family protein;(source:Araport11) |
AT2G44970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G56570 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT1G32140 | F-box family protein;(source:Araport11) |
AT3G12880 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G77830 | RING/U-box superfamily protein;(source:Araport11) |
AT2G32110 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
AT3G08600 | transmembrane protein, putative (DUF1191);(source:Araport11) |
AT2G33845 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT5G65740 | zinc ion binding protein;(source:Araport11) |
AT1G78865 | other_RNA;(source:Araport11) |
AT5G24220 | Lipase class 3-related protein;(source:Araport11) |
AT2G01160 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
AT4G16100 | heat shock protein, putative (DUF789);(source:Araport11) |
AT5G35560 | DENN (AEX-3) domain-containing protein;(source:Araport11) |
AT2G24625 | Encodes a defensin-like (DEFL) family protein. |
AT4G16530 | hypothetical protein;(source:Araport11) |
AT2G01240 | reticulon-like protein B15;(source:Araport11) |
AT5G43175 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT2G05640 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, low similarity to SP|Q9UUA2 DNA repair and recombination protein pif1, mitochondrial precursor {Schizosaccharomyces pombe};(source:TAIR10) |
AT5G42740 | Sugar isomerase (SIS) family protein;(source:Araport11) |
AT2G35945 | Natural antisense transcript overlaps with AT2G35940;(source:Araport11) |
AT1G51035 | hypothetical protein;(source:Araport11) |
AT1G78095 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 5.0e-45 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT4G36120 | filament-like protein (DUF869);(source:Araport11) |
AT3G25495 | pseudogene of leucine-rich repeat protein |
AT4G08555 | hypothetical protein;(source:Araport11) |
AT2G33090 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
AT4G03100 | Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11) |
AT1G75870 | hypothetical protein;(source:Araport11) |
AT2G44120 | Ribosomal protein L30/L7 family protein;(source:Araport11) |
AT3G52990 | Pyruvate kinase family protein;(source:Araport11) |
AT1G18120 | pseudogene of GDSL-like lipase/acylhydrolase superfamily protein;(source:Araport11) |
AT5G45120 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G46840 | F-box family protein;(source:Araport11) |
AT4G33370 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT5G53960 | Mid-1-related chloride channel domain-containing protein;(source:Araport11) |
AT5G34847 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.0e-27 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT2G31080 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.3e-49 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G05110 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.6e-51 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G59300 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G49520 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G80230 | Rubredoxin-like superfamily protein;(source:Araport11) |
AT1G14450 | NADH dehydrogenase (ubiquinone)s;(source:Araport11) |
AT3G10980 | PLAC8 family protein;(source:Araport11) |
AT2G35570 | pseudogene of Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
AT4G10370 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G29755 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.5e-180 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT5G01335 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.4e-29 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G46360 | transmembrane protein;(source:Araport11) |
AT5G43450 | encodes a protein whose sequence is similar to ACC oxidase |
AT4G39952 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G33058 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-112 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G27752 | Ubiquitin system component Cue protein;(source:Araport11) |
AT4G30650 | Low temperature and salt responsive protein family;(source:Araport11) |
AT1G66650 | Protein with RING/U-box and TRAF-like domain;(source:Araport11) |
AT5G49260 | hypothetical protein;(source:Araport11) |
AT1G24388 | hypothetical protein;(source:Araport11) |
AT2G34357 | ARM repeat superfamily protein;(source:Araport11) |
AT3G14600 | Ribosomal protein L18ae/LX family protein;(source:Araport11) |
AT1G04380 | encodes a protein similar to a 2-oxoglutarate-dependent dioxygenase |
AT1G71810 | Protein kinase superfamily protein;(source:Araport11) |
AT5G36960 | hypothetical protein;(source:Araport11) |
AT2G37810 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G36240 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
AT2G38790 | hypothetical protein;(source:Araport11) |
AT5G61290 | Flavin-binding monooxygenase family protein;(source:Araport11) |
AT1G61350 | ARM repeat superfamily protein;(source:Araport11) |
AT1G30190 | cotton fiber protein;(source:Araport11) |
AT5G45630 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT2G47740 | pre-tRNA tRNA-Gly (anticodon: CCC);(source:Araport11, TAIR10) |
AT3G17570 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G25720 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT5G07215 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.9e-34 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G14240 | Thioredoxin superfamily protein;(source:Araport11) |
AT5G46160 | Ribosomal protein L14p/L23e family protein;(source:Araport11) |
AT2G15870 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G77960 | repressor ROX1-like protein;(source:Araport11) |
AT4G16140 | proline-rich family protein;(source:Araport11) |
AT5G54360 | C2H2-like zinc finger protein;(source:Araport11) |
AT3G29680 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT1G26270 | Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11) |
AT1G09750 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G31350 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT2G21640 | Encodes a protein of unknown function that is a marker for oxidative stress response.Expression in rosette leaves is activated by high concentration of boron. |
AT5G54130 | Calcium-binding endonuclease/exonuclease/phosphatase family;(source:Araport11) |
AT3G57910 | D111/G-patch domain-containing protein;(source:Araport11) |
AT5G65207 | hypothetical protein;(source:Araport11) |
AT5G46300 | hypothetical protein;(source:Araport11) |
AT1G52870 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
AT4G01455 | tRNA-Glu (anticodon: TTC) |
AT4G13580 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT1G05790 | lipase class 3 family protein;(source:Araport11) |
AT1G02320 | hypothetical protein;(source:Araport11) |
AT1G61890 | MATE efflux family protein;(source:Araport11) |
AT1G63300 | Myosin heavy chain-related protein;(source:Araport11) |
AT1G55360 | tRNA-splicing ligase (DUF239);(source:Araport11) |
AT5G16453 | Encodes a defensin-like (DEFL) family protein. |
AT5G52650 | RNA binding Plectin/S10 domain-containing protein;(source:Araport11) |
AT5G26622 | Beta-galactosidase related protein;(source:Araport11) |
AT2G44230 | hypothetical protein (DUF946);(source:Araport11) |
AT4G24050 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G01710 | methyltransferase;(source:Araport11) |
AT1G30320 | Remorin family protein;(source:Araport11) |
AT4G08690 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT1G33780 | electron transporter, putative (DUF179);(source:Araport11) |
AT1G63980 | D111/G-patch domain-containing protein;(source:Araport11) |
AT1G70360 | F-box family protein;(source:Araport11) |
AT2G38590 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G16225 | Encodes a Maternally expressed gene (MEG) family protein |
AT5G37790 | Protein kinase superfamily protein;(source:Araport11) |
AT4G14360 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G50290 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT5G48610 | myb-like protein X;(source:Araport11) |
AT1G29540 | LOW protein: protein BOBBER-like protein;(source:Araport11) |
AT1G06700 | Protein kinase superfamily protein;(source:Araport11) |
AT3G11000 | DCD (Development and Cell Death) domain protein;(source:Araport11) |
AT3G08910 | DNAJ heat shock family protein;(source:Araport11) |
AT1G48660 | Auxin-responsive GH3 family protein;(source:Araport11) |
AT2G32179 | Natural antisense transcript overlaps with AT2G32180;(source:Araport11) |
AT2G16405 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G05630 | B3 domain protein;(source:Araport11) |
AT1G73090 | WD repeat protein;(source:Araport11) |
AT3G03610 | ELMO/CED-12 family protein;(source:Araport11) |
AT5G24200 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G23470 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT3G04010 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT3G48960 | Ribosomal protein L13e family protein;(source:Araport11) |
AT1G69430 | Son of sevenless protein;(source:Araport11) |
AT5G66675 | transmembrane protein, putative (DUF677);(source:Araport11) |
AT3G13674 | hypothetical protein;(source:Araport11) |
AT4G29120 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
AT5G43745 | ion channel POLLUX-like protein, putative (DUF1012);(source:Araport11) |
AT1G05061 | Pseudogene of AT2G32630; pentatricopeptide (PPR) repeat-containing protein |
AT5G25990 | core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT4G10925 | Nuclear transport factor 2 (NTF2) family protein;(source:Araport11) |
AT4G22460 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G11572 | Encodes a Plant thionin family protein |
AT1G04490 | hypothetical protein (DUF3527);(source:Araport11) |
AT4G02465 | hypothetical protein;(source:Araport11) |
AT4G13572 | hypothetical protein;(source:Araport11) |
AT4G36010 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT2G28680 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT5G42680 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT5G08090 | transmembrane protein;(source:Araport11) |
AT1G12510 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT2G02030 | F-box family protein;(source:Araport11) |
AT3G05160 | Major facilitator superfamily protein;(source:Araport11) |
AT5G40640 | transmembrane protein;(source:Araport11) |
AT4G26030 | C2H2-like zinc finger protein;(source:Araport11) |
AT1G61240 | lysine ketoglutarate reductase trans-splicing-like protein (DUF707);(source:Araport11) |
AT2G28270 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G13264 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.3e-23 P-value blast match to Q9S9L1 /206-367 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT3G06530 | ARM repeat superfamily protein;(source:Araport11) |
AT5G17280 | oxidoreductase-like protein, amino-terminal protein;(source:Araport11) |
AT3G17500 | F-box family protein;(source:Araport11) |
AT5G18950 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G15520 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT5G36270 | Annotated as pseudogene of dehydroascorbate reductase. Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT2G28780 | P-hydroxybenzoic acid efflux pump subunit;(source:Araport11) |
AT3G29772 | transposable_element_gene;(source:Araport11);pseudogene, similar to B1129H01.3, blastp match of 51%25 identity and 1.2e-59 P-value to GP|20161194|dbj|BAB90121.1||AP003370 B1129H01.3 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT3G27180 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G09876 | hypothetical protein;(source:Araport11) |
AT5G32460 | Transcriptional factor B3 family protein;(source:Araport11) |
AT1G05740 | FAM136A-like protein (DUF842);(source:Araport11) |
AT3G49510 | F-box family protein;(source:Araport11) |
AT2G10130 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 35%25 identity and 4.0e-70 P-value to GP|21952510|gb|AAM82604.1|AF525305_2|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10) |
AT1G73970 | obscurin-like protein;(source:Araport11) |
AT1G61830 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G06630 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G26110 | Protein kinase superfamily protein;(source:Araport11) |
AT4G14743 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT5G43310 | COP1-interacting protein-like protein;(source:Araport11) |
AT3G13700 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G34790 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.9e-11 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G10620 | methyltransferase;(source:Araport11) |
AT2G05270 | hypothetical protein;(source:Araport11) |
AT1G74750 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G12010 | C18orf8;(source:Araport11) |
AT2G16760 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT1G35510 | O-fucosyltransferase family protein;(source:Araport11) |
AT4G22720 | Actin-like ATPase superfamily protein;(source:Araport11) |
AT3G30727 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.6e-10 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT1G35950 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G05084.1);(source:TAIR10) |
AT4G27620 | intracellular protein transporter;(source:Araport11) |
AT5G39861 | pseudogene of receptor kinase 3;(source:Araport11) |
AT4G17612 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT5G28671 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G17670 | senescence-associated family protein (DUF581);(source:Araport11) |
AT1G61740 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
AT5G25020 | enhanced disease resistance-like protein (DUF1336);(source:Araport11) |
AT3G29310 | calmodulin-binding protein-like protein;(source:Araport11) |
AT5G28200 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, various predicted proteins, Arabidopsis thaliana;(source:TAIR10) |
AT5G62623 | Encodes a defensin-like (DEFL) family protein. |
AT4G10930 | RING/U-box protein;(source:Araport11) |
AT2G44198 | hypothetical protein;(source:Araport11) |
AT2G23710 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G09370.1);(source:TAIR10) |
AT5G10850 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / zinc ion binding [Arabidopsis thaliana] (TAIR:AT2G01050.1);(source:TAIR10) |
AT5G06685 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
AT1G25988 | coiled-coil protein, putative (DUF572);(source:Araport11) |
AT4G02005 | None;(source:Araport11) |
AT2G03570 | hypothetical protein;(source:Araport11) |
AT1G33030 | O-methyltransferase family protein;(source:Araport11) |
AT1G77730 | Pleckstrin homology (PH) domain superfamily protein;(source:Araport11) |
AT5G03370 | acylphosphatase family;(source:Araport11) |
AT5G52605 | Encodes a defensin-like (DEFL) family protein. |
AT5G02435 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT1G70770 | Involved in cell wall modifications resulting in resistance to the biotroph Hpa. |
AT4G30100 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G37540 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G08945 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.2e-16 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT3G01230 | splicing regulatory glutamine/lysine-rich-like protein;(source:Araport11) |
AT3G25150 | Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein;(source:Araport11) |
AT1G44050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G38710 | AMMECR1 family;(source:Araport11) |
AT1G49610 | F-box family protein;(source:Araport11) |
AT1G14390 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G32445 | pseudogene of 2-isopropylmalate synthase 1;(source:Araport11) |
AT3G51950 | Contains single CCCH domain. |
AT1G11170 | lysine ketoglutarate reductase trans-splicing-like protein (DUF707);(source:Araport11) |
AT1G75261 | Pseudogene of AT4G39230; isoflavone reductase, putative |
AT4G37110 | Zinc-finger domain of monoamine-oxidase A repressor R1;(source:Araport11) |
AT3G58860 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G43521 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
AT3G57460 | catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding protein;(source:Araport11) |
AT4G02740 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT2G42290 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G11925 | Encodes a Stigma-specific Stig1 family protein |
AT1G52085 | pseudogene of Mannose-binding lectin superfamily protein;(source:Araport11) |
AT5G38130 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT3G06870 | proline-rich family protein;(source:Araport11) |
AT2G38430 | hypothetical protein;(source:Araport11) |
AT4G08145 | transposable_element_gene;(source:Araport11);hypothetical protein, contains Pfam domain, PF04827: Protein of unknown function (DUF635);(source:TAIR10) |
AT4G00890 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
AT1G35640 | transposable_element_gene;(source:Araport11) |
AT3G54880 | zinc finger protein;(source:Araport11) |
AT5G48510 | BTB/POZ domain-containing protein;(source:Araport11) |
AT2G41950 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
AT1G55230 | proteinase inhibitor I4, serpin (DUF716);(source:Araport11) |
AT2G42920 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT5G30495 | Fcf2 pre-rRNA processing protein;(source:Araport11) |
AT2G24140 | myosin-J heavy chain-like protein (Protein of unknown function, DUF593);(source:Araport11) |
AT4G07940 | pre-mRNA-splicing factor CWC22-like protein, putative (DUF3245);(source:Araport11) |
AT5G42840 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G67520 | lectin protein kinase family protein;(source:Araport11) |
AT5G05430 | RNA-binding protein;(source:Araport11) |
AT2G02870 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G47940 | 40S ribosomal protein S27;(source:Araport11) |
AT1G67626 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G19620 | Glycosyl hydrolase family protein;(source:Araport11) |
AT1G26799 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT3G42724 | pseudogene of F-box/RNI-like superfamily protein;(source:Araport11) |
AT1G57860 | Translation protein SH3-like family protein;(source:Araport11) |
AT2G20070 | defensin-like protein;(source:Araport11) |
AT1G18382 | Natural antisense transcript overlaps with AT1G18380;(source:Araport11) |
AT3G09250 | Nuclear transport factor 2 (NTF2) family protein;(source:Araport11) |
AT2G24350 | RNA binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G25510 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G59460 | F-box/LRR protein;(source:Araport11) |
AT1G42040 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT2G36630 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
AT3G43880 | hypothetical protein;(source:Araport11) |
AT3G49330 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G68630 | PLAC8 family protein;(source:Araport11) |
AT5G56120 | RNA polymerase II elongation factor;(source:Araport11) |
AT1G12320 | ankyrin repeat/KH domain protein (DUF1442);(source:Araport11) |
AT1G34420 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
AT5G27010 | ARM repeat superfamily protein;(source:Araport11) |
AT1G74640 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G59200 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT4G27300 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G68780 | RNI-like superfamily protein;(source:Araport11) |
AT3G26720 | Glycosyl hydrolase family 38 protein;(source:Araport11) |
AT5G50030 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G07470 | Transcription factor IIA, alpha/beta subunit;(source:Araport11) |
AT4G04790 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G29280 | hypothetical protein;(source:Araport11) |
AT3G23145 | ATP binding / aminoacyl-tRNA ligase/ nucleotide binding protein;(source:Araport11) |
AT1G32880 | ARM repeat superfamily protein;(source:Araport11) |
AT5G20860 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT4G08450 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT2G04510 | pseudogene of ribonuclease H;(source:Araport11) |
AT4G22190 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
AT4G11670 | DNA topoisomerase 4 subunit B (DUF810);(source:Araport11) |
AT3G55605 | Mitochondrial glycoprotein family protein;(source:Araport11) |
AT3G09020 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
AT4G31196 | oxidoreductase;(source:Araport11) |
AT5G28180 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT3G51510 | transmembrane protein;(source:Araport11) |
AT4G11450 | bromo-adjacent domain protein, putative (DUF3527);(source:Araport11) |
AT4G31150 | endonuclease V family protein;(source:Araport11) |
AT4G34300 | Encodes protein with 14.7% glycine residues, similar to auxin response factor 30 (GI:20145855) {Arabidopsis thaliana} |
AT2G18721 | hypothetical protein;(source:Araport11) |
AT2G41190 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT2G17920 | nucleic acid binding / zinc ion binding protein;(source:Araport11) |
AT3G03510 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT5G19850 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G19250 | Glycoprotein membrane precursor GPI-anchored;(source:Araport11) |
AT4G22740 | glycine-rich protein;(source:Araport11) |
AT4G23515 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
AT1G68240 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT2G29160 | pseudogene of senescence-associated gene 13;(source:Araport11) |
AT1G20720 | RAD3-like DNA-binding helicase protein;(source:Araport11) |
AT1G53610 | transmembrane protein;(source:Araport11) |
AT1G65280 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT3G22970 | hypothetical protein (DUF506);(source:Araport11) |
AT1G79120 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT5G11910 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G21570 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT1G80630 | RNI-like superfamily protein;(source:Araport11) |
AT5G51080 | RNase H family protein;(source:Araport11) |
AT5G46010 | Homeodomain-like superfamily protein;(source:Araport11) |
AT1G13609 | Encodes a defensin-like (DEFL) family protein. |
AT3G28865 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.8e-16 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G19460 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT4G03911 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G69400 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G28330 | F-box family protein-like protein;(source:Araport11) |
AT2G40815 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT3G42650 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 7.9e-100 P-value blast match to At1g36190.1/92-340 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G19080 | metaxin-like protein;(source:Araport11) |
AT1G73230 | Nascent polypeptide-associated complex NAC;(source:Araport11) |
AT5G27770 | Ribosomal L22e protein family;(source:Araport11) |
AT1G18410 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G14990 | transmembrane protein;(source:Araport11) |
AT3G53190 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G22540 | hypothetical protein (DUF1677);(source:Araport11) |
AT5G03620 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
AT1G02270 | Calcium-binding endonuclease/exonuclease/phosphatase family;(source:Araport11) |
AT5G25840 | DUF1677 family protein (DUF1677);(source:Araport11) |
AT1G48390 | RNI-like superfamily protein;(source:Araport11) |
AT2G22150 | pseudogene of TRAF-like family protein;(source:Araport11) |
AT5G02690 | hypothetical protein;(source:Araport11) |
AT5G05240 | cation-transporting ATPase;(source:Araport11) |
AT1G73810 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT3G42255 | transposable_element_gene;(source:Araport11);pseudogene, similar to Hypothetical protein with similarity to putative Ac-like transposases, similar to Ac-like transposase;(source:TAIR10) |
AT4G21745 | PAK-box/P21-Rho-binding family protein;(source:Araport11) |
AT5G64430 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT1G51540 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G22440 | Ribosomal protein L1p/L10e family;(source:Araport11) |
AT1G13470 | hypothetical protein (DUF1262);(source:Araport11) |
AT1G47770 | Beta-galactosidase related protein;(source:Araport11) |
AT1G34560 | hypothetical protein (DUF1184);(source:Araport11) |
AT4G31030 | Putative membrane lipoprotein;(source:Araport11) |
AT3G12860 | NOP56-like pre RNA processing ribonucleoprotein;(source:Araport11) |
AT1G07190 | Lon protease;(source:Araport11) |
AT1G24267 | bZIP transcription factor, putative (DUF1664);(source:Araport11) |
AT1G17830 | hypothetical protein (DUF789);(source:Araport11) |
AT4G08090 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.4e-12 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G28600 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10) |
AT1G53120 | RNA-binding S4 domain-containing protein;(source:Araport11) |
AT1G13230 | Encodes a leucine-rich repeat protein pii-2. Located in the endoplasmic reticulum/plasma membrane continuum in Arabidopsis roots. Required for growth promotion and enhanced seed production mediated by the endophytic fungus Piriformospora indica in Arabidopsis. |
AT2G36650 | CHUP1-like protein;(source:Araport11) |
AT2G19850 | transcription repressor;(source:Araport11) |
AT2G20495 | Serine/Threonine-kinase;(source:Araport11) |
AT3G23270 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
AT1G79060 | TPRXL;(source:Araport11) |
AT4G04693 | pseudogene of F-box family protein;(source:Araport11) |
AT4G24600 | hypothetical protein;(source:Araport11) |
AT4G14650 | hypothetical protein;(source:Araport11) |
AT1G21323 | dual specificity kinase;(source:Araport11) |
AT5G03890 | PADRE protein up-regulated after infection by S. sclerotiorum. |
AT1G26208 | Natural antisense transcript overlaps with AT1G26210;(source:Araport11) |
AT2G28671 | hypothetical protein;(source:Araport11) |
AT1G20970 | calponin-like domain protein;(source:Araport11) |
AT3G62710 | Glycosyl hydrolase family protein;(source:Araport11) |
AT5G28235 | Ulp1 protease family protein;(source:Araport11) |
AT2G05914 | Potential natural antisense gene, locus overlaps with AT2G05915 |
AT1G78800 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT4G24973 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT3G24255 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT1G80020 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.0e-62 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G55690 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT5G04420 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G14190 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
AT1G63580 | Encodes a plasma membrane-localized protein with two DUF26 domains and a GPI anchor domain. |
AT1G27430 | GYF domain-containing protein;(source:Araport11) |
AT5G50270 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT1G33615 | None;(source:Araport11) |
AT5G58784 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
AT2G18900 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G06670 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.4e-141 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT2G41040 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G28811 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G41780 | myosin heavy chain-like protein;(source:Araport11) |
AT2G23650 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
AT4G26470 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT5G14900 | helicase associated (HA2) domain-containing protein;(source:Araport11) |
AT3G58800 | secretion-regulating guanine nucleotide exchange factor;(source:Araport11) |
AT2G06045 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.2e-12 P-value blast match to GB:AAC02672 polyprotein (Ty1_Copia-element) (Arabidopsis arenosa);(source:TAIR10) |
AT2G41780 | hypothetical protein;(source:Araport11) |
AT5G61970 | signal recognition particle-related / SRP-like protein;(source:Araport11) |
AT5G35555 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.1e-177 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT2G45860 | hypothetical protein;(source:Araport11) |
AT1G28190 | PADRE protein up-regulated after infection by S. sclerotiorum. |
AT2G25460 | EEIG1/EHBP1 protein amino-terminal domain protein;(source:Araport11) |
AT3G09035 | Concanavalin A-like lectin family protein;(source:Araport11) |
AT2G36540 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G35405 | Encodes a ECA1 gametogenesis related family protein |
AT4G24350 | Phosphorylase superfamily protein;(source:Araport11) |
AT4G21140 | copper ion-binding protein;(source:Araport11) |
AT2G35850 | transmembrane protein;(source:Araport11) |
AT2G11530 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.4e-24 P-value blast match to Q9SI25 /181-349 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT3G01345 | Expressed protein;(source:Araport11) |
AT1G79990 | coatomer subunit beta-2;(source:Araport11) |
AT3G24110 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT5G66150 | Glycosyl hydrolase family 38 protein;(source:Araport11) |
AT5G52390 | PAR1 protein;(source:Araport11) |
AT1G56420 | antigenic heat-stable protein;(source:Araport11) |
AT3G15780 | transmembrane protein;(source:Araport11) |
AT4G32050 | neurochondrin family protein;(source:Araport11) |
AT3G12340 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT1G58320 | PLAC8 family protein;(source:Araport11) |
AT1G62030 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G20780 | Major facilitator superfamily protein;(source:Araport11) |
AT3G53590 | LRR receptor-like Serine/Threonine-kinase;(source:Araport11) |
AT1G05660 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G05300 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
AT1G02360 | Chitinase family protein;(source:Araport11) |
AT2G39580 | zinc finger C3H1 domain protein;(source:Araport11) |
AT5G60680 | transcription initiation factor TFIID subunit (Protein of unknown function, DUF584);(source:Araport11) |
AT1G32110 | pseudogene of DNA-directed RNA polymerase family protein;(source:Araport11) |
AT5G07650 | Actin-binding FH2 protein;(source:Araport11) |
AT3G30705 | transmembrane protein;(source:Araport11) |
AT3G62790 | NADH-ubiquinone oxidoreductase-like protein;(source:Araport11) |
AT5G15300 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G09790 | pseudogene of the F-box family protein |
AT1G50340 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT3G13061 | Natural antisense transcript overlaps with AT3G13060;(source:Araport11) |
AT4G21215 | transmembrane protein;(source:Araport11) |
AT4G16330 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT3G03570 | signal transducer, putative (DUF3550/UPF0682);(source:Araport11) |
AT1G67540 | transmembrane protein;(source:Araport11) |
AT3G23740 | hypothetical protein;(source:Araport11) |
AT2G13430 | hypothetical protein;(source:Araport11) |
AT2G27060 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G02590 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G37480 | hypothetical protein;(source:Araport11) |
AT3G07250 | RNA-binding (RRM-RBD-RNP motif) domain nuclear transport factor 2 family protein;(source:Araport11) |
AT5G09710 | Magnesium transporter CorA-like family protein;(source:Araport11) |
AT1G23500 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G07730 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT5G62080 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G01440 | hypothetical protein (DUF3133);(source:Araport11) |
AT1G80850 | DNA glycosylase superfamily protein;(source:Araport11) |
AT4G36808 | Natural antisense transcript overlaps with AT4G36810;(source:Araport11) |
AT3G19055 | hypothetical protein;(source:Araport11) |
AT1G19960 | Unknown gene, expression decreased in response to Mn and increased by cytokinin. |
AT1G52840 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G13865.1);(source:TAIR10) |
AT3G09990 | Nucleoside transporter family protein;(source:Araport11) |
AT1G16230 | Target SNARE coiled-coil domain protein;(source:Araport11) |
AT2G23790 | calcium uniporter (DUF607);(source:Araport11) |
AT5G46710 | PLATZ transcription factor family protein;(source:Araport11) |
AT3G16712 | hypothetical protein;(source:Araport11) |
AT1G57540 | 40S ribosomal protein;(source:Araport11) |
AT4G32960 | BRISC/BRCA1-A complex protein;(source:Araport11) |
AT2G11220 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-16 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT1G20430 | hypothetical protein;(source:Araport11) |
AT4G08910 | homeobox protein;(source:Araport11) |
AT1G63206 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT1G54680 | translation initiation factor 3 subunit I;(source:Araport11) |
AT3G45530 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G59170 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G49350 | Glycine-rich protein family;(source:Araport11) |
AT3G58000 | VQ motif-containing protein;(source:Araport11) |
AT2G33815 | Natural antisense transcript overlaps with AT2G33810;(source:Araport11) |
AT3G43175 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.4e-49 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G36030 | hypothetical protein;(source:Araport11) |
AT3G15115 | serine/arginine repetitive matrix protein;(source:Araport11) |
AT5G15270 | RNA-binding KH domain-containing protein;(source:Araport11) |
AT2G47500 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
AT1G49245 | Prefoldin chaperone subunit family protein;(source:Araport11) |
AT5G48680 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
AT1G09150 | pseudouridine synthase and archaeosine transglycosylase (PUA) domain-containing protein;(source:Araport11) |
AT1G53350 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
AT5G56369 | Encodes a defensin-like (DEFL) family protein. |
AT3G62529 | pseudogene of pentatricopeptide (PPR) repeat-containing protein |
AT3G50665 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
AT2G33890 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT3G13335 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT5G09995 | transmembrane protein;(source:Araport11) |
AT5G46871 | Encodes a defensin-like (DEFL) family protein. |
AT1G75717 | hypothetical protein;(source:Araport11) |
AT5G58410 | HEAT/U-box domain-containing protein;(source:Araport11) |
AT4G02210 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
AT3G60150 | NADH dehydrogenase ubiquinone 1 alpha subcomplex assembly factor-like protein (DUF498/DUF598);(source:Araport11) |
AT1G69800 | Cystathionine beta-synthase (CBS) protein;(source:Araport11) |
AT5G59660 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G36510 | hypothetical protein;(source:Araport11) |
AT3G23770 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT2G40270 | Protein kinase family protein;(source:Araport11) |
AT5G61520 | Major facilitator superfamily protein;(source:Araport11) |
AT2G22145 | Encodes a ECA1 gametogenesis related family protein |
AT2G35612 | copper amine oxidase family protein;(source:Araport11) |
AT1G68600 | aluminum activated malate transporter family protein;(source:Araport11) |
AT3G28410 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT1G34660 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.1e-114 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
AT2G21172 | Pseudogene of AT5G16486 |
AT1G20060 | ATP binding microtubule motor family protein;(source:Araport11) |
AT2G11210 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.1e-93 P-value blast match to Q9ZQM3 /24-192 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT5G02244 | Pseudogene of AT3G57870; AHUS5 (SUMO CONJUGATION ENZYME 1); ubiquitin-protein ligase |
AT4G17860 | carboxyl-terminal proteinase-like protein, putative (DUF239);(source:Araport11) |
AT1G21864 | Encodes a Plant thionin family protein |
AT4G32950 | Protein phosphatase 2C family protein;(source:Araport11) |
AT3G21320 | EARLY FLOWERING protein;(source:Araport11) |
AT5G01030 | enolase, putative (DUF3527);(source:Araport11) |
AT1G03200 | hypothetical protein;(source:Araport11) |
AT1G01240 | transmembrane protein;(source:Araport11) |
AT4G15730 | CW-type Zinc Finger;(source:Araport11) |
AT1G61640 | Protein kinase superfamily protein;(source:Araport11) |
AT1G52600 | Peptidase S24/S26A/S26B/S26C family protein;(source:Araport11) |
AT1G05960 | ARM repeat superfamily protein;(source:Araport11) |
AT3G61185 | Encodes a defensin-like (DEFL) family protein. |
AT4G36515 | trichohyalin-like protein;(source:Araport11) |
AT4G07524 | Ras-related small GTP-binding family protein;(source:Araport11) |
AT1G61415 | CAP-gly domain linker;(source:Araport11) |
AT1G09600 | Protein kinase superfamily protein;(source:Araport11) |
AT5G24352 | Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11) |
AT4G24630 | DHHC-type zinc finger family protein;(source:Araport11) |
AT5G17270 | Protein prenylyltransferase superfamily protein;(source:Araport11) |
AT5G01150 | hypothetical protein (DUF674);(source:Araport11) |
AT3G07025 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
AT2G19260 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT1G62975 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G15060 | Lateral organ boundaries (LOB) domain family protein;(source:Araport11) |
AT4G08110 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 4.2e-66 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G06845 | Beta-galactosidase related protein;(source:Araport11) |
AT3G48540 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
AT3G46280 | kinase-like protein;(source:Araport11) |
AT2G42660 | Homeodomain-like superfamily protein;(source:Araport11) |
AT4G16447 | hypothetical protein;(source:Araport11) |
AT5G45620 | Proteasome component (PCI) domain protein;(source:Araport11) |
AT3G43570 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G17160 | aspartic/glutamic acid-rich protein;(source:Araport11) |
AT4G17210 | weak chloroplast movement under blue light protein (DUF827);(source:Araport11) |
AT2G07620 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, very low similarity to SP|Q9UUA2 DNA repair and recombination protein pif1, mitochondrial precursor {Schizosaccharomyces pombe};(source:TAIR10) |
AT3G24180 | Beta-glucosidase, GBA2 type family protein;(source:Araport11) |
AT5G52610 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G22290 | 14-3-3 family protein;(source:Araport11) |
AT2G46300 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT4G25400 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G38895 | RING/U-box superfamily protein;(source:Araport11) |
AT3G25221 | hypothetical protein;(source:Araport11) |
AT5G63200 | tetratricopeptide repeat (TPR)-containing protein;(source:Araport11) |
AT1G24160 | triadin;(source:Araport11) |
AT2G47410 | WD40 domain-containing protein;(source:Araport11) |
AT2G03930 | hypothetical protein (DUF239);(source:Araport11) |
AT2G04920 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G15870 | Fatty acid desaturase family protein;(source:Araport11) |
AT2G22230 | Thioesterase superfamily protein;(source:Araport11) |
AT1G30180 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.5e-115 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT3G46890 | maternal effect embryo arrest protein;(source:Araport11) |
AT5G06800 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
AT1G30795 | Glycine-rich protein family;(source:Araport11) |
AT4G35240 | DNA-directed RNA polymerase subunit beta, putative (DUF630 and DUF632);(source:Araport11) |
AT1G17270 | O-fucosyltransferase family protein;(source:Araport11) |
AT5G06190 | transmembrane protein;(source:Araport11) |
AT1G22720 | Protein kinase superfamily protein;(source:Araport11) |
AT2G03250 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT4G19520 | disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT3G23370 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G03330 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT3G18230 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT1G26460 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G49850 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT5G28469 | pseudogene of disease-resistance protein |
AT3G44380 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT1G29660 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G53560 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G59190 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT1G28090 | Polynucleotide adenylyltransferase family protein;(source:Araport11) |
AT3G02125 | pinin-like protein;(source:Araport11) |
AT1G74990 | RING/U-box superfamily protein;(source:Araport11) |
AT5G28712 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G44005 | pseudogene of Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT1G44150 | pseudogene of non-LTR retrolelement reverse transcriptase;(source:Araport11) |
AT3G10460 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT5G20110 | Dynein light chain type 1 family protein;(source:Araport11) |
AT1G06510 | forkhead-associated domain protein;(source:Araport11) |
AT4G02220 | zinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein;(source:Araport11) |
AT4G39680 | SAP domain-containing protein;(source:Araport11) |
AT3G62360 | Carbohydrate-binding-like fold;(source:Araport11) |
AT5G18540 | E3 ubiquitin-protein ligase;(source:Araport11) |
AT1G55030 | RNI-like superfamily protein;(source:Araport11) |
AT2G02210 | transposable_element_gene;(source:Araport11);pseudogene, Ulp1 protease family, contains Pfam profile PF02902: Ulp1 protease family, C-terminal catalytic domain;(source:TAIR10) |
AT3G19440 | Pseudouridine synthase family protein;(source:Araport11) |
AT3G45851 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G51650 | hypothetical protein;(source:Araport11) |
AT2G36780 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT5G35348 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G51240 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT3G48060 | BAH and TFIIS domain-containing protein;(source:Araport11) |
AT5G38300 | homeobox Hox-B3-like protein;(source:Araport11) |
AT2G28440 | proline-rich family protein;(source:Araport11) |
AT1G07440 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G32520 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G56220 | Dormancy/auxin associated family protein;(source:Araport11) |
AT2G14835 | RING/U-box superfamily protein;(source:Araport11) |
AT5G47830 | hypothetical protein;(source:Araport11) |
AT4G19150 | Ankyrin repeat family protein;(source:Araport11) |
AT1G03990 | Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11) |
AT1G62935 | transmembrane protein;(source:Araport11) |
AT5G06540 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G56050 | Protein kinase family protein;(source:Araport11) |
AT1G67790 | sieve element occlusion protein;(source:Araport11) |
AT4G15790 | uveal autoantigen with coiled-coil/ankyrin;(source:Araport11) |
AT3G42717 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.8e-229 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G57980 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT3G07140 | GPI transamidase component Gpi16 subunit family protein;(source:Araport11) |
AT4G14020 | Rapid alkalinization factor (RALF) family protein;(source:Araport11) |
AT1G02960 | kinetochore protein;(source:Araport11) |
AT4G29930 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G04840 | bZIP protein;(source:Araport11) |
AT1G12330 | cyclin-dependent kinase-like protein;(source:Araport11) |
AT3G48570 | secE/sec61-gamma protein transport protein;(source:Araport11) |
AT5G04250 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT2G13274 | Pseudogene of AT2G13150; transcription factor |
AT3G14075 | Mono-/di-acylglycerol lipase, N-terminal;(source:Araport11) |
AT3G57350 | Nucleoporin interacting component (Nup93/Nic96-like) family protein;(source:Araport11) |
AT2G02515 | hypothetical protein;(source:Araport11) |
AT1G44920 | transmembrane protein;(source:Araport11) |
AT3G31980 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G13250.1);(source:TAIR10) |
AT1G18230 | pseudogene of protein kinase family protein;(source:Araport11) |
AT5G43105 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.7e-39 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
AT2G15860 | BAT2 domain protein;(source:Araport11) |
AT1G27290 | transmembrane protein;(source:Araport11) |
AT2G28410 | transmembrane protein;(source:Araport11) |
AT2G21510 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT3G56275 | pseudogene of expressed protein;(source:Araport11) |
AT4G02715 | flocculation FLO11-like protein;(source:Araport11) |
AT1G77682 | Encodes a Plant thionin family protein |
AT2G10830 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G09050 | 8-amino-7-oxononanoate synthase;(source:Araport11) |
AT1G55265 | DUF538 family protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
AT5G08440 | transmembrane protein;(source:Araport11) |
AT3G07600 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT3G31440 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, blastp match of 41%25 identity and 1.3e-254 P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT3G50210 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT1G30130 | DUF1365 family protein;(source:Araport11) |
AT5G11960 | magnesium transporter, putative (DUF803);(source:Araport11) |
AT1G11230 | transmembrane protein, putative (DUF761);(source:Araport11) |
AT1G09920 | TRAF-type zinc finger-like protein;(source:Araport11) |
AT5G28250 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT2G07240.1);(source:TAIR10) |
AT5G27603 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G49950 | GRAS family transcription factor;(source:Araport11) |
AT4G19570 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G65900 | plant/protein;(source:Araport11) |
AT1G51400 | Photosystem II 5 kD protein;(source:Araport11) |
AT3G25950 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
AT5G27280 | Zim17-type zinc finger protein;(source:Araport11) |
AT5G21105 | Plant L-ascorbate oxidase;(source:Araport11) |
AT3G47000 | Glycosyl hydrolase family protein;(source:Araport11) |
AT1G71300 | Vps52 / Sac2 family;(source:Araport11) |
AT4G18501 | hypothetical protein;(source:Araport11) |
AT4G07330 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 2.6e-13 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
AT4G20220 | Reverse transcriptase (RNA-dependent DNA polymerase);(source:Araport11) |
AT3G24670 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G49790 | Carbohydrate-binding protein;(source:Araport11) |
AT2G41380 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G59350 | transmembrane protein;(source:Araport11) |
AT5G46270 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT4G36130 | Ribosomal protein L2 family;(source:Araport11) |
AT3G22230 | Ribosomal L27e protein family;(source:Araport11) |
AT5G06570 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G39895 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT3G01380 | sulfatase and phosphatidylinositolglycan class N domain-containing protein;(source:Araport11) |
AT4G21890 | zinc finger MYND domain protein;(source:Araport11) |
AT2G12580 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 7.0e-11 P-value blast match to GB:NP_038604 L1 repeat, Tf subfamily, member 26 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G49100 | vitellogenin-like protein;(source:Araport11) |
AT1G16960 | Ubiquitin domain-containing protein;(source:Araport11) |
AT5G02240 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. The mRNA is cell-to-cell mobile. |
AT3G21310 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT2G14510 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G46308 | transmembrane protein;(source:Araport11) |
AT3G11500 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
AT2G04043 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 3.7e-41 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G15200 | protein-protein interaction regulator family protein;(source:Araport11) |
AT4G33120 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G49490 | hypothetical protein;(source:Araport11) |
AT3G53490 | valine-tRNA ligase;(source:Araport11) |
AT3G43095 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
AT3G48115 | other_RNA;(source:Araport11) |
AT3G59650 | mitochondrial ribosomal protein L51/S25/CI-B8 family protein;(source:Araport11) |
AT3G29779 | transposable_element_gene;(source:Araport11);pseudogene, similar to SAE1-S9-protein, blastp match of 33%25 identity and 2.8e-14 P-value to GP|4760708|dbj|BAA77394.1||AB012866 SAE1-S9-protein {Brassica rapa};(source:TAIR10) |
AT5G52690 | Copper transport protein family;(source:Araport11) |
AT2G30985 | hypothetical protein;(source:Araport11) |
AT2G25890 | Oleosin family protein;(source:Araport11) |
AT5G37442 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.7e-44 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G28170 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35110.1);(source:TAIR10) |
AT1G33370 | pre-tRNA tRNA-Gly (anticodon: ACC);(source:Araport11, TAIR10) |
AT5G13181 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G27657 | hypothetical protein;(source:Araport11) |
AT2G15318 | hypothetical protein;(source:Araport11) |
AT3G52561 | hypothetical protein;(source:Araport11) |
AT3G27990 | None;(source:Araport11) |
AT5G59140 | BTB/POZ domain-containing protein;(source:Araport11) |
AT1G71110 | transmembrane protein;(source:Araport11) |
AT3G28230 | something about silencing protein;(source:Araport11) |
AT4G14305 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
AT5G23890 | GPI-anchored adhesin-like protein;(source:Araport11) |
AT5G49210 | stress response NST1-like protein;(source:Araport11) |
AT4G22090 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G49370 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
AT3G32043 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.2e-40 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G20298 | pseudogene of exonuclease family protein |
AT3G47940 | DNAJ heat shock family protein;(source:Araport11) |
AT5G47229 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G63770 | Peptidase M1 family protein;(source:Araport11) |
AT5G17190 | B-cell receptor-associated-like protein;(source:Araport11) |
AT5G07980 | dentin sialophosphoprotein-like protein;(source:Araport11) |
AT1G27900 | RNA helicase family protein;(source:Araport11) |
AT4G25410 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT3G26782 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G27320 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G78910 | Pseudouridine synthase family protein;(source:Araport11) |
AT1G56000 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
AT3G54470 | encodes the bi-functional orotate phosphoribosyltransferase/orotidine-5'-phosphate decarboxylase catalyzing the fifth and sixth step in the de novo pyrimidine ribonucleotide biosynthesis |
AT3G48550 | SHOOT GRAVITROPISM-like protein;(source:Araport11) |
AT3G47030 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G66100 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant thionin (PR-13) family with the following members: At1g66100, At5g36910, At1g72260, At2g15010, At1g12663, At1g12660. |
AT5G42325 | Transcription factor IIS protein;(source:Araport11) |
AT5G45650 | subtilase family protein;(source:Araport11) |
AT2G39240 | RNA polymerase I specific transcription initiation factor RRN3 protein;(source:Araport11) |
AT4G18070 | suppressor;(source:Araport11) |
AT4G21700 | DUF2921 family protein, putative (DUF2921);(source:Araport11) |
AT1G20950 | Phosphofructokinase family protein;(source:Araport11) |
AT2G13143 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G25275 | Thionin-like gene involved in resistance against the beet cyst nematode (Heterodera schachtii). |
AT2G24696 | transcriptional factor B3 family protein;(source:Araport11) |
AT1G26880 | Ribosomal protein L34e superfamily protein;(source:Araport11) |
AT4G16165 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT3G10060 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT5G24155 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
AT2G32310 | CCT motif family protein;(source:Araport11) |
AT4G17250 | transmembrane protein;(source:Araport11) |
AT1G27620 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT5G35802 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.6e-27 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G56140 | RNA-binding KH domain-containing protein;(source:Araport11) |
AT1G60610 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
AT5G23490 | hypothetical protein;(source:Araport11) |
AT4G33905 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
AT1G28160 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
AT2G28600 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G59770 | Protein-tyrosine phosphatase-like, PTPLA;(source:Araport11) |
AT5G37550 | hypothetical protein;(source:Araport11) |
AT3G27350 | transcriptional regulator ATRX-like protein;(source:Araport11) |
AT2G44930 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT3G18845 | Encodes a Protease inhibitor/seed storage/LTP family protein [pseudogene] |
AT4G34670 | Ribosomal protein S3Ae;(source:Araport11) |
AT3G06770 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G19680 | RING/U-box superfamily protein;(source:Araport11) |
AT4G02170 | cotton fiber protein;(source:Araport11) |
AT2G31930 | protein of unknown function |
AT3G25240 | sulfate/thiosulfate import ATP-binding protein, putative (DUF506);(source:Araport11) |
AT2G36430 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT3G30540 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT3G31460 | transposable_element_gene;(source:Araport11);retroelement pol polyprotein -related;(source:TAIR10) |
AT2G20060 | Ribosomal protein L4/L1 family;(source:Araport11) |
AT5G41250 | Exostosin family protein;(source:Araport11) |
AT3G03405 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT4G24652 | Pseudogene of AT4G20330; transcription initiation factor-related |
AT3G10750 | FBD domain family;(source:Araport11) |
AT3G26805 | pseudogene of Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G28500 | 60S acidic ribosomal protein family;(source:Araport11) |
AT5G11090 | serine-rich protein-like protein;(source:Araport11) |
AT1G68945 | hypothetical protein;(source:Araport11) |
AT5G27560 | DUF1995 domain protein, putative (DUF1995);(source:Araport11) |
AT1G54070 | Dormancy/auxin associated family protein;(source:Araport11) |
AT5G49800 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT3G50050 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G42174 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.1e-277 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT5G11900 | Translation initiation factor SUI1 family protein;(source:Araport11) |
AT5G12450 | FBD-like domain family protein;(source:Araport11) |
AT3G13062 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT4G00585 | transmembrane protein;(source:Araport11) |
AT5G05350 | PLAC8 family protein;(source:Araport11) |
AT5G53310 | myosin heavy chain-like protein;(source:Araport11) |
AT1G33300 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G21250 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
AT1G50880 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G09480 | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase The mRNA is cell-to-cell mobile. |
AT1G31130 | polyadenylate-binding protein 1-B-binding protein;(source:Araport11) |
AT2G12475 | Encodes a defensin-like (DEFL) family protein. |
AT4G09780 | TRAF-like family protein;(source:Araport11) |
AT4G17430 | O-fucosyltransferase family protein;(source:Araport11) |
AT1G29600 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT5G63340 | hypothetical protein;(source:Araport11) |
AT1G16800 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G25182 | Pseudogene of AT5G24050; DNA binding protein |
AT5G56310 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G54530 | serine protease, putative (Protein of unknown function, DUF538);(source:Araport11) |
AT5G12940 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT1G43680 | nucleic acid-binding/zinc ion-binding protein;(source:Araport11) |
AT1G32763 | Encodes a defensin-like (DEFL) family protein. |
AT5G56240 | hapless protein;(source:Araport11) |
AT1G69060 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G11280 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G21065 | secondary thiamine-phosphate synthase enzyme;(source:Araport11) |
AT3G60040 | F-box family protein;(source:Araport11) |
AT5G19370 | rhodanese-like domain-containing protein / PPIC-type PPIASE domain-containing protein;(source:Araport11) |
AT1G19390 | Wall-associated kinase family protein;(source:Araport11) |
AT1G33660 | Pseudogene of AT1G33660; peroxidase family protein |
AT3G61080 | Protein kinase superfamily protein;(source:Araport11) |
AT2G38370 | weak chloroplast movement under blue light protein (DUF827);(source:Araport11) |
AT2G07486 | transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBb0043H09.1, putative insertion sequence-like orf;(source:TAIR10) |
AT2G46550 | transmembrane protein;(source:Araport11) |
AT2G14690 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
AT3G30841 | Cofactor-independent phosphoglycerate mutase;(source:Araport11) |
AT3G29690 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT5G26740 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
AT4G13970 | zinc ion binding protein;(source:Araport11) |
AT3G27570 | Sucrase/ferredoxin-like family protein;(source:Araport11) |
AT3G10035 | pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10) |
AT4G12830 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G58260 | TRAF-like family protein;(source:Araport11) |
AT1G45243 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G04170 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT5G06660 | transmembrane/coiled-coil protein (Protein of unknown function DUF106, transmembrane);(source:Araport11) |
AT1G09900 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT3G27825 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT2G01990 | XRI1-like protein;(source:Araport11) |
AT2G40990 | DHHC-type zinc finger family protein;(source:Araport11) |
AT3G30742 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative non-LTR retroelement reverse transcriptase, similar to GB:S65812 from (Arabidopsis thaliana);(source:TAIR10) |
AT2G36815 | mid region of cactin;(source:Araport11) |
AT1G62370 | RING/U-box superfamily protein;(source:Araport11) |
AT3G54780 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT5G05140 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
AT2G06960 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT2G02780 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G21360 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT2G21235 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
AT4G36790 | Major facilitator superfamily protein;(source:Araport11) |
AT4G27660 | hypothetical protein;(source:Araport11) |
AT5G23100 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT4G34065 | Pseudogene of AT5G06265; hyaluronan mediated motility receptor-related |
AT4G30450 | glycine-rich protein;(source:Araport11) |
AT5G14210 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G59680 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G28280 | F-box/associated interaction domain protein;(source:Araport11) |
AT3G33572 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G07523.1);(source:TAIR10) |
AT5G45116 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.2e-227 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT5G22580 | Stress responsive A/B Barrel Domain-containing protein;(source:Araport11) |
AT3G46410 | Protein kinase superfamily protein;(source:Araport11) |
AT2G20740 | Tetraspanin family protein;(source:Araport11) |
AT5G27220 | Frigida-like protein;(source:Araport11) |
AT3G15909 | hypothetical protein;(source:Araport11) |
AT4G19450 | Major facilitator superfamily protein;(source:Araport11) |
AT3G07110 | Ribosomal protein L13 family protein;(source:Araport11) |
AT4G10070 | KH domain-containing protein;(source:Araport11) |
AT2G42955 | F-box/LRR protein;(source:Araport11) |
AT5G28253 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.2e-60 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT1G30200 | F-box family protein;(source:Araport11) |
AT1G05330 | hypothetical protein;(source:Araport11) |
AT5G22875 | transmembrane protein;(source:Araport11) |
AT3G30805 | Class II aminoacyl-tRNA and biotin synthetases superfamily protein;(source:Araport11) |
AT3G18350 | Plant protein of unknown function (DUF639);(source:TAIR10) |
AT4G13960 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT2G35040 | AICARFT/IMPCHase bienzyme family protein;(source:Araport11) |
AT1G28400 | GATA zinc finger protein;(source:Araport11) |
AT3G26960 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT5G04070 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G40113 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT2G05670 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT5G53100 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G10970 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
AT5G60400 | hypothetical protein;(source:Araport11) |
AT5G42500 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT5G62710 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G09520 | Cofactor-independent phosphoglycerate mutase;(source:Araport11) |
AT1G79710 | Major facilitator superfamily protein;(source:Araport11) |
AT1G21695 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G60960 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G16450 | Ribonuclease E inhibitor RraA/Dimethylmenaquinone methyltransferase;(source:Araport11) |
AT3G58877 | hypothetical protein;(source:Araport11) |
AT5G06278 | pseudogene of abscisic acid-responsive HVA22 family protein |
AT3G59570 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT3G11150 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT5G57330 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
AT1G45403 | membrane protein;(source:Araport11) |
AT3G29768 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-85 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
AT3G06868 | vitellogenin-like protein;(source:Araport11) |
AT5G48620 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
AT3G03100 | NADH:ubiquinone oxidoreductase, 17.2kDa subunit;(source:Araport11) |
AT5G39470 | F-box family protein;(source:Araport11) |
AT1G51910 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G28480 | DNAJ heat shock family protein;(source:Araport11) |
AT2G31902 | Natural antisense transcript overlaps with AT2G31900;(source:Araport11) |
AT5G20700 | senescence-associated family protein, putative (DUF581);(source:Araport11) |
AT3G30281 | Pseudogene of AT1G19260; hAT dimerisation domain-containing protein |
AT1G21780 | BTB/POZ domain-containing protein. Contains similarity to gb:AJ000644 SPOP (speckle-type POZ protein) from Homo sapiens and contains a PF:00651 BTB/POZ domain. ESTs gb:T75841, gb:R89974, gb:R30221, gb:N96386, gb:T76457, gb:AI100013 and gb:T76456 come from this gene;supported by full-length. Interacts with CUL3A and CUL3B. |
AT2G42370 | hypothetical protein;(source:Araport11) |
AT1G73930 | polarity axis stabilization protein;(source:Araport11) |
AT1G10419 | Pseudogene of AT1G10419 |
AT3G46400 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G25070 | neurofilament light protein;(source:Araport11) |
AT2G44195 | pre-mRNA splicing factor domain-containing protein;(source:Araport11) |
AT2G44410 | RING/U-box superfamily protein;(source:Araport11) |
AT3G17130 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT2G03780 | Translin family protein;(source:Araport11) |
AT2G32350 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT4G19160 | transglutaminase family protein;(source:Araport11) |
AT5G47050 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
AT3G22920 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT5G28400 | embryo defective protein;(source:Araport11) |
AT1G53635 | hypothetical protein;(source:Araport11) |
AT4G08076 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.7e-64 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G59770 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.2e-49 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G09450 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G51160 | Ankyrin repeat family protein;(source:Araport11) |
AT4G32900 | Peptidyl-tRNA hydrolase II (PTH2) family protein;(source:Araport11) |
AT5G35280 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G07310.1);(source:TAIR10) |
AT2G15800 | transposable_element_gene;(source:Araport11) |
AT4G35710 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
AT2G26920 | Ubiquitin-associated/translation elongation factor EF1B protein;(source:Araport11) |
AT1G29680 | histone acetyltransferase (DUF1264);(source:Araport11) |
AT2G13705 | pseudogene of DNA topoisomerase 1 beta;(source:Araport11) |
AT5G08320 | E2F-associated phosphoprotein;(source:Araport11) |
AT5G25425 | glycine-rich protein;(source:Araport11) |
AT1G33420 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT3G44780 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT1G64180 | intracellular protein transport protein USO1-like protein;(source:Araport11) |
AT5G25280 | serine-rich protein-like protein;(source:Araport11) |
AT4G09890 | mediator of RNA polymerase II transcription subunit, putative (DUF3511);(source:Araport11) |
AT4G26310 | elongation factor P (EF-P) family protein;(source:Araport11) |
AT2G45090 | pseudogene of receptor kinase 1;(source:Araport11) |
AT1G64561 | hypothetical protein;(source:Araport11) |
AT4G10550 | Subtilase family protein;(source:Araport11) |
AT1G67570 | zinc finger CONSTANS-like protein (DUF3537);(source:Araport11) |
AT3G14800 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.1e-83 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
AT2G13280 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, blastp match of 27%25 identity and 7.6e-27 P-value to GP|20279456|gb|AAM18736.1|AC092548_14|AC092548 putative reverse transcriptase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT4G31660 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT3G03670 | Peroxidase superfamily protein;(source:Araport11) |
AT5G27430 | Signal peptidase subunit;(source:Araport11) |
AT4G28900 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-236 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT2G27775 | PPR containing protein;(source:Araport11) |
AT4G32970 | BRISC/BRCA1-A complex protein;(source:Araport11) |
AT3G09915 | pseudogene of Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT4G16070 | lipase class 3 family protein;(source:Araport11) |
AT3G23080 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT2G24620 | S-locus glycoprotein family protein;(source:Araport11) |
AT5G28910 | alpha-(1,6)-fucosyltransferase;(source:Araport11) |
AT5G01300 | PEBP (phosphatidylethanolamine-binding protein) family protein;(source:Araport11) |
AT2G04042 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.0e-26 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G49120 | DUF581 family protein, putative (DUF581);(source:Araport11) |
AT1G31570 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 0. P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
AT1G20680 | transport/golgi organization-like protein (DUF833);(source:Araport11) |
AT4G29950 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT4G14200 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G22403 | other_RNA;(source:Araport11) |
AT5G24065 | Pseudogene of AT5G24065 |
AT4G40011 | hypothetical protein;(source:Araport11) |
AT3G42542 | Encodes a defensin-like (DEFL) family protein. |
AT3G50350 | membrane insertase, putative (DUF1685);(source:Araport11) |
AT1G70640 | octicosapeptide/Phox/Bem1p (PB1) domain-containing protein;(source:Araport11) |
AT2G29000 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G20360 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G13760 | Plasma-membrane choline transporter family protein;(source:Araport11) |
AT5G24206 | other_RNA;(source:Araport11) |
AT2G36854 | hypothetical protein;(source:Araport11) |
AT1G17090 | transmembrane protein;(source:Araport11) |
AT2G02830 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-37 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G47885 | Ribonuclease inhibitor;(source:Araport11) |
AT1G78640 | B3 domain protein;(source:Araport11) |
AT5G22555 | transmembrane protein;(source:Araport11) |
AT1G50732 | transmembrane protein;(source:Araport11) |
AT1G47655 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
AT1G74790 | catalytics;(source:Araport11) |
AT5G37340 | ZPR1 zinc-finger domain protein;(source:Araport11) |
AT4G17020 | transcription factor-like protein;(source:Araport11) |
AT4G01180 | XH/XS domain-containing protein;(source:Araport11) |
AT1G31300 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
AT1G75800 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT4G37530 | Peroxidase superfamily protein;(source:Araport11) |
AT5G24060 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G28720 | transmembrane protein;(source:Araport11) |
AT3G25810 | Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
AT5G33398 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.5e-17 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT5G02480 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT1G52120 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT5G55530 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT3G19850 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT2G06900 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 8.6e-144 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
AT1G06320 | hypothetical protein;(source:Araport11) |
AT5G39460 | F-box family protein;(source:Araport11) |
AT5G61490 | transmembrane protein;(source:Araport11) |
AT1G36730 | Translation initiation factor IF2/IF5;(source:Araport11) |
AT2G42950 | Magnesium transporter CorA-like family protein;(source:Araport11) |
AT5G46720 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
AT5G26010 | Protein phosphatase 2C family protein;(source:Araport11) |
AT4G00390 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
AT3G07320 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT5G25770 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G03180 | RING/U-box superfamily protein;(source:Araport11) |
AT1G48040 | Protein phosphatase 2C family protein;(source:Araport11) |
AT5G28073 | transposable_element_gene;(source:Araport11);hypothetical protein;(source:TAIR10) |
AT5G65550 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G42870 | heat shock protein;(source:Araport11) |
AT3G29570 | hypothetical protein;(source:Araport11) |
AT1G67180 | zinc finger (C3HC4-type RING finger) family protein / BRCT domain-containing protein;(source:Araport11) |
AT1G24570 | transmembrane protein, putative (DUF707);(source:Araport11) |
AT2G16230 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT4G26620 | Sucrase/ferredoxin-like family protein;(source:Araport11) |
AT3G60380 | cotton fiber protein;(source:Araport11) |
AT2G31410 | coiled-coil protein;(source:Araport11) |
AT1G26160 | Metal-dependent phosphohydrolase;(source:Araport11) |
AT4G35670 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G50460 | secE/sec61-gamma protein transport protein;(source:Araport11) |
AT4G27654 | transmembrane protein;(source:Araport11) |
AT2G33855 | transmembrane protein;(source:Araport11) |
AT4G10320 | tRNA synthetase class I (I, L, M and V) family protein;(source:Araport11) |
AT5G45220 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G63520 | F-box/LRR protein;(source:Araport11) |
AT1G15760 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
AT5G26720 | ubiquitin carboxyl-terminal hydrolase-like protein;(source:Araport11) |
AT5G13310 | hypothetical protein;(source:Araport11) |
AT4G09170 | transmembrane protein;(source:Araport11) |
AT5G65470 | O-fucosyltransferase family protein;(source:Araport11) |
AT5G27810 | MADS-box transcription factor family protein;(source:Araport11) |
AT1G25530 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT5G62970 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
AT4G18900 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G35370 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT4G00005 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
AT5G35111 | pseudogene of Peroxidase superfamily protein;(source:Araport11) |
AT4G03695 | pseudogene of hypothetical protein;(source:Araport11) |
AT2G21727 | Encodes a ECA1 gametogenesis related family protein |
AT2G19385 | zinc ion binding protein;(source:Araport11) |
AT5G45275 | Major facilitator superfamily protein;(source:Araport11) |
AT5G26320 | TRAF-like family protein;(source:Araport11) |
AT5G40500 | hypothetical protein;(source:Araport11) |
AT4G23510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G42480 | TLR4 regulator/MIR-interacting MSAP protein;(source:Araport11) |
AT3G43050 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 5.0e-39 P-value blast match to Q9SUF8 /145-308 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT1G80280 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G23955 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.6e-41 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G07820 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
AT1G35770 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT2G06860.1);(source:TAIR10) |
AT1G20800 | F-box family protein |
AT3G01340 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G01420 | Glutaredoxin family protein;(source:Araport11) |
AT2G06235 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G76550 | Phosphofructokinase family protein. Target of miRNA sRNA6. |
AT1G11070 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G47410 | hypothetical protein;(source:Araport11) |
AT3G61700 | helicase with zinc finger protein;(source:Araport11) |
AT5G11820 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT3G22520 | spindle assembly abnormal protein;(source:Araport11) |
AT5G28886 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G24370 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G36070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G16100 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
AT5G63930 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G41400 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT1G44045 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.8e-19 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G41320 | stress response NST1-like protein;(source:Araport11) |
AT5G15390 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
AT3G21690 | MATE efflux family protein;(source:Araport11) |
AT1G78260 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G07380 | hypothetical protein;(source:Araport11) |
AT3G03440 | ARM repeat superfamily protein;(source:Araport11) |
AT2G44820 | axoneme-associated protein MST101(2) protein;(source:Araport11) |
AT3G45555 | RING/U-box protein;(source:Araport11) |
AT1G10220 | ZCF37;(source:Araport11) |
AT1G05120 | Helicase protein with RING/U-box domain-containing protein;(source:Araport11) |
AT5G67640 | hypothetical protein;(source:Araport11) |
AT2G04870 | hypothetical protein;(source:Araport11) |
AT5G15790 | RING/U-box superfamily protein;(source:Araport11) |
AT2G36835 | hypothetical protein;(source:Araport11) |
AT1G54640 | F-box family protein-like protein;(source:Araport11) |
AT1G68862 | transmembrane protein;(source:Araport11) |
AT2G43720 | FAM136A-like protein (DUF842);(source:Araport11) |
AT2G37660 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G20480 | hypothetical protein;(source:Araport11) |
AT2G04230 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT4G18580 | hypothetical protein;(source:Araport11) |
AT5G14450 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G16770 | hypothetical protein;(source:Araport11) |
AT1G49100 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G51720 | Amino acid dehydrogenase family protein;(source:Araport11) |
AT5G25850 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT3G23880 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT5G25451 | Pseudogene of AT5G25440; protein kinase family protein |
AT5G62890 | Xanthine/uracil permease family protein;(source:Araport11) |
AT2G16140 | None;(source:Araport11) |
AT1G64320 | myosin heavy chain-like protein;(source:Araport11) |
AT4G25845 | oxysterol-binding 4B-like protein;(source:Araport11) |
AT1G27030 | hypothetical protein;(source:Araport11) |
AT3G53235 | hypothetical protein;(source:Araport11) |
AT4G10450 | Ribosomal protein L6 family;(source:Araport11) |
AT3G27520 | cryptic loci regulator;(source:Araport11) |
AT3G14580 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G36940 | myotubularin-like protein;(source:Araport11) |
AT3G07200 | RING/U-box superfamily protein;(source:Araport11) |
AT3G56590 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT4G39270 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G76460 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G08485 | Encodes a defensin-like (DEFL) family protein. |
AT4G11380 | Adaptin family protein;(source:Araport11) |
AT3G04950 | SEC-C motif protein;(source:Araport11) |
AT3G06433 | pseudogene of nodulin MtN3 family protein |
AT3G51700 | PIF1 helicase;(source:Araport11) |
AT2G19796 | other_RNA;(source:Araport11) |
AT2G15730 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G46030 | transcription elongation factor-like protein;(source:Araport11) |
AT1G66180 | The gene encodes a putative aspartyl protease (ASP). Its expression is induced in response to light and ascorbate. The mRNA is cell-to-cell mobile. |
AT5G39970 | catalytics;(source:Araport11) |
AT5G13070 | MSF1-like family protein;(source:Araport11) |
AT5G24080 | Protein kinase superfamily protein;(source:Araport11) |
AT1G13730 | Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein;(source:Araport11) |
AT5G51140 | Pseudouridine synthase family protein;(source:Araport11) |
AT1G69080 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT3G28155 | hypothetical protein;(source:Araport11) |
AT5G01595 | Natural antisense transcript overlaps with AT5G01600;(source:Araport11) |
AT1G11265 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.4e-253 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT2G38920 | SPX (SYG1/Pho81/XPR1) domain-containing protein / zinc finger (C3HC4-type RING finger) protein-like protein;(source:Araport11) |
AT1G68700 | transmembrane protein;(source:Araport11) |
AT2G17477 | Pseudogene of AT3G22350; F-box family protein |
AT1G67750 | Pectate lyase family protein;(source:Araport11) |
AT2G34340 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT2G24280 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G22510 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G22780 | Adaptor protein complex AP-2, alpha subunit;(source:Araport11) |
AT2G32220 | Ribosomal L27e protein family;(source:Araport11) |
AT3G19430 | late embryogenesis abundant protein-related / LEA protein-like protein;(source:Araport11) |
AT4G02100 | Heat shock protein DnaJ with tetratricopeptide repeat-containing protein;(source:Araport11) |
AT1G15757 | Encodes a defensin-like (DEFL) family protein. |
AT3G56680 | Single-stranded nucleic acid binding R3H protein;(source:Araport11) |
AT5G65445 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
AT5G45190 | Encodes a cyclin T partner CYCT1;5. Plays important roles in infection with Cauliflower mosaic virus (CaMV). |
AT4G10190 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G40050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G58225 | hypothetical protein;(source:Araport11) |
AT4G10720 | Ankyrin repeat family protein;(source:Araport11) |
AT4G31985 | Ribosomal protein L39 family protein;(source:Araport11) |
AT1G10650 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
AT5G05120 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
AT1G73650 | 3-oxo-5-alpha-steroid 4-dehydrogenase (DUF1295);(source:Araport11) |
AT3G43330 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30560.1);(source:TAIR10) |
AT1G64610 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G16550 | Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT1G75370 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT1G67325 | Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11) |
AT5G40520 | DNA double-strand break repair protein;(source:Araport11) |
AT3G47965 | hypothetical protein;(source:Araport11) |
AT1G44010 | transmembrane protein;(source:Araport11) |
AT1G74510 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT3G42794 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.2e-05 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT4G07747 | pseudogene of hypothetical protein;(source:Araport11) |
AT3G32047 | Cytochrome P450 superfamily protein;(source:Araport11) |
AT5G38310 | hypothetical protein;(source:Araport11) |
AT4G39970 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT4G16770 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT1G36480 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.6e-35 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
AT5G24480 | Beta-galactosidase related protein;(source:Araport11) |
AT1G31250 | proline-rich family protein;(source:Araport11) |
AT3G16190 | Isochorismatase family protein;(source:Araport11) |
AT3G62010 | metal ion-binding protein;(source:Araport11) |
AT5G07940 | dentin sialophosphoprotein-like protein;(source:Araport11) |
AT2G27385 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT1G50450 | Saccharopine dehydrogenase;(source:Araport11) |
AT2G20050 | protein phosphatase 2C and cyclic nucleotide-binding/kinase domain-containing protein;(source:Araport11) |
AT4G13245 | snoRNA;(source:Araport11) |
AT2G01870 | transmembrane protein;(source:Araport11) |
AT1G04470 | hypothetical protein (DUF810);(source:Araport11) |
AT5G48655 | RING/U-box superfamily protein;(source:Araport11) |
AT1G34281 | Pseudogene of AT5G28720; unknown protein |
AT2G34910 | root hair specific protein;(source:Araport11) |
AT1G55980 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
AT2G38660 | Amino acid dehydrogenase family protein;(source:Araport11) |
AT3G21400 | dynein beta chain, ciliary protein;(source:Araport11) |
AT1G43610 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G45234 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT3G27835 | Encodes a defensin-like (DEFL) family protein. |
AT4G27360 | Dynein light chain type 1 family protein;(source:Araport11) |
AT5G37050 | sorting nexin;(source:Araport11) |
AT1G20370 | Pseudouridine synthase family protein;(source:Araport11) |
AT4G20325 | ribonuclease H2 subunit B;(source:Araport11) |
AT4G26990 | polyadenylate-binding protein interacting protein;(source:Araport11) |
AT1G42450 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.3e-96 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT2G07212 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G62130 | Per1-like family protein;(source:Araport11) |
AT2G35970 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT5G03668 | Natural antisense transcript overlaps with AT5G03670;(source:Araport11) |
AT2G25970 | KH domain-containing protein;(source:Araport11) |
AT5G35796 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
AT4G12405 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
AT3G20015 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT5G39220 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G32850 | Protein kinase superfamily protein;(source:Araport11) |
AT5G67265 | hypothetical protein;(source:Araport11) |
AT5G15190 | hypothetical protein;(source:Araport11) |
AT2G45530 | RING/U-box superfamily protein;(source:Araport11) |
AT5G48730 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G77610 | EamA-like transporter family protein;(source:Araport11) |
AT3G46140 | Protein kinase superfamily protein;(source:Araport11) |
AT2G22200 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
AT3G28850 | Glutaredoxin family protein;(source:Araport11) |
AT5G67200 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G30945 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G28120 | transmembrane protein;(source:Araport11) |
AT2G35345 | hypothetical protein;(source:Araport11) |
AT4G10210 | transmembrane protein, putative (DUF239);(source:Araport11) |
AT1G10640 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G36320 | hypothetical protein;(source:Araport11) |
AT2G04480 | hypothetical protein;(source:Araport11) |
AT4G06621 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G16310 | Cation efflux family protein which affects ABA-JA crosstalk and susceptibility to Mamestra brassicae herbivory. |
AT1G21738 | hypothetical protein;(source:Araport11) |
AT1G73860 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G19086 | hypothetical protein;(source:Araport11) |
AT4G31340 | myosin heavy chain-like protein;(source:Araport11) |
AT5G35798 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 1.9e-52 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
AT5G49435 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
AT3G14480 | glycine/proline-rich protein;(source:Araport11) |
AT5G51580 | hypothetical protein;(source:Araport11) |
AT5G33200 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42400.1);(source:TAIR10) |
AT5G52710 | Copper transport protein family;(source:Araport11) |
AT2G19920 | RNA-dependent RNA polymerase family protein;(source:Araport11) |
AT1G15450 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT5G22080 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT4G10290 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT2G19802 | transmembrane protein;(source:Araport11) |
AT5G28442 | quinoprotein amine dehydrogenase, beta chain-like;(source:Araport11) |
AT4G12870 | Gamma interferon responsive lysosomal thiol (GILT) reductase family protein;(source:Araport11) |
AT5G26673 | Encodes a Plant thionin family protein |
AT1G53801 | Natural antisense transcript overlaps with AT1G53800;(source:Araport11) |
AT1G42420 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G57310 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT4G27250 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G21450 | Protein kinase superfamily protein;(source:Araport11) |
AT4G08610 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-87 P-value blast match to O22278 /203-375 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT5G29090 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G33131.1);(source:TAIR10) |
AT4G30180 | hypothetical protein;(source:Araport11) |
AT4G15830 | ARM repeat superfamily protein;(source:Araport11) |
AT2G41470 | agamous-like MADS-box protein;(source:Araport11) |
AT2G19090 | DUF630 family protein (DUF630 and DUF632);(source:Araport11) |
AT5G60250 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT3G44970 | Cytochrome P450 superfamily protein;(source:Araport11) |
AT4G03250 | Homeodomain-like superfamily protein;(source:Araport11) |
AT5G17360 | DNA ligase;(source:Araport11) |
AT5G35965 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.9e-244 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT5G11580 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT3G24517 | hypothetical protein;(source:Araport11) |
AT5G46170 | F-box family protein;(source:Araport11) |
AT3G19970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G33251 | pseudogene of Beta-galactosidase related protein;(source:Araport11) |
AT1G50140 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G07300 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G35090.1);(source:TAIR10) |
AT5G57100 | Nucleotide/sugar transporter family protein;(source:Araport11) |
AT3G58610 | ketol-acid reductoisomerase;(source:Araport11) |
AT2G05025 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G65365 | pseudogene of WALL ASSOCIATED KINASE (WAK)-LIKE 10;(source:Araport11) |
AT4G00530 | UvrABC system protein A;(source:Araport11) |
AT4G31115 | DUF1997 family protein, putative (DUF1997);(source:Araport11) |
AT4G29450 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G34310 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G02600 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
AT1G43940 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42540.1);(source:TAIR10) |
AT1G20310 | syringolide-induced protein;(source:Araport11) |
AT3G58035 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
AT4G25890 | 60S acidic ribosomal protein family;(source:Araport11) |
AT3G03305 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
AT5G28670 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, predicted helicase proteins, Arabidopsis thaliana;(source:TAIR10) |
AT5G04045 | Encodes a defensin-like (DEFL) family protein. |
AT3G09375 | pseudogene of eukaryotic initiation factor 4A-III;(source:Araport11) |
AT2G20920 | chaperone (DUF3353);(source:Araport11) |
AT2G19550 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G38700 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT1G52180 | Aquaporin-like superfamily protein;(source:Araport11) |
AT3G51000 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G36260 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 4.2e-91 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G23530 | ROH1, putative (DUF793);(source:Araport11) |
AT5G43185 | Expressed protein;(source:Araport11) |
AT1G52090 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G27590.1);(source:TAIR10) |
AT2G30300 | Major facilitator superfamily protein;(source:Araport11) |
AT1G64255 | MuDR family transposase;(source:Araport11) |
AT3G04160 | U11/U12 small nuclear ribonucleoprotein;(source:Araport11) |
AT4G01960 | transmembrane protein;(source:Araport11) |
AT5G49390 | serine/threonine-protein phosphatase 4 regulatory subunit-like protein;(source:Araport11) |
AT5G64690 | neurofilament triplet H protein-like protein;(source:Araport11) |
AT5G38840 | SMAD/FHA domain-containing protein;(source:Araport11) |
AT3G55600 | Membrane fusion protein Use1;(source:Araport11) |
AT5G54710 | Ankyrin repeat family protein;(source:Araport11) |
AT1G70160 | zinc finger MYND domain protein;(source:Araport11) |
AT2G46780 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G04760 | Major facilitator superfamily protein;(source:Araport11) |
AT5G04650 | transposable_element_gene;(source:Araport11) |
AT3G42727 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G07702 | snoRNA;(source:Araport11) |
AT1G58310 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT4G08280 | Thioredoxin superfamily protein;(source:Araport11) |
AT2G31520 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.9e-44 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
AT1G49000 | transmembrane protein;(source:Araport11) |
AT4G08876 | pyrophosphate-fructose-6-phosphate 1-phosphotransferase-related / pyrophosphate-dependent 6-phosphofructose-1-kinase-like protein;(source:Araport11) |
AT4G11100 | gelsolin protein;(source:Araport11) |
AT3G19630 | Radical SAM superfamily protein;(source:Araport11) |
AT3G13965 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT3G28925 | structural maintenance of chromosomes protein;(source:Araport11) |
AT1G63810 | nucleolar protein;(source:Araport11) |
AT3G55860 | hypothetical protein;(source:Araport11) |
AT1G49475 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT5G50450 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
AT4G39420 | spatacsin carboxy-terminus protein;(source:Araport11) |
AT5G40600 | bromodomain testis-specific protein;(source:Araport11) |
AT1G27300 | transmembrane protein;(source:Araport11) |
AT2G02700 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G22426 | hypothetical protein;(source:Araport11) |
AT5G26080 | proline-rich family protein;(source:Araport11) |
AT2G21760 | tRNA-Leu (anticodon: GAG) |
AT3G45840 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G26510 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT3G56060 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
AT5G49060 | DnaJ heat shock amino-terminal domain protein (DUF1977);(source:Araport11) |
AT5G09300 | Thiamin diphosphate-binding fold (THDP-binding) superfamily protein;(source:Araport11) |
AT5G12110 | elongation factor 1-beta 1;(source:Araport11) |
AT3G04970 | DHHC-type zinc finger family protein;(source:Araport11) |
AT5G52500 | transmembrane protein;(source:Araport11) |
AT4G08050 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 0. P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G10950 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
AT5G28056 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 0. P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
AT3G21810 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT2G22482 | other_RNA;(source:Araport11) |
AT1G12667 | Encodes a Plant thionin family protein |
AT5G31804 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-259 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G09130 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
AT3G21100 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G19460 | DUF3511 domain protein (DUF3511);(source:Araport11) |
AT1G21560 | hypothetical protein;(source:Araport11) |
AT2G16890 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT2G04300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G51030 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G24750 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G54950 | transmembrane protein;(source:Araport11) |
AT1G78140 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G32640 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
AT1G58235 | hypothetical protein;(source:Araport11) |
AT3G42330 | transposable_element_gene;(source:Araport11);contains InterPro domain DNA polymerase III clamp loader subunit, C-terminal;(source:TAIR10) |
AT4G00500 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G33760 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G31620 | hypothetical protein;(source:Araport11) |
AT1G75210 | HAD-superfamily hydrolase, subfamily IG, 5-nucleotidase;(source:Araport11) |
AT5G46645 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 0.00040 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G02960 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT5G12350 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
AT1G62450 | Immunoglobulin E-set superfamily protein;(source:Araport11) |
AT5G37360 | LOW protein: ammonium transporter 1-like protein;(source:Araport11) |
AT2G01630 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT1G66880 | Protein kinase superfamily protein;(source:Araport11) |
AT3G62520 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.1e-86 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
AT1G13850 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
AT3G60730 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT5G05330 | Encodes a protein with a putative HMG-box domain. The high-mobility group (HMG) proteins are chromatin-associated proteins that act as architectural factors in various nucleoprotein structures, which regulate DNA-dependent processes such as transcription and recombination. Expression of this gene was not detected according to Grasser et al. (J. Mol. Biol. 2006:358, 654-664). |
AT5G08180 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
AT3G50640 | hypothetical protein;(source:Araport11) |
AT4G16610 | C2H2-like zinc finger protein;(source:Araport11) |
AT5G05230 | RING/U-box superfamily protein;(source:Araport11) |
AT5G17410 | Spc97 / Spc98 family of spindle pole body (SBP) component;(source:Araport11) |
AT3G26100 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT1G47940 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G77100 | peroxidase superfamily protein;(source:Araport11) |
AT2G25550 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.1e-44 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
AT2G25070 | Protein phosphatase 2C family protein;(source:Araport11) |
AT1G28410 | myosin heavy chain-like protein;(source:Araport11) |
AT1G77145 | transmembrane protein, putative (DUF506);(source:Araport11) |
AT2G44798 | Natural antisense transcript overlaps with AT2G44800;(source:Araport11) |
AT5G41830 | RNI-like superfamily protein;(source:Araport11) |
AT1G66320 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT1G43150 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.3e-25 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G55855 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT1G12080 | Vacuolar calcium-binding protein-like protein;(source:Araport11) |
AT1G16250 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G61670 | Lung seven transmembrane receptor family protein;(source:Araport11) |
AT3G12585 | pre-tRNA tRNA-Arg (anticodon: CCG);(source:Araport11, TAIR10) |
AT1G18090 | 5-3 exonuclease family protein;(source:Araport11) |
AT5G33330 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT4G04980 | hypothetical protein;(source:Araport11) |
AT2G18090 | PHD finger family protein / SWIB complex BAF60b domain-containing protein / GYF domain-containing protein;(source:Araport11) |
AT4G18395 | hypothetical protein;(source:Araport11) |
AT1G34500 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
AT3G46240 | ER protein carbohydrate-binding protein;(source:Araport11) |
AT3G49020 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT5G18850 | Low-density receptor-like protein;(source:Araport11) |
AT1G48690 | Auxin-responsive GH3 family protein;(source:Araport11) |
AT5G21222 | protein kinase family protein;(source:Araport11) |
AT5G13340 | arginine/glutamate-rich 1 protein;(source:Araport11) |
AT1G35183 | zinc finger, C3HC4 type (RING finger) protein;(source:Araport11) |
AT1G32820 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.6e-83 P-value blast match to Q9SKL7 /23-182 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT1G06050 | ENHANCED DISEASE RESISTANCE-like protein (DUF1336);(source:Araport11) |
AT5G27715 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
AT2G10960 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.2e-18 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT2G40570 | initiator tRNA phosphoribosyl transferase family protein;(source:Araport11) |
AT5G14500 | aldose 1-epimerase family protein;(source:Araport11) |
AT5G23540 | Mov34/MPN/PAD-1 family protein;(source:Araport11) |
AT4G13760 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G62055 | pseudogene of Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT1G50780 | 2Fe-2S ferredoxin-like superfamily protein;(source:Araport11) |
AT2G28790 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT5G53900 | Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11) |
AT2G01023 | hypothetical protein;(source:Araport11) |
AT4G04940 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT5G03795 | Exostosin family protein;(source:Araport11) |
AT1G10610 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G09910 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
AT2G05753 | hypothetical protein;(source:Araport11) |
AT5G03377 | pseudogene of acylphosphatase family protein |
AT5G64420 | DNA polymerase V family;(source:Araport11) |
AT1G43835 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 2.7e-63 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
AT1G36210 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-71 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G72690 | neurofilament heavy protein;(source:Araport11) |
AT3G61160 | Protein kinase superfamily protein;(source:Araport11) |
AT1G48330 | SsrA-binding protein;(source:Araport11) |
AT5G52740 | Copper transport protein family;(source:Araport11) |
AT4G17718 | Encodes a defensin-like (DEFL) family protein. |
AT4G37240 | PADRE protein down-regulated after infection by S. sclerotiorun. |
AT3G16660 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT2G44210 | carboxyl-terminal peptidase (DUF239);(source:Araport11) |
AT3G23190 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
AT1G68300 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT1G04960 | golgin family A protein (DUF1664);(source:Araport11) |
AT5G41180 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
AT1G77932 | FANTASTIC four protein, putative (DUF3049);(source:Araport11) |
AT2G30430 | hypothetical protein;(source:Araport11) |
AT4G08455 | BTB/POZ domain-containing protein;(source:Araport11) |
AT1G06640 | encodes a protein whose sequence is similar to a 2-oxoglutarate-dependent dioxygenase The mRNA is cell-to-cell mobile. |
AT5G25750 | hypothetical protein;(source:Araport11) |
AT1G53200 | TAF RNA polymerase I subunit A;(source:Araport11) |
AT5G05180 | myosin heavy chain, striated protein;(source:Araport11) |
AT4G33810 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT4G20880 | ethylene-responsive nuclear protein / ethylene-regulated nuclear protein (ERT2);(source:Araport11) |
AT4G12135 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.1e-16 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G80400 | RING/U-box superfamily protein;(source:Araport11) |
AT1G17350 | NADH:ubiquinone oxidoreductase intermediate-associated protein 30;(source:Araport11) |
AT3G07910 | reactive oxygen species modulator-like protein;(source:Araport11) |
AT2G19140 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-09 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT5G59410 | Rab5-interacting family protein;(source:Araport11) |
AT5G02025 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
AT1G80580 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
AT5G60000 | transmembrane protein;(source:Araport11) |
AT2G03950 | transposable_element_gene;(source:Araport11);pseudogene, similar to P0518C01.31, similar to MURA transposase of maize Mutator transposon;(source:TAIR10) |
AT4G39240 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT2G41060 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G04280 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G32050 | hypothetical protein;(source:Araport11) |
AT2G03630 | suppressor SRP40-like protein;(source:Araport11) |
AT4G21360 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G37120 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 8.3e-14 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G43886 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.3e-165 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT1G30935 | Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT1G51300 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G29975 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.4e-306 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT4G29890 | choline monooxygenase, putative (CMO-like);(source:Araport11) |
AT1G78200 | Protein phosphatase 2C family protein;(source:Araport11) |
AT1G47390 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G03670 | Ankyrin repeat containing protein |
AT5G41760 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT1G60060 | Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11) |
AT2G42900 | Plant basic secretory protein (BSP) family protein;(source:Araport11) |
AT5G05025 | Encodes a Pollen Ole e I allergen and extensin family protein [pseudogene] |
AT1G08900 | Major facilitator superfamily protein;(source:Araport11) |
AT2G25150 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT4G07869 | Pseudogene of AT1G24440; protein binding / zinc ion binding protein |
AT5G55430 | hypothetical protein;(source:Araport11) |
AT2G27730 | copper ion binding protein;(source:Araport11) |
AT3G60340 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G76910 | hypothetical protein;(source:Araport11) |
AT5G40700 | transcriptional regulator ATRX-like protein;(source:Araport11) |
AT5G01010 | retinal-binding protein;(source:Araport11) |
AT1G66760 | MATE efflux family protein;(source:Araport11) |
AT5G50890 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G42886 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-89 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT1G23935 | apoptosis inhibitory protein;(source:Araport11) |
AT1G42698 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.4e-54 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
AT1G11200 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
AT5G54170 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT3G06750 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G03890 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT3G54550 | DNA-directed RNA polymerase subunit beta-beta protein, putative (DUF506);(source:Araport11) |
AT1G14048 | GCK domain-containing protein;(source:Araport11) |
AT3G63400 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT1G09870 | histidine acid phosphatase family protein;(source:Araport11) |
AT5G41900 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G11210 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT5G62420 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT3G27540 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT1G69760 | suppressor SRP40-like protein;(source:Araport11) |
AT5G09345 | pre-tRNA tRNA-Leu (anticodon: CAA);(source:Araport11, TAIR10) |
AT1G53930 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT1G34300 | lectin protein kinase family protein;(source:Araport11) |
AT1G11055 | Encodes a defensin-like (DEFL) family protein. |
AT2G45750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G05090 | Inositol monophosphatase family protein;(source:Araport11) |
AT2G15340 | glycine-rich protein;(source:Araport11) |
AT2G29679 | hypothetical protein;(source:Araport11) |
AT1G51810 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G12170 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT5G43695 | hypothetical protein;(source:Araport11) |
AT3G46070 | C2H2-type zinc finger family protein;(source:Araport11) |
AT2G31620 | Receptor-like protein kinase-related family protein;(source:Araport11) |
AT2G35050 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
AT2G21990 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT3G47342 | snoRNA;(source:Araport11) |
AT4G05631 | hypothetical protein;(source:Araport11) |
AT1G28250 | transmembrane protein;(source:Araport11) |
AT4G08330 | hypothetical protein;(source:Araport11) |
AT1G30925 | F-box/associated interaction domain protein;(source:Araport11) |
AT1G78060 | Glycosyl hydrolase family protein;(source:Araport11) |
AT3G07690 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
AT1G61750 | Receptor-like protein kinase-related family protein;(source:Araport11) |
AT4G02555 | snoRNA;(source:Araport11) |
AT1G47860 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-40 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G49460 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT4G29980 | fasciclin-like arabinogalactan protein;(source:Araport11) |
AT1G01570 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
AT3G23685 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT3G47890 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT5G45950 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G26558 | other_RNA;(source:Araport11) |
AT4G21420 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.9e-06 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
AT4G16260 | Encodes a putative beta-1,3-endoglucanase that interacts with the 30C02 cyst nematode effector. May play a role in host defense. |
AT5G18260 | RING/U-box superfamily protein;(source:Araport11) |
AT4G28440 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT2G11170 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G28899 | hypothetical protein;(source:Araport11) |
AT3G22290 | Endoplasmic reticulum vesicle transporter protein;(source:Araport11) |
AT1G43020 | electron protein, putative (Protein of unknown function, DUF547);(source:Araport11) |
AT4G11160 | Translation initiation factor 2, small GTP-binding protein;(source:Araport11) |
AT1G11592 | other_RNA;(source:Araport11) |
AT5G42760 | Leucine carboxyl methyltransferase;(source:Araport11) |
AT1G18760 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
AT2G10614 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G45740 | hydrolase family protein / HAD-superfamily protein;(source:Araport11) |
AT1G68350 | cotton fiber protein;(source:Araport11) |
AT3G61920 | PADRE protein. |
AT3G49740 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G18970 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G14590 | Isocitrate/isopropylmalate dehydrogenase family protein;(source:Araport11) |
AT3G50160 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT5G24205 | other_RNA;(source:Araport11) |
AT2G13950 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G60700 | hypothetical protein (DUF1163);(source:Araport11) |
AT1G17450 | B-block binding subunit of TFIIIC;(source:Araport11) |
AT5G10800 | RNA recognition motif (RRM)-containing protein;(source:Araport11) |
AT1G21080 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT1G08735 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.3e-87 P-value blast match to Q9SLM0 /314-478 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT2G37240 | Thioredoxin superfamily protein;(source:Araport11) |
AT1G15410 | aspartate-glutamate racemase family;(source:Araport11) |
AT2G13542 | Encodes a defensin-like (DEFL) family protein. |
AT5G55410 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G16660 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-268 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT5G20560 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT3G26910 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G08060 | furry;(source:Araport11) |
AT2G39865 | transmembrane protein;(source:Araport11) |
AT1G77280 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT4G29030 | Putative membrane lipoprotein;(source:Araport11) |
AT3G30380 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G73940 | tumor necrosis factor receptor family protein;(source:Araport11) |
AT3G61270 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
AT4G30900 | DNAse I-like superfamily protein;(source:Araport11) |
AT5G25570 | polyamine-modulated factor 1-binding protein;(source:Araport11) |
AT1G33360 | Encodes ClpX3, a subunit of the Clp protease complex. |
AT5G42530 | hypothetical protein;(source:Araport11) |
AT5G46490 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT4G18380 | F-box family protein;(source:Araport11) |
AT2G02520 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT2G03810 | 18S pre-ribosomal assembly protein gar2-like protein;(source:Araport11) |
AT3G43960 | Encodes a putative cysteine proteinase. Mutants exhibit shorter root hairs under phosphate-deficient conditions. |
AT5G15340 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G31412 | hAT transposon superfamily protein;(source:Araport11) |
AT3G25680 | SLH domain protein;(source:Araport11) |
AT4G25280 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G25700 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT2G46100 | Nuclear transport factor 2 (NTF2) family protein;(source:Araport11) |
AT1G49280 | pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10) |
AT5G41350 | RING/U-box superfamily protein;(source:Araport11) |
AT1G55100 | transposable_element_gene;(source:Araport11);pseudogene, putative ATP synthase beta subunit;(source:TAIR10) |
AT1G22180 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT3G42810 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G18420.1);(source:TAIR10) |
AT2G37690 | phosphoribosylaminoimidazole carboxylase, putative / AIR carboxylase;(source:Araport11) |
AT2G12320 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32169.1);(source:TAIR10) |
AT3G13650 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT3G30718 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 7.7e-111 P-value blast match to F21A17 reverse transcriptase (from Dan Voytas http://www.public.iastate.edu/~voytas) (Gypsy_Ty3-family);(source:TAIR10) |
AT2G37800 | cysteine/histidine-rich C1 domain protein;(source:Araport11) |
AT3G53680 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
AT1G52460 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G50150 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT5G09620 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT3G55790 | transmembrane protein;(source:Araport11) |
AT5G51380 | RNI-like superfamily protein;(source:Araport11) |
AT2G40290 | Encodes an eIF2alpha homolog that can be phosphorylated by GCN2 in vitro. |
AT3G49551 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G23740 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G11620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G73950 | Transmembrane Fragile-X-F-associated protein;(source:Araport11) |
AT1G32172 | other_RNA;(source:Araport11) |
AT4G02880 | ELKS/Rab6-interacting/CAST family protein;(source:Araport11) |
AT1G77160 | hypothetical protein (DUF506);(source:Araport11) |
AT1G19970 | ER lumen protein retaining receptor family protein;(source:Araport11) |
AT1G80970 | XH domain-containing protein;(source:Araport11) |
AT4G22980 | molybdenum cofactor sulfurase-like protein;(source:Araport11) |
AT5G27395 | Mitochondrial inner membrane translocase complex, subunit Tim44-related protein;(source:Araport11) |
AT4G13263 | ECA1 gametogenesis family protein (DUF784);(source:Araport11) |
AT4G29560 | fanconi anemia group E protein FANCE protein;(source:Araport11) |
AT3G01810 | EEIG1/EHBP1 protein amino-terminal domain protein;(source:Araport11) |
AT3G07440 | hypothetical protein;(source:Araport11) |
AT5G56900 | CwfJ-like family protein / zinc finger (CCCH-type) family protein;(source:Araport11) |
AT1G11970 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT3G45093 | Encodes a defensin-like (DEFL) family protein. |
AT2G17000 | Mechanosensitive ion channel family protein;(source:Araport11) |
AT2G04100 | MATE efflux family protein;(source:Araport11) |
AT5G23413 | pseudogene of HMG-box (high mobility group) DNA-binding family protein;(source:Araport11) |
AT3G02010 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G38215 | Natural antisense transcript overlaps with AT4G38210;(source:Araport11) |
AT5G28285 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 9.8e-101 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
AT2G03990 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT2G33650 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT2G14378 | Encodes a ECA1 gametogenesis related family protein |
AT4G31680 | Transcriptional factor B3 family protein;(source:Araport11) |
AT5G39850 | Ribosomal protein S4;(source:Araport11) |
AT3G60780 | hypothetical protein (DUF1442);(source:Araport11) |
AT5G59540 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT4G28025 | hypothetical protein;(source:Araport11) |
AT2G20721 | snoRNA;(source:Araport11) |
AT5G44690 | RING finger PFF0165c-like protein;(source:Araport11) |
AT4G29090 | Ribonuclease H-like superfamily protein;(source:Araport11) |
AT5G11760 | stress response protein;(source:Araport11) |
AT3G57062 | transmembrane protein;(source:Araport11) |
AT2G31290 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT1G21651 | zinc ion binding protein;(source:Araport11) |
AT2G12650 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-38 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G65440 | transmembrane protein;(source:Araport11) |
AT3G32902 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G07710.1);(source:TAIR10) |
AT3G12950 | Trypsin family protein;(source:Araport11) |
AT3G22750 | Protein kinase superfamily protein;(source:Araport11) |
AT3G24840 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT5G11870 | Alkaline phytoceramidase (aPHC);(source:Araport11) |
AT1G78280 | transferases, transferring glycosyl groups;(source:Araport11) |
AT3G42680 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G05647.1);(source:TAIR10) |
AT4G15715 | Proteinase inhibitor I25, cystatin, conserved region;(source:Araport11) |
AT1G29700 | Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11) |
AT5G44660 | hypothetical protein;(source:Araport11) |
AT5G38570 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G25585 | pre-tRNA tRNA-Leu (anticodon: CAA);(source:Araport11, TAIR10) |
AT5G28890 | transposable_element_gene;(source:Araport11);similar to DNA binding [Arabidopsis thaliana] (TAIR:AT4G01980.1);(source:TAIR10) |
AT1G54460 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
AT4G13495 | other_RNA;(source:Araport11) |
AT5G10340 | F-box family protein;(source:Araport11) |
AT5G46850 | phosphatidylinositol-glycan biosynthesis class X-like protein;(source:Araport11) |
AT5G25800 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT5G62760 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G33817 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.1e-100 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT5G53220 | hypothetical protein;(source:Araport11) |
AT5G14030 | translocon-associated protein beta (TRAPB) family protein;(source:Araport11) |
AT2G18630 | transmembrane protein, putative (DUF677);(source:Araport11) |
AT5G28920 | hypothetical protein;(source:Araport11) |
AT2G02610 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G30050 | transmembrane protein;(source:Araport11) |
AT5G56520 | hypothetical protein;(source:Araport11) |
AT1G27990 | transmembrane protein;(source:Araport11) |
AT1G72510 | DUF1677 family protein (DUF1677);(source:Araport11) |
AT3G56870 | hypothetical protein;(source:Araport11) |
AT5G52880 | F-box family protein;(source:Araport11) |
AT5G38350 | Disease resistance protein (NBS-LRR class) family;(source:Araport11) |
AT1G77660 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT3G31023 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.0e-152 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G06135 | transmembrane protein;(source:Araport11) |
AT5G35495 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.8e-27 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G27770 | DUF868 family protein (DUF868);(source:Araport11) |
AT3G43833 | hypothetical protein;(source:Araport11) |
AT3G45275 | Encodes a ECA1 gametogenesis related family protein |
AT1G63522 | Encodes a defensin-like (DEFL) family protein. |
AT5G33253 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-29 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT2G40910 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT4G00670 | Remorin family protein;(source:Araport11) |
AT4G19925 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
AT2G34080 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT1G23780 | F-box family protein;(source:Araport11) |
AT2G12325 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.9e-16 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
AT2G06170 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.7e-91 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT1G04560 | AWPM-19-like family protein;(source:Araport11) |
AT3G59923 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT5G46730 | glycine-rich protein;(source:Araport11) |
AT5G64250 | Aldolase-type TIM barrel family protein;(source:Araport11) |
AT1G49730 | Protein kinase superfamily protein;(source:Araport11) |
AT5G13845 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
AT2G34120 | Cytochrome C oxidase polypeptide VIB family protein;(source:Araport11) |
AT3G09570 | Lung seven transmembrane receptor family protein;(source:Araport11) |
AT2G14850 | SPT module subunit, interacts with HAG1. |
AT4G33890 | Component of SAGA complex, SPT module subunit, interacts with HAG1. |
AT4G31440 | transcriptional regulator of RNA polII, SAGA, subunit;(source:Araport11) |
AT2G24530 | Member of SAGA complex, SPT modulu subunit, interacts with HAG1. |
AT1G06100 | Fatty acid desaturase family protein;(source:Araport11) |
AT1G27930 | Arabinogalactan methylesterase,involved in arabinogalactan glucuronic acid methylation. Interacts with eIF3. |
AT5G21030 | PAZ domain-containing protein / piwi domain-containing protein;(source:Araport11) |
AT3G27250 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
AT5G40790 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
AT5G40800 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
AT3G07030 | Alba DNA/RNA-binding protein;(source:Araport11) |
AT2G17970 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT4G32660 | Encodes protein kinase AME3. |
AT4G03050 | The transcribed allele in ecotype Ler encodes a 2-oxoglutarate-dependent dioxygenase which is involved in glucosinolate biosynthesis. AOP3 is transcriptionally silent in leaf tissues of ecotype Col.The natural variation in this locus explains the diversification of hydroxyalkyl glucosinolates among different ecotypes of Arabidopsis. |
AT1G07570 | Protein kinase capable of phosphorylating tyrosine, serine, and threonine residues |
AT4G18020 | Encodes pseudo-response regulator 2 (APRR2) that interacts with a calcium sensor (CML9). |
AT1G19920 | encodes a chloroplast form of ATP sulfurylase. |
AT1G52080 | actin binding protein family;(source:Araport11) |
AT1G06400 | small GTP-binding protein (ara-2).RabGTPase functioning in anterograde trafficking from trans-Golgi network/early endosomal compartments to the plasma membrane as well as in responses to salinity stress. |
AT4G19640 | Encodes Ara7. |
AT1G01020 | ARV1 family protein;(source:Araport11) |
AT4G01510 | Arv1-like protein;(source:Araport11) |
AT2G30130 | Overexpression/activation tagged allele has epinastic leaves, reduced apical dominance and is sterile. Gene is similar to asymmetric leaves (AS)/lateral organ boundary (LOB) genes which repress KNOX gene expression. |
AT4G32200 | meiotic asynaptic mutant 2, homologue of ASY1 |
AT1G31860 | encodes a bifunctional protein that has phosphoribosyl-ATP pyrophosphohydrolase (PRA-PH) and phosphoribosyl-AMP cyclohydrolase (PRA-CH) activities. |
AT4G16640 | Matrix metalloprotease. |
AT5G64400 | CHCH domain protein;(source:Araport11) involved in mechanotransduction. Loss of both At12cys-1 and At12cys-2 lead to enhanced tolerance to drought and light stress and increased anti-oxidant capacity. |
AT5G09570 | Twin CX9C domain protein. Induced by low phosphate or iron, drought and heat stress. Loss of both At12cys-1 and At12cys-2 lead to enhanced tolerance to drought and light stress and increased anti-oxidant capacity. |
AT5G03545 | Expressed in roots in response to phosphate starvation, this response is enhanced by the presence of IAA. Additionally, its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. The mRNA is cell-to-cell mobile. |
AT3G29590 | At3g29590 (At5MAT) encodes a malonyl-CoA:anthocyanidin 5-O-glucoside-6"-O-malonyltransferase that is coordinately expressed with a epistatic 5-O-anthocyanidin glucosyltransferase (At4g14090). The enzyme is involved in the malonylation of anthocyanins in Arabidopsis. |
AT1G75940 | encodes a protein similar to the BGL4 beta-glucosidase from Brassica napus. The ATA27 protein is predicted to have an ER retention signal and an acidic isoelectric point, suggesting that it may be localized to the ER lumen. |
AT5G08790 | induced by wounding, belongs to a large family of putative transcriptional activators with NAC domain. |
AT4G14710 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT2G39190 | member of ATH subfamily |
AT1G20823 | Encodes a RING E3 ubiquitin ligase ATL80. Involved in phosphate mobilization and cold stress response in sufficient phosphate growth conditions. The mRNA is cell-to-cell mobile. |
AT4G20820 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G11770 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
AT5G44400 | FAD-binding Berberine family protein;(source:Araport11) |
AT5G44410 | FAD-binding Berberine family protein;(source:Araport11) |
AT5G44440 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G26400 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G26410 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G30710 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G51160 | TRAPP protein BET5 homolog. |
AT1G61660 | Encodes a transcriptional activator that regulates the expression of genes by binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT3G14000 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
AT2G02160 | Non- tandem CCCH zinc finger protein. |
AT4G25780 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
AT4G25790 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
AT4G30320 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
AT1G02305 | Encodes a capase involved in stress induced cell death. |
AT3G58580 | Encodes a protein that is involved in mRNA processing and localized to cytoplasmic p-bodies. Double mutants with CCR4a show decreased sensitivity to high concentrations of sucrose. Involved in starch and sucrose metabolism. |
AT4G22330 | AtCES1 encodes a nuclear and endoplasmic reticulum localized Acyl-CoA independent ceramide synthase that is involved in sphingolipid metabolism, disease resistance, nutrient limitation, and response to salt stress. Facilitates adaptation to environmental stresses by regulating autophagy. |
AT1G16380 | member of Putative Na+/H+ antiporter family |
AT5G56340 | RING/U-box superfamily protein;(source:Araport11) |
AT1G27840 | Encodes a DDB1a interacting protein ATCSA-1 required for UV-B tolerance and genomic integrity. |
AT4G15290 | Encodes a gene similar to cellulose synthase. Mutants exhibit shorter root hairs under phosphate-deficient conditions. |
AT2G24630 | encodes a XyG glucan synthase; gene similar to cellulose synthase |
AT2G25900 | Encodes a protein with two tandem-arrayed CCCH-type zinc fingers that binds RNA and is involved in RNA turnover. The mRNA is cell-to-cell mobile. |
AT4G21300 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G21030 | Encodes a nuclear protein that can bind DNA in a sequence specific manner and is involved in seed coat development and shoot branching. It has been shown to activate transcription of a target gene, AtEXPA9. |
AT5G10310 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
AT4G37810 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
AT3G62600 | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast. Forms a complex SDF2-ERdj3B-BiP that is required for the proper accumulation of the surface-exposed leucine-rich repeat receptor kinases EFR. EFR is involved in PAMP (pathogen associated molecular patterns) triggered immunity. |
AT3G51800 | putative nuclear DNA-binding protein G2p (AtG2) mRNA, |
AT5G61500 | autophagy-related (ATG) gene |
AT3G59950 | Autophagy protein. |
AT2G05630 | in the Arabidopsis autophagy pathway |
AT1G52150 | Member of the class III HD-ZIP protein family. Contains homeodomain and leucine zipper domain. Critical for vascular development and negatively regulates vascular cell differentiation. |
AT1G69780 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein which is expressed during the seed-to-seedling transition, regulates some of the network nodes, and affects late seedling establishment. Knock-out mutants for athb13 showed increased primary root length as compared with wild type (Col-0) seedlings, suggesting that this transcription factor is a negative regulator of early root growth, possibly repressing cell division and/or cell elongation or the length of time cells elongate. |
AT3G20040 | Hexokinase;(source:Araport11) |
AT1G73130 | ATG8A/F interacting protein containing a WxxL LIR motif at the C terminus which is essential for interaction with ATG8. Stress (abiotic or biotic) results in the formation of ATG8- and ATI3-labeled punctate structures, likely reflecting increased formation of ATG8-labeled phagophores or autophagosomes. ATI3 proteins probably act as selective autophagy receptors that target specific cellular components during the plant stress response. ATI3 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
AT2G31140 | Peptidase S24/S26A/S26B/S26C family protein;(source:Araport11) |
AT2G24060 | SUPPRESSOR OF VARIEGATION9 (SVR9),encodes a chloroplast-localized prokaryotic type translation initiation factor 3. Mutant plants shows both chloroplast development defect, and a series of leaf developmental abnormalities including more serrated leaf margin, disorganized mesophyll cells, and altered cotyledon venation patterns. |
AT1G28210 | DnaJ homolog AtJ1 (atj) |
AT1G16340 | Encodes a protein with putative 3-deoxy-D-manno-octulosonic acid 8-phosphate synthetase activity. This gene share a very high sequence homology with its homologue AtkdsA1 (AT1G79500). |
AT1G72310 | Encodes a putative RING-H2 zinc finger protein ATL3 (ATL3). |
AT5G05810 | RING/U-box superfamily protein;(source:Araport11) |
AT5G57160 | Encodes the Arabidopsis orthologue of the yeast and mammalian DNA ligase IV. Involved in the repair of DNA damage but, unlike in yeast, not required for T-DNA integration. Interacts with the Arabidopsis homologue of XRCC4. |
AT2G38130 | Encodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes. |
AT1G53165 | Protein kinase superfamily protein;(source:Araport11) |
AT5G50780 | MORC4 is a member of a family of GHKL ATPases. It is localized in the nuceloplasm and adjacent to chromocenters. Along with MORC7, it appears to repress the expression |
AT1G07880 | member of MAP Kinase |
AT1G18150 | Encodes mitogen-activated protein kinase 8 (MPK8). MPK8 connects protein phosphorylation, Ca2+, and ROS in the wound-signaling pathway. |
AT3G05830 | Encodes alpha-helical IF (intermediate filament)-like protein.NEAP1 is a member of a small family containing coiled-coil domains, a nuclear localization signal and a C-terminal predicted transmembrane domain. It localizes to the nuclear periphery. Mutants have altered nuclear morphology and chromatin structure. |
AT1G09470 | NEAP3 is a member of a small family containing coiled-coil domains, a nuclear localization signal and a C-terminal predicted transmembrane domain. It localizes to the nuclear periphery. Mutants have altered nuclear morphology and chromatin structure. |
AT2G31450 | DNA glycosylase superfamily protein;(source:Araport11) |
AT1G07620 | GTP-binding protein Obg/CgtA;(source:Araport11) |
AT5G51540 | Mitochondrial ATP-independent protease |
AT3G62880 | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
AT1G01230 | ORM1 is an ER localized orosomucoid-like protein involved in sphingolipid homeostasis. |
AT5G57345 | OXR is a single copy gene in Arabidopsis. It is localized to the ER. It is expressed throughout the plant and expression is induced in response to abiotic stress. While the function of OXR is unknown, overexpression results in increased abiotic stress tolerance and increased ascorbic acid content. |
AT4G00860 | putative pathogenesis-related protein whose transcript level is induced in response to ozone and pathogenic Pseudomonas strains. |
AT1G35537 | Encodes a defensin-like peptide with antifungal activity. |
AT1G49340 | Encodes a phosphatidylinositol 4-kinase that is expressed in inflorescences and shoots. |
AT2G02270 | pseudogene of phloem protein 2-B2;(source:Araport11) |
AT4G11570 | Encodes plastid localized protein involved in riboflavin biosynthesis. It dephosphorylates 5-amino-6-ribitylamino- 2,4(1H,3H) pyrimidinedione 5′-phosphate (ARPP) . |
AT5G21280 | Seed plant lineage specific gene that is expressed in response to oxidative and abiotic stresses. |
AT5G59840 | Ras-related small GTP-binding family protein;(source:Araport11) |
AT1G19230 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
AT4G27000 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G39220 | Key player of retrieval of ER membrane proteins |
AT4G16830 | Encodes a perinuclear and cytoplasmically localized mRNA binding protein. AtRGGA is likely involved in stress responsivness. It is induced by salt and osmotic stress and loss of function mutations are more sensitive to stress. The mRNA is cell-to-cell mobile. |
AT1G08600 | The Arabidopsis ATRX harbours a N-terminal ADD domain and a C-terminal helicase domain and is devoid of the large central region involved in DAXX interaction in mammals. Arabidopsis ATRX mutant alleles are viable, but with reduced fertility. Their combination with mutants for the H3.3 chaperone HIRA impairs plant survival. ATRX loss affects cellular histone H3.3 pools and modulates the H3.1/H3.3 balance. Notably, at a genome-wide scale, loss of ATRX leads to a reduced H3.3 level at genes characterized by elevated H3.3 occupancy and high expression, including the 45S ribosomal DNA (45S rDNA) loci. Indeed, expression of specific 45S rDNA sequence variants is altered by ATRX loss (DOI:10.1105/tpc.16.00877) |
AT1G20160 | Encodes two isoforms. One (SBT5.2(a) ) is a secreted, cell wall localized subtilisin-like serine protease that is involved in regulation of stomatal development. The second isoform (SBT5.2(b) is localized to endosomes. |
AT1G05520 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
AT2G21630 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
AT3G23660 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
AT4G14160 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
AT2G17640 | Encodes a cytosolic serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. Expression is induced after long-term sulfur starvation. |
AT3G01720 | peptidyl serine alpha-galactosyltransferase;(source:Araport11) |
AT1G29060 | Encodes a golgi localized QcSNARE involved in response to salt and osmotic stress. Overexpression confers increased resistance to NaCl, mannitol and LiCl. SFT12 may act by mediating vacuolar sequestration of NaCl and other ions. |
AT3G05840 | Glycogen synthase kinase-3 member which encodes a SHAGGY-like kinase involved in meristem organization. Regulates flowering through mediating CONSTANS stability. |
AT3G47460 | member of SMC subfamily |
AT5G08335 | Encodes an isoprenyl cysteine methylatransferase (ICMT) involved in the post-translational processing of proteins that have a C-terminal CaaX box. This protein appears to have higher catalytic activity and a higher transcript expression level than the other ICMT present in Arabidopsis (At5g23320). Analysis of ICMT RNAi lines suggests that this protein is involved in flower and stem development. |
AT2G16860 | GCIP-interacting family protein;(source:Araport11) |
AT1G32270 | member of SYP2 Gene Family |
AT5G51460 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
AT1G68020 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain and a trehalose phosphatase (TPP)-like domain. It can complement a yeast mutant lacking both of these activities suggesting that this is a bifunctional enzyme. |
AT3G54860 | Homologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis. |
AT2G32900 | Homologous to Drosophila ZW10, a centromere/kinetochore protein involved in chromosome segregation. Member of MAG2 complex on the ER that is responsible for efficient transport of seed storage proteins, functions in protein transport between the ER and Golgi apparatus, contain a Zeste?White 10 (ZW10) domain and a Sec39 domain. Required for proper maturation of seed storage proteins. |
AT1G19910 | vacuolar H+-pumping ATPase 16 kDa proteolipid (ava-p2) |
AT4G12530 | Encodes a member of the AZI family of lipid transfer proteins. |
AT2G01340 | Encodes a protein whose expression is responsive to nematode infection; PADRE protein up-regulated after infection by S. sclerotiorun. |
AT3G24315 | Sec20 family protein;(source:Araport11) |
AT4G21390 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT5G20990 | Involved in molybdenum cofactor (Moco) biosynthesis, inserting Mo into Molybdopterin. sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling. |
AT1G66270 | BGLU21 encodes a beta-glucosidase that has a high level of activity against the naturally occuring secondary metabolite scopolin. Recombinant BGLU21 produced in insect cells shows lower levels of activity using the structurally similar substrates esculin (33%) and 4-MU-glucoside (9%). BGLU21 is glycosylated in planta and has a C-terminal ER retention signal. Transcript analysis as well as protein extraction and western blotting from various plant organs suggest that BGLU21 is only present in roots and seedlings. Transcript levels increase in response to cold, auxin (2,4-D), and methyl jasmonate treatments. |
AT1G22490 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G04150 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. |
AT2G43140 | bHLH129 is a nuclear localized basic helix loop helix protein. It has been shown to function as a transcriptional repressor. Overexpression of bHLH129 regulates root elongation and ABA response. |
AT4G00870 | bHLH14 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH13 and bHLH17 to negatively regulate jasmonate responses. |
AT1G71870 | Metabolite transporter involved in the anthocyanin response to anthocyanin induction conditions. Affects ABA signaling and localization. |
AT3G57090 | Encodes a protein with similarity to yeast FIS proteins. These membrane anchored proteins bind DRP proteins and function during organelle division. FIS1B is expressed ubiquitously and appears to be involved in peroxisome division. |
AT5G42020 | Luminal binding protein (BiP2) involved in polar nuclei fusion during proliferation of endosperm nuclei. |
AT2G45100 | Cyclin/Brf1-like TBP-binding protein. Double mutants with BRF2 show defects in pollen development. Involved in regulation of thermo tolerance. |
AT3G09360 | Cyclin/Brf1-like TBP-binding protein. Double mutants with BRF1 show defects in pollen development. Controls FES1A regulated thermosensitivity. |
AT2G42270 | Similar to yeast Brr2p DEAD/DExH box ATP-dependent RNA helicase. |
AT5G61140 | Encodes a predicted protein with 30% identity with MER3/RCK. Similar to yast Brr2p DEAD/DExH box ATP-dependent RNA helicase. |
AT3G11480 | The gene encodes a SABATH methyltransferase that methylates both salicylic acid and benzoic acid. It is highly expressed in flowers, induced by biotic and abiotic stress and thought to be involved in direct defense mechanism. |
AT1G15280 | CASC3/Barentsz eIF4AIII binding protein;(source:Araport11) |
AT5G28770 | BASIC LEUCINE ZIPPER protein which regulates the circadian oscillator gene PSEUDO RESPONSE REGULATOR7 (PRR7) to change the circadian phase in response to sugars. It upregulates PRR7 in response to low energy. bZIP63 and PRR7 are required for correct oscillator phase under light/dark cycles. bZIP protein BZO2H3 mRNA, partial cds |
AT5G40880 | Involved in seed germination, seedling/seed development, interacting with PPPDE family protein Desi1. |
AT5G06830 | Conserved reticulophagy receptor that bridges the gap betweenselective autophagy and ribosome stalling at the endoplasmic reticulum. Interacts directly with ATG8. Recruited to phagophores, precursors to autophagosomes, during ER stress in an autophagy-dependent manner. Forms a receptor complex with UFL1, the E3 ligase that mediates ufmylation, and its adaptor protein, DDRGK1. |
AT5G14060 | lysine-sensitive aspartate kinase |
AT1G02150 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G16320 | Subunit in the anaphase-promoting complex. Role in gametogenesis, control of mitotic progression and cell differentiation during the entire life cycle. |
AT1G07270 | Cell division control, Cdc6;(source:Araport11) |
AT5G14170 | CHC1 is predicted to encode a protein that belongs to the chromodomain remodeling complex. Two RNAi knock-down lines have a dwarf phenotype and reduced rates of Agrobacterium-mediated transformation. The low rate of root-mediated transformation rate may result from altered root morphology or reduced root growth rates. Also named as SWP73B, a subunit of the SWI/SNF chromatin remodeling complex. Acts as important modulator of major developmental pathways. |
AT4G31810 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
AT5G37990 | SABATH family methyltransferase. |
AT4G25370 | Double Clp-N motif protein;(source:Araport11) |
AT3G24200 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
AT4G09040 | Encodes a protein that binds to the chloroplast psbA RNA. Has little effect on chloroplast gene expression under laboratory growth conditions. |
AT5G08650 | Critical for chloroplast protein synthesis under suboptimal conditions. Essential translation factor that promotes the efficiency of chloroplast protein synthesis. |
AT2G04530 | Encodes a protein with RNAse Z activity suggesting a role in tRNA processing. Protein contains a signal sequence for import into the chloroplast. |
AT1G19750 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G24870 | Ubiquitin E3 ligase, works with WDL7 in module which regulates microtubule disassembly to mediate stomatal closure in response to drought stress and ABA treatment. MREL57 interacts with, ubiquitinates and degrades WDL7, effect is enhanced by ABA. |
AT2G37150 | RING/U-box superfamily protein;(source:Araport11) |
AT1G17970 | RING/U-box superfamily protein;(source:Araport11) |
AT4G17740 | Cleaves the C-terminal extension of the D1 precursor (pD1) to form mature D1; initiation of the formation of the oxygenic D1/D2 type PSII. |
AT3G57680 | C-terminal peptidase |
AT1G59650 | Encodes CW14. |
AT1G25682 | coiled-coil protein (DUF572);(source:Araport11) |
AT5G06150 | Encodes a cyclin whose expression is reduced in response to high salt. |
AT5G48640 | Cyclin family protein;(source:Araport11) |
AT1G22015 | Glycosyltransferase-31 (GT31) family member; β-(1,3)-galactosyltransferase (GalT) that catalyzes the synthesis of a β-(1,3)-galactan. GT31 β-(1,3)-GalTs play a role in elaborating type II AGs that decorate AGPs and pectins, thereby imparting functional consequences on plant growth and development. |
AT4G27120 | ER-resident adaptor protein. Part of complex with C53 and UFL1, the E3 ligase that mediates ufmylation. Involved in the pathway that links ribosome-associated quality control with selective autophagy at the ER. |
AT1G11120 | CTTNBP 2 amino-terminal-like protein;(source:Araport11) |
AT1G62500 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT3G05727 | Encodes a defensin-like (DEFL) family protein. Activated by OXS2 under the treatment of salt. |
AT1G76880 | DF1 is a putative transcription factor required for the synthesis of seed mucilage polysaccharides. The df1 seeds produce almost 50% less mucilage than wild-type, but show less severe defects than the myb5 and ttg2 mutants. |
AT3G54600 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
AT3G01420 | Encodes an alpha-dioxygenase involved in protection against oxidative stress and cell death. Induced in response to Salicylic acid and oxidative stress. Independent of NPR1 in induction by salicylic acid. The mRNA is cell-to-cell mobile. |
AT3G44460 | basic leucine zipper transcription factor (BZIP67), identical to basic leucine zipper transcription factor GI:18656053 from (Arabidopsis thaliana); identical to cDNA basic leucine zipper transcription factor (atbzip67 gene) GI:18656052. Located in the nucleus and expressed during seed maturation in the cotyledons. |
AT5G18400 | Cytosolic Iron-sulfur cluster Assembly protein. |
AT1G72660 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G17190 | Encodes a ubiquitin receptor protein that specifically associates with PEX2 and PEX12. |
AT5G54880 | Involved in posttranscriptional modification of tRNA. Required for the acp3U20a modification of cytosolic tRNA. |
AT3G55410 | Encodes the E1 subunit of the 2-oxoglutarate dehydrogenase. |
AT1G18100 | Encodes a member of the FT and TFL1 family of phosphatidylethanolamine-binding proteins. It is expressed in seeds and up-regulated in response to ABA. Loss of function mutants show decreased rate of germination in the presence of ABA. ABA dependent regulation is mediated by both ABI3 and ABI5. ABI5 promotes MFT expression, primarily in the radicle-hypocotyl transition zone and ABI3 suppresses it in the seed. |
AT5G55070 | Encodes the E2 subunit of the 2-oxoglutarate dehydrogenase. |
AT5G60390 | GTP binding Elongation factor Tu family protein;(source:Araport11) |
AT2G32580 | transmembrane protein, putative (DUF1068);(source:Araport11) |
AT1G07920 | GTP binding Elongation factor Tu family protein;(source:Araport11) |
AT5G41120 | Esterase/lipase/thioesterase family protein;(source:Araport11) |
AT5G41130 | Esterase/lipase/thioesterase family protein;(source:Araport11) |
AT3G02030 | transferase;(source:Araport11) |
AT1G30580 | GTP binding protein;(source:Araport11) |
AT1G56050 | GTP-binding protein-like protein;(source:Araport11) |
AT3G23870 | magnesium transporter NIPA (DUF803);(source:Araport11) |
AT4G13800 | magnesium transporter NIPA (DUF803);(source:Araport11) |
AT1G71900 | magnesium transporter, putative (DUF803);(source:Araport11) |
AT1G34470 | magnesium transporter, putative (DUF803);(source:Araport11) |
AT4G23170 | Induced in response to Salicylic acid.Similar to receptor-like kinase 4 and 5. NPR1, a known positive regulator of the SA signaling pathway is responsible for the SA-dependent induction and constitutive repression of EP1 gene's basal expression. The mRNA is cell-to-cell mobile. |
AT4G32620 | Polycomb related protein that is part of a protein complex involved in histone deacetylation and heterochromatin silencing. |
AT3G05210 | encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10. |
AT1G19210 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
AT5G07580 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
AT5G61890 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
AT1G75920 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. The mRNA is cell-to-cell mobile. |
AT2G32170 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G13610 | Encodes a Fe(II)- and 2-oxoglutarate-dependent dioxygenase family gene F6'H1. Mutations in this gene compromise iron uptake and the production of fluorescent phenolics involved in Fe uptake. The mRNA is cell-to-cell mobile. |
AT1G18060 | localized to chloroplasts |
AT4G35900 | bZIP protein required for positive regulation of flowering. Mutants are late flowering. FD interacts with FT to promote flowering.Expressed in the shoot apex in floral anlagen, then declines in floral primordia. |
AT1G60950 | encodes a major leaf ferredoxin |
AT5G55000 | FH protein interacting protein FIP2 |
AT1G69572 | Circadian regulated lncRNA, natural antisense gene of CDF5 (AT1G69570). Displays antiphasic expression pattern in relation to CDF5 expression (PMID:28758689). |
AT3G11750 | Encodes an enzyme that can act as a aldolase or an epimerase for 7,8-dihydroneopterin and 7,8-dihydromonapterin in vitro. It is likely to act in tetrahydrofolate biosynthesis in vivo. |
AT5G62980 | Encodes an enzyme that can act as a aldolase or an epimerase for 7,8-dihydroneopterin and 7,8-dihydromonapterin in vitro. It is likely to act in folate biosynthesis as a homooctamer in vivo. |
AT3G21730 | Dihydroneopterin aldolase;(source:Araport11) |
AT2G43410 | FPA is a gene that regulates flowering time in Arabidopsis via a pathway that is independent of daylength (the autonomous pathway). Mutations in FPA result in extremely delayed flowering. Double mutants with FCA have reduced fertility and single/double mutants have defects in siRNA mediated chromatin silencing. |
AT2G19520 | FVE interacts with SUVH9 and is involved in RNA-directed DNA methylation by facilitating the recruitment of Pol V to chromatin. It is involved in the control of flowering. |
AT5G13480 | Encodes a protein with similarity to yeast Pfs2p, an mRNA processing factor. Involved in regulation of flowering time; affects FCA mRNA processing. Homozygous mutants are late flowering, null alleles are embryo lethal. |
AT3G51820 | Encodes a protein with chlorophyll synthase activity. This enzyme has been shown to perform the esterification of chlorophyllide (a and b), the last step of chlorophyll biosynthesis. Although it can use either geranylgeranyl pyrophosphate (GGPP) or phytyl pyrophosphate (PhyPP) as substrates, the esterification reaction was faster with GGPP than with PhyPP. |
AT3G06580 | Encodes a protein with galactose kinase activity. The gene was shown to complement the yeast Agal1 mutant defective in the galactokinase gene GAL1. |
AT1G53290 | Galactosyltransferase family protein;(source:Araport11) |
AT2G14960 | encodes a protein similar to IAA-amido synthases. Lines carrying an insertion in this gene are hypersensitive to auxin. |
AT5G06270 | One of two plant specific paralogs of unknown function. Interacts with GL2. GIR1/GIR2 loss of function resembles gl2 lof mutations |
AT3G10850 | glyoxalase II cytoplasmic isozyme (Glx2-2) mRNA, complete |
AT1G08750 | GPI8/PIG-K homolog involved in stomata development. Loss of function alleles do not transmit through the pollen. |
AT3G60210 | GroES-like family protein;(source:Araport11) |
AT5G57440 | A member of haloacid dehalogenase-like hydrolase family, HAD-type phosphosugar phosphatase. |
AT4G01070 | the glycosyltransferase (UGT72B1) is involved in metabolizing xenobiotica (chloroaniline and chlorophenole). Comparison between wild type and knock-out mutant demonstrates the central role of this gene for metabolizing chloroaniline but significantly less for chlorophenole. The glucosyltransferase preferred UDP-xylose over UDP-glucose indicating its (additional) functioning as a xylosyltransferase in planta |
AT1G32750 | This gene is predicted to encode a histone acetyltransferase. Five lines with RNAi constructs directed against HAF1 grow normally and can produce root calli, but have defects in agrobacterium-mediated transformation. |
AT4G36710 | GRAS family transcription factor;(source:Araport11) |
AT3G14130 | Aldolase-type TIM barrel family protein;(source:Araport11) |
AT3G14150 | Aldolase-type TIM barrel family protein;(source:Araport11) |
AT4G37790 | Encodes homeobox protein HAT22, member of the HD-Zip II family. The mRNA is cell-to-cell mobile. |
AT3G19510 | Encodes a member of the PHD-finger homeodomain protein family. The HAT3.1 homeodomain is highly divergent in sequence even at positions that are almost invariable among homeodomains. HAT3.1 shows a preference for the sequence T(A/G)(A/C)ACCA, different from those bound by other homeodomains. |
AT5G08720 | Encodes PIN2 PROMOTER BINDING PROTEIN 1 (PPP1), an evolutionary conserved plant-specific DNA binding protein that acts on transcription of PIN genes. Also named as HCF145. Mutations in HCF145 have reduced level of the tricistronic psaA-psaB-rps (small-subunit ribosomal protein)14 mRNA which encodes for the major subunits of the photosystem I (PSI). HCF145 binds to the 5'UTR of PSAA via a novel TMR domain. It functions to stabilize the PSAA transcript. |
AT1G58290 | Encodes a protein with glutamyl-tRNA reductase (GluTR) activity, catalyzing the NADPH-dependent reduction of Glu-tRNA(Glu) to glutamate 1-semialdehyde (GSA) with the release of free tRNA(Glu). It is involved in the early steps of chlorophyll biosynthesis. |
AT2G26540 | Encodes a uroporphyrinogen-III synthase involved in tetrapyrrole biosynthesis. The protein localizes to the chloroplast. Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
AT1G68670 | HHO2 is a HRS1 homolog. Nitrate-inducible expression. Also induced in roots by low Pi and is likely involved in maintaining phosphate homeostasis. It is target of PHR1.Both HHO2 and HRS1 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
AT3G55350 | PIF / Ping-Pong family of plant transposase;(source:Araport11) |
AT4G08570 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT5G40490 | HLP1 is a member of the conserved hnRNP A/B family and contains RNA Recognition Motifs (RRM).It binds mRNA and appears to be involved in targeting alternative polyadenylation (APA). APA targets include genes involved in flowering. Loss of HLP1 function results causes late flowering under long and short day conditions. This phenotype is suppressed by loss of FLC. |
AT1G55650 | HMG (high mobility group) box protein with ARID/BRIGHT DNA-binding domain-containing protein;(source:Araport11) |
AT3G25900 | Homocysteine S-methyltransferase family protein;(source:Araport11) |
AT4G36830 | ELO family protein. |
AT3G03890 | Dimeric β-barrel protein that is structurally related to the putative non-canonical heme oxygenase (HO) and is located in chloroplasts. May function additionally in the tetrapyrrole biosynthetic pathway. |
AT5G49760 | Leucine rich receptor kinase. Encodes a receptor of extracellular reactive oxygen species. |
AT1G52560 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT2G37470 | Histone superfamily protein;(source:Araport11) |
AT1G01370 | Encodes a centromere-identifying protein histone H3 variant. Localized at centromeres in both mitotic and meiotic cells. Aurora3 phosphorylates CENH3 at S65; this post-translational modification is required for the proper development of the floral meristem. |
AT5G10390 | Histone superfamily protein;(source:Araport11) |
AT1G75600 | Histone superfamily protein;(source:Araport11) |
AT1G49620 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Binds to D type cyclins and may inhibit cell cycle. |
AT1G63780 | Small nucleolar ribonucleoprotein protein involved in ribosomal RNA processing. Located in nucleolus and cajal bodies. |
AT2G17520 | Encodes a endoribonuclease/protein kinase IRE1-like protein that is predicted to form a type I transmembrane protein structure and contain kinase/endoribonuclease domains at their C-terminal halves. The transcript levels for several ER-stress responsive genes, including six protein disulfide isomerases (PDIs), BiP2, and AtbZIP60 are not affected in ire1-2 null mutants. The mRNA is cell-to-cell mobile. |
AT4G22220 | Encodes a mitochondrial protein similar to E.coli IscU. In bacteria, IscU is a scaffold protein accepting sulfur and iron to build a transient Fe-S cluster,which is subsequently transferred to a target apoprotein. |
AT1G80920 | A nuclear encoded soluble protein found in the chloroplast stroma. Negatively regulated by light and has rapid turnover in darkness. |
AT5G06770 | KHZ2 is a CCCH zinc-finger and KH domain protein belonging to the VII subfamily. It is expressed throughout the plant. Highly similar to KHZ1.Double mutants with khz1 are late flowering. Overexpression leads to increased rates of leaf senescence. |
AT3G16630 | Kinesin-13A localized to entire Golgi stacks. Involved in trichome development. |
AT2G28060 | Component of the regulatory subunit of SNF1-related protein kinase. As part of the regulatory complex it binds maltose which promotes kinase activity. |
AT4G16850 | 6-transmembrane (6TM) protein that underlies a QTL for petal size with increased expression correlating to increased petal size. |
AT3G27025 | Encodes a member of the LAZY gene family that is expressed in the shoot apex. |
AT3G20270 | Encodes one of the two LBP/BPI related proteins (AT1G04970/LBR-1, AT3G20270/LBR-2) that bind to LPS directly and regulate PR1 expression. |
AT1G47578 | Redundant octanoyltransferase involved in fatty acid synthesis. |
AT4G29540 | Encodes a UDP-N-acetylglucosamine acyltransferase. |
AT4G08869 | Encodes a defensin-like (DEFL) family protein. Pollen tube emergence accelerator that favors conspecific pollen over pollen from other species and thus promotes reproductive isolation. |
AT4G02800 | GRIP/coiled-coil protein;(source:Araport11) |
AT5G13240 | Global repressor of RNA polymerase III (Pol III). Maf1 repressor activity is critical for plant survival during environmental stresses, and is regulated by its phosphorylation/dephosphorylation through the activity of TOR and PP4/PP2A phosphatases. |
AT1G11090 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G11650 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G18360 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G39420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G47630 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G03630 | Pyridine nucleotide-disulfide oxidoreductase family protein;(source:Araport11) |
AT1G07950 | Surfeit locus protein 5 subunit 22 of Mediator complex;(source:Araport11) |
AT1G55080 | mediator of RNA polymerase II transcription subunit-like protein;(source:Araport11) |
AT3G03580 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G13020 | Encodes a member of the cdc2+ family of protein kinases MHK. Similar to the mak genes of rats. mak encodes a protein kinase that may play a role in spermatogenesis. |
AT1G18720 | Contains DUF962 domain. Localizes to ER and cam complement yeast Mpo1 dioxygenase function. Interacts with ABI1. May be involved in ER stress response. |
AT4G39690 | Encodes a homolog of the yeast mic60 protein that is localized in the inner membrane of the mitochondrion, interacts with Tom40 as part of a large lipid-enriched complex called the mitochondrial transmembrane lipoprotein complex (MTL) and is involved in mitochondrial lipid trafficking. |
AT4G32060 | Encodes an EF-hand protein with homology to constituents of the mitochondrial Ca2+ uniporter machinery in mammals. MICU binds Ca2+ and localizes to the mitochondria in Arabidopsis. It is a negative regulator of mitochondrial calcium uptake. Mutants display elevated matrix calcium at steady state and modified calcium transient kinetics in vivo. |
AT4G01883 | Polyketide cyclase / dehydrase and lipid transport protein;(source:Araport11) |
AT5G20440 | Mob1/phocein family protein;(source:Araport11) |
AT3G02090 | Insulinase (Peptidase family M16) protein;(source:Araport11) |
AT5G26340 | Encodes a protein with high affinity, hexose-specific/H+ symporter activity. The activity of the transporter appears to be negatively regulated by phosphorylation. Importantly, microarray analysis, as well as the study of the expression of this gene in mutants involved in programmed cell death (PCD) demonstrated a tight correlation between this gene's expression and PCD. |
AT3G18870 | Mitochondrial transcription termination factor family member. |
AT1G61990 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT1G62010 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT1G21150 | mTERF protein involved in mitochondrial development; required for salt tolerance. |
AT1G62110 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT1G62120 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT3G46950 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT5G23930 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT3G61940 | Member of Zinc transporter (ZAT) family. Expressed in roots under low zinc conditions. |
AT5G43560 | Encodes MUSE14, a TRAF domain protein. Regulates the turnover of nucleotide-binding domain and leucine-rich repeat-containing (NLR) immune receptors SNC1 and RPS2. Loss of both MUSE13 and MUSE14 leads to enhanced pathogen resistance, NLR accumulation, and autoimmunity. In addition, MUSE13/14 physically interact with ATG6 and appear to regulate ATG6 ubiquitination and thus formation of autophagosomes. |
AT1G70000 | Encodes a MYB-like Domain transcription factor that plays a positive role in anthocyanin accumulation in response to light and cytokinin via repression of MYBL2.MYBD expression increased in response to light or cytokinin, and MYBD enhanced anthocyanin biosynthesis via the repression of MYBL2 encoding for a transcription factor that had a negative effect on this process. In addition, MYBD can bind in vivo to the MYBL2 promoter and a lower level of histone H3K9 acetylation (H3K9ac) at upstream region of MYBL2 in MYBD-OX in comparison to wild-type plants, implies that MYBD represses MYBL2 expression via an epigenetic mechanism. |
AT5G08520 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
AT5G46760 | MYC3 is a JAZ-interacting transcription factor that act together with MYC2 and MYC4 to activate JA-responses. The mRNA is cell-to-cell mobile. |
AT4G17880 | MYC4 is bHLH transcriptional regulator. It functions as a JAZ-interacting transcription factor that acts together with MYC2 and MYC3 to activate JA-responses. It also functions in blue light mediated secondary cell wall biogenesis via regulation of NST1 expression. MYC4 directly binds to NST1 promoter and activates its expression. |
AT1G04890 | zein-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
AT2G30690 | lateral signaling target-like protein (Protein of unknown function, DUF593);(source:Araport11) |
AT3G04030 | Homeodomain-like superfamily protein;(source:Araport11) |
AT2G22770 | Regulates the development of ER bodies. also involves in response to the endophytic fungus Piriformospora indica. |
AT3G15950 | Similar to TSK-associating protein 1 (TSA1), contains 10 EFE repeats, a novel repeat sequence unique to plants. Expressed preferentially in the roots.Protein is localized to ER bodies- an endoplasmic reticulum derived structure. Loss of function mutations lack ER bodies. |
AT5G04370 | A member of the Arabidopsis SABATH methyltransferase gene family. Encodes NAMT1, a methyltransferase that methylates nicotinic acid to yield methyl nicotinate. |
AT2G39020 | Although this locus shares considerable sequence similarity with the adjacent NATA1 gene (At2g39030), they appear to encode genes with different functions. NATA1 is involved in the production of N-delta-acetylornithine, but, overexpression of At2g39020 in tobacco does not lead to the formation of this defense compound. The mRNA is cell-to-cell mobile. |
AT2G28250 | Protein kinase superfamily protein;(source:Araport11) |
AT4G09320 | nucleoside diphosphate kinase type 1 (NDPK1) gene, complete The mRNA is cell-to-cell mobile. |
AT1G54540 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT3G24600 | late embryogenesis abundant protein, group 2;(source:Araport11) |
AT1G73600 | Encodes a S-adenosyl-L-methionine-dependent phosphoethanolamine N-methyltransferase whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in roots. It catalyzes the three sequential P-base methylation of phosphoethanolamine to phosphocholine. Homologous biochemical function to NMT1 (At3g18000). Double mutants of NMT1 and NMT3 are defective in leaf, root, flower, seed, and pollen development. |
AT5G41190 | Encodes a cytoplasmic protein with RNA endonuclease activity. Mutants display aberrant RNA processing and male and female gametophyte development. |
AT4G26600 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G06560 | NOL1/NOP2/sun family protein;(source:Araport11) |
AT1G02080 | Acts as scaffold protein in the CCR4-NOT complex, by interacting with various NOT proteins and CAF1. Essential protein for proper pollen development and germination capacity. |
AT5G35430 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G45630 | RNA binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G20800 | Cell differentiation, Rcd1-like protein;(source:Araport11) |
AT2G32550 | Cell differentiation, Rcd1-like protein;(source:Araport11) |
AT3G45680 | Major facilitator superfamily protein;(source:Araport11) |
AT1G72140 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
AT1G22550 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
AT2G38100 | Encodes a nitrate transporter that is involved in nitrogen accumulation in embryos. |
AT3G26490 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT1G49670 | molecular function has not been defined. Was shown involved in oxidative stress tolerance. |
AT5G41010 | Non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB12. |
AT4G21710 | Encodes the unique second-largest subunit of DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB2 and a homolog of the E. coli RNA polymerase beta subunit. |
AT5G09920 | Non-catalytic subunit specific to DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB4) |
AT3G22320 | Non-catalytic subunit common to DNA-dependent RNA polymerases I, II, III and IV; homologous to budding yeast RPB5. |
AT5G51940 | One of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At2g04630. |
AT2G04630 | One of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At5g51940. |
AT3G59600 | One of two highly similar proteins that can serve as non-catalytic subunits of Nuclear RNA polymerases II, IV and V; homologous to budding yeast RPB8. Probably redundant with At1g54250. |
AT4G15950 | Non-catalytic subunit common to Nuclear DNA-dependent RNA polymerases IV and V; homologous to budding yeast RPB4. Role in gene silencing. Required for RNA-directed DNA methylation. |
AT2G15400 | Non-catalytic subunit of Nuclear DNA-dependent RNA polymerase V; homologous to budding yeast RPB3 and the E. coli RNA polymerase alpha subunit. A closely related paralog, At2g15430 can substitute for At2g15400 in the context of Pol V and encodes the equivalent subunit of Pol II and Pol IV. |
AT3G57080 | Non-catalytic subunit unique to Nuclear DNA-dependent RNA polymerase V; homologous to budding yeast RPB5. |
AT4G17300 | Asparaginyl-tRNA synthetase protein involved in amino acid activation/protein synthesis. |
AT3G20760 | Nse4, component of Smc5/6 DNA repair complex;(source:Araport11) |
AT1G21320 | nucleic acid/nucleotide binding protein;(source:Araport11) |
AT5G60980 | Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein;(source:Araport11) |
AT3G19830 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT4G12720 | Encodes a protein with ADP-ribose hydrolase activity. Negatively regulates EDS1-conditioned plant defense and programmed cell death. |
AT1G24310 | nuclear pore complex protein;(source:Araport11) |
AT1G07640 | A member of the DOF transcription factors. Prominently expressed in the phloem of leaves and other organs. Expression is induced by wounding, MeJA and insect feeding. Upregulates glucosinolate biosynthesis. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
AT1G76405 | outer envelope pore 21B-like protein;(source:Araport11) |
AT3G57990 | Encodes a ?-barrel protein, named OEP40, locates in in the outer envelope of chloroplasts, and functions as a solute channel which is selectively permeable for glucose. |
AT4G02900 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
AT4G35870 | early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
AT1G65080 | Structurally distinct member of Oxa1 superfamily , has tetratricopeptide repeat (TPR) domain at the C terminus. Paralog of OXA2b.Involved in maturation of mitochondrial cytochrome c. |
AT3G44370 | Member of the Oxa1 super family protein insertases.It is structurally distinct having a tetratricopeptide repeat (TPR) domain at the C terminus. Paralog of OXA2a. Involved in biogenesis of mitochondrial respiratory chain complex IV, specifically via membrane insertion of COX2. |
AT3G03773 | Encodes one of two isoforms of a co-chaperone of HSP90 that is required for root growth, in particular in the maintenance of the root meristem. It can be phosphorylated in vitro by human and maize CK2. |
AT3G48760 | DHHC-type zinc finger family protein;(source:Araport11) |
AT5G50020 | DHHC-type zinc finger family protein;(source:Araport11) |
AT1G72160 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT4G09160 | PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells. |
AT4G31300 | Encodes 20S proteasome subunit PBA1 (PBA1). PBA1 acts as a plant caspase-3-like enzyme. |
AT5G14710 | proteasome assembly chaperone-like protein;(source:Araport11) |
AT1G48170 | proteasome assembly chaperone;(source:Araport11) |
AT4G32730 | Encodes a putative c-myb-like transcription factor with three MYB repeats. |
AT1G50950 | protein disulfide-isomerase 5-like protein (DUF1692);(source:Araport11) |
AT1G77600 | One of 5 PO76/PDS5 cohesion cofactor orthologs of Arabidopsis. |
AT1G15940 | One of 5 PO76/PDS5 cohesion cofactor orthologs of Arabidopsis. |
AT1G60400 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G49770 | hypothetical protein;(source:Araport11) |
AT3G50720 | Protein kinase superfamily protein;(source:Araport11) |
AT5G14650 | Encodes a cell wall localized endo-polygalacturonase. |
AT1G04330 | A proline/serine rich protein of unknown function. It interacts with defense related MAP kinase MPK6 and others. May be involved in signaling during defense or stress response. |
AT5G61100 | PHD finger-containing protein. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
AT5G12150 | Encodes a protein with similarity to REN1, a Rho GTPase activating protein.It is cytoplasmic and plasma membrane associated in interphase, but during mitosis localizes to the CDZ/CDS in a POK-dependent manner. |
AT1G68740 | Encodes PHO1;H1, a member of the PHO1 family. Involved in inorganic phosphate (Pi) transport and homeostasis. Complements pho1 mutation. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
AT5G54430 | Contains a universal stress protein domain. Protein is phosphorylated in response to Phytophthora infestans zoospores and xylanase. |
AT4G27320 | Contains a universal stress protein domain. Protein is phosphorylated in response to Phytophthora infestans zoospores and xylanase. |
AT4G11810 | Encodes an SPX domain protein that transports Pi into the vacuole. Overexpression of PHT5:2 leads to massive Pi sequestration into vacuoles and altered regulation of Pi starvation-responsive genes. |
AT4G22990 | Encodes a member of the PHOSPHATE TRANSPORTER 5 family (PHT5;3). Overexpression of PHT5:3 leads to Pi sequestration into vacuoles and altered regulation of Pi starvation-responsive genes. |
AT1G14910 | ANTH domain-containing protein which functions as adaptor protein for clathrin-mediated endocytosis (CME) of the secretory vesicle-associated longintype R-SNARE VAMP72 group. Interacts with the SNARE domain of VAMP72 and clathrin at the plasma membrane. Required for recycling of R-SNARE proteins. |
AT5G35200 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
AT2G25430 | AP180 N-terminal homology domain, TPLATE complex protein involved in clathrin-mediated endocytosis. |
AT1G33340 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
AT2G01920 | ENTH/VHS/GAT family protein;(source:Araport11) |
AT1G21000 | PLATZ transcription factor family protein;(source:Araport11) |
AT4G17900 | PLATZ transcription factor family protein;(source:Araport11) |
AT1G76590 | PLATZ transcription factor family protein;(source:Araport11) |
AT3G27400 | Encodes a pectate lyase involved in response to nematodes. |
AT4G37070 | Patatin-related phospholipase A. Expressed strongly and exclusively in roots. AtplaIVA-null mutants have reduced lateral root development. Phosphorylation by calcium-dependent protein kinases in vitro enhances its activity. |
AT2G47050 | Encodes a pollen-expressed pectin methylesterase inhibitor that affects male fertility by regulating pollen viability and pollen tube growth. |
AT1G07970 | cytochrome B561, amino-terminal protein;(source:Araport11) |
AT5G11560 | catalytics;(source:Araport11) |
AT1G33612 | Encodes a receptor for the Plant Natriuretic Peptide (At2g18660, AtPNP-A). The receptor contains a functional guanylyl cyclase catalytic center embedded in the cytosolic kinase domain. This catalytic center can convert GTP into cGMP (and PPi) which enables ligand-specific downstream signalling. It is therefore consistent with the reported cGMP dependence of AtPNP-A effects (see DOI:10.1007/s11103-016-0465-8). |
AT4G01690 | Encodes protoporphyrinogen oxidase (PPOX). |
AT1G55190 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
AT1G76950 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
AT1G77800 | PHD finger family protein;(source:Araport11) |
AT1G72460 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G44565 | transmembrane protein;(source:Araport11) |
AT1G54590 | pre-mRNA-splicing factor-like protein;(source:Araport11) |
AT1G60170 | Encodes a splicing factor PRP31. Involved in transcriptional gene silencing and stress responses. |
AT1G04080 | Encodes a U1 small nuclear ribonucleoprotein (snRNP) factor involved in alternative splicing. |
AT5G64040 | Encodes the only subunit of photosystem I located entirely in the thylakoid lumen. May be involved in the interaction between plastocyanin and the photosystem I complex. Phosphorylation of this protein is dependent on calcium. |
AT5G67340 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT2G45910 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT2G19410 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G61560 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT1G01660 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT2G40640 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G18560 | Encodes PUCHI, a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. PUCHI is required for morphogenesis in the early lateral root primordium of Arabidopsis. Expressed in early floral meristem (stage 1 to 2). Required for early floral meristem growth and for bract suppression. Triple mutant with bop1 and bop2 displays a strong defect in the determination of floral meristem identity with reduced LFY expression and the lack of AP1 expression. |
AT2G23830 | PapD-like superfamily protein;(source:Araport11) |
AT1G66700 | A member of the Arabidopsis SABATH methyltransferase gene family. Encodes PXMT1, a methyltransferase that methylates 1,7-paraxanthine. |
AT3G09260 | Encodes beta-glucosidase.The major constituent of ER bodies. One of the most abundant proteins in Arabidopsis seedlings. Exist in an soluble (inactive) and non-soluble (active) form, most probably formed in a polymerization process. Involved in the mutualistic interaction between Arabidopsis and the endophytic fungus Piriformospora indica. |
AT2G44610 | Golgi-localized small GTPase, participates in the trafficking of CESA6 to the plasma membrane, maintaining Golgi organization and morphology, possible role in exocytosis. Plays and important role in hypocotyl growth by influencing cell elongation/growth and deposition of cellulose microfibrils in the cell wall. Plays an important role in cellulose synthesis. Influences both the distribution and velocity of cellulose synthase complexes in the plasma membrane. Encodes a GTP-binding protein with similarity to yeast YPT6 . RAB6 can complement the yeast YTP mutant. |
AT3G46060 | small GTP-binding protein (ara-3) The mRNA is cell-to-cell mobile. |
AT2G31970 | Encodes the Arabidopsis RAD50 homologue. It is involved in double strand break repair. Component of the meiotic recombination complex that processes meiotic double-strand-breaks to produce single-stranded DNA ends, which act in the homology search and recombination. Accumulates in the nucleus during meiotic prophase, a process regulated by PHS1. |
AT5G43530 | Helicase protein with RING/U-box domain-containing protein;(source:Araport11) |
AT2G31890 | Protein contains putative RNA binding domain. Expressed in response to Pseudomonas syringae infection. Resistance requires silencing of AtRAP suggesting it functions as a negative regulator of plant disease resistance. Alpha helical repeat protein; only member of the OPR (octotricopeptide repeat) protein family in land plants. |
AT4G12610 | transcription initiation factor IIF subunit alpha RAP74;(source:Araport11) |
AT4G10110 | Shows some similarity to RBM7, subunit of NEXT complex. |
AT3G46770 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT3G06160 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT3G06220 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT2G24700 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
AT5G44750 | Homologous to Y-family DNA polymerases, contains BRCT domain. Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS). |
AT4G26540 | Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11) |
AT1G67800 | Copine (Calcium-dependent phospholipid-binding protein) family;(source:Araport11) |
AT4G19700 | Encodes BOI (Botrytis Susceptible 1 Interactor). Has E3 ubiquitin ligase activity. Interacts with and ubiquitinates BOS1 (Botrytis Susceptible 1). It prevents caspase activation and attenuates cell death. |
AT5G08050 | Encodes a grana core localized protein. Mutant plants have reduced NPQ, affected organization of light-havesting complex II and an enhanced grana stacking. |
AT1G74730 | Encodes a grana core localized protein, is homologous to RIG1. Mutant plants have reduced NPQ, affected organization of light-havesting complex II and an enhanced grana stacking. |
AT1G71980 | RMR2 is a secretory pathway protein localized to the trans-golgi network. It belongs to a family of vacuolar sorting receptors. If forms heterodimers with RMR1. |
AT1G35630 | Protease-associated (PA) RING/U-box zinc finger family protein;(source:Araport11) |
AT5G11930 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
AT4G33040 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
AT3G02920 | Replication protein A, subunit RPA32;(source:Araport11) |
AT5G61000 | Replication factor-A protein 1-like protein;(source:Araport11) |
AT1G77940 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
AT2G01250 | Cytosolic ribosomal 60S subunit protein. |
AT1G23410 | cytosolic ribosomal protein gene, part of eS31 family |
AT3G02250 | O-fucosyltransferase family protein;(source:Araport11) |
AT2G03280 | O-fucosyltransferase family protein;(source:Araport11) |
AT5G22070 | Putative glycosyltransferase that negatively regulates leaf senescence in a SID2 dependent manner. |
AT2G28620 | Mutants have radially swollen roots but do not exhibit defects in abundance or orientation of cortical microtubules, nor are microfibrils reduced. Cellulose synthesis is also unchanged with respect to wild type. There is a disruption in the normal pattern of cell wall placement. |
AT1G58430 | Encodes an anther-specific proline-rich protein. |
AT1G58520 | GDSL-like lipase/acylhydrolase superfamily protein;(source:Araport11) |
AT4G35740 | Encodes RECQ3, an ATP-dependent helicase. |
AT4G08685 | Encodes a protein, expressed in leaves, with similarity to pollen allergens. The mRNA is cell-to-cell mobile. |
AT5G63980 | Encodes a bifunctional protein that has 3'(2'),5'-bisphosphate nucleotidase and inositol polyphosphate 1-phosphatase activities and rescues sulfur assimilation mutants in yeast. It is involved in the response to cold, drought (negative regulator of drought tolerance), and ABA. Mutants in this gene exhibit enhanced induction of stress genes in response to cold, ABA, salt and dehydration and increased levels of 3'-phosphoadenosine 5'-phosphate (PAP). Involved in degradation of small mRNAs. Mutants also affect the accumulation of miRNA target cleavage products. Regulates light-dependent repression of hypocotyl elongation and flowering time via its 3'(2'),5'-bisphosphate nucleotidase activity. Its activity is sensitive to the redox state of its environment, decreasing under oxidative conditions and is regulated by dimerization and intra and inter-molecular disulfide bond formation. |
AT1G09050 | arginine-glutamic acid dipeptide repeat protein;(source:Araport11) |
AT4G11740 | Isolated as a suppressor of a dominant mutant in the Ara4 gene that was expressed in yeast ypt1 mutant strains. A novel protein with a small region of similarity to coil-coiled domain of yeast VSP27 protein. |
AT1G32940 | Subtilase family protein;(source:Araport11) |
AT5G59810 | Subtilase family protein;(source:Araport11) |
AT5G51340 | SCC4 is a tetratricopeptide repeat containing protein and a likely component of a plant cohesion loading complex along with its partner SSC2 It is expressed primarily in dividing cells. Loss of function mutants are embryo lethal, arresting by globular stage. |
AT1G22870 | One of two paralogs in Arabidopsis.Loss of both SCYL2B and SCYL2A results in severe growth defects. |
AT4G12120 | member of KEULE Gene Family |
AT3G63460 | Together with SEC31A a component of the coat protein complex II (COPII) which promotes the formation of transport vesicles from the endoplasmic reticulum (ER). |
AT4G14870 | Encodes a component of the thylakoid-localized Sec system involved in the translocation of cytoplasmic proteins into plastid. The mRNA is cell-to-cell mobile. |
AT1G64350 | seh1-like protein |
AT3G48900 | Encodes one of two GEN1 homologs in Arabidopsis. It is a member of the class IV Rad2/XPG family of nucleases that processes Holliday junctions in a manner analogous to the HJ resolvases of phages, archaea, and bacteria. |
AT1G47710 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
AT3G45100 | encodes Arabidopsis homolog of a conserved protein involved in the first step of the GPI biosynthetic pathway. |
AT4G00800 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT2G47860 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT5G27350 | Encodes a sugar-porter family protein that is induced during leaf senescence. The increase in its gene expression during leaf senescence is paralleled by an accumulation of monosaccharides. The mRNA is cell-to-cell mobile. |
AT5G27360 | Encodes a sugar-porter family protein that unlike the closely related gene, SFP1, is not induced during leaf senescence. |
AT1G66740 | Located on the SSL2 region of Arabidopsis thaliana, which is homeologous to the Brassica S locus for self incompatibility. Expressed in both vegetative and reproductive organs suggesting AtSP7 might not be involved in self incompatibility. Its expression is regulated during cell cycle progression through E2F transcription factors. The protein interacts with acetylated histones H3 and H4 and HAM acetyltransferases, proteins known to be involved in cell cycle control and DNA repair. Functions redundantly with AT5G38110 during gametogenesis. |
AT4G23570 | Closely related to SGT1B, may function in SCF(TIR1) mediated protein degradation. AtSGT1a and AtSGT1b are functionally redundant in the resistance to pathogenes. AtSGT1b was more highly expressed than AtSGT1. The N-terminal TPR domain of AtSGT1a reduces the steady-state level of Arabidopsis SGT1 proteins whereas the same domain from AtSGT1b enhances SGT1 accumulation. The TPR domain is dispensable for SGT1 resistance. AtSGT1a is induced upon pathogen infection and can function in R gene-mediated resistance. |
AT3G13672 | SINAT homolog with truncated RING finger and zinc finger domains. |
AT3G61790 | SINAT E3 ubiquitin ligase involved in mediation of FREE1 and VPS23A degradation to modulate abscisic acid signaling. |
AT4G27880 | Encodes an E3 ubiquitin ligase that functions in 26S proteosome pathway. Targeting of proteins for degradation such RD21A results in indirect effects such as loss of drought induced stomatal immunity. |
AT3G03970 | At3G03970 encodes the plant KASH protein SINE2; SINE2 interacts with SUN1 and SUN2 and is localized at the nuclear envelope. |
AT5G42190 | Similar to SKP1 in yeast and humans which are involved in mitotic cell cycle control and ubiquitin mediated proteolysis. |
AT1G21410 | AtSKP2;1 is a homolog of human SKP2, the human F-box protein that recruits E2F1. Contains an F-box motif at the N-terminal region and a C-terminal Leu-rich repeat domain. Forms part of an E3-ubiquitin-ligase SCF (Skp1, cullin, F-box) complex and recruits phosphorylated AtE2Fc, a transcriptional factor that might play a role in cell division and during the transition from skotomorphogenesis to photomorphogenesis. AtSKP2;1 (At1g21410) and AtSKP2;2 (At1g77000) may be duplicated genes. |
AT1G51745 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
AT5G19400 | Encodes SMG7, a protein that possesses an evolutionarily conserved EST1 domain and exhibits strong homology to human SMG6 (EST1A) and SMG7 (EST1C) proteins. SMG7 plays an evolutionarily conserved role in nonsense-mediated RNA decay (NMD). Required for exit from meiosis. Hypomorphic smg7 alleles render mutant plants sterile by causing an unusual cell-cycle arrest in anaphase II that is characterized by delayed chromosome decondensation and aberrant rearrangement of the meiotic spindle. Disruption of SMG7 causes embryonic lethality. |
AT5G59360 | hypothetical protein;(source:Araport11) |
AT5G02420 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
AT5G40460 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
AT3G22760 | CXC domain containing TSO1-like protein 1. The gene is expressed in stamens, pollen mother cells, and immature ovules. Regulates fate transition and cell Divisions in the stomatal lineage. |
AT2G37970 | Encodes a cytosolic heme binding protein(cHBP)that can reversibly bind tetrapyrroles including heme, protoporphyrin IX and Mg-protoporphyrin IX dimethyl ester with distinct binding affinities. |
AT3G48210 | kinetochore protein;(source:Araport11) |
AT5G08565 | Transcription initiation Spt4-like protein;(source:Araport11) |
AT5G24150 | squalene monooxygenase gene homolog |
AT3G62240 | RING/U-box superfamily protein;(source:Araport11) |
AT3G17520 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
AT1G73820 | Protein phosphatase which physically interacts with the RRM1 motif of FCA to antagonize FCA binding with COOLAIR, which is critical for PRC2 enrichment and H3K27me3 deposition. |
AT5G44568 | Secreted peptide which functions in plant growth and pathogen defense. |
AT1G65484 | Secreted peptide which functions in plant growth and pathogen defense. |
AT1G65490 | Secreted peptide which functions in plant growth and pathogen defense. |
AT5G48710 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT4G24130 | ABA responsive SVB family gene. |
AT5G49600 | ABA responsive SVB family gene. |
AT2G36740 | DNA binding protein SWC2;(source:Araport11) |
AT1G21460 | Nodulin MtN3 family protein;(source:Araport11) |
AT5G50790 | Encodes a member of the SWEET sucrose efflux transporter family proteins. Transcriptionally activated by long photoperiods; activation depends on FT and SOC1. The ectopic expression of SWEET10 causes early flowering and leads to higher levels of transcription of flowering-time related genes in the shoot apex. |
AT3G48740 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
AT5G23660 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
AT5G50800 | Encodes a member of the SWEET sucrose efflux transporter family proteins, together with RPG1, it is involved in pollen development. Together with SWEET14, it is likely involved in modulating the GA response and is required for proper development of anthers, seeds and seedlings. |
AT4G25010 | Encodes a member of the SWEET sucrose efflux transporter family proteins. Together with SWEET13, it is likely involved in modulating the GA response and is required for proper development of anthers, seeds and seedlings. |
AT3G16690 | Nodulin MtN3 family protein;(source:Araport11) |
AT3G14770 | Nodulin MtN3 family protein;(source:Araport11) |
AT3G28007 | Nodulin MtN3 family protein;(source:Araport11) |
AT4G10850 | Nodulin MtN3 family protein;(source:Araport11) |
AT5G40260 | Encodes RPG1 (RUPTURED POLLEN GRAIN1), a member of the MtN3/saliva gene family. Crucial for exine pattern formation and cell integrity of microspores. |
AT2G39060 | Encodes a sucrose transporter that is expressed in nectaries and is involved in nectar secretion. |
AT3G48600 | SWIB complex BAF60b domain-containing protein;(source:Araport11) |
AT4G34290 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
AT3G59550 | Encodes an alpha-kleisin protein that is localized primarily in the nucleolus and is essential for megagametogenesis and plays an important role in pollen development. alpha-kleisins are core components of meiotic and mitotic cohesin complexes. |
AT5G04220 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT5G11100 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT5G15570 | Bromodomain transcription factor;(source:Araport11) |
AT1G27595 | Encodes a protein of unknown function containing a Symplekin C domain that is involved in negative regulation of glucose response. Mutants show increased sensitivity to glucose with a variety of assays. |
AT1G73140 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).The dwarf phenotype can only be seen in tbl3 tbl31 esk1 triple mutant. tbl3 and tbl31 are specifically involved in 3-O-monoacetylation of xylan. |
AT4G29000 | Tesmin/TSO1-like CXC domain-containing protein which is a transcriptional repressor of genes required for maintenance of DNA methylation, including MET1, CMT3, DDM1, KYP and VIMs. Functions redundantly with its paralogue TCX6 in repressing the expression of these genes. |
AT4G23050 | PAS domain-containing protein tyrosine kinase family protein;(source:Araport11) |
AT5G56130 | Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. |
AT5G42920 | Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. |
AT3G02950 | Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. |
AT1G74950 | Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators. |
AT1G12250 | Pentapeptide repeat-containing protein;(source:Araport11) |
AT4G11240 | encodes a type I serine/threonine protein phosphatase expressed in expressed in roots, rosettes and flowers. |
AT5G27840 | Encodes a Type One Protein Phosphatase that acts as a nucleocytoplasmic negative regulator of tip growth. Mutants affect pollen germination, pollen tube growth, and root hair growth. It acts genetically downstream of ANX1 (AT3G04690) and ANX2 (AT5G28680) and is functionally redundant with ATUNIS1/TOPP9 (AT3G05580). |
AT3G01780 | Encodes TPLATE, a cytokinesis protein targeted to the cell plate. Functions in vesicle-trafficking events required for site-specific cell wall modifications during pollen germination and for anchoring of the cell plate to the mother wall at the correct cortical position. |
AT5G62240 | TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of Aurora kinase activity. |
AT2G17930 | Component of the SPT module of the SAGA complex. |
AT4G36080 | Component of the SPT module of the SAGA complex. |
AT3G05000 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
AT5G16280 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
AT4G40000 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT2G22400 | TRM4B is a cytosine-5--methyltransferase. Mutants have decreased methyl cytosine and defects in root development. |
AT5G11040 | Encodes a tethering factor required for cell plate biogenesis. |
AT1G67990 | Encodes a tapetum-specific O-methyltransferase. In vitro enzyme assay indicated activity with caffeoyl-CoA, caffeoyl glucose, chlorogenic acid and polyamine conjugates. RNAi mutants had impaired silique development and seed setting. |
AT3G50590 | WD40/YVTN repeat protein. |
AT1G60900 | Putative U2A65 splicing factor which functions in abscisic acid mediated flowering via regulating the precursor messenger RNA splicing of ABI5 and FLC in shoot apex. Regulates flowering time and displays a redundant role in pollen tube growth together with AtU2AF65a. |
AT5G40395 | U6acat;(source:Araport11) |
AT3G56740 | ATI3A interacting protein containing a large N-terminal rhomboid-like transmembrane domain and a UBA domain at their C terminus, localized in the ER with an important role in plant heat tolerance. UBAC2 proteins may act as both cargo receptors and inducers of an ATI3-mediated selective autophagy pathway, where ATI3 and UBAC2 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
AT1G65650 | Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1;(source:Araport11) |
AT4G27560 | Encodes a UDP-glycosyltransferase that contributes to cold, salt and drought stress tolerance via modulating anthocyanin accumulation. |
AT4G27570 | Encodes a UDP-glycosyltransferase that contributes to cold, salt and drought stress tolerance via modulating anthocyanin accumulation. |
AT1G22400 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G67250 | Proteasome maturation factor UMP1;(source:Araport11) |
AT2G39260 | Nonsense mediated decay (NMD)factor. |
AT2G01690 | Homologous to mammalian VAC14s, which is involved in the production of phosphatidylinositol 3,5-bisphosphate. Mutants are male gametophyte lethal. |
AT5G14510 | Armadillo (ARM) repeat containing protein involved in vascular development. |
AT5G44560 | SNF7 family protein;(source:Araport11) |
AT4G27040 | EAP30/Vps36 family protein;(source:Araport11) |
AT5G22950 | SNF7 family protein;(source:Araport11) |
AT4G19003 | E2F/DP family winged-helix DNA-binding domain-containing protein;(source:Araport11) |
AT4G05000 | Vacuolar protein sorting-associated protein VPS28 family protein;(source:Araport11) |
AT5G04920 | EAP30/Vps36 family protein;(source:Araport11) |
AT2G22880 | VQ motif-containing protein;(source:Araport11) |
AT1G29170 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
AT4G27260 | encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. It is involved in camalexin biosynthesis via conjugating indole-3-carboxylic acid (ICA) and cysteine (Cys). The mRNA is cell-to-cell mobile. |
AT5G65130 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
AT5G45050 | Encodes a member of the WRKY Transcription Factor (Group II-e) family. |
AT4G26640 | member of WRKY Transcription Factor; Group I |
AT4G23550 | Encodes WRKY DNA-binding protein 29 (WRKY29). The mRNA is cell-to-cell mobile. |
AT4G04450 | member of WRKY Transcription Factor; Group II-b. Interacts with lncRNA APOLO to trigger root hair cell expansion in response to cold. |
AT1G62300 | Encodes a transcription factor WRKY6. Regulates Phosphate1 (Pho1) expression in response to low phosphate (Pi) stress. |
AT2G04240 | Encodes a small protein with an N-terminal trans-membrane domain and a RING-H2 zinc finger motif located at the C-terminus. Gene expression is induced by salt and osmotic stress. Transcrips levels are induced by DELLA proteins and repressed by gibberellic acid. Involved in ABA metabolism. |
AT4G33200 | member of Myosin-like proteins |
AT1G08730 | Encodes a class XI myosin that is involved in organelle motility, actin organization, and optimal growth of pollen tubes. |
AT1G54560 | Encodes a class XI myosin that is involved in organelle motility, actin organization, and optimal growth of pollen tubes. |
AT4G28710 | member of Myosin-like proteins The mRNA is cell-to-cell mobile. |
AT5G20490 | Encodes a member of the type XI myosin protein family involved in root hair growth, trichome development, and organelle trafficking. Required for fast root hair growth. This gene appears to be expressed at low levels throughout the plant. |
AT3G04490 | Ran effector. XPO4 coordinates the nuclear accumulation of TOPLESS and TOPLESS-Related transcription corepressors, which plays a role in regulating salicylic acid-mediated defense feedback and modulating the strength of immunity induced by cpr5, a nucleoporin mutant. |
AT5G06120 | Ran effector. |
AT1G58380 | Ribosomal protein S5 family protein;(source:Araport11) |
AT1G51510 | This gene is predicted to encode a protein involved in the exon junction complex. Though there is a predicted RNA binding motif, in the Drosophila ortholog (33% identity), this motif mediates interactions with Mago and is not available for RNA binding. The Arabidopsis Y14 protein appears to be predominantly nucleolar, but there is also some evidence for its presence in the cytoplasm. |
AT2G38860 | Encodes protease I (pfpI)-like protein YLS5. |
AT1G21430 | Flavin-binding monooxygenase family protein;(source:Araport11) |
AT4G21160 | ADP-ribosylation factor GTPase-activating protein containing zinc finger and C2 domains and a novel PI-3-P-binding protein region. Binds PI-3-P. Highest expression levels in flowering tissue, rosettes and roots. A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
AT3G53600 | Nuclear C2H2 zinc finger protein.Expression is induced by cold, osmotic, salt, and drought stress. Over expression confers some drought tolerance whereas mutants display some drought sensitivity. |
AT1G59600 | ZCW7;(source:Araport11) |
AT2G30080 | member of Fe(II) transporter isolog family. Gene expression is not regulated by iron, copper, or zinc deficiency or excess. |
AT3G57720 | Protein kinase superfamily protein;(source:Araport11) |
AT1G58350 | Putative serine esterase family protein;(source:Araport11) |
AT1G58270 | ZW9 mRNA, complete cds The mRNA is cell-to-cell mobile. |
AT2G16770 | Basic-region leucine zipper (bZIP23) transcription factor involved in the adaptation to zinc deficiency. Binds ZDRE motifs. |
AT2G20960 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
AT5G51690 | Encodes an aminotransferase with broad specificity for aspartate and aromatic amino aids such as tyrosine and phenylalanine. It does not act on branched chain amino acids and does not have ACC synthase activity. |
AT1G01480 | a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family, isolated from a flower-specific cDNA library. |
AT4G26200 | Member of a family of proteins in Arabidopsis that encode 1-Amino-cyclopropane-1-carboxylate synthase, an enzyme involved in ethylene biosynthesis. Not expressed in response to IAA. |
AT4G37770 | Encodes an auxin inducible ACC synthase. |
AT4G08040 | encodes an aminotransferase that belongs to ACC synthase gene family structurally |
AT4G11280 | encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family The mRNA is cell-to-cell mobile. |
AT3G21500 | Encodes a protein postulated to have 1-deoxy-D-xylulose 5-phosphate synthase activity. |
AT1G50480 | 10-formyltetrahydrofolate synthetase (THFS) mRNA, complete The mRNA is cell-to-cell mobile. |
AT1G76680 | Encodes a member of an alpha/beta barrel fold family of FMN-containing oxidoreductases. One of the closely related 12-oxophytodienoic acid reductases. This enzyme is not expected to participate in jasmonic acid biosynthesis because during in vitro assays, it shows very little activity with the naturally occurring OPDA isomer. Shows activity towards 2,4,6-trinitrotoluene. Expressed predominately in root. Up-regulated by senescence and jasmonic acid. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. Predicted to be a cytosolic protein. |
AT2G31360 | Encodes a protein homologous to delta 9 acyl-lipid desaturases of cyanobacteria and acyl-CoA desaturases of yeast and mammals. expression up-regulated by cold temperature. It is involved in the synthesis of the 24:1n-9 and 26:1n-9 components of seed lipids, sphingolipids and the membrane phospholipids phosphatidylserine (PS), and phosphatidylethanolamine (PE). |
AT1G09780 | Encodes a 2,3-biphosphoglycerate-independent phosphoglycerate mutase that is involved in pollen development and stomatal movement. |
AT1G74040 | Encodes an active Arabidopsis isopropylmalate synthase IPMS2. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS2 can be compensated by a second isopropylmalate synthase gene IPMS1 (At1g18500). |
AT5G47760 | serine/threonine protein kinase |
AT3G51260 | 20S proteosomal alpha subunits. Interacts with SnRK, SKP1/ASK1 during proteasomal binding of an SCF ubiquitin ligase. |
AT3G14290 | Encodes 20S proteasome subunit PAE2 (PAE2) that has RNase activity. |
AT1G47250 | Encodes 20S proteasome subunit PAF2 (PAF2). |
AT2G27020 | Encodes 20S proteasome alpha 7 subunit PAG1. |
AT1G56450 | 20S proteasome beta subunit PBG1 (PBG1) mRNA, complete cds |
AT5G40580 | Encodes 20S proteasome beta subunit PBB2 (PBB2). |
AT2G05840 | Encodes 20S proteasome subunit PAA2 (PAA2). |
AT2G20580 | encoding the RPN subunits of the 26S proteasome The mRNA is cell-to-cell mobile. |
AT4G28470 | encoding the RPN subunits of the 26S proteasome |
AT5G53000 | PP2A-associated protein with a possible function in the chilling response |
AT5G48880 | Encodes a peroxisomal 3-keto-acyl-CoA thiolase 2 precursor. EC2.3.1.16 thiolases. AT5G48880.1 is named PKT1 and AT5G48880.2 is named PKT2. |
AT1G01120 | Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis. |
AT2G28630 | Encodes KCS12, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT2G46720 | Encodes KCS13, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT4G34250 | Encodes KCS16, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT5G04530 | Encodes KCS19, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT1G25450 | Encodes KCS5, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT1G68530 | Encodes KCS6, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT1G71160 | Encodes KCS7, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT2G16280 | Encodes KCS9, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT4G24770 | Encodes a chloroplast RNA-binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). Required for editing and stability of specific chloroplast mRNAs. |
AT2G26260 | Encodes an enzyme with 3β-hydroxysteroid dehydrogenase/C4-decarboxylase activity in vitro. The activity of the enzyme was determined using microsomal extracts of yeast overexpressing the Arabidopsis gene. Cytosolic fractions failed to be associated to the activity, leading to the speculation that the enzyme is membrane-bound. |
AT4G23800 | Encodes a protein containing three copies of the HMG (high mobility group)-box domain. The two Arabidopsis 3xHMG-box proteins are: AT4G11080 (3xHMG-box1) and AT4G23800 (3xHMG-box2). Interacts with mitotic and meiotic chromosomes. |
AT1G51680 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. In addition to 4-coumarate, it also converts ferulate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, ferulic acid, caffeic acid and 5-OH-ferulic acid. At4CL1 was unable to use sinapic acid as substrate. |
AT1G72370 | acidic protein associated to 40S ribosomal subunit of ribosomes. Involved in polysome formation during active protein synthesis. Expressed in actively growing tissue. |
AT1G48860 | 5-enolpyruvylshikimate-3-phosphate synthase involved in shikimic acid biosynthesis. |
AT5G13050 | 5-Formyltetrahydrofolate cycloligase (5-CHO-THF cycloligase - AT5G13050.1) regulates/influences under photorespiratory conditions the activity of another gene product, i.e. serine hydroxymethyltransferase (SHMT) due to accumulating amounts of 5-Formyltetrahydrofolate |
AT2G05830 | Encodes a 5-methylthioribose-1-phosphate isomerase. |
AT5G08530 | 51 kDa subunit of complex I;(source:Araport11) |
AT5G41670 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
AT1G13700 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
AT5G24410 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
AT5G24420 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
AT4G00810 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
AT1G04620 | Encodes a 7-hydroxymethyl chlorophyll a reductase, an enzyme of the chlorophyll cycle that converts 7-hydroxymethyl chlorophyll a to chlorophyll a. |
AT5G14920 | Encodes a GASA domain containing protein that regulates increases in plant growth through GA-induced and DELLA-dependent signal transduction and that can increase abiotic stress resistance by reducing ROS accumulation. |
AT5G48390 | Defective in meiotic chromosome segregation. It is involved in crossover formation and involved in both male and female meiosis. |
AT5G40010 | Encodes a mitochondrial ATPase involved in seed and silique development. |
AT5G67030 | Encodes a single copy zeaxanthin epoxidase gene that functions in first step of the biosynthesis of the abiotic stress hormone abscisic acid (ABA). Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. |
AT1G16540 | Encodes molybdenum cofactor sulfurase. Involved in Moco biosynthesis. Involved in the conversion of ABA-aldehyde to ABA, the last step of abscisic acid (ABA) biosynthesis. sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling.N terminal domain is similar to bacterial NifS suggesting a common mechanism for sulphur mobilization and transfer. Also involved in protein import into chloroplasts. |
AT2G44880 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT4G26080 | Involved in abscisic acid (ABA) signal transduction. Negative regulator of ABA promotion of stomatal closure. |
AT5G57050 | Encodes a protein phosphatase 2C and is involved in ABA signal transduction. Binds fibrillin preprotein in vitro and in vivo. |
AT3G24650 | Homologous to the maize transcription factor Viviparous-1. Full length ABI3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of ABI3 requires the B3 DNA-binding domain and an activation domain. In addition to the known N-terminal-located activation domain, a second transcription activation domain was found in the B1 region of ABI3. ABI3 is essential for seed maturation. Regulator of the transition between embryo maturation and early seedling development. Putative seed-specific transcriptional activator. ABI3 is a central regulator in ABA signaling and is unstable in vivo. It interacts with and can by polyubiquitinated by AIP2 in vivo. Based on double mutant analyses, ABI3 interacts genetically with both FUS3 and LEC1 and is involved in controlling accumulation of chlorophyll and anthocyanins, sensitivity to abscisic acid, and expression of the members of the 12S storage protein gene family. In addition, both FUS3 and LEC1 regulate positively the abundance of the ABI3 protein in the seed. Alternative splicing of ABI3 is developmentally regulated by SUA (AT3G54230). |
AT2G40220 | Encodes a member of the DREB subfamily A-3 of ERF/AP2 transcription factor family (ABI4). The protein contains one AP2 domain. There is only one member in this family. Involved in abscisic acid (ABA) signal transduction, ABA-mediated glucose response, and hexokinase-dependent sugar responses. Acts downstream of GUN1 in retrograde signaling. Expressed most abundantly in developing siliques and to a lesser degree in seedlings. |
AT5G04895 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT1G66600 | A member of WRKY Transcription Factor; Group III. Involved in the regulation of plant responses to ABA and drought stress. |
AT5G51760 | Encodes AHG1 (ABA-hypersensitive germination 1), a putative protein phosphatase 2C (PP2C). Expressed in seeds. AHG1 functions in seed development and germination. |
AT5G13680 | A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1?ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. Mutants have no ncm5U (5-carbamoylmethyluridine). |
AT1G79600 | Encodes a chloroplast ABC1-like kinase that regulates vitamin E metabolism. |
AT4G33680 | Encodes an L,L-diaminopimelate aminotransferase. Involved in disease resistance against Pseudomonas syringae. mutants have elevated SA levels, a low level of spontaneous cell death, callose deposition, and enlarged cells in leaves. genetically maps on chr 4 between L23H3 and nga1139. |
AT3G29575 | ABI five binding protein 3;(source:Araport11) |
AT2G46225 | Encodes a subunit of the WAVE complex. The WAVE complex is required for activation of ARP2/3 complex which functions in actin microfilament nucleation and branching. One of four ABI-like proteins. |
AT1G08780 | ABI3-interacting protein 3;(source:Araport11) |
AT5G24310 | One of four ABI-like proteins. |
AT2G45190 | Encodes a member of the YABBY family of transcriptional regulators that is involved in abaxial cell type specification in leaves and fruits. YAB1 acts in a non-cell autonomous fashion within the meristem to affect phyllotactic patterning. The non-autonomous effect on the central region of the meristem is mediated through the activity if Lateral Suppressor (LAS). |
AT1G80070 | Encodes a factor that influences pre-mRNA splicing and is required for embryonic development. Mutations result in an abnormal suspensor and embryo lethality. The mRNA is cell-to-cell mobile. |
AT2G16910 | Encodes a basic helix-loop helix transcription factor involved in tapetal cell development, that directly regulates MGT5 expression in tapetum cells. Loss of function mutations are male sterile. AMS binds to a region termed the E box of target gene promoters. |
AT3G19290 | bZIP transcription factor with specificity for abscisic acid-responsive elements (ABRE). Mediates ABA-dependent stress responses.ABF4 acts through SnRK2 pathway and binds to ABA response elements of the promoters of NYE1 and regulates their expression to promote chlorophyll degradation. |
AT5G19530 | Encodes a spermine synthase. Required for internode elongation and vascular development, specifically in the mechanism that defines the boundaries between veins and nonvein regions. This mechanism may be mediated by polar auxin transport. Though ACL5 has been shown to function as a spermine synthase in E. coli, an ACL5 knockout has no effect on the endogenous levels of free and conjugated polyamines in Arabidopsis, suggesting that ACL5 may have a very specific or altogether different in vivo function. |
AT1G62380 | Encodes a protein similar to 1-aminocyclopropane-1-carboxylic oxidase (ACC oxidase). Expression of the AtACO2 transcripts is affected by ethylene. |
AT1G77330 | similar to 1-aminocyclopropane-1-carboxylate oxidase GI:3386565 from (Sorghum bicolor) |
AT5G65800 | 1-aminocyclopropane-1-carboxylate synthase (ACS) is encoded by a multigene family consisting of at least five members whose expression is induced by hormones, developmental signals, and protein synthesis inhibition. |
AT2G34690 | Gene product transports the glycolipid precursor sphingosine between membranes in vitro. Mutant constitutively expresses defense-related genes that accompany the hypersensitive response normally triggered by avirulent pathogens. The mRNA is cell-to-cell mobile. |
AT3G19720 | Encodes a novel chloroplast division protein. Mutants of exhibit defects in chloroplast constriction, have enlarged, dumbbell-shaped chloroplasts. The ARC5 gene product shares similarity with the dynamin family of GTPases, which mediate endocytosis, mitochondrial division, and other organellar fission and fusion events in eukaryotes. Phylogenetic analysis showed that ARC5 is related to a group of dynamin-like proteins unique to plants. A GFP-ARC5 fusion protein localizes to a ring at the chloroplast division site. Chloroplast import and protease protection assays indicate that the ARC5 ring is positioned on the outer surface of the chloroplast. Facilitates separation of the two daughter chloroplasts. |
AT5G47720 | Encodes a functional acetoacetyl-CoA thiolase that is functionally redundant with AACT2. Loss-of-function mutants show no apparent growth phenotypes. |
AT5G48230 | Encodes an acetoacetyl-CoA thiolase that generates the bulk of the acetoacetyl-CoA precursor needed for the cytosolic localized, mevalonate-derived isoprenoids biosynthetic pathway. Loss-of-function mutants are embryo lethal. |
AT2G31810 | ACT domain-containing small subunit of acetolactate synthase protein;(source:Araport11) |
AT1G36160 | Encodes acetyl-CoA carboxylase. Mutant displays uncoordinated cell divisions which are enhanced by cytokinins. Mutant also has aberrant organization of the apical region in the embryo and abnormal root and shoot development and is deficient in freezing tolerance after cold acclimation. Essential for very long chain fatty acid elongation. The mRNA is cell-to-cell mobile. |
AT1G36180 | acetyl-CoA carboxylase 2 (ACC2) The mRNA is cell-to-cell mobile. |
AT5G36880 | Encodes a plastidic acetyl-coA synthetase. This enzyme plays a role in converting acetate to acetyl-coA in the plastids. It does not appear to be a major contributor to fatty acid biosynthesis based on mutant phenotypes. The enzyme seems to act as a monomer and may play an important role in preventing the toxic accumulation of fermentation products including acetaldehyde, acetate, and ethanol. It participates in the pyruvate dehydrogenase bypass pathway |
AT3G09980 | Encodes ACIP1, a microtubules-associated protein required for bacterial immunity. The mRNA is cell-to-cell mobile. |
AT4G35830 | Encodes an aconitase that can catalyze the conversion of citrate to isocitrate through a cis-aconitate intermediate, indicating that it may participate in the TCA cycle and other primary metabolic pathways. The protein is believed to accumulate in the mitochondria and the cytosol. It affects CSD2 (At2g28190 - a superoxide dismutase) transcript levels and may play a role in the response to oxidative stress. This enzyme can also specifically bind to the 5' UTR of CSD2 in vitro. |
AT2G05710 | Encodes an aconitase that can catalyze the conversion of citrate to isocitrate through a cis-aconitate intermediate, indicating that it may participate in the TCA cycle and other primary metabolic pathways. The protein is believed to accumulate in the mitochondria and the cytosol. It affects CSD2 (At2g28190 - a superoxide dismutase) transcript levels and may play a role in the response to oxidative stress. One member of the family (ACO1 - At35830) was shown to specifically bind to the 5' UTR of CSD2 in vitro. ACO3 is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. The mRNA is cell-to-cell mobile. |
AT5G65890 | Member of ACT domain containing protein family. ACT domains are amino acid binding domains. Shows strongest expression in flowers and siliques. |
AT1G76990 | ACT domain repeat 3;(source:Araport11) |
AT2G36840 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. |
AT1G16880 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. The mRNA is cell-to-cell mobile. |
AT2G39570 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. |
AT5G59370 | Encodes one of eight Arabidopsis actins. ACT4 belongs to the reproductive actin subclass which is predominantly expressed in developing and reproductive tissues, such as pollen, pollen tubes, ovules, and developing seeds. Expression of the ACT4/GUS fusion was restricted to young vascular tissues, tapetum, and developing and mature pollen. |
AT1G49240 | Member of a subclass of actins composed of ACT2 and ACT8. Its mRNA is strongly expressed in strongly expressed in leaves, roots, stems, flowers, pollen, and siliques. However, protein expression, assayed by a ACT8:GUS fusion reporter, is very low in pollen. |
AT5G52360 | ADF10 is an actin-depolymerizing factor that preferentially binds ADP-G-actin and inhibits G-actin nucleotide exchange. ADF10 promotes actin turnover in pollen , regulating organization of actin filaments and vesicle trafficking during pollen tube growth. |
AT5G59890 | actin depolymerizing factor 4 (ADF4) mRNA, complete cds |
AT2G16700 | Encodes actin depolymerizing factor 5 (ADF5). |
AT3G27000 | encodes a protein whose sequence is similar to actin-related proteins (ARPs) in other organisms. its transcript level is down regulated by light and is expressed in very low levels in all organs examined. |
AT3G12110 | Encodes an actin that is expressed predominantly during reproductive development. |
AT2G01330 | nucleotide binding protein;(source:Araport11) |
AT5G56180 | encodes a protein whose sequence is similar to actin-related proteins (ARPs) in other organisms. Member of nuclear ARP family of genes. |
AT1G60430 | actin-related protein C3;(source:Araport11) |
AT1G20560 | acyl activating enzyme 1;(source:Araport11) |
AT3G23790 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT4G25050 | encodes an acyl carrier protein predominantly expressed in leaves. Gene expression is upregulated by light. |
AT5G27200 | Encodes an acyl carrier protein family member. Expression is induced by salt stress and overexpression leads to increased salt tolerance. |
AT4G14070 | Plastidic acyl activating enzyme involved in the elongation of exogenous medium-chain fatty acids to 16- and 18-carbon fatty acids. |
AT3G48990 | Encodes an oxalyl-CoA synthetase and is required for oxalate degradation, for normal seed development, and for defense against an oxalate-producing fungal pathogen. |
AT3G16910 | Encodes a peroxisomal protein with acetyl-CoA synthetase activity that is responsible for the activation of acetate for entry into the glyoxylate cycle. |
AT3G02610 | Encodes one of two ∆9 palmitoyl-ACP desaturases responsible for the biosynthesis of ω-7 fatty acids in the maturing endosperm. |
AT5G16230 | Encodes one of two ∆9 palmitoyl-ACP desaturases responsible for the biosynthesis of ω-7 fatty acids in the maturing endosperm. |
AT5G27630 | Acyl-CoA binding protein with high affinity for oleoyl-CoA. Expressed in all plant organs. Involved in fatty acid transport. Plays a role in determining seed oil content. |
AT1G06290 | Encodes an acyl-CoA oxidase with specificity for medium chain fatty acids. The mRNA is cell-to-cell mobile. |
AT2G35690 | Encodes an acyl-CoA oxidase. Involved in jasmonate biosynthesis. Expressed uniformly in seedlings and throughout development. |
AT1G35290 | Thioesterase superfamily protein;(source:Araport11) |
AT1G31730 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
AT2G19790 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
AT5G11490 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
AT5G46630 | clathrin adaptor complexes medium subunit family protein, contains Pfam profile: PF00928 adaptor complexes medium subunit family; similar to micro-adaptins of clathrin coated vesicle adaptor complexes |
AT4G24550 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
AT4G22570 | Encodes an adenine phosphoribosyltransferase (APT; EC 2.4.2.7), which is a constitutively expressed enzyme involved in the one-step salvage of adenine to AMP. APT3 has higher affinity for zeatin, isopentenyladenine and benzyladenine than APT1 but lower Vmax than APT1. |
AT4G12440 | adenine phosphoribosyl transferase 4;(source:Araport11) |
AT3G09820 | Involved in the salvage synthesis of adenylates and methyl recycling |
AT5G63400 | encodes a protein similar to adenylate kinase. |
AT5G19220 | Encodes the large subunit of ADP-glucose pyrophosphorylase which catalyzes the first, rate limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms (ApL1-4) have been identified. ApL1 is the major large subunit isoform present in leaves. Mutational analysis of APS1 suggests that APL1 and APL2 can compensate for loss of APS1 catalytic activity,suggesting both have catalytic as well as regulatory functions. |
AT1G23490 | Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. A member of ARF GTPase family. Arabidopsis has 21 known members, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
AT1G10630 | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
AT2G15310 | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor (GI:861205) (Chlamydomonas reinhardtii), other ARFs and ARF-like proteins. |
AT3G03120 | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster}, other ARFs and ARF-like proteins. |
AT5G37680 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARL GTPases. |
AT5G47280 | ADR1-like 3;(source:Araport11) |
AT4G18960 | Floral homeotic gene encoding a MADS domain transcription factor. Specifies floral meristem and carpel and stamen identity. Binds CArG box sequences. It is the only C function gene. It interacts genetically with the other homeotic genes to specify the floral organs. |
AT1G22130 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL104 is expressed in pollen.It forms heterodimers with other MICK family members (AGL65 and AGL30). Involved in late stages of pollen development and pollen tube growth. |
AT5G13790 | AGL15 (AGAMOUS-Like 15) is a member of the MADS domain family of regulatory factors. Although AGL15 is preferentially expressed during embryogenesis, AGL15 is also expressed in leaf primordia, shoot apical meristems and young floral buds, suggesting that AGL15 may play a role during post-germinative development. Transgenic plants that ectopically express AGL15 show delays in the transition to flowering, perianth abscission and senescence and fruit and seed maturation. Role in embryogenesis and gibberellic acid catabolism. Targets B3 domain transcription factors that are key regulators of embryogenesis.AGL15 binds the HAE promoter in floral receptacles and represses HAE expression. AGL15 is phosphorylated in a MKK4/5 dependent manner in floral receptacles. Serines 231 and 257 are phosphorylated in floral receptacles. AGL15 also directly regulates the expression of the peroxidase PRX17, linking it to lignified tissue expression. |
AT3G57390 | encodes a MADS-box containing protein likely to be a transcription factor that is expressed in endosperm and developing gametophytes. The protein sequence is most similar to that of AGL15, which is expressed in developing embryos. |
AT2G45660 | Controls flowering and is required for CO to promote flowering. It acts downstream of FT. Overexpression of (SOC1) AGL20 suppresses not only the late flowering of plants that have functional FRI and FLC alleles but also the delayed phase transitions during the vegetative stages of development. AGL20/SOC1 acts with AGL24 to promote flowering and inflorescence meristem identity.AGL20 upregulates expression of AGL24 in response to GA. |
AT4G37940 | encodes a MADS box protein, highly expressed in the root. |
AT2G03060 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL30 is expressed in pollen.It forms heterodimers with other MICK family members. |
AT2G26320 | AGAMOUS-like 33;(source:Araport11) |
AT2G26880 | AGAMOUS-like 41;(source:Araport11) |
AT5G62165 | Encodes a MADS box transcription factor. Expressed in quiescent center. Involved in floral transition. |
AT3G05860 | MADS-box transcription factor family protein;(source:Araport11) |
AT2G28700 | AGAMOUS-like 46;(source:Araport11) |
AT2G40210 | AGAMOUS-like 48;(source:Araport11) |
AT3G30260 | Agamous-like transcription factor. A target of SPL10, AGL79 knockdowns show defects in leaf shape, shoot branching, and flowering time. |
AT5G60910 | MADS box gene negatively regulated by APETALA1 |
AT5G06500 | AGAMOUS-like 96;(source:Araport11) |
AT1G46408 | AGAMOUS-like 97;(source:Araport11) |
AT3G25250 | Arabidopsis protein kinase The mRNA is cell-to-cell mobile. |
AT2G13810 | ALD1 is a L-lysine alpha-aminotransferase. It is part of the pipecolic acid biosynthetic pathway, where it catalyzes the biochemical conversion of lysine to epsilon-amino-alpha-ketocaproic acid (KAC) which is subject to subsequent transamination, cyclization and isomerization to form 2,3-dehydropipecolic acid. |
AT4G21060 | Encodes an endomembrane system-localized, hydroxyproline-O-galactosyltransferase specific for arabinogalactan-protein biosynthesis. |
AT2G17580 | Encodes a bacterial-type poly(A) polymerase, AGS1. |
AT4G37750 | ANT is required for control of cell proliferation and encodes a putative transcriptional regulator similar to AP2. Loss of function alleles have reduced fertility, abnormal ovules and abnormal lateral organs. Expressed in the chalaza, floral organ primordia, and lateral shoot organ primordia. Regulates growth and cell numbers during organogenesis. |
AT1G17290 | Encodes for alanine aminotransferase (ALAAT1), involved in alanine catabolism during plants recovery from hypoxia The mRNA is cell-to-cell mobile. |
AT1G70580 | Encodes a protein with glyoxylate aminotransferase activity. It can act on a number of different small substrates and amino acids in vitro. |
AT2G13360 | Encodes a peroxisomal photorespiratory enzyme that catalyzes transamination reactions with multiple substrates. It is involved in photorespiration. |
AT2G38400 | alanine:glyoxylate aminotransferase 2 homolog (AGT3) mRNA, |
AT1G50200 | Alanyl-tRNA synthetase;(source:Araport11) |
AT1G24490 | Homologue of the Alb3/Oxa1/YidC family. ALB4 is almost identical to the Alb3/Oxa1/YidC domain of the previously described 110 kDa inner envelope protein ARTEMIS. However, ALB4 is expressed as a separate 55 kDa protein and is located in the thylakoid membrane of chloroplasts. Analysis of a T-DNA insertion line with a reduced level of Alb4 revealed chloroplasts with an altered ultrastructure. Mutant plastids are larger, more spherical in appearance and the grana stacks within the mutant lines are less appressed than in the wild-type chloroplasts. ALB4 is required for proper chloroplast biogenesis. The mRNA is cell-to-cell mobile. |
AT2G01110 | mutant is Albino and pale green; Chloroplast Protein Translocation (tatC). Core subunit of the chloroplast Tat translocase. Integral chloroplast thylakoid membrane protein. |
AT3G63410 | Encodes a MPBQ/MSBQ methyltransferase located in the chloroplast inner envelope membrane. Mutant plants lack plastoquinone (PQ), suggesting that the APG1 protein is involved in the methylation step of PQ biosynthesis. The gene product is also involved in tocopherol (vitamin E) biosynthesis. |
AT5G01370 | Nuclear protein with a lysine-rich domain and a C-terminal serine-rich domain. Interacts with Alcatraz (ALC). ACI1 is mainly expressed in the vascular system. Involved in cell separation during fruit dehiscence. |
AT5G67110 | encodes a myc/bHLH transcription factor-like protein. Gene product is involved in fruit dehiscence. Mutant siliques fail to dehisce. |
AT1G77120 | Catalyzes the reduction of acetaldehyde using NADH as reductant. Requires zinc for activity. Dimer. Anaerobic response polypeptide (ANP). Fermentation. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. The mRNA is cell-to-cell mobile. |
AT2G14170 | Arabidopsis thaliana methylmalonate-semialdehyde dehydrogenase |
AT5G62530 | Encodes mitochondrial Delta-pyrroline-5- carboxylate dehydrogenase. Involved in the catabolism of proline to glutamate. Involved in protection from proline toxicity. Induced at pathogen infection sites. P5CDH and SRO5 (an overlapping gene in the sense orientation) generate 24-nt and 21-nt siRNAs, which together are components of a regulatory loop controlling reactive oxygen species (ROS) production and stress response. |
AT3G66658 | Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures. |
AT3G48000 | Encodes a putative (NAD+) aldehyde dehydrogenase. |
AT3G24503 | Arabidopsis thaliana aldehyde dehydrogenase AtALDH1a mRNA. a sinapaldehyde dehydrogenase catalyzes both the oxidation of coniferylaldehyde and sinapaldehyde forming ferulic acid and sinapic acid, respectively |
AT1G44170 | Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. It is also able to oxidize beta-unsaturated aldehydes, but not aromatic aldehydes. Activity of ALDH3H1 is NAD +-dependent. |
AT1G79440 | Encodes a mitochondrial succinic semialdehyde dehydrogenase (SSADH). Nomenclature according to Kirch, et al (2004). |
AT2G37790 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT2G37760 | Encodes an NADPH-dependent aldo-keto reductase that can act on a wide variety of substrates in vitro including aliphatic and aromatic aldehydes and steroids. Transcript levels for this gene are up-regulated in response to cold, salt, and drought stress. |
AT5G26210 | Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7). |
AT1G14510 | Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7). |
AT1G15130 | ALIX mediates endosomal protein trafficking and turnover through the ESCRT/MVB pathway. One target is the phosphate transporter PHT1;1. Modulates ABA-mediated inhibition of plant growth and stomatal aperture (PMID:31363038). |
AT4G34860 | Plant neutral invertase family protein;(source:Araport11) |
AT1G22650 | Plant neutral invertase family protein;(source:Araport11) |
AT1G23740 | AOR is an alkenal/one oxidoreductase that acts on compounds with unsaturated alpha,beta-carbonyls. The activity of this enzyme with a number of substrates, including acrolein and 3-buten-2-one, was demonstrated in vitro using a truncated form of the protein that lacked approximately 80 of the first amino acids. This protein appears to localize to the chloroplast where it likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation. |
AT4G03060 | Encodes a truncated and null function protein, due to a 5-bp deletion in cDNA. The functional allele in ecotype Cvi, AOP2, encodes a 2-oxoglutarate-dependent dioxygenase which is involved in glucosinolate biosynthesis. The natural variation in this locus explains the diversification of alkenyl glucosinolate among different ecotypes of Arabidopsis. |
AT5G42650 | Encodes a member of the cytochrome p450 CYP74 gene family that functions as an allene oxide synthase. This enzyme catalyzes dehydration of the hydroperoxide to an unstable allene oxide in the JA biosynthetic pathway. It shows a dual catalytic activity, the major one being a 13-AOS but also expressing a 9-AOS activity. CFA-Leu, CFA-Val, CFA-Met and CFA-Ala can induce the expression of AOS. |
AT3G52720 | Encodes an alpha carbonic anhydrase (CAH1) located in the chloroplast stroma. Most chloroplast proteins are encoded by the nuclear genome and imported with the help of sorting signals that are intrinsic parts of the polypeptides. CAH1 takes an alternative route through the secretory pathway, and becomes N-glycosylated before entering the chloroplast. Glycosylation and intra-molecular disulfide bridge fromation are necessary for the correct folding, ER export, trafficking and activity of the protein. |
AT2G28210 | alpha carbonic anhydrase 2;(source:Araport11) |
AT4G20990 | alpha carbonic anhydrase 4;(source:Araport11) |
AT4G21000 | alpha carbonic anhydrase 6;(source:Araport11) |
AT5G56330 | alpha carbonic anhydrase 8;(source:Araport11) |
AT1G73680 | Encodes an alpha dioxygenase. Recombinant protein catalyzes the conversion of a wide range of fatty acids into 2(R)-hydroperoxy derivatives. |
AT1G69830 | Encodes a plastid-localized α-amylase. Expression is reduced in the SEX4 mutant. Loss of function mutations show normal diurnal pattern of starch accumulation/degradation. Expression follows circadian rhythms. |
AT5G08370 | Member of Glycoside Hydrolase Family 27 (GH27)that functions as an α-galactosidase. |
AT3G56310 | Member of Glycoside Hydrolase Family 27 (GH27)that functions as an α-galactosidase. |
AT3G46970 | Encodes a cytosolic alpha-glucan phosphorylase. In vitro, the enzyme has a preference for branched polysaccharides, such as glycogen. |
AT5G11720 | Glycosyl hydrolases family 31 protein;(source:Araport11) |
AT1G51590 | Encodes an alpha-mannosidase I enzyme responsible for N-glycan maturation. |
AT3G56450 | member of alpha-SNAP Gene Family |
AT2G25940 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteinases that is expressed in vegetative organs and is upregulated in association with various types of cell death and under stressed conditions. |
AT1G68560 | Encodes a bifunctional alpha-l-arabinofuranosidase/beta-d-xylosidase that belongs to family 3 of glycoside hydrolases. |
AT1G20650 | Protein kinase superfamily protein;(source:Araport11) |
AT1G07180 | Internal NAD(P)H dehydrogenase in mitochondria. The predicted protein sequence has high homology with other designated NAD(P)H DHs from microorganisms; the capacity for matrix NAD(P)H oxidation via the rotenone-insensitive pathway is significantly reduced in the Atndi1 mutant plant line; the in vitro translation product of AtNDI1 is imported into isolated mitochondria and located on the inside of the inner membrane. |
AT2G29990 | alternative NAD(P)H dehydrogenase 2;(source:Araport11) |
AT1G25480 | Encodes a phosphorylation-dependent anion channel that can mediate malate release from the vacuole and is required for stomatal closure in response to abscisic acid. |
AT2G17470 | Encodes ALMT6, a member of the aluminum-activated malate transporter family. |
AT1G08430 | Encodes a Al-activated malate efflux transporter. It is essential for aluminum tolerance but does not represent the major Al tolerance QTL. Staurosporine and calyculin A both block all changes in AtALMT1 gene expression (as a result malate release is totally inhibited). AtALMT1 transcription was clearly induced by indole-3-acetic acid, abscisic acid, low pH, hydrogen peroxide and flg22. STOP1 and CAMTA2 transcription factors are involved in Al-inducible expression of AtALMT1 and both proteins bind to the AtALMT1 promoter. |
AT3G18440 | Belongs to the aluminum-activated malate transporter family. Encodes a vacuolar malate channel. Expressed in all parts of plants. Almost exclusively expressed in mesophyll cells of leaves. The mRNA is cell-to-cell mobile. |
AT4G17970 | Anion transporter involved in stomatal closure. Gene has 3 splicing variants. |
AT5G27610 | protein ALWAYS EARLY 1;(source:Araport11) |
AT3G05380 | ALWAYS EARLY 2;(source:Araport11) |
AT1G58360 | Encodes AAP1 (amino acid permease 1), a neutral amino acid transporter expressed in seeds. Functions in amino acid uptake into embryos. The transporter also functions in acquisition of glutamate and neutral amino acids by the root. |
AT5G63850 | Amino acid transporter whose expression is downregulated by dehydration. |
AT1G10010 | Encodes a high affinity amino acid transporter that is probably responsible for import of organic nitrogen into developing seeds. One of eight gene family members that encode amino acid permeases. Most closely related to AAP1 (75%) identity. |
AT3G25585 | aminoalcoholphosphotransferase (AAPT2) |
AT5G44240 | Expression is upregulated in the shoot of cax1/cax3 mutant. The mRNA is cell-to-cell mobile. |
AT1G59820 | Encodes a phospholipid translocase. Involved in secretory vesicle formation from trans-Golgi in peripheral columella cells at the root tip. Mutants have short primary roots and grow slower. The mRNA is cell-to-cell mobile. |
AT1G72700 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
AT1G68710 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
AT1G64780 | encodes an ammonium transporter protein believed to act as a high affinity transporter. It is expressed in the root, primarily in endodermal and cortical cells, and contributes to ammonium uptake in the root. |
AT4G28700 | ammonium transporter 1;(source:Araport11) |
AT2G38290 | encodes a high-affinity ammonium transporter, which is expressed in shoot and root. Expression in root and shoot is under nitrogen and carbon dioxide regulation, respectively. |
AT2G18290 | Encodes APC10 (anaphase promoting complex 10). Overexpression of APC10 likely mimics auxin and ethylene sensitive phenotypes. Plays an essential role in cell proliferation during leaf development. |
AT2G04660 | a highly conserved ubiquitin-protein ligase involved in cell cycle regulation |
AT5G53860 | Encodes a plant-specific protein with a domain similar to the central cysteine-rich domain of DnaJ proteins. It is involved in chloroplast and leaf development. |
AT1G01510 | Encodes a homolog of human CtBP. Mutant has longer and thicker leaves than wild type. Involved in controlling polar cell expansion in the leaf width direction. It has been shown to localize to cytosolic stress granules and is involved in their formation. |
AT5G28640 | Encodes a protein with similarity to mammalian transcriptional coactivator that is involved in cell proliferation during leaf and flower development. Loss of function mutations have narrow, pointed leaves and narrow floral organs. AN3 interacts with members of the growth regulating factor (GRF) family of transcription factors. |
AT5G54610 | Induced in response to Salicylic acid. Belongs to the ankyrin repeat protein family. |
AT5G02620 | Encodes a member of the ankyrin repeat protein. Localized in the endoplasmic reticulum. |
AT1G35720 | Encodes a member of the annexin gene family, a diverse, multigene family of calcium-dependent, membrane-binding proteins. The protein was determined to have peroxidase activity. This activity is thought to be dependent on the presence of post-translational modifications (most likely phosphorylation). The protein was shown to be present as a mixture of monomer and homodimer. The homodimerization seems to be dependent on the presence of Ca2+ or H2O2. The dimerization was prevented by the addition of DTT, β-mercaptoethanol and TCEP. Annat1 mRNA is expressed in flowers, roots,leaves and stems and is most abundant in stems. mRNA levels are increased in response to oxidative stress. Developmental expression patterns suggest a role in Golgi-mediated polysaccharide secretion. It is a Ca 2+-permeable transporter providing a molecular link between reactive oxygen species and cytosolic Ca 2+ in plants. The mRNA is cell-to-cell mobile. |
AT5G10230 | Encodes a calcium-binding protein annexin (AnnAt7). |
AT1G25220 | Catalyzes the first step of tryptophan biosynthesis: Chorismate L-Glutamine = Anthranilate Pyruvate L-Glutamate. Functions as a heterocomplex with anthranilate synthase alpha subunit (ASA1 or ASA2). |
AT1G69120 | Floral homeotic gene encoding a MADS domain protein homologous to SRF transcription factors. Specifies floral meristem and sepal identity. Required for the transcriptional activation of AGAMOUS. Interacts with LEAFY.Binds to promoter and regulates the expression of flowering time genes SVP, SOC1 and AGL24. |
AT1G34780 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. |
AT5G18120 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. |
AT4G39940 | adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete The mRNA is cell-to-cell mobile. |
AT2G41460 | Apurinic endonuclease-redox protein. It functions as an apurinic/apyrimidinic class II endonuclease, and is involved in DNA repair. |
AT2G44900 | ARABIDILLO-1 and its homolog, ARABIDILLO -2, are unique among Arabidopsis Arm-repeat proteins in having an F-box motif and fall into a phylogenetically distinct subgroup from other plant Arm-repeat proteins Similar to arm repeat protein in rice and armadillo/beta-catenin repeat family protein / F-box family protein in Dictyostelium. ARABIDILLO-1 promote lateral root development. Mutant plants form fewer lateral roots, while ARABIDILLO-1-overexpressing lines produce more lateral roots than wild-type seedlings. |
AT3G57510 | Encodes ADPG1, a polygalacturonase protein involved in silique and anther dihiscence. Loss of function mutations have reduced seed set, indehiscent fruit and reduced pollen shedding. Required for release of cell wall-derived PR elicitors. |
AT3G23620 | BRIX domain containing protein, similar to RNA biogenesis factors in yeast. Binds rRNA and likely also functions in RNA biogenesis in Arabidopsis. Essential gene, mutants are embryo lethal and does not transmit well through the gametophyte. |
AT2G37990 | ribosome biogenesis regulatory protein (RRS1) family protein;(source:Araport11) |
AT3G01310 | Encodes a functional VIP1/PPIP5K-type ATP-grasp kinase that is involved in both InsP6 to InsP7 conversion and InsP7 to InsP8 conversion, producing the InsP8 cofactor of the ASK1-COI1-JAZ-jasmonate co-receptor complex. It is the major isoform in plants, is required for jasmonate-dependent defenses, and plays an important role in plant defenses against necrotrophic fungi and insect herbivores. |
AT5G15070 | Encodes a functional VIP1/PPIP5K-type ATP-grasp kinase that is involved in both InsP6 to InsP7 conversion and InsP7 to InsP8 conversion. It is the minor isoform in plants and is expressed in pollen. |
AT3G15460 | Encodes one of two Arabidopsis orthologs of yeast BRX1, a protein involved in maturation of the large ribosomal subunit. The proteins are mainly localized in nucleolus. Mutant plants are affected in pre-rRNA processing. |
AT3G54020 | Inositol phosphorylceramide synthase |
AT2G37940 | Inositol phosphorylceramide synthase 2;(source:Araport11) |
AT5G18270 | NAC domain containing protein 87;(source:Araport11) |
AT5G06750 | Protein phosphatase 2C family protein;(source:Araport11) |
AT2G17800 | A member of ROP GTPase family. Rac-like GTP-binding protein ARAC1/ATGP2. Encodes a geranylgeranylated GTP binding protein. Involved in the auxin-activated 26S proteasome-dependent Aux/IAA proteolysis pathway. |
AT5G65530 | Encodes a protein kinase involved in mediating resistance to fungi and also trichome branch number. Kinase activity is increased by ROP6 which also affects its sub-cellular localization (becomes localized to the cell periphery_ |
AT2G32480 | Metalloprotease essential for plastid development. Located in the inner membrane of chloroplasts. |
AT2G28130 | NSE5 subunit of the SMC5/6 complex. |
AT1G09730 | Encodes a SUMO protease that positively regulates the transition to flowering in long and short days. Along with SPF2, its activity is required for fertility as asp1/spf2 double mutants have defects in gametogenesis and embroygenesis. |
AT1G49220 | RING/U-box superfamily protein;(source:Araport11) |
AT1G72200 | RING/U-box superfamily protein;(source:Araport11) |
AT2G20030 | RING/U-box superfamily protein;(source:Araport11) |
AT4G30400 | RING/U-box superfamily protein;(source:Araport11) |
AT5G43420 | RING/U-box superfamily protein;(source:Araport11) |
AT1G53010 | RING/U-box superfamily protein;(source:Araport11) |
AT2G46495 | RING/U-box superfamily protein;(source:Araport11) |
AT5G42200 | RING/U-box superfamily protein;(source:Araport11) |
AT4G17920 | RING/U-box superfamily protein;(source:Araport11) |
AT4G09120 | RING/U-box superfamily protein;(source:Araport11) |
AT4G28890 | RING/U-box superfamily protein;(source:Araport11) |
AT1G23980 | RING/U-box superfamily protein;(source:Araport11) |
AT3G03550 | RING/U-box superfamily protein;(source:Araport11) |
AT5G17600 | RING/U-box superfamily protein;(source:Araport11) |
AT4G10150 | RING/U-box superfamily protein;(source:Araport11) |
AT1G49200 | RING/U-box superfamily protein;(source:Araport11) |
AT3G18773 | RING/U-box superfamily protein;(source:Araport11) |
AT2G46494 | RING/U-box superfamily protein;(source:Araport11) |
AT1G20760 | EH domain containing protein. |
AT1G21630 | TPLATE Adaptor complex subunit. |
AT1G78440 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins. |
AT4G12640 | Encodes a member of the Split ends (Spen) protein family that is characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. Knockout and overexpression mutants show no apparent changes in growth, development and flowering time under standard growth conditions. |
AT1G22500 | Gene encodes a putative C3HC4-type RING zinc finger factor. it is induced in response to light and ascorbate stimulus. |
AT4G37450 | AGP18 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP17 and AGP19, other lysine-rich AGPs. It is expressed in young leaves, shoots, roots and flowers and is active in the regulation of the selection and survival of megaspores. |
AT5G64310 | Encodes arabinogalactan-protein (AGP1). The mRNA is cell-to-cell mobile. |
AT4G09030 | Encodes arabinogalactan protein (AGP10). The mRNA is cell-to-cell mobile. |
AT3G13520 | Encodes a GPI-anchored arabinogalactan (AG) peptide with a short 'classical' backbone of 10 amino acids, seven of which are conserved among the 4 other Arabidopsis AG peptides. These peptides may be involved in cell signaling. |
AT5G11740 | Encodes arabinogalactan protein (AGP15). The mRNA is cell-to-cell mobile. |
AT2G46330 | Encodes arabinogalactan protein (AGP16). |
AT2G22470 | Encodes arabinogalactan-protein (AGP2). |
AT3G57690 | Encodes a putative arabinogalactan-protein (AGP23). |
AT2G47930 | arabinogalactan protein 26;(source:Araport11) |
AT1G28290 | Encodes an atypical arabinogalactan protein that is localized to the plasma membrange. AGP31 is highly expressed in flowers and vascular tissue and is repressed by jasmonic acid. AGP31 may play a role in vascular tissue function during defense and development. |
AT3G20865 | Encodes a putative arabinogalactan-protein (AGP40) that is expressed in pollen. |
AT5G14380 | Encodes an arabinogalactan protein that is expressed in pollen, pollen sac and pollen tube. Loss of AGP6 function results in decreased fertility due to defects in pollen tube growth. |
AT3G42850 | Mevalonate/galactokinase family protein;(source:Araport11)arabinokinase activity |
AT4G16130 | Arabinokinase. |
AT5G36925 | hypothetical protein;(source:Araport11) |
AT5G61980 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD1 belongs to the class 1, together with AGD2, AGD3 and AGD4. Not expressed in hypocotyls and cotyledons. |
AT3G07490 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
AT4G05330 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
AT3G17660 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes; AGD15 belongs to the class 4, together with AGD14. |
AT1G60860 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD2 belongs to the class 1, together with AGD1, AGD3, and AGD4. |
AT3G53710 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
AT4G17890 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
AT5G46750 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. The mRNA is cell-to-cell mobile. |
AT4G08900 | Encodes an arginase, likely to be involved in polyamine biosynthesis in pollen. |
AT5G52040 | Encodes an arginine/serine-rich splicing factor. Transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. RS41 binds to HYL1 and co-localizes to the nuclear dicing body. Along with RS41, it appears to be involved in pri-miRNA processing and miRNA biogenesis. |
AT3G53500 | Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
AT2G37340 | encodes an RS-containing Zinc knuckle protein with molecular mass of 33kDa that is localized to nuclear specks. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
AT5G43810 | Encodes Argonaute10, a member of the EIF2C (elongation initiation factor 2c)/ Argonaute class of proteins. Required to establish the central-peripheral organization of the embryo apex. Along with WUS and CLV genes, controls the relative organization of central zone and peripheral zone cells in meristems. Acts in embryonic provascular tissue potentiating WUSCHEL function during meristem development in the embryo. AGO10 specifically sequesters miR166/165 to regulate shoot apical meristem development. |
AT1G31290 | ARGONAUTE 3;(source:Araport11) |
AT2G27040 | AGO4 is a member of a class of PAZ/PIWI domain containing proteins involved in siRNA mediated gene silencing.Loss of function mutations have reduced site specific CpNpG and CpHpH methylation, abnormal ovule/megagametophyte develoment and increased susceptibility to bacterial pathogens including Tobacco rattle virus. |
AT2G27880 | AGO5.Required for antiviral RNA silencing.Confers resistance to Potato virus X. |
AT5G21150 | AGO9-dependent sRNA silencing is crucial to specify cell fate in the Arabidopsis ovule. AGO9 is expressed in reproductive companion cells but not in the associated male or female gametes or their precursors. Therefore, AGO9 acts non-cell autonomously to silencing the activity of TEs activity in the female gametophyte.Loss of function mutants produce ectopic megaspore mother cell and supernumary female gametophytes. |
AT4G34370 | RING/U-box superfamily protein;(source:Araport11) |
AT1G05880 | Encodes ARI12 (ARIADNE 12). ARI12 belongs to a family of `RING between RING fingers' (RBR) domain proteins with E3 ligase activity. Expression of ARI12 is induced by UV-B exposure. |
AT5G63750 | RING/U-box superfamily protein;(source:Araport11) |
AT5G63730 | Encodes ARIADNE14 (ARI14), a putative ubiquitin E3 ligase. ARI14 and an inversely transcribed gene KPL generate a sperm-specific natural cis-antisense siRNA pair. In the absence of KPL, ARI14 RNA levels in sperm are increased and fertilization is impaired. |
AT5G63760 | RING/U-box superfamily protein;(source:Araport11) |
AT5G08730 | IBR domain-containing protein;(source:Araport11) |
AT1G05890 | RING/U-box superfamily protein;(source:Araport11) |
AT1G63760 | pseudogene of RING/U-box superfamily protein;(source:Araport11) |
AT2G31510 | IBR domain-containing protein;(source:Araport11) |
AT1G65430 | IBR domain-containing protein;(source:Araport11) |
AT1G04880 | Encodes a ARID-HMG DNA-binding protein that functions in pollen tube growth through the regulation of gene expression by interacting with the transcription factors AGL66 and AGL104. |
AT5G13060 | Encodes a novel Armadillo BTB protein that intreacts with the pre-replication complex and several transcription factors. Overexpression results in decreased cell proliferation and loss of function results in increased cell proliferation suggesting a role in negative regulation of cellular proliferation. |
AT1G12430 | Encodes the kinesin-like protein PAK has an Armadillo motif tail and is involved in guard cell development in Arabidopsis (from Genbank record AF159052).However, no defect in stomatal complexes has been observed in loss of function mutations. It accumulates at the preprophase band (PPB) in a cell-cycle and microtubule-dependent manner and is most highly expressed in cells where the placement of the division plane (early embryogenesis, stomatal lineages) is critical. |
AT5G66200 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
AT3G26600 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
AT1G11790 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
AT3G44720 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile. |
AT2G20340 | Encodes an aromatic aldehyde synthase (AtAAS), which catalyzes the in vitro conversion of phenylalanine and 3,4-dihydroxy-L-phenylalanine to phenylacetaldehyde and dopaldehyde, respectively. The mRNA is cell-to-cell mobile. |
AT3G11900 | encodes an amino acid transporter that transports aromatic and neutral amino acids, IAA, and 2,4-D. Expressed in all tissues with highest abundance in flowers and cauline leaves. a member of a small gene family in Arabidopsis and represents a new class of amino acid transporters. |
AT1G68310 | Encodes a protein that has been shown to specifically interact with a sequence motif, PIEPPPHH, in the cytoplasmic tail of a membrane protein that directs the protein from the ER to vacuoles where it is internalized. Required for both leaf adaxial?abaxial polarity formation and normal cell proliferation. It is part of a protein complex with CIA1, NAR1, and MET18, which are highly conserved in eukaryotes and are involved in the biogenesis of cytosolic and nuclear Fe-S proteins. |
AT1G07890 | Encodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. The mRNA is cell-to-cell mobile. |
AT4G35000 | Encodes a microsomal ascorbate peroxidase APX3. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. The APX3 protein interacts with AKR2 (ankyrin-containing protein that interacts with AFT1) and AFT1, a 14-3-3 protein. |
AT1G76710 | SET domain group 26;(source:Araport11) |
AT3G02890 | PHD protein which cooperates with PAIPP2 and BAH domain protein AIPP3 to read H3K4 histone marks. The BAH-PHD bivalent histone reader complex silences a substantial subset of H3K27me3-enriched loci, including development and stress response-related genes. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
AT4G11560 | BAH domain protein which cooperates with PHD protein AIPP2 to read H3K27me3 histone marks. The BAH-PHD bivalent histone reader complex silences a substantial subset of H3K27me3-enriched loci, including development and stress response-related genes. Responsible for preventing flowering by suppressing the expression of flowering genes. Binding of BDT1 to the H3K27me3 peptide, which is enhanced by PHD proteins, is critical for preventing early flowering. |
AT3G16150 | Encodes an asparaginase that catalyzes the degradation of L-asparagine to L-aspartic acid and ammonia. The mRNA is cell-to-cell mobile. |
AT5G42050 | Stress responsive asparagine-rich protein. Binds to PevD (Verticillium dahliae ) fungal effector protein. NRP interacts with CRY2, leading to increased cytoplasmic accumulation of CRY2 in a blue light-independent manner (PMID:28633330).NRP also binds FyPP3 and recruits it to endosomes and thus targets it for degradation. |
AT2G30970 | ASPARTATE AMINOTRANSFERASE 1 |
AT5G19550 | Nitrogen metabolism. Major cytosolic isoenzyme controlling aspartate biosynthesis in the light. The mRNA is cell-to-cell mobile. |
AT5G11520 | Encodes the chloroplastic isozyme of aspartate aminotransferase. Involved in aspartate biosynthesis and nitrogen metabolism. mRNA is expressed in senescing leaves. |
AT4G31990 | Encodes a plastid-localized aspartate aminotransferase. Does not display any PAT (glutamate/aspartate-prephenate aminotransferase) activity even in the presence of a high concentration of prephenate. |
AT5G13280 | Asp kinase inhibited by Lys and S-adenosylmethionine. Contains regulatory domains that belong to the ACT domain family, which allow binding to a extreme variety of ligands. Can function as a monomer or as a dimer with acetohydroxyacid synthase (HSDH). |
AT3G02020 | encodes a monofunctional aspartate kinase |
AT4G19710 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
AT1G11910 | Encodes an aspartic proteinase that forms a heterodimer and is stable over a broad pH range (ph 3-8). |
AT1G10600 | associated molecule with the SH3 domain of STAM 2;(source:Araport11) |
AT2G17380 | Encodes clathrin assembly protein AP19. The mRNA is cell-to-cell mobile. |
AT2G37630 | Encodes a MYB-domain protein involved in specification of the leaf proximodistal axis. Mutation results in lobed and dissected leaves with a characteristic asymmetry. Homologous to the Antirrhinum PHANTASTICA (PHAN) and maize ROUGH SHEATH2 (RS2) genes Asymmetric placement of auxin response at the distal leaf tip precedes visible asymmetric leaf growth. Acts alongside AXR1 to exclude BP expression in leaves and with PIN1 to repress BP and promote lateral organ growth. Interacts physically with AS2 to form a complex that binds to the BP promoter and silences BP. Also functions as a regulator of the plant immune response. |
AT1G65620 | required for formation of a symmetric flat leaf lamina, encodes a member of a family of proteins characterized by cysteine repeats and a leucine zipper; involved in KNOX gene regulation. Acts together with ASL1 in proximal-distal symmetry determination. Forms a complex with AS1 that binds to the BP promoter and leads to silencing of BP. |
AT1G16530 | ASYMMETRIC LEAVES 2-like 9;(source:Araport11) |
AT1G67370 | Meiotic asynaptic mutant 1 (ASY1). ASY1 protein is initially distributed as numerous foci throughout the chromatin. During early G2, the foci are juxtaposed to the nascent chromosome axes to form a continuous axis associated signal. |
AT2G17410 | AT Rich domain protein. |
AT1G76510 | ARID/BRIGHT DNA-binding domain-containing protein;(source:Araport11) |
AT3G09470 | Protein similar to UNC93 of C.elegans. Mutants are hypersensitive to ABA treatment and salt sensitive and have disregulated K+ accumulation. |
AT2G33620 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT1G63480 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT4G17950 | AT-hook motif containing nuclear localized (AHL) DNA-binding protein; substrate of immune MAPKs. Phosphorylation regulates AHL13 protein stability and thereby its immune functions. Regulates key factors of jasmonic acid biosynthesis and signaling and affects immunity toward Pseudomonas syringae and Botrytis cinerea pathogens. |
AT4G17800 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
AT4G22810 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
AT4G12050 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
AT5G51590 | Member of the 29 AT-hook family TFs involved in the development of root xylem. |
AT4G00200 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT5G46640 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT2G42940 | Encodes a nuclear matrix protein with AT-hook DNA binding motifs that acts in the maintenance of genomic integrity by silencing TEs and repeat-containing genes through epigenetic machinery. It interacts with FVE and MSI5 which are components of HDAC corepressor complexes. It is expressed in tapetum during the tetrad stage. |
AT3G43240 | Interacts with CHR11, CHR17, and RTL1, several known subunits of ISWI. JA biosynthesisis is positively regulated by this chromatin remodeling complex, thereby promoting stamen filament elongation. |
AT4G02940 | ALKBH10B is a functional RNA N6-methyladenosine demethylase. Reduction in ALKBH10B decreases m6A levels, and affects the stability of flowering time genes including FT, SPL3 and SPL9. Mutant plants are early flowering. |
AT4G32830 | Encodes a member of a family of Ser/Thr kinases whose activities peak during cell division. Transcripts are abundant in tissues rich in dividing cells like roots and flowers but are low or absent in fully expanded leaves and stems. In interphase cells, the protein is predominantly nuclear. During mitosis, the protein associates with plant-specific cytoskeletal structures (preprophase band, phragmoplast, nascent cell plate) that are necessary for cytokinesis as well as with the microtubule spindle. It specifically phosphorylates Ser10 of histone H3 and colocalizes with phosphorylated histone H3 during mitosis. |
AT2G25880 | Encodes a member of a family of Ser/Thr kinases whose activities peak during cell division. Transcripts are abundant in tissues rich in dividing cells like roots and flowers but are low or absent in fully expanded leaves and stems. In interphase cells, the protein is predominantly nuclear. During mitosis, the protein associates with plant-specific cytoskeletal structures (preprophase band, phragmoplast, nascent cell plate) that are necessary for cytokinesis as well as with the microtubule spindle. |
AT2G45490 | Encodes a member of a family of Ser/Thr kinases whose activities peak during cell division. Transcripts are abundant in tissues rich in dividing cells like roots and flowers but are low or absent in fully expanded leaves and stems. In interphase cells, the protein is predominantly nuclear. During mitosis, the protein associates with plant-specific cytoskeletal structures (preprophase band, phragmoplast, nascent cell plate) that are necessary for cytokinesis as well as with the microtubule spindle. The protein is concentrated in nuclear dots arranged around the nucleolus and the nuclear periphery in early prophase cells. |
AT3G48190 | Encodes a homolog of the human ATM gene, which is mutated in ataxia telangiectasia, a chromosome instability disorder. Suppresses leaf senescence triggered by DNA double-strand break through epigenetic control of senescence-associated genes. Characterization of mutants suggest a role homologous recombination for DNA damage repair in response to ionizing radiation as well as during meiosis. The protein has kinase domains and shows kinase activity in orthologs. There is also evidence that ATM might be involved in the telomerase-independent process known as Alternative Lengthening of Telomeres. |
AT1G09250 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT2G45980 | Encodes an Atg8-interacting protein that is partially associated with the ER during favorable growth conditions and becomes mainly associated with a spherical compartment that dynamically moves along the ER network. In stress induced plants, ATI1 is localized to a novel plastid associated bodies that are transported to vesicles, in what appears to be an autophagy dependent process. ATI1 interacts with number of other plastid proteins such as NPQ4 and APE1. |
AT4G09550 | Encodes a gamma-tubulin complex protein that plays a role in gamma-tubulin complex localization, spindle stability and chromosomal segregation. |
AT3G62690 | Encodes a RING-H2 zinc finger protein related to ATL2. The ATL gene family is represented by fifteen sequences that contain, in addition to the RING, a transmembrane domain which is located in most of them towards the N-terminal end. |
AT5G49460 | One of the two genes encoding subunit B of the cytosolic enzyme ATP Citrate Lyase (ACL) |
AT1G58080 | ATP phosphoribosyl transferase, catalyses first step of histidine biosynthesis |
AT3G52300 | ATP synthase D chain;(source:Araport11) |
AT2G41700 | ATP-binding cassette A1;(source:Araport11) |
AT3G47730 | member of ATH subfamily |
AT3G47760 | ABC2 homolog 4;(source:Araport11) |
AT3G47770 | ABC2 homolog 5;(source:Araport11) |
AT5G61730 | Encodes an ER-localized ABC transporter with a role in the supply of fatty acid substrates for TAG biosynthesis at the ER during the seed-filling stage. |
AT1G27940 | P-glycoprotein 13;(source:Araport11) |
AT3G28345 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
AT3G28860 | Encodes a member of the ATP-binding cassette (ABC) transporter family that is involved in auxin transport and is involved in postembryonic organ separation. Also known as AtMDR11 and PGP19. Possibly regulates auxin-dependent responses by influencing basipetal auxin transport in the root. Acts upstream of phyA in regulating hypocotyl elongation and gravitropic response. Exerts nonredundant, partially overlapping functions with the ABC transporter encoded by AtPGP1. |
AT4G25960 | P-glycoprotein 2;(source:Araport11) |
AT3G55320 | P-glycoprotein 20;(source:Araport11) |
AT3G62150 | Encodes a facultative transporter controlling auxin concentrations in plant cells. |
AT3G28415 | ABC transporter family protein;(source:Araport11) |
AT1G70610 | member of TAP subfamily |
AT5G39040 | Encodes a member of TAP subfamily of ABC transporters that is located in the vacuole. Mutants are hypersensitive to aluminum and the gene product may be important for intracellular movement of some substrate, possibly chelated Al, as part of a mechanism of aluminum sequestration. |
AT5G03910 | member of ATH subfamily |
AT4G01820 | member of MDR subfamily |
AT4G01830 | P-glycoprotein 5;(source:Araport11) |
AT2G39480 | P-glycoprotein 6;(source:Araport11) |
AT5G46540 | P-glycoprotein 7;(source:Araport11) |
AT1G30400 | glutathione S-conjugate transporting ATPase (AtMRP1) mRNA. An ABCC-type arsenite-phytochelatin transporter. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
AT1G30410 | member of MRP subfamily |
AT2G07680 | Encodes ABCC13/MRP11, a member of the multidrug resistance associated protein MRP/ABCC subfamily. Its expression is induced by gibberellic acid and downregulated by naphthalene acetic acid, abscisic acid, and zeatin. |
AT3G62700 | member of MRP subfamily |
AT3G60970 | member of MRP subfamily |
AT2G34660 | encodes a multidrug resistance-associated protein that is MgATP-energized glutathione S-conjugate pump. An ABCC-type arsenite-phytochelatin transporter. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. The mRNA is cell-to-cell mobile. |
AT3G13090 | member of MRP subfamily |
AT3G21250 | member of MRP subfamily |
AT4G39850 | Encodes a peroxisomal protein of the ATP binding cassette (ABC) transporter class (PMP subfamily) with significant identity to the human X-linked adrenoleukodystrophy protein (ALDP). The gene product promotes germination and represses embryo dormancy. ABI3, ABA1, FUS3 and LEC1 are epistatic to this gene. Mutants accumulate fatty acyl CoA suggesting a defect in uptake of fatty acyl CoA into the peroxisome. |
AT1G54350 | ABC transporter family protein;(source:Araport11) |
AT3G13640 | member of RLI subfamily |
AT5G60790 | Member of GCN subfamily; essential for translation inhibition under cold stress through interacting with GCN2 to phosphorylate eukaryotic translation initiation factor 2. GCN1 regulated gens are involved in flower development, seed dormancy and seed development, response to osmotic stress, amino acid biosynthesis, photosynthesis, cell wall organization, protein transport and localization, lipid biosynthesis, transcription, macroautophagy, proteolysis and cell death. |
AT5G09930 | ABCF2 is one of five members of the ABCF gene family in Arabidopsis, which are homologs of the yeast ABCF protein, GCN20. |
AT1G64550 | Encodes a member of GCN subfamily. Predicted to be involved in stress-associated protein translation control. The mutant is affected in MAMP ((microbe-associated molecular patterns)-induced stomatal closure, but not other MAMP-induced responses in the leaves. Arabidopsis has five ABCF proteins, which are all closely related by sequence to yeast GCN20. None of these five are individually required for GCN2 kinase activity. |
AT5G64840 | ABCF5 is one of five members of the ABCF gene family in Arabidopsis, which are homologs of the yeast ABCF protein GCN20. |
AT1G51500 | Encodes an ABC transporter involved in cuticular wax biosynthesis. Lines carrying recessive mutations in this locus have weakly glaucous stem surface, and relative elevated secondary alcohols and ketones. |
AT1G51460 | ABCG13 encodes a member of the ATP-binding cassette (ABC) transporter family protein. Mutants show defects in petal elongation resulting in a folded petal phenotype. |
AT3G21090 | ABC-2 type transporter family protein;(source:Araport11) |
AT3G55100 | ABC-2 type transporter family protein;(source:Araport11) |
AT2G37360 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
AT3G25620 | ABC-2 type transporter family protein;(source:Araport11) |
AT5G19410 | ABC-2 type transporter family protein;(source:Araport11) |
AT1G53390 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G16340 | Encodes a p-coumaryl alcohol exporter involved in lignin biosynthesis. |
AT2G28070 | ABC-2 type transporter family protein;(source:Araport11) |
AT2G29940 | pleiotropic drug resistance 3;(source:Araport11) |
AT2G37280 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
AT2G36380 | pleiotropic drug resistance 6;(source:Araport11) |
AT3G53480 | Negative regulator of auxin polar transport inhibitors. ABCG37 regulates auxin distribution and homeostasis in roots by excluding IBA from the root apex, but does not act directly in basipetal transport. ABCG37 and ABCG36 act redundantly at outermost root plasma membranes and, transport IBA out of the cells. Also involved in root transmembrane secretion of fluorescent phenolics involved in Fe uptake. The mRNA is cell-to-cell mobile. |
AT3G30842 | pleiotropic drug resistance 10;(source:Araport11) |
AT4G15233 | ABC-2 and Plant PDR ABC-type transporter family protein;(source:Araport11) |
AT5G13580 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). Phloem-expressed and plasma membrane-localized jasmonate transporter which together with JAT4 and GLR3.3 involved in regulating long-distance translocation of JA, which is important for driving the loading, translocation of JA in the phloem pathway by a self-propagation mode, contributing to wound-induced systemic response/resistance. |
AT2G01320 | ABC-2 type transporter family protein;(source:Araport11) |
AT5G14100 | Member of NAP subfamily. Putative component of chloroplast ECF/ABC-Transporter involved in metal homeostasis. |
AT1G65410 | Encodes a member of NAP subfamily of transporters. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
AT1G19800 | Encodes a permease-like protein involved in lipid transfer from the ER to the chloroplast, more specifically, transfer of phosphatidate across the chloroplast inner membrane. Mutant leaves accumulate trigalactosyldiacylglycerol, triacylglycerol and phosphatidate. Chloroplast lipids are altered in their fatty acid composition and as a consequence the development of chloroplasts in the mutants are impacted. The mutant seeds has a higher abortion rate. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
AT3G20320 | Encodes a permease-like component of an ABC transporter involved in lipid transfer from ER to chloroplast. A phosphatidic acid-binding protein with a predicted mycobacterial cell entry domain. It is tethered to the inner chloroplast envelope membrane facing the outer envelope membrane. Presumed bacterial orthologs of TGD1 and TGD2 in Gram-negative bacteria are typically organized in transcriptional units, suggesting their involvement in a common biological process. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
AT1G03905 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G10670 | One of the three genes encoding subunit A of the trimeric protein ATP Citrate Lyase. Antisense ACLA-1 plants cause a reduction in cytosolic acetyl-CoA metabolism and have upregulation of stress-related genes and down-regulation of primary metabolism and growth genes, suggesting the mutation restricts normal growth and developmental processes and puts the plant into a state of stress. |
AT1G60810 | One of the three genes encoding subunit A of the trimeric enzyme ATP Citrate lyase |
AT3G19160 | Encodes cytokinin synthase. |
AT5G51050 | Encodes an APC isoform in Arabidopsis, a calcium-dependent mitochondrial ATP-Mg/Pi transporter. |
AT4G18980 | Encodes a nuclear-targeted protein AtS40-3 that modulates senescence associated gene expression. |
AT5G48520 | Encodes AUGMIN subunit3 (AUG3), a homolog of animal dim gamma-tubulin 3/human augmin-like complex, subunit 3. Plays a critical role in microtubule organization during plant cell division. |
AT2G32980 | HAUS augmin-like complex subunit;(source:Araport11) |
AT5G38880 | HAUS augmin-like complex subunit;(source:Araport11) |
AT3G21180 | one of the type IIB calcium pump isoforms. encodes an autoinhibited Ca(2+)-ATPase that contains an N-terminal calmodulin binding autoinhibitory domain. |
AT2G41560 | Encodes a calmodulin-regulated Ca(2+)-ATPase that improves salt tolerance in yeast. Localized to the vacuole. Lesion mimic phenotype when mutation in the gene is combined with a mutation in ACA11. Lesion mimic phenotype of double knockout can be suppressed by nutritional supplements that increase anion levels (e.g. 15 mM Nitrate, Chloride, or Phosphate). |
AT5G57110 | Arabidopsis-autoinhibited Ca2+ -ATPase, isoform 8, contains all of the characteristic motifs of Ca2+ -transporting P-type Ca2+ -ATPases and is localized to the plasma membrane. |
AT3G13970 | Autophagy protein. |
AT3G18770 | Autophagy protein. |
AT3G62770 | Required for autophagosome formation during nutrient deprivation and senescence, promotes pexophagy during seedling development. |
AT2G44140 | Autophagy protein |
AT3G61710 | Encodes autophagy protein 6 (ATG6), required for pollen germination and plant development. |
AT2G45170 | Involved in autophagy. Under nutrient starvation the protein localizes to autophagosomes. Involved in submergence (hypoxia) tolerance; ethanol induces autophagy. |
AT4G30790 | Encodes autophagy-related 2 (ATG11) |
AT3G49590 | Autophagy protein. |
AT3G61960 | autophagy gene |
AT3G53930 | Protein kinase superfamily protein;(source:Araport11) |
AT2G37840 | Protein kinase superfamily protein;(source:Araport11) |
AT1G75310 | auxin-like 1 protein;(source:Araport11) |
AT4G12780 | Negative regulation of growth and endocytosis, most likely as a result of inhibition of the recruitment of clathrin to endocytic pits. Overexpression inhbits recruitment of clathrin resulting in negative regulation of endocytosis and developmental arrest. |
AT1G21660 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT4G36520 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT5G49980 | auxin F-box protein 5;(source:Araport11) |
AT2G38120 | Encodes an auxin influx transporter. AUX1 resides at the apical plasma membrane of protophloem cells and at highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning. Shoot supplied ammonium targets AUX1 and inhibits lateral root emergence. The mRNA is cell-to-cell mobile. |
AT1G04250 | Transcription regulator acting as repressor of auxin-inducible gene expression. Auxin-inducible AUX/IAA gene. Short-lived nuclear protein with four conserved domains. Domain III has homology to beta alpha alpha dimerization and DNA binding domains. Involved in auxin signaling and is a positive modulator of natural leaf senescence. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. |
AT1G54990 | auxin response mutant (AXR4) The mRNA is cell-to-cell mobile. |
AT1G59750 | Encodes a member of the auxin response factor family. ARFs bind to the cis element 5'-TGTCTC-3' ARFs mediate changes in gene expression in response to auxin. ARF's form heterodimers with IAA/AUX genes. ARF1 enhances mutant phenotypes of ARF2 and may act with ARF2 to control aspects of maturation and senescence.ARF1:LUC and 3xHA:ARF1 proteins have a half-life of ~3-4 hours and their degradation is reduced by proteasome inhibitors. 3xHA:ARF1 degradation is not affected by a pre-treatment with IAA. A nuclear-targeted fusion protein containing the middle region of ARF1 linked to LUC:NLS has a similar half-life to the full-length ARF1:LUC construct. The degradation of 3xHA:ARF1 is not affected in an axr6-3 mutant grown at room temperature, although the degradation of AXR2/IAA7 is slowed under these conditions. |
AT2G28350 | Involved in root cap cell differentiation. |
AT1G34310 | auxin response factor 12;(source:Araport11) |
AT1G19220 | Encodes an auxin response factor that contains the conserved VP1-B3 DNA-binding domain at its N-terminus and the Aux/IAA-like domains III and IV present in most ARFs at its C-terminus. The protein interacts with IAA1 (yeast two hybrid) and other auxin response elements such as ER7 and ER9 (yeast one hybrid). ARF19 protein can complement many aspects of the arf7 mutant phenotype and , together with ARF7, is involved in the response to ethylene. In the arf7 arf19 double mutant, several auxin-responsive genes (e.g. IAA5, LBD16, LBD29 and LBD33) are no longer upregulated by auxin. |
AT1G35240 | auxin response factor 20;(source:Araport11) |
AT1G30330 | Encodes a member of the auxin response factor family. Mediates auxin response via expression of auxin regulated genes. Acts redundantly with ARF8 to control stamen elongation and flower maturation. Expression of ARF6 is controlled by miR167. |
AT4G23980 | Encodes auxin response factor 9 (ARF9). The mRNA is cell-to-cell mobile. |
AT1G22220 | F-box family protein;(source:Araport11) |
AT2G34680 | isolated from differential screening of a cDNA library from auxin-treated root culture. sequence does not show homology to any known proteins and is predicted to be extracellular. |
AT5G13160 | Mutant is defective in perception of Pseudomonas syringae avirulence gene avrPphB. Encodes a putative serine-threonine kinase. |
AT5G13320 | Encodes an enzyme capable of conjugating amino acids to 4-substituted benzoates. 4-HBA (4-hydroxybenzoic acid) and pABA (4-aminobenzoate) may be targets of the enzyme in Arabidopsis, leading to the production of pABA-Glu, 4HBA-Glu, or other related compounds. This enzyme is involved in disease-resistance signaling. It is required for the accumulation of salicylic acid, activation of defense responses, and resistance to Pseudomonas syringae. Salicylic acid can decrease this enzyme's activity in vitro and may act as a competitive inhibitor. Expression of PBS3/GH3.12 can be detected in cotyledons, true leaves, hypocotyls, and occasionally in some parts of roots from 10-day-old seedlings. No expression has been detected in root, stem, rosette or cauline leaves of mature 4- to 5-week-old plants. |
AT3G28930 | avrRpt2-induced gene that exhibits RPS2- and avrRpt2-dependent induction early after infection with Pseudomonas syringae pv maculicola strain ES4326 carrying avrRpt2 |
AT2G32410 | Involved in chiasma distribution, affects expression of key DNA repair and meiotic genes, signifcant role in DNA repair. |
AT3G10960 | Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2). |
AT3G21150 | Encodes a protein with a B-box domain predicted to act as a transcription factor. Expression of the BBX32 gene is affected by monochromatic red light. Genetic analysis shows BBX32 is under circadian control; it is a morning gene under clock regulation. |
AT4G34700 | Encodes the B22 subunit of eukaryotic mitochondrial Complex I. Mutation in the gene display pleiotropic phenotypes including shorter roots, smaller plants and delayed flowering. The mRNA is cell-to-cell mobile. |
AT1G16270 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
AT3G23750 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G28450 | Negative regulator of pattern-triggered immunity in complex with BIR3 and PLDγ1. |
AT1G69990 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G35260 | CAAX protease self-immunity protein;(source:Araport11) |
AT5G15160 | BNQ2 belongs to a family of atypical non-DNA binding basic helix-loop-helix (bHLH) proteins that heterodimerize with and negatively regulate bHLH transcription factors. Directly and negatively regulated by AP3 and PI in petals.Required for appropriate regulation of flowering time. |
AT5G65700 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM2,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM1 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. The mRNA is cell-to-cell mobile. |
AT4G20270 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. The mRNA is cell-to-cell mobile. |
AT4G15370 | Encodes an oxidosqualene cyclase that primarily produces the tetracyclic triterpene baruol in vitro and when expressed in yeast. It can also make 22 other minor triterpenoid products with varying numbers of rings. |
AT4G29100 | Member of basic helix loop helix protein family. Expressed primarily in vascular system. Overexpression causes ABA sensitivity. Together with PFA1 and PFA2 governs the competence of pericycle cells to initiate lateral root primordium formation. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT2G31210 | Encodes a bHLH transcription factor that together with bHLH089 and bHLH010 is important for the normal transcriptome of the developing Arabidopsis anther, possibly by forming a feed-forward loop with DYT1. |
AT3G23210 | bHLH34 is a basic helix loop helix transcription factor. It can bind GAGA and E-box cis elements.It is induced by abiotic stressors including ABA, salt and glucose. PGR, a plasma membrane glucose responsive regulator is a target of bHLH34. Involved in Fe regulation. |
AT3G56970 | Encodes a member of the basic helix-loop-helix transcription factor family protein. |
AT3G51960 | bZIP transcription factor induced by salt stress and promoted salt tolerance. Localized to the cytoplasm and nucleus under control conditions and targeted preferentially to the nucleus under salt stress |
AT3G54620 | bZIP transcription factor-like protein mRNA |
AT5G24800 | Encodes bZIP protein BZO2H2. |
AT5G49450 | Encodes a transcription activator is a positive regulator of plant tolerance to salt, osmotic and drought stresses. |
AT2G18160 | Encodes a b-ZIP transcription factor. |
AT5G15830 | basic leucine-zipper 3;(source:Araport11) |
AT2G21230 | bZIP30 is a transcriptional activator that is involved in regulation of growth and development of reproductive organs. It interacts with a number of developmental regulators including WUS, HEC1, KNAT1/BP, KNAT2, JAB, BEL1, and NGA1. |
AT2G13150 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
AT1G59530 | basic leucine-zipper 4;(source:Araport11) |
AT1G75390 | basic leucine-zipper 44;(source:Araport11) |
AT2G22850 | basic leucine-zipper 6;(source:Araport11) |
AT1G06070 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
AT2G38160 | hypothetical protein;(source:Araport11) |
AT1G27850 | Encodes a microtubule-associated protein involved in cortical microtubule organization during leaf development. |
AT3G08670 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
AT3G51540 | mucin-5AC-like protein;(source:Araport11) |
AT2G17770 | Encodes a paralog of bZIP transcription factor FD. This protein interacts with FD and FT. |
AT1G32150 | Encodes a G group bZIP transcription factor family member that can bind cis elements with an ACGT core, such as G-box, Hex, C-box and As-1. The protein is localized in the nucleus and can homodimerize and can heterodimerize with other G group members. |
AT2G44330 | RING/U-box superfamily protein;(source:Araport11) |
AT3G15690 | Single hybrid motif superfamily protein;(source:Araport11) |
AT3G56130 | biotin/lipoyl attachment domain-containing protein;(source:Araport11) |
AT5G52060 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
AT4G02660 | Beige/BEACH and WD40 domain-containing protein;(source:Araport11) |
AT1G58230 | binding protein;(source:Araport11) |
AT4G08540 | One of a pair of paralogs (the other is AT1G77890)that is a subunit of the lass III phosphatidylinositol 3-kinase (PI3K) complex,but is not essential for PI3P biosynthesis. |
AT2G35940 | Encodes a member of the BEL-like homeodomain protein family. Ecotopic expression in the embryo sac leads to defects in nuclear migration and cellularization and embryo sacs with multiple egg cells. Loss of function alleles have no female gametophyte defects. The ecotopic expression phenotype requires KNAT3 because it can be suppressed by loss of KNAT3 function alleles. Localized to the nucleus but interaction with OFP1 relocates it to the cytoplasm. |
AT1G75410 | BEL1-like homeodomain 3 (BLH3) |
AT2G27220 | BEL1-like homeodomain 5;(source:Araport11) |
AT2G16400 | BEL1-like homeodomain 7;(source:Araport11) |
AT2G27990 | Encodes a BEL1-like homeobox gene that functions together with PNY in meristem maintenance by regulating the allocation process during vegetative and reproductive development. Both gene products are required for the competence of the SAM to respond properly to floral inductive signals. |
AT5G41410 | Homeodomain protein required for ovule identity.Loss of function mutations show homeotic conversion of integuments to carpels.Forms heterodimers with STM and KNAT1. Interacts with AG-SEP heterodimers is thought to restrict WUS expression. BEL interacts with MADS box dimers composed of SEP1(or SEP3) and AG, SHP1, SHP2 and STK. The interaction of BEL1 with AG-SEP3 is required for proper integument development and specification of integument identity. |
AT1G69010 | Encodes BES1-INTERACTING MYC-LIKE 2 (BIM2), a PAR1 (PHYTOCHROME RAPIDLY REGULATED 1)-interacting protein that positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
AT5G08130 | Encodes a basic helix-loop-helix (bHLH) family protein BIM1 (BES1-INTERACTING MYC-LIKE 1), involved in brassinosteroid signaling. It synergistically interacts with BES1 to bind to E box sequences (CANNTG). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
AT3G50750 | BES1/BZR1 homolog 1;(source:Araport11) |
AT3G61320 | Encodes a bestrophin-like protein (Best1). Located in the stroma thylakoid membrane. Functions as a chloride ion channel. Proposed to modulate proton motive force partitioning by mediating chloride ion influx in the thylakoid lumen. Major isoform (based on transcript analysis), redundant function with AtBest2. |
AT1G70410 | Encodes a putative beta-carbonic anhydrase betaCA4. Together with betaCA1 (At3g01500) regulates CO2-controlled stomatal movements in guard cells, as well as attenuates immunity. Differential CA gene expression in response to changing atmospheric CO2 conditions contribute to altered disease resistance levels. |
AT1G58180 | beta carbonic anhydrase 6;(source:Araport11) |
AT2G32810 | putative beta-galactosidase |
AT5G42260 | beta glucosidase 12;(source:Araport11) |
AT2G44450 | beta glucosidase 15;(source:Araport11) |
AT1G52400 | encodes a member of glycosyl hydrolase family 1, located in inducible ER bodies which were formed after wounding, required in inducible ER body formation The mRNA is cell-to-cell mobile. |
AT3G03640 | Encodes beta-glucosidase (GLUC). |
AT2G44460 | Beta-glucosidase, major myrosinase which initiates sulfur reallocation by hydrolyzing particular GL species, conferring sulfur deficiency tolerance, especially during early development. |
AT5G24540 | beta glucosidase 31;(source:Araport11) |
AT1G26560 | beta glucosidase 40;(source:Araport11) |
AT5G36890 | beta glucosidase 42;(source:Araport11) |
AT1G60270 | beta glucosidase 6;(source:Araport11) |
AT3G62750 | Encodes a putative beta glucosidase, expressed in the peroxisome. |
AT3G52060 | Encodes a plasmodesmal glycosyltransferase-like protein. Mutation results in defects in seed germination and delayed plant growth. |
AT4G00490 | Encodes a chloroplast beta-amylase. The enzyme activity is very weak compared to BAM1 and BAM3. It forms a tetramer whose activity requires K+ and exhibits sigmoidal kinetics Mutants of BAM2 have no visible phenotype. |
AT5G45300 | Encodes a beta-amylase-like protein present in the nucleus rather than targeted to the chloroplast. Contains BRASSINAZOLE RESISTANT1 (BZR1)-type DNA binding domains. Activates gene expression in protoplast transactivation assays. |
AT2G32290 | beta-amylase 6;(source:Araport11) |
AT1G78950 | Terpenoid cyclases family protein;(source:Araport11) |
AT5G63810 | member of Glycoside Hydrolase Family 35 |
AT4G26140 | putative beta-galactosidase |
AT4G38590 | putative beta-galactosidase (BGAL14 gene) |
AT1G45130 | beta-galactosidase 5;(source:Araport11) |
AT1G61810 | beta-glucosidase 45;(source:Araport11) |
AT4G21760 | beta-glucosidase 47;(source:Araport11) |
AT5G65940 | hydrolyzes beta-hydroxyisobutyryl-CoA |
AT4G25700 | Converts beta-carotene to zeaxanthin via cryptoxanthin. |
AT1G67730 | Encodes one of the two Arabidopsis homologues to YBR159w encoding a S. cerevisiae beta-ketoacyl reductase (KCR), which catalyzes the first reduction during VLCFA (very long chain fatty acids, >18 carbon) elongation: KCR1 (At1g67730), KCR2 (At1g24470). Complementation of the yeast ybr159Delta mutant demonstrated that the two KCR proteins are divergent and that only AtKCR1 can restore heterologous elongase activity similar to the native yeast KCR gene. The mRNA is cell-to-cell mobile. |
AT5G49360 | Encodes a bifunctional {beta}-D-xylosidase/{alpha}-L-arabinofuranosidase required for pectic arabinan modification. Located in the extracellular matrix. Gene is expressed specifically in tissues undergoing secondary wall thickening. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
AT5G09730 | Encodes a protein similar to a beta-xylosidase located in the extracellular matrix. It is able to degrade terminal arabinosyl residues and likely participates in the in-vivo hydrolysis of arabinan. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
AT2G01170 | Encodes a bidirectional amino acid transporter that can transport ala, arg, glu and lys, GABA but not pro with both export and import activity. Its expression is localized in the vascular tissues suggesting a function in amino acids export from the phloem into sink tissue. |
AT1G19660 | Wound-responsive family protein;(source:Araport11) |
AT3G02260 | Calossin-like protein required for polar auxin transport. Involved in regulating sugar response and C/N balance. |
AT1G54200 | DNA mismatch repair Msh6-like protein;(source:Araport11) |
AT3G60860 | Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking. The mRNA is cell-to-cell mobile. |
AT4G12030 | Required for the biosynthesis of methionine-derived glucosinolates. Involved in the transport of 2-keto acids between chloroplasts and the cytosol. |
AT1G78560 | Chloroplast inner membrane, pantothenate transporter. |
AT2G26900 | Sodium Bile acid symporter family;(source:Araport11) |
AT3G29185 | Encodes a chloroplast protein that interacts with the CF1β, γ, and ε subunits of the chloroplast ATP synthase and is required for assembly of its F1 module. The protein is comprised primarily of two β-barrels and acts as a chaperone orchestrating the early steps of the CF1 assembly pathway via specific interaction with the CF1 β, γ, and ε subunits. |
AT3G23980 | Encodes a protein that interacts with the Polycomb-group (Pc-G) histone methyltransferase CLF (CURLY LEAF). It colocalizes with CLF to the nucleus and represses a subset of Pc-G target genes. The pleiotropic developmental mutant phenotype suggests that BLI prevents premature differentiation. |
AT4G14480 | Encodes a putative Ser/Thr protein kinase, BLUS1 (BLUE LIGHT SIGNALING1). BLUS1 functions as a phototropin substrate and primary regulator of stomatal control to enhance photosynthetic CO2 assimilation under natural light conditions. |
AT4G18950 | BHP1 is a Raf-like protein kinase involved in mediating blue light dependent stomatal opening. |
AT3G52740 | Plant specific protein.BIC1 and BIC2 inhibit cryptochrome function by blocking blue light-dependent cryptochrome dimerization.Light activated transcription of BICs is mediated by cryptochromes. |
AT3G44450 | Plant specific protein.BIC1 and BIC2 inhibit cryptochrome function by blocking blue light-dependent cryptochrome dimerization.Light activated transcription of BICs is mediated by cryptochromes. |
AT1G14580 | C2H2-like zinc finger protein;(source:Araport11) |
AT5G45100 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
AT1G79110 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
AT1G73177 | The BONSAI gene encodes a protein with similarity to the APC13 component of the Anaphase Promoting Complex. Plants with lowered level of BONSAI expression, resulting from hypomethylation, RNAi knock-down, or a T-DNA insertion show some abnormalities in shoot and inflorescence development. |
AT5G61900 | Encodes a plasma-membrane localized, copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Mutants exhibit temperature-sensitive growth defects and increased hypersensitive response where permissive conditions are low temperature (22 degrees Celsius) and low humidity. Gene is expressed at 22 but not at 28 (restrictive condition) degrees. Lethality of double mutants with BON3 can be partially suppressed by SNC1. Double mutants show defects in development that are genetically separable from hypersensitive/cell death response. |
AT1G08860 | Encodes a copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Overexpression of this gene suppresses bon1-1 phenotypes. Double mutant analyses with bon1-1 suggest that BON1 and BON3 have overlapping functions in maintaining cellular homeostasis and inhibiting cell death. |
AT4G39630 | translation initiation factor;(source:Araport11) |
AT1G79420 | C-type mannose receptor (DUF620);(source:Araport11) |
AT1G49840 | glutamyl-tRNA (Gln) amidotransferase subunit A (DUF620);(source:Araport11) |
AT5G05840 | replication factor C subunit, putative (DUF620);(source:Araport11) |
AT1G67950 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
AT5G32450 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
AT1G73830 | Encodes the brassinosteroid signaling component BEE3 (BR-ENHANCED EXPRESSION 3). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
AT2G46020 | Encodes a SWI/SNF chromatin remodeling ATPase that upregulates transcription of all three CUC genes and is involved in the formation and/or maintenance of boundary cells during embryogenesis. Also mediates repression of expression of seed storage proteins in vegetative tissues. Interacts strongly with AtSWI3C, also with AtSWI3B, but not with AtSWI3A or AtSWI3D. |
AT3G03460 | One of two paralogous GLTSCR domain containing proteins and a core component of SWI/SNF complexes. Interacts with BRM and may be responsible for ensuring proper complex assembly and association with chromatin. Function is dependent upon the GLTSCR domain. |
AT5G17510 | mediator of RNA polymerase II transcription subunit-like protein;(source:Araport11) |
AT1G10070 | Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. Involved in cell wall development. |
AT1G50090 | D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein;(source:Araport11) |
AT2G42160 | Encodes a RING domain containing protein BRIZ1. BRIZ1 (At2g42160) and BRIZ2 (At2g26000) proteins form a heteromeric E3 ligase complex required for seed germination and post-germination growth. |
AT2G26000 | Encodes a RING domain containing protein BRIZ2. BRIZ1 (At2g42160) and BRIZ2 (At2g26000) proteins form a heteromeric E3 ligase complex required for seed germination and post-germination growth. |
AT5G11400 | Psuedokinase that appears to produce a truncated (42AA protein) in Col-0 reference genome. Full length transcripts have been identified in Hh-0, Västervik and Dju-1 ecotypes. |
AT5G11360 | Interleukin-1 receptor-associated kinase 4 protein;(source:Araport11) |
AT3G30180 | Encodes a cytochrome p450 enzyme that catalyzes the last reaction in the production of brassinolide. It is capable of converting 6-deoxocastasterone into castasterone, a C-6 oxidation, as well as the further conversion of castasterone into brassinolide by a Baeyer-Villinger oxidation reaction at C-6, resulting in the formation of an unusual seven-membered lactone ring. The enzyme possesses high affinity for both C28- and C27-Brassinosteroids. The expression of the gene using a CYP85A2 promoter:LUC fusion construct was shown to be under circadian and light control. |
AT4G18710 | Encodes BIN2, a member of the ATSK (shaggy-like kinase) family. BIN2 functions in the cross-talk between auxin and brassinosteroid signaling pathways. BIN2 regulates root epidermal cell fate specification by phosphorylating EGL3 and TTG1. BIN2-mediated phosphorylation appears to promote BZR1 export from the nucleus. KIB1 interacts with BIN2 blocking its interaction with substrates and promotes BIN2 degradation. |
AT5G24630 | This gene is predicted to encode a protein that forms part of the topoisomerase VI complex. BIN4 is a nuclear-localized protein that can bind DNA. bin4 mutants are brassinolide-insensitive dwarves with severely reduced cell size in leaves, roots, and hypocotyls. Proper development of root hairs and trichomes is also disrupted in bin4 mutants and they have elevated levels of double strand breaks in their cotyledon cells. |
AT5G46570 | Encodes BR-signaling kinase 2 (BSK2), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
AT5G59010 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
AT1G63500 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
AT3G09240 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
AT3G15120 | Encodes BRP1, an ATPase domain-containing protein that interacts with BRAT1 to negatively regulate transcriptional silencing at methylated genomic regions. |
AT1G80210 | Mov34/MPN/PAD-1 family protein;(source:Araport11) |
AT4G21070 | Encodes AtBRCA1, an ortholog of the human breast cancer susceptibility gene 1. Contains one N-terminal RING finger, two C-terminal BRCT and the p300/CBP interacting domain. Strongly induced by gamma rays, consistent with a putative role in DNA repair and in cell cycle control. |
AT1G54180 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
AT5G20540 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
AT4G03080 | Protein phosphatase which promotes stomatal ACD by establishing kinase-based signalling asymmetry in the two daughter cells. |
AT1G08420 | Protein phosphatase which promotes stomatal ACD by establishing kinase-based signalling asymmetry in the two daughter cells. |
AT2G27210 | Protein phosphatase which promotes stomatal ACD by establishing kinase-based signalling asymmetry in the two daughter cells. |
AT2G01950 | Encodes a leucine rich repeat receptor kinase and associated with provascular/procambial cells. Similar to BRI, brassinosteroid receptor protein. |
AT5G65090 | Encodes a protein involved in root hair morphogenesis and tip growth. Required for restricting both the size of the root-hair initiation site and the width of the root hairs during the transition to tip growth, but, apparently, is not required for normal subsequent tip growth. |
AT1G20670 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
AT5G55040 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
AT1G76380 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
AT5G62040 | BFT is a member of The FLOWERING LOCUS T (FT)/TERMINAL FLOWER 1 (TFL1) gene family that encodes regulators involved in control of flower development. |
AT5G59570 | Encodes BOA (BROTHER OF LUX ARRHYTHMO), a component of the circadian clock. The mRNA is cell-to-cell mobile. |
AT3G18290 | Encodes BRUTUS (BTS), a putative E3 ligase protein with metal ion binding and DNA binding domains, which negatively regulates the response to iron deficiency. The mRNA is cell-to-cell mobile. |
AT1G74770 | zinc ion binding protein;(source:Araport11) |
AT5G63160 | BTB and TAZ domain protein. Short-lived nuclear-cytoplasmic protein targeted for degradation by the 26S proteosome pathway. Acts redundantly with BT2 and BT3 during female gametophyte development. |
AT4G37610 | BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves. |
AT5G19000 | Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). |
AT1G50280 | BTB/POZ protein that forms a complex with CUL3a. Involved in repression of ABA responses. |
AT3G19590 | Encodes a protein that may have a role in the spindle assembly checkpoint. |
AT5G04480 | Encodes a protein with sequence similarity to glycosyltransferases that is localized to the golgi apparatus and is involved in pollen tube development. |
AT3G17590 | Encodes the Arabidopsis homologue of yeast SNF5 and represents a conserved subunit of plant SWI/SNF complexes. |
AT1G01550 | Encodes a protein with no functionally characterized domains that to prevent the synthesis of a novel substance that moves from the root to the shoot, where it modifies shoot growth by interfering with auxin signaling. Synthesis and delivery of this substance requires neither phloem nor endodermis. |
AT4G25490 | Transcriptional activator that binds to the DRE/CRT regulatory element and induces COR (cold-regulated) gene expression increasing plant freezing tolerance. It encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. |
AT4G25470 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature, abscisic acid, and circadian rhythm. Overexpressing this gene leads to increased freeze tolerance and induces the expression level of 85 cold-induced genes and reduces the expression level of 8 cold-repressed genes, which constitute the CBF2 regulon. Mutations in CBF2 increases the expression level of CBF1 and CBF3, suggesting that this gene may be involved in a negative regulatory or feedback circuit of the CBF pathway. |
AT2G40790 | Encodes a monocysteinic thioredoxin, thioredoxin in which the second cysteine of the redox site is replaced by a serine, with low disulfide reductase but efficient disulfide isomerase activity. It contains a large N-terminal extension with respect to the dicysteinic thioredoxins that is enriched with 8 cysteines and positively charged residues. |
AT2G33540 | C-terminal domain phosphatase-like 3;(source:Araport11) |
AT3G19600 | Encodes a Ser-2-specific RNAPII CTD phosphatase with two tandem-repeated CTD phosphatase domains that belongs to the group III CTD phosphatase-like (CPL) family. It positively regulates ABA and drought responses. |
AT2G23440 | transmembrane protein;(source:Araport11) |
AT3G50610 | DNA-directed RNA polymerase II subunit RPB1-like protein;(source:Araport11) |
AT3G17980 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT1G48590 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT1G73580 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT5G55990 | Encodes a member of the Arabidopsis CBL (Calcineurin B-like Calcium Sensor) protein family. |
AT1G64480 | calcineurin B-like protein 8, member of plant-specific family of calcium sensor proteins containing 3 EF-hand motifs |
AT4G32820 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G37640 | Encodes a calmodulin-regulated Ca(2+)-pump located in the endoplasmic reticulum. Belongs to plant 2B ATPase's with an N-terminal autoinhibitor. |
AT5G04870 | A calcium-dependent protein kinase that can phosphorylate phenylalanine ammonia lyase (PAL), a key enzyme in pathogen defense.Phosphorylates, in vivo, the transcription factor ORE1, a master regulator of senescence. |
AT3G51850 | member of Calcium Dependent Protein Kinase The mRNA is cell-to-cell mobile. |
AT5G19450 | calcium-dependent protein kinase (CDPK19) mRNA, complete |
AT1G35670 | Encodes a Ca(2+)-dependent, calmodulin-independent protein kinase that is rapidly induced by drought and high-salt stress but not by low-temperature stress or heat stress. Positive regulator of ABA signaling. Phosphorylates ABA responsive transcription factors ABF1 and ABF4. |
AT2G38910 | member of Calcium Dependent Protein Kinase |
AT4G04740 | member of Calcium Dependent Protein Kinase |
AT2G35890 | member of Calcium Dependent Protein Kinase |
AT4G38230 | member of Calcium Dependent Protein Kinase |
AT5G54590 | Splice variant At5g54590.2 encodes CRLK1 (440-amino acid in length) calcium/calmodulin-regulated receptor-like kinase crucial for cold tolerance. CRLK1 is Primarily localized in the plasma membrane. |
AT1G06490 | Encodes Callose Synthase 7 (CalS7), a phloem-specific callose synthase responsible for callose deposition in developing sieve elements during phloem formation and in mature phloem induced by wounding. |
AT3G56800 | encodes a calmodulin |
AT1G66410 | encodes a calmodulin |
AT5G21274 | Encodes a calmodulin isoform. Expressed in leaves. |
AT3G25600 | Calmodulin like protein. Paralog of CML15. |
AT1G66400 | Encodes a calmodulin-like protein. Regulates nitric oxide levels and transition to flowering. |
AT1G76640 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT4G35987 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G62570 | Calmodulin binding protein-like protein;(source:Araport11) |
AT5G58940 | Arabidopsis thaliana calmodulin-binding receptor-like kinase mRNA The mRNA is cell-to-cell mobile. |
AT4G16150 | CATMA5 is a transcriptional activator. It acts in the cold response pathway, it can bind to and activate the expression of DREB1 genes. |
AT3G16940 | Calmodulin binding transcription factor. Mutants display increased salt tolerance during early germination. Involved in regulation of salt stress responsive genes. |
AT4G35310 | calmodulin-domain protein kinase CDPK isoform 5 (CPK5) |
AT3G10660 | predicted to encode calcium-dependent protein kinase and is localized to the ER. Protein is myristoylated in a cell-free extract. Changing the proposed myristoylated site, G residue in the amino terminal, to A prevented the meristoylation . The G to A mutation decreased AtCPK2 membrane association by approximately 50%. |
AT1G08450 | Encodes one of three Arabidopsis calreticulins. In CRT-deficient mouse fibroblasts, this protein restores ER Ca2+ levels. Non-receptor component required for EFR-mediated immunity. Mutants show de-repressed anthocyanin accumulation in the presence of elf18, and EFR accumulation and signalling. |
AT3G56690 | encodes a protein similar to ATPases and binds to calmodulin in vitro. This is a single-copy gene and is expressed in all tissues examined. |
AT1G04260 | Encodes protein that interacts with CaMV movement protein. Colocalizes in the cytoplasm with the movement protein. Has similarity to mammalian proteins (such as the rat PRA1) which have been described as rab acceptors. |
AT5G18520 | Encodes a candidate G-protein Coupled Receptor that is involved in the regulation of root growth by bacterial N-acyl-homoserine lactones (AHLs) and plays a role in mediating interactions between plants and microbes. The mRNA is cell-to-cell mobile. |
AT2G46410 | Nuclear-localized R3-type MYB transcription factor. Positive regulator of hair-cell differentiation. Preferentially transcribed in hairless cells. Moves from atrichoblasts into trichoblast via plasmodesmata in a tissue-specific mode. N-terminus and part of the Myb domain are required for this movement, with W76 playing a crucial role. Capability to increase the size-exclusion limit of plasmodesmata. Regulated by WEREWOLF. |
AT1G29900 | Encodes carbamoyl phosphate synthetase (CPS) large subunit (CARB), also named as VEN3. Heterologous expression of the Arabidopsis VEN3 and VEN6 genes in a CPS-deficient Escherichia coli strain fully restored bacterial growth in minimal medium, demonstrating the enzymatic activity of the VEN3 and VEN6 proteins. |
AT1G49660 | Encodes a protein with carboxylesterase whose activity was tested using pNA. |
AT3G07370 | Encodes AtCHIP, a new class of E3 ubiquitin ligases with three tetratricopeptide repeats and a U-box domain, structurally similar to the animal CHIP proteins. Plays an important role in plant cellular metabolism under temperature stress conditions. Functions as an E3 ubiquitin ligase of protein phosphatase 2A subunits and alters plant response to abscisic acid treatment. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT5G01270 | Encodes CPL2, a carboxyl-terminal domain (CTD) phosphatase that dephosphorylates CTD Ser5-PO4 of the RNA polymerase II complex. Regulates plant growth, stress and auxin responses. |
AT2G44990 | More Axillary Branching; carotenoid cleavage dioxygenases. |
AT1G80000 | CASC3/Barentsz eIF4AIII binding protein;(source:Araport11) |
AT4G26100 | Encodes a member of the casein kinase 1 protein family that is expressed in punctate particles at the cell periphery suggesting possible plasmodesmatal localization (member of CKL-B group). |
AT1G72710 | Encodes a member of the casein kinase 1 protein family that is localized to the cytoplasm and nucleus. The mRNA is cell-to-cell mobile. |
AT3G23340 | Member of CKL gene family (CKL-C group). |
AT4G28540 | Member of CKL gene family (CKL-C group). |
AT5G47080 | Regulatory subunit beta of casein kinase II (CK2). purified CKB1 resulted in up 100-fold stimulation of casein kinase activity compared with the CKA1 activity alone. Forms a tetrameric complex with CKA1 (CKA1(2)CKB1(2)). One known substrate of CK2 is Phytochrome Interacting Factor 1 (PIF1). CK2-mediated phosphorylation enhances the light-induced degradation of PIF1 to promote photomorphogenesis. |
AT3G60250 | Regulatory (beta) subunit of the protein kinase CK2. Involved in regulation of the circadian clock in Arabidopsis |
AT5G15450 | Encodes a chloroplast-targeted Hsp101 homologue. Functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. APG6 expression is upregulated in response to heat shock in various organs, but not in response to other abiotic stresses. Apg6 mutants have a pale-green phenotype. |
AT4G20390 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT4G03540 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT4G15630 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT4G15620 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT4G25040 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT3G14380 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT5G62820 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT2G36330 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT4G11655 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT3G55390 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT2G28370 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT5G02060 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT4G37235 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT1G49405 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT3G11550 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT4G35600 | Encodes a receptor-like cytoplasmic kinase that acts as a spatial inhibitor of cell separation. Analysis of the cDNA previously described in Meiners et al., 1991 revealed mistakes in the predicted open reading frame. The mRNA is cell-to-cell mobile. |
AT5G11350 | Deadenylase. |
AT1G31530 | Deadenylase. |
AT1G20630 | Catalyzes the reduction of hydrogen peroxide using heme group as cofactor. Protects cells from toxicity by H2O2. |
AT1G20620 | Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen. The mRNA is cell-to-cell mobile. |
AT1G54115 | Involved in cation (Na and K) homeostasis. |
AT2G38170 | Encodes a high affinity vacuolar calcium antiporter. The residue His 338 is critical to Ca2+ transport activity. Disruption of CAX1 reduces manganese and zinc of shoot tissue and results in a decrease in the activity of vacuolar V-type proton ATPase. |
AT3G13320 | low affinity calcium antiporter CAX2 The mRNA is cell-to-cell mobile. |
AT1G30450 | member of Cation-chloride co-transporter family |
AT3G44930 | member of Putative Na+/H+ antiporter family |
AT3G44910 | member of Putative Na+/H+ antiporter family |
AT5G41610 | member of Putative Na+/H+ antiporter family |
AT1G79400 | member of Putative Na+/H+ antiporter family |
AT3G53720 | member of Putative Na+/H+ antiporter family. Involved in the osmoregulation through K(+) fluxes and possibly pH modulation of an active endomembrane system in guard cells. |
AT5G01680 | member of Putative Na+/H+ antiporter family |
AT5G01690 | member of Putative Na+/H+ antiporter family |
AT3G44900 | member of Putative Na+/H+ antiporter family |
AT1G08135 | cation/H+ exchanger 6B;(source:Araport11) |
AT2G13620 | member of Putative Na+/H+ antiporter family |
AT1G58030 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Localized to the tonoplast. |
AT5G36940 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. |
AT2G34960 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Mediates efficient uptake of Lys, Arg and Glu in a yeast system. Localized to the plasma membrane. |
AT5G04770 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. Expressed in sink tissues. Induced during infestation of roots by the plant parasitic root-knot nematode, Meloidogyne incognita. Localized in the plasma membrane. |
AT3G10600 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. |
AT1G05940 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. |
AT1G26310 | Floral homeotic gene encoding a MADS domain protein homologous to AP1. Enhances the flower to shoot transformation in ap1 mutants. |
AT3G54900 | A.thaliana PICOT protein.It activates CAX1 gene Calcium transport activity.In other organisms, PICOT proteins appear to play a negative regulatory role in cellular stress responses. |
AT2G38270 | Encodes protein homologous to CXIP1. CXIP1 is a PICOT domain containing protein interacts with CAX1, a high capacity calcium transporter. However, CXP2 does not interact with CAX1 and only moderately activates another calcium transporter CAX4. |
AT1G48260 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.21), which has also been reported as a member of the CBL-interacting protein kinases (CIPK17). |
AT4G18700 | Encodes CBL-interacting protein kinase 12 (CIPK12). |
AT5G01810 | Encodes a CBL-interacting serine/threonine protein kinase, also has similarities to SOS2 kinase. |
AT5G07070 | Encodes CBL-interacting protein kinase 2 (CIPK2). |
AT1G30270 | Arabidopsis thaliana CBL-interacting protein kinase 23. CIPK23 serves as a positive regulator of the potassium transporter AKT1 by directly phosphorylating AKT1. CIPK23 is activated by the binding of two calcineurin B-like proteins, CBL1 and CBL9. The mRNA is cell-to-cell mobile. |
AT5G25110 | salt- and anoxia-induced member of AtCIPK family. |
AT4G14580 | CBL-interacting protein kinase |
AT3G23000 | Encodes a serine/threonine protein kinase with similarities to CBL-interacting protein kinases, SNF1 and SOS2. The mRNA is cell-to-cell mobile. |
AT1G01140 | Encodes a CBL-interacting protein kinase with similarity to SOS2 |
AT4G27460 | Cystathionine beta-synthase (CBS) family protein;(source:Araport11) |
AT1G65320 | Cystathionine beta-synthase (CBS) family protein;(source:Araport11) |
AT2G16940 | Splicing factor which interacts with IRR and SR45 to mediate pre-mRNA splicing to facilitate protein function, however not contributing to target specificity. |
AT3G18480 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component, known as a golgin in mammals and yeast. A fluorescently-tagged version of CASP co-localizes with Golgi markers, and this localization appears to require the C-terminal (565?689aa) portion of the protein. The protein is inserted into a membrane in a type II orientation. |
AT2G33590 | Encodes a protein with homology to members of the dihydroflavonol-4-reductase (DFR) superfamily. The expression pattern of AtCRL1 indicates that CRL1 has a role in embryogenesis and seed germination. AtCRL1 is induced by ABA, drought and heat, and is highly expressed in seeds. The mRNA is cell-to-cell mobile. |
AT1G27890 | Deadenylase. |
AT5G39420 | CDC2C;(source:Araport11) |
AT4G28980 | Encodes a CDK-activating kinase that regulates root initial cell differentiation. Phosphorylates CDKD2 and CDKD3, but not CDKD1. Controls CDK activities and basal transcription. |
AT2G27970 | CDK-subunit 2;(source:Araport11) |
AT1G62430 | Encodes a CDP-diacylglycerol synthase, involved in phospholipid biosynthesis. |
AT3G50530 | CDPK-related kinase |
AT2G41140 | Encodes CDPK-related kinase 1 (CRK1). |
AT2G46700 | CDPK-related kinase 3;(source:Araport11) |
AT5G27080 | No expression of gene detected yet. |
AT3G25100 | Required for normal meiosis, may act in the last round of DNA replication prior to meiosis, sequence similar to yeast CDC45 |
AT3G53230 | CDC48 is induced upon oilseed rape mosaic tobamovirus infection and appears to be involved in controlling virus movement. |
AT2G03670 | CDC48 - like protein AAA-type ATPaseCell. division control protein 48 homolog B |
AT5G23040 | Encodes a protein that enables protochlorophillide's binding to pPORA's transit sequence, regulating pPORA's translocation into the plastid stroma, and blocking movement of the translocating polypeptide chain back into the cytosol. Causes Bax mediated lethality in yeast by generating reactive oxygen species and this effect is suppressed by AtBI-1. |
AT1G17630 | Encodes a PPR protein involved in mitochondrial functioning. Mutants suppress cell wall defects caused by C17 chemical inhibitor. Mutants are defective in cytochrome c maturation and activation of mitochondrial retrograde signalling. |
AT4G32410 | Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. |
AT2G25540 | cellulose synthase |
AT5G09870 | Encodes a cellulose synthase CESA5 that produces seed mucilage cellulose.Mutants are defective in seed coat mucilage.Involved in the regulation of mucilage composition and/or mucilage synthesis. |
AT1G77460 | Encodes a plasma membrane, microtubule associated protein with sequence similarity to CSI1 that is involved in cellulose biosynthesis and cell elongation. A mutation in CSI3 alone do not appear to affect growth but enhances the cell elongation phenotype of CSI1 mutants. CSI3 co localizes with CSI1 and CESA3 and CESA6. |
AT3G56000 | encodes a gene similar to cellulose synthase |
AT1G55850 | encodes a protein similar to cellulose synthase The mRNA is cell-to-cell mobile. |
AT4G23990 | encodes a protein similar to cellulose synthase |
AT2G22125 | Encodes a protein involved in cell elongation in root and anther filaments. Mutants have greater cell volumes in root tissues and have additive phenotypes with other cell expansion mutants such as those carrying mutations in COB, QUI and POM1 loci. POM2/CSI1 promotes Cellulose Synthase and microtubule co-alignment. The mRNA is cell-to-cell mobile. |
AT4G16590 | encodes a gene similar to cellulose synthase |
AT5G22740 | Encodes a beta-mannan synthase based on in vitro enzyme assays from heterologously expressed protein. CSLA2 synthesizes the backbone of galactoglucomannan in seed coat epidermal cells. Both CSLA2 and MUCI10, which may be part of a protein complex, are critical for mucilage architecture. |
AT1G23480 | encodes a gene similar to cellulose synthase |
AT2G32620 | encodes a gene similar to cellulose synthase |
AT2G32530 | encodes a gene similar to cellulose synthase |
AT4G15320 | encodes a gene similar to cellulose synthase |
AT3G03050 | encodes a cellulose synthase like protein. mutations initiate root hairs that rupture at their tip soon after initiation. is required for the synthesis of a noncellulosic wall polysaccharide. |
AT1G32180 | encodes a gene similar to cellulose synthase |
AT5G16910 | encodes a gene similar to cellulose synthase. Located in Golgi membranes. The mRNA is cell-to-cell mobile. |
AT4G07960 | encodes a XyG glucan synthase; gene similar to cellulose synthase |
AT3G28180 | encodes a gene similar to cellulose synthase The mRNA is cell-to-cell mobile. |
AT1G15660 | Encodes a homologue of the human centromeric protein C (CENP-C). CENP-C co-localizes with the 180 bp centromeric regions of chromosomes throughout the cell cycle, but does not completely cover the 180 bp regions. |
AT2G30370 | Encodes a small, potentially secreted protein that acts as an inhibitor of stomatal production though likely not through direct interaction with the TMM receptor. It is homologous to known stomatal regulators EPF1 and EPF2. Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
AT5G20720 | Encodes a chloroplast co-chaperonin with similarity to CPN21 from spinach, E.coli GroES. |
AT5G26360 | TCP-1/cpn60 chaperonin family protein;(source:Araport11) |
AT3G11830 | TCP-1/cpn60 chaperonin family protein;(source:Araport11) |
AT3G03960 | TCP-1/cpn60 chaperonin family protein;(source:Araport11) |
AT1G26230 | Encodes a subunit of chloroplasts chaperonins that are involved in mediating the folding of newly synthesized, translocated, or stress-denatured proteins. Cpn60 subunits are: Cpn60alpha1 (At2g28000), AtCpn60alpha2 (At5g18820), AtCpn60beta1 (At1g55490), AtCpn60beta2 (At3g13470), AtCpn60beta3 (At5g56500), AtCpn60beta4 (At1g26230). |
AT3G62080 | Encodes a charged multi-vesicular body protein (CHMP7) homolog, that is an ESCRT-III-related protein and functions in the endosomal sorting pathway in humans. The Brassica homolog has been shown to be involved in plant growth and leaf senescence. |
AT3G22780 | CHC protein involved in cell cycle progression (positive regulator). |
AT2G30380 | MYB family transcription factor;(source:Araport11) |
AT3G21630 | LysM receptor-like kinase, based on protein sequence alignment analysis, it has a typical RD signaling domain in its catalytic loop and possesses autophosphorylation activity. Involved in the perception and transduction of the chitin oligosaccharide elicitor. Located in the plasma membrane. CERK1 phosphorylates LIK1, a LLR-RLK that is involved in innate immunity, |
AT5G40890 | Encodes a member of the voltage-dependent chloride channel. Also functions as a NO3-/H+ exchanger that serves to accumulate nitrate nutrient in vacuoles. Mutants homozygous for the T-DNA insertion mutation have reduced nitrate uptake capacity in high nitrate environment and exhibit hypersensitivity to chlorate. Role in cytosolic pH homeostasis. |
AT5G49890 | member of Anion channel protein family |
AT1G29910 | member of Chlorophyll a/b-binding protein family |
AT1G54870 | ChlADR is an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. The N-terminal region of this protein directs GFP to the chloroplast where where ChlADR likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation. In addition, this enzyme can also reduce cis-3-hexenal, a major plant volatile compound that contributes to green leaf odor, as well as methylglyoxal in vitro. |
AT2G44650 | Encodes a chloroplast-localized chaperonin 10 whose mRNA is expressed in leaves and stems but not roots. |
AT1G36390 | Chloroplast GrpE protein. |
AT5G49910 | Stromal heat shock protein involved in protein import into chloroplast. The mRNA is cell-to-cell mobile. |
AT2G16800 | Encodes a nuclear-encoded chloroplast protein that plays an important role in vegetative growth, female gametogenesis, and embryogenesis likely by mediating chloroplast integrity and development. |
AT1G35680 | Encodes a chloroplast ribosomal protein L21 that is required for chloroplast development and embryogenesis. The mRNA is cell-to-cell mobile. |
AT2G20020 | Promotes the splicing of chloroplast group II introns. Splices clpP-1 and ropC1 introns. |
AT3G52380 | Encodes a chloroplast RNA-binding protein that stabilizes chloroplast RNAs as evidenced by analyses of transcript accumulation in null mutants. Essential for seedling development (albino, strongly retarded growth even on sucrose-containing medium). |
AT3G63140 | Encodes a protein with ribonuclease activity that is involved in plastid rRNA maturation. |
AT2G25625 | Histone deacetylase-like protein;(source:Araport11). Induced by senescence and abiotic stresses. |
AT5G63060 | Sec14p like protein involved in chloroplast vesicle transport. Required for photoauxotrophic growth. |
AT5G52100 | Is essential for chloroplast NAD(P)H dehydrogenase activity, which is involved in electron transfer between PSII and PSI. Likely functions in biogenesis or stabilization of the NAD(P)H dehydrogenase complex. The mRNA is cell-to-cell mobile. |
AT5G39210 | Encodes a protein of the chloroplastic NAD(P)H dehydrogenase complex (NDH Complex) involved in respiration, photosystem I (PSI) cyclic electron transport and CO2 uptake. The product of this gene appears to be essential for the stable formation of the NDH Complex. The mRNA is cell-to-cell mobile. |
AT1G71697 | Encodes choline kinase. mRNA levels are increased in response to wounding. The mRNA is cell-to-cell mobile. |
AT4G09760 | encodes a choline synthase whose gene expression is induced by high salt and mannitol. |
AT5G66750 | Protein is similar to SWI2/SNF2 chromatin remodeling proteins. DDM1 is appears to act as a chromatin-remodeling ATPase involved in cytosine methylation in CG and non-CG contexts. Involved in gene silencing and maintenance of DNA methylation and histone methylation. Hypomethylation of many genomic regions occurs in ddm1 mutants, and can cause several phenotypic abnormalities, but some loci, such as BONSAI (At1g73177) can be hypermethylated in ddm1 mutants after several generations, leading to different phenotypes. DDM1 might be involved in establishing a heterochromain boundary. A line expressing an RNAi targeted against DDM1 shows some resistance to agrobacterium-mediated root transformation. |
AT1G05490 | Involved in gene silencing. Locus-specific regulator of 24nt-siRNA expression, works together with CLSY1-4 as the master regulators of essentially all Pol-IV-dependent 24nt-siRNAs. |
AT3G24340 | Involved in gene silencing. Locus-specific regulator of 24nt-siRNA expression, works together with CLSY1-3 as the master regulators of essentially all Pol-IV-dependent 24nt-siRNAs. |
AT2G13370 | Chromatin-remodeling factor; has large number of MAPK docking sites (D-sites). |
AT1G80740 | ecotype Kl-0 chromomethylase (CMT1). A plant line expressing an RNAi construct directed against DMT4 has reduced agrobacterium-mediated tumor formation. |
AT4G19020 | Encodes a plant DNA methyltransferase that methylates mainly cytosines in CHH (H = any base but G) contexts. It is involved in heat tolerance. |
AT1G69770 | Encodes a chromomethylase involved in methylating cytosine residues at non-CG sites. Involved in preferentially methylating transposon-related sequences, reducing their mobility. CMT3 interacts with an Arabidopsis homologue of HP1 (heterochromatin protein 1), which in turn interacts with methylated histones. Involved in gene silencing. |
AT1G04730 | Necessary for sister chromatid cohesion. Acts in synergy with ETG1. |
AT3G23690 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G80820 | Encodes an cinnamoyl CoA reductase isoform. Involved in lignin biosynthesis. |
AT4G37970 | cinnamyl alcohol dehydrogenase 6;(source:Araport11) |
AT2G21890 | cinnamyl alcohol dehydrogenase homolog 3;(source:Araport11) |
AT5G58780 | Encodes a novel Z,E-mixed heptaprenyl diphosphate (Z,E-HepPP) synthase, which may be responsible for short-chain betulaprenols. It catalyzes the formation of C 35 short-chain polyisoprenoids in which the optimal allylic substrate was E,E-FPP. It may have a role in response to cold stress in root. |
AT2G23400 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
AT5G58782 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
AT2G42790 | Encodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development. |
AT1G68110 | An ENTH (Epsin NH2 terminal homology)/ANTH/VHS superfamily protein with adenylate cyclase activity and a role in clathrin assembly and endocytosis. |
AT3G11130 | CHC1 heavy chain subunit of clathrin. Involved in vesicle mediated trafficking. Mutants show reduced rates of endocytosis and defects clathrin mediated exocytosis. Mutants also have increased dehydration tolerance which may be related to the overall slower stomatal aperture dynamics. Overall growth is affected. |
AT3G08530 | CHC2 heavy chain subunit of clathrin. Involved in vesicle mediated trafficking. Mutants show reduced rates of endocytosis and defects clathrin mediated exocytosis Mutants have increased drought tolerance due to defects in stomatal movement. |
AT3G51890 | Clathrin light chain protein;(source:Araport11) |
AT1G75820 | Putative receptor kinase with an extracellular leucine-rich domain. Controls shoot and floral meristem size, and contributes to establish and maintain floral meristem identity. Negatively regulated by KAPP (kinase-associated protein phosphatase). CLV3 peptide binds directly CLV1 ectodomain. |
AT1G68795 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT1G70895 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT3G24225 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. Regulates root meristem size in a SCR and SHR-independent pathway. |
AT1G05065 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT5G64800 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT1G06225 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT5G12990 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT2G31083 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT2G31082 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT2G23950 | Encodes an LLR receptor kinase that is expressed in protophloem and is required for CLE peptide sensing in roots. One of a group of LRR-RLKs, designated as CLAVATA3 INSENSITIVE RECEPTOR KINASES (CIKs), that acts as a co-regulator and has essential roles in regulating CLV3-mediated stem cell homeostasis. |
AT5G51660 | cleavage and polyadenylation specificity factor 160;(source:Araport11) |
AT1G30460 | Encodes AtCPSF30, the 30-KDa subunit of cleavage and polyadenylation specificity factor. AtCPSF30 is a probable processing endonuclease. Nucleus-localized RNA binding protein capable of interacting with itself and with calmodulin. Its RNA-binding activity is inhibited by calmodulin in a calcium-dependent fashion. |
AT2G01730 | a homolog of cleavage and polyadenylation specificity factor that plays an essential role in the development of female gametophyte and embryo |
AT1G61010 | cleavage and polyadenylation specificity factor 73-I;(source:Araport11) |
AT1G71800 | RNA 3′-end?processing factor of antisense FLC transcript. Mediates silencing of the floral repressor gene FLC. Member of CstF complex. |
AT4G15560 | Encodes a protein with 1-deoxyxylulose 5-phosphate synthase activity involved in the MEP pathway. It is essential for chloroplast development in Arabidopsis |
AT4G17040 | HON5 (At4g17040) encodes the ClpR4 subunit of the chloroplast-localized Clp protease complex. hon mutations disturb plastid protein homeostasis, thereby activating plastid signaling and inducing stress acclimatization. |
AT3G04680 | Encodes a nuclear protein that functions in mRNA processing. Mutations in this gene cause embryo lethality and reduced transmission through the female gametophyte. Over-expression of a CLPS3:TAP protein changes the relative levels of two alternatively processed FCA transcripts. It also causes abnormal phyllotaxy and flower development, early flowering under long and short days, and increased levels of CUC1 and WUS expression. |
AT5G55130 | putative molybdopterin synthase sulphurylase (cnx5) |
AT4G10100 | molybdenum cofactor synthesis family protein, similar to Molybdenum cofactor synthesis protein 2 small subunit (Molybdopterin- synthase small subunit) (MOCS2A) (MOCO1-A) (Swiss-Prot:O96033) (Homo sapiens); contains TIGRFAM TIGR01682: molybdopterin converting factor, subunit 1; sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling. |
AT4G26180 | Encodes a mitochondrial CoA transporter. |
AT5G60920 | Encodes a glycosylphosphatidylinositol-anchored protein localized primarily in the plasma membrane of the longitudinal sides of root cells. Necessary for oriented cell expansion in Arabidopsis. Cob mutants have abnormal roots that expand radially rather than longitudinally under certain growth conditions. |
AT3G29810 | During the course of seed coat epidermal cell differentiation, COBRA-LIKE 2 plays a role in cellulose deposition into mucilage secretory cells of Arabidopsis seeds. COBRA-LIKE 2 affects mucilage solubility and cellulosic ray formation. |
AT4G16120 | putative membrane-anchored cell wall protein |
AT2G30920 | The enzyme encoded by this gene has been shown to complement the Saccharomyces cerevisiae coq3 mutation and, therefore, to have hexaprenyldihydroxybenzoate methyltransferase activity. It is however likely that, in Arabidopsis, the enzyme catalyzes the methylation of nonaprenyldihydroxybenzoate as it is the prevalent polyprenoid in this plant species. The enzyme is a mitochondrial-localized methyltransferase involved in ubiquinone biosynthesis. |
AT3G26710 | cofactor assembly of complex C;(source:Araport11) |
AT5G36120 | One of four Arabidopsis homologs of bacterial ymlg proteins. |
AT1G01290 | COFACTOR OF NITRATE REDUCTASE AND XANTHINE DEHYDROGENASE 3. Encodes a protein involved in molybdenum cofactor biosynthesis. Homologous to E.coli MoaC. Expression is low in all tissues examined, except in roots. Appears to have targeting signals for chloroplast or mitochondria |
AT2G44050 | 6,7-dimethyl-8-ribityllumazine synthase / DMRL synthase / lumazine synthase / riboflavin synthase [Arabidopsis thaliana]. Acts in the jasmonic acid signaling pathway. The mRNA is cell-to-cell mobile. |
AT1G13030 | Encodes a plant coilin, a protein that in other organisms is a major structural scaffolding protein necessary for Cajal body formation, composition and activity. It has been shown to bind both U1 and U1 snRNAs in vitro. |
AT2G42530 | Encodes COR15B, a protein that protects chloroplast membranes during freezing. |
AT2G15970 | encodes an alpha form of a protein similar to the cold acclimation protein WCOR413 in wheat. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. The mRNA is cell-to-cell mobile. |
AT1G20440 | Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. Cold regulated gene, amino acid sequence homology with Group II LEA (late embryogenesis abundant) proteins. Also responds to osmotic stress, ABA, dehydration and inhibits e.coli growth while overexpressed. COR47 and RAB18 double overexpressor plants are cold tolerant. Regulated by heat shock. |
AT4G36290 | R-protein-interacting protein that localizes to endosomes and functions in resistance gene?mediated immunity. Belongs to the conserved Microrchidia (MORC) adenosine triphosphatase (ATPase) family, predicted to catalyze alterations in chromosome superstructure. Required for heterochromatin condensation and gene silencing. |
AT4G01290 | Protein with evolutionarily conserved eIF4E-binding motif in its N-terminal domain that can form mRNA cap?binding complexes and has the potential for regulating gene expression as a translation factor associated plant-specific cell cycle regulator. |
AT2G34560 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G31780 | Encodes a component of the oligomeric Golgi (COG) complex. Found in pollen golgi apparatus. Loss of function results in defects in pollen tube growth resulting in lack of transmission through the pollen. |
AT5G03190 | peptide upstream protein;(source:Araport11) |
AT4G09680 | Encodes CTC1 (Conserved Telomere Maintenance Component 1) involved in telomere maintenance. |
AT5G53420 | Member of ASML2 family of CCT domain proteins.There is a preferential accumulation of RNA isoforms CCT101.1 and CCT101.2 in response to N-treatment, each isoform has different targets. |
AT5G57660 | CONSTANS-like 5;(source:Araport11) |
AT3G07650 | This gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO. The mRNA is cell-to-cell mobile. |
AT3G21290 | Nuclear-localized intrinsically disordered protein involved in promoting miRNA activity. |
AT3G26940 | Receptor-like cytoplasmic kinase, RLCKVII subfamily. Overexpression causes abnormal differential and elongation growth after organ differentiation. |
AT4G12560 | Encodes CPR1 (Constitutive Expresser of PR Genes 1, also known as CPR30), a F-Box protein that functions as a negative regulator of defense response and targets resistance proteins. |
AT5G05170 | Encodes a cellulose synthase isomer. CESA3 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA3, along with CESA1 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. The xylem cells in primary root have reduced cell expansion and higher than normal lignification. |
AT5G42970 | encodes subunit 4 of COP9 signalosome complex. sequence is similar to a subunit of the 19S regulatory particle of the 26S proteasome. recessive mutation causes derepression of photomorphogenesis. |
AT1G29690 | Encodes a protein containing a domain with significant homology to the MACPF (membrane attack complex and perforin) domain of complements and perforin proteins that are involved in innate immunity in animals. Transgenic cad1-1 mutant plants show lesions seen in the hypersensitive response, as well as a spontaneous activation of expression of pathogenesis-related genes and leading to a 32-fold increase in salicylic acid (SA). CAD1 is postulated to act as a negative regulator controlling SA-mediated pathway of programmed cell death in plant immunity. |
AT3G01490 | Belongs to the Raf-like kinase subfamily of the mitogen-activated protein kinase kinase kinase (MAPKKK) family. Negatively regulates stomatal opening by negatively regulating plasma membrane H+-ATPase phosphorylation. |
AT5G50000 | Belongs to the Raf-like kinase subfamily of the mitogen-activated protein kinase kinase kinase (MAPKKK) family. Negatively regulates stomatal opening by negatively regulating plasma membrane H+-ATPase phosphorylation. |
AT5G63440 | Encodes a single copy protein in Arabidopsis containing a DUF167 domain that is conserved in eukaryotes. Genetically CSU suppresses mutations in COP1. In vitro, it interacts with CACTIN and in vivo with CCA1. CSU4 promotes photomorphogenesis via negative regulation of CCA1 and PIF4 expression. |
AT5G37190 | COP1-interacting protein 4, a nuclear-localized positive regulator of arabidopsis photomorphogenesis |
AT4G27430 | Positive regulator of light-regulated genes. Novel nuclear protein which requires light for its high level expression. The mRNA is cell-to-cell mobile. |
AT5G64920 | Encodes a RING-H2 protein that interacts with the RING finger domain of COP1. CIP8 exhibits a strong interaction with the E2 ubiquitin conjugating enzyme AtUBC8 through its N-terminal domain and promotes ubiquitination in an E2-dependent fashion in vitro. It is possible that the AtUBC8-CIP8 module might interact with COP1 in vivo, thereby participating in proteasome-mediated degradation of HY5. |
AT1G22920 | AJH1 encodes a protein similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Encodes a subunit of the COP9 complex that is involved in protein deneddylation. Plants with mutations in CSN5A and CSN5B have a de-etiolated phenotype. Required for the recovery of AUX/IAA repressor levels following recurrent heat stress to regulate auxin homeostasis. |
AT1G71230 | Encodes a subunit of the COP9 complex, similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Involved in protein deneddylation. Double mutants with CSN5A are constitutively photomorphogenic (de-etiolated) and have abnormal auxin responses. |
AT1G31710 | Copper amine oxidase family protein;(source:Araport11) |
AT3G43670 | Copper amine oxidase family protein;(source:Araport11) |
AT2G42490 | Peroxisome-localized copper amine oxidase involved in lateral root formation. |
AT1G12520 | Copper-zinc superoxide dismutase copper chaperone (delivers copper to the Cu-Zn superoxide dismutase). Localized to the chloroplast. Expressed in roots and shoots. Up-regulated in response to copper and senescence. The AtACC activates all three CuZnSOD activities located in three different subcellular compartments. Contains three domains, central, ATX-1 like and C-terminal. ATX-1 like domain essential for the copper chaperone function of AtCCS in planta. |
AT1G08830 | Encodes a cytosolic copper/zinc superoxide dismutase CSD1 that can detoxify superoxide radicals. Its expression is affected by miR398-directed mRNA cleavage. Regulated by biotic and abiotic stress. Activation of CSD1 in the cytoplasm involves both a CCS-dependent and -independent pathway. |
AT2G28190 | Encodes a chloroplastic copper/zinc superoxide dismutase CSD2 that can detoxify superoxide radicals. Its expression is affected by miR398-directed mRNA cleavage. Activation depends totally on CCS. Overexpression of a miR398-resistant form of CSD2 leads to more dramatic improvements in stress (hight light, Cu2+ and methyl viologen) tolerance than overexpression of wild-type CSD2. The mRNA is cell-to-cell mobile. |
AT3G14170 | CORD1 is a member of a novel and plant specific family of microtubule associated proteins. CORD1 binds microtubules via a conserved protein domain shared among family members. CORD functions may overlap;cord1 / cord2 mutants have defects in secondary cell wall pit morphology. |
AT1G08760 | CORD2 is a member of a novel and plant specific family of microtubule associated proteins. CORD1 binds microtubules via a conserved protein domain shared among family members. CORD functions may overlap;cord1 / cord2 mutants have defects in secondary cell wall pit morphology. |
AT1G23790 | dicer-like protein (DUF936);(source:Araport11) |
AT1G70340 | Member of a novel, plant specific family of microtubule associated proteins. |
AT1G69180 | Putative transcription factor with zinc finger and helix-loop-helix domains, the later similar to HMG boxes. Involved in specifying abaxial cell fate in the carpel. Four putative LFY binding sites (CCANTG) and two potential binding sites for MADS box proteins known as CArG boxes (CC(A/T)6GG) were found in the region spanning 3.8 Kb upstream of the CRC coding region. CRC targets YABBY genes such as YUC4 in gynoecium development. |
AT5G47850 | CRINKLY4 related 4;(source:Araport11) |
AT3G01370 | Encodes a protein containing a CRM domain that is involved in group I and group II intron splicing. |
AT3G23070 | Encodes a CRM domain protein CFM3a, involved in group IIB intron splicing in chloroplasts. |
AT4G39040 | RNA-binding CRS1 / YhbY (CRM) domain protein;(source:Araport11) |
AT4G01710 | belongs to the DIS(distorted) gene family. Encodes a actin polymerization factor. Involved in cell expansion of trichome. |
AT4G28520 | Encodes a 12S seed storage protein that is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
AT5G44120 | Encodes a 12S seed storage protein. The Landsberg erecta genome contains another copy of 12S globulin gene, CRA2, which is located tandemly with CRA1. Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
AT5G48560 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT4G08920 | Encodes CRY1, a flavin-type blue-light photoreceptor with ATP binding and autophosphorylation activity. Functions in perception of blue / green ratio of light. The photoreceptor may be involved in electron transport. Mutant phenotype displays a blue light-dependent inhibition of hypocotyl elongation. Photoreceptor activity requires light-induced homodimerisation of the N-terminal CNT1 domains of CRY1. Involved in blue-light induced stomatal opening. The C-terminal domain of the protein undergoes a light dependent conformational change. Also involved in response to circadian rhythm. Mutants exhibit long hypocotyl under blue light and are out of phase in their response to circadian rhythm. CRY1 is present in the nucleus and cytoplasm. Different subcellular pools of CRY1 have different functions during photomorphogenesis of Arabidopsis seedlings. The mRNA is cell-to-cell mobile. |
AT1G32790 | RNA-binding protein, putative, similar to RNA-binding protein GB:CAB40027 GI:4539439 from (Arabidopsis thaliana).Member of a family of PAB2 binding domain proteins. |
AT3G14010 | hydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2. |
AT4G20320 | Cytidine triphosphate synthase. |
AT2G34890 | Cytidine triphosphate synthase. |
AT1G71200 | bHLH160 transcription factor. Induced by copper deficiency and seems to mediate copper uptake along with SPL7. Alternative splicing variant in response to MeJa treatment has potential novel function where it can dimerize but not bind DNA, resulting in a function opposite of the primary isoform. |
AT2G02560 | Arabidopsis thaliana homolog of human CAND1 (cullin-associated and neddylation-dissociated). Putative similarity to TBP-interacting protein TIP120. Ubiquitously expressed in plant tissues throughout development. T-DNA insertion mutant plants were completely sterile and resistant to sirtinol and auxin, but not to gibberellins or brassinolide. Displayed developmental phenotypes similar to those of axr1, namely, short petioles, downwardly curling leaves, shorter inflorescence. Required for SCF function and appears to modulate SCF complex cycling. Physically interacts with CUL1. The mRNA is cell-to-cell mobile. |
AT1G76420 | Identified in an enhancer trap line; member of the NAC family of proteins. Expressed at the boundary between the shoot meristem and lateral organs and the polar nuclei in the embryo sac. Together with CUC2-DA1-UBP15 part of a regulatory module which controls the initiation of axillary meristems, thereby determining plant architecture. Regulates axillary meristem initiation by directly binding to the DA1 promoter. |
AT5G53950 | Transcriptional activator of the NAC gene family, with CUC1 redundantly required for embryonic apical meristem formation, cotyledon separation and expression of STM. Proper timing of CUC2 expression is required to maintain the phyllotactic pattern initiated in the meristem. CUC2 expression in leaf sinus region is required for serration and the extent of serration is modulated by mir164A mediated repression of CUC2. Together with CUC3-DA1-UBP15 part of a regulatory module which controls the initiation of axillary meristems, thereby determining plant architecture. Regulates the axillary meristem initiation, directly binding to the DA1 promoter. |
AT3G18210 | Belongs to the 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily proteins and contains an oxoglutarate/iron-dependent oxygenase domain (InterPro:IPR005123) of the prolyl 4-hydroxylase, alpha subunit subtype (P4Hc; InterPro:IPR006620), participates in epigenetic repression of flowering genes, works redundantly with ICU11 to repress several members of the MADS-box transcription factors family, during vegetative development via histone modification. |
AT4G01150 | Integral thylakoid membrane protein required for proper grana stack curvature. |
AT4G38100 | CURVATURE THYLAKOID 1D-like protein; involved in thylakoid membrane organization. |
AT5G33370 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. Mutants are defective in cuticle formation with reduced sepal cuticle ridge formation. |
AT2G46430 | Encodes a cyclic nucleotide gated channel, downstream component of the signaling pathways leading to hypersensitive response (HR) resistance. |
AT3G17700 | cyclic nucleotide-binding transporter 1, member of a family of cyclic nucleotide gated channels. The mRNA is cell-to-cell mobile. |
AT5G54250 | member of Cyclic nucleotide gated channel family, downstream component of the signaling pathways leading to HR resistance. mutant plants exhibit gene-for-gene disease resistance against avirulent Pseudomonas syringae despite the near-complete absence of the hypersensitive response (HR). Salicylic acid accumulation in dnd2 mutants is completely PAD4-independent. |
AT4G01010 | member of Cyclic nucleotide gated channel family |
AT3G48010 | member of Cyclic nucleotide gated channel family |
AT4G30360 | member of Cyclic nucleotide gated channel family |
AT5G14870 | Encodes a member of the cyclic nucleotide gated channel family that is asymmetrically localized to the plasma membrane at the growing tip of the pollen tube and is involved in pollen tube growth and pollen tube guidance to ovules. It likely directly transduces a cNMP signal into an ion flux that can produce a localized signal capable of regulating the pollen tip-growth machinery. Also functions as a Ca2+ permeable channel. |
AT2G23980 | Encodes a cyclic GMP-activated non-selective cation channel in the plasma membrane of guard cells. Required for constitutive growth of root hairs as Ca2+-permeable channels. |
AT5G25380 | core cell cycle genes |
AT1G80370 | Encodes a A2-type cyclin. Contributes to the fine-tuning of local proliferation during plant development. |
AT1G47230 | Post-prophase target of anaphase promoting complex/cyclosome E3-ligase controlling formative cell divisions. |
AT2G26760 | Cyclin B1;(source:Araport11) |
AT1G34460 | B1 type cyclin |
AT1G20610 | Cyclin B2;(source:Araport11) |
AT2G22490 | encodes a D-type cyclin whose transcription level is regulated by sucrose but not phytohormones or nitrate. Protein physically interacts with CDC2A. CycD2 kinase activity is regulated by sequestration of CycD2 protein in a form inaccessible to immunoprecipitation and probably not complexed to CDC2A. |
AT5G65420 | Encodes a D-type cyclin CYCD4;1 that physically interacts with CDC2A and is expressed during vascular tissue development, embryogenesis, and formation of lateral root primordia. Its expression is upregulated early during germination.Involved in stomatal cell lineage proliferation in the hypocotyl. |
AT5G10440 | Encodes a cyclin involved in cell proliferation during stomatal cell lineage development. |
AT4G03270 | Cyclin D6, involved in cortex/endodermis asymmetric stem cell division. |
AT5G27620 | core cell cycle genes The mRNA is cell-to-cell mobile. |
AT2G44740 | cyclin p4;(source:Araport11) |
AT5G61650 | The P-type cyclins (CYCPs) share a conserved central region of 100 amino acids ('cyclin box') displaying homology to the corresponding region of the PHO80 cyclin from Saccharomyces cerevisiae and the related G1 cyclins from Trypanosoma cruzi and T. brucei. |
AT3G54180 | Arabidopsis homolog of yeast cdc2, a protein kinase (cyclin-dependent kinase) that plays a central role in control of the mitotic cell cycle. |
AT1G76540 | Encodes a cyclin-dependent protein kinase involved in regulation of the G2/M transition of the mitotic cell cycle. Specifically binds to the cyclin CYCD4;1, expressed in shoot meristem, young leaves and vascular tissue during the G2/M phase. Required for proper organization of the shoot apical meristem and for hormone signaling. |
AT5G10270 | Encodes CDKC;1, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. |
AT1G73690 | cyclin dependent kinase activator CDKD;1. Nuclear localization. Involved in cell cycle regulation and cell differentiation. |
AT1G18040 | cyclin-dependent kinase D1;(source:Araport11) |
AT5G63610 | significant sequence similarity to plant and animal cyclin-dependent protein kinases, and was classified as an E-type CDK with a SPTAIRE cyclin binding motif in the kinase domain. |
AT5G63370 | CDKG1 interacts with the splicing factor RSZ33 to regulate proper splicing of Cals5 Pre-mRNA. |
AT1G67580 | Protein kinase superfamily protein;(source:Araport11) |
AT1G47210 | cyclin-dependent protein kinase 3;(source:Araport11) |
AT5G62430 | Dof-type zinc finger domain-containing protein, similar to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Represses expression of Constans (CO), a circadian regulator of flowering time. Interacts with LKP2 and FKF1. Expression oscillates under constant light conditions. Mainly expressed in the vasculature of cotyledons, leaves and hypocotyls, but also in stomata. Localized to the nucleus and acts as a repressor of CONSTANS through binding to the Dof binding sites in the CO promoter. Protein gets degraded by FKF1 in the afternoon. CDF1 binds to the TOPLESS co-repressor protein through an N-terminal motif which is conserved across CDF-like proteins throughout land-plants. This interaction is important for the repression of CO and FT genes during the morning. Loss of CDF1 dependent repression through omission of TPL coordinating residues or through the loss of TPL function in phloem companion cells results in early flowering due to an up regulation of FT. |
AT3G47500 | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions. |
AT1G26790 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
AT3G01480 | Encodes a chloroplast cyclophilin functioning in the assembly and maintenance of photosystem II (PSII) supercomplexes. The mRNA is cell-to-cell mobile. |
AT3G44600 | Cyclophilin71 is a WD40 domain cyclophilin, which functions in gene repression, organogenesis and meristem development. CYP71 physically interacts with histone H3. |
AT4G34960 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT2G47320 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT3G66654 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT5G50375 | Converts pentacyclic cyclopropyl sterols to conventional tetracyclic sterols. CPI1 function during and just after division and support gravitropism by establishing polar PIN2 localization. Required for endocytosis of PIN2 |
AT5G13690 | Encodes an enzyme that is predicted to act as an alpha-N-acetylglucosaminidase (NAGLU). An naglu mutant arrests early in seed development but does not appear to have male or female gametophytic defects. Transcript levels for this gene are increased during reproductive development. |
AT1G66160 | CYS, MET, PRO, and GLY protein 1;(source:Araport11) |
AT3G57050 | Encodes cystathionine beta-lyase, the second enzyme in the methionine biosynthetic pathway. Mutants show defects in root development, reduced methylation and maintenance of the quiescent center. |
AT2G40880 | Encodes a protein with cysteine proteinase inhibitor activity. Overexpression increases tolerance to abiotic stressors (i.e.salt,osmotic, cold stress). The mRNA is cell-to-cell mobile. |
AT5G12140 | Encodes a cystatin. |
AT5G50260 | Encodes a papain-like cysteine protease involved in tapetal programmed cell death and pollen development.CEP1 is expressed specifically in the tapetum from stages 5 to 11 of anther development. The CEP1 protein first appears as a proenzyme in precursor protease vesicles, and is then transported to the vacuole and transformed into the mature enzyme before rupture of the vacuole. CEP1 was also released to the tapetal cell wall during late stage 6 and stage 7. After the tapetal cell wall degenerated, the CEP1 enzyme entered the callose wall from the degenerated tapetal cell wall and was probably involved in degeneration of the callose wall. |
AT3G48340 | KDEL-tailed cysteine endopeptidase. Mutants generated via RNAi show decreased lateral root growth. |
AT4G11310 | cysteine proteinase precursor-like protein |
AT4G11320 | Papain family cysteine protease;(source:Araport11) |
AT4G36880 | cysteine proteinase1;(source:Araport11) |
AT4G23180 | Encodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) The mRNA is cell-to-cell mobile. |
AT4G23230 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23290 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23310 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23320 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G05200 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G21400 | Encodes a cysteine-rich receptor-like protein kinase. |
AT1G70530 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G11460 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G11480 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G11530 | Encodes a cysteine-rich receptor-like protein kinase. The mRNA is cell-to-cell mobile. |
AT4G04540 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G00970 | Encodes a cysteine-rich receptor-like protein kinase. |
AT5G40380 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23150 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23160 | Encodes a cysteine-rich receptor-like protein kinase. |
AT1G05340 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
AT2G33520 | cysteine-rich/transmembrane domain protein A;(source:Araport11) |
AT3G60620 | cytidinediphosphate diacylglycerol synthase 5;(source:Araport11) |
AT1G26340 | encodes a member of the cytochromes b5 family of proteins that localizes to the outer envelope of the chloroplast. The C-terminal portion of the protein appears to be capable of inserting into a plant microsomal membrane in vitro. |
AT2G32720 | Participates with ELO2 in VLCFA synthesis. |
AT5G48810 | Encodes a cytochrome b5 isoform that localizes to the ER. The C-terminal portion of the protein appears to be capable of inserting into a plant microsomal membrane in vitro and the protein appears to be subject to glycosylation. The mRNA is cell-to-cell mobile. |
AT1G69750 | cytochrome c oxidase 19-2;(source:Araport11) |
AT2G35030 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G10040 | Encodes cytochrome c. Promoter directs preferential expression in vascular tissues of cotyledons, leaves, roots, and hypocotyls, and in anthers. Double mutants with CYTC-1 accumulate starch during the day, have delayed growth and development and reduced GA and DELLA proteins linking cellular metabolism and GA homeostasis. |
AT5G45040 | Encodes a Class I cytochrome c family member possessing a high structural homology with photosynthetic cytochrome c(6) from cyanobacteria, but structurally and functionally distinct through the presence of a disulfide bond. |
AT2G17330 | putative obtusifoliol 14-alpha demethylase. Expressed pseudogene. |
AT1G11680 | putative obtusifoliol 14-alpha demethylase involved in sterol biosynthesis. The mRNA is cell-to-cell mobile. |
AT3G61880 | Encodes a cytochrome p450 monooxygenase. Overexpression of this gene allows fruit growth independently of fertilization. The gene is normally expressed only in floral organs(during the Arabidopsis stage 14 flower) and in the funiculus at anthesis. |
AT1G58260 | member of CYP79C subfamily of cytochrome p450s. Encodes a putative xylan endohydrolase. similar to some closely linked pseudogenes. |
AT4G15393 | a member of the cytochrome P450 gene family. molecular function unknown. |
AT1G01280 | member of CYP703A CYP703A2 is expressed specifically in anthers of land plants, catalyzing the in-chain hydroxylation at the C-7 position of medium-chain saturated fatty acids (lauric acid in-chain hydroxylase) which is involved in pollen development (sporopollenin synthesis). |
AT2G44890 | member of CYP704A |
AT5G42580 | a member of the cytochrome P450 family |
AT2G14100 | a member of the cytochrome P450 family |
AT1G28430 | member of CYP705A |
AT1G50560 | member of CYP705A |
AT4G15360 | member of CYP705A |
AT3G20960 | cytochrome P450, family 705, subfamily A, polypeptide 33;(source:Araport11) |
AT5G47990 | Encodes an endomembrane system-expressed member of the CYP705A family of cytochrome P450 enzymes. It appears to catalyze the addition of a double bond to thalian-diol at carbon 15. Reduced levels of THAD expression lead to a build up of thalian-diol in root extracts. thad1-1 mutants also have longer roots than wild type seedlings and show altered gravitropic responses. |
AT4G19230 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. CYP707A1 appears to play an important role in determining the ABA levels in dry seeds. Gene involved in postgermination growth. Overexpression of CYP707A1 leads to a decrease in ABA levels and a reduction in after-ripening period to break dormancy. |
AT5G45340 | Encodes a protein with ABA 8'-hydroxylase activity; involved in ABA catabolism. Mutant analyses show that disruption in the gene results in more drought tolerance whereas overexpression results in increased transpiration rate and reduced drought tolerance. Gene involved in postgermination growth. Plant P450 CYP707A3, ABA 8'-hydroxylase, binds enantioselectively (+)-ABA but not (-)-ABA, whereas the enzyme binds both enantiomers of AHI1 (a structural ABA analogue used as ABA 8'-hydroxylase competitive inhibitor). |
AT1G78490 | member of CYP708A family. The mRNA is cell-to-cell mobile. |
AT5G24950 | putative cytochrome P450 |
AT1G11610 | putative cytochrome P450 |
AT3G48290 | putative cytochrome P450 |
AT3G48280 | putative cytochrome P450 |
AT3G48270 | putative cytochrome P450 |
AT5G25120 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
AT5G25180 | putative cytochrome P450 |
AT3G26150 | putative cytochrome P450 |
AT3G26190 | putative cytochrome P450 |
AT3G26200 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
AT1G13070 | putative cytochrome P450 |
AT3G26295 | putative cytochrome P450. |
AT5G35715 | encodes a protein with cytochrome P450 domain |
AT2G02580 | member of CYP71B |
AT5G52400 | member of CYP715A |
AT5G36140 | Encodes a member of the CYP716A subfamily of cytochrome P450 monooxygenases with triterpene oxidizing activity catalyzing C-28 hydroxylation of alpha-amyrin, beta-amyrin, and lupeol, producing uvaol, erythrodiol, and betulin, respectively.In particular, 22alpha-hydroxylation activity has been observed against alpha-amyrin. Should be merged with At5g36130. |
AT3G14640 | putative cytochrome P450 |
AT3G14650 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
AT3G14680 | putative cytochrome P450 |
AT3G14620 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
AT3G14630 | putative cytochrome P450 |
AT5G14400 | Encodes a brassinosteroid C-22 hydroxylase. |
AT1G67110 | cytochrome P450, family 735, subfamily A, polypeptide 2;(source:Araport11) |
AT3G52970 | member of CYP76G |
AT1G74110 | member of CYP78A |
AT1G13710 | Encodes the cytochrome P450 CYP78A5 monooxygenase. Contributes to the generation of a growth-stimulating signal distinct from the classical phytohormones that prevents proliferation arrest, promoting organ growth. In ovules it is required for megagametogenesis, maternal control of seed size and restricting megaspore mother cell fate to a single cell. |
AT1G01190 | cytochrome P450, family 78, subfamily A, polypeptide 8;(source:Araport11) |
AT2G23220 | member of CYP81D |
AT4G37370 | member of CYP81D |
AT5G57220 | member of CYP81F, involved in glucosinolate metabolism. Mutants had impaired resistance to fungi. The mRNA is cell-to-cell mobile. |
AT4G37400 | member of CYP81F |
AT4G37410 | member of CYP81F The mRNA is cell-to-cell mobile. |
AT2G25160 | cytochrome P450, family 82, subfamily F, polypeptide 1;(source:Araport11) |
AT3G25180 | Encodes a cytochrome P450 monooxygenase (CYP82G1) that catalyzes the production of two volatile homoterpenes, TMTT and DMNT, although it is only likely to produce TMTT in planta. TMTT can be involved in attracting predatory insects to protect Arabidopsis plants from herbivorous pests. Homoterpene synthesis is also stimulated by fungal elicitors which increase the transcript levels of CYP82G1. |
AT5G58860 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly only in root tissue. |
AT1G63710 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at highest level in mature stems and flowers. |
AT1G13140 | member of CYP86C |
AT1G13150 | member of CYP86C |
AT1G05160 | Encodes an ent-kaurenoic acid hydroxylase, a member of the CYP88A cytochrome p450 family. |
AT5G06900 | member of CYP93D |
AT5G63450 | AtWRKY33 regulates root apoplastic barrier formation by controlling AtCYP94B1 leading to increased salt tolerance of Arabidopsis plants. Regulation by WRKY33 to control apoplastic barrier formation in roots to confer salt tolerance. |
AT2G23180 | member of CYP96A |
AT4G39500 | cytochrome P450, family 96, subfamily A, polypeptide 11;(source:Araport11) |
AT1G66030 | Encodes a protein with cytochrome P450 domain. Probable psuedogene. |
AT4G32170 | member of CYP96A |
AT4G39480 | member of CYP96A |
AT4G15110 | member of CYP97B |
AT2G39770 | Encodes a GDP-mannose pyrophosphorylase/ mannose-1-pyrophosphatase. This enzyme provides GDP-mannose, which is used for cell wall carbohydrate biosynthesis and protein glycosylation as well as for ascorbate (vitamin C) biosynthesis. Mutations in this gene confer hypersensitivity to NH4+. |
AT5G56970 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins.Acts on N6-(2-isopentenyl)adenine 9-riboside. |
AT4G29740 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
AT1G75450 | This gene used to be called AtCKX6. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
AT5G21482 | This gene used to be called AtCKX5. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. Enzyme assays show preference for N6 -(2-isopentenyl)adenine 9-glucoside substrate. |
AT2G41510 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins.Acts on zeatin 9-riboside-50-triphosphate substrate. |
AT1G68550 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT3G25890 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. The mRNA is cell-to-cell mobile. |
AT1G25470 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT5G53290 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
AT4G27950 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
AT2G46310 | CRF5 encodes one of the six cytokinin response factors. It is transcriptionally upregulated in response to cytokinin. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves. |
AT2G47430 | Encodes a putative plasma membrane-bound hybrid histidine kinase and cytokinin sensor that is expressed within the female gametophyte. |
AT5G50915 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT2G40730 | kinase family with ARM repeat domain-containing protein;(source:Araport11) |
AT4G09510 | CINV2 appears to function as a neutral invertase based on the phenotype of a cinv1(AT1G35580)/cinv2 double mutant. It is predicted to be a cytosolic enzyme. CINV1, CINV2, and possibly other cytosolic invertases may play an important role in supplying carbon from sucrose to non-photosynthetic tissues. |
AT1G65930 | Encodes a NADP+-isocitrate dehydrogenase that is believed to function in the cytosol. It appears to contribute to NADPH production under oxidative stress, and thereby to participate in redox signalling linked to defense responses. The mRNA is cell-to-cell mobile. |
AT1G04270 | Encodes cytosolic ribosomal protein S15. |
AT4G36400 | Encodes a (D)-2-hydroxyglutarate dehydrogenase. |
AT4G02850 | DAAR1 encodes a PLP-independent racemase that catalyzes the conversion from L-Ile to D-allo-Ile. |
AT3G12620 | Protein phosphatase 2C family protein;(source:Araport11) |
AT1G48420 | Encodes an enzyme that decomposes D-cysteine into pyruvate, H2S, and NH3. Only D-cysteine but not L-cysteine was converted by D-CDes to pyruvate, H2S, and NH3. There is conflicting evidence on its 1-aminocyclopropane-1-carboxylate deaminase activity. Involved in regulating ethylene levels. DCD enhances plant cadmium tolerance by promoting hydrogen sulfide production. |
AT5G61410 | Arabidopsis thaliana ribulose-5-phosphate-3-epimerase mRNA |
AT4G36860 | DAR1 is a member of a small (7 member) ubiquitin binding protein family. It appears to play a role in regulation of endoreduplication in leaf epidermal tissue. |
AT5G66630 | DA1-related protein 5;(source:Araport11) |
AT5G66620 | DA1-related protein 6;(source:Araport11) |
AT5G66610 | DA1-related protein 7;(source:Araport11) |
AT4G18550 | DSEL is cytosolic acylhydrolase that shows prefential lipase activity against the sn-1 position of several classes of lipids, including 1,3-diacylglycerols and 1-monoacylglycerols. Overexpression of DSEL leads to increased peroxisome and oil body levels in cotyledons and reduced beta-oxidation activity in seedlings. |
AT5G58760 | Encodes a DDB1a interacting protein DDB2 required for UV-B tolerance and genomic integrity. |
AT4G05420 | Structurally similar to damaged DNA binding proteins. DDB1a is part of a 350 KDa nuclear localized DET1 protein complex. This complex may physically interact with histone tails and while bound to chromatin- repress transcription of genes involved in photomorphogenesis. DDB1a is shown to be RUB-modified. |
AT4G21100 | One of two closely related genes similar to a damaged DNA binding protein originally described in mammals. May form a complex with DET1 to regulate photomorphogenesis. Loss of function mutations are lethal. The DDB1b protein binds with a number of DWD-containing proteins and may form part of a CUL4-based E3 ubiquitin ligase. |
AT3G60140 | Encodes a protein similar to beta-glucosidase and is a member of glycoside hydrolase family 1. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile. |
AT3G13450 | branched chain alpha-keto acid dehydrogenase E1 beta |
AT4G31160 | Encodes a DCAF/DWD protein capable of interacting with DDB1 and associating with CUL4, likely as part of a nuclear ubiquitin ligase complex. DCAF1 appears to be required for plant embryogenesis and to affect several other developmental processes including leaf, shoot, and flower development. |
AT5G22760 | PHD finger family protein;(source:Araport11) |
AT1G18950 | DDT domain superfamily;(source:Araport11) |
AT4G10180 | Encodes a nuclear-localized protein that acts as a repressor of photomorphogenesis and may be involved in chromatin remodeling. The mRNA is cell-to-cell mobile. |
AT1G03310 | Encodes a protein with strong similarity to isoamylase (EC:3.2.1.68) however lacks critical residues known to be important for activity. Appears to co localize with ISA1 in the chloroplast isoamylase complex. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. It has been postulated that AtISA2 interacts with AtISA1 to form the Iso1 complex. |
AT1G08370 | Encodes DCP1 involved in mRNA decapping. DCP1 forms a mRNA decapping complex with DCP2 (At5g13570) and VCS (VARICOSE) (At3g13300). However, unlike DCP2, DCP1 itself does not have mRNA decapping activity in vitro. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. The protein was shown by immunoprecipitation not to interact with DCP2. |
AT1G26110 | Encodes Decapping 5, required for mRNA decapping, P-body formation and translational repression during postembryonic development. |
AT5G45330 | decapping 5-like protein;(source:Araport11) |
AT1G19115 | Member of the IGT gene family. |
AT2G44810 | Mutant has defects in anther dehiscence, pollen maturation, and flower opening. The DAD1 protein is a chloroplastic phospholipase A1 that catalyzes the initial step of jasmonic acid biosynthesis. |
AT5G66680 | Encodes a protein ortholog of human SOT48 or yeast WBP1, an essential protein subunit of the oligosaccharyltransferase (OST) complex, which is responsible for the transfer in the ER of the N-linked glycan precursor onto Asn residues of candidate proteins. |
AT5G05280 | Encodes a RING-finger E3 ligase protein that controls anther dehiscence by positively regulating the expression of DAD1 in the jasmonic acid biosynthesis pathway. |
AT3G09090 | Encodes DEX1 (defective in exine formation). Required for exine pattern formation during pollen development. |
AT3G28470 | Member of the R2R3 factor gene family. Its E-box is critical for the DYT1- bHLH089 heterocomplex to bind to and activate its transcription. |
AT5G26940 | Encodes a Mg2+-dependent DNA exonuclease that degrades organelle DNA during Arabidopsis pollen development. |
AT3G07530 | integrator complex subunit;(source:Araport11) |
AT1G55350 | Similar to maize DEK1, a gene encoding a membrane protein of the calpain gene superfamily required for aleurone cell development in the endosperm of maize grains. A key component of the embryonic L1 cell-layer specification pathway. It localizes to membranes and undergoes intramolecular autolytic cleavage events that release the calpain domain into the cytoplasm. |
AT5G44480 | mutant has Altered lateral root; UDP Glucose Epimerase The mRNA is cell-to-cell mobile. |
AT5G16780 | Encodes a protein belonging to SART-1 family. The gene is expressed in the basal region of the developing embryo during heart stage. Phenotypic analyses of dot2 mutants suggest that this protein plays a role in root, shoot, and flower development. dot2 mutants are dwarved plants that display an aberrant spurred leaf venation pattern and fail to flower. In the roots DOT2 appears to be require for normal meristem organization and maintenance and the proper expression of PIN and PLT genes. |
AT4G18750 | Encodes a pentatricopeptide (PPR) protein involved in leaf and root development. dot4 mutants have an aberrant midgap venation pattern in juvenile leaves and cotyledons. |
AT1G13290 | Encodes a putative zinc finger protein (C2H2 family, type IIIA, subclass A1d) that has a WIP domain. Seedlings with mutations in DOT5 have a misaligned venation defect in their leaves and cotyledons. Additional developmental abnormalities, such as elongated petioles and aberrant phyllotaxy suggest that DOT5 is required for normal shoot and root development. |
AT4G11393 | Encodes a defensin-like (DEFL) family protein. |
AT3G27925 | Encodes a DegP protease; nuclear gene encoding chloroplast-targeted protease that can degrade two lumenal proteins, plastocyanin and OE33, suggesting a role as a general-purpose protease in the thylakoid lumen. Involved in the degradation of D1 protein of PS II, hence participating in the repair of PS II damages caused by photoinhibition. The mRNA is cell-to-cell mobile. |
AT1G65630 | Encodes a putative DegP protease. |
AT5G40200 | Encodes a putative DegP protease. The mRNA is cell-to-cell mobile. |
AT4G25480 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF3). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. |
AT1G21910 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
AT3G12930 | Encodes a novel conserved chloroplast protein that interacts with components of the PEP complex. Mutants show delayed greening and reduced photosynthetic capcity. |
AT3G55610 | encodes delta 1-pyrroline-5-carboxylate synthetase B. Gene expression is induced by dehydration, high salt and ABA. Knock-out mutations in P5CS2 are embryo-lethal. P5CS2 appears to be present in different cells and/or different subcellular locations from P5CS1 in a tissue-dependent manner. Mutants are defective in pollen development. |
AT5G13450 | delta subunit of Mt ATP synthase;(source:Araport11) |
AT5G43280 | Encodes the peroxisomal delta 3,5-delta2,4-dienoyl-CoA isomerase, a enzyme involved in degradation of unsaturated fatty acids. Gene expression is induced upon seed germination. |
AT2G39800 | encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. P5CS1 appears to be involved in salt stress responses related to proline accumulation, including protection from reactive oxidative species. P5CS1 appears to be present in different cells and/or different subcellular locations from P5CS2 in a tissue-dependent manner. |
AT5G04560 | Encodes a DNA glycosylase DEMETER (DME). Responsible for endosperm maternal-allele-specific hypomethylation at the MEDEA (MEA) gene. DME can excise 5-methylcytosine in vitro and when expressed in E. coli. DME establishes MEA imprinting by removing 5-methylcytosine to activate the maternal allele. |
AT2G36490 | A repressor of transcriptional gene silencing. Functions by demethylating the target promoter DNA. Interacts physically with RPA2/ROR1. In the ros1 mutants, an increase in methylation is observed in a number of gene promoters. Among the loci affected by ros1, a few (RD29A and At1g76930) are affected in cytosine methylation in all sequence contexts (CpG, CpNpG or CpNpN), although many others are affected primarily in non-CpG contexts. The ros1 mutant is more susceptible to biotrophic pathogens and is repressed in its responsiveness of salyclic acid-dependent defence genes. |
AT4G34060 | Encodes a protein with 5-meC and thymine-DNA glycosylase activity with a preference for CpG and CpHpG sequences. Involved in maintaining methylation marks. Many targets of DML3 are senescence-associated genes (SAGs). |
AT4G04860 | DERLIN-2.2;(source:Araport11) |
AT5G41560 | Encodes a substrate receptor for CRL4-CDD complexes that provides substrate specificity for CRL4 by interacting with ubiquitination targets. By its interaction and regulation of levels of PYL8 through proteasomal degradation, it negatively regulates ABA-mediated developmental responses, including inhibition of seed germination, seedling establishment, and root growth |
AT5G52050 | MATE efflux family protein;(source:Araport11) |
AT5G38030 | MATE transporter involved in auxin homeostasis in roots. |
AT4G25640 | Encodes a multidrug and toxin efflux family transporter. Involved in flavonoid metabolism, affecting Root growth, seed development and germination, and pollen development, release and viability. |
AT1G58220 | Plays an essential role in organ development by regulating cell expansion either directly by affecting cell wall architecture and/or cytoplasmic growth or indirectly through the ethylene and/or ABA signaling pathways.DRMY1 is Involved in regulating floral organ development, especially ensuring organ size robustness (PMID:32451448). |
AT5G06250 | Transcription repressor involved in regulation of inflorescence architecture. |
AT1G17470 | Encodes a member of the DRG (developmentally regulated G-protein) family expressed throughout the plant, with highest expression in actively growing tissues. Has GTPase activity. |
AT3G10160 | Encodes a protein with tetrahydrofolylpolyglutamate synthase activity that is located in the mitochondrial matrix. One of the three folylpolyglutamate synthetase isoforms (FPGSs): FPGS1 (At5g05980, plastidic), FPGS2 (At3g10160, mitochondrial) and FPGS3 (At3g55630, cytosolic). |
AT3G55630 | Encodes one of the three folylpolyglutamate synthetase isoforms (FPGSs): FPGS1 (At5g05980, plastidic), FPGS2 (At3g10160, mitochondrial) and FPGS3 (At3g55630, cytosolic). |
AT3G51520 | Encodes a functional acyl-CoA:diacylglycerol acyltransferase with different acyl-CoA substrate preferences and shows higher DAG to TAG conversion rate than AtDGAT1. It increases both C18:2 and C18:3 polyunsaturated fatty acids at the expense of C16:0. |
AT5G57690 | Involved in nitric oxide-dependent pollen tube guidance and fertilization. |
AT5G07920 | Encodes a putative diacylglycerol kinase that is mainly expressed in roots, shoots and leaves, but its enzyme product was not active in vitro. |
AT5G09470 | Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470). |
AT2G33430 | Encodes a multiple organellar RNA editing factor, a chloroplast protein which is required for the maturation of the plastid ribosomal RNAs and is essential for chloroplast differentiation.Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
AT2G45440 | Encodes a protein that likely has dihydropicolinate synthase activity based on its mutant phenotype of decreased lysine levels and increased aspartate levels. The mutant also has increased levels of threonine. The enzyme is predicted to localize to the chloroplast. |
AT4G35420 | Encodes DRL1 (Dihydroflavonol 4-reductase-like1), a closely related homolog of the rice anther-specific gene OsDFR2. DRL1 may be involved in a metabolic pathway essential for pollen wall development and male fertility. Mutant plants have impaired pollen formation and seed production. |
AT1G27980 | Encodes an ER-localized sphingoid long-chain base-1-phosphate lyase involved in the dehydration stress response. |
AT3G23940 | Encodes a member of the dihydroxyacid dehydrates family of proteins that encode enzymes involved in branched chain amino acid biosynthesis. Loss of function mutations have significantly reduced transmission and fertility due to defects in male and female gametophyte development and embryo lethality. Mutants have increased sensitivity to abiotic stressors which may be partially compensated by addition of amino acids to the growth medium. |
AT5G48490 | Encodes a protein with similarity to a lipid transfer protein that may contribute to systemic acquired resistance (SAR). |
AT4G23690 | Encodes a homodimeric all-beta dirigent protein in the superfamily of calycins. Dirigent proteins impart stereoselectivity on the phenoxy radical coupling reaction yielding optically active lignans from two molecules of coniferyl alcohol. |
AT1G30825 | Involved in trichome maturation. mutant displays enlarged trichomes |
AT5G04760 | R-R-type MYB protein which plays negative roles in salt stress and is required for ABA signaling in Arabidopsis. |
AT3G14990 | Encodes a homolog of animal DJ-1 superfamily protein. In the A. thaliana genome, three genes encoding close homologs of human DJ-1 were identified AT3G14990 (DJ1A), AT1G53280 (DJ1B) and AT4G34020 (DJ1C). Among the three homologs, DJ1C is essential for chloroplast development and viability. It exhibits glyoxalase activity towards glyoxal and methylglyoxal. The mRNA is cell-to-cell mobile. |
AT4G10500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT4G10490 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT2G37590 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
AT4G00940 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
AT3G10690 | Encodes a protein that when expressed together with GYRB2 generates an active supercoiling DNA gyrase enzyme that shares similar properties to its bacterial counterpart, including sensitivity to gyrase-specific antibiotics. |
AT3G10270 | Protein targeting to mitochondria is influenced by UTR sequences. |
AT5G04110 | DNA GYRASE B3;(source:Araport11) |
AT3G17830 | Molecular chaperone Hsp40/DnaJ family protein;(source:Araport11) |
AT1G80030 | Molecular chaperone Hsp40/DnaJ family protein;(source:Araport11) |
AT1G77930 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT3G13310 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT2G18465 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G67630 | DNA polymerase alpha 2;(source:Araport11) |
AT2G42120 | DNA polymerase delta small subunit;(source:Araport11) |
AT5G22110 | Encodes a protein with similarity to DNA polymerase epsilon subunit B an essential gene that is required for DNA replication. Homozygous mutants are embryo lethal. Expressed in meristematic , rapidly dividing regions. |
AT1G10520 | Encodes a homolog of the mammalian DNA polymerase lambda that is involved in the repair of UV-B induced DNA damage. |
AT5G55300 | Encodes a type-I DNA topoisomerase I. Disruptions in this gene affect phyllotaxis and plant architecture suggesting that the gene plays a critical role in the maintenance of a regular pattern of organ initiation. Isolated as a protein oxidized during seed germination; proteomics approach revealed differences in de novo synthesis levels of this protein in condition with vs. without salicylic acid in the period from 0 to 40 hrs. following seed imbibition. Functions in stem cell maintenance at all stages of shoot and floral meristems and in the regulation of gene silencing. |
AT4G21040 | Dof-type zinc finger domain-containing protein;(source:Araport11) |
AT4G21050 | Encodes a transcriptional activator involved in shoot branching and silique development. Involved in shoot regenaration from root explants. |
AT4G21080 | Dof-type zinc finger domain-containing protein;(source:Araport11) |
AT1G20340 | recombination and DNA-damage resistance protein (DRT112) One of two Arabidopsis plastocyanin genes. Predominant form, expressed 10x higher than PETE1. PETE2 is thought to be post-transcriptionally regulated via copper accumulation and is involved in copper homeostasis. Mutation of this gene does not have obvious effect on photosynthesis. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the membrane. |
AT2G46590 | Encodes a protein containing Dof zinc finger motifs that is a positive regulator of light-mediated seed germination. Its expression is limited to vascular system of the mother plant. A recessive mutation is inherited as maternal-effect and expression is not detected in the embryo. Mutants are defective in seed germination and are more dependent on light and cold treatment and less sensitive to gibberellin during seed germination. It plays its main role downstream of PIL5 and DAG1 in the phytochrome B (phyB)-mediated pathway. |
AT3G21270 | Encodes Dof zinc finger protein adof2. |
AT3G45040 | Encodes a putative dolichol kinase that is localized to the endoplasmic reticulum and involved in pollen tube reception in the female gametophyte. |
AT1G11420 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. |
AT2G46840 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype. Overexpression increases plant organ size, possibly by influencing the expression of the cell wall formation and auxin transporter genes that regulate cell size. |
AT2G47230 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. |
AT3G62300 | Encodes a protein with Agenet/Tudor and DUF724 domains. It can interact with ABAP1, a negative regulator of DNA replication and transcription, with the plant histone modification 'reader' LHP1, and with non-modified histones. It may act as a link between DNA replication, transcription and chromatin remodeling during flower development. Loss of function mutant has a WT phenotype. |
AT5G23770 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
AT5G15380 | Encodes methyltransferase involved in the de novo DNA methylation and maintenance of asymmetric methylation of DNA sequences. |
AT5G14620 | A putative DNA methyltransferase with rearranged catalytic domains; similar to mammalian DNMT3 methyltransferases; contains UBA domains. The 3'-end proximal part of the gene coding region is highly methylated at both adenine and cytosine residues. |
AT3G17310 | Encodes DRM3 (Domains Rearranged Methyltransferase3), a catalytically mutated paralog of the cytosine methyltransferase DRM2. Despite being catalytically mutated, DRM3 is required for normal maintenance of non-CG DNA methylation, establishment of RNA-directed DNA methylation triggered by repeat sequences and accumulation of repeat-associated small RNAs. |
AT2G36800 | Encodes a DON-Glucosyltransferase. The UGT73C5 glucosylates both brassinolide and castasterone in the 23-O position. The enzyme is presumably involved in the homeostasis of those steroid hormones hence regulating BR activity. Transgenic plants overexpressing UGT73C5 show a typical BR-deficient phenotype. |
AT1G05800 | Encodes a galactolipase. Located in the chloroplast. Involved in the initial step of jasmonic acid biosynthesis. Expressed in vegetative tissues and is necessary for the biosynthesis of basal-level JAs in vegetative tissues. |
AT2G33830 | Negative regulator of local and systemic acquired resistance; target of FLD for activation of SAR. |
AT3G62800 | Encodes a nuclear dsRNA-binding protein DRB4 that interacts specifically with DCL4. May regulate DCL4 function and thereby affect miRNA biogenesis. Also has an impact on polymerase IV-dependent siRNA levels. DRB4 interacts with the P6 viral protein from Cauliflower mosaic virus and may be a target of viral silencing suppression. |
AT5G14960 | DP-E2F-like 2;(source:Araport11) |
AT5G67190 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
AT2G23340 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
AT2G30580 | Encodes a C3HC4 RING-domain-containing ubiquitin E3 ligase capable of interacting with DREB2A. DRIP2 seems to be involved in regulating stress-related transcriptional changes and drought tolerance. |
AT5G17460 | glutamyl-tRNA (Gln) amidotransferase subunit C;(source:Araport11) |
AT2G31470 | Encodes a F-Box protein DOR (Drought tolerance Repressor) functionally as an inhibitory factor for abscisic acid-induced stomatal closure under drought stress. |
AT1G56280 | Encodes a gene whose transcript level in root and leaves increases to progressive drought stress. The increase in transcript level is independent from abscisic acid level. Sequence is not similar to any protein of known function. It appears to be a member of plant-specific gene family. It's phosphorylated by AtCPK11 in a Ca(2+)-dependent manner at Thr105 and Ser107 within the AtDi19 bipartite nuclear localization signal |
AT4G15910 | encodes a gene whose transcript level in root and leaves increases to progressive drought stress. The transcript level is also affected by changes of endogenous or exogenous abscisic acid level. It appears to be a member of plant-specific gene family that includes late embryo-abundant and zinc- IAA-induced proteins in other plants. The mRNA is cell-to-cell mobile. |
AT5G55970 | Drought-induced gene encoding an ER-localized RING-type E3 Ub ligase. |
AT4G17505 | carboxyl-terminal proteinase-like protein (DUF239);(source:Araport11) |
AT1G05540 | hypothetical protein (DUF295);(source:Araport11) |
AT4G25930 | DUF295 domain containing protein. |
AT5G53780 | F-box protein, putative (DUF295);(source:Araport11) |
AT3G21520 | Encodes a protein is directly or indirectly involved in membrane fission during breakdown of the ER and the tonoplast during leaf senescence and in membrane fusion during vacuole biogenesis in roots. The mRNA is cell-to-cell mobile. |
AT5G46090 | transmembrane protein, putative (DUF679);(source:Araport11) |
AT1G09157 | Loss-of-function mutation in this gene together with DMP9 induces maternal haploids, with an average haploid induction rate of 2.1 ? 1.1%. |
AT1G64570 | Homeodomain-like superfamily protein;(source:Araport11) |
AT4G35560 | Target promoter of the male germline-specific transcription factor DUO1. The mRNA is cell-to-cell mobile. |
AT4G35280 | Target promoter of the male germline-specific transcription factor DUO1. |
AT3G19820 | Involved in the conversion of the early brassinosteroid precursor 24-methylenecholesterol to campesterol. Brassinosteroids affect cellular elongation. Mutants have dwarf phenotype. DWF1 is a Ca2+-dependent calmodulin-binding protein. |
AT3G03990 | Encodes an alpha/beta hydrolase essential for strigolactone signaling. Degradation of the protein is promoted by strigolactone. The mRNA is cell-to-cell mobile. |
AT5G54510 | Encodes an IAA-amido synthase that conjugates Ala, Asp, Phe, and Trp to auxin. Lines overexpressing this gene accumulate IAA-ASP and are hypersensitive to several auxins. Identified as a dominant mutation that displays shorter hypocotyls in light grown plants when compared to wild type siblings. Protein is similar to auxin inducible gene from pea (GH3). |
AT1G03055 | Encodes the ortholog of rice D27. It is plastid-localized and is required for the inhibition of secondary bud outgrowth and operates on a nonmobile precursor upstream of MAX1 in the SL biosynthesis pathway. |
AT2G19430 | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. |
AT1G76260 | DWD (DDB1-binding WD40 protein) hypersensitive to ABA 2;(source:Araport11) |
AT4G17620 | NAD-RNA decapping enzyme.Mediates the connection between RNA turnover and retrograde chloroplast-to-nucleus signaling. Catalyzes the hydrolysis of RNAs bearing a 5 -hydroxyl group (5-OH RNA). |
AT2G14120 | Encodes a dynamin related protein. DRPs are self-assembling GTPasse involved in fission and fusion of membranes. DRP3B functions in mitochondrion and peroxisome fission in combination with DRP3A. |
AT1G60540 | Annotated as pseudogene of the dynamin family.Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT1G53140 | Encodes DRP5A, a dynamin protein involved in cytokinesis in Arabidopsis. |
AT5G42080 | Encodes a dynamin-like protein related to phragmoplastin. Mutations in this gene, in combination with mutation in ADL1E, result in defects in embryogenesis, cell plate formation and trichome branching. Also controls vascular patterning in combination with VAN3 and GNOM. DRP2B and DRP1A participate together in clathrin-coated vesicle formation during endocytosis. |
AT4G33650 | Encodes a protein with high sequence similarity to the dynamin superfamily. Among those members ADL2 was most closely related to Dnm1p of yeast and likely a member of the Vps1p subfamily. Widely expressed in various tissues with highest expression in flower tissues. Localizes to the chloroplast, mitochondrion and peroxisome. Involved in peroxisome and mitochondria fission in combination with DRP3B. |
AT3G16800 | EGR3 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress, EGR3 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
AT5G19180 | Encodes a subunit of a RUB-activating enzyme analogous to the E1 ubiquitin-activating enzyme. ECR1 functions as a heterodimer with AXR1 to activate RUB, a ubiquitin-related protein. |
AT2G40550 | Encodes a nuclear localized target of E2Fa-DPa, transcription factors controlling cell cycle progression. Required for sister chromatid cohesion and DNA repair. |
AT4G12480 | Encodes a putative lipid transfer protein, vernalization-responsive and cold-induced. It is involved in priming the SAR and ISR responses, specifically in propagating the cell-to-cell mobile signal. The kinases MPK3 (AT3G45640) and MPK6 (AT2G43790) promote the accumulation of AZI1/EARLI1 at plastids during defense priming induction. The kinases MPK3 (AT3G45640) and MPK6 (AT2G43790) promote the accumulation of AZI1/EARLI1 at plastids during defense priming induction. |
AT2G25930 | Encodes a nuclear protein that is expressed rhythmically and interacts with phytochrome B to control plant development and flowering through a signal transduction pathway. Required component of the core circadian clock regardless of light conditions. |
AT5G62640 | nuclear targeted protein involved in flowering time regulation that affects flowering time independent of FLC |
AT5G04240 | Early Flowering 6 (ELF6) encodes a Jumonji N/C and zinc finger domain-containing protein that acts as a repressor in the photoperiod pathway. ELF6 interacts with BES1 in a Y2H assay, in vitro, and in Arabidosis protoplasts (based on BiFC). ELF6 may play a role in brassinosteroid signaling by affecting histone methylation in the promoters of BR-responsive genes. |
AT2G06210 | Encodes a yeast CTR9 homolog that is involved in the control of flowering time by elevating FLC expression to a level that creates the vernalization-responsive, winter-annual habit. Yeast CTR9 is a component of a five-member PAF1 complex that associates with RNA pol II and is thought to regulate gene expression by recruiting SET1 (a histone 3 Lys 4 [H3-K4] methyl transferase) to the initially transcribed [5'] regions of target chromatin. Mutants display reduced H3-K4 methylation in both FLC and FLM chromatin. Member of PAF-C complex. |
AT1G77300 | Encodes a protein with histone lysine N-methyltransferase activity required specifically for the trimethylation of H3-K4 in FLC chromatin (and not in H3-K36 dimethylation). Acts as an inhibitor of flowering specifically involved in the autonomous promotion pathway. EFS also regulates the expression of genes involved in carotenoid biosynthesis and nitrogen assimilation.Modification of histone methylation at the CRTISO locus reduces transcript levels 90%. The increased shoot branching seen in some EFS mutants is likely due to the carotenoid biosynthesis defect having an effect on stringolactones.Required for ovule, embryo sac, anther and pollen development. |
AT2G03500 | Encodes a nuclear localized member of the MYB family of transcriptional regulators that is involved in negative regulation of flowering. It is expressed in vascular tissues and at low levels in the shoot apex during the transition to flowering. Loss of function mutations are early flowering.EFM is involved in the autonomous, thermosensory and GA pathways and expression is directly regulated by SVP. EFM interacts with JMJD5 to repress FT expression. |
AT3G22840 | Encodes an early light-inducible protein. |
AT5G57920 | early nodulin-like protein 10;(source:Araport11) |
AT5G25090 | early nodulin-like protein 13;(source:Araport11) |
AT3G01070 | early nodulin-like protein 16;(source:Araport11) |
AT2G27035 | Has been classified as a stellacyanin. Has also been classified as an early nodulin-like protein (ENODL), because it does not have a His residue involved in Cu binding. ENODLs are proteins having one plastocyanin-like (PCNL) domain lacking the amino acid residues necessary for Cu binding. |
AT4G32490 | early nodulin-like protein 4;(source:Araport11) |
AT3G18590 | early nodulin-like protein 5;(source:Araport11) |
AT1G56410 | encodes a heat shock protein whose gene expression is induced by heat and dehydration. |
AT1G30360 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
AT1G02205 | Expression of the CER1 gene associated with production of stem epicuticular wax and pollen fertility. Biochemical studies showed that cer1 mutants are blocked in the conversion of stem wax C30 aldehydes to C29 alkanes, and they also lack the secondary alcohols and ketones. These suggested the CER1 protein is an aldehyde decarbonylase, but the exact molecular function of this protein remains to be determined. |
AT3G55360 | Enoyl-CoA reductase is involved in all very long chain fatty acids (VLCFA) elongation reactions that are required for cuticular wax, storage lipid and sphingolipid metabolism. The protein is located in the ER, but in contrast to its yeast homolog TSC13 is not particularly enriched in the nuclear envelope-vacuole junction. Mutants in this gene show abnormal organ morphology and stem glossiness. Cells in all tissues are only about 1/3 of the size of wild type cells. The morphological changes are most likely to result from the reduction in the VLCFA content of sphingolipids. Mutants also show abnormalities in the endocytic membrane organization and transport as well as reduced trichome papillae. |
AT5G57800 | encodes a transmembrane protein with similarity to the sterol desaturase family at the N-terminus and to the short-chain dehydrogenase/reductase family at the C-terminus. Mutant analyses indicate this protein is involved in cuticle membrane and wax biosynthesis. The mRNA is cell-to-cell mobile. |
AT4G33790 | Encodes an alcohol-forming fatty acyl-CoA reductase, involved in cuticular wax biosynthesis. Lines carrying recessive mutations are deficient in primary alcohol and have glossy stem surfaces. |
AT1G09330 | ECHIDNA localizes to the TGN, and has been shown to function in the vacuolar sorting pathway of cell wall components ,mucilage, and wax. |
AT1G80350 | encodes a p60 katanin protein that is expressed throughout the plant. Required for the specification of cell fates from early in development (in the meristem) through differentiation and for normal postmitotic organization of cortical microtubules into transverse arrays in root epidermis cells. Mutants display cytoskeletal defects. |
AT3G55830 | A member of the Glycosyltransferase Family 64, homologous to Poplar cambium-expressed GT64 gene. The EPC1 protein plays a critical role during plant development in maintaining the integrity of organs via cell-cell adhesion, thereby providing mechanical strength and facilitating the movement of metabolites throughout the plant.Loss of function specifically affects glycosylinositolphosphorylceramide (GIPC) mannosylation. |
AT5G48090 | EDM2-like protein1;(source:Araport11) |
AT2G21750 | Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion. |
AT5G15440 | EID1-like 1;(source:Araport11) |
AT3G63060 | EDL3 is an F-box protein involved that mediated the regulation of abscisic acid signalling. |
AT1G54270 | member of eIF4A - eukaryotic initiation factor 4A |
AT4G24800 | MA3 domain-containing protein;(source:Araport11) |
AT3G18910 | EIN2 targeting protein2;(source:Araport11) |
AT2G25490 | Encodes an F-box protein involved in the ubiquitin/proteasome-dependent proteolysis of EIN3. The mRNA is cell-to-cell mobile. |
AT5G25350 | Arabidopsis thaliana EIN3-binding F-box protein 2 (EBF2) mRNA. Part of the SCF complex, it is located in the nucleus and is involved in the ethylene-response pathway. |
AT1G50940 | Encodes the electron transfer flavoprotein ETF alpha, a putative subunit of the mitochondrial electron transfer flavoprotein complex (ETF beta is At5g43430.1) in Arabidopsis. Mutations of the ETF beta gene results in accelerated senescence and early death compared to wild-type during extended darkness. |
AT5G43430 | Encodes the electron transfer flavoprotein ETF beta, a putative subunit of the mitochondrial electron transfer flavoprotein complex (ETF alpha is At1g50940) in Arabidopsis. Mutations of the ETF beta gene result in accelerated senescence and early death compared to wild-type during extended darkness. Also involved in the catabolism of leucine and chlorophyll degradation pathway activated during darkness-induced carbohydrate deprivation. |
AT1G72630 | ELF4-like 2;(source:Araport11) |
AT1G75000 | ELO family protein. |
AT5G11260 | Basic leucine zipper (bZIP) transcription factor. Nuclear localization. Involved in light-regulated transcriptional activation of G-box-containing promoters. Negatively regulated by Cop1. Although cytokinins do not appear to affect the gene's promoter activity, they appear to stabilize the protein. HY5 plays a role in anthocyanin accumulation in far-red light and blue light, but not in red light or in the dark. Mutant studies showed that the gene product is involved in the positive regulation of the PHYA-mediated inhibition of hypocotyl elongation. Binds to G- and Z-boxes, and other ACEs, but not to E-box. Loss of function mutation shows ABA resistant seedling phenotypes suggesting involvement for HY5 in mediating ABA responses. Binds to the promoter of ABI5 and regulates its expression.Involved in the regulation of response to nutrient levels. |
AT1G49540 | elongator protein 2;(source:Araport11) |
AT4G10090 | elongator protein 6;(source:Araport11) |
AT3G48930 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT1G49400 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT1G79350 | Encodes the Arabidopsis thaliana orthologue of metazoan Strawberry notch, a highly conserved co-activator of the developmental regulator Notch. It mediates stress-induced chromatin memory by modulating nucleosome occupancy by interacting with chromatin remodeling proteins of the ISWI and SWI/SNF classes. |
AT1G48850 | Flavoenzyme-encoding gene essential for embryo development. |
AT2G26830 | Encodes a member of a small family of choline/ethanolamine kinases that is localized to the plasma membrane. Homozygous loss of function alleles are embryo lethal. Overexpression results in altered phospholipid levels suggesting a critical role in phospholipid biosynthesis. |
AT3G18110 | P-type pentatricopeptide repeat (PPR) factor involved in chloroplast gene expression and early plastid development. |
AT4G23250 | cysteine-rich receptor-like protein kinase 17;(source:Araport11) |
AT1G56200 | Encodes a chloroplast localized protein that is essential for chloroplast development. |
AT1G80260 | Spc97 / Spc98 family of spindle pole body (SBP) component;(source:Araport11) |
AT1G06150 | Encodes a LHW-like protein with 79% amino acid identity to LHW. |
AT5G37510 | Encodes a subunit of the 400 kDa subcomplex of the mitochondrial NADH dehydrogenase (complex I). The protein has been isolated in the male gametophyte. The mRNA is cell-to-cell mobile. |
AT1G78630 | Ribosomal protein L13 family protein;(source:Araport11) |
AT1G20960 | Similar to DEAD/DExH box ATP-dependent RNA helicase . Required for proper splicing of FLC. Mutants have reduced FLC levels and are early flowering. |
AT5G27720 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
AT1G67440 | Homolog of bacterial rsgA, functions in chloroplast ribosome biogenesis. |
AT4G09980 | Encodes a member of a core set of mRNA m6A writer proteins and is required for N6-adenosine methylation of mRNA. |
AT3G18390 | CRS1 / YhbY (CRM) domain-containing protein;(source:Araport11) |
AT2G28880 | ADCS encodes a protein that has two functional domains. The N-terminal domain has glutamine amidotransferase activity while the C-terminal domain has aminodeoxychorismate synthase (ADCS) activity. These two domains act together to catalyze the transformation of chorismate to 4-amino-4-deoxychorismate. This reaction is required for 4-aminobenzoate (pABA) production and ultimately for folate biosynthesis. The putative target peptide of ADCS can direct GFP to the chloroplast. |
AT1G10510 | RNI-like superfamily protein;(source:Araport11) |
AT3G05680 | Encodes a splicing/methylation factor that is a homologue to the mammalian VIRILIZER, is member of a core set of mRNA m6A writer proteins and is required for N6-adenosine methylation of mRNA. Analysis of transcriptional profiles of the vir-1 mutant suggests that VIR is likely involved in regulation of gene expression, but the function of VIR is rather general than specific and knock-down of VIR does not affect overall splicing rates. |
AT3G29290 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G16715 | protein EMBRYO DEFECTIVE 2247;(source:Araport11) |
AT4G04350 | tRNA synthetase class I (I, L, M and V) family protein;(source:Araport11) |
AT1G02780 | Ribosomal protein L19e family protein;(source:Araport11) |
AT2G25660 | Translocon at the inner-envelope membrane of chloroplasts which binds to the outer-membrane channel TOC75. |
AT1G08840 | Encodes a homolog of human and yeast DNA2. Mutants have increased sensitivity to DNA damage stress. |
AT1G24340 | A locus involved in embryogenesis. Mutations in this locus result in embryo lethality. The mRNA is cell-to-cell mobile. |
AT1G70070 | Allelic to ISE2(increased size exclusion limit of plasmodesmata 2). Mutants maintain dilated plasmodesmata at the embryonic torpedo stage. |
AT3G20440 | Encodes BE1, a putative glycoside hydrolase. Involved in organogenesis and somatic embryogenesis by regulating carbohydrate metabolism. Mutation in BE1 has pleotrophic effect on the whole plant development. |
AT5G02250 | Encodes a exoribonuclease involved in rRNA processing in mitochondria and chloroplasts.Loss of function mutations are pale green and require supplementation with sucrose for germination and early development. Plants are pale green due to defects in chloroplast biogenesis. |
AT5G55940 | Uncharacterized protein family (UPF0172);(source:Araport11) |
AT4G14590 | embryo defective 2739;(source:Araport11) |
AT3G20400 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT4G36630 | Vacuolar sorting protein 39;(source:Araport11) |
AT5G63050 | embryo defective 2759;(source:Araport11) |
AT2G17510 | ribonuclease II family protein;(source:Araport11) |
AT2G45000 | Encodes a nucleoporin, a component of the nuclear pore complex, that appears to be a major negative regulator of auxin signalling. Loss of function mutants are embryo lethal. |
AT5G05560 | Encodes a subunit of the Arabidopsis thaliana E3 ubiquitin ligase complex that plays a synergistic role with APC4 both in female gametogenesis and in embryogenesis. |
AT5G15540 | Encodes Adherin SCC2. Essential for viability. Required for normal seed development. Plays a role in the establishment of sister-chromatid cohesion and chromosome organization during meiosis. |
AT2G31060 | elongation factor family protein;(source:Araport11) |
AT4G27010 | ribosome 60S biogenesis amino-terminal protein;(source:Araport11) |
AT2G39080 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G67320 | DNA primase, large subunit family;(source:Araport11) |
AT4G19350 | embryo defective 3006;(source:Araport11) |
AT5G40480 | embryo defective 3012;(source:Araport11) |
AT1G05600 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G59990 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT4G02790 | Encodes a GTPase that is targeted to chloroplasts and co-fractionated with chloroplast ribosomes. Mutants are embryo lethal due to this essential function being lost. |
AT5G14320 | Ribosomal protein S13/S18 family;(source:Araport11) |
AT5G51200 | Originally identified as EDS4, enhanced disease sensitive phenotype and subsequently cloned and identified as NUCLEOPORIN205. Affects circadian clock and downstream genes including those involved in defense response. |
AT5G27270 | P-type PPR chloroplast localized protein required for group II intron splicing in chloroplasts. |
AT2G35950 | embryo sac development arrest 12;(source:Araport11) |
AT3G60360 | embryo sac development arrest 14;(source:Araport11) |
AT1G61140 | SNF2 domain-containing protein / helicase domain-containing protein / zinc finger protein-like protein;(source:Araport11) |
AT2G18080 | Serine carboxypeptidase S28 family protein;(source:Araport11) |
AT2G34860 | DnaJ-like zinc finger domain-containing protein which regulates the assembly of photosystem I (PSI) and seed development. |
AT4G33050 | Encodes a calmodulin-binding protein involved in stomatal movement. |
AT3G03650 | Exostosin family protein;(source:Araport11) |
AT2G36640 | Encodes putative phosphotyrosine protein belonging to late embryogenesis abundant (LEA) protein in group 3 that might be involved in maturation and desiccation tolerance of seeds. RFLP and CAPS mapping place it on chromosome 4 but the nucleotide sequence maps it to chromosome 2. |
AT5G51230 | Polycomb group protein with zinc finger domain involved in negative regulation of reproductive development. Forms a complex with FIE, CLF, and MSI1. This complex modulates the expression of target genes including AG, PI and AP3. |
AT4G02440 | EID1 is an F-box protein that functions as a negative regulator in phytochrome A (phyA)-specific light signalling. Expressed at all stages of plant development independently of light conditions, localizes to the nucleus, and forms nuclear speckles under continuous far-red light. Forms stable dimeric and trimeric complexes with several ASK proteins and Cullin1 in yeast and in planta. |
AT3G12140 | Agenet domain containing nucleosome binding protein. Binds H3K36 sites. |
AT5G06780 | Emsy N Terminus (ENT)/ plant Tudor-like domains-containing protein;(source:Araport11) |
AT5G13020 | Agenet domain containing nucleosome binding protein. Binds H3K36 sites. |
AT2G44440 | Emsy N Terminus (ENT) domain-containing protein;(source:Araport11) |
AT1G32280 | Encodes a homolog of the barley endosperm-specific gene END1 with seed and pollen specific expression. |
AT5G01930 | Encodes a endo-beta-mannanase involved in seed germination. |
AT5G05460 | Encodes a cytosolic beta-endo-N-acetyglucosaminidase (ENGase). ENGases N-glycans cleave the O-glycosidic linkage between the two GlcNAc residues of the N-glycan core structure and thus generate a protein with a single GlcNAc attached to asparagine. |
AT4G21590 | Encodes a putative endonuclease but no demonstrable endonuclease activity, either towards single stranded DNA or mismatches, has been seen in vitro. Activated by AGAMOUS in a cal-1, ap1-1 background. Expressed in the floral meristem and during stamen development. |
AT2G21600 | Key player of retrieval of ER membrane proteins The mRNA is cell-to-cell mobile. |
AT1G10130 | Encodes a golgi localized P2A-type Ca2+ ATPase involved in Mn nutrition and homeostasis. |
AT1G64360 | SAQR is a clade specific protein present in single copy in Arabidopsis.It's expression is increased during light induced oxidative stress ,drought stress and also during senescence. Promoter contains two AGL15 binding sites. |
AT4G19040 | Encodes a PH and START domain-containing protein that mediates resistance to pathogenic fungi. Resistance requires salicylic acid signalling. Mutants are resistant to E. cichoracearum. Expressed throughout plant tissues and possibly localized to membranes /mitochondrion. |
AT5G05190 | hypothetical protein (DUF3133);(source:Araport11) |
AT1G74710 | Encodes a protein with isochorismate synthase activity. Mutants fail to accumulate salicylic acid. Its function may be redundant with that of ICS2 (AT1G18870). |
AT5G55390 | Encodes EDM2 (enhanced downy mildew 2). The predicted protein bears typical features of transcriptional regulators. EDM2 contains two putative bipartite nuclear localization signals (NLS) two zinc-finger-like motifs, a Proline-rich region and a large aspartic acid-rich region. Both zinc-finger-like stretches resemble the PHD (plant homeodomain) finger motif. Mutations in EDM2 comprise RPP7 mediated resistance against Hyaloperonospora parasitica isolate Hiks1 (HpHiks1). EDM2 may function as a direct or indirect regulator of RPP7 expression. |
AT2G41070 | Transcription factor homologous to ABI5. Regulates AtEm1 expression by binding directly at the AtEm1 promoter. Located in the nucleus and expressed during seed maturation in the cotyledons and later in the whole embryo. |
AT1G17440 | Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. The gene product is an EIN3-interacting TFIID transcription factor required for proper ethylene response, including ERF1 induction. Loss of function mutants show enhanced response to ethylene. Located in nucleus and expressed throughout the plant. Required for ERF1 expression. Cytokinin-hypersensitive 1 (CKH1) mutants are characterized by rapidly growing calli with a green color at low levels of cytokinins, which are insufficient to induce such cytokinin responses in wild-type explants. It is hypothesized that CKH1 acts as a negative regulator of cytokinin signaling in Arabidopsis. |
AT5G40280 | encodes a beta subunit of farnesyl-trans-transferase, which is involved in meristem organization and ABA-mediated signal transduction pathway. Mutant phenotypes have been observed in meristem organization, and response to abscisic acid and drought. The mRNA is cell-to-cell mobile. |
AT1G73840 | Resembles the CstF64 family of RNA processing factors that are conserved between yeast and mammals. In mammals, CstF64 is a component of the CstF complex which is required for mRNA 3'end formation along with other factors. |
AT1G32490 | Encodes a homolog of the yeast PRP2 protein, one of four related DEAH RNA helicases identified as essential cofactors for RNA splicing. Involved in ABI4-regulated ABA signaling under high glucose condition in early seedling growth. |
AT5G01400 | Encodes a Symplekin/Pta1 homologue which would have the potential to interact with either ESP1 or AtCstF64. |
AT5G22090 | EAR1 is a negative regulator of ABA signaling that enhances the activity of all six clade A PP2Cs (ABI1, ABI2, HAB1, HAB2, AHG1, AHG3) by interacting with and releasing the N-terminal autoinhibition of these proteins. EAR1 indirectly affects OST1 activity through enhancing ABI1 activity. The EAR1 141-287 fragment is sufficient for the functioning of EAR1 in ABA responses; the 131-248 region harbors an intrinsically disordered region and only 249-278 can form a predicted regular structure. EAR1 is located in the ER, nuclei, and cytoplasm; ABA signaling promotes the translocation of EAR1 from the ER and/or cytoplasm to the nucleus. Mutations showed that it functions in seed germination, primary root growth, and drought tolerance. |
AT3G12680 | Member of the floral homeotic AGAMOUS pathway. |
AT3G42660 | Ctf4 related nuclear protein. Interacts with LHP1-PRC2 to maintain H3K27 methylation in rapidly dividing cells. EOL1 expression is restricted to rapidly dividing cells. |
AT1G12980 | Encodes an AP2/ERF protein, is expressed in a subdomain of meristem stem cells, in lateral organ anlagen, and transiently in the distal domain of organ primordia. It is a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ESR1). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. Can confer cytokinin-independent shoot formation and causes severe meristem defects when overexpressed in Arabidopsis root explants. Involved in controlling embryogenesis and embryo patterning by interaction with PHAVOLUTA. |
AT5G17170 | rubredoxin family protein;(source:Araport11) |
AT1G01380 | ETC1 is involved in trichome and root hair patterning in Arabidopsis. |
AT1G60550 | enoyl-CoA hydratase/isomerase D;(source:Araport11) |
AT1G34245 | Encodes a secretory peptide EPF2 expressed in proliferating cells of the stomatal lineage, known as meristemoids, and in guard mother cells, the progenitors of stomata. Controls asymmetric cell divisions during stomatal development. EPF2 is related to EPF1, also involved in stomatal development. Its transcript levels change after inducing MUTE expression in a mute background. EPF2 binds to the ER receptor triggering MAPK activation that in turn inhibits stomatal development. EPF2 competes with STOMAGEN for binding to receptor protein kinases ER, and TMM. |
AT3G13898 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
AT3G14210 | A semidominant QTL which has an epistatic effect on the Epithiospecifier gene. Represses nitrile formation and favors isothiocyanate production during glucosinolate hydrolysis. The functional allele deters the insect herbivory T. ni. |
AT3G20290 | Encodes AtEHD1, one of the Arabidopsis Eps15 homology domain proteins involved in endocytosis (AtEHD2, At4g05520). |
AT4G05520 | Encodes AtEHD2, one of the Arabidopsis Eps15 homology domain proteins involved in endocytosis (AtEHD1, At3g20290). |
AT4G05110 | equilibrative nucleoside transporter 6;(source:Araport11) |
AT1G61630 | equilibrative nucleoside transporter 7;(source:Araport11) |
AT4G00900 | Type IIA (SERCA-type) Ca2+ ATPase, catalyzes the efflux of calcium from the cytoplasm. |
AT1G08920 | Encodes ESL1, a transporter for monosaccharides. |
AT5G62230 | Encodes a receptor-like kinase that, together with ER and ERL2 governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. It is important for maintaining stomatal stem cell activity and preventing terminal differentiation of the meristemoid into the guard mother cell. Along with erl2 functionally compensates for loss of erecta during integument development. Its transcript levels change after inducing MUTE expression in a mute background. |
AT2G20880 | Encodes ERF53, a drought-induced transcription factor. Belongs to the AP2/ERF superfamily, and has a highly conserved AP2 domain. Regulates drought-responsive gene expressions by binding to the GCC box and/or dehydration-responsive element (DRE) in the promoter of downstream genes. Overexpression of AtERF53 driven by the CaMV35S promoter resulted in an unstable drought-tolerant phenotype in T2 transgenic plants. Involved in heat shock response. |
AT1G28360 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ERF12). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. Regulates floral development. |
AT5G44210 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-9). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
AT2G35700 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Thought to be involved in secondary cell wall metabolism. |
AT1G44830 | Encodes a nuclear-localized member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. Overexpression in cultured cells results in an increase in pectin deposition.ERF014 differentially regulates responses to bacterial and fungal pathogens. |
AT2G01480 | ESMD1 is a golgi localized putative O-fucosyltransferase. |
AT1G47370 | RBA1 variant in Ag0 background is a TIR-only receptor protein that binds to the bacterial type III effector protein HopBA. The Col-0 variant, which is not expressed, is likely a psuedogene and more highly methylated than the Ag0 variant which is expressed. |
AT5G43060 | Peptidase, activity detected in extracts of root, leaf and cell culture. |
AT5G42950 | EXA1 is a GYF domain-containing gene of the SMY2 subgroup. Mutants exhibit resistance to potexviruses. |
AT2G21800 | Forms a complex with MUS81 that functions as endonuclease in DNA recombination and repair processes. |
AT4G29960 | EBS7 encodes a plant specific, endoplasmic reticulum localized protein that is involved in endoplasmic reticulum-associated degradation (ERAD). It interacts with the ERAD component AtHRD1a and may regulate HRD1a stability. Identified in a screen for supressors of a mutation in bri1 that causes bri1 to be retained in the ER. Loss of EBS7 function restores BR sensitivity in the bri1-9 mutant allele. |
AT2G25820 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
AT3G04580 | Ethylene receptor, subfamily 2. Has serine kinase activity. |
AT3G23150 | Involved in ethylene perception in Arabidopsis The mRNA is cell-to-cell mobile. |
AT5G51190 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture and the response to cold stress. |
AT5G07310 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Cytokinin production induced by jasmonate represses adventitious rooting. |
AT3G16280 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
AT1G72360 | Encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12. |
AT4G28140 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. Regulated by heat shock. |
AT1G17870 | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442?454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171?179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria. Mediates chloroplastic ROS homeostasis and promotes retrograde signaling in response to salt stress. |
AT1G05010 | Encodes 1-aminocyclopropane-1-carboxylate oxidase |
AT3G20770 | Encodes EIN3 (ethylene-insensitive3), a nuclear transcription factor that initiates downstream transcriptional cascades for ethylene responses. EIN3 interacts with MYC2, MYC3 and MYC4 to inhibit jasmonate-induced expression of wound-responsive genes and herbivory-inducible genes, and plant defense against generalist herbivores. |
AT1G73730 | Encodes a putative transcription factor involved in ethylene and sulfate starvation signalling. Isolated DNA binding domain has been shown to bind DNA in vitro. |
AT2G31230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
AT3G16770 | Encodes a member of the ERF (ethylene response factor) subfamily B-2 of the plant specific ERF/AP2 transcription factor family (RAP2.3). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12.It is localized to the nucleus and acts as a transcriptional activator through the GCC-box. It has been identified as a suppressor of Bax-induced cell death by functional screening in yeast and can also suppress Bax-induced cell death in tobacco plants. Overexpression of this gene in tobacco BY-2 cells confers resistance to H2O2 and heat stresses. Overexpression in Arabidopsis causes upregulation of PDF1.2 and GST6. It is part of the ethylene signaling pathway and is predicted to act downstream of EIN2 and CTR1, but not under EIN3. The mRNA is cell-to-cell mobile. |
AT3G60490 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
AT2G33860 | ettin (ett) mutations have pleiotropic effects on Arabidopsis flower development, causing increases in perianth organ number, decreases in stamen number and anther formation, and apical-basal patterning defects in the gynoecium. The ETTIN gene encodes a protein with homology to DNA binding proteins which bind to auxin response elements. ETT transcript is expressed throughout stage 1 floral meristems and subsequently resolves to a complex pattern within petal, stamen and carpel primordia. ETT probably functions to impart regional identity in floral meristems that affects perianth organ number spacing, stamen formation, and regional differentiation in stamens and the gynoecium. During stage 5, ETT expression appears in a ring at the top of the floral meristem before morphological appearance of the gynoecium, consistent with the proposal that ETT is involved in prepatterning apical and basal boundaries in the gynoecium primordium. It is a target of the ta-siRNA tasiR-ARF. ETT is also a target of AP2; integrateing the functions of AGAMOUS and APETALA2 in floral meristem determinacy. Positive regulation of drought stress response genes. |
AT1G13950 | Encodes eukaryotic translation initiation factor 5A (EIF-5A).In mammalian cells it functions as a shuttle protein that translocates mRNA from the nucleus to cytoplasmic ribosomes. Overexpression results in an increase in both primary and secondary xylem formation. In RNAi suppressed lines, xylem formation is reduced. |
AT3G19760 | Encodes an RNA helicase that may be a component of the Exon Junction Complex. Subcellular localization is modulated by stress. Under normal conditions it is localized to the nuceloplasm but under hyopoxic conditions it localizes to the nucleolus and splicing speckles. |
AT2G39820 | Translation initiation factor IF6;(source:Araport11) |
AT1G04170 | protein synthesis initiation factor eIF2 gamma The mRNA is cell-to-cell mobile. |
AT3G22860 | member of eIF3c - eukaryotic initiation factor 3c |
AT5G25780 | member of eIF3b - eukaryotic initiation factor 3b |
AT3G56150 | member of eIF3c - eukaryotic initiation factor 3c |
AT3G57290 | Encodes a protein that is found in not only the eif3 complex but also in association with subunits of the COP9 signalosome. eIF3e appears to be subjected to proteasome-dependent degradation that requires the PCI domain of eIF3e. The level of eIF3e present in cells appears to affect the rate of translation. |
AT3G11400 | One of the 2 genes that code for the G subunit of eukaryotic initiation factor 3 (EIF3). The mRNA is cell-to-cell mobile. |
AT3G13920 | eukaryotic translation initiation factor 4A-1 |
AT1G29590 | translation initiation factor;(source:Araport11) |
AT3G60240 | protein synthesis initiation factor 4G (EIF4G). A mutation in this gene (cum2-1) results in decreased accumulation of CMV coat protein in upper, uninoculated leaves. Likely affects cell-to-cell movement of the virus, also affects TCV multiplication. |
AT2G24050 | Encodes a putative eukaryotic translation initiation factor. |
AT3G53890 | Cytosolic ribosomal protein. Mutants enhance the varigation effect of var2 mutations suggesting a link between cytosolic translation and chloroplast development. |
AT5G61020 | YTHDF protein which togeteher with ECT2 and ECT4 is involved in cell proliferation during plant organogenesis. |
AT1G55500 | YTHDF protein which togeteher with ECT2 and ECT3 is involved in cell proliferation during plant organogenesis. |
AT1G48110 | evolutionarily conserved C-terminal region 7;(source:Araport11) |
AT1G79270 | evolutionarily conserved C-terminal region 8;(source:Araport11) |
AT5G07280 | Encodes EMS1 (EXCESS MICROSPOROCYTES1), a putative leucine-rich repeat receptor protein kinase that controls somatic and reproductive cell fates in Arabidopsis anther. |
AT5G12370 | exocyst complex component sec10;(source:Araport11) |
AT3G56640 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
AT1G47550 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. It binds phosphoinositide lipids. |
AT1G76850 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. The mRNA is cell-to-cell mobile. |
AT5G52340 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT5G50380 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT4G31540 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT3G55150 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT2G28650 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT2G17230 | EXORDIUM like 5;(source:Araport11) |
AT5G42540 | Encodes a protein with similarity to yeast 5'-3'exonucleases and can functionally complement the yeast mutations. In Arabidopsis XRN2 acts as a suppressor of posttranscriptional gene silencing. |
AT1G54490 | Involved in the ethylene response. XRN4 does not appear to regulate ethylene signaling via an RNA-INDUCED SILENCING COMPLEX-based RNA silencing mechanism but acts by independent means. Endogenous suppressor of posttranscriptional gene silencing. The mRNA is cell-to-cell mobile. |
AT1G20190 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT1G69530 | Member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
AT3G03220 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT5G56320 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT2G03090 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
AT5G39260 | expansin-like protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT5G39310 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT2G28950 | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
AT1G12560 | Member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Containing a conserved root hair-specific cis-element RHE. Expressed specifically in root hair cell and involved in root hair elongation. |
AT5G02260 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT2G20750 | member of BETA-EXPANSINS. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT3G03110 | Encodes a member of the exportin family (XPO1B)which function as receptors for nuclear transport.Along with XPO1A involved in the development of male and female gametophytes. |
AT5G35190 | proline-rich extensin-like family protein;(source:Araport11) |
AT2G43150 | Proline-rich extensin-like family protein;(source:Araport11) |
AT4G08380 | Proline-rich extensin-like family protein;(source:Araport11) |
AT2G24980 | Proline-rich extensin-like family protein;(source:Araport11) |
AT4G08400 | Proline-rich extensin-like family protein;(source:Araport11) |
AT4G08410 | Proline-rich extensin-like family protein;(source:Araport11) |
AT3G57630 | Encodes a glycoprotein glycosyl transferase ExAD. Knockout mutants show truncated root hair phenotype. |
AT1G12090 | extensin-like protein (ELP) |
AT1G31930 | Encodes XLG3 (extra-large G protein 3) that shows significant similarity to the G protein alpha subunit in its C terminal region. Involved in the regulation of root morphological and growth responses. |
AT1G75910 | Member of Lipase proteins. Involved in lipid metabolism and pollen wall formation. DYT1 and bHLH089 specifically recognize the TCATGTGC box to activate expression. |
AT3G14100 | Triple RNA Recognition Motif protein involved in the dynamic and reversible aggregation of translationally repressed mRNAs during hypoxia.During hypoxia, UBP1C association with non? uracil-rich mRNAs is enhanced concomitant with its aggregation into microscopically visible cytoplasmic foci, referred to as UBP1 stress granules (SGs). This mRNA association occurs as global levels of protein synthesis decline during hypoxia. Upon reoxygenation, rapid UBP1 SG disaggregation coincides with the return of the stabilized mRNAs to polysomes. |
AT1G21760 | This gene is predicted to encode an F-box protein that is evolutionarily conserved between Arabidopsis and other eukaryotes including S.cerevisiae and humans. It may play a role in regulating translation under conditions of temperature stress. FBP7 transcript levels are increased at high and low temperatures. The mRNA is cell-to-cell mobile. |
AT4G05010 | F-box family protein;(source:Araport11) |
AT2G24250 | LOW protein: F-box/kelch-repeat protein (DUF295);(source:Araport11) |
AT2G26160 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
AT3G25750 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
AT5G24040 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
AT1G57906 | F-box protein;(source:Araport11) |
AT1G64840 | LOW protein: F-box/kelch-repeat protein (DUF295);(source:Araport11) |
AT2G05970 | F-box protein (DUF295);(source:Araport11) |
AT2G24080 | F-box protein (DUF295);(source:Araport11) |
AT3G03726 | F-box/kelch-repeat protein, putative (DUF295);(source:Araport11) |
AT1G27540 | F-box protein (DUF295);(source:Araport11) |
AT4G10820 | F-box family protein;(source:Araport11) |
AT4G14165 | F-box family protein-like protein;(source:Araport11) |
AT4G22030 | F-box protein with a domain protein;(source:Araport11) |
AT1G27550 | F-box family protein;(source:Araport11) |
AT5G25290 | F-box protein (DUF295);(source:Araport11) |
AT5G38270 | F-box family protein;(source:Araport11) |
AT1G27580 | F-box protein (DUF295);(source:Araport11) |
AT2G04810 | F-box only protein (DUF295);(source:Araport11) |
AT1G80790 | Belongs to a subgroup of SGS3-like proteins that act redundantly in RNA-directed DNA methylation: AT1G15910 (FDM1), AT4G00380 (FDM2), AT3G12550 (FDM3), AT1G13790 (FDM4), AT1G80790 (FDM5). The mRNA is cell-to-cell mobile. |
AT1G26380 | Functions in the biosynthesis of 4-hydroxy indole-3-carbonyl nitrile (4-OH-ICN), a cyanogenic phytoalexin in Arabidopsis. FOX1 acts as a dehydrogenase on indole cyanohydrin to form indole carbonyl nitrile. |
AT3G24140 | Encodes a basic helix-loop-helix transcription factor whose activity is required to promote differentiation of stomatal guard cells and to halt proliferative divisions in their immediate precursors. It fulfills its role through recruitment of the Arabidopsis Retinoblastoma homologue, RETINOBLASTOMA-RELATED (RBR). Both transcript and protein are expressed in and are required for halting divisions at the end of the stomatal lineage. It also has a role in the promotion of guard cell fate and in controlling the transition from guard mother cell to guard cell. Its transcript levels change after inducing MUTE expression in a mute background. |
AT4G14970 | Encodes a protein that is required for meiotic homologous recombination and acts in parallel to both MUTS HOMOLOG 4 (AtMSH4), known for its role in promoting interfering cross-overs (COs) and MMS AND UV SENSITIVE 81 (AtMUS81), known for its role in the formation of non-interfering COs. |
AT1G03170 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
AT5G19260 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
AT2G37678 | Positive regulator of photomorphogenesis in far-red light. Most abundant in young seedlings in the dark. Downregulated in the light and older as plants develop. Localized in the nucleus and the cytoplasm. Nuclear localization strongest in the dark. Degraded through the 26S proteasome. Regulated by PHYA. It is specifically required for the light-regulated nuclear accumulation of phyA ( but not phyB) likely by shuttling PHYA into the nucleus. |
AT4G15090 | Encodes a nuclear localized protein involved in far red light response signaling. Loss of function mutants are defective in far red light responses. For example:prevents leaf senescence under high ratio of red/far-red light conditions.Interacts with homologous gene FHY3. |
AT5G02200 | Encodes a small plant-specific protein with both nuclear localization and nuclear export signals that is specifically required, together with FHY1, for the light-regulated nuclear accumulation of phyA. |
AT5G28530 | FAR1-related sequence 10;(source:Araport11) |
AT2G32250 | FAR1-related sequence 2;(source:Araport11) |
AT2G27110 | FAR1-related sequence 3;(source:Araport11) |
AT3G44860 | Encodes a farnesoic acid carboxyl-O-methyltransferase. The mRNA is cell-to-cell mobile. |
AT5G47770 | Encodes a protein with farnesyl diphosphate synthase activity. |
AT5G63530 | Farnesylated protein that binds metals. |
AT1G65470 | Chromatin Assembly Factor-1 (CAF-1) p150 subunit. Mutants have reduced heterochromatin content. In Arabidopsis, the three CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1, respectively. Mutations in FAS1 or FAS2 lead to increased frequency of homologous recombination and T-DNA integration in Arabidopsis. |
AT1G33390 | Over-expression of this gene results in stem fasciation. The predicted amino acid sequence reveals the presence of two domains (DEXH-box or DEAD-box helicase and DUF1065 domain) and fragments of two more domains (HrpA domain and HA2 domain). |
AT2G20520 | fasciclin-like arabinogalactan-protein 6 (Fla6). Possibly involved in embryogenesis and seed development. |
AT4G31370 | fasciclin-like arabinogalactan-protein, putative (FLA5) |
AT5G60490 | Encodes a member of fasciclin-like arabinogalactan proteins (FLAs) containing a cell adhesion fasciclin (FAS) domain. Mutations result in altered stem biomechanics with reduced tensile strength and reduced tensile modulus of elasticity, as well as altered cell wall architecture and composition, with increased cellulose microfibril angle, reduced arabinose, galactose and cellulose content. Possibly involved in embryogenesis and seed development. |
AT2G04780 | fasciclin-like arabinogalactan-protein 7 (Fla7). Possibly involved in embryogenesis and seed development. |
AT5G18580 | fass mutants have aberrant cell shapes due to defects in arrangement of cortical microtubules. Encodes a protein highly conserved in higher plants and similar in its C-terminal part to B' regulatory subunits of type 2A protein phosphatases. Interacts with an Arabidopsis type A subunit of PP2A in the yeast two-hybrid system. |
AT3G25110 | Encodes a FatA acyl-ACP thioesterase |
AT5G64440 | AtFAAH (fatty acid amide hydrolase) modulates endogenous NAEs (N-Acylethanolamines) levels in plants by hydrolyzing NAEs to ethanolamine and their corresponding free fatty acids. NAE depletion likely participates in the regulation of plant growth. The mRNA is cell-to-cell mobile. |
AT1G74960 | Encodes a plastidic beta-ketoacyl-ACP synthase II, involved in fatty acid elongation from 16:0-ACP to 18:0-ACP. Homozygous knock-out mutants are embryo lethal, indicating early embryo development is sensitive to elevated 16:0. |
AT3G12120 | Major enzyme responsible for the synthesis of 18:2 fatty acids in the endoplasmic reticulum. Contains His-rich motifs, which contribute to the interaction with the electron donor cytochrome b5. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
AT2G29980 | Endoplasmic reticulum enzyme responsible for the synthesis of 18:3 fatty acids from phospholipids. Uses cytochrome b5 as electron donor. |
AT3G15850 | Chloroplastic enzyme responsible for the synthesis of 16:1 fatty acids from galactolipids and sulpholipids. Uses ferredoxin as electron donor. The mRNA is cell-to-cell mobile. |
AT4G30950 | Chloroplastic enzyme responsible for the synthesis of 16:2 and 18:2 fatty acids from galactolipids, sulpholipids and phosphatidylglycerol. Uses ferredoxin as electron donor. Gene mutation resulted in reduced level of unsaturated fatty acids leading to susceptibility to photoinhibition. |
AT3G57280 | Encodes a chloroplast inner envelope localized member of the Tmemb_14 gene family. FAX1 is involved in fatty acid and lipid homeostasis and likely functions as a fatty acid transporter that exports fatty acids from the plastid. The mRNA is cell-to-cell mobile. |
AT4G20870 | encodes a fatty acid hydroxylase, required for the AtBI-1-mediated suppression of programmed cell death. |
AT5G22500 | Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. |
AT3G44550 | Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. The mRNA is cell-to-cell mobile. |
AT5G22420 | fatty acid reductase 7;(source:Araport11) |
AT3G44560 | fatty acid reductase 8;(source:Araport11) |
AT3G23410 | Encodes a fatty alcohol oxidase. |
AT5G11460 | FCS like zinc finger 10 is induced during energy starvation through SnRK1 signaling. Mutants accumulate more SnRK1alpha1 which results in the inhibition of seedling growth under favorable growth conditions. Increased SnRK1 activity in the mutant also results in the downregulation of TOR signaling (DOI:10.1111/tpj.13854). |
AT1G78020 | FCS like zinc finger 6 is induced during energy starvation through SnRK1 signaling. Mutants accumulate more SnRK1alpha1 which results in the inhibition of seedling growth under favorable growth conditions. Increased SnRK1 activity in the mutant also results in the downregulation of TOR signaling (DOI:10.1111/tpj.13854). |
AT5G51100 | Fe superoxide dismutase whose mRNA levels are increased in response to exposure to UV-B. |
AT1G47400 | Involved in regulation of iron deficiency response genes. Overexpression results in hyperaccumulation of Fe and Mn. |
AT2G28160 | Encodes a putative transcription factor that regulates iron uptake responses. mRNA is detected in the outer cell layers of the root and accumulates in response to iron deficiency. The expression of many iron-regulated genes is dependent on FIT1. It specifically regulates FRO2 at the level of mRNA accumulation and IRT1 at the level of protein accumulation.Similar to FER in tomato and is a regulator of iron uptake. It is post-transcriptionally controlled. |
AT3G51550 | Encodes a synergid-expressed, plasma-membrane localized receptor-like kinase that accumulates asymetrically in the synergid membrnane at the filiform apparatus and mediates male-female gametophyte interactions during pollen tube reception. Also involved in powdery mildew infection. Mutants show faster root elongation under dim light, the protein is required for intracellular accumulation of AHA2 under dim-light growth conditions. Positively regulates flowering by modulating the transcript accumulation and mRNA alternative splicing of certain flowering-related genes, including FLOWERING LOCUS C (FLC) and its homolog MADS AFFECTING FLOWERING (MAF). However, the RALF1 ligand negatively regulates flowering compared with FER. |
AT1G20020 | Encodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the stroma The mRNA is cell-to-cell mobile. |
AT5G23440 | ferredoxin/thioredoxin reductase subunit A (variable subunit) 1;(source:Araport11) |
AT1G01590 | Encodes a ferric-chelate reductase that is expressed at extremely low levels in Fe deficiency-induced seedlings. |
AT1G01580 | Encodes the low-iron-inducible ferric chelate reductase responsible for reduction of iron at the root surface. It is likely to be the major Fe(III) chelate reductase in Arabidopsis iron metabolism. Coordinately regulated with IRT1, the major transporter responsible for high-affinity iron uptake from the soil, at both transcriptional and posttranscriptional levels. Steady state mRNA levels are regulated by several metals. Its transcription is regulated by FIT1. |
AT1G23020 | Encodes a ferric chelate reductase whose transcription is regulated by FIT1. Expressed in the root, shoot, flower and cotyledon. |
AT5G23980 | Encodes a ferric chelate reductase that is expressed at low levels in roots,shoots and cotyledons, but not flowers. Its transcription is regulated by FIT1. |
AT5G23990 | Encodes a ferric chelate reductase that is expressed at low levels in roots,shoots and flowers, but not cotyledons. |
AT3G56090 | Encodes FERRITIN 3, AtFER3. Ferritins are a class of 24-mer multi-meric proteins found in all kingdoms of life. Function as the main iron store in mammals. Evidence suggests that Arabidopsis ferritins are essential to protect cells against oxidative damage, but they do not constitute the major iron pool. |
AT2G30390 | Encodes one of two ferrochelatase genes in Arabidopsis. Ferrochelatase is the terminal enzyme of heme biosynthesis. FC-II is speculated to operate in photosynthetic cytochromes. |
AT4G36220 | encodes ferulate 5-hydroxylase (F5H). Involved in lignin biosynthesis. |
AT3G27120 | Encodes a conserved AAA-ATPase that acts as a negative regulator of meiotic CO formation. |
AT4G22910 | FIZZY-related 2;(source:Araport11) |
AT4G25340 | Encodes a member of the FKBP-type immunophilin family that functions as a histone chaparone. Binds to 18S rDNA and represses its expression. The N-terminal nucleoplasmin domain interacts with H2A/H2B and H3/H4 histone oligomers, individually, as well as simultaneously, suggesting two different binding sites for H2A/H2B and H3/H4. |
AT5G64350 | Encodes FK506-binding protein 12 (FKBP12 or FKP12). FKP12 overexpression dramatically enhances rapamycin sensitivity, whereas rapamycin inhibition is relieved in transgenic plants deficient in FKP12. |
AT5G45680 | Peptidyl-Prolyl Isomerase located in chloroplast thylakoid lumen The mRNA is cell-to-cell mobile. |
AT1G12200 | Putative flavin monooxygenase. |
AT1G62570 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
AT5G54500 | Encodes a flavin mononucleotide-binding flavodoxin-like quinone reductase that is a primary auxin-response gene. |
AT5G08640 | Encodes a flavonol synthase that catalyzes formation of flavonols from dihydroflavonols. Co-expressed with CHI and CHS (qRT-PCR). |
AT5G63580 | encodes a protein whose sequence is similar to flavonol synthase |
AT2G30120 | protein FLC EXPRESSOR;(source:Araport11) |
AT3G19980 | Encodes catalytic subunit of serine/threonine protein phosphatase 2A. It can associate with phytochromes A and B in vitro. Mutant plants display an accelerated flowering phenotype.Acts antagonistically to SnRK2 to regulate ABI5 phosphorylation. It inteacts with NRP which results in tethering to endosomes leading to its degradation. |
AT1G51140 | Encodes a basic helix-loop-helix-type transcription factor involved in photoperiodism flowering. Binds to the E-box cis-element in the CONSTANS (CO) promoter to regulate flowering. Interacts with CFL1 and along with CFLAP2 negatively regulates cuticle development. Binds to the potassium channel gene KAT1 as a dimer. The DNA-binding capacity is inhibited in response to ABA through phosphorylation-dependent monomerization. |
AT2G42280 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT4G16280 | Involved in the promotion of the transition of the vegetative meristem to reproductive development. Four forms of the protein (alpha, beta, delta and gamma) are produced by alternative splicing. Involved in RNA-mediated chromatin silencing. At one point it was believed to act as an abscisic acid receptor but the paper describing that function was retracted. |
AT3G04610 | RNA-binding KH domain-containing protein;(source:Araport11) |
AT1G65480 | FT, together with LFY, promotes flowering and is antagonistic with its homologous gene, TERMINAL FLOWER1 (TFL1). Together with TSF, it plays an antagonistic role to TFL1 in the determination of inflorescence meristem identity. FT is expressed in leaves and is induced by long day treatment. Either the FT mRNA or protein is translocated to the shoot apex where it induces its own expression. Recent data suggests that FT protein acts as a long-range signal. FT is a target of CO and acts upstream of SOC1. |
AT5G24860 | encodes a small protein of 12.6 kDa that regulates flowering and is involved in gibberellin signalling pathway. It is expressed in apical meristems immediately after the photoperiodic induction of flowering. Genetic interactions with flowering time and floral organ identity genes suggest that this gene may be involved in modulating the competence to flower. There are two other genes similar to FPF1, FLP1 (At4g31380) and FLP2 (no locus name yet, on BAC F8F16 on chr 4). This is so far a plant-specific gene and is only found in long-day mustard, arabidopsis, and rice. |
AT4G28370 | Encodes an E3 ubiquitin ligase that is involved in plant cell wall modification, seed mucilage extrusion, and controls the degree of pectin methylesterification in seed mucilage. fly1 mutant seeds release more compact mucilage capsules and detached outer tangential primary walls when hydrated in water. Fly1 is located in the endomembrane system, likely localized in late endosome/multivesicular bodies/prevacular compartment. It has been shown to ubiquitinate proteins in conjunction with UBA1 and UBC8. |
AT4G15060 | FBD, F-box/LRR protein;(source:Araport11) |
AT3G63300 | Encodes a pleckstrin homology domain- and DUF828-containing protein. Mutants have defects in leaf vascular pattering, with vascular bundles that fail to meet distally in both the cotyledons and leaves. Necessary to the formation of the closed leaf vascular pattern characteristic of dicot leaves in response to auxin. Redundant with FKD2. FKD1 may influence PIN1 localization in an auxin dependent manner. proposed to be a key component of the auxin canalization pathway. FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
AT4G17350 | FORKED-LIKE family member, part of Group 3 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
AT4G16670 | FORKED-LIKE family member, part of Group 3 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
AT5G57770 | FORKED-LIKE family member, part of Group 2 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
AT5G14780 | Encodes a NAD-dependent formate dehydrogenase. |
AT3G07540 | Actin-binding FH2 (formin homology 2) family protein;(source:Araport11) |
AT5G07770 | Actin-binding FH2 protein;(source:Araport11) |
AT1G59910 | Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. |
AT5G58160 | Class II formin; modulator of pollen tube elongation. |
AT1G31810 | Encodes the Type II Arabidopsis formin14. Interacts with microtubules and microfilaments to regulate cell division. |
AT4G33240 | Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant. |
AT1G34260 | Encodes a protein that is predicted to act as a phosphatidylinositol-3P 5-kinase, but, because it lacks a FYVE domain, it is unlikely to be efficiently targeted to membranes containing the porposed phosphatidylinositol-3P substrate. Therefore, its molecular function remains unknown. The mRNA is cell-to-cell mobile. |
AT1G71010 | Encodes a protein that is predicted to act as a phosphatidylinositol-3P 5-kinase, but, because it lacks a FYVE domain, it is unlikely to be efficiently targeted to membranes containing the proposed phosphatidylinositol-3P substrate. Therefore, its molecular function remains unknown. The mRNA is cell-to-cell mobile. |
AT1G14350 | Encodes a putative MYB transcription factor involved in stomata development, loss of FLP activity results in a failure of guard mother cells (GMCs) to adopt the guard cell fate, thus they continue to divide resulting in abnormal stomata consisting of clusters of numerous guard cell-like cells. This phenotype is enhanced in double mutants with MYB88. Its transcript levels change after inducing MUTE expression in a mute background. Also regulates female reproductive development. |
AT2G06005 | Encodes one of the FRI interacting proteins: FRIGIDA INTERACTING PROTEIN 1 (FIP1)/At2g06005, FIP2/ At4g17060. FRI (At4G00650) is a major determinant of natural variation in Arabidopsis flowering time. |
AT4G10260 | Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). |
AT1G06030 | Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). |
AT1G43670 | Encodes a fructose-1,6-bisphosphatase. This enzyme, in addition to catalyzing the formation of fructose-6-phosphate for sucrose biosynthesis, appears to play a role in fructose-mediated signaling that is independent of its enzymatic activity. atcfbp-1/fins1 mutants have reduced photosynthetic rates, elevated levels of starch and reduced levels of sucrose during the day. Although the protein is expected to be cytosolic, a GFP-tagged version localizes to the cytoplasm and the nucleus. The mRNA is cell-to-cell mobile. |
AT1G07110 | Encodes the bifunctional enzyme fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase. |
AT2G21330 | fructose-bisphosphate aldolase 1;(source:Araport11) |
AT5G03690 | Aldolase superfamily protein;(source:Araport11) |
AT2G36460 | Aldolase superfamily protein;(source:Araport11) |
AT3G52930 | Aldolase superfamily protein;(source:Araport11) |
AT5G06850 | Encodes an endoplasmic reticulum protein that is involved in the transport of the florigen FT from companion cells to sieve elements, thus affecting FT transport through the phloem to the SAM. |
AT4G23940 | Encodes FtsHi1. Localizes to the chloroplast envelope membrane. Functions in chloroplast biogenesis and division.Strong interaction with TIC inner envelope protein translocon which consists of Tic20/Tic56/Tic100/Tic214(Ycf1)(DOI:10.1105/tpc.18.00357). |
AT1G50250 | encodes an FTSH protease that is localized to the chloroplast. Involved in the D1 repair cycle of Photosystem II. FtsH1 and FtsH5 are interchangeable in thylakoid membranes. |
AT2G29080 | encodes an FtsH protease that is localized to the mitochondrion |
AT2G26140 | Encodes an FtsH protease that is localized to the mitochondrion. Loss of function results in increased determinacy of the meristem that is exacerbated when plants are grown at higher temperatures. |
AT3G47060 | encodes an FtsH protease that is localized to the chloroplast |
AT1G14080 | Encodes an alpha-(1,2)-fucosyltransferase. |
AT1G14100 | member of Glycosyltransferase Family- 37. FUT8 was previously associated to AT1G14110 |
AT2G47510 | Encodes a mitochondrial-localized protein. The FUM1 gene appears to be essential, suggesting that FUM1 may play a crucial role as a fumarase in the tricarboxylic acid cycle. |
AT1G02090 | encodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype. |
AT3G26790 | Transcriptional factor with high similarity to the B3 region of the VP1/ABI3-like proteins. Full length FUS3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of FUS3 requires the B3 DNA-binding domain and an activation domain. FUS3 specifies cotyledon identity. Regulator of gene expression during late embryogenesis. Involved in the control foliar organ identity in Arabidopsis by regulating the synthesis of two hormones, abscisic acid and gibberellin. FUS3 together with LEC1 positively regulate the abundance of the ABI3 protein in the seed. |
AT2G16630 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT1G71450 | Encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. FUF1 appears to negatively regulate certain ethylene responsive EDF genes thereby negatively regulating flower senescence. |
AT1G03160 | A new plant-specific member of the dynamin superfamily; defines a new protein class within the dynamin superfamily of membrane remodeling GTPases that regulates organization of the thylakoid network in plants. Targeted to chloroplasts and associated with thylakoid and envelope membranes as punctate structures. Knockout mutants have abnormalities in chloroplast and thylakoid morphology, including disorganized grana stacks and alterations in the relative proportions of grana and stroma thylakoids. Overexpression of FZL-GFP also conferred defects in thylakoid organization. |
AT2G26300 | Encodes an alpha subunit of a heterotrimeric GTP-binding protein. The active GTP-bound form of GPA1 binds to the GTG1 and GTG2 abscisic acid (ABA) receptors and appears to affect their GTPase and GTP-binding activity, and hence, ABA binding abilities. GPA1 is a positive regulator in ABA-mediated inhibition of stomatal opening. Plants with recessive mutant alleles have complex phenotypes including: reduced brassinolide response, reduced cell divisions, round leaves, short hypocotyls. It is likely to be involved in the signaling events that trigger unfolded protein response-associated cell death. GPA1 is also involved in sugar signaling. The mRNA is cell-to-cell mobile. |
AT4G36730 | member of a gene family encoding basic leucine zipper proteins (GBFs) which bind the G-box |
AT1G03970 | encodes a basic leucine zipper G-box binding factor that can bind to G-box motifs only as heterodimers with GBF2 or GBF3. A single amino acid change can confer G-box binding as homodimers. |
AT4G34590 | Encodes a basic domain leucine zipper (bZip) transcription factor bZIP11. Translation is repressed by sucrose. Directly regulates gene expression of ASN1 and ProDH2, which are enzyme-coding genes involved in amino acid metabolism. Susceptibility factor during Pseudomonas syringae infection. |
AT5G10450 | Encodes a member of the 14-3-3 gene family that is a lambda isoform (14-3-3λ). Interacts with APX3 (ascorbate peroxidase) and AKR2 , suggesting a role in mediating oxidative metabolism in stress response. This protein was shown to colocalize and interact with SERK1 by which it is phosphorylated. This protein is also reported to interact with the phosphorylated form of the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1. Interacts with JAZ10.4 which lacks the Jas motif. It is also phosphorylated by CRPK1 as part of the response to cold and translocates to the nucleus after phosphorylation. |
AT4G17330 | gene of unknown function expressed in seedlings, flower buds and stems |
AT4G02780 | Catalyzes the conversion of geranylgeranyl pyrophosphate (GGPP) to copalyl pyrophosphate (CPP) of gibberellin biosynthesis |
AT1G79460 | Encodes for a protein with ent-kaurene synthase B activity which catalyzes the second step in the cyclization of GGPP to ent-kaurene in the gibberellins biosynthetic pathway. |
AT4G20170 | glycosyltransferase family protein (DUF23);(source:Araport11) |
AT5G14470 | GHMP kinase family protein;(source:Araport11) |
AT2G32740 | galactosyltransferase 13;(source:Araport11) |
AT5G15470 | Encodes a protein with putative galacturonosyltransferase activity. |
AT4G38270 | Encodes a protein with putative galacturonosyltransferase activity. |
AT1G13250 | Encodes a protein with putative galacturonosyltransferase activity. |
AT3G62660 | Encodes a protein with putative galacturonosyltransferase activity. |
AT5G49150 | Encodes a transmembrane domain containing protein expressed in sperm cells. Mutants are defective in gamete fusion. Target promoter of the male germline-specific transcription factor DUO1. |
AT5G48030 | encodes a mitochondrially targeted DNAJ protein involved in female gametophyte development. |
AT1G47260 | Encodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex. |
AT2G36830 | Encodes a tonoplast intrinsic protein, which functions as water channel. It has also been shown to be able to facilitate the transport of urea and hydrogen peroxide. Highly expressed in vascular tissues of the root, stem, cauline leaves and flowers but not in the apical meristems. The mRNA is cell-to-cell mobile. |
AT4G32940 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteinases that is expressed in vegetative organs and is upregulated in association with various types of cell death and under stressed conditions. They are essential in processing seed storage proteins and for mediating the susceptible response of toxin-induced cell death. |
AT1G78680 | The Arabidopsis protein AtGGH2 is a gamma-glutamyl hydrolase acting specifically on monoglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. |
AT1G78670 | gamma-glutamyl hydrolase 3;(source:Araport11) |
AT4G30530 | Encodes a gamma-glutamyl peptidase, outside the GGT family, that can hydrolyze gamma-glutamyl peptide bonds. The mRNA is cell-to-cell mobile. |
AT4G29210 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in the vacuole and is most active in roots. The encoded enzyme is involved in the initial degradation of glutathione conjugates in this cell compartment. It is also induced by xenobiotics and contributes to xenobiotics metabolism. Note that conflicting nomenclature exists in the literature: At4g29210 is named as GGT3 in Plant J. 2007 Mar 49(5):878-88; At4g29210 is named as GGT4 and At1g69820 as GGT3 in Plant Physiol. 2007 Aug 144(4):1715-32. |
AT4G12960 | Gamma interferon responsive lysosomal thiol (GILT) reductase family protein;(source:Araport11) |
AT5G24280 | Encodes GMI1, a structural-maintenance-of-chromosomes-hinge domain-containing protein. Involved in somatic homologous recombination. |
AT1G64970 | gamma-tocopherol methyltransferase (g-TMT) mRNA, nuclear; mutant has Deficient in alpha and beta tocopherol; Accumulates gamma tocopherol in leaves |
AT3G53760 | Encodes GCP4 (gamma-Tubulin Complex Protein 4), required for microtubule organization. |
AT4G09610 | GAST1 protein homolog 2;(source:Araport11) |
AT2G28340 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT5G49300 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT4G36620 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT4G17570 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT3G20750 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT3G60530 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT5G66320 | Encodes GATA transcription factor gene GNC, involved in regulating carbon and nitrogen metabolism. Expression occurs in aerial tissue at an early stage of development and is inducible by nitrate. |
AT4G32890 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT4G16141 | GATA type zinc finger transcription factor family protein;(source:Araport11) |
AT5G37500 | Encodes a guard cell outward potassium channel. Belongs to the Shaker family K+ channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mutants have increased water consumption and limited stomatal closure in response to abscisic and jasmonic acids. It forms a heteromeric K(out) channels with SKOR. The gene is expressed ubiquitously in root and the vasculature and guard cells of leaves. Expression is suppressed during agrobacterium-induced tumor formation and increased in response to water deprivation and cold. |
AT2G15740 | Member of a small family of zinc finger containing putative transcription factors.Similar to GAZ. |
AT5G42640 | Member of a small family of zinc finger containing putative transcription factors.Similar to GAZ. |
AT5G22990 | Member of a small family of zinc finger containing putative transcription factors.Similar to GAZ. |
AT3G14225 | Contains lipase signature motif and GDSL domain. |
AT2G25650 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
AT5G14280 | DNA-binding storekeeper-like protein;(source:Araport11) |
AT1G54380 | Encodes GEMIN2, a spliceosomal small nuclear ribonucleoprotein assembly factor conserved from yeast to humans. GEMIN2 is a key component of a posttranscriptional regulatory mechanism that ensures the appropriate acclimation of plants to daily and seasonal changes in temperature conditions. It controls the alternative splicing of several circadian clock genes and attenuates the effects of temperature on the circadian period. |
AT3G45240 | Encodes a geminivirus Rep interacting kinase (GRIK; GRIK1/AT3G45240, GRIK2/AT5G60550). GRIKs are SnRK1 (SNF1-related kinases) activating kinases. Both GRIKs specifically bind to the SnRK1 catalytic subunit and phosphorylate the equivalent threonine residue in its activation loop in vitro. Involved in resistance to S. sclerotiorum, fungal sRNA target. |
AT3G59410 | Encodes an eIF2alpha kinase that can bind uncharged tRNA via its C-terminus and can phosphorylate both eIF2alpha homologues in Arabidopsis. |
AT4G09000 | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available. |
AT5G65430 | member of 14-3-3 proteins. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 |
AT3G52280 | Bromodomain containing nuclear-localized protein involved in leaf development. GTE6 binds to the promoter and intron of AS1 and regulates its expression via histone acetylation. |
AT4G27600 | Encodes a phosphofructokinase B-type carbohydrate kinase family protein, NARA5. Regulates photosynthetic gene expression. |
AT2G18640 | Encodes an endoplasmic reticulum-targeted geranylgeranyl pyrophosphate synthase |
AT4G38460 | Encodes a type II small subunit of the heteromeric geranyl(geranyl) diphosphate synthase that is localized to the chloroplast, expressed in petals and sepals and is involved in monoterpene biosynthesis. The mRNA is cell-to-cell mobile. |
AT1G09560 | Encodes a plasodesmata-located protein involved in regulating primary root growth by controlling phloem-mediated allocation of resources between the primary and lateral root meristems. The mRNA is cell-to-cell mobile. |
AT5G39100 | germin-like protein (GLP6) |
AT4G14630 | germin-like protein with N-terminal signal sequence that may target it to the vacuole, plasma membrane and/or outside the cell. The mRNA is cell-to-cell mobile. |
AT1G02335 | Encodes a plasodesmata-located protein involved in regulating primary root growth by controlling phloem-mediated allocation of resources between the primary and lateral root meristems. |
AT2G36690 | Protein belonging to the Fe-dependent 2-oxoglutarate dioxygenase superfamily, catalyzes the stereospecific hydration of GA12 to produce DHGA12, negatively regulates ABA sensitivity during germination, phototrophic establishment and seedling development. |
AT3G27490 | GSR1 is a tandem plant PhD homeodomain protein involved in auxin mediated seed dormancy and germination. It was identified in a screen for mutations resistant to the compound germostatin. It interacts with components of the auxin signaling pathway and may function as an auxin stimulated co-repressor. |
AT5G56300 | A member of the Arabidopsis SABATH methyltransferase gene family. Encodes GAMT2, a methyltransferase that uses S-adenosine-L-methionine (SAM) as a methyl donor to methylate the carboxyl group of GAs, resulting in the methyl esters of GAs (MeGAs). Expressed most highly in the siliques during seed development. |
AT5G59845 | Member of a family of proteins named as being GA inducible but GASA10 does not appear to be GA induced. It is likely to be secreted as the protein is found in the cell wall. |
AT2G34555 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins to deactivate them. |
AT1G50960 | Encodes a protein with gibberellin 2-oxidase activity which acts specifically on C-20 gibberellins. DDF1 binds to GA2OX7 and regulates its expression in response to salt stress. |
AT1G15550 | Involved in later steps of the gibberellic acid biosynthetic pathway. Activated by AGAMOUS in a cal-1, ap1-1 background. Deletion of 208 bp from -1016 to -809 (Δ-808) resulted in loss of GA-negative feedback (this sequence, which contains a 43-bp sequence GNFEI, was shown to be sufficient for GA-negative feedback). |
AT4G21690 | gibberellin 3-oxidase 3;(source:Araport11) |
AT4G26420 | A member of the Arabidopsis SABATH methyltransferase gene family. Encodes GAMT1, a methyltransferase that uses S-adenosine-L-methionine (SAM) as a methyl donor to methylate the carboxyl group of GAs, resulting in the methyl esters of GAs (MeGAs). Expressed most highly in the siliques during seed development. SABATH family methyltransferase. |
AT1G22770 | Together with CONSTANTS (CO) and FLOWERING LOCUS T (FT), GIGANTEA promotes flowering under long days in a circadian clock-controlled flowering pathway. GI acts earlier than CO and FT in the pathway by increasing CO and FT mRNA abundance. Located in the nucleus. Regulates several developmental processes, including photoperiod-mediated flowering, phytochrome B signaling, circadian clock, carbohydrate metabolism, and cold stress response. The gene's transcription is controlled by the circadian clock and it is post-transcriptionally regulated by light and dark. Forms a complex with FKF1 on the CO promoter to regulate CO expression. The mRNA is cell-to-cell mobile. |
AT2G22475 | Encodes GL2-expression modulator (GEM). Involved in the spatial control of cell division, patterning and differentiation of Arabidopsis root epidermal cells. GEM interacts with CDT1, a DNA replication protein and TTG1 (TRANSPARENT TESTA GLABRA1), a WD40-repeat protein involved in GL2-dependent cell fate decision. GEM seems to participate in the maintenance of a repressor histone H3 epigenetics status of the GL2 and CPC (CAPRICE) promoters. |
AT3G27920 | Encodes GL1, a Myb-like protein that is required for induction of trichome development. Interacts with JAZ and DELLA proteins to regulate trichome initiation. Natural hyperfunctional alleles producing trichome development in fruits and pedicels have been found. |
AT5G41315 | Encodes a basic helix loop helix domain protein that interacts with GL1 in trichome development.GL3 interacts with JAZ and DELLA proteins to regulate trichome initiation. |
AT1G68360 | Encodes a nuclear localized member of the C2H2 family of TFIIIA transcription factors.GIS3 is involved in trichome initiation and development downstream of GA and cytokinin signaling. GIS regulates the expression GIS and GIS2. |
AT2G37585 | Encodes GlcAT14C. Has glucuronosyltransferase activity adding glucuronic acid residues to beta-1,3- and beta-1,6-linked galactans. |
AT2G19880 | Encodes Glucosylceramide synthase (GCS) which catalyzes the final step in glucosylceramide (GlcCer) synthesis by transferring a glucosyl residue from UDP-Glc to the ceramide backbone. |
AT4G10060 | Glucosylceramidase that preferentially hydrolyzes long acyl chain glucosylceramides. |
AT5G45600 | The GSA41 human homolog is expressed in nuclei and binds NuMA, a component of the nuclear matrix in interphase nuclei. It negatively regulates flowering by controlling the H4 acetylation levels in the FLC and FT chromatin. |
AT4G34740 | Encodes glutamine 5-phosphoribosylpyrophosphate amidotransferase. Mutants are deficient in leaf, but not cotyledon, plastid and palisade cell development. Mutants exhibit defective chloroplast development under non-low light, suggesting that the defect in chloroplast development is caused by photo-oxidative damage. Plays role in differential development of vascular-associated cells. Demonstrates a cell-specific difference in chloroplast development.Mutant leaves are highly reticulate with a green vascular pattern. |
AT2G41760 | Controls the expression of specific defence-response genes, activates the synthesis pathway for the phytoalexin camalexin and influences basal resistance to Pseudomonas syringae pv tomato (Pst). |
AT4G08350 | global transcription factor group A2;(source:Araport11) |
AT1G65440 | Related to yeast Spt6 protein, which functions as part of a protein complex in transcription initiation and also plays a role in chromatin structure / assembly. It encodes a putative WG/GW-repeat protein involved in the regulation of apical-basal polarity of embryo |
AT5G10550 | This gene is predicted to encode a bromodomain-containing protein. A plant line expressing RNAi constructs targeted against GTE7 shows some resistance to agrobacterium-mediated root transformation. |
AT5G65630 | This gene is predicted to encode a bromodomain-containing protein. Plant lines expressing RNAi constructs targeted against GTE7 show some resistance to agrobacterium-mediated root transformation. |
AT1G48520 | Encodes Glu-tRNA(Gln) amidotransferase subunit B (from Genbank record AF239836). |
AT3G07160 | Encodes GSL10, a member of the Glucan Synthase-Like (GSL) family believed to be involved in the synthesis of the cell wall component callose. GSL10 is required for male gametophyte development and plant growth. Has a role in entry of microspores into mitosis. GSL10 mutation leads to perturbation of microspore division symmetry, irregular callose deposition and failure of generative cell engulfment by the vegetative cell cytoplasm. Also refer to GSL8 (At2g36850). |
AT5G13000 | encodes a gene similar to callose synthase |
AT4G03550 | Encodes a callose synthase that is required for wound and papillary callose formation in response to fungal pathogens Erysiphe and Blumeria. Mutants are resistant to P. parasitica and exhibit an exaggerated PR1 response.Contributes to PAMP-induced basal defense. The mRNA is cell-to-cell mobile. |
AT5G36870 | encodes a gene similar to callose synthase |
AT5G04500 | Encodes a member of the CAZy Glycosyltransferase Family 64 that is involved in glycosylinositolphosphorylceramide and sphingolipid glycosylation. In mutants, seed germination was less sensitive to salt stress than in wild-type plants. [The protein was expected to be Golgi-localized based on function as well as the Golgi localization of its homolog GMT1. However, GFP-fusion proteins localized both to the ER and Golgi, and especially to ER when co-expressed with Golgi markers. Therefore, localization cannot confidently be defined. (pers. communication, J. Mortimer)] |
AT5G54800 | Encodes glucose6-Phosphate/phosphate transporter 1. Essential for pollen maturation and embryo sac development. The mRNA is cell-to-cell mobile. |
AT5G35790 | Encodes a plastidic glucose-6-phosphate dehydrogenase that is sensitive to reduction by DTT and whose mRNA is more prevalent in developing organs but absent in the root. |
AT1G24280 | Encodes a plastidic glucose-6-phosphate dehydrogenase that is sensitive to reduction by DTT and whose mRNA is most highly expressed in root. |
AT1G09420 | Encodes a protein similar to glucose-6-phosphate dehydrogenase but, based on amino acid differences in the active site and lack of activity, does not encode a functional G6PDH. The amino acid sequence for the consensus sequence of the G6PDH active site (DHYLGKE) differs in three places in this protein. gc exon splice site at 20574 is based on protein alignment, and is not confirmed experimentally. |
AT3G27300 | glucose-6-phosphate dehydrogenase 5;(source:Araport11) |
AT5G40760 | Encodes a cytosolic glucose-6-phosphate dehydrogenase that is insensitive to reduction by DTT and whose mRNA is expressed ubiquitously. The mRNA is cell-to-cell mobile. |
AT1G61800 | glucose6-Phosphate/phosphate transporter 2. Expression is upregulated in the shoot of cax1/cax3 mutant. The mRNA is cell-to-cell mobile. |
AT1G67490 | Encodes an alpha-glucosidase I enzyme that catalyzes the first step in N-linked glycan processing. Localized to the endoplasmic reticulum (ER). |
AT5G61250 | Belongs to the plant glycoside hydrolase family 79. Encodes a protein with several posttranslational modification sites including O-β-GlcNAc attachment sites and serine-, threonine- and tyrosine-phosphorylation sites, suggesting that this protein is extensively modified posttranslationally. The protein is predicted (WoLF PSORT program) to be secreted. |
AT5G34940 | The protein is predicted (WoLF PSORT program) to be membrane-associated. |
AT3G17760 | glutamate decarboxylase 5;(source:Araport11) |
AT2G32390 | Encodes a ionotropic glutamate receptor ortholog, a member of a putative ligand-gated ion channel subunit family. |
AT4G35290 | Encodes a putative glutamate receptor like-protein, member of Putative ligand-gated ion channel subunit family |
AT2G24710 | member of Putative ligand-gated ion channel subunit family |
AT4G31710 | member of Putative ligand-gated ion channel subunit family |
AT5G11210 | member of Putative ligand-gated ion channel subunit family |
AT5G11180 | member of Putative ligand-gated ion channel subunit family |
AT2G29110 | member of Putative ligand-gated ion channel subunit family |
AT2G29100 | member of Putative ligand-gated ion channel subunit family |
AT3G51480 | member of Putative ligand-gated ion channel subunit family |
AT2G32400 | Glr5 |
AT2G41220 | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression is most abundant in root. The mRNA is cell-to-cell mobile. |
AT1G23310 | Identified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway. |
AT4G31730 | Glutamine dumper1 is a putative transmembrane protein. It is involved in glutamine secretion The mRNA is cell-to-cell mobile. |
AT4G25760 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
AT5G57685 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
AT2G24762 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
AT5G24920 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
AT1G66200 | encodes a cytosolic glutamate synthetase, this enzyme has low affinity with substrate ammonium |
AT3G17820 | encodes a cytosolic glutamine synthetase, the enzyme has low affinity with substrate ammonium The mRNA is cell-to-cell mobile. |
AT4G25720 | This locus encodes a protein with similarity to gamma-glutamylcyclotransferase that may be involved in catalyzing the formation of pyroglutate residue on proteins that have been post-translationally processed to reveal a glutamine at their N-terminus. Enzymatic assays to test the function of this protein were performed using a truncated form of the protein lacking a signal peptide that is most similar to the AT4G25720.1 protein model. |
AT5G63030 | Thioredoxin superfamily protein, redox sensor. |
AT4G28730 | Encodes a glutaredoxin GrxC5. GrxC5 exists as two forms when expressed in Escherichia coli. The monomeric apoprotein possesses deglutathionylation activity mediating the recycling of plastidial methionine sulfoxide reductase B1 and peroxiredoxin IIE, whereas the dimeric holoprotein incorporates a [2Fe-2S] cluster. |
AT2G31570 | glutathione peroxidase GPx |
AT2G48150 | Encodes glutathione peroxidase. |
AT1G63460 | Encodes GPX8 (glutathione peroxidase 8). Involved in the suppression of oxidative damages in nucleus and cytosol. The mRNA is cell-to-cell mobile. |
AT1G02930 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
AT3G03190 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
AT5G17220 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). Mutants display no pigments on leaves and stems. Likely to function as a carrier to transport anthocyanin from the cytosol to tonoplasts. |
AT2G30860 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
AT1G74590 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT1G69930 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT1G69920 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT1G27130 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). GSTU13 acts in the pathogen triggered pathway for indole glucosinolate metabolisms that involves also PENETRATION2 myrosinase. It is likely the enzyme that conjugates GSH with unstable indol-3-ylmethyl-ITCs formed upon PEN2-mediated IG hydrolysis, particularly in the branch of this pathway in which 4-substituted IGs are processed. |
AT1G78380 | Encodes a glutathione transferase that is a member of Tau GST gene family. Expression is induced by drought stress, oxidative stress, and high doses of auxin and cytokinin. naming convention according to Wagner et al. (2002) The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
AT1G78360 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT1G78340 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT1G78320 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT3G43800 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). The mRNA is cell-to-cell mobile. |
AT2G29440 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT3G09270 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT5G62480 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT5G41210 | Encodes glutathione transferase belonging to the theta class of GSTs. Naming convention according to Wagner et al. (2002). |
AT5G41240 | Encodes glutathione transferase belonging to the theta class of GSTs. Naming convention according to Wagner et al. (2002). |
AT5G41220 | Encodes glutathione transferase belonging to the theta class of GSTs. Naming convention according to Wagner et al. (2002). |
AT3G55040 | Encodes a member of the lambda family of glutathione transferases. It has thiol transferase activity and self S-glutathionylation activity in vitro. |
AT3G24170 | Encodes a cytosolic glutathione reductase. |
AT1G12900 | glyceraldehyde 3-phosphate dehydrogenase A subunit 2;(source:Araport11) |
AT1G42970 | Encodes chloroplast localized glyceraldehyde-3-phosphate dehydrogenase that can use both NADH and NADPH to reduce 1,3-diphosphate glycerate. It forms A2B2 heterotetramers with GapA forms of the GADPH enzyme. These complexes are active in the light under reducing conditions, but show reduced NADPH-dependent activity in response to oxidized thioredoxins and increased NAD(H)/NADP(H) ratios due to the formation of inactive A8B8 hexadecamers. The mRNA is cell-to-cell mobile. |
AT3G04120 | encodes cytosolic GADPH (C subunit) involved in the glycolytic pathway but also interacts with H2O2 potentially placing it in a signalling cascade induced by ROS. The mRNA is cell-to-cell mobile. |
AT1G79530 | Encodes one of the chloroplast/plastid localized GAPDH isoforms (GAPCp1/At1g79530 and GAPCp2/At1g16300). gapcp double mutants display a drastic phenotype of arrested root development, dwarfism and sterility. GAPCps are important for the synthesis of serine in roots. |
AT4G25840 | glycerol-3-phosphatase 1;(source:Araport11) |
AT2G13100 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). The mRNA is cell-to-cell mobile. |
AT1G02390 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
AT4G01950 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
AT3G11430 | sn-glycerol-3-phosphate 2-O-acyltransferas, involved in the biosynthesis of suberin polyester. |
AT2G38110 | bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly. |
AT5G06090 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
AT1G31750 | proline-rich family protein;(source:Araport11) |
AT5G45350 | proline-rich family protein;(source:Araport11) |
AT4G19200 | Glycine and proline rich protein.Mutants have increased size. |
AT2G04063 | glycine-rich protein;(source:Araport11) |
AT2G35370 | Encodes glycine decarboxylase complex H protein. Involved in photorespiration. The mRNA is cell-to-cell mobile. |
AT2G26080 | glycine decarboxylase P-protein 2;(source:Araport11) |
AT4G38680 | Encodes a glycine-rich protein that binds nucleic acids and promotes DNA melting. Its transcript and protein levels are up-regulated in response to cold treatment with protein levels peaking earlier in shoots (~10-14 days) than in roots (~21 days). It is normally expressed in meristematic regions and developing tissues where cell division occurs. RNAi and antisense lines with lower levels of CSP2/GRP2 transcripts flower earlier than wild type plants and have some defects in anther and seed development. |
AT5G07510 | encodes a glycine-rich protein that is expressed in low abundance in stems and leaves, and very low abundance in flowers. |
AT2G05520 | Encodes a glycine-rich protein that is expressed mainly in stems and leaves. AtGRP3 functions in root size determination during development and in Al stress. mRNA levels are upregulated in response to ABA, salicylic acid and ethylene but downregulated in response to desiccation. The mRNA is cell-to-cell mobile. |
AT4G18360 | Encodes a glycolate oxidase that modulates reactive oxygen species-mediated signal transduction during nonhost resistance. |
AT1G21360 | glycolipid transfer protein 2;(source:Araport11) |
AT4G24260 | Encodes a protein with similarity to endo-1,4-b-glucanases. KOR3 is induced by nemotodes and is expressed in syncitia induced by Heterodera schachtii.May be involved in the development and function of syncitia. |
AT4G02290 | glycosyl hydrolase 9B13;(source:Araport11) |
AT4G09740 | glycosyl hydrolase 9B14;(source:Araport11) |
AT4G39000 | glycosyl hydrolase 9B17;(source:Araport11) |
AT4G39010 | Cellulase involved in cell wall modification during valve dehiscence. |
AT1G48930 | glycosyl hydrolase 9C1;(source:Araport11) |
AT1G64390 | glycosyl hydrolase 9C2;(source:Araport11) |
AT2G27130 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT3G43720 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT3G58550 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT5G09370 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G36150 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G55260 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G62790 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G73550 | Encodes a Protease inhibitor/seed storage/LTP family protein |
AT1G73560 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT5G62220 | Encodes a Golgi apparatus-localized galactosyltransferase involved in galactosyl-substitution of xyloglucan at position 2. |
AT1G32930 | Galactosyltransferase family protein;(source:Araport11) |
AT2G43430 | Encodes a predicted mitochondrial glyoxalase GLX2-1. Studies using recombinant protein show that GLX2-1 contains a dinuclear metal binding site, but does not have glyoxalase 2 activity. Required for abiotic stress but not for normal plant growth. |
AT2G31350 | Encodes a mitochondrial glyoxalase 2 that can accommodate a number of different metal centers and with the predominant metal center being Fe(III)Zn(II). |
AT1G11840 | Encodes Ni+ dependent glyoxalase I homolog ATGLX1. |
AT5G57040 | Vicinal oxygen chelate (VOC) superfamily member. Responds to NaCl,drought and high light stress. |
AT1G64185 | Vicinal oxygen chelate (VOC) superfamily member. |
AT1G53580 | Mononuclear Fe(II)-containing member of the b-lactamase fold superfamily. ETHE1 is homodimeric in solution, exhibits low-level esterase activity, and specifically binds a single Fe(II) atom in the active site. |
AT1G08110 | Encodes a Zn2+ dependent glyoxylase. |
AT1G80160 | Vicinal oxygen chelate (VOC) superfamily member. |
AT2G28420 | Vicinal oxygen chelate (VOC) superfamily member. |
AT3G17420 | Serine/threonine protein kinase-like protein expressed in etiolated cotyledons and found in glyoxysomes. |
AT1G13980 | Encodes a GDP/GTP exchange factor for small G-proteins of the ADP ribosylation factor (RAF) class, and as regulator of intracellular trafficking. Homologous to Sec7p and YEC2 from yeast. Involved in the specification of apical-basal pattern formation. Essential for cell division, expansion and adhesion. It appears that heteotypic binding between the DCB and C-terminal domains of two GNOM proteins is required for membrane association, however, GNOM appears to exist predominantly as a heterodimer formed through DCB-DCB interactions. BFA inhibits GNOM trafficking and BFA resistant lines are more resistant to cold stress. |
AT5G39500 | Encodes GNOM-LIKE1/ERMO1, a member of ARF-GEF family. Required for endoplasmic reticulum (ER) morphology. The mRNA is cell-to-cell mobile. |
AT1G79830 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC5 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (139 aa) portion of the protein. The C-terminal portion of the protein can also specifically interact with two members of the Rab family of GTPases (RabH1b and RabH1c). |
AT3G27530 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC6 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (225 aa) portion of the protein. |
AT3G11450 | Encodes a ZRF1 chromatin regulator. Functions in regulating plant growth and development. |
AT1G31140 | Encodes a B-sister MADS-box protein, GORDITA which is specific to the Brassicaceae. GOA is the most closely related paralog of ABS. GOA represses fruit growth and contributes to integument development. Over-expression of GOA results in disorganized floral structure and addition of carpel-like features to sepals. |
AT1G55325 | Encodes the Arabidopsis homolog of the transcriptional regulator MED13, is dynamically expressed during embryogenesis and regulates both developmental timing and the radial pattern formation. |
AT1G32900 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT5G18525 | Encodes a BEACH domain containing protein that is involved in targeting storage proteins to the protein storage vacuoles and effector triggered immunity to Psuedomonas syringae. |
AT1G28130 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. |
AT1G01160 | Arabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA |
AT4G00850 | Arabidopsis thaliana GRF1-interacting factor 3 (GIF3) mRNA |
AT2G37070 | Encodes a microtubule-associated protein track growing microtubule plus ends. |
AT3G53320 | Encodes a microtubule-associated protein track growing microtubule plus ends. |
AT4G37740 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower |
AT2G36400 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower. |
AT3G52910 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in root, shoot and flower. |
AT3G13960 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in root, shoot and flower. |
AT5G53660 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in shoot and flower. |
AT4G24150 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in shoot and flower. |
AT2G45480 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development. |
AT5G13190 | Encodes a plasma membrane localized LITAF domain protein that interacts with LSD1 and acts as a negative regulation of hypersensitive cell death. |
AT1G33240 | Encodes a plant transcriptional activator that contains two separate, but similar, trihelix DNA-binding domains, similar to GT-2. Gene is expressed in all aerial parts of the plant, with higher level of expression in siliques. At-GTL2 was thought to be a duplicated copy of this gene but is likely to be a cloning artefact, the result of a chimeric clone. Regulates ploidy-dependent cell growth in trichome. |
AT5G28300 | Encodes a Ca(2+)-dependent CaM-binding protein. AtGT2L specifically targets the nucleus and possesses both transcriptional activation and DNA-binding abilities, implicating its function as a nuclear transcription factor. |
AT4G34460 | Encodes the heterotrimeric G-protein beta subunit and is involved in organ shape. A significant fraction of the protein is found in the ER. Mutants carrying null alleles express similar fruit phenotypes, as seen in er plants, but differ from er in that the stem is only slightly shorter than that in the wild type, the pedicel is slightly longer than that in the wild type, and the leaves are rounder than those in er mutants. Gene is expressed in all tissues examined, with highest expression level found in siliques. It is involved in resistance to Plectosphaerella cucumerina. The predicted protein has two DWD motifs. It can bind to DDB1a in Y2H assays and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. It seems to be involved in the calcium-mediated response to extracellular ATP. |
AT4G35860 | GTP-binding protein ATGB2 |
AT5G48650 | Negative regulator of defense response to Pseudomonas syringae pv. tomato through altered stomatal and apoplastic immunity. |
AT2G44100 | GDP dissociation inhibitor involved in vesicular membrane traffic |
AT1G03830 | Assembles liquid?liquid phase separation (LLPS)-driven condensates within the nucleus to protect against infection and autoimmunity. Pseudo-GTPase which sequesters catalytically active GBPL3 under basal conditions but is displaced by GBPL3 LLPS when it enters the nucleus following immune cues to drive the formation of unique membraneless organelles. |
AT5G46070 | Assembles liquid?liquid phase separation (LLPS)-driven condensates within the nucleus to protect against infection and autoimmunity. Within membraneless organelles termed GBPL defence-activated condensates (GDACs), directly binds defence-gene promoters and recruited specifc transcriptional coactivators of the Mediator complex and RNA polymerase II machinery to massively reprogram host gene expression for disease resistance. |
AT3G10350 | One of 3 GET paralogs in Arabidopsis. GET3b is a chloroplast localized protein with no obvious role in Tail Anchored (TA) protein insertion. |
AT5G60730 | One of 3 GET paralogs in Arabidopsis. GET3c is a mitochondrion localized protein with no obvious role in Tail Anchored (TA) protein insertion. |
AT5G63220 | golgi-to-ER traffic-like protein;(source:Araport11) |
AT3G53630 | hypothetical protein;(source:Araport11) |
AT2G18960 | Encodes a plasma membrane proton ATPase. Mutants have a reduced ability to close their stomata in response to drought and are affected in stomatal but not seed responsiveness to ABA. The mRNA is cell-to-cell mobile. |
AT5G62670 | H[+]-ATPase 11;(source:Araport11) |
AT2G24520 | plasma membrane H+-ATPase;(source:Araport11) |
AT2G07560 | H[+]-ATPase 6;(source:Araport11) |
AT5G20140 | Encodes a haem-binding protein, HBP5. HBP5 binds haem and interacts with the haem oxygenase, HY1. Disrupting the binding of HBP5 to HY1 leads to oxidative stress. |
AT1G28440 | HAESA-like 1;(source:Araport11) |
AT2G35230 | Contains a plant-specific VQ motif. Involved in endosperm growth and seed size determination. IKU1 is expressed in the early endosperm and its progenitor, the central cell.IKU1 interacts with MINI3 in the yeast two-hybrid system. |
AT2G45160 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
AT3G60630 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
AT2G36450 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Ectopic overexpression of HRD increases the density of the root network and improves water and salt stress tolerance in Arabidopsis. Overexpression of HRD in rice causes an increase in plant biomass and drought resistance. |
AT2G43910 | HARMLESS TO OZONE LAYER 1;(source:Araport11) |
AT3G61590 | F-box protein that is involved in some aspect of regulation of gene silencing by miRNA. Loss of function mutations have increased levels of some miRNAs. Its activity depends on the presence of functional F-box. |
AT1G06840 | Homomultimers interact with cytoplasmic signaling molecule PBL27, resulting in herbivory resistance, in an ethylene-dependent manner. |
AT5G10010 | myosin-H heavy protein;(source:Araport11) |
AT5G02500 | Encodes a member of heat shock protein 70 family. Hsc70-1 negatively regulates the expression of Hsp101 through HsfA1d, HsfA1e and HsfA2. During non-HS condition, Hsc70-1 attenuates the activity of HsfAs and finally affects the expression of HsfA2 and Hsp101 genes. hsc70-1 mutant showed thermotolerance phenotype due to higher expression of Hsp101 and other HS inducible genes. |
AT4G17750 | native protein is a trimer, interacts with HSP70, also with TBP, DNA interaction is modulated by phosphorylation and is heat-shock inducible |
AT5G16820 | Encodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes. |
AT3G46230 | Member of the class I small heat-shock protein (sHSP) family, which accounts for the majority of sHSPs in maturing seeds.Induced by heat, cold, salt, drought and high-light. |
AT5G59720 | encodes a low molecular weight heat shock protein that contains the heat shock element in the promoter region. Expression is induced in response to heat shock. |
AT3G23990 | mitochondrial chaperonin HSP. assist in rapid assembly of the oligomeric protein structures in the mitochondria. |
AT2G33210 | Involved in the RNA splicing of rpl2 and ccmFC introns in mitochondria. |
AT3G12580 | heat shock protein 70;(source:Araport11) |
AT4G16660 | heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
AT1G79920 | Heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
AT1G11660 | heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
AT1G16030 | heat shock protein 70B;(source:Araport11) |
AT5G56030 | A member of heat shock protein 90 (HSP90) gene family. Expressed in all tissues and abundant in root apical meristem, pollen and tapetum. Expression is NOT heat-induced but induced by IAA and NaCl. Interacts with HsfA1d in the cytosol and the nucleus and negatively regulates HsfA1d. Did not bind to AtHsfA4c. The mRNA is cell-to-cell mobile. |
AT1G79930 | encodes high molecular weight heat shock protein 70 not a HSP90 homolog, mRNA is constitutively expressed but transiently induced after heat shock |
AT3G22830 | member of Heat Stress Transcription Factor (Hsf) family |
AT2G41690 | member of Heat Stress Transcription Factor (Hsf) family |
AT3G17210 | Encodes a heat stable protein with antimicrobial and antifungal activity. |
AT4G29770 | Target of trans acting-siR480/255. Testing. |
AT5G18065 | target of trans acting-siR480/255 protein;(source:Araport11) |
AT5G17450 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT2G28090 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT2G36950 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT3G05220 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT3G05920 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT3G24450 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT3G56891 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT4G16380 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT4G27590 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT4G39700 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT5G37860 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT5G50740 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT4G37270 | Encodes a P1B-type ATPases that is localized to the chloroplast envelope and is involved in the transport of Cu into chloroplasts. It is essential for growth under high light conditions. |
AT4G30110 | encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc |
AT4G30120 | encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc |
AT2G19110 | Encodes a protein with similarity to Zn ATPase. Can rescue Zn deficiency in yeast and Cd resistance, suggesting a role in Zn and Cd transport. The mRNA is cell-to-cell mobile. |
AT1G01490 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT5G09750 | Encodes a bHLH transcription factor that is involved in transmitting tract and stigma development. |
AT1G69720 | Encodes a member (HO3) of the heme oxygenase family. |
AT2G39740 | Encodes HESO1 (HEN1 suppressor 1), a terminal nucleotidyl transferase that uridylates miRNAs and siRNAs at 3′ end. HESO1-mediated 3′ uridylation destabilizes small RNAs in hen1. |
AT4G30850 | heptahelical transmembrane protein homologous to human adiponectin receptors and progestin receptors |
AT5G20270 | heptahelical transmembrane protein homologous to human adiponectin receptors and progestin receptors |
AT3G46290 | Encodes HERCULES1 (HERK1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
AT5G63620 | Encodes an oxidoreductase involved in transducing the perception of E-2-hexenal, which changes the redox status of the mitochondria. |
AT4G29130 | Encodes a hexokinase (HXK1) in the plant glucose-signaling network. Functions as a glucose sensor to interrelate nutrient, light, and hormone signaling networks for controlling growth and development in response to the changing environment. |
AT1G47840 | Encodes a putative hexokinase. |
AT1G50460 | Involved in glucose-ethylene crosstalk. |
AT4G37840 | Encodes a putative hexokinase. |
AT3G45060 | member of High affinity nitrate transporter family |
AT5G52440 | HCF106; nuclear gene for chloroplast. Thylakoid membrane delta pH translocation pathway component protein; related to Escherichia coli TatA and TatB The mRNA is cell-to-cell mobile. |
AT5G23120 | encodes a stability and/or assembly factor of photosystem II The mRNA is cell-to-cell mobile. |
AT3G15095 | Encodes HCF243 (high chlorophyll fluorescence), a chloroplast-localized protein involved in the D1 protein stability of the photosystem II complex1. |
AT1G16720 | Encodes HCF173, a protein with weak similarities to the superfamily of the short-chain dehydrogenases/reductases. HCF173 is involved in the initiation of translation of the psbA mRNA and binds a specific site in the 5' UTR of psbA mRNA. Mutants shows a high chlorophyll fluorescence phenotype (hcf) and are severely affected in the accumulation of PSII subunits. The protein HCF173 is localized in the chloroplast, where it is mainly associated with the membrane system and is part of a higher molecular weight complex with psbA mRNA as a component of this complex. |
AT4G35250 | HCF244 is a member of the atypical short-chain dehydrogenase/reductase superfamily, a modified group, which has lost enzyme activity.HCF244 interacts with unknown partners in a 200-400 kD membrane associated complex. |
AT2G39810 | A novel protein with a RING finger motif near the amino terminus. Negative regulator of cold responses. Functions as an E3 ligase required for the ubiquitination of ICE1. HOS1 physically interacts with ICE1 and mediates the ubiquitination of ICE1 both in vitro and in vivo. Overexpression represses the expression of CBFs and their downstream genes and confers increased sensitivity to freezing stress. The mRNA is cell-to-cell mobile. |
AT1G62400 | Protein kinase involved in regulation of stomatal aperture in response to CO2. |
AT1G14900 | Encodes a protein belonging to the subgroup of HMGA (high mobility group A) proteins that interact with A/T-rich stretches of DNA. |
AT4G10310 | encodes a sodium transporter (HKT1) expressed in xylem parenchyma cells. Mutants over-accumulate sodium in shoot tissue and have increased sodium in the xylem sap and reduced sodium in phloem sap and roots. |
AT5G23420 | Encodes HMGB6, a protein belonging to the subgroup of HMGB (high mobility group B) proteins. Localized in the nucleus. Binds to supercoiled DNA in vitro. HMGB6 is phosphorylated by protein kinase CK2alpha within its acidic C-terminal domain. |
AT5G59220 | Encodes a member of the PP2C family (Clade A protein phosphatases type 2C). Functions as a negative regulator of osmotic stress and ABA signaling. |
AT2G29380 | highly ABA-induced PP2C protein 3;(source:Araport11) |
AT4G26900 | encodes a glutamine amidotransferase and cyclase, catalyzes the fifth and sixth steps of the histidine biosynthetic pathway |
AT3G56490 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
AT1G27320 | Encodes a histidine kinases, a cytokinin receptor that controls cytokinin-mediated leaf longevity through a specific phosphorylation of the response regulator, ARR2. The mRNA is cell-to-cell mobile. |
AT5G10720 | member of Histidine Kinase |
AT1G61270 | Involved in transport of 1-Aminocyclopropane-1-carboxylic acid (ACC). |
AT1G31160 | Encodes a member of the histidine triad nucleotide-binding family of proteins, but its activity has not been determined. |
AT1G03430 | Encodes AHP5, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
AT3G46100 | histidyl-tRNA synthetase |
AT1G06760 | winged-helix DNA-binding transcription factor family protein;(source:Araport11) |
AT1G79000 | Homologous to CREB-binding protein, a co-activator of transcription with histone acetyl-transferase activity. No single prior lysine acetylation is sufficient to block HAC1 acetylation of the H3 or H4 peptides, suggesting that HAC1, HAC5, and HAC12 can acetylate any of several lysines present in the peptides. HAM2 acetylates histone H4 lysine 5. A plant line expressing an RNAi construct targeted against HAC1 has reduced rates of agrobacterium-mediated root transformation. |
AT1G16710 | Encodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC12 acetylation of the H3 or H4 peptides, suggesting that HAC12 can acetylate any of several lysines present in the peptides. |
AT1G67220 | histone acetyltransferase of the CBP family 2;(source:Araport11) |
AT3G12980 | Encodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC5 acetylation of the H3 or H4 peptides, suggesting that HAC5 can acetylate any of several lysines present in the peptides. Di-acetylation of both lysines 9 and 14 on the H3 peptide significantly reduces the level of incorporated radioactive acetylation catalyzed by HAC5, indicating that HAC5 may acetylate either lysine 9 or lysine 14. The mRNA is cell-to-cell mobile. |
AT5G56740 | Encodes an enzyme with histone acetyltransferase activity. Histone H4 is the primary substrate for the enzyme. Prior acetylation of lysine 12 of histone H4 reduces radioactive acetylation by HAG2. HAG2 acetylates histone H4 lysine 12. |
AT5G64610 | Encodes an enzyme with histone acetyltransferase activity. HAM1 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM1. HAM1 acetylates histone H4 lysine 5. |
AT3G19040 | Encodes a protein similar to TATA-binding protein-associated factor TAF1 (a.k.a. TAFII250) with histone acetyltransferase activity. It is required in integrating light signals to regulate gene expression and growth. |
AT5G26040 | Class III RPD3 type protein. Encodes HDA2, a member of the histone deacetylase family proteins. |
AT5G22650 | Encodes a member of a plant-specific class of histone deacetylases. Controls the development of adaxial/abaxial leaf polarity. Its mRNA is widely expressed in stems, leaves, flowers and young siliques. Plant lines expressing RNAi constructs directed against this gene showed a marked reduction in agrobacterium-mediated root transformation. |
AT3G44750 | Encodes a histone deacetylase. Controls the development of adaxial/abaxial leaf polarity. Two lines with RNAi-directed against this gene show reduced Agrobacterium-mediated DNA transformation of the roots. Involved in development of the vascular tissue of the stem by affecting cell proliferation and differentiation. |
AT5G61060 | Encodes a member of the histone deacetylase family. Class II RPD3-like family HDAC member which controls negative responses to salinity stress. |
AT5G63110 | RPD3-like histone deacetylase. HDA6 mutations specifically increase the expression of auxin-responsive transgenes, suggesting a role in transgene silencing. |
AT3G44680 | Encodes HDA9 (a RPD3-like histone deacetylase). Functions in promoting the onset of leaf senescence.The hda9 mutant shows enhanced H3K9 acetylation levels,based on immunodetection using H3K9ac antibodies. Negatively controls gene expression in concert with interacting proteins POWERDRESS (PWR), HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENES 15 (HOS15), WRKY53, ELONGATED HYPOCOTYL 5 (HY5), ABA INSENSITIVE 4 (ABI4) and EARLY FLOWERING 3 (ELF3). Involved in mutual negative feedback regulation with WRKY53. Mutations lead to a mild early flowering phenotype under SD. |
AT5G08450 | Component of histone-deacetylase complexes. Interacts with HDA6 and HDA19 and facilitates histone deacetylation. Several salt-inducible genes are de-repressed in hdc1 mutants. Mutants are hypersensitive to ABA during germination, grow less and flower later than wildtype. HDC1-overexpressing plants display opposite phenotypes. |
AT3G54560 | Encodes HTA11, a histone H2A protein. Loss of all H2A.Z (triple mutant with HTA8 and HTA9) results in a reduction in DNA methylation of transposons but not that of genes. Loss of H2A.Z causes misregulation of many genes involved in the response to developmental and environmental cues, and that these genes tend to have high levels of gene-body H2A.Z. |
AT5G27670 | Encodes HTA7, a histone H2A protein. |
AT1G52740 | Encodes HTA9, a histone H2A protein. Loss of all H2A.Z (triple mutant with HTA8 and HTA11) results in a reduction in DNA methylation of transposons but not that of genes. Loss of H2A.Z causes misregulation of many genes involved in the response to developmental and environmental cues, and that these genes tend to have high levels of gene-body H2A.Z. |
AT1G55250 | Encodes one of two orthologous E3 ubiquitin ligases in Arabidopsis that are involved in monoubiquitination of histone H2B. |
AT5G12910 | Plays role in cell fate reprogramming during plant regeneration; expression is rapidly induced upon wounding. Involved in release from PRC2-mediated gene repression by its deposition into chromatin, which is involved in reprogramming cell fate to produce pluripotent callus cells. |
AT2G25710 | Encodes a dual-targeted biotin holocarboxylase synthetase that can localize to the chloroplast and the cytosol. In vitro, it has been shown to catalyze the addition of biotin to the BCCP subunit of acetyl-CoA carboxylase and it can also biotinylate methylcrotonyl-CoA carboxylase. A small upstream ORF in the 5'UTR (uORF24) regulates the differential targeting of this enzyme. |
AT3G01470 | Encodes a homeodomain leucine zipper class I (HD-Zip I) transcriptional activator involved in leaf and hypocotyl development. Its promoter is bound by PIF1 which likely regulates its expression. Its translation is regulated by a conserved upstream ORF (CPuORF33). |
AT3G61890 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Loss of function mutant has abnormally shaped leaves and stems. |
AT5G03790 | Encodes a homeodomain leucine zipper class I (HD-Zip I) meristem identity regulator that acts together with LFY to induce CAL expression. It binds to the CAL promoter proximal CAATNATTG element. LMI1 acts primarily downstream of LFY in meristem identity regulation. The interaction between LFY, LMI1 and CAL resembles a feed-forward loop transcriptional network motif. The gene also had additional LFY-independent roles in leaf morphogenesis and bract formation. |
AT5G66700 | Encodes a homeodomain protein. Member of HD-ZIP 1 family, most closely related to HB5. AtHB53 is auxin-inducible and its induction is inhibited by cytokinin, especially in roots therefore may be involved in root development. |
AT2G46680 | encodes a putative transcription factor that contains a homeodomain closely linked to a leucine zipper motif. Transcript is detected in all tissues examined. Is transcriptionally regulated in an ABA-dependent manner and may act in a signal transduction pathway which mediates a drought response. |
AT4G16780 | Encodes a homeodomain-leucine zipper protein that is rapidly and strongly induced by changes in the ratio of red to far-red light. It is also involved in cell expansion and cell proliferation and in the response to auxin. The mRNA is cell-to-cell mobile. |
AT3G01220 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Expressed during seed germination in the micropylar endosperm and in the root cap, and increases ABA sensitivity and seed dormancy when mutated. The mRNA is cell-to-cell mobile. |
AT2G36610 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
AT4G24660 | homeobox protein 22;(source:Araport11) |
AT2G18350 | homeobox protein 24;(source:Araport11) |
AT5G65410 | Encodes ZFHD2, a member of the zinc finger homeodomain transcriptional factor family.Gain of function of ATHB25 (35S and UBQ10 proomoters) and double loss of function of ATHB25 and ATHB22 increases and decreases, respectively, seed longevity. This phenotype is maternal and related to seed coat alterations. Gain of function increases expression of GA3OX2 and GA4 and GA1 levels. Together with REM7 induces the expression of genes controlling shoot stem characteristics by ectopic expression in roots. |
AT1G75240 | Encodes a zinc finger-homeodomain transcription factor ZHD5. Nuclear import and DNA binding of the ZHD5 transcription factor is modulated by a competitive peptide inhibitor MIF1 (AT1G74660). |
AT3G28920 | homeobox protein 34;(source:Araport11) |
AT2G22430 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein that is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis. |
AT2G01430 | ATHB17 is a member of the HD-Zip transcription factor family. It is expressed most strongly in roots at different stages of development and induced by ABA, paraquat, drought, and NaCl treatments. Loss of function mutants are more sensitive to salt and drought stress.The protein is nuclear localized and has been shown to bind to the promoter of SIG5 and other genes. |
AT2G44910 | Encodes a homeodomain protein whose expression displays a dependence on phyB for both red and far-red light response. Also involved in the shade avoidance syndrome. |
AT1G73360 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. It is involved in trichome branching. The transcription factor directly upregulates the expression of several cell-wall-loosening protein genes and reveals the important role that these target genes play in coordinating cell-wall extensibility with root development. |
AT5G17320 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
AT3G63250 | Encodes a homocysteine methyltransferase (HMT). Among the three HMT coding genes in the genome, HMT2 is responsible for a significant proportion of HMT activity in the flower stalks and silique hulls. However, HMT2 does not significantly contribute to the total HMT activity in seeds. |
AT3G22740 | homocysteine S-methyltransferase (HMT3) |
AT5G54080 | Encodes a homogentisate 1,2-dioxygenase that can convert homogentisate to malylacetoacetate and is likely to be involved in tyrosine catabolism. |
AT2G18950 | Encodes homogentisate phytyltransferase involved in tocopherol biosynthesis. Has impact on seed longevity and plays a role in the adaptation to low temperature stress, notably phloem loading. |
AT3G11945 | Encodes a protein involved in plastoquinone-9 biosynthesis. The enzyme possesses homogentisate prenyltransferase activity and was shown to use solanesyl diphosphate, farnesyl diphosphate and geranylgeranyldiphosphate as prenyl donors, but not phytyldiphosphate. This gene At3g11945 derives from a split of At3g11950, publications Tian et al (2007) and Sadre et al (2006) refer to this gene as At3g11950. |
AT5G48840 | Encodes a pantothenate synthetase that appears to be located in the cytosol. This protein is expected to play a role in pantothenate (vitamin B5) biosynthesis. Analysis of the catalytic properties of this enzyme indicate that it might be able to synthesize adequate amounts of pantothenate even in the presence of low levels of pantoate. |
AT1G79050 | recA DNA recombination family protein;(source:Araport11) |
AT3G44530 | Encodes a nuclear localized WD-repeat containing protein involved in negative regulation of knox gene expression via epigenetic mechanism of chromatin re-organization. It is a part of the HISTONE REGULATOR complex that deposits histones in a DNA synthesis-independent manner and affects both nucleosome occupancy and the maintenance of transcriptional silencing. Interacts physically and genetically with AS1. Expressed in meristem and leaf primordia. Homozygous mutants are embryo lethal. Phenotype of cosuppressed lines is variable but show effects on leaf development similar to as1/as2. |
AT5G53480 | Sensitive to ABA, role in drought stress. |
AT2G12550 | ubiquitin-associated (UBA)/TS-N domain-containing protein;(source:Araport11) |
AT2G22450 | riboflavin biosynthesis protein;(source:Araport11) |
AT5G59750 | monofunctional riboflavin biosynthesis protein RIBA 3;(source:Araport11) |
AT3G50470 | Homolog of RPW8 |
AT4G22970 | Encodes a separase (ESP), homologous to human and mouse separase protein. Separase is a capase family protease required for the release of sister chromatid cohesion during meiosis and mitosis. Arabidopsis separase contains a predicted 2Fe2S-ferredoxin domain that is not present in the proteins of other organisms. Also contains a putative EF-hand calcium binding domain. Mutant seeds exhibited embryo arrest at the globular stage. The endosperm also exhibited a weak titan-like phenotype. Transgenic plants expressing AESP RNA interference (RNAi) from the meiosis-specific DMC1 promoter exhibited alterations in chromosome segregation during meiosis I and II that resulted in polyads containing from one to eight microspores. Plays an essential role in embryo development. Required for the removal of cohesin from meiotic chromosomes and establishment of meiotic nuclear domains. This gene was also identified through the rsw4 mutant. Lines carrying recessive, temperature-sensitive mutations exhibit reduced anisotropic growth at 30 degrees Celsius. Microtubules and cellulose microfibrils are not depleted or disoriented in the mutants at the restrictive temperature. |
AT1G04050 | Encodes SUVR1, one of the four closely related Arabidopsis SUVR proteins that belong to the SU(VAR)3-9 subgroup of SET-domain proteins. Proteins containing the evolutionarily conserved SET domain are involved in regulation of eukaryotic gene expression and chromatin structure through their histone lysine methyltransferase (HMTase) activity. SUVR1, SUVR2 and SUVR4 proteins contain a novel domain at their N-terminus, and a SUVR specific region preceding the SET domain. Localized to the nucleolus, maybe involved in regulation of rRNA expression. |
AT5G64520 | Encodes a protein of the XRCC2 family involved in DNA repair. atxrcc2-1 Mutants are sensitive to MitomycinC but do not show fertility defects. |
AT5G41370 | Encodes XPB1, a DNA repair protein and transcription factor. Arabidopsis thaliana has duplicated XPB gene (AtXPB1 and AtXPB2, with high similarity to each other). XPB proteins are involved in both DNA repair and transcription, they are component of the transcription factor IIH (TFIIH) and are responsible for DNA helicase activity during nucleotide (nt) excision repair (NER). Complementation assays in yeast rad25 mutant strains suggest the involvement of AtXPB2 in DNA repair. Although both genes are expressed in a constitutive manner during the plant life cycle, Northern blot analyses suggest that light modulates the expression level of both XPB copies. The mRNA is cell-to-cell mobile. |
AT5G41360 | Encodes XPB2, a DNA repair protein and transcription factor. Arabidopsis thaliana has duplicated XPB gene (AtXPB1 and AtXPB2, with high similarity to each other). XPB proteins are involved in both DNA repair and transcription, they are component of the transcription factor IIH (TFIIH) and are responsible for DNA helicase activity during nucleotide (nt) excision repair (NER). Complementation assays in yeast rad25 mutant strains suggest the involvement of AtXPB2 in DNA repair. Although both genes are expressed in a constitutive manner during the plant life cycle, Northern blot analyses suggest that light modulates the expression level of both XPB copies.XPB2 preferentially expressed in developing organs and during the cell cycle. |
AT4G16420 | Transcriptional co-activator. Essential for the developmental switch from cell proliferation to cell differentiation in response to variations in auxin and cytokinin concentrations. Part of SAGA complex. Regulates gene expression by affecting histone H3 acetylation. |
AT5G02410 | Encodes ALG10, an ER-resident alpha1,2-glucosyltransferase that is required for lipid-linked oligosaccharide biosynthesis and subsequently for normal leaf development and abiotic stress response. |
AT1G03380 | yeast autophagy 18 G-like protein;(source:Araport11) |
AT3G16090 | Encodes one of the Arabidopsis homologs of the yeast/human Hrd1 protein: AT3G16090 (Hrd1A), AT1G65040 (Hrd1B). Involved in ERAD (Endoplasmic reticulum-associated degradation). |
AT5G48120 | ARM repeat superfamily protein;(source:Araport11) |
AT1G59760 | Encodes MTR4, a putative RNA helicase and exosome co-factor. Required for proper rRNA biogenesis and development. |
AT5G23320 | Encodes a prenylcysteine alpha-carboxyl methyltransferase involved in methylation of isoprenylated proteins. This protein appears to have lower catalytic activity and a lower transcript expression level than the other ICMT present in Arabidopsis (At5g08335). Analysis of ICMT RNAi lines suggests that this protein may be involved in flower and stem development. |
AT3G57150 | Encodes a putative pseudouridine synthase (NAP57). |
AT1G17550 | Protein Phosphatase 2C |
AT4G13940 | Encodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing. The mRNA is cell-to-cell mobile. |
AT4G37580 | involved in apical hook development. putative N-acetyltransferase |
AT1G12270 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT4G12400 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT3G43300 | AtMIN7 is an immunity associated Arabidopsis protein targeted by HopM1, a conserved Pseudomonas syringae virulence protein. AtMIN7 encodes one of the eight members of the Arabidopsis adenosine diphosphate (ADP) ribosylation factor (ARF) guanine nucleotide exchange factor (GEF) protein family. The AFR GEF proteins are key components of the vesicle trafficking system in eukaryotic cells. HopM1 mediates the destruction of AtMIN7 via the host proteasome. Critical for cuticle formation and related leaf surface defense against the bacterial pathogen Pseudomonas syringae pathovar tomato (Pto). |
AT1G80600 | Encodes HopW1-1-Interacting protein 1 (WIN1). Interacts with the P. syringae effector HopW1-1. WIN1 is a putative acetylornithine transaminase. Modulates plant defenses against bacteria. Three WIN proteins are identified so far (WIN1: AT1G80600; WIN2: AT4G31750; WIN3: AT5G13320). Mediates red-light inhibition of seed germination. |
AT1G72970 | Originally identified as a mutation that causes floral organs to fuse together. About 10-20% of mutants also have defects in ovules. Mutants have reduced fertility most likely as because of fusions that pistil emergence. The protein has similarity to the mandelonitrile lyase family of FAD containing oxidoreductases and is predicted to be secreted (SignalP).It is expressed in all tissue layers of roots, inflorescences, stems, leaves, and flowers and is also expressed in siliques. Expression is highest in inflorescence and flower tissue.Transmission of mutant alleles to the progeny shows non mendelian segregation- a percentage of mutant alleles revert back to a previous parental (e.g. grandparental) wild type allele. It has been suggested that an RNA template driven or other extra-DNA genomic mechanism may be responsible for the non-mendelian inheritance of HTH. Reversion events in alleles at other loci have also been observed to occur in plants with an hth mutant background indicating a genome wide effect. |
AT3G16360 | Encodes AHP4, a histidine-containing phosphotransmitter involved in Histidine (His)-to-Aspartate (Asp) phosphorelay signal transduction. AHP4 is one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
AT1G25550 | Member of HHO/HRS GARP type transcriptional repressor family. Involved in Pi uptake and Pi starvation signaling. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
AT1G49560 | Homeodomain-like superfamily protein;(source:Araport11) |
AT5G08230 | HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. |
AT1G17560 | Encodes HUELLENLOS (HLL), a mitochondrial ribosome protein, similar to L14 ribosomal protein of eubacteria. HLL is essential for normal ovule development. |
AT1G74520 | Part of the AtHVA22a family. Protein expression is ABA- and stress-inducible. |
AT5G62490 | Part of the AtHVA22 family. Protein expression is ABA- and stress-inducible. |
AT1G19950 | HVA22-like protein H (ATHVA22H);(source:Araport11) |
AT4G36720 | HVA22-like protein K;(source:Araport11) |
AT1G76490 | Encodes a 3-hydroxy-3-methylglutaryl coenzyme A reductase, which is involved in melavonate biosynthesis and performs the first committed step in isoprenoid biosynthesis. Expression is activated in dark in leaf tissue but not controlled by light in the root (confine The mRNA is cell-to-cell mobile. |
AT5G48930 | At5g48930 has been shown to encode for the hydroxycinnamoyl-Coenzyme A shikimate/quinate hydroxycinnamoyltransferase (HCT) both synthesizing and catabolizing the hydroxycinnamoylesters (coumaroyl/caffeoyl shikimate and quinate) involved in the phenylpropanoid pathway. Influence on the accumulation of flavonoids which in turn inhibit auxin transport and reduce plant growth. The mRNA is cell-to-cell mobile. |
AT4G20930 | Encodes a 3-hydroxyisobutyrate dehydrogenase. |
AT5G08280 | Encodes a protein with porphobilinogen deaminase activity. This protein is targeted to the chloroplast. Mutants spontaneously develop chlorotic leaf lesions in the absence of pathogen attack, resembling the phenotype of lesion-mimic mutants. It has been shown to interact with the PPR protein AtECB2 for chloroplast RNA editing. |
AT4G11820 | Encodes a protein with hydroxymethylglutaryl-CoA synthase activity which was characterized by phenotypical complementation of the S. cerevisiae mutant. Involved in glucosinolate biosynthesis. |
AT5G13500 | Hyp O-arabinosyltransferase-like protein;(source:Araport11) |
AT3G54590 | Encodes a hydroxyproline-rich glycoprotein. The mRNA is cell-to-cell mobile. |
AT5G19800 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G47350 | Encodes a putative hydroxysteroid dehydrogenase (HSD). Genes that encode HSD include: At5g50600 and At5g50700 (HSD1), At3g47350(HSD2), At3g47360(HSD3), At5g50590 and At5g50690(HSD4), At5g50770(HSD6) (Plant Cell Physiology 50:1463). Two copies of HSD1 and HSD4 exist due to a gene duplication event. In Plant Physiology 145:87, At5g50690 is HSD7, At4g10020 is HSD5. |
AT3G47360 | Encodes a putative hydroxysteroid dehydrogenase (HSD). Genes that encode HSD include: At5g50600 and At5g50700 (HSD1), At3g47350(HSD2), At3g47360(HSD3), At5g50590 and At5g50690(HSD4), At5g50770(HSD6) (Plant Cell Physiology 50:1463). Two copies of HSD1 and HSD4 exist due to a gene duplication event. In Plant Physiology 145:87, At5g50690 is HSD7, At4g10020 is HSD5. |
AT4G10020 | Encodes a putative hydroxysteroid dehydrogenase (HSD). Genes that encode HSD include: At5g50600 and At5g50700 (HSD1), At3g47350(HSD2), At3g47360(HSD3), At5g50590 and At5g50690(HSD4), At5g50770(HSD6) (Plant Cell Physiology 50:1463). Two copies of HSD1 and HSD4 exist due to a gene duplication event. In Plant Physiology 145:87, At5g50690 is HSD7, At4g10020 is HSD5. |
AT1G69840 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
AT1G72770 | mutant has ABA hypersensitive inhibition of seed germination; Protein Phosphatase 2C; regulates the activation of the Snf1-related kinase OST1 by abscisic acid. The mRNA is cell-to-cell mobile. |
AT1G64960 | ARM repeat superfamily protein;(source:Araport11) |
AT1G67700 | multidrug resistance protein;(source:Araport11) |
AT5G41950 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G09700 | Encodes a nuclear dsRNA binding protein. Involved in mRNA cleavage. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin. |
AT3G01100 | unknown protein, has cDNAs and ESTs associated to it |
AT5G55510 | PRAT protein family which has a unique system for importing and exporting proteins from chloroplasts. Acts in the export of proteins from chloroplasts during leaf senescence. |
AT3G49560 | HP30/Tric1 is a component of the mitochondrial protein translocation complex and is involved in tRNA transport along with HP30-2/Tric2. Role in protein import into chloroplasts. |
AT4G27450 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
AT1G33055 | hypothetical protein;(source:Araport11) |
AT5G10040 | transmembrane protein;(source:Araport11) |
AT3G48030 | Mitochondria localized, hypoxia induced gene similar to rice HIGD. |
AT5G27760 | Hypoxia-responsive family protein;(source:Araport11) |
AT3G05550 | Hypoxia-responsive family protein;(source:Araport11) |
AT1G68100 | member of IAA-alanine resistance protein 1 |
AT1G51780 | encodes a member of the six Arabidopsis IAA-amino acid conjugate hydrolase subfamily and conjugates and is very similar to IAR3. |
AT1G44350 | encodes a protein similar to IAA amino acid conjugate hydrolase. |
AT3G02875 | Hydrolyzes amino acid conjugates of the plant growth regulator indole-3-acetic acid (IAA), including IAA-Leu and IAA-Phe. Uses Mg and Co ions as cofactors. |
AT3G18485 | Encodes a novel protein with no predicted membrane-spanning domains that is polymorphic among Arabidopsis accessions. The protein may modulate a metal transporter. Mutants are resistant to IAA-Leu, IAA-Phe, and the divalent metals cobalt and manganese but remain sensitive to free IAA; they are defective in lateral root formation and primary root elongation. |
AT5G54140 | encodes a protein similar to IAA amino acid conjugate hydrolase |
AT4G37550 | Indole-3-acetamide (IAM) hydrolase gene required for the auxin effects of IAM. |
AT1G18660 | Membrane localized protein of unknown function. Involved in negative regulation of immune response. Mutants have increased resistance to pathogens. |
AT1G17210 | IAP-like protein 1;(source:Araport11) |
AT3G06810 | Encodes a protein with similarity to acyl-CoA dehydrogenases. Mutations in IBR3 render plants resistant to indole-3-butryic acid, a putative storage form of the biologically active auxin IAA (indole-3-acetic acid). IBR3 is hypothesized to carry out the second step in a β-oxidation-like process of IBA metabolism in Arabidopsis. Though its subcellular location has not been determined, IBR3 has a peroxisomal targeting sequence and two other putative IBA metabolic enzymes (IBR1 and IBR10) can be found in this organelle. No specific enzymatic activity has been documented for IBR3, but double mutant analyses with CHY1 argue against a role for IBR3 in general fatty acid β-oxidation. The mRNA is cell-to-cell mobile. |
AT4G30410 | sequence-specific DNA binding transcription factor;(source:Araport11) |
AT2G32320 | Interacts genetically with its homolog ICA1; alters growth and flowering time plasticity in relation to temperature. Mutants display effects on growth, flowering and plant development, and ploidy level depending on ambient temperature (effects specific at >27C). |
AT1G72270 | Encodes IDAP1. Acts together with IDAP2 and IDM1 to regulate active DNA demethylation. |
AT2G43060 | ILI1 binding bHLH 1;(source:Araport11) |
AT1G64790 | ILITHYIA (ILA) is a HEAT repeat protein involved in plant immunity. The gene is also involved in systemic acquired resistance induced by P. syringae expressing avrRps4. Loss-of-function mutants of ILA caused pleiotropic defects in the mutant plants. The mutant plants are smaller in size and the leaves are serrated and yellow to light green in color. Required for bacterium-triggered stomatal closure. |
AT4G09950 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G33970 | IAN9 is a member of a small family of proteins. It's expression is repressed upon pathogen infection and loss of function mutants show increased resistance to bacterial pathogens. |
AT3G23900 | Physically interacts with, and promotes canonical splicing of, transcripts encoding defense signaling proteins, including the key negative regulator of pattern recognition receptor signaling complexes, CALCIUM-DEPENDENT PROTEIN KINASE 28 (CPK28). Upon immune activation by Plant Elicitor Peptides (Peps), IRR is dephosphorylated, disrupting interaction with CPK28 transcripts and resulting in accumulation of an alternative splice variant encoding a truncated CPK28 protein with impaired kinase activity and diminished function as a negative regulator. |
AT4G31180 | The IBI1 gene encodes an aspartyl tRNA synthetase (AspRS). In addition, the IBI1 protein acts as a receptor protein of the chemical plant defence activator beta-aminobutyric acid (BABA). Binding of IBI1 to the active R-enantiomer of BABA primes non-canonical defence activity of the AspRS protein against pathogen attack. |
AT1G09270 | Protein interacts with Agrobacterium proteins VirD2 and VirE2. |
AT5G49310 | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
AT3G05720 | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
AT5G03070 | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
AT5G08550 | Encodes a transcriptional repressor that is homologous to the C-terminal region of mammalian GC binding factor. It regulates endoreduplication through control of CYC2A expression. |
AT4G18570 | Microtubule associated protein involved in cortical microtubule organization. |
AT5G67100 | Encodes the putative catalytic subunit of the DNA polymerase alpha. Interacts with genes involved in chromatin-mediated cellular memory. ICU2 genetically interacts with TERMINAL FLOWER2, the ortholog of HETEROCHROMATIN PROTEIN1 of animals and yeasts, and with the Polycomb group (PcG) gene CURLY LEAF. A number of regulatory genes were derepressed in the icu2-1 mutant, including genes associated with flowering time, floral meristem, and floral organ identity. Mutant has curled, involute leaves and causes early flowering. |
AT3G13810 | indeterminate(ID)-domain 11;(source:Araport11) |
AT1G68130 | Encodes the longer of two splice variants of a transcription factor involved in regulating starch metabolism in response to cold. |
AT1G25250 | Encodes a transcription factor that, together with IDD14 and IDD15, regulates auxin biosynthesis and transport and thus aerial organ morphogenesis and gravitropic responses . IDD16 also binds to the SPCH promoter and regulates stomata initiation. |
AT2G02080 | C2H2 BIRD transcription factor family. |
AT1G55110 | indeterminate(ID)-domain 7;(source:Araport11) |
AT1G21120 | O-methyltransferase family protein;(source:Araport11) |
AT1G52830 | An extragenic dominant suppressor of the hy2 mutant phenotype. Also exhibits aspects of constitutive photomorphogenetic phenotype in the absence of hy2. Mutants have dominant leaf curling phenotype shortened hypocotyls and reduced apical hook. Induced by indole-3-acetic acid. |
AT3G23050 | Transcription regulator acting as repressor of auxin-inducible gene expression. Plays role in the control of gravitropic growth and development in light-grown seedlings. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. Pseudomonas syringae type III effector AvrRpt2 stimulates AXR2 protein turnover. |
AT4G14560 | auxin (indole-3-acetic acid) induced gene (IAA1) encoding a short-lived nuclear-localized transcriptional regulator protein. The mRNA is cell-to-cell mobile. |
AT1G04550 | IAA12/BDL plays a role in auxin-mediated processes of apical-basal patterning in the embryo. bdl mutants lack a primary root meristem |
AT4G14550 | IAA14 is a member of the Aux/IAA protein family. Involved in lateral root development. Gain of function mutation decreases auxin-inducible gene expression. Protein is localized to the nucleus. Expressed in stele and root tip epidermis. Functions as a negative regulator of ARF7/19. |
AT1G51950 | indole-3-acetic acid inducible 18;(source:Araport11) |
AT5G25890 | encodes a protein that may be a negative regulator of lateral root formation in response to auxin. It is a member of IAA/ARF gene family and is plant-specific. Gain of function mutations in this gene suppresses lateral root formation and is resistant to inhibition of root elongation by auxin, cytokinin, and ethylene. |
AT2G01200 | Belongs to auxin inducible gene family. |
AT1G15050 | Belongs to auxin inducible gene family. |
AT5G65670 | auxin (indole-3-acetic acid) induced gene The mRNA is cell-to-cell mobile. |
AT2G04550 | Encodes a protein phosphatase that interacts with MPK12, but not with other MAP kinases. It can dephosphorylate a dually phosphorylated MPK12 in vitro and can inactivate MPK12 in vivo. ibr5 mutants have reduced sensitivity to auxin and abscisic acid. IBR5 promotes auxin responses, including auxin-inducible transcription, differently than the TIR1 auxin receptor and without destabilizing Aux/IAA repressor proteins. It plays a role in male gametophyte development, auxin and TCP growth regulatory pathways. Regulates leaf serrations development via modulation of the expression of PIN1. |
AT2G22670 | Encodes a transcriptional repressor of the auxin response that is auxin inducible and is involved in lateral root formation. The mRNA is cell-to-cell mobile. |
AT1G76952 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
AT3G24010 | ING1 encodes a member of the Inhibitor of Growth family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA. |
AT5G48820 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type and CDC2A cyclins and may inhibit cell cycle. Seven KRP genes were found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. |
AT1G23420 | Essential for formation and asymmetric growth of the ovule outer integument. Member of the YABBY protein family of putative transcription factors that contain apparent Cys(2)-Cys(2) zinc-finger domains and regions of similarity to the high mobility group (HMG) transcription factors. INO may be required for polarity determination in the central part of the ovule. |
AT4G33770 | Inositol pyrophosphate kinase. Catalyzes the phosphorylation of phytic acid (InsP6) to the symmetric InsP7 isomer 5-InsP7. |
AT1G47510 | Encodes a phosphatidylinositol polyphosphate 5-phosphatase. It can dephosphorylate PI(4,5)P2, PI(3,5)P2, and PI(3,4,5)P3, but, it is not active against PI(5)P or the water soluble inositol(1,4,5)P3 or inositol(1,3,4,5)P4. The transcript levels for this gene rise in response to auxin, ABA, and JA. |
AT1G34120 | Encodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not act on I(1)P, I(1,4)P2, or phosphatidylinositol(4,5)P2. |
AT3G11870 | An isoform of IRE1A and IRE1B. Functions redundantly with IRE1B during gametophyte development. |
AT1G30220 | Inositol transporter presenting conserved extracellular loop domains homologs of plexins/semaphorin/integrin (PSI) domains from animal type I receptors. |
AT2G43900 | Encodes a 5-inositol-phosphate phosphatase, that, in vitro, shows activity against IP(1,4,5). |
AT2G31830 | Encodes a 5-inositol-polyphosphate phosphatase, that, in vitro, shows some activity against Ins(1,4,5)P3 and PI(3,4,5)P3, but even higher activity against PI(4,5)P2 |
AT1G17140 | Encodes a ROP/RAC effector, designated interactor of constitutive active ROPs 1 (ICR1), that interacts with GTP-bound ROPs. ICR1 is a scaffold mediating formation of protein complexes that are required for cell polarity. ICR1 is comprised of coiled-coil domains and forms complexes with itself and the exocyst vesicle-tethering complex subunit SEC3. |
AT3G05820 | Encodes a putative plastid-targeted alkaline/neutral invertase.Expression is induced by salt, osmotic and ABA treatments. Loss of function affects mitochondrial functioning and ROS production. |
AT1G48280 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G09710 | Ca(2+)-dependent calmodulin-binding protein. Targeted to the nucleus. Involved in glucosinolate metabolism in response to biotic challenge. Expressed in vascular tissue.Member of IQ67 (CaM binding) domain containing family. |
AT3G59690 | Member of IQ67 (CaM binding) domain containing family. |
AT5G03040 | Member of IQ67 (CaM binding) domain containing family. |
AT4G29150 | Member of IQ67 (CaM binding) domain containing family. |
AT1G19870 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
AT5G35670 | Member of IQ67 (CaM binding) domain containing family. |
AT2G26410 | Member of IQ67 (CaM binding) domain containing family. |
AT3G22190 | Member of IQ67 (CaM binding) domain containing family. |
AT2G26180 | Transient Expression of Pro35S:YFP-IQD5 in leaves of N. benthamiana alters microtubule organization.Member of IQ67 (CaM binding) domain containing family. |
AT1G17480 | Transient expression of Pro35S:GFP-IQD7 in leaves of N. benthamiana alters microtubule organization, in patterns similar to Pro35S:GFP-IQD8 and Pro35S:GFP-IQD6.Member of IQ67 (CaM binding) domain containing family. |
AT2G33990 | Member of IQ67 (CaM binding) domain containing family. |
AT5G03570 | Encodes FPN2, a tonoplast localized nickel transport protein. FPN2 is one of the Arabidopsis orthologs (AT2G38460/IREG1/FPN1 and AT5G03570/IREG2/FPN2) the iron efflux transporter ferroportin (FPN) identified in animals. |
AT1G60960 | Encodes a plasma membrane localized zinc/iron transporter. |
AT4G18780 | Encodes a member of the cellulose synthase family involved in secondary cell wall biosynthesis. Mutants have abnormal xylem formation, reduced cellulose content, and enhanced drought and osmotic stress tolerance. Mediates resistance towards bacterial pathogens via ABA. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling. |
AT2G38080 | LAC4 appears to have laccase activity based on enzyme assays performed using lac4 mutants. These mutants also have reduced levels of lignin. LAC4 is expressed in vascular bundles and fibers and likely contributes to lignin biosynthesis, and hence cell wall biosynthesis, there. lac4/irx12 mutants have a mild irregular xylem phenotype. |
AT4G36890 | IRX14 was identified as MUCI64 in a reverse genetic screen for MUCILAGE-RELATED genes. IRX14/MUCI64 is a GT43 protein essential for xylan elongation in seed coat mucilage. The xylan backbone maintains the attachment of mucilage to the seed surface and the distribution of cellulose. It was identified based on its gene expression co-variance with the IRX3 gene involved in secondary cell wall synthesis. A biochemical assay using the irx14 mutant indicates that IRX14 might function in xylose chain elongation. |
AT5G67230 | Encodes a member of the GT43 family glycosyltransferases involved in glucuronoxylan biosynthesis: AT2G37090 (IRX9) and AT1G27600 (IRX9-L or I9H, IRX9 homolog); AT4G36890 (IRX14) and AT5G67230 (IRX14-L or I14H, IRX14 homolog). They form two functionally non-redundant groups essential for the normal elongation of glucuronoxylan backbone. I9H functions redundantly with IRX9, I14H is redundant with IRX14. IRX9 or I9H do not complement IRX14, IRX14 or I14H do not complement IRX9. |
AT4G30370 | RING/U-box superfamily protein;(source:Araport11) |
AT5G17420 | Encodes a xylem-specific cellulose synthase that is phosphorylated on one or more serine residues (on either S185 or one of S180 or S181). |
AT3G01020 | Encodes a mitochondrial protein similar to E.coli IscU. In bacteria, IscU is a scaffold protein accepting sulfur and iron to build a transient Fe-S cluster,which is subsequently transferred to a target apoprotein. |
AT4G04080 | Encodes a mitochondrial protein similar to E.coli IscU. In bacteria, IscU is a scaffold protein accepting sulfur and iron to build a transient Fe-S cluster,which is subsequently transferred to a target apoprotein. |
AT2G39930 | Encodes an isoamylase-type debranching enzyme. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. Mutants have reduced starch content and abnormally structured amylopectins and phytoglycogens. It has been postulated that AtISA1 interacts with AtISA2 to form the Iso1 complex. |
AT1G18870 | Encodes a protein with isochorismate synthase activity involved in phylloquinone biosynthesis. Mutant studies of this gene's function suggest that its function is redundant with that of ICS1 (AT1G7410). |
AT4G35650 | Encodes a regulatory subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase. In contrast to the broadly expressed other regulatory (IDH-I and IDH-II) and catalytic (IDH-V and IDH-VI) subunits of this enzyme, IDH-III expression appears to be restricted largely to pollen. |
AT3G09810 | Encodes a catalytic subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase |
AT1G26640 | Encodes a cytosolic isopentenyl phosphate kinase that plays an important role in regulating the formation of both MVA (mevalonic acid) and MEP (methylerythritol phosphate) pathway-derived terpenoid compounds by controlling the ratio of IP/DMAP to IPP/DMAPP. IPP and DMAPP are the universal C5 building blocks of all natural terpenoids. IPK enhances terpenoid formation by returning IP/DMAP to the terpenoid biosynthetic network. |
AT1G68460 | Encodes a putative adenylate isopentenyltransferase. It catalyzes the formation of isopentenyladenosine 5'-monophosphate (iPMP) from AMP and dimethylallylpyrophosphate (DMAPP), but it has a lower Km for ADP and likely works using ADP or ATP in plants. It is involved in cytokinin biosynthesis. |
AT3G63110 | Encodes cytokinin synthase involved in cytokinin biosynthesis. IPT3 subcellular localization is modulated by farnesylation- when farnesylated it is localized to the nucleus, otherwise to the chloroplast. |
AT1G25410 | AB061404 Arabidopsis thaliana AtIPT6 mRNA for cytokinin synthase, complete cds |
AT4G13430 | Encodes a methylthioalkylmalate isomerase involved in glucosinolate biosynthesis. |
AT3G58990 | Small subunit, which together with IPMI SSU1, IPMISSU2 and IPMI LSU1, is a member of heterodimeric isopropylmalate isomerase (IPMI). Together with IPMI SSU3 participates in the Met chain elongation pathway. |
AT3G15490 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
AT1G51900 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
AT1G25420 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
AT4G29440 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
AT2G19710 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
AT1G13340 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
AT1G75100 | Contains a J-domain at the C-terminus which is similar to the J-domain of auxilin, a clathrin-uncoating factor in cow, yeast and worm. Arabidopsis contains 6 other proteins similar to auxilin. Expressed in leaves and stems, but not in roots. Localized in the cytoplasm. Required for the chloroplast accumulation response, but not for the avoidance response. No molecular function known. Influences the composition of photosynthetic pigments, the efficiency of photosynthesis, and the CO2 uptake rate. Positive effect on water use efficiency (WUE) by reducing stomatal aperture and water vapor conductance; involved in the fine-tuning of H2O2 foliar levels, antioxidant enzymes activities and cell death after UV-C photooxidative stress. |
AT2G39310 | jacalin-related lectin 22;(source:Araport11) |
AT3G22275 | Encodes a non-TIFY JAsmonate ZIM-domain (JAZ) protein with a Ser-rich C-terminal tail that is a site for phosphorylation that interacts with the bHLH transcription factor MYC2 and the co-repressor TOPLESS and acts as a repressor of JA signaling. JAZ13 is the 13th member of the JAZ family in Arabidopsis, and the only member not classified as a TIFY protein. |
AT3G22160 | VQ motif-containing protein. JAV1 is a repressor of jasmonate-mediated defense responses. |
AT3G11180 | One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
AT3G55970 | One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
AT3G43440 | jasmonate-zim-domain protein 11;(source:Araport11) |
AT3G17860 | JAZs are direct targets of the SCFCOI1 E3 ubiquitin-ligase and JA treatment induces their proteasome-mediated degradation. Furthermore, JAI3 negatively regulates the key transcriptional activator of JA responses, AtMYC2. The C-terminal portion of JAZ3, including the Jas domain, appears to be important for JAZ3-COI1 binding in the presence of coronatine. |
AT1G48500 | Jasmonate zim domain transcription factor family protein.Involved in freezing tolerance and JA iduceed leaf senesence. |
AT1G72450 | JAZ6 transcript levels rise in response to a jasmonate stimulus and a GFP:JAZ6 fusion protein localizes to the nucleus. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ6:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. |
AT2G29640 | JOSEPHIN-like protein;(source:Araport11) |
AT1G63490 | Histone demethylase belonging to the KDM5/JARID1 family which plays crucial roles in response to dehydration stress and abscisic acid (ABA). Directly binds the chromatin of OPEN STOMATA 1 (OST1) and demethylated H3K4me3 for the regulation of OST1 mRNA abundance, thereby modulating the dehydration stress response. |
AT1G60160 | Member of the KT/KUP/HAK family of proton-coupled potassium transporters which have potential effect on cellular expansion. |
AT1G01790 | Encodes a member of the cation/proton antiporters-2 antiporter superfamily, the K efflux antiporter KEA1 that is localized to the chloroplast envelope. |
AT4G00630 | Encodes a K(+)/H(+) antiporter that modulates monovalent cation and pH homeostasis in plant chloroplasts or plastids. |
AT4G04850 | Encodes a potassium efflux antiporter; has three splice forms KEA3.1, KEA3.2, and KEA3.3, KEA3.2 is the most abundant splice form in all plant organs (silique, flower, leaf and root). KEA3.1 and KEA3.3 are minor variants that can be found in flowers and in leaves. KEA3 is localized to the thylakoid membrane and enriched in the stromal lamellae. It allows proton efflux from the thylakoid lumen by proton/potassium antiport. |
AT5G51710 | member of Putative potassium proton antiporter family |
AT2G26650 | Encodes AKT1, a member of the Shaker family inward rectifying potassium channel predominantly expressed in predominantly in root hairs and root endodermis. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
AT4G32500 | Encodes AKT5, a member of the Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
AT1G31120 | potassium transporter |
AT1G70300 | potassium transporter |
AT4G19960 | Encodes a potassium ion transmembrane transporter. Also mediates cesium uptake when expressed in E. coli. The mRNA is cell-to-cell mobile. |
AT3G02050 | potassium transporter KUP3p (KUP3) |
AT4G38600 | encodes a member of HECT ubiquitin protein ligase family that is involved in trichome cell morphogenesis. Mutants in this gene exhibit supernumerary trichome branches and increased DNA content. |
AT1G32240 | Encodes a member of the KANADI family of putative transcription factors. Together with KAN1, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN1 and KAN4 appears to regulate the proper localization of PIN1 in early embryogenesis. |
AT5G23430 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
AT3G61980 | Encodes a Kazal-type serine proteinase inhibitor that is highly expressed in seedlings and flowers. |
AT5G03770 | Encodes a putative KDO (3-deoxy-D-manno-octulosonate) transferase |
AT5G13530 | Encodes KEEP ON GOING (KEG), a RING E3 ligase involved in abscisic acid signaling. KEG is essential for Arabidopsis growth and development. ABA promotes KEG degradation via the ubiquitin dependent 26S proteasome pathway. Associates with and ubiquitinates MKK4 and MKK5 to regulate plant immunity. |
AT1G50650 | KRS is a member of the STIG1 family of peptides. Its expression in embryos appears to be dependent upon ZOU.Loss of function results in a reduction of α-JIM12 labelled 'sheath' around the developing embryo. |
AT2G46110 | Encodes a ketopentoate hydroxymethyltransferase that appears to localize to the mitochondria. This protein is expected to play a role in pantothenate (vitamin B5) biosynthesis. |
AT1G26945 | Encodes a basic helix-loop-helix (bHLH) protein involved in blue/far-red light signaling. Physically interacts with HFR1 and negatively regulates its activity. |
AT1G05360 | KMS2 encode a endoplasmic reticulum protein involved in the early secretory pathway. |
AT2G17220 | Encodes a putative serine/threonine-specific protein kinase kin3. Protein is N-myristoylated. |
AT5G27000 | Encodes a kinesin-like protein that binds microtubules in an ATP-dependent manner. |
AT4G05190 | ATK5 encodes a kinesin protein involved in microtubule spindle morphogenesis. It acts as a minus-end directed motor as well as a plus-end tracking protein (+TIP). Localizes to mitotic spindle midzones and regions rich in growing plus-ends within phragmoplasts. |
AT2G21380 | Kinesin motor family protein;(source:Araport11) |
AT3G12020 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G39050 | Kinesin motor family protein;(source:Araport11) |
AT5G06670 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G65460 | Kinesin that binds cyclin-dependent kinase CDKA;1 as homodimer or as heterodimer with KCA1 |
AT3G44730 | kinesin-like protein 1;(source:Araport11) |
AT5G02520 | Arabidopsis KNL2 localizes at chromocenters during all stages of the mitotic cell cycle, except from metaphase to mid-anaphase, and its level is strictly regulated by the proteasome degradation pathway. Knockout of KNL2 via a T-DNA insertion resulted in a reduced amount of centromeric cenH3, mitotic and meiotic abnormalities, and reduced growth and fertility. |
AT3G50630 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Gene was isolated from a yeast two hybrid screen as an interacting protein of CDC2A. Recombinant protein has a strong kinase inhibitor activity in vitro. Transcript is expressed in all tissues examined but is differentially distributed from ICK1. Controls the onset of the endoreduplication cycle through inhibition of CDKA;1. The KRP2 protein abundance is regulated by proteolysis through CDKB1;1 phosphorylation. |
AT2G32710 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI). A member of seven KRP genes found in Arabidopsis thaliana. Negative regulator of cell division. Expressed in actively dividing cells. |
AT3G19150 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type cyclins. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. KRP6 appears to be targeted for degradation by RHF1a and RHF2a to allow mitotic divisions during gametogenesis. In addition, KRP6 transcript levels rise prior to and drop following the meitotic divisions of gametogenesis. Elevated levels of KRP6 negatively affect plant development and fertility. |
AT1G80440 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB20, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. The mRNA is cell-to-cell mobile. |
AT3G59940 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB50, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. The mRNA is cell-to-cell mobile. |
AT3G20490 | Involved in DNA repair. Mutants show accumulation of DNA lesions upon genotoxic stress |
AT4G08150 | A member of class I knotted1-like homeobox gene family (together with KNAT2). Similar to the knotted1 (kn1) homeobox gene of maize. Normally expressed in the peripheral and rib zone of shoot apical meristem but not in the leaf primordia. It is also expressed in the fourth floral whorl, in the region that would become style, particularly in the cell surrounding the transmitting tissue. No expression was detected in the first three floral whorls. Expression is repressed by auxin and AS1 which results in the promotion of leaf fate. |
AT1G62990 | Encodes a homeodomain transcription factor of the Knotted family. May be involved in secondary cell wall biosynthesis. Mutants have moderately irregular xylem development. Expression of this gene is upregulated by SND1 and MYB46. |
AT3G08550 | mutant is Dwarfed and shows defects in cell elongation; Cellulose deficient; Plasma Membrane Protein |
AT1G77860 | Mutant has Altered morphology of pollen exine wall; Seven-Path Transmembrane Protein |
AT4G33670 | Encodes a L-galactose dehydrogenase, involved in ascorbate biosynthesis |
AT5G60320 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT3G45430 | Extracellular ATP transmembrane receptor involved in innate immunity. |
AT4G02420 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT2G32800 | protein kinase family protein;(source:Araport11) |
AT3G46760 | Protein kinase superfamily protein;(source:Araport11) |
AT5G06740 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT5G55830 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT1G70110 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT2G43700 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT3G59750 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT5G01550 | Encodes LecRKA4.2, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. |
AT4G35890 | Encodes a cytoplasmic LAM domain containing protein that is involved in leaf senescence. The mRNA is cell-to-cell mobile. |
AT5G03260 | LAC11 is a putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
AT5G05390 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
AT5G60020 | LAC17 appears to have laccase activity based on enzyme assays performed using lac17 mutants. Notably, these mutants appear to have a reduced deposition of G lignin units. LAC17 is expressed in interfascicular fibers and likely contributes to lignin biosynthesis, and hence, cell wall biosynthesis, there. |
AT2G30210 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
AT2G46570 | putative laccase, a member of laccase family of genes (with 17 members in Arabidopsis). |
AT5G01040 | putative laccase, knockout mutant showed early flowering |
AT2G41500 | Encodes LACHESIS (LIS), a protein with seven WD40 repeats. LIS is homologous to the yeast splicing factor PRP4 which is associated with the U4/U6 complex of the spliceosome. LIS is involved in a mechanism that prevents accessory cells from adopting gametic cell fate: lis mutant forms supernumerary egg cells. |
AT1G15420 | Encodes a novel plant specific protein that is co-expressed with components of pre-rRNA processing complex. Co-localizes with NuGWD1 and SWA1. |
AT1G02820 | Late embryogenesis abundant 3 (LEA3) family protein;(source:Araport11) |
AT2G14560 | Encodes LURP1, a member of the LURP cluster (late upregulated in response to Hyaloperonospora parasitica) which exhibits a pronounced upregulation after recognition of the pathogenic oomycte H. parasitica. LURP1 is required for full basal defense to H. parasitica and resistance to this pathogen mediated by the R-proteins RPP4 and RPP5. The mRNA is cell-to-cell mobile. |
AT3G21420 | LATERAL BRANCHING OXIDOREDUCTASE (LBO), encodes an oxidoreductase-like enzyme of the 2-oxoglutarate and Fe(II)-dependent dioxygenase superfamily. It is involved in the biosynthesis of strigolactones. |
AT2G42430 | LOB-domain protein gene LBD16. This gene contains one auxin-responsive element (AuxRE). Regluates lateral root formation. |
AT3G58190 | This gene contains two auxin-responsive element (AuxRE). Required for triggering cell reprogramming during callus formation. |
AT5G12330 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Expressed in lateral root primordia and induced by auxin. SWP1 is involved in the repression of LRP1 via histone deacetylation. |
AT3G05090 | Encodes a DCAF protein. Mutants are defective in lateral root development and suggest roles for DDB1-Cul4?mediated protein degradation in regulating auxin accumulation during lateral root primordium development and lateral root meristem emergence. |
AT1G77220 | LAZ1H1 is a DUF300 that is localized to the tonoplast. Along with LAZ1 it appears to play a role in maintaining the structural integrity of vacuoles and regulating BR signaling by modulating downstream subcellular distribution of BAK1. |
AT3G22990 | Armadillo-repeat containing protein. Involved in leaf and flower development. Located in nucleus. Broadly expressed throughout vegetative and floral tissues. LFR is functionally associated with AS2 to mediate leaf development. |
AT1G66930 | Protein kinase superfamily protein;(source:Araport11) |
AT1G11755 | Encodes a cis-prenyltransferase, involved in dolichol biosynthesis. Wilted leaves in mutants due to cell membrane lesions. Mutants have increased drought tolerance, but hypersensitve to dark stress. |
AT5G13910 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (LEAFY PETIOLE). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and LEAFY PETIOLE. Acts as a positive regulator of gibberellic acid-induced germination. |
AT5G01560 | Encodes LecRKA4.3, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. |
AT5G17440 | LUC7 related protein;(source:Araport11) |
AT5G16590 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G14460 | Leucine rich repeat protein that also contains an adenylate cyclase catalytic core motif. Capable of converting ATP to cAMP in vitro. Mutants show increased susceptibility to fungal pathogens. |
AT1G62440 | encodes a paralog of LRX1 (LEUCINE-RICH REPEAT/EXTENSIN 1) which acts synergistically with LRX1 in root hair cell morphogenesis. |
AT1G49490 | Pollen expressed protein required for pollen tube growth.Along with other members of the LRX family, itnteracts with RALF4 to control pollen tube growth and integrity. Loss of function results in premature pollen tube rupture and reduced fertility. |
AT2G24200 | Cytosol aminopeptidase family protein;(source:Araport11) |
AT4G30920 | Encodes LAP2, an aminopeptidase playing key roles in senescence, stress response and amino acid turnover. |
AT4G32551 | LEUNIG regulates floral organ identity,gynoecium and ovule development. Negatively regulates AGAMOUS . Encodes a glutamine-rich protein with seven WD repeats similar to transcriptional corepressors. |
AT2G32700 | Encodes a WD40 repeat and LUFS domain containing protein that is similar to LUG. Interacts physically with SEUSS and likely functions as part of a repressor complex that represses AG. Involved in cell wall modifications necessary for mucilage extrusion and mediates aluminium sensitivity through PECTIN METHYLESTERASE46-modulated root cell wall pectin methylesterification. |
AT4G14730 | Stress induced membrane protein. Mutants show enhanced cell death under stress. |
AT1G03070 | Bax inhibitor-1 family protein;(source:Araport11) |
AT2G42610 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
AT3G04510 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
AT2G31160 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
AT5G58500 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
AT1G07090 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
AT1G78815 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
AT4G18610 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
AT5G54270 | Lhcb3 protein is a component of the main light harvesting chlorophyll a/b-protein complex of Photosystem II (LHC II). |
AT3G47470 | Encodes a chlorophyll a/b-binding protein that is more similar to the PSI Cab proteins than the PSII cab proteins. The predicted protein is about 20 amino acids shorter than most known Cab proteins. |
AT4G17600 | Encodes Lil3:1 (light-harvesting-like) protein. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus. A generic LHC motif is present in Lil3:1. The mRNA is cell-to-cell mobile. |
AT1G77690 | Encodes an auxin influx carrier LAX3 (Like Aux1) that promotes lateral root emergence. Auxin-induced expression of LAX3 in turn induces a selection of cell-wall-remodelling enzymes, which are likely to promote cell separation in advance of developing lateral root primordia. |
AT5G01240 | Encodes LAX1 (LIKE AUXIN RESISTANT), a member of the AUX1 LAX family of auxin influx carriers. Required for the establishment of embryonic root cell organization. |
AT1G43130 | like COV 2;(source:Araport11) |
AT3G55760 | hypothetical protein;(source:Araport11) |
AT5G04360 | Encodes an enzyme thought to be involved in the hydrolysis of the α-1,6 linkages during starch degradation in seed endosperm. However, a knockout mutant of Arabidopsis lacking limit dextrinase has normal rates of starch degradation in the leaf at night, indicating that more than one isoamylases might be involved in this process. |
AT2G15230 | Lipase active on medium and short chain triacylglycerols, but not on phospho- or galactolipids. Active between pH4 and 7 with an optimum at pH6. Knock-out mutant has not obvious phenotype. Predicted to be extracellular. |
AT1G15080 | Encodes phosphatidic acid phosphatase. Involved in ABA signaling. Functions as a negative regulator upstream of ABI4. Expressed during germination and seed development. Expressed overall in young seedlings, in roots, hypocotyls, and vascular cells of cotyledons and leaves of 10 day-old seedlings, in flower filaments and stem elongation zones. Not expressed in anthers, pollen nor petals. |
AT3G18220 | Phosphatidic acid phosphatase (PAP2) family protein;(source:Araport11) |
AT2G15050 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
AT5G59310 | Encodes a member of the lipid transfer protein family. Proteins of this family are generally small (~9 kD), basic, expressed abundantly and contain eight Cys residues. The proteins can bind fatty acids and acylCoA esters and can transfer several different phospholipids. They are localized to the cell wall. The mRNA is present in flowers and siliques, and is strongly up-regulated by abscisic acid. Predicted to be a member of PR-14 pathogenesis-related protein family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
AT3G08770 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
AT4G21220 | Trimeric LpxA-like enzymes superfamily protein;(source:Araport11) |
AT1G55020 | lipoxygenase, a defense gene conferring resistance Xanthomonas campestris The mRNA is cell-to-cell mobile. |
AT3G45140 | Chloroplast lipoxygenase required for wound-induced jasmonic acid accumulation in Arabidopsis.Mutants are resistant to Staphylococcus aureus and accumulate salicylic acid upon infection. The mRNA is cell-to-cell mobile. |
AT1G17420 | LOX3 encode a Lipoxygenase. Lipoxygenases (LOXs) catalyze the oxygenation of fatty acids (FAs). |
AT1G72520 | PLAT/LH2 domain-containing lipoxygenase family protein;(source:Araport11) |
AT5G65770 | Encodes a protein that localizes to the nuclear periphery and affects nuclear morphology. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
AT2G45450 | ZPR1, a small leucine zipper-containing protein that interacts with REV HD-ZIPIII and is involved in the establishment of leaf polarity. |
AT2G36307 | Has been identified as a translated small open reading frame by ribosome profiling. |
AT2G24260 | Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair and sperm cell development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3). |
AT2G28500 | LOB domain-containing protein 11;(source:Araport11) |
AT2G31310 | LOB domain-containing protein 14;(source:Araport11) |
AT2G45420 | LOB domain-containing protein 18;(source:Araport11) |
AT1G06280 | LOB domain-containing protein 2;(source:Araport11) |
AT3G27650 | LOB domain-containing protein 25;(source:Araport11) |
AT3G27940 | LOB domain-containing protein 26;(source:Araport11) |
AT3G47870 | Required for normal cell division during pollen development. Mutant has extra cell in pollen of vegetative cell identity. Male gametophytic mutation. |
AT1G72980 | LOB domain-containing protein 7;(source:Araport11) |
AT2G19510 | LOB domain-containing protein 8;(source:Araport11) |
AT2G19820 | LOB domain-containing protein 9;(source:Araport11) |
AT1G10920 | Encodes LOV1, a disease susceptibility gene that, paradoxically, is a member of the NBS-LRR resistance gene family. Conditions susceptibility to the fungus Cochliobolus victoriae and victorin-dependent induction of defense-associated proteins. Saturation mutagenesis identified 59 lov mutations that all display reduced susceptibility to vitorin. Mutations in known defense response pathways do not prevent susceptibility to C. victoriae. |
AT5G26860 | Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins. The mRNA is cell-to-cell mobile. |
AT2G28305 | Putative lysine decarboxylase family protein;(source:Araport11) |
AT4G35190 | Putative lysine decarboxylase family protein;(source:Araport11) |
AT5G03270 | lysine decarboxylase family protein;(source:Araport11) |
AT5G11950 | Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At2G37210. |
AT3G55850 | Encodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids. |
AT1G77590 | Encodes major plastidic long chain acyl-CoA synthetase with a slight substrate preference of oleic acid over any of the other fatty acids. |
AT5G23670 | Encodes the LCB2 subunit of serine palmitoyltransferase, an enzyme involved in sphingosine biosynthesis. The protein is localized to the endoplasmic reticulum. |
AT1G49430 | Encodes a long chain acyl-CoA synthetase that catalyzes the synthesis of omega-hydroxy fatty acyl-CoA intermediates in the pathway to cutin synthesis. Required for repression of lateral root formation. |
AT4G23850 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT3G05970 | encode peroxisomal long-chain acyl-CoA synthetase (LACS) isozymes |
AT5G27600 | Encode peroxisomal long-chain acyl-CoA synthetase. Activates fatty acids for further metabolism. Interacts with PEX5. |
AT4G11030 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT5G23450 | Encodes a sphingosine kinase that specifically phosphorylates D-erythro-dihydrosphingosine (DHS), but not N-acetyl-DHS or D-threo-DHS. It also also phosphorylates D-erythro-sphingosine, trans-4, trans-8-sphingadienine and phytosphingosine. |
AT2G46090 | Encodes a putative sphingosine kinase (SphK) containing the five conserved domains (C1-C5) previously identified in SphKs. |
AT5G15580 | Encodes LONGIFOLIA1 (LNG1). Regulates leaf morphology by promoting cell expansion in the leaf-length direction. The LNG1 homologue LNG2 (At3g02170) has similar function. |
AT1G15370 | TPLATE adaptor complex subunit. |
AT5G50150 | LOTR1 protein has an unknown function. It contains both DUF4409 and DUF239 domains. Loss of function mutations show defects in formation of the Casparian band- which is correlated with mis localization of CASP1. |
AT5G56170 | LORELEI-LIKE-GPI-ANCHORED PROTEIN 1;(source:Araport11) |
AT5G35620 | Cap-binding protein, binds to the 5' cap structure of nuclear-encoded mRNAs. Mutant is resistant to potyvirus infection. |
AT4G34120 | Encodes a single cystathionine beta-Synthase domain-containing protein. Modulates development by regulating the thioredoxin system. The mRNA is cell-to-cell mobile. |
AT1G23010 | Encodes a protein with multicopper oxidase activity. Located in ER. Function together with LPR2 (AT1G71040) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
AT5G51545 | Encodes LPA2 (low psii accumulation2), an intrinsic thylakoid membrane protein required for efficient assembly of Photosystem II. |
AT5G47010 | Required for nonsense-mediated mRNA decay. Involved in RNA interference. lba1 mutants has reduced sugar-induced expression of Atb- amylase, is hypersensitive to glucose and abscisic acid and resistant to mannose, and shows early flowering, short day-sensitive growth, and seed germination phenotypes. The mRNA is cell-to-cell mobile. |
AT3G04945 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G30074 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G29280 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G29273 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G28405 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G09984 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G22121 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G09153 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G13095 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT3G25265 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G14935 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT3G04943 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT3G06985 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G39917 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT5G48945 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G33233 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G28355 | low-molecular-weight cysteine-rich 5;(source:Araport11) |
AT2G12465 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G41997 | Encodes a Defensin-like (DEFL) family protein |
AT5G42242 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT5G47077 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT1G73603 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT1G75830 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
AT2G02100 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. The mRNA is cell-to-cell mobile. |
AT4G19035 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G02135 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G31953 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G25295 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G22210 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT1G32540 | Encodes a protein with 3 plant-specific zinc finger domains that acts as a positive regulator of cell death. |
AT4G21610 | Contains the same novel zinc finger motif with LSD1, a negative regulator of cell death and defense response. Due to differential splicing, it encodes two different proteins, one of which contains an additional, putative DNA binding motif. Northern analysis demonstrated that LOL2 transcripts containing the additional DNA binding motif are predominantly upregulated after treatment with both virulent and avirulent Pseudomonas syringae pv maculicola strains. |
AT4G16310 | FAD-dependent lysine-specific histone demethylase involved in the control of flowering time. |
AT4G02560 | Encodes a nuclear localized protein with similarity to transcriptional regulators. Recessive mutants are late flowering. Expression of LFY is reduced in LD mutants. LD has been reported to exhibit prion like behavior in yeast but it remains to be determined if such activity exists during normal plant development. |
AT3G10230 | Encodes a protein with lycopene β-cyclase activity. This enzyme uses the linear, symmetrical lycopene as substrate. However, unlike the ε-cyclase which adds only one ring, the β-cyclase introduces a ring at both ends of lycopene to form the bicyclic β-carotene. |
AT1G14030 | Encodes a lysine methyltransferase whose main soluble physiological substrates are chloroplastic fructose 1,6-bisphosphate aldolases, FBA1, FBA2, and FBA3. Lysines near the C-terminal end of the target proteins are trimethylated. |
AT3G01760 | Encodes an amino acid transporter expressed in the root that is involved in the uptake of acidic amino acids, glutamine and alanine, and probably phenylalanine. |
AT4G33150 | This is a splice variant of the LKR/SDH locus. It encodes a bifunctional polypeptide lysine-ketoglutarate reductase and saccharopine dehydrogenase involved in lysine degradation. There is another splice variant that encodes a mono saccharopine dehydrogenase protein. Gene expression is induced by abscisic acid, jasmonate, and under sucrose starvation. |
AT2G17120 | Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. It contains a C-terminal GPI anchor signal and is an ortholog of OsCEBiP. |
AT1G51940 | Encodes a LysM-containing receptor-like kinase. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. Based on protein sequence alignment analysis, it has a typical RD signaling domain in its catalytic loop and possesses autophosphorylation activity.It is required for the suppression of defense responses in absence of pathogen infection or upon abscisic acid treatment. Loss-of-function mutants display enhanced resistance to Botrytis cinerea and Pectobacterium carotovorum. Its expression is repressed by pathogen infection and biological elicitors and is induced abscisic acid.Expression is strongly repressed by elicitors and fungal infection, and is induced by the hormone abscisic acid (ABA). Insertional mutants show increased expression of PHYTOALEXIN-DEFICIENT 3 (PAD3), enhanced resistance to Botrytis cinerea and Pectobacterium carotovorum infection and reduced physiological responses to ABA, suggesting that LYK3 is important for the cross-talk between signaling pathways activated by ABA and pathogens (PMID:24639336). |
AT2G23770 | Encodes a putative LysM-containing receptor-like kinase LYK4. Shares overlapping function with LYK5 in mediating chitin-triggered immune responses. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain. |
AT3G57650 | Encodes an endoplasmic reticulum localized protein with lysophosphatidyl acyltransferase activity. |
AT1G51260 | ACYL-COA:1-ACYLGLYCEROL-3-PHOSPHATE ACYLTRANSFERASE, PUTATIVE SIMILAR TO ACYL-COA:1-ACYLGLYCEROL-3-PHOSPHATE ACYLTRANSFERASE GI:4583544 FROM [BRASSICA NAPUS] |
AT3G18850 | lysophosphatidyl acyltransferase 5;(source:Araport11) |
AT3G11710 | lysyl-tRNA synthetase 1;(source:Araport11) |
AT5G04710 | Plastid localized metalloaminopeptidase. |
AT3G48390 | MA3 domain-containing protein;(source:Araport11) |
AT5G50850 | Transketolase family protein;(source:Araport11) |
AT1G77080 | MADS domain protein - flowering regulator that is closely related to FLC. Deletion of this locus in Nd ecotype is correlated with earlier flowering in short days suggesting function as a negative regulator of flowering. |
AT5G65060 | MADS domain protein - flowering regulator that is closely related to FLC |
AT5G24350 | Member of MAG2 complex on the ER that is responsible for efficient transport of seed storage proteins, functions in protein transport between the ER and Golgi apparatus, contain a Zeste?White 10 (ZW10) domain and a Sec39 domain. Required for proper maturation of seed storage proteins. |
AT4G15570 | Similar to yeast Sen1 (splicing endonuclease 1)helicase protein. Involved in female gametophyte development. The mRNA is cell-to-cell mobile. |
AT5G22830 | Transmembrane magnesium transporter that is essential for chloroplast development and photosynthesis. One of nine family members. |
AT4G28580 | Transmembrane magnesium transporter that induces Mg transport from tapetum cell to locule. One of nine family members. Functions in pollen development. |
AT2G03620 | Transmembrane magnesium transporter. One of nine family members. |
AT4G25080 | Encodes a protein with methyltransferase activity responsible for the methylation of magnesium protoporphyrin IX. Mutants defective in this gene are affected in chlorophyll biosynthesis and show a reduction in the accumulation of a number of major thylakoid-associated proteins including components of PSI (LHCI), PSII (LHCII, D1, CP43) and the cytochrome b6f complex (Cytf). By contrast, no significant changes were detected for the proteins of the stroma and the chloroplast envelope. |
AT1G02140 | Encodes a homologue of the exon junction complex (EJC) component MAGO that participates in intron-mediated enhancement of gene expression. |
AT1G17930 | Mobile domain protein involved in silencing of transposable elements. Loss of function affects shoot and root meristem maintenance. Interacts and functions with MAIL1 and PP7L in gene silencing. |
AT2G11000 | Encodes a non-functional Arabidopsis homolog of the yeast protein MAK10, a component of the N-terminal acetyltransferase complex C. Mutant plants have normal photosynthesis as well as growth rates and pigmentation comparable to wild type. |
AT3G47520 | Encodes a protein with NAD-dependent malate dehydrogenase activity, located in chloroplasts. The mRNA is cell-to-cell mobile. |
AT5G45840 | Encodes a leucine-rich-repeat RLK that is localized to the plasma membrane of pollen tubes and functions with MIK1/2 as the male receptor of the pollen tube chemo-attractant LURE1.MDIS1 forms a complex with MIK1/2 and binds LURE1. |
AT2G21870 | Encodes the FAd subunit of mitochondrial F1F0-ATP synthase. Essential for pollen formation. |
AT1G08660 | Encodes a sialyltransferase-like protein that is localized to the Golgi apparatus and is involved in pollen tube growth and pollen germination. |
AT1G66170 | Encodes a PHD-domain containing protein required for male meiosis. Gene is expressed in developing male meiocytes and protein is localized to nuclear euchromatin specifically during diplotene. Required to regulate microtubule organization and cell cycle transitions during male meiosis, and functions as a direct transcription activator of the meiotic gene TDM1. |
AT1G19890 | histone 3.3, male-gamete-specific expression. Direct target promoter of the male germline-specific transcription factor DUO1. |
AT1G72250 | Malectin domain kinesin. |
AT2G22610 | Malectin domain kinesin. Possible role in cell division, with a possible secondary function in the nuclei. |
AT3G21190 | O-fucosyltransferase family protein;(source:Araport11) |
AT1G51630 | O-fucosyltransferase family protein;(source:Araport11) |
AT3G59790 | Encodes a member of the MAP Kinase family. Thought to be a pseuedogene, MAPK10 is expressed very transiently during germination and in the leaf tips/hydathodes. Loss of function mutations are late flowering in long days and exhibit abnormal patterning of cotyledon veins. MPK10 interacts with and may be regulated by MPKK2 another map kinase. |
AT3G14720 | member of MAP Kinase The mRNA is cell-to-cell mobile. |
AT2G42880 | member of MAP Kinase |
AT4G11330 | MAP kinase |
AT2G18170 | MAP kinase 7;(source:Araport11) |
AT3G18040 | Encodes a protein with similarity to MAP kinases (MAPK9).Expressed preferentially in guard cells and appears to be involved in reactive oxygen species mediated ABA signaling. |
AT1G73500 | member of MAP Kinase Kinase family. Autophosphorylates and also phosphorylates MPK3 and MPK6. Independently involved in ethylene and calmalexin biosynthesis. Induces transcription of ACS2, ACS6, ERF1, ERF2, ERF5, ERF6, CYP79B2, CYP79B3, CYP71A13 and PAD3. |
AT4G26070 | Member of MAP Kinase Kinase. Likely functions in a stress-activated MAPK pathway. Can phosphorylate the MAPK AtMPK4, in response to stress. Gets phosphorylated by MEKK1 in response to wounding. |
AT4G08500 | Encodes a member of the A1 subgroup of the MEKK (MAPK/ERK kinase kinase) family. MEKK is another name for Mitogen-Activated Protein Kinase Kinase Kinase (MAPKKK or MAP3K). This subgroup has four members: At4g08500 (MEKK1, also known as ARAKIN, MAP3Kb1, MAPKKK8), At4g08480 (MEKK2, also known as MAP3Kb4, MAPKKK9), At4g08470 (MEKK3, also known as MAP3Kb3, MAPKKK10) and At4g12020 (MEKK4, also known as MAP3Kb5, MAPKKK11, WRKY19). Nomenclatures for mitogen-activated protein kinases are described in Trends in Plant Science 2002, 7(7):301. Mediates cold, salt, cadmium and wounding stress signalling. Phosphorylates MEK1. |
AT4G08470 | Encodes a member of the A1 subgroup of the MEKK (MAPK/ERK kinase kinase) family. MEKK is another name for Mitogen-Activated Protein Kinase Kinase Kinase (MAPKKK or MAP3K). This subgroup has four members: At4g08500 (MEKK1, also known as ARAKIN, MAP3Kb1, MAPKKK8), At4g08480 (MEKK2, also known as MAP3Kb4, MAPKKK9), At4g08470 (MEKK3, also known as MAP3Kb3, MAPKKK10) and At4g12020 (MEKK4, also known as MAP3Kb5, MAPKKK11, WRKY19). Nomenclatures for mitogen-activated protein kinases are described in Trends in Plant Science 2002, 7(7):301. |
AT5G42600 | Encodes an oxidosqualene synthase that produces the monocyclic triterpene marneral. Crucial for growth and development. |
AT2G14680 | myosin heavy chain-like protein;(source:Araport11) |
AT2G16970 | Major facilitator superfamily protein;(source:Araport11) |
AT2G34850 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G34880 | JMJ15 is a novel H3K4 demethylase that regulates genes involved in flowering and response to stress. It is also a maternally expressed, imprinted gene. |
AT2G21650 | RSM1 is a member of a small sub-family of single MYB transcription factors. Analysis of overexpressin lines indicate its involvement during early morphogenesis. |
AT4G13345 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
AT4G13610 | DNA (cytosine-5-)-methyltransferase family protein;(source:Araport11) |
AT5G45800 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G02240 | F-box family protein;(source:Araport11) |
AT3G19350 | Encodes a the C-terminal domain of poly(A) binding proteins. MPC is imprinted such that only the maternal allele is expressed in the endosperm. MPC is silenced by the action of MET1 and its expression is promoted by DEM. |
AT4G34830 | Encodes MRL1, a conserved pentatricopeptide repeat protein, required for stabilization of rbcL mRNA. |
AT3G59350 | Pti-like protein. Interacts with CLV1 and functions in CLE peptide signaling pathway in root development. Membrane localization is dependent on palmytolation. |
AT1G53470 | mechanosensitive channel of small conductance-like 4;(source:Araport11) |
AT3G14810 | mechanosensitive channel of small conductance-like 5;(source:Araport11) |
AT1G78610 | mechanosensitive channel of small conductance-like 6;(source:Araport11) |
AT5G03220 | Encodes together with its paralog MED7B a subunit of the middle module of the transcriptional co-regulator Mediator complex. Regulates genes required for normal development of etiolated seedlings. |
AT5G03500 | Encodes together with its paralog MED7A a subunit of the middle module of the transcriptional co-regulator Mediator complex. Regulates genes required for normal development of etiolated seedlings. |
AT1G02580 | Encodes the imprinted gene MEA that belongs to Polycomb Repressive Complex 2 (PRC2) and has a SET domain for methyltransferase activity and is involved in the stable transcriptional silencing of target genes. It negatively regulates seed development in the absence of fertilization. Mutations in this locus result in embryo lethality. MEA is imprinted in the endosperm. The maternal allele is expressed and the paternal allele is silent. MEA is controlled by DEMETER (DME), a DNA glycosylase required to activate MEA expression, and METHYLTRANSFERASE I (MET1), which maintains CG methylation at the MEA locus. MEA is involved in the negative regulation of its own imprinted gene expression; the effect is not only allele-specific but also dynamically regulated during seed development. In the ovule, the MEA transcripts are accumulated at their highest level before fertilization and gradually decrease after fertilization |
AT2G10440 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
AT5G19480 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
AT4G09070 | TATA-binding related factor (TRF) of subunit 20 of Mediator complex;(source:Araport11) |
AT1G23230 | Mediator tail subunit, involved in transcriptional regulation. Mediator Complex Subunit, interacts with MED2, MED5, MED16 in the Regulation of Phenylpropanoid Biosynthesis. |
AT5G09850 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
AT3G63210 | encodes a novel zinc-finger protein with a proline-rich N-terminus, identical to senescence-associated protein SAG102 |
AT4G18120 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML3 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. Among mei2-like genes, AML3 is the transcript with highest frequency of alternative splicing. Expression was detected during early embryo development (heart and torpedo stage); no accumulation was detected in vegetative and floral apices, as revealed by in situ hybridization. |
AT5G61960 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML1 is a member of two sister clades of mei2-like gene family, AML1 through AML5 and belongs to the clade named ALM14. AML1 is expressed during early embryo development, particularly along embryonic axis at torpedo stage, in shoot apex (weaker expression) and in the organogenic regions of floral apices. |
AT1G29400 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML5 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. Among mei2-like genes, AML5 is the transcript with highest frequency of alternative splicing. Expression was detected during embryo development (heart and torpedo stage) and in vegetative and floral apices. |
AT1G77320 | Mutant is defective in meiosis and produces abnormal microspores. Encodes a BRCT-domain-containing protein that could be specific to the meiotic cell cycle and that plays a crucial role in some DNA repair events independent of SPO11 DSB recombination repair. |
AT3G02980 | Encodes MEIOTIC CONTROL OF CROSSOVERS1 (MCC1), a GCN5-related histone N-acetyltransferase. MCC1 appeared to be required in meiosis for normal chiasma number and distribution and for chromosome segregation. Activation tagging line has increased level of histone H3 acetylation. |
AT5G54260 | DNA repair and meiotic recombination protein, component of MRE11 complex with RAD50 and NBS1 |
AT5G24290 | Vacuolar iron transporter (VIT) family protein;(source:Araport11) |
AT1G64720 | membrane related protein CP5 |
AT3G01050 | membrane-anchored ubiquitin-fold protein 1 precursor;(source:Araport11) |
AT5G15460 | membrane-anchored ubiquitin-fold protein 2;(source:Araport11) |
AT1G77870 | membrane-anchored ubiquitin-fold protein 5 precursor;(source:Araport11) |
AT1G22050 | membrane-anchored ubiquitin-fold protein 6 precursor;(source:Araport11) |
AT1G64080 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
AT2G37380 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
AT5G50440 | Member of Membrin Gene Family. Encodes a Golgi-localized SNARE protein MEMB12. MEMB12 is a target of miR393b-mediated gene silencing during Pseudomonas syringae pv. Tomato infection. Loss of function of MEMB12 leads to increased exocytosis of an antimicrobial pathogenesis-related protein, PR1. |
AT1G56260 | Required for the maintenance of stem cells through a reduction in DNA damage. |
AT3G14390 | Meso-diaminopimelate decarboxylase which catalyzes the decarboxylation of mesodiaminopimelate, the final reaction in the diaminopimelate L-lysine biosynthetic pathway. |
AT5G11880 | Meso-diaminopimelate decarboxylase which catalyzes the decarboxylation of mesodiaminopimelate, the final reaction in the diaminopimelate L-lysine biosynthetic pathway. |
AT4G28590 | Encodes a dual-targeted nuclear/plastidial phytochrome signaling component required for PEP assembly. It controls PhAPG expression primarily from the nucleus by interacting with phytochromes and promoting their localization to photobodies for the degradation of the transcriptional regulators PIF1 and PIF3. RCB-dependent PIF degradation in the nucleus signals the plastids for PEP assembly and PhAPG expression. |
AT5G54930 | AT hook motif-containing protein;(source:Araport11) |
AT5G64240 | Encodes a type I metacaspase. Two Arabidopsis metacaspases, AT1G02170 (MC1) and AT4G25110 (MC2) antagonistically control programmed cell death in Arabidopsis. MC1 is a positive regulator of cell death and requires conserved caspase-like putative catalytic residues for its function. MC2 negatively regulates cell death. This function is independent of the putative catalytic residues. A third type I Arabidopsis metacaspase is MC3 (AT5g64240). |
AT1G79330 | Metacaspase AtMCPb2/AMC6. Caspase family protein. Arginine/lysine-specific cysteine protease activity. Induces apoptosis in yeast. Contains Pfam domain, PF00656: ICE-like protease (caspase) p20 domain. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
AT3G15353 | metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage |
AT2G36880 | methionine adenosyltransferase 3;(source:Araport11) |
AT3G25740 | Encodes a plastid localized methionine aminopeptidase. Formerly called MAP1C, now called MAP1B. |
AT2G44180 | Encodes a MAP2 like methionine aminopeptidase. In MAP1A mutant background plants show an increased sensitivity to fumagillin resulting in defects in development. Phenotype is similar to RNAi lines which knock out all MAP2/MAP1 loci. |
AT4G29840 | threonine synthase |
AT2G18030 | Peptide methionine sulfoxide reductase family protein;(source:Araport11) |
AT4G04810 | methionine sulfoxide reductase B4;(source:Araport11) |
AT4G21850 | methionine sulfoxide reductase B9;(source:Araport11) |
AT5G20980 | Encodes a plastidic methionine synthase, involved in methionine de novo synthesis in the chloroplast |
AT5G17920 | Encodes a cytosolic cobalamin-independent methionine synthase, involved in methionine regeneration via the activated methyl cycle (SAM cycle). The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. The mRNA is cell-to-cell mobile. |
AT3G50440 | Encodes a protein shown to have methyl jasmonate esterase activity in vitro. This protein does not act on methyl IAA, MeSA, MeGA4, or MEGA9 in vitro. |
AT3G29770 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
AT1G26360 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco but no enzymatic activity has been identified for this protein. |
AT1G33990 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
AT1G69240 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco but no enzymatic activity has been identified for this protein. |
AT3G10870 | Encodes a methyl IAA esterase. Methyl IAA is believed to be an inactive form of auxin that needs to be demethylated to exert a biological effect. MES17 does not act on methyl JA, MeSA, MeGA4, or MEGA9 in vitro. This gene is expressed in several tissues of seedlings and adult plants, with a higher relative level of expression in the seedling shoot apex and the adult stem. |
AT5G10300 | Encodes a protein with R-selective hydroxynitrile lyase activity. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
AT2G23550 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco but no enzymatic activity has been identified for this protein. |
AT4G22745 | Protein containing methyl-CpG-binding domain. |
AT3G15790 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
AT3G63030 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
AT5G35330 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
AT3G59970 | methylenetetrahydrofolate reductase MTHFR1 mRNA, complete |
AT1G11580 | methylesterase PCR A;(source:Araport11) |
AT4G38800 | Encodes one of the 5'-methylthioadenosine nucleosidases (AT4G38800/MTN1; AT4G34840/MTN2). Double mutant, mtn1-1mtn2-1, retains approximately 14% of the MTN enzyme activity present in the wild type and displays a pleiotropic phenotype that includes altered vasculature and impaired fertility. |
AT1G18500 | Encodes an active Arabidopsis isopropylmalate synthase IPMS1. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS1 can be compensated by a second isopropylmalate synthase gene IPMS2 (At1g74040). The mRNA is cell-to-cell mobile. |
AT5G49160 | Encodes a cytosine methyltransferase MET1. Required for silencing of FWA paternal allele in endosperm. Two lines with RNAi constructs directed against DMT1 have reduced agrobacterium-mediated tumor formation. The mRNA is cell-to-cell mobile. |
AT4G36270 | Member of the microrchidia protein family which have been described as epigenetic regulators and plant immune mediators, contains a hallmark GHKL-type ATPase domain in N-terminus. |
AT5G02035 | microRNA ath-MIR2111b precursor;(source:Araport11) |
AT5G11977 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC |
AT1G66795 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGACAGAAGAUAGAGAGCAC |
AT3G18217 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGACAGAAGAUAGAGAGCAC. Pri-mRNA coordinates for MIR157c (converted to TAIR10 based on PMID19304749): Chr3: 6244826-6243830 (reverse), length: 997 bp; exon coordinates: exon 1: 6244826 to 6244347, exon 2: 6244115 to 6243830; mature miRNA and miRNA* are located on exon 1. |
AT4G17788 | Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA. Pri-mRNA coordinates for MIR160b (converted to TAIR10 based on PMID19304749): Chr4: 9888799-9889176 (forward), length: 378 bp; exon coordinates: exon 1: 9888799-9889176; mature miRNA and miRNA* are located on exon 1.The miR160b pri-mRNA also encodes a regulatory peptide miPEP160b (AT4G17787) that regulates accumulation of its own miRNA |
AT1G48267 | Encodes a microRNA that targets several PPR family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCAAUGCAUUGAAAGUGACUA. Pri-mRNA coordinates for MIR161 (converted to TAIR10 based on PMID19304749): Chr4: 17825619-17826317 (forward), length: 699 bp; exon coordinates: exon 1: 17825619 to 17825867, exon 2: 17825996 to 17826317; mature miRNA and miRNA* are located on exon 1. |
AT5G27807 | Encodes a microRNA that targets several genes containing NAC domains including NAC1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCG. Early extra petal mutant (eep1). Pri-mRNA coordinates for MIR164c (converted to TAIR10 based on PMID19304749): Chr5: 9852483-9853314 (forward), length: 832 bp; exon coordinates: exon 1: 9852483-9853314; mature miRNA and miRNA* are located on exon 1. |
AT1G01183 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUCCCC. Accumulation of the pri-miRNA165a transcript is increased by the activity of the miPEP165 peptide which is encoded within the pri-miRNA165a transcript. |
AT4G00885 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUCCCC |
AT5G08717 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC |
AT5G41905 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC |
AT3G22886 | Encodes a microRNA that targets ARF family members ARF6 and ARF8. Essential for fertility of both ovules and anthers. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGAAGCUGCCAGCAUGAUCUA. Pri-mRNA coordinates for MIR167a (converted to TAIR10 based on PMID19304749): Chr3: 8108021-8108622 (forward), length: 602 bp; exon coordinates: exon 1: 8108021 to 8108622; mature miRNA and miRNA* are located on exon 1. |
AT1G31173 | Encodes a microRNA that targets ARF family members ARF6 and ARF8. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAAGCUGCCAGCAUGAUCUGG |
AT3G26812 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UAGCCAAGGAUGACUUGCCUG |
AT5G66045 | Encodes a microRNA that targets several SCL family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAUUGAGCCGUGUCAAUAUC |
AT3G51375 | Encodes a microRNA that targets several SCL family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAUUGAGCCGCGCCAAUAUC |
AT2G28056 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AGAAUCUUGAUGAUGCUGCAU. Pri-mRNA coordinates for MIR172a (converted to TAIR10 based on PMID19304749): Chr2: 11943611-11941515 (reverse), length: 2097 bp; exon coordinates: exon 1: 11943611 to 11942837, exon 2: 11942688 to 11942600, exon 3: 11941905 to 11941515; mature miRNA and miRNA* are located on exon 1. |
AT3G11435 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AGAAUCUUGAUGAUGCUGCAG |
AT4G23713 | Encodes a microRNA that targets several TCP family members controlling leaf development. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGACUGAAGGGAGCUCCCU. The miR319a pri-mRNA also encodes a regulatory peptide miPEP319a (AT4G23712) that regulates accumulation of its own miRNA. |
AT1G20375 | Encodes a microRNA that targets one member of the F-box family. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGCAUUCUGUCCACCUCC. It targets F-box protein AT1g27340. It is involved in the regulation of leaf morphology. |
AT1G69792 | Encodes a microRNA that targets both APS and AST family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: CUGAAGUGUUUGGGGGAACUC. Predicted targets are ATP sulfurylases. |
AT1G69797 | Encodes a microRNA that targets both APS and AST family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: CUGAAGUGUUUGGGGGGACUC. Predicted targets are ATP sulfurylases. |
AT5G35407 | Encodes a microRNA that targets several GRF family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCCACAGCUUUCUUGAACUU. Expression increased with leaf development, antagonizing with expression of GRFs. Transcript accumulates in the distal zone of young developing seeds, restricing the expression of GRF2 to the proximal part. miR396 attenuates cell proliferation in developing leaves through the repression of GRF activity and a decrease in the expression of cell cycle genes. |
AT4G05105 | Encodes a microRNA that targets several Laccase family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCAUUGAGUGCAGCGUUGAUG |
AT1G63005 | Encodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: CCUGCCAAAGGAGAGUUGCCC |
AT2G34202 | Encodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. Mature sequence: UGCCAAAGGAGAUUUGCCCCG |
AT2G47275 | Encodes a microRNA that targets AGO2 and AGO3. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUAGAUUCACGCACAAACUCG Thought to be dicot specific. It has homologs in 16 dicot species. |
AT2G22668 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:ATGAGTTGGGTCTAACCCATAACT |
AT1G52185 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:TAGAATGCTATTGTAATCCAG |
AT2G47015 | Encodes a microRNA that targets both a Laccase and Plantacyanin-like family member. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AUGCACUGCCUCUUCCCUGGC |
AT2G16145 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:GGTTCGTACGTACACTGTTCA |
AT2G32273 | Encodes a microRNA. Mature sequence:GAAGGTAGTGAATTTGTTCGA. Functions as a negative regulator of seed germination under salt stress conditions. |
AT1G76062 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUCUUGCAUAUGUUCUUUAUC |
AT1G01046 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUUCUUCUACUUCUUGCACA |
AT1G67481 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UACCAACCUUUCAUCGUUCCC |
AT3G44444 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UAACUAAACAUUGGUGUAGUA |
AT3G53016 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCUCGGUUCGCGAUCCACAAG |
AT5G15833 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AUGAAUUUGGAUCUAAUUGAG |
AT5G40384 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: ACAAAAUCCGUCUUUGAAGA |
AT4G21362 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGAACAUGGUUUAUUAGGAA |
AT5G39693 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCUGGUGUUGAGAUAGUUGAC |
AT1G23060 | hypothetical protein;(source:Araport11) |
AT5G44610 | Encodes a protein with seven repeated VEEKK motifs. RNAi and overexpression experiments suggest that the gene is not involved in cell division but might be consequential for cell shape of epidermal and cortical cells. The protein encoded by this gene binds to cortical microtubules and inhibits tubulin polymerization. Associates to the plasma membrane and interacts with calmodulin and phosphatidylinositol phosphates, indicating an involvement in cellular signal transduction. Expression is enhanced by abiotic and hormonal factors. Induced during senescence.Interacts with Ca2+/calmodulin complex, phosphatidylinositol phosphates, and free Ca2+. |
AT3G60840 | Encodes MAP65-4, a non-motor microtubule associated protein (MAP) that belongs to the evolutionarily conserved MAP65 family. MAP65-4 specifically associates with the forming mitotic spindle during prophase and with the kinetochore fibers from prometaphase to the end of anaphase. MAP65-4 cross-links microtubules and promotes microtubule bundle elongation. |
AT1G27920 | microtubule-associated protein 65-8;(source:Araport11) |
AT1G68060 | Encodes a microtubule associated protein (MAP70-1). Expressed in all tissues. |
AT1G24764 | Member of the MAP70 protein family. |
AT4G17220 | Encodes a microtubule associated protein (MAP70-5). Regulates secondary wall patterning in wood cells. Expressed in all tissues. |
AT4G35920 | Encodes an integral plasma membrane protein. Functionally complements the yeast mid1 mutant, a deficiency of Ca2+ influx. Involved in Ca2+ influx and mechanical sensing in roots. An over-expression line showed increased Ca2+ uptake than the wild type plant. The primary root of a knock-out mutant failed to penetrate a harder agar medium from a softer medium. |
AT1G67120 | Represents a homolog of the yeast MDN gene, which encodes a non-ribosomal protein involved in the maturation and assembly of the 60S ribosomal subunit. In Arabidopsis, it is essential for female gametogenesis progression. |
AT1G26700 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO14 belongs to the clade I, with AtMLO4 and AtMLO11. The gene is expressed during early seedling growth, in developing primary root, and particularly in root tips of 10-day old seedlings; it was not expressed in leaves or flowers, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT3G45290 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO3 belongs to the clade IV, with AtMLO2, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in primary root and lateral root primordia, in fruit abscission zone, in vascular system of cotyledons and in trichomes of young leaves,; it was not expressed in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT1G42560 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO9 belongs to the clade III, with AtMLO5, AtMLO7, AtMLO8, and AtMLO10. The gene is expressed during early seedling growth, in cotyledon vascular system, in flowers (with strong expression in anthers) in siliques and fruit abscission zone; not expressed in roots, or in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT1G74660 | Encodes MINI ZINC FINGER 1 (MIF1) which has a zinc finger domain but lacks other protein motifs normally present in transcription factors. MIF1 physically interact with a group of zinc finger-homeodomain (ZHD) transcription factors, such as ZHD5 (AT1G75240), that regulate floral architecture and leaf development. Gel mobility shift assays revealed that MIF1 blocks the DNA binding activity of ZHD5 homodimers by competitively forming MIF1-ZHD5 heterodimers. Constitutive overexpression of MIF1 caused dramatic developmental defects, seedlings were non-responsive to gibberellin (GA) for cell elongation, hypersensitive to the GA synthesis inhibitor paclobutrazol (PAC) and abscisic acid (ABA), and hyposensitive to auxin, brassinosteroid and cytokinin, but normally responsive to ethylene. |
AT3G28917 | mini zinc finger 2;(source:Araport11) |
AT5G35520 | encodes a homologue of the yeast (S. pombe) Mis12 (minichromosome instability) protein. MIS12 co-localizes with 180 bp repeats of centromeric DNA throughout the cell cycle with a similar pattern to AtCENH3/HTR12. Neither of these two proteins completely cover the 180 bp regions based on FISH analysis. |
AT1G44900 | Encodes MCM2 (MINICHROMOSOME MAINTENANCE 2), a protein essential to embryo development. Overexpression results in altered root meristem function. |
AT2G16440 | Regulates DNA replication via interaction with BICE1 and MCM7. |
AT2G07690 | Member of the minichromosome maintenance complex, involved in DNA replication initiation. Abundant in proliferating and endocycling tissues. Localized in the nucleus during G1, S and G2 phases of the cell cycle, and are released into the cytoplasmic compartment during mitosis. Binds chromatin. |
AT5G44635 | minichromosome maintenance (MCM2/3/5) family protein;(source:Araport11) |
AT3G09660 | Encodes a minichromosome maintenance protein that is involved with RAD51 in a backup pathway that repairs meiotic double strand breaks without giving meiotic crossovers when the major pathway, which relies on DMC1, fails. |
AT2G14050 | minichromosome maintenance 9;(source:Araport11) |
AT4G38440 | Encodes MINIYO (IYO), a positive regulator of transcriptional elongation that is essential for cells to initiate differentiation. |
AT5G27540 | Encodes a protein with similarity to GTPases that is localized to the mitochondrion. Involved in embryogenesis, pollen tube growth and required for mitochondrial development. |
AT3G05310 | Encodes a protein with similarity to MIRO GTPases. |
AT1G26800 | MPSR1 is cytoplasmic E3 ligase that senses misfolded proteins independently of chaperones and targets those proteins for degradation via the 26S proteasome. Involved in the regulation of the homeostasis of sensor NLR immune receptors. |
AT4G21090 | MITOCHONDRIAL FERREDOXIN 2;(source:Araport11) |
AT5G47630 | Encodes a member of the mitochondrial acyl carrier protein (ACP) family. Its role is currently obscure as it is weakly expressed and has not yet been identified by mitochondrial proteome analysis. |
AT2G04540 | Encodes a mitochondrial beta-ketoacyl-ACP synthase. |
AT3G02330 | Involved in cytidine to uridine editing of the mitochondrial mRNA AtMg00510. |
AT5G08305 | E+-type pentatricopeptide repeat protein involved in C to U editing in mitochondria and chloroplasts. |
AT5G09950 | Encodes a DYW-class PPR protein required for RNA editing at four sites in mitochondria of A. thaliana. |
AT1G62260 | Encodes MITOCHONDRIAL EDITING FACTOR 9 (MEF9), an E subclass PPR protein required for RNA editing. |
AT4G04750 | Putative mitochondrial F1F0-ATPase. |
AT4G05450 | mitochondrial ferredoxin 1;(source:Araport11) |
AT5G55200 | Co-chaperone GrpE family protein;(source:Araport11) |
AT5G09590 | heat shock protein 70 (Hsc70-5); nuclear |
AT5G23395 | Encodes Mia40, a component of the mitochondrial intermembrane space assembly machinery involved in the import pathway of the small intermembrane space proteins. |
AT1G66345 | Pentatricopeptide Repeat Protein involved in splicing of nad4 intron which affects biogenesis of the respiratory complex I. |
AT1G07030 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT1G48030 | Encodes a mitochondrial lipoamide dehydrogenase whose expression is induced by light. |
AT1G53240 | mMDH1 encodes a mitochrondrial malate dehydrogenase. It is expressed at higher levels than the other mitochrondrial isoform mMDH2 (At3G15020) according to transcript and proteomic analyses. |
AT3G15020 | Lactate/malate dehydrogenase family protein;(source:Araport11) |
AT5G64710 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
AT5G09840 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
AT3G16480 | mitochondrial processing peptidase alpha subunit;(source:Araport11) |
AT4G22310 | Uncharacterized protein family (UPF0041);(source:Araport11) |
AT3G13930 | Encodes a subunit of the mitochondrial pyruvate dehydrogenase complex. |
AT4G30700 | Encodes a pentatricopeptide repeat protein involved in mitochondrial RNA editing. |
AT1G06710 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G01340 | Transports citrate, isocitrate and aconitate, succinate and fumarate. Catalyzes a fast counter-exchange transport as well as a low uniport of substrates, exhibits a higher transport affinity for tricarboxylates than dicarboxylates. Might be involved in storage oil mobilization 78 at early stages of seedling growth and in nitrogen assimilation in root tissue by 79 catalyzing citrate/isocitrate or citrate/succinate exchanges. |
AT5G64950 | mTERF family protein which functions in the regulation of mtDNA transcription. |
AT4G11060 | Participates in a minimal functioning DNA replisome in plant chloroplasts and mitochondria which consists of the DNA primase-helicase protein Twinkle along with DNA polymerase 1A or 1B. |
AT1G10210 | Encodes ATMPK1. Kinase is activated by wounding. |
AT4G36450 | member of MAP Kinase |
AT1G53510 | Member of MAP Kinase familly. Target of MPKKK20 phosphorylation. Mutant root growth is sensitive oryzalin and suggestive of a role in signaling during microtubule organization. |
AT3G45640 | Encodes a mitogen-activated kinase whose mRNA levels increase in response to touch, cold, salinity stress and chitin oligomers.Also functions in ovule development. Heterozygous MPK3 mutants in a homozygous MPK6 background are female sterile due to defects in integument development. MPK3 can be dephosphorylated by MKP2 in vitro. The mRNA is cell-to-cell mobile. |
AT5G40440 | Encodes a mitogen-activated protein kinase kinase. Activates MPK8 and is a target of MPKKK20. Mutant root growth is sensitive oryzalin and suggestive of a role in signaling during microtubule organization. |
AT5G55090 | member of MEKK subfamily |
AT4G26890 | Member of MEKK subfamily. Involved in wound response signaling. Interacts with At5g40440, and activates At1g59580. |
AT2G32510 | Member of MEKK subfamily involved in wound and JA induced signaling.Interacts with At5g40440, and activates At1g59580. |
AT3G50310 | Encodes a member of MEKK subfamily. Target promoter of the male germline-specific transcription factor DUO1. Involved in osmotic stress response via regulation of MPK6 activity. It also plays an important role in regulating cell division and cell elongation in the primary root meristematic and elongation areas. Mutants show defects in root microtubule organization.It phosphorylates MPK18 and MKK3.It is a positive regulator of ABA-induced stomatal closure that acts by phosphorylating MKK5. |
AT3G07980 | MAP3K epsilon protein kinase 2 is functionally redundant with MAP3Ke1. Required for pollen development but not essential. |
AT3G13530 | MAP3K epsilon protein kinase 1 is functionally redundant with MAP3Ke2. Required for pollen development but not essential. map3ke1;map3ke2 double-mutant pollen grains develop plasma membrane irregularities following pollen mitosis I. Localized primarily in the plasma membrane. Expressed in leaf trichomes, root columella cells and developing ovules. |
AT3G55270 | Encodes MAP kinase phosphatase 1 (MKP1). Loss of MKP1 results in hypersensitivity to acute UV-B stress, but without impairing UV-B acclimation. |
AT5G49880 | Encodes a spindle assembly checkpoint protein MAD1. The mRNA is cell-to-cell mobile. |
AT5G11300 | mitotic-like cyclin, core cell cycle gene that is expressed only in roots (RT_PCR), portions with mitotic activity only (whole mount in situ). |
AT2G41660 | Essential for hydrotropism in roots. Mutant roots are defective in hydrotropism, and have slightly reduced phototropism and modified wavy growth response. Has normal gravitropism and root elongation. |
AT2G01530 | MLP-like protein 329;(source:Araport11) |
AT1G23260 | MMZ1/UEV1A encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UEV1A can form diubiquitin and triubiquitin chains in combination with UBC13A/UBC35 in vitro. It can also functionally complement an mms2 mutation in budding yeast, both by increasing mms2 mutant viability in the presence of the DNA damaging agent MMS, and by reducing the rate of spontaneous DNA mutation. However, a combination of MMZ1/UEV1A and UBC13A do not do a good job of rescuing an mms2 ubc13 double mutant in yeast. MMZ1/UEV1A transcripts are found at low levels in most plant organs, but cannot be detected in the pollen. Transcript levels do not appear to be stress-inducible. The uev1a-1 mutant shows normal sensitivity to MMS in germination assays suggesting that UEV1A is not required for DNA damage tolerance during this developmental stage. |
AT1G54030 | Encodes a vacuolar protein. Mutation causes organizational defects in the endoplasmic reticulum and aberrant protein trafficking in the plant secretory pathway. The mRNA is cell-to-cell mobile. |
AT3G18165 | Encodes MOS4 (Modifier of snc1, 4), a nuclear protein homologous to human Breast Cancer-Amplified Sequence (BCAS2). MOS4 interacts with AtCDC5 and PRL1. All three proteins are essential for plant innate immunity. |
AT5G05680 | Encodes MOS7 (Modifier of snc1,7), homologous to human and Drosophila melanogaster nucleoporin Nup88. Resides at the nuclear envelope. Modulates the nuclear concentrations of certain defense proteins regulates defense outputs. |
AT5G62600 | Encodes a nuclear importer of serine-arginine rich (SR) proteins and is involved in the regulation of splicing of R genes by regulating the import of the SR proteins into the nucleus. |
AT1G31720 | chitin synthase, putative (DUF1218);(source:Araport11) |
AT2G25680 | Encodes a high-affinity molybdate transporter. Mutant has reduced concentrations of molybdate in roots and shoots, and reduced shoot and root length when growing on Mo-limited medium. |
AT1G80310 | MOT2 encodes a molybdate transporter which locates to the vacuolar membrane. Loss-of-function (knock out) mutants show elevated molydate levels in rosette leaves and in fully senescent leaves, but decreased MoO4 levels in seeds. Under conditions of molybdate deficiency leaves from mot2::tDNA mutants show strongly reduced nitrate reductase activity. The mot2 gene is slightly expressed in young and mature leaves, but strongly in senescing leaves. This observation points to a function of MOT2 in molybdate transfer from leaves to seeds during plant senescence. |
AT2G28390 | SAND family protein;(source:Araport11) |
AT3G52880 | Encodes a peroxisomal monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2 |
AT3G09940 | Encodes a member of the monodehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica. |
AT2G26840 | Encodes a Holliday junction resolvase that binds and cleaves the core of Holliday junctions symmetrically. It appears to mediate chloroplast nucleoid segregation during chloroplast division. |
AT1G19850 | Encodes a transcription factor (IAA24) mediating embryo axis formation and vascular development. Similar to AUXIN RESPONSIVE FACTOR 1 (ARF1) shown to bind to auxin responsive elements (AREs), and to the maize transcriptional activator VIVIPAROUS 1( VP1). In situ hybridization shows expression in provascular tissue of embryos, the emerging shoot primordia, then is restricted to provascular tissue, and in the root central vascular cylinder. |
AT4G04950 | Encodes a monothiol glutaredoxin that is a critical component involved in ROS accumulation, auxin signaling, and temperature-dependent postembryonic growth in plants. It has been shown to associate with the cytosolic Fe-S assembly (CIA) complex and contributes to, but is not essential for, the correct functioning of client Fe-S proteins in unchallenged conditions. |
AT2G42620 | The mutations at MAX2 cause increased hypocotyl and petiole elongation in light-grown seedlings. Positional cloning identifies MAX2 as a member of the F-box leucine-rich repeat family of proteins. MAX2 is identical to ORE9, a proposed regulator of leaf senescence. Involved in positive regulation of light responses. The mRNA is cell-to-cell mobile. |
AT5G51350 | Encodes a receptor-like kinase that represses secondary growth, the production of secondary vascular tissues. |
AT1G21920 | MRF1 is related to SET7/9 proteins but contains an atypical SET domain. It is expressed in phloem and mutants have a weak late flowering phenotype. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT4G18640 | Required for root hair elongation during tip growth. The mRNA is cell-to-cell mobile. |
AT1G07360 | Encodes MAC5A, a component of the MOS4-associated complex (MAC) that contributes to snc1- mediated autoimmunity. MAC is a highly conserved nuclear protein complex associated with the spliceosome. Homologues include AT1G07360 (MAC5A), AT2G29580 (MAC5B) and AT5G07060 (MAC5C). |
AT2G05990 | Encodes enoyl-ACP reductase a component of the fatty acid synthase complex. A reduced function mutation in this gene, mod1, was found in a screen for premature cell death mutants. Mutant plants have reduced lipid level and pleiotropic morphological defects, including chlorotic and abnormally shaped leaves. The mRNA is cell-to-cell mobile. |
AT3G15300 | VQ motif-containing protein;(source:Araport11) |
AT2G17010 | MSL8 encodes a protein with similarity to mechano-sensitive channel proteins. MSL8 is expressed specifically in pollen and germinating pollen tubes.It regulates pollen germination and is needed to maintain cellular integrity during pollen hydration and germination. |
AT3G10320 | MUCI21 is a GT61 protein required for the production of highly branched xylan in seed coat mucilage. MUCI21 likely decorates xylan with xylose side chains that seem to be necessary for pectin attachment to the seed surface. |
AT1G28240 | strawberry notch protein (DUF616);(source:Araport11) |
AT2G16780 | Encodes a WD-40 repeat protein similar to yeast MSI1. |
AT2G43290 | Calmodulin-like MSS3.Encodes an endomembrane localized member of the CML subfamily VII. Contains a canonical CaM domain and unique N-terminal extension that distinguishes it from other members of the subfamily. |
AT5G58230 | Encodes a WD-40 repeat containing protein that functions in chromatin assembly as part of the CAF1 and FIE complex. Mutants exhibit parthenogenetic development that includes proliferation of unfertilized endosperm and embryos. In heterozygous plants 50% of embryos abort. Of the aborted embryos the early aborted class are homozygous and the later aborting lass are heterozygotes in which the defective allele is maternally transmitted. Other phenotypes include defects in ovule morphogenesis and organ initiation,as well as increased levels of heterochromatic DNA. MSI1 is needed for the transition to flowering. In Arabidopsis, the three CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1, respectively. Mutations in FAS1 or FAS2 lead to increased frequency of homologous recombination and T-DNA integration in Arabidopsis. In the ovule, the MSI1 transcripts are accumulated at their highest level before fertilization and gradually decrease after fertilization. MSI is biallelically expressed, the paternall allele is expressed in the endosperm and embryo and is not imprinted. MSI1 forms a complex with RBR1 that is required for activation of the imprinted genes FIS2 and FWA. This activation is mediated by MSI1/RBR1 mediated repression of MET1. |
AT3G06860 | Encodes a multifunctional protein. Involved in peroxisomal fatty acid beta oxidation. Loss-of-function mutant lacks hydroxyacyl-CoA dehydrogenase activity and have reduced levels of long-chain enoyl-CoA hydratase activity. The mutant has fewer but larger peroxisomes. The mRNA is cell-to-cell mobile. |
AT1G04150 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT1G22610 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT4G11610 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT2G35240 | Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
AT1G30620 | encodes a type-II membrane protein that catalyzes 4-epimerization of UDP-D-Xylose to UDP-L-Arabinose in vitro, the nucleotide sugar used by glycosyltransferases in the arabinosylation of cell wall polysaccharides and wall-resident proteoglycans. |
AT2G30640 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
AT5G48965 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
AT3G05850 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
AT5G34853 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
AT3G24320 | Encodes a DNA binding protein that promotes re-arrangements of mitochondrial genome. Mutations affects mitochondrial gene expression, and impairs mitochondrial function. Dual targeting of the protein to mitochondria and chloroplasts caused by alternative translation initiation. Plastid MSH1 depletion results in variegation, abiotic stress tolerance, variable growth rate, and delayed maturity. |
AT4G35520 | DNA mismatch repair protein similar to MutL. Required for normal levels of meiotic crossovers |
AT3G18524 | Encodes a DNA mismatch repair homolog of human MutS gene, MSH6. MSH2 is involved in maintaining genome stability and repressing recombination of mismatched heteroduplexes.There are four MutS genes in Arabidopsis, MSH2, MSH3, MSH6, and MSH7, which all act as heterodimers and bind to 51-mer duplexes. MSH2 has different binding specificity to different mismatches in combination with MSH3, MSH6, or MSH7. |
AT4G02070 | encodes a DNA mismatch repair homolog of human MutS gene, MSH6. There are four MutS genes in Arabidopsis, MSH2, MSH3, MSH6, and MSH7, which all act as heterodimers and bind to 51-mer duplexes. MSH2*MSH6 bound the (+T) substrate strongly, (T/G) well, and (+AAG) no better than it did a (T/A) homoduplex. |
AT4G17380 | Encodes the Arabidopsis homolog of MSH4, a meiosis-specific member of the MutS-homolog family of genes. It is expressed only in floral tissues and only during early meiotic prophase I, preceding the synapsis of homologous chromosomes. It is involved in the early steps of recombination. |
AT1G63910 | member of MYB3R- and R2R3- type MYB- encoding genes |
AT2G26950 | Member of the R2R3 factor gene family. |
AT1G69560 | Encodes LOF2 (LATERAL ORGAN FUSION2), a MYB-domain transcription factor expressed in organ boundaries. Functions in boundary specification, meristem initiation and maintenance, and organ patterning. Also see LOF1 (At1g26780). |
AT3G02940 | Encodes a putative transcription factor (MYB107). |
AT3G06490 | Encodes a MYB transcription factor involved in regulating anther dehiscence as well as regulating cell death, and cuticle-related Botrytis immunity. |
AT3G29020 | Encodes a putative transcription factor (MYB110). |
AT5G49330 | Member of the R2R3 factor gene family. Together with MYB11 and MYB111 redundantly regulates flavonol biosynthesis. |
AT1G48000 | Encodes a putative transcription factor (MYB112). |
AT1G66380 | Encodes a member of the MYB family of transcription factors. Involved in regulation of anthocyanin biosynthesis. Affects the expression of enzymes involved in later steps of anthocyanin biosynthesis |
AT5G40360 | Encodes a member of the MYB family of transcription factors and in involved in regulation of glucosinolate (GLS) biosynthesis. MYB115 binds to the promoters of a number of GLS biosynthetic enzymes and mutations show differences in accumulation of GLS compared to wild type. |
AT3G27785 | MYB118 encodes a myb transcription factor that represses endosperm maturation and, along with MYB115, regulates glucosinolate biosynthesis. |
AT5G58850 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB119). |
AT2G47460 | MYB12 belongs to subgroup 7 of the R2R3-MYB family. It strongly activates the promoters of chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), flavonol synthase (FLS) and - to a lesser extent - chalcone flavanone isomerase (CHI), but cannot activate the promoters of flavonoid-3'hydroxylase (F3'H) and dihydroflavonol 4-reductase (DF). The activation requires a functional MYB recognition element (MRE). Results from the myb12-1f allele indicate that an activation domain might be present in the C-terminus. Overexpression or knock-out plants do not show any obvious phenotype under greenhouse conditions. Young myb12-ko seedlings contain reduced amounts of flavonoids (quercetin and kaempferol), while seedlings as well as leaves of MYB12-OX plants displayed an increased flavonoid content. They did not show any significant difference in anthocyanin content. Expression of CHS and FLS shows a clear correlation to MYB12 expression levels. CHI and F3H show increased transcript levels in the MYB12-OX lines, but no differences in the knock-out. Even in the absence of functional MYB12, flavonol biosynthesis is not completely absent, suggesting functional redundancy. The redundant factors are MYB11 and MYB111 although MYB12 is primarily required for flavonol biosynthesis in roots. Mutations in MYB12 block both auxin and ethylene stimulation of flavonoid synthesis. |
AT5G55020 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB120). |
AT1G74080 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB122). |
AT1G66230 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
AT3G27810 | Encodes a member of the R2R3-MYB transcription factor gene family. Induced by jasmonate. Involved in jasmonate response during stamen development. MYB21 interacts with JAZ proteins, and functions redundantly with MYB24 and MYB57 to regulate stamen development. Promotes flavonol biosynthesis through regulation of FLS1 gene expression. |
AT5G40330 | Encodes a MYB gene that, when overexpressed ectopically, can induce ectopic trichome formation. It is a member of subgroup 15, together with WER and GL1. Members of this subgroup share a conserved motif of 19 amino acids in the putative transcription activation domain at the C-terminal end. The gene is expressed in leaves, stems, flowers, seeds and roots and quite strongly in trichomes. There is partial functional redundancy between ATMYB23 and GL1. The two proteins are functionally equivalent with respect to the regulation of trichome initiation but not with respect to trichome branching - which is controlled by MYB23 and not GL1. |
AT3G53200 | Member of the R2R3 factor gene family. |
AT5G07690 | Encodes a putative transcription factor (MYB29) that acts as a negative regulator of mitochondrial stress responses. |
AT3G28910 | Encodes a MYB family transcriptional regulator.It is a a positive regulator of the pathogen-induced hypersensitive response and of brassinosteroid and abscisic acid signaling and a negative regulator of photomorphogenesis. Accumulation of MYB30 is light regulated and activity is modulated by SUMOlaytion. MYB30 can for complexes with different bHLH components to regulate expression of different pathways. |
AT1G74650 | Member of the R2R3 factor gene family. |
AT5G06100 | Encodes a member of the myb family of transcription factors (MYB33), contains Pfam profile: PF00249 myb DNA-binding domain. Double mutants with MYB65 are male sterile- anthers are small, pollen development is defective. Spatial expression appears to be under the control of miR159, contains a target site for this micro RNA. A highly conserved RNA secondary structure abuts the miR159 binding site which facilitates its regulation by miR159. When the target site is mutated, expression is detected in leaves, roots, anther filament, pistil. The expression of a translational fusion is specific to anther locules in contrast to constructs lacking the miR159 target site. Phenotype is conditional and can be restored by lower temperature or higher light intensity. |
AT4G17785 | Encodes a putative transcription factor (MYB39) involved in the regulation of suberin biosynthetic genes. |
AT3G09370 | C-myb-like transcription factor (MYB3R3) mRNA. It is a target of CDK phosphorylation and blocks cell division in response to DNA damage. |
AT4G38620 | Encodes a R2R3 MYB protein which is involved in the response to UV-B. It functions as a repressor of target gene expression. One of its target genes encodes cinnamate 4-hydroxylase; mutants accumulate sinapate esters in their leaves. MYB4 binds to its own promoter and represses its own expression. Nuclear localization of MYB4 depends on the action of the beta importin SAD2. The mRNA is cell-to-cell mobile. |
AT5G14340 | Member of the R2R3 factor gene family. |
AT5G12870 | Encodes MYB46, member of the R2R3 factor gene family. Modulates Disease Susceptibility to Botrytis cinerea. |
AT1G18710 | Member of the R2R3 factor gene family. Promotes seed longevity (viability of seed over time.) Expressed in the chalazal seed coat. Overexpresion enhances resistance of seed to deterioration (PMID:32519347). |
AT3G18100 | Member of the R2R3 transcription factor gene family. |
AT1G57560 | Member of the R2R3 factor gene family. |
AT1G18570 | Encodes a member of the R2R3-MYB transcription family. Involved in indole glucosinolate biosynthesis. The mRNA is cell-to-cell mobile. |
AT5G65230 | Member of the R2R3 factor gene family. |
AT4G01680 | Encodes a putative transcription factor (MYB55). |
AT5G17800 | Member of the R2R3 factor gene family that acts as a cell-specific repressor of quiescent center (QC) divisions in the primary root, acting through the BR signaling pathway. Works with BES1 to regulate QC division in the root. |
AT1G16490 | Member of the R2R3 factor gene family. |
AT4G09460 | Encodes myb6 DNA-binding protein. The mRNA is cell-to-cell mobile. |
AT1G08810 | putative transcription factor of the R2R3-MYB gene family. Transcript increases under conditions that promote stomatal opening (white and blue light, abi1-1 mutation) and decreases under conditions that trigger stomatal closure (ABA, desiccation, darkness), with the exception of elevated CO2. Expressed exclusively in guard cells of all tissues. It is required for light-induced opening of stomata. Mutant shows reduced stomatal aperture which helps to limit water loss during drought. |
AT1G09540 | Encodes putative transcription factor. Mutants lack of mucilage extrusion from the seeds during imbibition. Reduced quantities of mucilage are deposited during the development of the seed coat epidermis in myb61 mutants. Expressed in guard cells,loss of function mutations show an increase in stomatal pore opening suggesting a role in ABA independent regulation of stomatal pore size. |
AT1G68320 | putative transcription factor: R2R3-MYB transcription family. Involved in regulation of phosphate starvation responses and gibberellic acid biosynthesis. |
AT4G33450 | Member of the R2R3 factor gene family. |
AT2G16720 | Encodes a member of MYB3R- and R2R3- type MYB- encoding gene family that acts as a repressor of flavonol biosynthesis. AtMYB7 gene expression is induced by salt treatment. |
AT4G05100 | Member of the R2R3 factor gene family. |
AT3G50060 | Encodes a member of the R2R3 transcription factor gene family. Expressed in response to potassium deprivation and auxin. Involved in lateral root development. Interacts with ARF7 and regulates the expression of some auxin responsive genes. |
AT4G13480 | Member of the R2R3 factor gene family. |
AT5G52600 | Encodes a nuclear-localized transcription activator that is a member of the R2R3 factor gene family. MYB82 and GL1 can form homodimers and heterodimers at R2R3-MYB domains. At least one of the two introns in MYB82 is essential to the protein?s trichome developmental function. |
AT3G49690 | Putative homolog of the Blind gene in tomato. Together with RAX1 and RAX3 belong to the class R2R3 MYB genes; encoded by the Myb-like transcription factor MYB84, regulates axillary meristem formation. |
AT4G22680 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
AT4G37780 | encoded by the Myb-like transcription factor MYB87, regulates axillary meristem formation, expressed throughout the plant. Member of the R2R3 factor gene family. |
AT2G02820 | Encodes a putative transcription factor (MYB88), involved in stomata development, double loss of MYB88 and FLP (MYB124) activity results in a failure of guard mother cells (GMCs) to adopt the guard cell fate, thus they continue to divide resulting in abnormal stomata consisting of clusters of numerous guard cell-like cells. This phenotype is enhanced in double mutants over the single mutant flp phenotype. Also regulates female reproductive development. |
AT5G16770 | Member of the R2R3 factor gene family. |
AT1G66390 | Production of anthocyanin pigment 2 protein (PAP2). |
AT3G47600 | Encodes a putative transcription factor (MYB94). |
AT4G26930 | Encodes a putative transcription factor (MYB97). |
AT5G62320 | Encodes a putative transcription factor (MYB99). |
AT5G18650 | Encodes a RING-type E3 ubiquitin ligase that interacts with and ubiquitinates MYB30, leads to MYB30 proteasomal degradation and downregulation of its transcriptional activity. Since MYB30 is a positive regulator of Arabidopsis HR and defence responses, MIEL1 is involved in the negative regulation of these processes. The mRNA is cell-to-cell mobile. |
AT5G58730 | pfkB-like carbohydrate kinase family protein;(source:Araport11) |
AT1G14520 | Encodes MIOX1. Belongs to myo-inositol oxygenase gene family. |
AT4G26260 | Encodes a myo-inositol oxygenase, which is the first enzyme in the inositol route to ascorbate (L‐ascorbic acid, AsA, vitamin C). Overexpression results in enhanced biomass and abiotic stress tolerance. |
AT3G19960 | member of Myosin-like proteins |
AT1G17580 | Encodes a member of the type XI myosin protein family involved in organelle trafficking and overall plant development. |
AT5G54280 | Type VII myosin gene |
AT1G08800 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
AT5G16720 | caldesmon-like protein (Protein of unknown function, DUF593);(source:Araport11) |
AT1G04600 | member of Myosin-like proteins |
AT2G33240 | member of Myosin-like proteins |
AT3G10550 | Has 3'-phosphatase activity against both phosphatidylinositol-3,5-bisphosphate (PtdIns3,5P2) and Phosphatidylinositol-3-phosphate (PtdIns3P). The in vitro activity was higher with PtdIns3,5P2 than with PtdIns3P. |
AT5G57020 | Arabidopsis thaliana myristoyl-CoA:protein N-myristoyltransferase. |
AT1G52030 | Similar to myrosinase binding proteins which may be involved in metabolizing glucosinolates and forming defense compounds to protect against herbivory. Also similar to lectins and other agglutinating factors. Expressed only in flowers. |
AT5G66900 | RPW8 -CNL gene is required for signal transduction of TNLs; functionally redundant to NRG1.2. Exhibits autoimmunity. |
AT1G31070 | Encodes a protein that functions as an N-acetylglucosamine-1-phosphate uridylyltransferase that catalyzes the formation of UDP-N-acetylglucosamine (UDP-GlcNAc). This is an essential precursor for glycolipid and glycoprotein synthesis and is also used for regulatory protein modification in signaling pathways. The enzyme can also catalyze the reverse reaction using both UDP-GlcNAc and the less common UDP-N-acetylgalactosamine as substrates. |
AT4G04910 | N-ethylmaleimide sensitive factor that can functionally complement yeast SEC18 AAA+ ATPase activity. Mutants show defects in intracellular vesicle mediated transport. Appears to affect cycling of PIN1 (and probably other proteins.) |
AT5G56750 | AGB1/AGG dimmer interacting protein, response to water deficit. |
AT5G11790 | Plays a role in dehydration stress response. |
AT2G19620 | Plays a role in dehydration stress response. |
AT1G49810 | member of Na+/H+ antiporter-Putative family |
AT5G27150 | Encodes a vacuolar sodium/proton antiporter involved in salt tolerance, ion homeostasis, and leaf development. The mRNA is cell-to-cell mobile. |
AT1G14660 | member of putative Na+/H+ antiporter (AtNHX) family. Functions as a plasma membrane Li+/H+ antiporter. Involved in Li+ efflux and detoxification. |
AT1G80410 | Encodes the catalytic subunit of a N-terminal acetyltransferase. |
AT2G46770 | NAC transcription factor NST1. NST1 and NST2 are redundant in regulating secondary wall thickening in anther walls and siliques. An NST1 promoter fusion was detected in various tissues in which lignified secondary walls develop. Both MYC2 and MYC4 bind to the NST1 promoter and appear to regulate its expression in response to blue light. |
AT3G15510 | Note of caution: not to be confused with another protein (AtNAC6 locus AT5G39610) which on occasion has also been referred to as AtNAC2. |
AT5G39610 | Encodes a NAC-domain transcription factor. Positively regulates aging-induced cell death and senescence in leaves. This gene is upregulated in response to salt stress in wildtype as well as NTHK1 transgenic lines although in the latter case the induction was drastically reduced. It was also upregulated by ABA, ACC and NAA treatment, although in the latter two cases, the induction occurred relatively late when compared with NaCl or ABA treatments. Note: this protein (AtNAC6) on occasion has also been referred to as AtNAC2, not to be confused with the AtNAC2 found at locus AT3G15510. |
AT5G64060 | NAC domain containing protein 103;(source:Araport11) |
AT1G32510 | NAC domain containing protein 11;(source:Araport11) |
AT1G32770 | Encodes SND1, a NAC Domain transcription factor involved in secondary wall biosynthesis in fibers. Expressed specifically in interfascicular fibers and xylary fibers in stems. Expressed in the procambium of stem inflorescences and root. May act as a negative regulator of secondary wall thickening in xylary fibers. Acts redundantly with NST1 to control development of secondary walls in siliques. |
AT1G02220 | NAC domain transcription factor which functions as a negative regulator of the TDIF-PXY module and fine-tunes TDIF signaling in vascular development. Controls the balance of xylem formation and cambial cell divisions. |
AT1G77450 | NAC domain transcriptional regulator that is induced by ROS in roots where it regulates the expression of downstream genes such as MYB30. |
AT3G04430 | NAC domain containing protein 49;(source:Araport11) |
AT3G10480 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. It binds the NAC-binding site, the Mitochondrial Dysfunction Motif. |
AT3G10490 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. |
AT3G10500 | Encodes a transcriptional activator that is associated with the plasma membrane in a dormant form and is proteolytically cleaved to create a form that can enter the nucleus. It is thought to promote ROS production by binding directly to the promoters of genes encoding ROS biosynthetic enzymes during drought-induced leaf senescence. The mRNA is cell-to-cell mobile. |
AT3G44290 | Represses sugar-induced ABI5 transcription. |
AT3G44350 | NAC domain containing protein 61;(source:Araport11) |
AT4G01520 | NAC domain containing protein 67;(source:Araport11) |
AT4G01550 | Encodes a plasma-membrane bound NAC transcription factor, whose controlled proteolytic activation allows it to enter the nucleus. |
AT4G10350 | NAC domain protein. SMB, BRN1, and BRN2 act to regulate root cap maturation, in a partially redundant fashion.BRN1 and BRN2, control the cell wall maturation processes that are required to detach root cap layers from the root. |
AT4G28500 | NAC domain containing protein 73;(source:Araport11) |
AT5G07680 | NAC domain containing protein 80;(source:Araport11) |
AT5G46590 | Transcription factor required for the initiation of cell division during wound healing. Redundantly involved with ANAC071 in the process of "cambialization". |
AT5G56620 | NAC domain containing protein 99;(source:Araport11) |
AT3G61910 | NAC transcription factor NST2. NST1 and NST2 are redundant in regulating secondary wall thickening in anther walls. NST2 promoter was particularly strong in anther tissue. |
AT4G35580 | Encodes a calmodulin-binding NAC protein (CBNAC). Contains calmodulin-binding domain in the C-terminus of the protein. Functions as a calmodulin-regulated transcriptional repressor. |
AT4G01540 | Encodes a membrane-bound NAC (for NAM, ATAF1/2, CUC2) transcription factor, designated NTM1 (for NAC with transmembrane motif1). NTM1 regulates cell division in Arabidopsis. |
AT5G62380 | Encodes a NAC-domain transcription factor involved in xylem formation. Induces transdifferentiation of various cells into metaxylem vessel elements. Located in the nucleus. Expression induced in the presence of auxin, cytokinin and brassinosteroids. |
AT3G12977 | NAC transcription regulator. Regulates endosperm cell expansion during germination. |
AT5G61390 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT5G46830 | Calcium-binding transcription factor involved in salt stress signaling. |
AT1G04280 | Encodes a mitochondrial CaM/Ca2+-dependent NAD+ kinase. |
AT4G21490 | NAD(P)H dehydrogenase B3;(source:Araport11) |
AT2G20800 | NAD(P)H dehydrogenase B4;(source:Araport11) |
AT2G13560 | Encodes an NAD-dependent malic enzyme (NAD-ME) that does not act on oxaloacetate, indicating that it belongs to EC 1.1.1.39. It is a member of the alpha family of NAD-MEs in plants. It appears to function as a homodimer or as a heterodimer with the beta-type NAD-ME2 (At4g00570). NAD-ME1 transcript and protein levels are higher during the night than during the day. The mRNA is cell-to-cell mobile. |
AT1G70760 | a subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. Located on the thylakoid membrane. Mutant has impaired NAD(P)H dehydrogenase activity. The mRNA is cell-to-cell mobile. |
AT5G58260 | Encodes subunit NDH-N of NAD(P)H:plastoquinone dehydrogenase complex (Ndh complex) present in the thylakoid membrane of chloroplasts. This subunit is thought to be required for Ndh complex assembly. |
AT4G09350 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT5G53460 | NADH-dependent glutamate synthase The mRNA is cell-to-cell mobile. |
AT2G19900 | The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME1 is expressed in response to developmental and cell-specific signals. The enzyme is active in vitro and appears to function as a homohexamer or homooctamer. It is believed to be a cytosolic protein. |
AT5G25880 | The malic enzyme (EC 1.1.1.40) encoded by the ATNADP-ME3 is presumably cytosolic and restricted in its expression by both developmental and cell-specific signals. |
AT5G67440 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
AT4G37590 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
AT1G18800 | Double nrp1-1 nrp2-1 mutants show arrest of cell cycle progression at G2/M and disordered cellular organization occurred in root tips. Localize in the nucleus and can form homomeric and heteromeric protein complexes with NRP1. Bind histones Histone2A and Histone2B and associate with chromatin in vivo. Plant mutated in both NRP1 and NRP2 genes show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. NRP genes act synergistically with NAP1 genes in promoting somatic homologous recombination. |
AT1G33040 | nascent polypeptide-associated complex subunit alpha-like protein 5;(source:Araport11) |
AT5G67330 | Encodes a member of the Nramp2 metal transporter family; like its homolog Atnramp3, localized in vacuolar membrane. Seedlings of double mutant, atnramp3-1 atnramp4-1, were arrested at early germination. The mRNA is cell-to-cell mobile. |
AT3G17850 | Protein kinase which together with IRE3 plays an important role in controlling root skewing and maintaining the microtubule network. |
AT3G52640 | Encodes a gamma-secretase subunit. Associates with other subunits in intracellular membrane compartments. |
AT2G27080 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT5G36970 | NDR1/HIN1-like protein, expression induced during incompatible response to a pathogen, expression is at least partly dependent on the salicylic acid signaling pathway |
AT1G28380 | This gene is predicted to encode a protein involved in negatively regulating salicylic acid-related defense responses and cell death programs. nsl1 mutants develop necrotic lesions spontaneously and show other features of a defense response, such as higher levels of SA and disease resistance-related transcripts, in the absence of a biotic stimulus. The NSL1 protein is predicted to have a MACPF domain, found in proteins that form a transmembrane pore in mammalian immune responses. NSL1 transcript levels do not appear to change in response to biotic stresses, but are elevated by cycloheximide in seedlings, and by sodium chloride in roots. The mRNA is cell-to-cell mobile. |
AT2G16485 | Encodes NERD (Needed for RDR2-independent DNA methylation), a plant-specific GW repeat- and PHD finger-containing protein involved in siRNA-dependent DNA methylation. |
AT4G05590 | Encodes NRGA1, a putative mitochondrial pyruvate carrier that mediates ABA regulation of guard cell ion channels and drought stress responses. |
AT2G17750 | Intrinsic thylakoid membrane protein that fixes RPOTmp on the stromal side of the thylakoid membrane. |
AT2G17730 | Intrinsic thylakoid membrane protein that fixes RPOTmp on the stromal side of the thylakoid membrane. |
AT3G22790 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It binds filamentous actin and is localized to the plasma membrane and plasmodesmata. |
AT4G02710 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
AT1G09720 | Member of NET domain family of actin binding proteins. Paralog of At3g22790 (NET2A). |
AT2G22560 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
AT5G05970 | a WD40 repeat protein related to the animal NEDD1/GCP-WD protein, which interacts with the g-tubulin complex. Plays a critical role in MT organization during mitosis |
AT1G07380 | Encodes a neutral ceramidase that is involved in sphingolipid homeostasis and responses to oxidative stress. |
AT3G51050 | NERD1 is a single copy locus encoding a protein of unknown function that is localized to the nucleus. Single mutants show defects in root hair growth, root meristem function, cell elongation. NERD1 appears to act synergistically with the exocyst in root development. |
AT4G24690 | Encodes NBR1, a selective autophagy substrate. The mRNA is cell-to-cell mobile. |
AT4G01940 | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU2 and 3 than to NFU4 and 5. Targeted to the chloroplast. |
AT1G51390 | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU4 than to NFU1,2, and 3. Targeted to the mitochondrion. The mRNA is cell-to-cell mobile. |
AT5G05660 | Encodes a homolog of the mammalian zinc finger transcription factor NF-X1. |
AT3G61970 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT1G01030 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT5G04950 | Encodes a nicotianamide synthase. |
AT5G56080 | Encodes a protein with nicotianamine synthase activity. Its transcript levels rise in roots in response to zinc deficiency and rise in leaves in response to elevated levels of zinc. |
AT2G22570 | encodes a nicotinamidase that converts nicotinamide into nicotinic acid. As such the encoded enzyme is involved in the pyridine nucleotide salvage pathway which may be connected to the de novo NAD biosynthesis through the ABA signaling pathway. |
AT2G23420 | nicotinate phosphoribosyltransferase 2;(source:Araport11) |
AT3G13050 | Encodes a plant nicotinate transporter than can also transport trigonelline (N-methylnicotinate). |
AT5G55810 | encodes a bi-functional enzyme that expresses both nicotinamide-nucleotide adenylyltransferase (2.7.7.1) and nicotinate-nucleotide adenylyltransferase (2.7.7.18)activity. |
AT1G42470 | Patched family protein;(source:Araport11) |
AT4G38350 | Patched family protein;(source:Araport11) |
AT5G49940 | Encodes a protein containing the NFU domain and functions as a molecular scaffold for iron-sulfur cluster assembly and delivery. Homologous to the cyanobacterial CNFU protein and is targeted to the chloroplast. |
AT3G54500 | Member of a small family (4 proteins) in Arabidopsis that have some overlap in function. LNK2 along with LNK1 functions in the integration of light signaling and circadian clock. It is regulated by the clock TOC1 complex. Functions as a transcriptional coactivator. |
AT3G12320 | Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK4 in having affects on biomass accumulation and phototrophism. |
AT1G02450 | NIMIN1 modulates PR gene expression according the following model: NPR1 forms a ternary complex with NIMIN1 and TGA factors upon SAR induction that binds to a positive regulatory cis-element of the PR-1 promoter, termed LS7. This leads to PR-1 gene induction. NIMIN1 decreases transcriptional activation, possibly through its EAR motif, which results in fine-tuning of PR-1 gene expression. |
AT3G44200 | Encodes AtNek5, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.Interacts physically with plant kinesins ARK1 and ARK2. Mutants show defects in root epidermal cell morphology, trichome branching and other epidermal cell abnormalities suggesting a rol e in epidermal cell differentiation. NEK6 co-localizes with cortical microtubules. |
AT3G04810 | Encodes AtNek2, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
AT3G12200 | Encodes AtNek7, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
AT2G33160 | Gene structure annotation for AT2G33160.1 is inaccurate in TAIR10, see PMID:23709666 and Comments field on the locus page for updated annotation. |
AT1G20640 | Plant regulator RWP-RK family protein;(source:Araport11) |
AT1G76350 | Plant regulator RWP-RK family protein;(source:Araport11) |
AT3G59580 | Plant regulator RWP-RK family protein;(source:Araport11) |
AT4G18350 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
AT3G14440 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane. |
AT1G30100 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
AT1G78390 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
AT1G77760 | Encodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. Similar to molybdopterin oxidoreductases at the N-terminus, and to FAD/NAD-binding cytochrome reductases at the C-terminus. Cofactors: FAD, heme iron (cytochrome B-557), and molybdenum-pterin. |
AT1G37130 | Identified as a mutant resistant to chlorate. Encodes nitrate reductase structural gene. Involved in nitrate assimilation. Has nitrate reductase activity. Up-regulated by the fungus P. indica. Binds transcription factor At2g35940. The mRNA is cell-to-cell mobile. |
AT3G60320 | bZIP domain class transcription factor (DUF630 and DUF632);(source:Araport11) |
AT3G16180 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
AT1G12940 | member of High affinity nitrate transporter family |
AT3G16410 | Encodes a nitrile-specifier protein NSP4. NSP4 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. The mRNA is cell-to-cell mobile. |
AT3G47450 | Encodes a protein with similarity to the bacterial YqeH GTPase required for proper ribosome assembly. Mutant analyses show that this protein regulates growth and hormonal signaling and attenuates oxidative stress and reactive oxygen species (ROS). It also seems to be involved in regulating leaf senescence, cell death, nitric oxide biosynthesis in response to ABA but not exogenous H2O2. This protein also appears to be required for proper plastid biogenesis. Levels of several plastid-localized proteins, including RBCL, ClpP1, and the MEP biosynthesis enzymes DXS and DXR are altered in rif1-1 mutants. This protein was originally characterized as a mitrochondrial-localized nitric oxide synthase, but, the synthase activity was later disproven. In addition, new studies with GFP fusion proteins and chloroplast import assays suggest that this protein is found in chloroplasts. Its localization to the chloroplast is enhanced by S-acylation. |
AT3G54360 | Encodes a catalase chaperon that is essential for catalase activity. Required for multiple stress responses. |
AT4G28600 | encodes a calmodulin-binding protein that is expressed in pollen, suspension culture cells, flowers, and fruits. |
AT3G51610 | Encodes a membrane protein NO PRIMEXINE AND PLASMA MEMBRANE UNDULATION (NPU). Involved in primexine deposition and plasma membrane undulation during early pollen wall development. |
AT3G57670 | Encodes a a C2H2/C2HC zinc finger transcription factor specifically expressed in the transmitting tract and involved in transmitting tract development and pollen tube growth.Acts redundantly with WIP4 and WIP5 to determine distal cell fate in the root. MP binds to regulatory elements within the NTT locus and likely regulates its expression. |
AT4G13750 | Encodes NO VEIN (NOV), a plant-specific nuclear factor required for leaf vascular development, cellular patterning and stem cell maintenance in the root meristem, as well as for cotyledon outgrowth and separation. nov mutations affect many aspects of auxin-dependent development without directly affecting auxin perception. |
AT5G37820 | NOD26-like intrinsic protein 4;(source:Araport11) |
AT4G03090 | AtNDX negatively regulates ABI4 expression during ABA signaling. |
AT2G03440 | Induced at the transcriptional level by Pseudomonas syringae pv. tomato infection. |
AT3G20600 | Required for non-race specific resistance to bacterial and fungal pathogens.Mediates systemic acquired resistance (SAR) response. The mRNA is cell-to-cell mobile. |
AT3G52140 | Involved in regulating mitochondrial quality control. Regulates mitochondrial association time and thereby is involved in mitochondrial fusion. Mutants show unregulated autophagy and display transcriptomic markers of mitochondrial stress. Its activity can be modulated by Lys acetylation. |
AT5G20730 | Encodes an auxin-regulated transcriptional activator. Activates expression of IAA1 and IAA9 in the presence of auxin. Mutants affect blue light and gravitropic and auxin mediated growth responses. Together with AUX19, it is involved in the response to ethylene. In the arf7 arf19 double mutant, several auxin-responsive genes (e.g. IAA5, LBD16, LBD29 and LBD33) are no longer upregulated by auxin. |
AT1G15780 | mediator of RNA polymerase II transcription subunit 15a-like protein;(source:Araport11) |
AT1G44575 | Encoding PSII-S (CP22), a ubiquitous pigment-binding protein associated with photosystem II (PSII) of higher plants. Involved in nonphotochemical quenching rather than in photosynthesis. Mutant has a normal violaxanthin cycle but has a limited capacity of quenching singlet excited chlorophylls and is tolerant to lipid peroxidation. |
AT5G43050 | Chloroplast localized YCF20-like gene involved in nonphotochemical quenching. Has overlapping functions with npq7 The mRNA is cell-to-cell mobile. |
AT5G11630 | The mutant is insensitive to oxylipin 9-HOT treatment. Involved in plant defense. |
AT5G52820 | Encodes a NOTCHLESS homolog, a non-ribosomal protein involved in the maturation and assembly of the 60S ribosomal subunit, that is required for female gametogenesis. The mRNA is cell-to-cell mobile. |
AT1G54960 | member of MEKK subfamily |
AT3G06030 | NPK1-related protein kinase 3 |
AT1G47240 | Encodes a member of the NRAMP2 gene family of metal ion transporters that is required for root growth at low Mn conditions. NRAMP2 is mainly localized to TGN and has influx transport activity of Mn in yeast. Mutation of NRAMP2 impaired root growth, although there was greater Mn retention in the roots under Mn-deficient conditions. |
AT1G15960 | member of Nramp2 family |
AT1G52190 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
AT5G62680 | Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds. |
AT1G27080 | Encodes a protein with low-affinity nitrate transporter activity that is expressed in the vascular tissue of the funiculus and the silique. This plasma membrane-localized enzyme is predicted to have 12 transmembrane domains. Plants lacking NRT1.6 have reduced levels of nitrate in their seeds and have increased levels of early embryonic developmental defects and seed abortion. |
AT1G69870 | Encodes a low affinity nitrate transporter NRT1.7. Expressed in phloem. Responsible for source-to-sink remobilization of nitrate. The mRNA is cell-to-cell mobile. |
AT3G45650 | Encodes a nitrate efflux transporter NAXT1 (for NITRATE EXCRETION TRANSPORTER1). Localized to the plasma membrane. NAXT1 belongs to a subclass of seven NAXT members from the large NITRATE TRANSPORTER1/PEPTIDE TRANSPORTER family and is mainly expressed in the cortex of mature roots. |
AT1G68570 | NPF3.1 is a membrane localized GA transporter that is expressed in the root endodermis. |
AT1G59740 | Major facilitator superfamily protein;(source:Araport11) |
AT1G33440 | Major facilitator superfamily protein;(source:Araport11) |
AT1G27040 | Major facilitator superfamily protein;(source:Araport11) |
AT3G21670 | Major facilitator superfamily protein;(source:Araport11) |
AT1G32450 | Transmembrane nitrate transporter. Involved in xylem transport of nitrate from root to shoot. Induced in response to high and low concentrations of nitrate. Not involved in nitrate uptake. Expressed in root pericycle cells under the control of MYB59. Also functions as a proton-coupled H+/K+ antiporter for K+ loading into the xylem. |
AT3G54140 | Encodes a di- and tri-peptide transporter that recognizes a variety of different amino acid combinations. GFP-tagged PTR1 localizes to the plasma membrane and has 8 to 11 predicted transmembrane domains. PTR1 is expressed in a number of different vascular tissues throughout the plant based on promoter:GUS expression analysis. ptr1 mutants have a lower dry weight than wild type plants when both are grown with Pro-Ala or Ala-Ala dipeptides as their nitrogen source, suggesting that PTR1 plays a role in dipeptide uptake in the roots. Furthermore N content of ptr1 mutants is lower than that of wild type plants when grown with Pro-Ala or a mixture of dipeptides as nitrogen source |
AT2G02040 | Encodes a di- and tri-peptide transporter that recognizes a variety of different amino acid combinations. Expression of the transcripts for this gene can be detected in the embryo through in situ hybridization. This protein does not have nitrate transporter activity based on oocyte transport assays. Enhances water uptake during early seed germination. |
AT4G13350 | Encodes a GTPase that interacts with nuclear shuttle proteins (NSPs) from a number of different plant viruses. The gene is widely expressed and NIG transcript levels do not rise in response to viral infection. This cytoplasmic protein does not directly interact with a viral movement protein (MP), but, it does promote the movement of NSP from the nucleus to the cytoplasm. Overexpression of NIG in Arabidopsis plants renders them more sensitive to geminivirus infection. |
AT1G13400 | Along with JAG, it is involved in stamen and carpel development. Expression is limited to the adaxial side of lateral organs. Activated by AGAMOUS in a cal-1, ap1-1 background. |
AT4G37210 | Encodes a predominantly nuclear histone chaperone that promotes [H3-H4]2 tetrasome formation and does not promote disassembly of in vitro preassembled tetrasomes. |
AT1G03920 | Protein kinase family protein;(source:Araport11) |
AT3G23310 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
AT2G19400 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
AT2G20470 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
AT1G30640 | Protein kinase family protein;(source:Araport11) |
AT5G09890 | Protein kinase family protein;(source:Araport11) |
AT3G05690 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. |
AT3G14020 | nuclear factor Y, subunit A6;(source:Araport11) |
AT1G30500 | nuclear factor Y, subunit A7;(source:Araport11) |
AT1G17590 | Binds directly to CCAAT cis-elements in the promoters of multiple MIR156 genes and inhibits the juvenile-to adult transition by activating transcription of these MIR156s. |
AT5G23090 | nuclear factor Y, subunit B13;(source:Araport11) |
AT1G09030 | nuclear factor Y, subunit B4;(source:Araport11) |
AT2G13570 | nuclear factor Y, subunit B7;(source:Araport11) |
AT2G37060 | nuclear factor Y, subunit B8;(source:Araport11) |
AT3G12480 | nuclear factor Y, subunit C11;(source:Araport11) |
AT5G38140 | nuclear factor Y, subunit C12;(source:Araport11) |
AT1G54830 | Encodes a NUCLEAR FACTOR-Y C (NF-YC) homologue NF-YC3. NF-YC3., NF-YC4 and NF-YC9 redundantly modulate GA- and ABA-mediated seed germination. |
AT5G50490 | nuclear factor Y, subunit C5;(source:Araport11) |
AT5G50470 | nuclear factor Y, subunit C7;(source:Araport11) |
AT5G27910 | nuclear factor Y, subunit C8;(source:Araport11) |
AT1G08970 | Encodes a NUCLEAR FACTOR-Y C (NF-YC) homologue NF-YC9. NF-YC3., NF-YC4 and NF-YC9 redundantly modulate GA- and ABA-mediated seed germination. |
AT1G31470 | Major facilitator superfamily protein;(source:Araport11) |
AT5G11240 | GHS40 encodes a WD40 protein, that is localized in the nucleus and nucleolus. In the presence of high glucose it negatively regulates the expression of abscisic acid degradation and signaling genes. |
AT4G32850 | Encodes a nuclear poly(A) polymerase. Located in the nucleus. The mRNA is cell-to-cell mobile. |
AT1G79280 | Encodes a 237-kDA protein with similarity to vertebrate Tpr, a long coiled-coil proteins of nuclear pore inner basket filaments. It is localized to the inner surface of the nuclear envelope and is a component of the nuclear pore-associated steps of sumoylation and mRNA export in plants. Mutations affect flowering time regulation and other developmental processes. Probably acts in the same pathway as ESD4 in affecting flowering time, vegetative and inflorescence development. |
AT3G57660 | Encodes a subunit of RNA polymerase I (aka RNA polymerase A). The mRNA is cell-to-cell mobile. |
AT1G29940 | Encodes a subunit of RNA polymerase 1 (aka RNA polymerase A). |
AT1G06790 | Encodes a subunit of RNA polymerase III involved in maintaining global RNA homeostasis, not just that of genes transcribed by RNA pol III. |
AT5G60040 | Encodes a subunit of RNA polymerase III (aka RNA polymerase C). |
AT5G45140 | Encodes a subunit of RNA polymerase III (aka RNA polymerase C). |
AT2G27810 | Encodes a plasma-membrane localized nucleobase transporter capable of transporting adenine, guanine, uracil and hypoxanthine. Likely to be a proton-nucleobase symporter. |
AT1G10540 | nucleobase-ascorbate transporter 8;(source:Araport11) |
AT1G17690 | U3 small nucleolar RNA-associated protein;(source:Araport11) |
AT1G48920 | Encodes ATNUC-L1 (NUCLEOLIN LIKE 1), the predominant form of the two nucleolin proteins found in Arabidopsis. This protein is involved in rRNA processing, ribosome biosynthesis, and vascular pattern formation. PARL1 localizes to the nucleolus and parl1 mutants accumulate elevated levels of the unspliced 35S pre-rRNA. parl1 mutants also have defects in cotyledon, leaf, sepal, and petal vein patterning and have reduced stature, reduced fertility, increased bushiness, and reduced root length. The sugar-induced expression of ribosome proteins is also reduced in parl1 mutants. The mRNA is cell-to-cell mobile. |
AT3G18610 | Encodes ATNUC-L2 (NUCLEOLIN LIKE 2). |
AT1G14850 | Encodes a protein similar to nucleoporin, a a major component of the nuclear pore complex (NPC) involved in cellular nucleo-cytoplasmic transport |
AT1G60420 | Reduce transmission through pollen. The mRNA is cell-to-cell mobile. |
AT5G18860 | Encodes a purine nucleoside hydrolase active in the apoplast. It might play a role in salvaging extracellular ATP. NSH3 transcript levels rise in response to jasmonic acid and wounding. |
AT5G18870 | Similar to N terminal region of NSH1 nucleoside hydrolase. |
AT4G29730 | cell cycle-related repressor genes encoding WD-repeat proteins. |
AT4G39390 | Encodes a golgi localized nucleotide sugar transporter. |
AT1G63000 | nucleotide-rhamnose synthase/epimerase-reductase;(source:Araport11) |
AT1G68760 | Encodes a cytosol-localized nudix hydrolase that hydrolyzes 8-oxo-(d)GTP to its monophosphate form. This protective mechanism prevents the misincorporation of these oxidized nucleotides into DNA and RNA. NUDX1 also has a low level of dihydroneopterin triphosphate pyrophosphatase activity in vitro and may participate in the folate synthesis pathway. |
AT1G12880 | nudix hydrolase homolog 12;(source:Araport11) |
AT3G26690 | Encodes AtNUDT13, a mitochondrial Nudix hydrolase specific for long-chain diadenosine polyphosphates. |
AT2G01670 | nudix hydrolase homolog 17;(source:Araport11) |
AT2G42070 | Encodes a plastid-localized Nudix hydrolase that has FAD pyrophosphohydrolase activity. Negative feedback regulation of the metabolism of flavins through the hydrolysis of FAD by AtNUDX23 in plastids is involved in the flavin homeostasis in plant cells. |
AT1G30110 | Encodes a ppGpp pyrophosphohydrolase. |
AT5G47240 | nudix hydrolase homolog 8;(source:Araport11) |
AT5G44160 | NUC is a member of the BIRD group of transcriptional regulators and is required for the formative divisions that pattern the root. the ground tissue into cortex and endodermis. |
AT5G04900 | Encodes a chlorophyll b reducatase involved in the degradation of chlorophyll b and LHCII (light harvesting complex II). |
AT4G14880 | Encodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis and for the fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA. Lines carrying semi-dominant mutations exhibit early senescence. Required for pollen tube growth and/or fertilization. |
AT3G22460 | Encodes a member of a family of genes with O-acetylserine(thiol)lyase activity. |
AT2G43750 | Arabidopsis thaliana O-acetylserine (thiol) lyase (OAS-TL) isoform oasB, the key enzyme for fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Required for pollen tube growth and/or fertilization. |
AT3G59760 | Arabidopsis thaliana O-acetylserine (thiol) lyase (OAS-TL) isoform oasC. Required for pollen tube growth and/or fertilization. |
AT5G60850 | Encodes a zinc finger protein. |
AT5G53450 | OBP3-responsive protein 1;(source:Araport11) |
AT5G06960 | Encodes a basic leucine zipper (B-ZIP) containing protein that interacts with NPR1 to promote expression of salicylic acid induced genes. Binds the ocs-element. |
AT1G06160 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
AT3G09070 | Encodes a polarly localised membrane-associated protein that regulates phloem differentiation entry. |
AT5G58930 | hypothetical protein (DUF740);(source:Araport11) |
AT1G05510 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
AT4G33760 | Aminoacyl tRNA synthetase functions in SAM maintenance. |
AT5G51210 | Encodes oleosin3, a protein found in oil bodies, involved in seed lipid accumulation. |
AT1G09930 | oligopeptide transporter |
AT5G53520 | Encodes an oligopeptide transporter. Target promoter of the male germline-specific transcription factor DUO1. |
AT5G53510 | oligopeptide transporter |
AT1G51560 | Pyridoxamine 5-phosphate oxidase family protein;(source:Araport11) |
AT4G33950 | Encodes calcium-independent ABA-activated protein kinase, a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Mutations disrupted ABA induction of stomatal closure as well as ABA inhibition of light-induced stomatal opening. However, regulation of stomatal opening/closing by light or CO(2) is not affected in these mutants. May act in the interval between ABA perception and reactive oxygen species production in the ABA signalling network. |
AT2G41225 | Encodes a protein of unknown function that is involved in regulation of cell expansion. Based on sequence similarity OSR2 is localized to the plasma membrane. It is expressed in organs that are undergoing cell expansion. Over-expression modifies plant sensitivity to ethylene, leading to improved drought tolerance. |
AT5G65620 | Zincin-like metalloproteases family protein;(source:Araport11) |
AT1G47720 | Encodes an organellar single-strand DNA binding protein, located in mitochondria, controls the stoichiometry of alternative mitochondrial DNA forms generated by homologous recombination. |
AT1G73530 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G20930 | Encodes a unique protein that is both a member of the RIP (RNA-editing interacting protein) family and the RNA recognition motif (RRM)-containing family. It controls the editing extent of 62% of the plastid Cs targeted for editing in Arabidopsis. |
AT5G59200 | Encodes a chloroplast RNA editing factor. |
AT1G73220 | Encodes Organic Cation Transporter 1 (OCT1), likely to be involved in polyamine transport. |
AT1G79410 | organic cation/carnitine transporter5;(source:Araport11) |
AT4G29910 | Origin Recognition Complex subunit 5. Involved in the initiation of DNA replication. Interacts strongly with all ORC subunits. |
AT2G37560 | Origin Recognition Complex subunit 2. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts strongly with all ORC subunits. |
AT5G16690 | Origin Recognition Complex subunit 3. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with all ORC subunits except ORC1b. |
AT2G01120 | Origin Recognition Complex subunit 4. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with all ORC subunits except ORC1b. |
AT1G75330 | ornithine carbamoyltransferase;(source:Araport11) |
AT5G35080 | Encodes a protein involved in the endoplasmic reticulum-associated degradation of glycoproteins. |
AT1G13170 | OSBP(oxysterol binding protein)-related protein 1D;(source:Araport11) |
AT4G22540 | OSBP(oxysterol binding protein)-related protein 2A;(source:Araport11) |
AT4G25860 | OSBP(oxysterol binding protein)-related protein 4A;(source:Araport11) |
AT4G25850 | OSBP(oxysterol binding protein)-related protein 4B;(source:Araport11) |
AT5G57240 | OSBP(oxysterol binding protein)-related protein 4C;(source:Araport11) |
AT1G28120 | Deubiquitinase with preference towards M1 and K48 linkages. |
AT1G16000 | Member of the Arabidopsis 7-kDa OEP family. Tail-anchored (TA) membrane protein which possesses a single C-terminal transmembrane domain targeting post-translationally to plastids. |
AT1G80890 | GAG1At protein;(source:Araport11) |
AT5G19620 | AtOEP80 is paralog to the chloroplastic protein translocation channel Toc75. Mutations in this locus result in embryo lethality. |
AT3G27930 | Encodes a novel plant-specific beta-barrel protein that likely plays a role in the transport of metabolites and in leaf senescence. |
AT1G50670 | OTU-like cysteine protease family protein;(source:Araport11) |
AT3G62940 | Induces cross-talks among epigenomes that altogether impact the regulation of approximately 7060 genes of which 186 genes associated with root development. |
AT1G05420 | ovate family protein 12;(source:Araport11) |
AT2G36050 | ovate family protein 15;(source:Araport11) |
AT2G32100 | ovate family protein 16;(source:Araport11) |
AT3G52540 | ovate family protein 18;(source:Araport11) |
AT4G18830 | Member of the ovate protein family.Interacts with BLH1 and KNAT3. Regulates the subcellular localization of BLH1.I May also directly affect microtubule organization via interactions with TON2. |
AT2G18500 | ovate family protein 7;(source:Araport11) |
AT1G10570 | Encodes a deSUMOylating enzyme. In vitro it has both peptidase activity and isopeptidase activity: it can cleave the C-terminal residues from SUMO to activate it for attachment to a target protein and it can also act on the isopeptide bond between SUMO and another protein. sYFP:OTS2 protein accumulates in nuclei in a punctate pattern. Double mutant analysis with ULP1D/OTS1 indicates that these genes are involved in salt stress responses and flowering time regulation. |
AT2G25840 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
AT5G52520 | Encodes a chloroplast and mitochondria localized prolyl-tRNA synthetase. |
AT2G05590 | TLDc domain protein that confers increased tolerance to oxidative stress. |
AT4G29190 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT1G12480 | Encodes a membrane protein with 10 predicted transmembrane helices. SLAC1 is a multispanning membrane protein expressed predominantly in guard cells that plays a role in regulating cellular ion homeostasis and S-type anion currents. SLAC1 is important for normal stomatal closure in response to a variety of signals including elevated CO2, ozone, ABA, darkness, and humidity. SLAC1:GFP localizes to the plasma membrane. |
AT4G33520 | Encodes a putative metal-transporting P-type ATPase PAA1. An alternative-splicing event of the PAA1 pre-mRNA produces a copper chaperon named PCH1. The mRNA is cell-to-cell mobile. |
AT4G30210 | Encodes NADPH-cytochrome P450 reductase that catalyzes the first oxidative step of the phenylpropanoid general pathway. The mRNA is cell-to-cell mobile. |
AT5G39860 | Encodes PRE1 (PACLOBUTRAZOL RESISTANCE1). PRE1 and IBH1 form a pair of antagonistic HLH/bHLH transcription factors that function downstream of BZR1 to mediate brassinosteroid regulation of cell elongation. BNQ1 is directly and negatively regulated by AP3 and PI in petals.Required for appropriate regulation of flowering time. |
AT1G01860 | dimethyladenosine transferase |
AT4G17410 | PQT3 is a nuclear localized E3 ligase involved in negative regulation of stress tolerance.PRMT4b is a substrate of PQT3. |
AT1G19300 | The PARVUS/GLZ1 gene encodes a putative family 8 glycosyl transferase that contributes to xylan biosynthesis. Its gene expression shows good co-variance with the IRX3 gene involved in secondary cell wall synthesis. PARVUS/GLZ1 is predicted to have galacturonosyltransferase activity and may be involved in the formation of the complex oligosaccharide sequence present at the reducing end of xylan. PARVUS is expressed in cells undergoing secondary wall thickening, and parvus mutants have thinner cell walls. |
AT2G02710 | Encodes a putative blue light receptor protein. |
AT3G54010 | Immunophilin-like protein similar to the p59 FK506-binding protein (FKBP52). Shows rotamase activity and contains an FKBP-like domain and three tetratricopeptide repeat units. Members of this class of mutation show ectopic cell proliferation in cotyledons. Gene may be alternatively spliced. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT3G22270 | Topoisomerase II-associated protein PAT1;(source:Araport11) |
AT4G37050 | Patatin-related phospholipase A. Expressed in the floral gynaecium and is induced by abscisic acid (ABA) or phosphate deficiency in roots. |
AT2G39220 | Phospholipase pPLAIIIa involved in seed germination and resistance to Turnip Crinkle Virus. |
AT3G63200 | PATATIN-like protein 9;(source:Araport11) |
AT1G22530 | PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells. |
AT3G22231 | Encodes a member of a novel 6 member Arabidopsis gene family. Expression of PCC1 is regulated by the circadian clock and is upregulated in response to both virulent and avirulent strains of Pseudomonas syringae pv. tomato. |
AT3G04720 | Encodes a protein similar to the antifungal chitin-binding protein hevein from rubber tree latex. mRNA levels increase in response to ethylene and turnip crinkle virus infection. The mRNA is cell-to-cell mobile. |
AT1G75040 | Thaumatin-like protein involved in response to pathogens. mRNA level of the PR-5 gene (At1g75040)is significantly changed after cutting the inflorescence stem indicating the existence of a network of signal transducing pathways as other stress-regulated genes (At5g01410, At3g17800, At1g29930)do not response to the treatment. The mRNA is cell-to-cell mobile. |
AT5G06370 | PSE1 is a single copy gene that is induced in response to lead and confers increased tolerance to lead when overexpressed. It is localized to the cytoplasm. The protein has an NC domain. PSE1 appears to regulate tolerance via a GSH dependent phytochelatin synthesis pathway. |
AT3G55450 | PBS1-like 1;(source:Araport11) |
AT1G69790 | Protein kinase superfamily protein;(source:Araport11) |
AT5G47070 | Encodes a member of the RLCK VII-4 subfamily of receptor-like cytoplasmic kinases that has been shown to phosphorylate MAPKKK5 Ser-599 and MEKK1 Ser-603, both players in PRR-mediated resistance to bacterial and fungal pathogens. |
AT3G20530 | Protein kinase superfamily protein, expressed in the peroxisome. |
AT4G13190 | Protein kinase superfamily protein;(source:Araport11) |
AT3G24790 | Protein kinase superfamily protein;(source:Araport11) |
AT3G07070 | Protein kinase superfamily protein;(source:Araport11) |
AT1G24030 | Protein kinase superfamily protein;(source:Araport11) |
AT1G72540 | Protein kinase superfamily protein;(source:Araport11) |
AT2G28940 | Protein kinase superfamily protein;(source:Araport11) |
AT2G39110 | Protein kinase superfamily protein;(source:Araport11) |
AT1G52260 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). |
AT3G16110 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). |
AT1G04980 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. |
AT2G32920 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. |
AT1G07960 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. |
AT4G27080 | putative protein |
AT5G22130 | member of Glycosyltransferase Family- 50 |
AT4G14713 | PPD1 (and its paralog, PPD2) encode plant-specific putative DNA-binding proteins. PPD1 and PPD2 are not found in grasses. Overexpression of PPD reduces lamina size by promoting the early arrest of dispersed meristematic cells DMC proliferation during leaf and silique development. Deletion of the PPD locus increases leaf lamina size and results in dome-shaped rather than flat leaves. Siliques are also altered in shape because of extra lamina growth. The curvature of a deltappd leaf reflects the difference between excess growth of the lamina and a limitation to the extension capacity of its perimeter. |
AT4G14720 | PPD2 (and its paralog, PPD1) encode plant-specific putative DNA-binding proteins. Deletion of the PPD locus increases leaf lamina size and results in dome-shaped rather than flat leaves. Siliques are also altered in shape because of extra lamina growth. |
AT1G57590 | Pectinacetylesterase family protein;(source:Araport11) |
AT3G09405 | Pectinacetylesterase family protein;(source:Araport11) |
AT1G09550 | Pectinacetylesterase family protein;(source:Araport11) |
AT3G62060 | Pectinacetylesterase family protein;(source:Araport11) |
AT4G19410 | Pectinacetylesterase family protein;(source:Araport11) |
AT5G23870 | Encodes a pectin acetylesterase that removes cell wall acetate associated with pectin formation in Arabidopsis leaves. |
AT3G29090 | Encodes an atypical pectin methylesterase that does not require salt for its activity and has a blockwise mode of pectin demethylesterification. |
AT3G49220 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT4G00190 | pectin methylesterase 38;(source:Araport11) |
AT4G02300 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT5G47500 | predicted to encode a pectin methylesterase |
AT5G49180 | Encodes a putative pectin methylesterase. The gene is preferentially expressed in floral buds and more specifically in mucilage secretory cells of seeds. Mutants have smaller mucilage cells and abnormal mucilage profiles. |
AT2G44490 | Encodes a glycosyl hydrolase that localizes to peroxisomes and acts as a component of an inducible preinvasion resistance mechanism. Required for mlo resistance. The mRNA is cell-to-cell mobile. |
AT1G06580 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G80270 | PENTATRICOPEPTIDE REPEAT 596;(source:Araport11) |
AT2G35130 | PPR protein involved in plastid mRNA splicing. |
AT1G52620 | Mitochondrial pentatricopeptide repeat protein required for stabilizing nad1 transcripts. |
AT3G59040 | Involved in chloroplast biogenesis and function. |
AT4G25130 | Encodes a chloroplast-localized methionine sulfoxide reductase that is a member of the MSRA family. Involved in protection of chloroplasts from oxidative stress. |
AT1G31050 | Together with PFA2 and PFA3 governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT1G27660 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT3G20640 | Governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT1G05250 | Encodes a cationic cell-wall-bound peroxidase homolog that is involved in the lignification of cell walls. Regulated by COG1, involved in seed longevity. |
AT4G11290 | Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
AT5G64120 | Encodes a cell wall bound peroxidase that is induced by hypo-osmolarity and is involved in the lignification of cell walls. Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
AT3G49110 | Class III peroxidase Perx33. Expressed in roots. Located in the cell wall. Involved in cell elongation. Expression activated by light. May play a role in generating H2O2 during defense response. The mRNA is cell-to-cell mobile. |
AT3G47430 | member of the peroxin11 (PEX11) gene family, located on the peroxisome membrane, controls peroxisome proliferation. The mRNA is cell-to-cell mobile. |
AT1G01820 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
AT3G07560 | Encodes peroxin 13 (PEX13) involved in protein transport into peroxisomes, for example, peroxisomal import of nitric oxide synthase. |
AT5G56290 | Encodes the peroxisomal targeting signal type 1 receptor that facilitates peroxisomal protein translocation. It recognizes proteins with the PTS1 consensus sequence (tripeptide SKL or a conserved variant) at the extreme C terminus. The protein has several domains, including C-terminal tetratricopeptide repeat motifs which act in binding the C-terminal "SKL" targeting signal. The mechanism of transport has been worked out in other organisms: The receptor recognizes and binds cytosolic PTS1-containing proteins. The PEX5-PTS1 complex binds a PEX14/PEX13 receptor complex at the peroxisome membrane and is translocated into the peroxisome matrix in a process dependent on PEX2,PEX10, and PEX12. In the peroxisome matrix, PEX5 releases its cargo and is recycled to the cytosol in a process dependent on PEX1, PEX4, PEX6 and PEX22. It is also involved, in conjunction with PEX7, in PTS1- and PTS2-dependent peroxisomal protein import. RNAi experiments suggest that PEX5 is necessary for the maintenance of both glyoxysomal and leaf peroxisomal functions. |
AT3G04460 | RING finger protein involved in peroxisome biogenesis. Also involved in peroxisomal import of nitric oxide synthase. Has been demonstrated to have E3 ubiquitin ligase activity. |
AT5G25760 | mutant displays sucrose-dependent seedling development and reduced lateral root production. PEX4 interacts with PEX22 in a yeast two-hybrid. Necessary for peroxisome biogenesis. The PEX4 and PEX22 pair may be important during the remodeling of peroxisome matrix contents as glyoxysomes transition to leaf peroxisomes. |
AT1G65990 | type 2 peroxiredoxin-related / thiol specific antioxidant / mal allergen family protein;(source:Araport11) |
AT3G06050 | Encodes a mitochondrial matrix localized peroxiredoxin involved in redox homeostasis. Knockout mutants have reduced root growth under certain oxidative stress conditions. |
AT1G04710 | EC2.3.1.16 thiolase. Its transcript levels change after inducing MUTE expression in a mute background. |
AT2G22780 | encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
AT5G14520 | Encodes a nucleolar protein that plays an essential role in cell growth and survival through its regulation of ribosome biogenesis and mitotic progression. |
AT1G71440 | Encodes tubulin-folding cofactor E. Mutant embryos consist of one or a few grossly enlarged cells, surrounded by an endosperm that fails to cellularize and contains a few big nuclei. |
AT2G34710 | Dominant PHB mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. Has overlapping functions with PHAVOLUTA, REVOLUTA and CORONA. |
AT1G30490 | Dominant PHV mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Has overlapping functions with PHABULOSA, REVOLUTA and CORONA/ATHB15 in patterning the apical portion of the embryo. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. |
AT5G39050 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. |
AT5G04230 | Member of Phenylalanine ammonialyase (PAL) gene family. Differs significantly from PAL1 and PAL2 and other sequenced plant PAL genes. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
AT3G10340 | Encodes PAL4, a putative a phenylalanine ammonia-lyase. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
AT5G02460 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
AT1G63090 | phloem protein 2-A11;(source:Araport11) |
AT3G53000 | phloem protein 2-A15;(source:Araport11) |
AT1G80110 | phloem protein 2-B11;(source:Araport11) |
AT5G24560 | phloem protein 2-B12;(source:Araport11) |
AT1G09155 | phloem protein 2-B15;(source:Araport11) |
AT2G02300 | phloem protein 2-B5;(source:Araport11) |
AT2G33770 | Encodes a ubiquitin-conjugating E2 enzyme. UBC24 mRNA accumulation is suppressed by miR399f, miR399b and miR399c. Involved in phosphate starvation response and mediates degradation of PHO1 and PHT1s at endomembrane. Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
AT5G23630 | A member of the eukaryotic type V subfamily (P5) of P-type ATPase cation pumps; MIA is most similar to the human P5 ATPase ATY2(44% identity) and to Spf1p from S. cerevisiae (41% identity). Highly abundant in the endoplasmic reticulum and small vesicles of developing pollen grains and tapetum cells. T-DNA insertional mutants of MIA suffer from imbalances in cation homeostasis and exhibit a severe reduction in fertility. Mutant microspores fail to separate from tetrads and pollen grains are fragile with an abnormal morphology and altered cell wall structure. MIA is also named PDR2 and was shown to be required for proper expression of SCARECROW (SCR), a key regulator of root patterning, and for stem-cell maintenance in Pi-deprived roots. |
AT3G42770 | E3 ligase involved in phosphate homeostasis. Under low Pi stress it targets WRKY6(AT1G62300) for degradation which in turn is a repressor of PHO1( AT3G23430 ). |
AT4G28610 | Similar to phosphate starvation response gene from Chlamydomonas. Weakly responsive to phosphate starvation. Acts upstream of PHO2 in phosphate signaling and PHT1;1 in arsenate accumulation. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
AT1G73010 | Encodes PPsPase1, a pyrophosphate-specific phosphatase catalyzing the specific cleavage of pyrophosphate (Km 38.8 uM) with an alkaline catalytic pH optimum. Expression is upregulated in the shoot of cax1/cax3 mutant. |
AT5G43350 | Encodes an inorganic phosphate transporter Pht1;1. Mutants display enhanced arsenic accumulation. Under high arsenate concentrations, PHT1;1 levels are reduced and it is delocalized from the plasma membrane. Members of the Pht1 family of phosphate transporters include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341).PHT1;1 expression is transcriptionally regulated by WRKY6 and by PHR1. |
AT5G43360 | Encodes Pht1;3, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
AT2G32830 | Encodes Pht1;5, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
AT5G43340 | Encodes Pht1;6, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
AT3G54700 | Encodes Pht1;7, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
AT1G20860 | Encodes Pht1;8, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
AT1G76430 | Encodes Pht1;9, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
AT5G43370 | Encodes a phosphate transporter Pht1;2. Members of the Pht1 family of phosphate transporters include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341) The mRNA is cell-to-cell mobile. |
AT3G26570 | low affinity phosphate transporter |
AT2G17270 | Encodes a mitochondrial phosphate transporter. Modulates plant responses to salt stress. |
AT2G38060 | Encodes an inorganic phosphate transporter (PHT4;2). |
AT1G35140 | EXL1 is involved in the C-starvation response. Phenotypic changes of an exl1 loss of function mutant became evident only under corresponding experimental conditions. For example, the mutant showed diminished biomass production in a short-day/low light growth regime, impaired survival during extended night, and impaired survival of anoxia stress. |
AT3G58830 | Encodes a phosphatidylglycerophosphate (PGP) phosphatase that localizes to chloroplasts in above ground plant parts and mitochondria in root tips and root hairs and is involved in the synthesis of plastidial Phosphatidylglycerol (PG). This enzyme is responsible for the second step of PG synthesis. Mutants show reduced root growth. |
AT5G64070 | Encodes a phosphatidylinositol 4-OH kinase, PI-4Kbeta1. Arabidopsis contains 12 PI-4Ks in three separate families: PI-4Kalphs, PI-4kbeta, and PI-4Kgamma. PI-4Kbeta1 is 83% identical to PI-4kbeta2 encoded by At5g09350. Interacts with the RabA4b GTPase. Important for polarized root hair growth as the loss of this gene and its close relative PI-4kbeta2, leads to the formation of abnormal root hairs. |
AT5G09350 | Encodes a phosphatidylinositol 4-OH kinase, PI-4Kbeta2. Arabidopsis contains 12 PI-4Ks in three separate families: PI-4Kalphs, PI-4kbeta, and PI-4Kgamma. PI-4Kbeta2 is 83% identical to PI-4kbeta1 encoded by At5g64070. Important for polarized root hair growth as the loss of this gene and its close relative PI-4kbeta1, leads to the formation of abnormal root hairs. |
AT1G03050 | Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane. |
AT1G21980 | Type I phosphatidylinositol-4-phosphate 5-kinase. Preferentially phosphorylates PtdIns4P. Induced by water stress and abscisic acid in Arabidopsis thaliana. Expressed in procambial cells of leaves, flowers and roots. A N-terminal Membrane Occupation and Recognition Nexus (MORN)affects enzyme activity and distribution. |
AT1G77740 | Encodes PIP5K2, a phosphatidylinositol-4-phosphate 5-kinase (PtdIns(4)P 5-kinase 2; or PIP5K2 that is involved in regulating lateral root formation and root gravity response. The mRNA is cell-to-cell mobile. |
AT3G07960 | Encodes phosphatidylinositol-4-phosphate 5-kinase 6 (PIP5K6). Regulates clathrin-dependent endocytosis in pollen tubes. |
AT3G47220 | Encodes a plasma membrane-localized phosphoinositide-specific phospholipase C with a role in thermotolerance. |
AT3G47290 | phosphatidylinositol-speciwc phospholipase C8;(source:Araport11) |
AT1G15110 | PSS1 encodes a base-exchange-type Phosphatidylserine (PS) synthase. Mutant analysis revealed its role in pollen maturation. |
AT1G53310 | Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins.Plays an important role in carbon and nitrogen metabolism. |
AT2G42600 | Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins.PPC1 and PPC2 are crucial for balancing carbon and nitrogen metabolism. |
AT3G14940 | Encodes a cytosolic phosphoenolpyruvate carboxylase (PEPC) that has activity when expressed in E.coli. Its mRNA is most abundantly expressed in roots and siliques. PPC3 belongs to the plant-type PEPC family. It can form an enzymatically active complex with a castor bean ortholog of PPC4, which encodes a bacterial-type PEPC. The mRNA is cell-to-cell mobile. |
AT1G68750 | Encodes one of four Arabidopsis phosphoenolpyruvate (PEP) carboxylase proteins. But, it is more similar to bacterial PEP carboxylase than plant PEP carboxylase. Efforts to express this enzyme and to demonstrate its enzymatic activity in E.coli failed. |
AT1G08650 | Encodes a phosphoenolpyruvate carboxylase kinase that is expressed at highest levels in leaves. Expression is induced by light. The mRNA is cell-to-cell mobile. |
AT1G12680 | phosphoenolpyruvate carboxylase-related kinase 2;(source:Araport11) |
AT4G26270 | phosphofructokinase 3;(source:Araport11) |
AT4G32840 | phosphofructokinase 6;(source:Araport11) |
AT5G26570 | chloroplastidic phosphoglucan, water dikinase (PWD) which is required for normal degradation of leaf starch in Arabidopsis. NMR analysis of the mutants, suggests that the gene is specifically involved in the phosphorylation of the glucosyl residues of starch at the C3 position. |
AT5G51820 | Encodes a plastid isoform of the enzyme phosphoglucomutase involved in controlling photosynthetic carbon flow. Effective petiole movement against the direction of the gravity requires functional PGM activity that is required for full development of amyloplasts. |
AT4G24620 | The PGI1 gene encodes the plastid phospho-glucose (Glc) isomerase. While pgi1-1 mutant has a deficiency in leaf starch synthesis, it accumulates starch in root cap cells. Flowering time of the pgi1-1 mutant is significantly delayed under short-day conditions. |
AT3G12780 | PGK1 was localized exclusively in the chloroplasts of photosynthetic tissues and is the photosynthetic isoform. The pgk1.1 knock-down mutant displayed reduced growth, lower photosynthetic capacity and starch content. Expression studies in PGK mutants showed that PGK1 and PGK3 were down-regulated in pgk3.2 and pgk1.1, respectively. These results indicate that the down-regulation of photosynthetic activity could be a plant strategy when glycolysis is impaired to achieve metabolic adjustment and optimize growth (DOI:10.1104/pp.17.01227).Functions redundantly with AT1G56190 in the chloroplast in the biosynthesis of thylakoid membrane galactolipids. Double mutants are photosynthetically incompetent, plants are albino and seedling lethal |
AT1G78050 | phosphoglycerate/bisphosphoglycerate mutase;(source:Araport11) |
AT2G40850 | phosphoinositide 4-kinase gamma 1;(source:Araport11) |
AT4G29470 | Encodes one of the four Arabidopsis phospholipase PLA2 parologs: AT2G06925 (PLA2-ALPHA), AT2G19690 (PLA2-BETA), AT4G29460 (PLA2-GAMMA) and AT4G29470 (PLA2-DELTA). Involved in pollen development and germination and tube growth. |
AT4G29460 | Encodes one of the four Arabidopsis phospholipase PLA2 parologs: AT2G06925 (PLA2-ALPHA), AT2G19690 (PLA2-BETA), AT4G29460 (PLA2-GAMMA) and AT4G29470 (PLA2-DELTA). Involved in pollen development and germination and tube growth. |
AT5G58670 | phosphatidylinositol-specific phospholipase C is induced to a significant extent under various environmental stresses, such as dehydration, salinity, and low temperature. May play a role in secondary ABA response. There are two genes called ATPLC1, one corresponding to AT4g38530 and one corresponding ot AT5g58670 (this one). |
AT1G52570 | member of C2-PLD subfamily |
AT5G25370 | member of C2-PLD subfamily. Analyses on the gene structures/sequences, overall amino acid sequences, and domain structures indicate that PLDalpha3 is most closely related to other two PLDalphas than to other PLDs. Phylogenetic analysis has not identified a true ortholog for PLDalpha3. Involved in hyperosmotic response. |
AT2G42010 | phospholipase D (PLDbeta) |
AT4G00240 | member of C2-PLD subfamily |
AT4G35790 | Encodes a protein with phospholipase D activity. Involved in phospolipase metabolism. Mutants are affected in hydrogen peroxide mediated cell death. |
AT4G11830 | Encodes one of three phospholipase D enzymes of the gamma class. |
AT3G16785 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Does not appear to be involved in root hair patterning. Not induced upon Pi starvation. |
AT3G05630 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. Regulates vesicle trafficking. Required for auxin transport and distribution and hence auxin responses. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Plays a major role in phosphatidic acid production during phosphate deprivation. Induced upon Pi starvation in both shoots and roots. Involved in hydrolyzing phosphatidylcholine and phosphatidylethanolamine to produce diacylglycerol for digalactosyldiacylglycerol synthesis and free Pi to sustain other Pi-requiring processes. Does not appear to be involved in root hair patterning. Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
AT3G11470 | Encodes one of three splice variants. Differs in having CM in positions 88 and 89. The protein is localized to the mitochondria where it phosphopantetheinylates the mature apo mtACP isoforms. It is an essential gene as homozygous mutants cannot be recovered (embryo lethal). |
AT2G42910 | Phosphoribosyltransferase family protein;(source:Araport11) |
AT2G32260 | phosphorylcholine cytidylyltransferase;(source:Araport11) |
AT4G15130 | phosphorylcholine cytidylyltransferase2;(source:Araport11) |
AT2G17630 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT3G13670 | MUT9-like protein kinase. Contributes to phosphorylation of photoexcited CRY2. Interaction with CRY2 occurs via the non catalytic PPKC domain.MLK4 phosphorylates the conserved H2A serine 95 residue. Synthetic mutants that cannot phosphorylate H2AS95 fail to complement the late flowering phenotype suggesting that MLK4 promotes long day flowering via phosphorylation.MLK4 is required for H2A295 phosphorylation of GI. |
AT5G18190 | Casein kinase involved in phosphorylation and ubiquination of RYR/PYLs, resulting in negative regulation of ABA response.Also annotated as MUT9-LIKE kinase that functions as H3-T3 specific histone kinase. |
AT3G03940 | Casein kinase involved in phosphorylation and ubiquination of RYR/PYLs, resulting in negative regulation of ABA response. Also acts in GA response pathway along with RGA1/CCA1. |
AT3G47390 | Encodes a protein that is believed to function as a pyrimidine reductase involved in riboflavin and FAD biosynthesis. phs1 was identified as a photosensitive mutant that shows reduced growth, chloroplast developmental abnormalities, reduced chlorophyll levels, increased oxidative stress, reduced NADPH/NADP+ ratios, reduced photosystem I electron transport, and reduced photosynthetic protein levels under high light conditions. Many of these abnormal phenotypes likely arise from the reduction in the levels of FAD in the phs1 mutant. |
AT1G68650 | Member of the UPF0016 family of membrane proteins, belongs to the conserved group of Mn/Ca transporters. Might act to fine tune Mn allocation into the endoplasmic reticulum of specific cell types. |
AT1G15980 | encodes a novel subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in cyclic electron flow around photosystem I to produce ATP. |
AT2G39470 | PsbP-like protein 2;(source:Araport11) |
AT2G46820 | Encodes the P subunit of Photosystem I. About 25% of the TMP14 pool appeared to be phosphorylated, and this ratio is not affected by light. Contains seven phosphorylation sites on threonine residue and chloroplast targeting signal. Located in the proximity of PSI-L, -H and -O subunits. Forms oligomers with other members of CURT1 family to modulate grana structure. |
AT3G16140 | Encodes subunit H of photosystem I reaction center subunit VI. |
AT3G27690 | Encodes Lhcb2.4. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus. The mRNA is cell-to-cell mobile. |
AT2G30570 | Encodes PsbW, a protein similar to photosystem II reaction center subunit W. Loss of PsbW destabilizes the supramolecular organization of PSII. |
AT2G30790 | Encodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution. |
AT3G45780 | Blue-light photoreceptor. Contains a light activated serine-threonine kinase domain and LOV1 and LOV2 repeats. Mutants are defective in blue-light response. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT1 undergoes blue-light-dependent autophosphorylation. At least eight phosphorylation sites have been identified in PHOT1. Phosphorylation of serine851 in the activation loop of PHOT1 appears to be required for stomatal opening, chloroplast accumulation, leaf flattening, and phototropism, and phosphorylation of serine849 may also contribute to the regulation of these responses. Phosphorylation-dependent binding of 14-3-3 proteins to the Hinge1 region of PHOT1 appears to require serine350 and serine376. |
AT5G58140 | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light. The mRNA is cell-to-cell mobile. |
AT5G29000 | MYB-CC family member. PHL1 acts redundantly with PHR1 to regulate responses to Pi starvation. |
AT2G20400 | MYB-CC transcription factor. PHL4 is related to PHR1 (which regulates plant Pi starvation response) but it does not seem to have a significant role in Pi starvation. |
AT3G17360 | PHRAGMOPLAST ORIENTING KINESIN 1 is one of the two Arabidopsis homologs isolated in yeast two-hybrid screen for interaction partners of maize gene TANGLED1 (TAN1). Based on sequence homology in their motor domains, POK1 and POK2 belong to the kinesin-12 class which also includes the well-characterized group of phragmoplast-associated kinesins AtPAKRPs. Both kinesins are composed of an N-terminal motor domain throughout the entire C terminus and putative cargo binding tail domains. The expression domains for POK1 constructs were more limited than those for POK2; both are expressed in tissues enriched for dividing cells. The phenotype of pok1/pok2 double mutants strongly resembles that of maize tan1 mutants, characterized by misoriented mitotic cytoskeletal arrays and misplaced cell walls. |
AT4G14330 | Orphan kinesin with processive motility on single microtubules. |
AT3G55340 | Plant-specific protein. Interacts with phragmoplastin, Rop1 and Rop2. Involved in cell plate formation. |
AT3G58850 | Encodes PHYTOCHROME RAPIDLY REGULATED2 (PAR2), an atypical basic helix-loop-helix (bHLP) protein. Closely related to PAR1 (At2g42870). Up regulated after simulated shade perception. Acts in the nucleus to control plant development and as a negative regulator of shade avoidance response. Functions as transcriptional repressor of auxin-responsive genes SAUR15 (AT4G38850) and SAUR68 (AT1G29510). |
AT2G26710 | Encodes a member of the cytochrome p450 family that serves as a control point between multiple photoreceptor systems and brassinosteroid signal transduction. Involved in brassinolide metabolism. Mediates response to a variety of light signals including hypocotyl elongation and cotyledon expansion. |
AT1G09570 | Light-labile cytoplasmic red/far-red light photoreceptor involved in the regulation of photomorphogenesis. It exists in two inter-convertible forms: Pr and Pfr (active) and functions as a dimer.The N terminus carries a single tetrapyrrole chromophore, and the C terminus is involved in dimerization. It is the sole photoreceptor mediating the FR high irradiance response (HIR). Major regulator in red-light induction of phototropic enhancement. Involved in the regulation of de-etiolation. Involved in gravitropism and phototropism. Requires FHY1 for nuclear accumulation. |
AT4G18130 | member of Histidine Kinase |
AT1G09530 | Transcription factor interacting with photoreceptors phyA and phyB. Forms a ternary complex in vitro with G-box element of the promoters of LHY, CCA1. Acts as a negative regulator of phyB signalling. It degrades rapidly after irradiation of dark grown seedlings in a process controlled by phytochromes. Does not play a significant role in controlling light input and function of the circadian clockwork. Binds to G- and E-boxes, but not to other ACEs. Binds to anthocyanin biosynthetic genes in a light- and HY5-independent fashion. PIF3 function as a transcriptional activator can be functionally and mechanistically separated from its role in repression of PhyB mediated processes. |
AT3G62090 | encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. |
AT2G20180 | Encodes a novel Myc-related bHLH transcription factor that has transcriptional activation activity in the dark. It is a key negative regulator of phytochrome-mediated seed germination and acts by inhibiting chlorophyll biosynthesis, light-mediated suppression of hypocotyl elongation and far-red light-mediated suppression of seed germination, and promoting negative gravitropism in hypocotyls. Light reduces this activity in a phy-dependent manner. The protein preferentially interacts with the Pfr forms of Phytochrome A (PhyA) and Phytochrome B (PhyB), is physically associated with APRR1/TOC1 and is degraded in red (R) and far-red (FR) light through the ubiquitin (ub)-26S proteasome pathway to optimize photomorphogenic development in Arabidopsis. It also negatively regulates GA3 oxidase expression. |
AT2G43010 | Isolated as a semidominant mutation defective in red -light responses. Encodes a nuclear localized bHLH protein that interacts with active PhyB protein. Negatively regulates phyB mediated red light responses. Involved in shade avoidance response. Protein abundance is negatively regulated by PhyB.Involved in the regulation of response to nutrient levels. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
AT2G02950 | Encodes a basic soluble protein which can independently bind to either PHYA or PHYB, regardless of whether the phytochromes are in the Pr or Pfr state. PKS1 can be phosphorylated by oat phyA in vitro in a light regulated manner. It is postulated to be a negative regulator of phyB signalling. |
AT3G16500 | phytochrome-associated protein 1 (PAP1) |
AT1G72390 | nuclear receptor coactivator;(source:Araport11) |
AT5G61270 | Basic helix-loop-helix (bHLH) phytochrome interacting factor. Interacts specifically with the far-red light?absorbing Pfr form of phyB through a conserved domain called the active phyB binding motif. Upon light exposure, PIF7 rapidly migrates to intranuclear speckles, where it colocalizes with phyB. Role as negative regulator of phyB-mediated seedling deetiolation. |
AT4G14210 | Encodes phytoene desaturase (phytoene dehydrogenase), an enzyme that catalyzes the desaturation of phytoene to zeta-carotene during carotenoid biosynthesis. Processed protein is localized to the plastid. |
AT5G53890 | Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of phytosulfokine (PSK), which is a 5-aa tyrosine-sulfated peptide that primarily promotes cellular proliferation. |
AT1G05320 | myosin heavy chain, embryonic smooth protein;(source:Araport11) |
AT4G31900 | chromatin remodeling factor;(source:Araport11) |
AT5G12130 | integral membrane TerC family protein;(source:Araport11) |
AT1G68450 | VQ motif-containing protein;(source:Araport11) |
AT1G71720 | Encodes a chloroplast localized protein that regulates the translation of Ycf1 by binding to its mRNA. It is involved in the biogenesis of photosynthetic complexes. |
AT1G76620 | Serine/Threonine-kinase, putative (Protein of unknown function, DUF547);(source:Araport11) |
AT1G73590 | Encodes an auxin efflux carrier involved in shoot and root development. It is involved in the maintenance of embryonic auxin gradients. Loss of function severely affects organ initiation, pin1 mutants are characterised by an inflorescence meristem that does not initiate any flowers, resulting in the formation of a naked inflorescence stem. PIN1 is involved in the determination of leaf shape by actively promoting development of leaf margin serrations. In roots, the protein mainly resides at the basal end of the vascular cells, but weak signals can be detected in the epidermis and the cortex. Expression levels and polarity of this auxin efflux carrier change during primordium development suggesting that cycles of auxin build-up and depletion accompany, and may direct, different stages of primordium development. PIN1 action on plant development does not strictly require function of PGP1 and PGP19 proteins. |
AT1G70940 | A regulator of auxin efflux and involved in differential growth. PIN3 is expressed in gravity-sensing tissues, with PIN3 protein accumulating predominantly at the lateral cell surface. PIN3 localizes to the plasma membrane and to vesicles. In roots, PIN3 is expressed without pronounced polarity in tiers two and three of the columella cells, at the basal side of vascular cells, and to the lateral side of pericycle cells of the elongation zone. PIN3 overexpression inhibits root cell growth. Protein phosphorylation plays a role in regulating PIN3 trafficking to the plasma membrane. The mRNA is cell-to-cell mobile. |
AT5G65980 | Auxin efflux carrier family protein;(source:Araport11) |
AT2G26700 | Member of AGC VIIIa Kinase gene family. Encodes PID2, a homolog of PID. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
AT1G32100 | Encodes a pinoresinol reductase involved in lignan biosynthesis. Expressed strongly in roots and less strongly in stems. Shows specificity for pinoresinol and not lariciresinol. |
AT5G18410 | distorted trichomes and exhibits a diffuse actin cytoskeleton |
AT4G02075 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT1G68610 | Target promoter of the male germline-specific transcription factor DUO1. |
AT1G18490 | 2-aminoethanethiol dioxygenase, putative (DUF1637);(source:Araport11) |
AT2G42670 | Plant Cysteine Oxidase (PCO). Involved in controlling the stability of Group VII ethylene response factors (ERF-VIIs) via N-Arg/degron pathway through catalyzing the oxidation of their N-Cys for subsequent Arginyl-tRNA--protein transferase 1 (ATE1) mediated arginine installation. |
AT1G55010 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
AT4G33330 | Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. |
AT1G08990 | plant glycogenin-like starch initiation protein 5;(source:Araport11) |
AT5G05850 | Encodes PIRL1, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen. |
AT4G35470 | Encodes PIRL4, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
AT2G17440 | Encodes PIRL5, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. The mRNA is cell-to-cell mobile. |
AT4G26050 | Encodes PIRL8, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. The mRNA is cell-to-cell mobile. |
AT2G28830 | Encodes a U-box E3 ubiquitin ligase involved in ubiquitination of pattern recognition receptor FLS2.pub12/pub13 double mutants enhanced chitin-induced ROS production and callose deposition suggesting they function redundantly to negatively regulate immune response to fungal elicitor. |
AT3G46510 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. Can be phosphorylated in vitro by MLPK, ARK1, and ARK2 but not by SD1-29. Involved in ubiquitination of pattern recognition receptor FLS2. |
AT3G54850 | Encodes a protein with a typical U-box domain followed by an Armadillo repeat region, a domain organization that is frequently found in plant U-box proteins. Displays ubiquitin ligase activity in vitro. Regulator of flowering time. |
AT1G29340 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity. It is required for cell death and full resistance specified by Arabidopsis RPM1 and RPS4 resistance proteins against Pseudomonas syringae pv tomato. The mRNA is cell-to-cell mobile. |
AT1G60190 | Encodes PUB19, a plant U-box armadillo repeat protein. Involved in salt inhibition of germination together with PUB18. The mRNA is cell-to-cell mobile. |
AT2G35930 | Encodes a cytoplasmically localized U-box domain containing E3 ubiquitin ligase that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
AT3G11840 | Encodes a U-box-domain-containing E3 ubiquitin ligase that acts as a negative regulator of PAMP-triggered immunity. |
AT1G49780 | PUB25 and PUB26 are closely related paralogs that encode functional E3 ligases. They function in immune response pathway by targeting BIK1 for degradation. |
AT3G18710 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
AT3G54790 | ARM repeat superfamily protein;(source:Araport11) |
AT5G65200 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
AT3G47820 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT1G76390 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT1G27910 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
AT5G18320 | One of three tandemly located, paralogous plant U-box proteins. Mutants show increased sensitivity to water stress.Expression in roots is enhanced by auxin and to a lesser extent ABA and cytokinin treatment. |
AT4G21350 | Encodes a U-box/ARM repeat protein required fore self-incompatibility. |
AT3G07360 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
AT1G23030 | Encodes a plant U-Box protein that is capable of binding and ubiquitinating a variety of targets including MYC2,LRR1,KIN and acting as an E3 ligase. Regulates a number of physiological hormonal and environment al responses via selective degradation of targets.Unlike PUB10, its closest homolog in Arabidopsis, it does not appear to play a major role in the MeJA-mediated response. |
AT1G14570 | Encodes a nuclear UBX-containing protein that can bridge ubiquitin to AtCDC48A. |
AT4G10790 | Encodes a member of the plant UBX-domain containing (PUX) protein family. It is an integral lipid droplet (LD) protein that associates with a subpopulation of LDs during seed germination. It likely acts as an adaptor recruiting CDC48A to ubiquitinated oleosins, thus facilitating the dislocation of oleosins from LDs by the segregase activity of CDC48A. |
AT3G29380 | Encodes a TFIIB-related protein expressed in the reproductive organs and seeds. Loss-of-function specifically affects the development of the syncytial endosperm. It is not required for RNA polymerase IV or V activities. |
AT2G02850 | Encodes plantacyanin one of blue copper proteins. Involved in anther development and pollination. Expressed in the transmitting tract of the pistil. |
AT4G23400 | Plasma membrane intrinsic protein, involved redundantly with PIP1;1/2/3/4 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
AT5G60660 | A member of the plasma membrane intrinsic protein subfamily PIP2.When expressed in yeast cells can conduct hydrogen peroxide into those cells. Mutants exhibit longer root hairs. |
AT3G54820 | plasma membrane intrinsic protein 2;(source:Araport11) |
AT4G35100 | a member of the plasma membrane intrinsic protein PIP. functions as aquaporin. Salt-stress-inducible MIP |
AT4G20260 | Encodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels. The mRNA is cell-to-cell mobile. |
AT1G69295 | Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and is predicted to bind callose. |
AT3G58100 | Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and is predicted to bind callose. |
AT1G04520 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. |
AT5G37660 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
AT1G19880 | Encodes a regulator of chromatin condensation 1 (RCC1) family protein; confers plasticity of rosette diameter in response to changes in N availability. |
AT5G53280 | An integral outer envelope membrane protein (as its homolog PDV2), component of the plastid division machinery. Similar to ARC5, PDV1 localized to a discontinuous ring at the division site in wild-type plants. PDV1 and PDV2 are required for localization of ARC5 at the chloroplast division site. Topological analysis showed that the large N-terminal region of PDV1 upstream of the transmembrane helix bearing a putative coiled-coil domain is exposed to the cytosol. Mutation of the conserved PDV1 C-terminal Gly residue did not block PDV1 insertion into the outer envelope membrane but did abolish its localization to the division site. The mRNA is cell-to-cell mobile. |
AT2G16070 | An integral outer envelope membrane protein (its homolog in A thaliana PDV1), component of the plastid division machinery. Similar to ARC6, PDV2 localizes to a continuous ring at the division site in wild-type plants. PDV1 and PDV2 are required for localization of ARC5 at the chloroplast division site. |
AT1G02660 | PLIP2 is a glycerolipid A1 lipase with substrate preference for monogalactosyldiacylglycerol. Expression is induced by ABA. |
AT1G32990 | mutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Plastid Ribosomal Protein L11 The mRNA is cell-to-cell mobile. |
AT2G24090 | Ribosomal protein L35;(source:Araport11) |
AT5G65220 | Ribosomal L29 family protein;(source:Araport11) |
AT1G29070 | Ribosomal protein L34;(source:Araport11) |
AT5G54180 | Encodes a member of the Mitochondrial Transcription Termination Factor Family and is involved in the transcription termination of the chloroplast gene psbJ1. pTAC15 specifically binds to the 3'-terminal region of psbJ. |
AT1G80480 | plastid transcriptionally active 17;(source:Araport11) |
AT3G04260 | PEP complex component. |
AT4G13670 | plastid transcriptionally active 5;(source:Araport11) |
AT3G52150 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G17870 | plastid-specific ribosomal protein 6 precursor (Psrp-6) - like |
AT3G24590 | Encodes a signal peptidase Plsp1 (plastidic type I signal peptidase 1). Required for thylakoid development. Functions in the maturation of the 75-kD component of the translocon at the outer envelope membrane of chloroplasts and oxygen evolving complex subunit 33 (OE33). Involved in the maturation of PsbO, plastocyanin and FtsH2/8. The mRNA is cell-to-cell mobile. |
AT1G76100 | One of two Arabidopsis plastocyanin genes. Expressed at 1/10th level of PETE2. Does not respond to increased copper levels and is thought to be the isoform that participates in electron transport under copper-limiting conditions. Mutation of this gene does not have obvious effect on photosynthesis. |
AT3G58010 | plastoglobulin 34kD;(source:Araport11) |
AT4G39730 | PLAT1 domain stress protein family member. Involved in mediating response to stresses such as pathogen infection. It is found in endoplasmic reticulum bodies. PLAT1 is induced by pathogenic fungi and induces the production of scopolin. |
AT5G65158 | Lipase/lipooxygenase, PLAT/LH2 family protein;(source:Araport11) |
AT3G20840 | Encodes a member of the AINTEGUMENTA-like (AIL) subclass of the AP2/EREBP family of transcription factors and is essential for quiescent center (QC) specification and stem cell activity. It is a key effector for establishment of the stem cell niche during embryonic pattern formation. It is transcribed in response to auxin accumulation and is dependent on auxin response transcription factors. |
AT2G45800 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. |
AT1G01780 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. The mRNA is cell-to-cell mobile. |
AT5G02400 | Encodes a protein with similarity to the POL locus which is a novel protein phosphatase 2C. Ubiquitously expressed. No phenotype observed in homozygous null mutant background. |
AT2G29790 | Encodes a Maternally expressed gene (MEG) family protein [pseudogene] |
AT5G35390 | Encodes a member of the receptor-like kinase family of genes. In pollen tubes, it accumulates in the plasma membrane of the apical growing tip through the process of exocytosis. |
AT3G22200 | Genetically redundant with POP3;mediates pollen tube guidance. Double mutants are self sterile; gamma-aminobutyrate transaminase subunit precursor; nuclear gene for mitochondrial product. Encodes gamma-aminobutyrate transaminase that uses pyruvate instead of alpha-ketoglutarate as cosubstrate. Mutations in POP2/HER1 render roots resistant to the inhibitory growth effects of the volatile organic compound E-2-hexenal implicated in plant defense. |
AT2G35350 | Encodes a protein most similar to the POLTERGEIST locus. Double mutant analysis of loss of function alleles indicate PLL1 functions redundantly with POL to regulate meristem size and pedicel length. Acts in a dose dependent manner with POL to suppress the clv1, clv2 and clv3 phenotypes. |
AT1G34140 | polyadenylate-binding protein, putative / PABP, putative, non-consensus splice donor TA at exon 1; similar to polyadenylate-binding protein (poly(A)-binding protein) from (Triticum aestivum) GI:1737492, (Nicotiana tabacum) GI:7673355, {Arabidopsis thaliana} SP:P42731; contains InterPro entry IPR000504: RNA-binding region RNP-1 (RNA recognition motif) (RRM). Only member of the class IV PABP family. |
AT3G16380 | polyadenylate-binding protein, putative / PABP, putative, similar to polyadenylate-binding protein (poly(A)-binding protein) from {Arabidopsis thaliana} SP:P42731, (Cucumis sativus) GI:7528270, {Homo sapiens} SP:Q13310, {Arabidopsis thaliana} SP:Q05196; contains InterPro entry IPR000504: RNA-binding region RNP-1 (RNA recognition motif) (RRM). Member of the class III family of PABP proteins. |
AT1G49760 | polyadenylate-binding protein, putative / PABP, putative, similar to poly(A)-binding protein GB:AAF66825 GI:7673359 from (Nicotiana tabacum). Highly and ubiquitously expressed. Member of the class II PABP family. |
AT3G06560 | Encodes a poly(A) polymerase. Located in the cytoplasm. |
AT2G31320 | Encodes a poly(ADP-ribose) polymerase. |
AT5G13700 | Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants). |
AT1G60390 | polygalacturonase 1;(source:Araport11) |
AT1G70370 | Polygalacturonase involved in cell wall modification. |
AT3G26610 | Encodes an apoplast-localized polygalacturonase involved in cell elongation and flower development. |
AT1G48100 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G20540 | Encodes an organellar DNA polymerase I that is also involved in double strand break repair. |
AT2G16530 | Encodes polyprenol reductase involved in N-gylcosylation. Mutants are defective in pollen development. Knockouts are embryo lethal |
AT4G23660 | Encodes para-hydroxy benzoate polyprenyl diphosphate transferase. The enzyme was shown to be able to use a wide range of prenyl substrates : from GPP (C10) to decaprenyl diphosphate (C50). |
AT3G01150 | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination. |
AT5G53180 | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination. |
AT1G43190 | polypyrimidine tract-binding protein 3;(source:Araport11) |
AT1G05850 | Encodes an endo chitinase-like protein AtCTL1. Essential for tolerance to heat, salt and drought stresses. Also involved in root hair development, cell expansion and response to cytokinin. Allelic to erh2. 11 alleles described in Hauser (1995). Mutant is defective in acquired thermotolerance, appears semidwarf throughout its life cycle and has extra lateral branches. There are two EMS alleles. Expression of AtHSP101 is not affected in the mutants. |
AT4G02460 | Encodes a protein similar to PMS1 in yeast, a member of the family of eukaryotic MutL homologs. The protein appears to play a role in DNA mismatch repair and in the suppression of somatic homeologous recombination. |
AT4G18290 | Encodes KAT2, a member of the Shaker family potassium ion (K+) channel. Critical to stomatal opening induced by blue light. Critical to circadian rhythm of stomatal opening. Involved in plant development in response to high light intensity. Under high light intensity, the mutant plant produced less biomass compared to the wild type. The Shaker family K+ ion channels include five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
AT4G32650 | Encodes KAT3, a member of the Shaker family of voltage-gated potassium channel subunits. Does not form functional potassium channel on its own. Involved in down-regulating AKT1 and KAT1 channel activity by forming heteromers with AKT1 or KAT1. The Shaker family K+ ion channels include five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inwardly rectifying conductance): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
AT2G30070 | Encodes a high affinity potassium transporter. |
AT2G40540 | putative potassium transporter AtKT2p (AtKT2) mRNA, |
AT3G52250 | Encodes a protein with a putative role in mRNA splicing. The mRNA is cell-to-cell mobile. |
AT3G61600 | POZ/BTB containing-protein AtPOB1. Involvement in protein ubiquitylation is predicted based on physical interaction with CULLIN 3 proteins. The mRNA is cell-to-cell mobile. |
AT5G17070 | Encodes a PP4R2 domain protein that likely functions as a regulatory subunit of PP4, a highly conserved ser/thr protein phosphatase. |
AT3G19670 | Binds the carboxyl-terminal domain (CTD) of the largest subunit of RNA polymerase II and functions as a scaffold for RNA processing machineries. Ubiquitously expressed and localize to the nucleus. |
AT3G19840 | Binds the carboxyl-terminal domain (CTD) of the largest subunit of RNA polymerase II and functions as a scaffold for RNA processing machineries. |
AT4G28460 | Activates immune responses through RECEPTOR-LIKE KINASE7 (RLK7). Induces stomatal closure is dependent on RLK7 and the transcription of genes involved in SA production and SA-dependent stomatal closure. SA promotes the flg22-induced expression of PIP1 preligand, prePIP1. |
AT4G37290 | Encoding a precursor protein of a secreted peptide that is responsive to flg22 stimulus. |
AT2G23270 | Encoding a precursor protein of a secreted peptide that is responsive to flg22 stimulus. Finetuning role in modulation of immunity through the regulation of SA and JA biosynthesis and signalling pathways. |
AT1G49800 | Homolog of PIP1. |
AT5G43066 | Homolog of prePIP1. |
AT5G44585 | Precursor of serine-rich endogenous peptide which regulates defense response and root elongation. Has properties of phytocytokines, activates the phospholipid signaling pathway, regulates reactive oxygen species response, and is perceived in a BAK1 co-receptor-dependent manner. |
AT2G07340 | PREFOLDIN 1;(source:Araport11) |
AT3G22480 | prefoldin 2;(source:Araport11) |
AT5G49510 | prefoldin 3;(source:Araport11) |
AT5G23290 | prefoldin 5;(source:Araport11) |
AT2G40380 | prenylated RAB acceptor 1.B2;(source:Araport11) |
AT1G55640 | prenylated RAB acceptor 1.G1;(source:Araport11) |
AT5G56230 | prenylated RAB acceptor 1.G2;(source:Araport11) |
AT3G19170 | Zinc metalloprotease pitrilysin subfamily A. Signal peptide degrading enzyme targeted to mitochondria and chloroplasts. Expressed only in siliques and flowers |
AT2G28610 | Encodes a homeodomain containing protein that regulates lateral axis-dependent development of Arabidopsis flowers and is required for cell proliferation. It is expressed in a restricted number of L1 cells at the lateral regions of flower primordia, floral organ primordia, and young leaf primordia. |
AT2G01500 | PFS2 encodes a homeodomain gene that is a member of the WUS clade of transcription factors. It delays differentiation and maturation of primordia and regulates ovule patterning. The pfs2 mutant exhibits developmental defects in the maternal integuments and gametophyte, specifically, the boundary between the chalaza and the nucellus shifted towards the distal end of pfs2 ovule primordia. In addition, leaves displayed curling and petals were wavy and crenulated. Overexpression of PFS2 affects floral organ and leaf development. Single- and double-mutant analyses reveal that PFS2 activity represses AGAMOUS expression in young floral primordia. Also involved in regulation of response to low temperature. |
AT5G09520 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G21295 | Pro-Trp-Pro-Trp repeat protein. |
AT4G33500 | Protein phosphatase 2C family protein. Loss of function enhances immunity to bacterial pathogens. |
AT4G28510 | prohibitin 1 (Atphb1) |
AT5G40770 | prohibitin 3 |
AT5G14300 | prohibitin 5;(source:Araport11) |
AT5G44140 | prohibitin 7;(source:Araport11) |
AT2G28625 | Encodes a cytoplasmic protein that genetically interacts with AtRZF1, a RING-type subunit of the E3 ubiquitin ligase family, to mediate proline accumulation in response to abiotic stress. |
AT2G36590 | Encodes a proline transporter with affinity for gly betaine, proline, and GABA. Protein is expressed in leaves, flowers and siliques but to a much lesser extent in roots. |
AT4G32710 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT1G52290 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT3G24400 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT3G18810 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT1G49270 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT1G68690 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT3G62680 | Proline-rich protein The mRNA is cell-to-cell mobile. |
AT4G38770 | Encodes one of four proline-rich proteins in Arabidopsis which are predicted to localize to the cell wall. Transcripts are most abundant in aerial organs of the plant. |
AT2G17720 | Encodes a prolyl 4-hydroxylase that modifies the extensin proteins in root hair cells. |
AT3G62120 | Encodes a cytosolic prolyl-tRNA synthetase. |
AT3G13330 | Encodes a protein that interacts with the 26S proteasome. Mutants are phenotypically indistinguishable from wild type plants under a variety of growth conditions. Protein levels increase upon exposure of seedlings to MG132, a specific, potent, reversible, and cell-permeable proteasome inhibitor. |
AT5G66140 | Encodes alpha5 subunit of 20S proteosome complex involved in protein degradation. |
AT3G53970 | PTRE1 was identified as homologous to human PI31. It has a conserved proline-rich domain at the C-terminus and a highly conserved FP (Fbxo7/PI31) dimerization domain at the N-terminus as well as some novel, conserved domains found only in plants. It regulates auxin signaling possibly via its proteosome suppressing activity. |
AT1G16470 | Encodes 20S proteasome subunit PAB1 (PAB1). |
AT4G22750 | Encodes a protein S-acyltransferase that, together with PAT14, cooperatively regulates leaf senescence. |
AT2G19670 | protein arginine methyltransferase 1A;(source:Araport11) |
AT3G12270 | protein arginine methyltransferase 3;(source:Araport11) |
AT5G49020 | Encodes a type I protein arginine methyltransferase. PRMT4a can catalyze the asymmetric dimethylation of arginines 2,17, and 26 on histone 3 and can also methylate myelin basic protein in vitro. Double mutants lacking PRMT4a and 4b have reduced levels of histone 3 methylated at R17. These double mutants flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts. |
AT3G06930 | Encodes an type I protein arginine methyltransferase. PRMT4b can catalyze the asymmetric dimethylation of arginines 2,17, and 26 on histone 3 and can also methylate myelin basic protein in vitro. Double mutants lacking PRMT4a and 4b have reduced levels of histone 3 methylated at R17. These double mutants flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts. |
AT3G20020 | protein arginine methyltransferase 6;(source:Araport11) |
AT1G55480 | Encodes a member of a novel plant protein family containing a PDZ, a K-box, and a TPR motif. mRNA but not protein levels decrease after wounding. ZKT is phosphorylated at Thr and Ser residues after wounding. The mRNA is cell-to-cell mobile. |
AT1G71140 | MATE transporter that can export the antibiotic norfloxacin. |
AT1G08910 | Encodes an SP-RING domain containing protein that functions in sumolaytion and is involved in positive regulation of sulfur metabolism and stress response. |
AT5G41580 | Encodes an SP-RING domain containing protein that functions in sumolaytion and is involved in positive regulation of sulfur metabolism and stress response. |
AT2G28930 | protein kinase 1B;(source:Araport11) |
AT1G14370 | Encodes protein kinase APK2a. Protein is N-myristoylated. |
AT2G44830 | AGCVIII kinase involved in the pulse-induced first positive phototropism. Plasma-membrane-associated element of a molecular rheostat that modulates auxin flux through developing protophloem sieve elements (PPSEs) while interacting with BRX, thereby timing PPSE differentiation. Activates PIN-mediated auxin efflux. |
AT3G25800 | one of three genes encoding the protein phosphatase 2A regulatory subunit |
AT2G42500 | Encodes one of the isoforms of the catalytic subunit of protein phosphatase 2A: AT1G59830/PP2A-1, AT1G10430/PP2A-2, At2g42500/PP2A-3, At3g58500/PP2A-4 [Plant Molecular Biology (1993) 21:475-485 and (1994) 26:523-528; Note that in more recent publications, there is mixed use of gene names for PP2A-3 and PP2A-4 - some refer to At2g42500 as PP2A-3 and some as PP2A-4]. ACR4 phosphorylates the PROTEIN PHOSPHATASE 2A-3 (PP2A-3) catalytic subunit of the PP2A phosphatase holoenzyme and PP2A dephosphorylates ACR4. |
AT3G58500 | Encodes one of the isoforms of the catalytic subunit of protein phosphatase 2A: AT1G59830/PP2A-1, AT1G10430/PP2A-2, At2g42500/PP2A-3, At3g58500/PP2A-4 [Plant Molecular Biology (1993) 21:475-485 and (1994) 26:523-528; Note that in more recent publications, there is mixed use of gene names for PP2A-3 and PP2A-4 - some refer to At2g42500 as PP2A-3 and some as PP2A-4]. |
AT5G36250 | Encodes a myristoylated 2C-type protein phosphatase that interacts with the catalytic subunit of SnRK1. The mRNA is cell-to-cell mobile. |
AT5G55260 | Encodes a protein with similarity to the catalytic subunit of the mammalian PPX protein phospatase. |
AT5G03420 | Encodes a chloroplast-localized CBM48-containing protein that is involved in starch granule initiation. Mutants lacking PTST3 have fewer starch granules in leaf chloroplasts than the wild type. PTST3 interacts with PTST2, which is also involved in granule initiation. |
AT2G35680 | Encodes a phosphatidylglycerophosphate (PGP) phosphatase involved in the synthesis of plastidial Phosphatidylglycerol (PG) in conjunction with PGPP1 and PTPMT2 in root. PTPMT1 levels were higher in node, cauline leaf, and flower than in root, leaf, and stem. |
AT5G02310 | Encodes PROTEOLYSIS6 (PRT6), a component of the N-end rule pathway that targets protein degradation through the identity of the amino-terminal residue of specific protein substrates. Another component of the N-end rule pathway is arginyl-tRNA:protein arginyltransferase (ATE). Arabidopsis contains two ATE genes: At5g05700/ATE1, At3g11240/ATE2. PRT6 and ATE were shown to regulate seed after-ripening, seedling sugar sensitivity, seedling lipid breakdown, and abscisic acid (ABA) sensitivity of germination. The mRNA is cell-to-cell mobile. |
AT4G04890 | Encodes a homeodomain protein that is expressed in the LI layer of the vegetative, floral and inflorescence meristems. Binds to the L1 box promoter element which is required in some proteins for L1 specific expression. |
AT4G31850 | Encodes a protein containing 27 pentatrico-peptide repeat (PPR) motifs. Functions in the stabilization of petL operon RNA and also in the translation of petL. |
AT3G15340 | Encodes PPI2 (proton pump interactor 2), a homologue of PPI1, a protein that interacts with the plasma membrane H+ ATPase AHA1. |
AT5G66570 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO1 is the major isoform in the wild-type. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the membrane. The mRNA is cell-to-cell mobile. |
AT5G60100 | Encodes pseudo-response regulator 3 (APRR3/PRR3). PRR3 transcript levels vary in a circadian pattern with peak expression at dusk under long and short day conditions. PRR3 affects the period of the circadian clock and seedlings with reduced levels of PRR3 have shorter periods, based on transcriptional assays of clock-regulated genes. PRR3 is expressed in the vasculature of cotyledons and leaves where it may help stabilize the TOC1 protein by preventing interactions between TOC1 and the F-box protein ZTL. |
AT5G24470 | Encodes a pseudo-response regulator whose mutation affects various circadian-associated biological events such as flowering time in the long-day photoperiod conditions, red light sensitivity of seedlings during early photomorphogenesis, and the period of free-running rhythms of certain clock-controlled genes including CCA1 and APRR1/TOC1 in constant white light. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR7 and PRR9 to regulate hypocotyl growth under photoperiodic conditions. |
AT1G68210 | Similar to ARR response regulator proteins that function in two-component signal transduction but lacking a conserved D-D-K motif in the receiver domain |
AT1G34320 | Ikzf5 (DUF668);(source:Araport11) |
AT1G72300 | Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of PSY1. PSY1 is an 18-aa tyrosine-sulfated glycopeptide encoded by AT5G58650 that promotes cellular proliferation and expansion. |
AT3G50110 | Encodes a phosphatase with low in vitro tyrosine phosphatase activity that is NOT capable of dephosphorylating in vitro the 3'phosphate group of PI3P, PI(3,4)P2. |
AT1G35750 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT4G08840 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT5G43110 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT4G08560 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT5G09610 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT1G72320 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT1G78160 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT1G22240 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT2G32080 | similar to the conserved animal nuclear protein PUR alpha which was implicated in the control of gene transcription and DNA replication |
AT4G18210 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. The mRNA is cell-to-cell mobile. |
AT1G19770 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. The mRNA is cell-to-cell mobile. |
AT1G57990 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
AT1G28220 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
AT4G18195 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
AT2G16430 | Encodes an acid phosphatase involved plant acclimation to Pi deprivation. |
AT2G18130 | purple acid phosphatase 11;(source:Araport11) |
AT2G32770 | purple acid phosphatase 13;(source:Araport11) |
AT4G36350 | purple acid phosphatase 25;(source:Araport11) |
AT5G57140 | purple acid phosphatase 28;(source:Araport11) |
AT1G14700 | purple acid phosphatase 3;(source:Araport11) |
AT1G52940 | Encodes a purple acid phosphatase that is induced under prolonged phosphate (Pi) starvation and is required for maintaining basal resistance against Pseudomonas syringae and Botrytis cinerea. |
AT2G01890 | Encodes a purple acid phosphatase (PAP) belonging to the low molecular weight plant PAP group. |
AT3G22330 | DEAD-box protein required for efficient group II intron splicing in mitochondria. |
AT5G36150 | putative pentacyclic triterpene synthase 3;(source:Araport11) |
AT3G24160 | Encodes a putative Type 1 membrane protein (PMP). |
AT5G40340 | PWWP domain protein involved in regulation of FLC and flowering time. |
AT3G27860 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
AT5G01890 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
AT2G41820 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G18620 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
AT4G17870 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
AT5G05440 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
AT5G53580 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT5G49970 | encodes the bifunctional pyridoxine (pyridoxamine) 5?-phosphate oxidase (PPOX)(EC 1.4.3.5) that is involved in the formation of pyridoxal 5'-phosphate (member of the vitamin B6 group). NAD(P)HX epimerase (AT5G49970) interconverts the two epimers of NAD(P)HX. |
AT3G16050 | Encodes a protein with pyridoxal phosphate synthase activity whose transcripts were detected mostly in roots and accumulate during senescence. The protein was found in very low abundance, which prevented a specific localisation. |
AT4G22930 | Encodes dihydroorotase (PYR4). |
AT3G08860 | Encodes a protein that is predicted to have beta-alanine aminotransferase activity. |
AT5G23300 | dihydroorotate dehydrogenase, catalyses fourth step of pyrimidine biosynthesis |
AT3G53620 | Encodes a soluble protein with inorganic pyrophosphatase activity that is highly specific for Mg-inorganic pyrophosphate. The mRNA is cell-to-cell mobile. |
AT5G09650 | Encodes a protein with inorganic pyrophosphatase activity. |
AT5G14800 | Delta 1-pyrroline-5-carboxylate reductase, catalyzes the final step in proline biosynthesis from glutamate and ornithine.In situ hybridization indicated that under normal growth conditions, the highest concentration of P5CR transcripts occurs in the cortical parenchyma, phloem, vascular cambium and pith parenchyma in the vicinity of the protoxylem. Single gene in Arabidopsis. |
AT5G01330 | pyruvate decarboxylase |
AT1G01090 | pyruvate dehydrogenase E1 alpha subunit |
AT3G06483 | Pyruvate dehydrogenase kinase (PDK) specifically phosphorylates the E1α subunit of the pyruvate dehydrogenase complex (PDC) on a Ser residue using ATP as a phosphate donor. PDK is a unique type of protein kinase having a His-kinase-like sequence but Ser-kinase activity. Site-directed mutagenesis and structural analysis indicate that PDK belongs to the GHKL superfamily. |
AT3G07970 | Required for pollen separation during normal development. In qrt mutants, the outer walls of the four meiotic products of the pollen mother cell are fused, and pollen grains are released in tetrads.May be required for cell type-specific pectin degradation. |
AT4G20050 | Encodes a polygalacturonase that plays a direct role in degrading the pollen mother cell wall during microspore development. |
AT4G21800 | Encodes QQT2. Required for early embryo development. qqt1 mutant lines are embryo-defective. Participates in the organization of microtubules during cell division. Interacts with QQT1 (encoded by AT5G22370). |
AT2G01350 | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli. |
AT5G50210 | Encodes an Fe-S binding protein with quinolinate synthase (QS) activity and cysteine desulfurase activator activity. The QS activity was demonstrated by functional complementation of corresponding E. coli mutants and complementation of embryo-lethal phenotypes of the QS homozygous null allele in Arabidopsis. The SufE domain of the protein also stimulates the cysteine desulfurase activity of CpNifS (AT1G08490) in vitro. This protein binds a (4Fe-Su)2+ cluster in its NadA domain and is localized in the chloroplast. |
AT1G74720 | Encodes a putative transmembrane protein carrying four C(2) domains, suggesting that QKY may function in membrane trafficking in a Ca(2+)-dependent fashion. Mutant analysis shows that this gene is involved in organ development. |
AT3G06540 | Encodes a cytoplasmic Rab escort protein that preferentially binds the GDP-bound form of Rab and stimulates geranylgeranylation of various Rab GTPases in Arabidopsis extracts in vitro. |
AT5G09550 | GDP dissociation inhibitor family protein / Rab GTPase activator family protein;(source:Araport11) |
AT4G24490 | RAB geranylgeranyl transferase alpha subunit 1;(source:Araport11) |
AT5G12210 | RAB geranylgeranyl transferase beta subunit 1;(source:Araport11) |
AT3G12070 | RAB geranylgeranyl transferase beta subunit 2;(source:Araport11) |
AT1G09630 | Encodes a putative GTP-binding protein. Associates with organelles on a pathway from the Golgi to the plasma membrane in interphase. In dividing cells acts at the cell plate. |
AT1G49300 | encodes a small GTPase involved in membrane trafficking. Gene expression is induced by hydrogen peroxide and lines. Lines overexpressing the gene are more tolerant to high salt and hyperosmotic conditions. |
AT4G17530 | AtRabD2c encodes a Rab GTPase, which plays important roles in pollen development, germination and tube elongation. |
AT2G21880 | RAB GTPase homolog 7A;(source:Araport11) |
AT5G03520 | GTPase that colocalizes with golgi and plasma membranes. |
AT5G45750 | RAB GTPase homolog A1C;(source:Araport11) |
AT4G18800 | Encodes RabA1d, a member of the RabA subfamily of small Rab GTPases. |
AT5G60860 | RAB GTPase homolog A1F;(source:Araport11) |
AT2G33870 | RAB GTPase homolog A1H;(source:Araport11) |
AT1G28550 | RAB GTPase homolog A1I;(source:Araport11) |
AT1G07410 | RAB GTPase homolog A2B;(source:Araport11) |
AT3G46830 | RAB GTPase homolog A2C;(source:Araport11) |
AT5G59150 | RAB GTPase homolog A2D;(source:Araport11) |
AT5G47520 | RAB GTPase homolog A5A;(source:Araport11) |
AT3G07410 | RAB GTPase homolog A5B;(source:Araport11) |
AT1G73640 | RAB GTPase homolog A6A;(source:Araport11) |
AT3G09910 | RAB GTPase homolog C2B;(source:Araport11) |
AT3G18820 | RAB7 homolog, forms retromer complex with VPS35; ES17 prevents the retromer complex to endosome anchoring, resulting in retention of RABG3f. The interaction of RABG3f?VPS35 functinons as a checkpoint in the control of traffic toward the vacuole. |
AT5G64990 | RAB GTPase homolog H1A;(source:Araport11) |
AT4G39890 | RAB GTPase homolog H1C;(source:Araport11) |
AT5G10260 | RAB GTPase homolog H1E;(source:Araport11) |
AT5G45130 | small GTP binding protein The mRNA is cell-to-cell mobile. |
AT5G62880 | ROP (Rho of plant GTPases) family member involved in cell wall patterning. Locally activated to form plasma membrane domains, which direct formation of cell wall pits in metaxylem vessel cells through interaction with cortical microtubules. Pattern formation of cell wall pits is governed by ROP activation via a reaction-difusion mechanism. Patterning involves active ROP1 recruiting BDR1 to the plasma membrane in pit regions. BRD1 in turn recruits the actin binding protein WAL. |
AT1G75840 | Belongs to the plant-specific ROP group of Rho GTPases; localized to the plasma membrane of tips of root hairs; involved in polar growth control. The mRNA is cell-to-cell mobile. |
AT4G39250 | RAD-like 1;(source:Araport11) |
AT1G19510 | RAD-like 5;(source:Araport11) |
AT1G75250 | RAD-like 6;(source:Araport11) |
AT1G71310 | A protein coding gene with unknown function. The 5? UTR and the first two exons and introns of this gene overlap with a RNA coding gene TER1. TER1 (GenBank accession no. HQ401284) encodes a putative template sequence (5′-CTAAACCCTA-3′) corresponding to 1.5 copies of the Arabidopsis telomere repeat (PNAS 2011, 108:73-78). |
AT4G15475 | Contributes to UV tolerance through nucleotide excision repair. |
AT3G02540 | Encodes a member of the RADIATION SENSITIVE23 (RAD23) family: AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome. |
AT1G32230 | Encodes a protein belonging to the (ADP-ribosyl)transferase domain-containing subfamily of WWE protein-protein interaction domain protein family. Superoxide radicals are necessary and sufficient to propagate cell death or lesion formation in rcd1 mutants. Without stress treatment, RCD1 is localized in the nucleus. Under high salt or oxidative stress, RCD1 is found not only in the nucleus but also in the cytoplasm. The mRNA is cell-to-cell mobile. |
AT5G27920 | Encodes a nuclear F-box protein that can directly interact with the C2H2‐type zinc finger transcription factor STOP1 and promote its ubiquitination and degradation. STOP1 is crucial for aluminum (Al) resistance. |
AT4G31170 | Protein kinase superfamily protein;(source:Araport11) |
AT3G46930 | Encodes a Raf-Like Mitogen-Activated Protein Kinase Kinase Kinase Raf43. Required for tolerance to multiple abiotic stresses. |
AT2G34825 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT3G04735 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT3G23805 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT3G29780 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT1G60625 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT1G60815 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT5G55190 | A member of RAN GTPase gene family. Encodes a small soluble GTP-binding protein. Likely to be involved in nuclear translocation of proteins. May also be involved in cell cycle progression. Role in seed and endosperm development. |
AT5G19320 | Encodes RAN GTPase activating protein 2. The protein is localized to the nuclear envelope during interphase. |
AT1G02900 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. Mediates Ca2+-dependent signaling. Regulates the splicing of flowering genes and exerts an opposite effect on the flowering time compared with FER. |
AT5G01770 | Encodes one of two Arabidopsis RAPTOR/KOG1 homologs. RAPTOR proteins are binding partners of the target of rapamycin kinase that is present in all eukaryotes and play a central role in the stimulation of cell growth and metabolism in response to nutrients. Mutations in this gene have no visible effects on embryo or plant development. |
AT1G05260 | Encodes a cold-inducible cationic peroxidase that is involved in the stress response. In response to low temperature, RCI3 transcripts accumulate in the aerial part and in roots of etiolated seedlings but only in roots of light-grown seedlings. The mRNA is cell-to-cell mobile. |
AT3G05880 | Induced by low temperatures, dehydration and salt stress and ABA. Encodes a small (54 amino acids), highly hydrophobic protein that bears two potential transmembrane domains. |
AT2G45280 | Encodes a protein similar to RAD51C involved in double stranded break repair via homologous recombination. Sensitive to DSB induced by Mitomycin C and gamma irradiation, interacts with Atxrcc3 in yeast two-hybrid assay. Required for female meiosis but not critical for mitosis under normal conditions. |
AT5G55080 | A member of RAN GTPase gene family. |
AT5G08710 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT3G20390 | Encodes a plastidial RidA (Reactive Intermediate Deaminase A) homolog that hydrolyzes the enamines/imines formed by Thr dehydratase from Ser or Thr. RidA accelerates the deamination of reactive enamine/imine intermediates produced by threonine dehydratase (At3g10050) with threonine or serine as substrates. In the absence of RidA, the serine-derived imine inactivates BCAT3 (At3g49680). RidA thus pre-empts damage to BCAT3 by hydrolyzing the reactive imine before it does damage. |
AT3G55510 | Encodes a regulator of floral determinacy in that interacts with both nucleolar and nucleoplasmic proteins. |
AT3G18130 | Encodes a protein with similarity to mammalian RACKs. RACKs function to shuttle activated protein kinase C to different subcellular sites and may also function as a scaffold through physical interactions with other proteins. RACK1C has no phenotype on its own and probably acts redundantly with RACK1A and RACK1B. |
AT4G21380 | encodes a putative receptor-like serine/threonine protein kinases that is similar to Brassica self-incompatibility (S) locus. Expressed in root. Shoot expression limited to limited to the root-hypocotyl transition zone and at the base of lateral roots as well as in axillary buds, and pedicels. |
AT1G71390 | receptor like protein 11;(source:Araport11) |
AT1G71400 | Encodes a CLAVATA2 (CLV2)-related gene. Complements the clv2 mutant when expressed under the control of the CLV2 promoter. The mRNA is cell-to-cell mobile. |
AT1G74170 | receptor like protein 13;(source:Araport11) |
AT1G74180 | receptor like protein 14;(source:Araport11) |
AT1G74190 | receptor like protein 15;(source:Araport11) |
AT1G74200 | receptor like protein 16;(source:Araport11) |
AT2G25440 | receptor like protein 20;(source:Araport11) |
AT2G32660 | receptor like protein 22;(source:Araport11) |
AT2G33030 | receptor like protein 25;(source:Araport11) |
AT2G33060 | receptor like protein 27;(source:Araport11) |
AT2G42800 | receptor like protein 29;(source:Araport11) |
AT3G05360 | receptor like protein 30;(source:Araport11) |
AT1G28340 | receptor like protein 4;(source:Araport11) |
AT4G13900 | pseudogene of receptor like protein 47;(source:Araport11) |
AT5G45770 | receptor like protein 55;(source:Araport11) |
AT5G65830 | receptor like protein 57;(source:Araport11) |
AT1G45616 | receptor like protein 6;(source:Araport11) |
AT1G47890 | receptor like protein 7;(source:Araport11) |
AT2G18890 | RLCK VI_A class kinase which activity is regulated by Rho-of-plants (ROP) GTPases. Controls seedling and plant growth in parallel with gibberrellin. |
AT3G17840 | Encodes a receptor-like kinase found at the cell surface of various tissues. Its function remains unknown. |
AT1G29750 | Receptor-like serine/threonine kinase (RKF1). The putative extracellular domain of the RKF1 protein contains 13 tandem repeats of leucine-rich sequences. Expressed in early flower primordial, stamen, and pollen grains. |
AT1G69270 | RPK1 is a leucine-rich receptor-like kinase located in the plasma membrane which is upregulated by abscisic acid, dehydration, high salt, low temperature, but not by other plant hormones. RPK1 knock-out and antisense plants show an ABA-insensitive phenotype. RPK1 plays a role in ABA-controlled cell proliferation and is a regulator of the ABA signal transduction pathway. Overexpression of the LRR domain has a dominant negative effect on RPK1. Mutations in RPK1 uncouple cotyledon anlagen and primordia by modulating epidermal cell shape and polarity. |
AT3G02130 | Encodes a receptor-like kinase RPK2 (also known as TOADSTOOL 2/TOAD2). Functions as a regulator of meristem maintenance. Mutants are insensitive to synthetic CLV3 peptide. Mutations in the RPK2 also result in stem cell expansion and increased number of floral organs, as seen in the other clv mutants. Forms homo-oligomers. |
AT4G16860 | Confers resistance to Peronospora parasitica. RPP4 is coordinately regulated by transcriptional activation and RNA silencing. |
AT1G58602 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
AT1G31360 | Encodes a (d)NTP-dependent 3'->5' DNA helicase. This protein can also disrupt D loop structures and may mediate branch migration of Holliday junctions when tested in vitro. The unwinding activity of the enzyme depends on the presence of divalent cations (Mg2+, Mn2+, or Ca2+, but not Zn2+).(d)NTPs are also required with ATP and dATP supporting the greatest amount of DNA unwinding in vitro. |
AT1G60930 | AtRECQ4B mutant showed no sensitivity to DNA damaging agents.Involved in homologous recombination. |
AT1G70630 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
AT1G01320 | Encodes REDUCED CHLOROPLAST COVERAGE 1 (REC1) a protein with similarity to the FLOURY locus in maize. Located in the nucleus and cytosol. Contributes to establishing the size of the chloroplast compartment. |
AT1G15290 | Encodes REDUCED CHLOROPLAST COVERAGE 3 (REC3). Contributes to establishing the size of the chloroplast compartment. |
AT4G11040 | Encodes a nuclear localized protein with sequence similarity to PP2C phosphatases that is involved in seed dormancy. Loss of function mutations have reduced seed dormancy but does not act through ABA or DOG1 pathways. Lacks several conserved key residues and does not possess any appreciable phosphatase activity in in vitro assays. QTL allele with a nonsynonymous amino acid change confers seed dormancy phenotype. |
AT4G04340 | Encodes a plasma membrane localized hyperosmolality gated calcium channel that is expressed in guard cells and roots. |
AT3G61730 | Encodes a nuclear localized F-box protein that is involved in tapetal layer degeneration and pollen development. Interacts with ASK1 and that interaction is mediated by the F-box domain. |
AT3G15820 | Functions as phosphatidylcholine:diacylglycerol cholinephosphotransferase, a major reaction for the transfer of 18:1 into phosphatidylcholine for desaturation and also for the reverse transfer of 18:2 and 18:3 into the triacylglycerols synthesis pathway |
AT3G06550 | Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Mutants show reduced cell wall polysaccharide acetylation and increased resistance to Botrytis cinerea. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. |
AT2G34410 | Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Has high similarity to RWA2 whose mutant displays reduced acetylation. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. |
AT2G36890 | Putative homolog of the Blind gene in tomato. Together with RAX1 and RAX3 belong to the class R2R3 MYB genes; encoded by the Myb-like transcription factor MYB38, regulates axillary meristem formation. The mRNA is cell-to-cell mobile. |
AT3G17170 | Translation elongation factor EF1B/ribosomal protein S6 family protein;(source:Araport11) |
AT5G53160 | Encodes RCAR3, a regulatory component of ABA receptor. Interacts with protein phosphatase 2Cs ABI1 and ABI2. Stimulates ABA signaling. The mRNA is cell-to-cell mobile. |
AT4G29040 | RPT2a encodes the 26S proteasome subunit. It is required for root meristem maintenance, and regulates gametogenesis. RPT2a is also shown to regulate gene silencing via DNA methylation. |
AT3G05530 | Encodes RPT5a (Regulatory Particle 5a), one of the six AAA-ATPases of the proteasome regulatory particle. Essential for gametophyte development. In Arabidopsis, the RPT5 subunit is encoded by two highly homologous genes, RPT5a and RPT5b. RPT5a and RPT5b show accession-dependent functional redundancy. In Wassilewskija (Ws) accession: mutant alleles of RPT5a displayed 50% pollen lethality, indicating that RPT5a is essential for male gametophyte development. In the Columbia (Col) accession, a rpt5a mutant allele did not display such a phenotype because the RPT5b Col allele complements the rpt5a defect in the male gametophyte, whereas the RPT5b Ws allele does not. Double rpt5a rpt5b mutants in Col background showed a complete male and female gametophyte lethal phenotype. The mRNA is cell-to-cell mobile. |
AT1G13260 | Encodes an AP2/B3 domain transcription factor which is upregulated in response to low temperature. It contains a B3 DNA binding domain. It has circadian regulation and may function as a negative growth regulator. The mRNA is cell-to-cell mobile. |
AT1G68840 | Rav2 is part of a complex that has been named `regulator of the (H+)-ATPase of the vacuolar and endosomal membranes' (RAVE) The mRNA is cell-to-cell mobile. |
AT5G19790 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family (RAP2.11). The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT1G78080 | Encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family (RAP2.4). The protein contains one AP2 domain. Role in mediating light and ethylene signaling. The mRNA is cell-to-cell mobile. |
AT5G13330 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
AT1G49480 | Encodes a nuclear-localized DNA-binding protein that interacts with ITN1 at the PM and nuclei in vivo and may regulate ITN's subcellular localization. |
AT3G48430 | Relative of Early Flowering 6 (REF6) encodes a Jumonji N/C and zinc finger domain-containing protein that acts as a positive regulator of flowering in an FLC-dependent pathway. REF6 mutants have hyperacetylation of histone H4 at the FLC locus. REF6 interacts with BES1 in a Y2H assay and in vitro. REF6 may play a role in brassinoteroid signaling by affecting histone methylation in the promoters of BR-responsive genes. It is most closely related to the JHDM3 subfamily of JmjN/C proteins. The mRNA is cell-to-cell mobile. |
AT2G45820 | Lipid raft regulatory protein, crucial for plasma membrane nanodomain assembly to control plasmodesmata aperture and functionality. |
AT3G57540 | Remorin family protein;(source:Araport11) |
AT1G77470 | Encodes a protein with high homology to the Replication Factor C, Subunit 3 (RFC3) of yeast and other eukaryotes. rfc3 mutants are hypersensitive to salicylic acid and exhibit enhanced induction of PR genes and resistance against virulent oomycete Hyaloperonospora arabidopsidis Noco2. The enhanced pathogen resistance in the mutant is NPR1-independent. |
AT3G52630 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT5G02030 | Mutant has additional lateral organs and phyllotaxy defect. Encodes a homeodomain transcription factor. Has sequence similarity to the Arabidopsis ovule development regulator Bell1. Binds directly to the AGAMOUS cis-regulatory element. Its localization to the nucleus is dependent on the coexpression of either STM or BP. |
AT2G01570 | Member of the VHIID/DELLA regulatory family. Contains homopolymeric serine and threonine residues, a putative nuclear localization signal, leucine heptad repeats, and an LXXLL motif. Putative transcriptional regulator repressing the gibberellin response and integration of phytohormone signalling. DELLAs repress cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. RGA1 binds to PIF3 and inhibits its DNA binding activity and thus affects the expression of PIF3 regulated genes. RGA may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. Involved in fruit and flower development. |
AT5G58130 | Encodes ROS3 (repressor of silencing 3), a RNA-binding protein required for DNA demethylation. |
AT5G23730 | Encodes REPRESSOR OF UV-B PHOTOMORPHOGENESIS 2 (RUP2). Functions as a repressor of UV-B signaling. |
AT5G09780 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
AT4G31610 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. Expressed specifically in reproductive meristems. |
AT4G31615 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
AT4G31620 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
AT4G15720 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G62270 | BOR2 is involved in efficient borate crosslinking of rhamnogalacturonan II in cell walls under boron limitation. |
AT1G74810 | HCO3- transporter family;(source:Araport11) |
AT2G44420 | protein N-terminal asparagine amidohydrolase family protein;(source:Araport11) |
AT4G11170 | Encodes RMG1 (Resistance Methylated Gene 1), a NB-LRR disease resistance protein with a Toll/interleukin-1 receptor (TIR) domain at its N terminus. RMG1 is expressed at high levels in response to flg22 and in naive met1/nrpd2 relative to wild-type plants. Expression of this gene is controlled by DNA methylation in its promoter region. The RMG1 promoter region is constitutively demethylated by active DNA demethylation mediated by the DNA glycosylase ROS1. |
AT5G43730 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
AT1G11330 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT3G03710 | Encodes a chloroplast polynucleotide phosphorylase (PNPase). Involved in response to phosphorus (P) starvation. Mutants impaired in the expression of this gene have been selected through their resistance to fosmidomycin, a strong inhibitor of DXR, an enzyme of the methylerythritol-dependent IPP biosynthesis pathway. The pathway enzymes were upregulated in the mutant seedlings. |
AT4G26090 | Encodes a plasma membrane protein with leucine-rich repeat, leucine zipper, and P loop domains that confers resistance to Pseudomonas syringae infection by interacting with the avirulence gene avrRpt2. RPS2 protein interacts directly with plasma membrane associated protein RIN4 and this interaction is disrupted by avrRpt2. The mRNA is cell-to-cell mobile. |
AT5G45250 | RPS4 belongs to the Toll/interleukin-1 receptor (TIR)-nucleotide binding site (NBS)-Leu-rich repeat (LRR) class of disease resistance (R ) genes. Confers specific resistance to Pseudomonas syringae pv. tomato carrying the avirulence gene AvrRPS4. Produces alternative transcripts with truncated open reading frames. |
AT5G43930 | Encodes a WD40 repeat domain-containing protein which negatively regulates plant resistance to Phytophthoravpathogens by modulating the biosynthesis of endogenous jasmonic acid and salicylic acid. |
AT1G09090 | NADPH-oxidase AtrbohB plays a role in seed after-ripening. Major producer of superoxide in germinating seeds. AtrbohB pre-mRNA is alternatively spliced in seeds in a hormonally and developmentally regulated manner. ABA caused accumulation of AtrbohB-? mRNA and prevented prevented AtrbohB-a mRNA expression in fresh seeds. |
AT3G45810 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
AT3G16857 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
AT4G31920 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
AT2G27070 | member of Response Regulator: B- Type |
AT5G07210 | member of Response Regulator: B- Type |
AT5G62120 | member of Response Regulator: B- Type |
AT5G26594 | Encodes an atypical subtype of the ARR (Arabidopsis response regulator) protein family . It appears to be expressed in floral buds, mature flowers, and pollen. But, unlike the related ARR22 protein, it does not appear to be expressed at the seed:funiculus junction. |
AT1G59940 | Type A response regulator highly similar to bacterial two-component response regulators. Rapidly induced by cytokinin. Involved in red-light signaling. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
AT1G10470 | Encodes a two-component response regulator. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
AT3G49580 | response to low sulfur 1;(source:Araport11) |
AT3G49570 | response to low sulfur 3;(source:Araport11) |
AT5G65950 | TRAPPIII complex protein which regulates TGN integrity, by altered TGN/EE association of several residents, including SYNTAXIN OF PLANTS 61 (SYP61), and altered vesicle morphology. Involved in regulation of endosomal function and salt stress response. |
AT1G47128 | Cysteine proteinase precursor-like protein/ dehydration stress-responsive gene (RD21). Has been shown to have peptide ligase activity and protease activity in vitro. RD21 is involved in immunity to the necrotrophic fungal pathogen Botrytis cinerea.Activity detected in root, leaf, flower and cell culture. |
AT4G27410 | Encodes a NAC transcription factor induced in response to desiccation. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response. |
AT2G37180 | a member of the plasma membrane intrinsic protein PIP2. functions as aquaporin and is involved in desiccation. |
AT5G44790 | ATP dependent copper transporter vital for ethylene response pathway |
AT5G48310 | Protein of unknown function that may be involved in stress response. Strongly expressed in vascular tissues.Mutants are ABA- insensitive. |
AT1G05760 | Specifically restrict the long-distance movement of tobacco etch potyvirus (TEV) without involving either hypersensitive cell death or systemic acquired resistance |
AT3G27670 | A novel protein, did not show high similarity to any protein of known function; reveals a novel genetic connection between lipid synthesis and embryo development. Expressed in all tissues examined including leaves, flowers, roots, stems, and siliques, but accumulation levels were not correlated with the degree to which different organs appeared affected by the mutation. Mutant plants showed alterations in the cuticular wax profiles and embryo development. The mRNA is cell-to-cell mobile. |
AT2G41945 | Encodes a novel protein found only in plants. RED1 has two isoforms RED1.1 and RED1.2. It is localized to the nucleus. Loss of function mutants are embryo lethal but can be rescued before desiccation by embryo culture. |
AT1G49770 | Encodes a member of the basic helix loop helix family of transcription factors. Loss of RGE1 function causes shriveled seeds that contain small embryos. The cuticle in the embryos does not develop normally, possible due to the adeherence of the endosperm to the developing embryo. RGE1 is expressed in the endosperm surrounding region which directly surrounds the developing embryo, however it exerts its effect non autonomously- in the developing embryo. Mutant seedlings are extremely sensitive to desiccation due to the abnormal cuticle. Together with ICE1, ZOU determines primary seed dormancy depth independently of their joint role in endosperm development. |
AT1G64090 | Reticulan like protein B3;(source:Araport11) |
AT2G46170 | Reticulon family protein;(source:Araport11) |
AT3G61560 | Reticulon family protein;(source:Araport11) |
AT3G12280 | Encodes a retinoblastoma homologue RETINOBLASTOMA-RELATED protein (RBR or RBR1). RBR controls nuclear proliferation in the female gametophyte. Also required for correct differentiation of male gametophytic cell types. Regulates stem cell maintenance in Arabidopsis roots. Involved in the determination of cell cycle arrest in G1 phase after sucrose starvation. RBR1 is also involved in regulation of imprinted genes. Together with MSI1 it represses the expression of MET1. This in turn activates expression of the imprinted genes FIS2 and FWA. Functions as a positive regulator of the developmental switch from embryonic heterotrophic growth to autotrophic growth.ChIP studies indicate that one class of targets of RBR1 are transposable elements. |
AT5G17300 | Myb-like transcription factor that regulates hypocotyl growth by regulating free auxin levels in a time-of-day specific manner. |
AT4G01280 | RVE5 is one of eleven homologous MYB-like transcription factors in Arabidopsis and a member of the RVE8 clade. Plays a minor role in clock regulation. |
AT5G52660 | Encodes RVE6, a homolog of the circadian rhythm regulator RVE8. rve4 rve6 rve8 triple mutants display an extremely long circadian period, with delayed and reduced expression of evening-phased clock genes. |
AT2G26670 | Encodes a plastid heme oxygenase necessary for phytochrome chromophore biosynthesis and for coupling the expression of some nuclear genes to the functional state of the chloroplast. |
AT5G15650 | RGP2 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1(at3g02230)/rgp2 double mutants have a male gametophyte lethal phenotype. RGP2 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. RGP2 was originally identified as Reversibly Glycosylated Polypeptide-2. Constitutive expression in tobacco impairs plant development and virus spread. |
AT2G26070 | Encodes a predicted membrane protein. Similar sequences are widely distributed and conserved in plants, animals and protists but absent in fungi and prokaryotes. The sequence has no known motifs and no biological function has been assigned in any species. In Arabidopsis, it appears to be involved in the negative regulation of the response to ethylene, is localized to the Golgi and is a positive regulator of ETR1. |
AT5G60690 | REVOLUTA regulates meristem initiation at lateral positions. a member of a small homeodomain-leucine zipper family. Has overlapping functions with PHAVOLUTA and PHABULOSA. The mRNA is cell-to-cell mobile. |
AT1G14020 | O-fucosyltransferase family protein;(source:Araport11) |
AT4G09730 | Encodes RH39, a DEAD-box protein involved in the introduction of the hidden break into the 23S rRNA in the chloroplasts. Recombinant RH39 binds to the 23S rRNA in a segment adjacent to the stem-loop creating the hidden break target loop in a sequence-dependent manner. Has ATP-hydrolyzing activity at a Kcat of 5.3 /min in the presence of rRNA sequence. Mutants have drastically reduced level of level of ribulose 1,5-bisphosphate carboxylase/oxygenase. The mRNA is cell-to-cell mobile. |
AT2G22620 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
AT1G56550 | Encodes a rhamnogalacturonan II specific xylosyltransferase. |
AT5G45160 | Root hair defective 3 GTP-binding protein (RHD3);(source:Araport11) |
AT3G51300 | Encodes a pollen-specific Rop GTPase, member of the Rho family of small GTP binding proteins that interacts with RIC3 and RIC4 to control tip growth in pollen tubes. These three proteins promote the proper targeting of exocytic vesicles in the pollen tube tip. ROP1 activity is regulated by the REN1 GTPase activator protein. |
AT3G48040 | Encodes a member of the Rop subfamily of Rho GTPases in Arabidopsis that contains a putative farnesylation motif. It is localized to the plasma membrane and involved in the negative regulation of ABA signalling. |
AT1G18600 | Mitochondrion-located rhomboid-like protein |
AT3G58460 | RHOMBOID-like protein 15;(source:Araport11) |
AT4G23070 | RHOMBOID-like protein 7;(source:Araport11) |
AT2G39780 | Encodes the main endoribonuclease activity in plant cells and localizes to the endoplasmic reticulum (ER), ER-derived structures, and vacuoles. It is essential for normal ribosomal RNA recycling. The mRNA is cell-to-cell mobile. |
AT1G26820 | Encodes ribonuclease RNS3. |
AT3G23580 | Encodes one of the 3 ribonucleotide reductase (RNR) small subunit genes (RNR2A). Functionally redundant with the ribonucleotide reductase TSO2. mRNA was shown to specifically accumulate during the S-phase of the cell cycle in synchronized tobacco BY2 cells. Critical for cell cycle progression, DNA damage repair and plant development. |
AT4G36680 | Ribosomal pentatricopeptide repeat protein |
AT1G43170 | Encodes a cytoplasmic ribosomal protein. The mRNA is cell-to-cell mobile. |
AT3G25920 | encodes a plastid ribosomal protein CL15, a constituent of the large subunit of the ribosomal complex |
AT3G05590 | Encodes cytoplasmic ribosomal protein L18. |
AT3G55280 | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA and functionally redundant to it. |
AT3G17465 | encodes a putative L3 ribosomal protein targeted to the plastid. |
AT1G69620 | putative 60S ribosomal protein L34 The mRNA is cell-to-cell mobile. |
AT2G37600 | cytosolic ribosomal protein gene, part of eL36 familyl |
AT3G44590 | cytosolic ribosomal protein gene, part of bL12 family |
AT5G30510 | ribosomal protein S1;(source:Araport11) |
AT3G22300 | Nuclear-encoded gene for mitochondrial ribosomal small subunit protein S10 |
AT5G23740 | Encodes a putative ribosomal protein S11 (RPS11-beta). |
AT5G47320 | Nuclear encoded mitochondrial ribosome subunit. The mRNA is cell-to-cell mobile. |
AT3G56340 | Small ribosomal subunit protein. |
AT5G64140 | Encodes a putative ribosomal protein S28. |
AT4G31700 | Encodes a putative ribosomal protein S6 (rps6a). RPS6A and RPS6B are fully redundant and essential during gametogenesis. |
AT3G11964 | Encodes a nucleolar protein that is a ribosome biogenesis co-factor. Mutants display aberrant RNA processing and female gametophyte development. |
AT5G13430 | Rieske FeS protein.Ubiquinol-cytochrome C reductase iron-sulfur subunit;(source:Araport11) |
AT5G44280 | Encodes a nuclear localized protein with similarity to animal polycomb repressive core complex1 (PRC1) core component RING.Appears to function redundantly with ATRING1b, a close paralog. Both interact physically with CLF and LHP1 and appear to function together to repress class I KNOX gene expression. |
AT1G03770 | Encodes a nuclear localized protein with similarity to animal polycomb repressive core complex1 (PRC1) core component RING.Appears to function redundantly with ATRING1a, a close paralog. Both interact physically with CLF and LHP1 and appear to function together to repress class I KNOX gene expression. |
AT3G43750 | E3 ubiquitin ligases, member of the RING between RING fingers (RBR)-type RSL1/RFA family, are key regulators of ABA receptor stability in root and leaf tissues, targeting ABA receptors for degradation in different subcellular locations. |
AT3G45570 | RING/U-box protein with C6HC-type zinc finger domain-containing protein;(source:Araport11) |
AT3G45580 | RING/U-box protein with C6HC-type zinc finger;(source:Araport11) |
AT3G45480 | RING/U-box protein with C6HC-type zinc finger;(source:Araport11) |
AT3G45460 | IBR domain containing protein;(source:Araport11) |
AT3G45540 | RING/U-box protein with C6HC-type zinc finger;(source:Araport11) |
AT2G26130 | Encodes a RING-type zinc finger ubiquitin ligase involved in seed longevity.Gain of function (35S promoter) increases, and loss of function decreases, seed longevity. |
AT3G56580 | Encodes a functional E3 ubiquitin ligase involved in the dehydration stress response and regulation of proline biosynthesis. |
AT2G01735 | encodes a RING-H2 zinc finger protein essential for seed development. |
AT4G11370 | Encodes a putative RING-H2 finger protein RHA1a. |
AT1G15100 | Encodes a putative RING-H2 finger protein RHA2a. |
AT4G35480 | Encodes a putative RING-H2 finger protein RHA3b. |
AT2G01150 | Encodes a RING-H2 finger protein that is expressed in vascular tissue, root tips, embryos and pistils. |
AT5G44180 | Interacts with CHR11, CHR17, and ARID5, several known subunits of ISWI. JA biosynthesisis is positively regulated by this chromatin remodeling complex, thereby promoting stamen filament elongation. |
AT1G29730 | Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth. |
AT1G29740 | Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth. |
AT5G65900 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT1G80670 | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
AT2G40700 | DEAD-box helicase family protein. Overexpression confers tolerance to salt stress. |
AT5G05450 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G63120 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G14610 | DEAD box RNA helicase family protein;(source:Araport11) |
AT3G09720 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G45810 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT5G60990 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT2G41340 | NRPE5-like protein of unknown function; homologous to budding yeast RPB5 |
AT1G62670 | Encodes a pentatricopeptide repeat protein required for 5' end processing of nad9 and cox3 mRNAs in mitochondria. |
AT3G54760 | RRM1 interacts with SUVH9 and FVE and has an auxiliary role in RNA-directed DNA methylation. |
AT3G23830 | encodes a glycine-rich RNA binding protein. Gene expression is induced by cold and reduced by ionic (salt) and non-ionic (mannitol) osmotic stress. Lines overexpressing the gene are slightly more tolerant to osmotic stress during germination. |
AT1G17640 | Belongs to a member of the RNA-binding glycine-rich (RBG) gene superfamily. |
AT4G14300 | Belongs to a member of the RNA-binding glycine-rich (RBG) gene superfamily. |
AT1G58470 | Encodes an mRNA-binding protein that contains two RNA recognition motifs (RRMs) and is expressed in proliferating tissues. Preferentially binds UUAGG, GUAGG and/or UUAGU. Loss of function of RBP1 causes decreased root length. |
AT1G49600 | RNA-binding protein 47A;(source:Araport11) |
AT1G47490 | RNA-binding protein 47C;(source:Araport11) |
AT4G03110 | Encodes a putative RNA-binding protein that is located in the cytoplasm and is involved in the hypersensitive response and positively regulates salicylic acid-mediated immunity. |
AT4G11130 | Encodes RNA-dependent RNA polymerase that is required for endogenous siRNA (but not miRNA) formation. Nomenclature according to Xie, et al. (2004). |
AT2G29540 | RNA polymerase I(A) and III(C) 14 kDa subunit |
AT1G80650 | RNAse THREE-like protein 1;(source:Araport11) |
AT3G54280 | ROOT GROWTH DEFECTIVE 3;(source:Araport11) |
AT5G51060 | RHD2 (along with RHD3 and RHD4) is required for normal root hair elongation. Has NADPH oxidase activity. Gene is expressed in the elongation and differention zone in trichoblasts and elongating root hairs. RDH2 is localized to the growing tips of root hair cells. It is required for the production of reactive oxygen species in response to extracellular ATP stimulus. The increase in ROS production stimulates Ca2+ influx. |
AT3G51460 | Encodes RHD4 (ROOT HAIR DEFECTIVE4), a phosphatidylinositol-4-phosphate phosphatase required for root hair development. The mRNA is cell-to-cell mobile. |
AT4G33880 | RSL2 was expressed concurrently with RSL4 and its expression was controlled by RHD6 and RSL1. Required for root-hair growth. |
AT1G27740 | Basic helix-loop-helix (bHLH) transcription factor that is sufficient to promote postmitotic cell growth in root-hair cells. RSL4 is a direct transcriptional target of RHD6 |
AT1G66470 | ROOT HAIR DEFECTIVE6;(source:Araport11) |
AT3G10710 | root hair specific 12;(source:Araport11) |
AT4G02270 | root hair specific 13;(source:Araport11) |
AT4G29180 | root hair specific 16;(source:Araport11) |
AT5G22410 | root hair specific 18;(source:Araport11) |
AT1G48380 | Encodes a novel nuclear protein required for root hair initiation and ploidy-dependent cell growth. Its sequence has similarity to the C-terminal domain of mammalian DNA topo IIalpha. Shows in vitro DNA binding activity and is likely to be part of the topo VI complex by binding to subunit A. |
AT1G26370 | RNA helicase family protein;(source:Araport11) |
AT2G04025 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
AT5G64770 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
AT4G33495 | A member of the RPD gene family - there are13 annotated genes and one EST encoding RPD1-like proteins in Arabidopsis. Shows no homology to any protein of known function. Abundant expression found in the shoot apex and the root. rpd1 mutant is a temperature-sensitive mutant isolated on the basis of the impairment in adventitious roots formation in hypocotyl region. Also, disruption of the RPD1 gene by a T-DNA insertion caused embryogenesis arrest at the globular to transition stages. This phenotype is consistent with the hypothesized function of RPD1 in the maintenance of active cell proliferation. |
AT2G31190 | Encodes RUS2 (root UVB sensitive2), a DUF647-containing protein that is homologous to the RUS1 protein. RUS2 works with RUS1 in a root UV-B sensing pathway that plays a vital role in Arabidopsis early seedling morphogenesis and development. Required for auxin polar transport. |
AT2G26290 | root-specific kinase 1;(source:Araport11) |
AT1G25490 | One of three genes encoding phosphoprotein phosphatase 2A regulatory subunit A; Recessive ethylene-response mutant EER1 displays increased ethylene sensitivity in the hypocotyl and stem |
AT5G19560 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT1G31650 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT2G45890 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Mutants exhibit longer root hairs under phosphate-deficient conditions. Involved in cell wall patterning. Encodes ROP activator, regulates the formation of ROP-activated domains; these in turn determine the pattern of cell wall pits. Forms a dimer that interacts with activated ROP11 in vivo, which could provide positive feedback for ROP activation. Required for periodic formation of secondary cell wall pits |
AT5G02010 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Involved in cell wall patterning. Encodes ROP activator, regulates the formation of ROP-activated domains; these in turn determine the pattern of cell wall pits. Required for periodic formation of secondary cell wall pits. |
AT3G11490 | ROP (Rho of plant GTPases) family member Involved in cell wall patterning. Encodes ROP inactivator, regulates the formation of ROP-activated domains; these in turn determined the pattern of cell wall pits. Positively regulates pit formation, but negatively regulates pit size, required for periodic formation of secondary cell wall pits. |
AT2G33460 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Interacts with Rop1 and is involved in pollen tube growth and function. Protein most similar to RIC3(family subgroup III). RIC1 is localized to the apical region of the plasma membrane in pollen tube and mutation analyses indicate that this localization is dependent on ROP1 binding. Gene is expressed in all tissues examined.Analysis of overexpression and loss of function mutants indicates a role in cortical microtubule organization during pavement cell morphogenesis. |
AT4G04900 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Most similar to RIC9 and RIC11 (subfamily group I). Gene is expressed predominantly in roots, leaves, and seedlings. |
AT5G16490 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). It interacts with Rop1 and is involved in pollen tube growth and function, and exocytosis in the pollen tube tip. Protein most similar to RIC2 (family subgroup V). Gene is expressed in all tissues examined.Interacts with ROP2 during pavement cell morphogenesis and with ROP1 to promote apical F-actin assembly. |
AT2G20430 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Most similar to RIC7 and RIC8 (subfamily group II). Gene is expressed predominantly in inflorescence and flower tissue. |
AT4G24580 | Encodes a Rho GTPase-activating protein that interacts with ROP1 (a Rho GTPase) and regulates pollen tube development. This protein can be observed at the apical tip of growing pollen tubes and on endocytic vesicles traveling to this region of the pollen tube. |
AT1G63240 | Methyl-DNA binding protein which interacts with RMB1 and ROS1 acting in the base excision repair pathway through DNA methylation. |
AT4G38740 | Encodes cytosolic cyclophilin ROC1. |
AT4G36380 | Encodes a cytochrome P-450 gene that is involved in leaf blade expansion by controlling polar cell expansion in the leaf length direction. Member of the CYP90C CYP450 family. ROT3 was shown to be involved in brassinosteroid biosynthesis, most likely in the conversion step of typhasterol (TY) to castasterone (CS). As 6-deoxo-CS was unable to restore the phenotype of rot3-1, it has been postulated that ROT3 might be specifically involved in the conversion of TY to CS in the C6-oxidation pathway of brassinolide. Recently, CYP90C1 was shown to catalyse the C-23 hydroxylation of several brassinosteroids (the enzyme has a broad specificity for 22-hydroxylated substrates). |
AT1G17235 | This gene is predicted to encode a small protein with a DVL domain found in the DVL / RTFL protein family. Over-expression analyses using truncated versions of a related family member, ROT4, suggest that the DVL / RTF domain is involved in regulating cell proliferation. |
AT4G13395 | ROTUNDIFOLIA like 12;(source:Araport11) |
AT3G25717 | ROTUNDIFOLIA like 16;(source:Araport11) |
AT2G29125 | ROTUNDIFOLIA like 2;(source:Araport11) |
AT3G18518 | Member of a family of small polypeptides found only in angiosperm lineages.Contains a conserved 29 amino acid domain (RTF or DVL domain). |
AT1G67265 | ROTUNDIFOLIA like 21;(source:Araport11) |
AT1G64585 | ROTUNDIFOLIA like 22;(source:Araport11) |
AT4G35783 | ROTUNDIFOLIA like 6;(source:Araport11) |
AT3G55515 | ROTUNDIFOLIA like 7;(source:Araport11) |
AT2G39705 | ROTUNDIFOLIA like 8;(source:Araport11) |
AT1G53708 | ROTUNDIFOLIA like 9;(source:Araport11) |
AT5G08020 | Encodes a homolog of Replication Protein A. rpa70b mutants are hypersensitive to UV-B radiation and MMS treatments suggesting a role for this protein in DNA damage repair. The mRNA is cell-to-cell mobile. |
AT5G26760 | Encodes RPAP2 IYO Mate (RIMA), a homologue of yeast and human proteins linked to nuclear import of selective cargo. Knockdown of RIMA causes delayed onset of cell differentiation. |
AT3G25070 | Encodes a member of the R protein complex and may represent a virulence target of type III pili effector proteins (virulence factors) from bacterial pathogens, which is 'guarded' by R protein complex (RPM1 and RPS2 proteins). RIN4 physically interacts with RPS2 and RPM1 in vivo. Bacterial avirulence (Avr) effectors AvrB, AvrRpm1, and AvrRpt2 induce a mobility shift in RIN4 and expression of AvrRpt2 induces rapid degradation of RIN4. RIN4 contains 2 sites for AvrRpt2 autocleavage, called RCS1 and RCS2. Overexpression of RIN4 inhibits multiple phenotypes associated with AvrRpt2 function and also inhibits PAMP-induced defense signaling. Attached to the plasma membrane at its carboxyl terminus. Cleaved by AvrRpt2 at two PxFGxW motifs, one releasing a large portion of RIN4 from the plasma membrane and both exposing amino-terminal residues that destabilized the carboxyl-terminal cleavage products by targeting them for N-end ubiquitylation and proteasomal degradation. Major virulence target of the TTSE HopF2Pto. The mRNA is cell-to-cell mobile. |
AT5G18700 | Encodes a microtubule-associated kinase-like protein RUNKEL (RUK). Contains a putative serine/threonine kinase domain and a microtubule-binding domain. RUK directly binds to microtubules in vitro and colocalizes with mitotic preprophase band, spindle, and phragmoplast in vivo. Required for cell plate expansion in cytokinesis. |
AT1G18790 | RWP-RK domain-containing protein;(source:Araport11) |
AT2G35800 | Encodes a predicted calcium-dependent S-adenosyl methionine carrier. |
AT4G39460 | Encodes a plastid metabolite transporter required for the import of S-Adenosylmethionine from the cytosol. Impaired function of SAMT1 led to decreased accumulation of prenyllipids and mainly affected the chlorophyll pathway. |
AT1G34065 | S-adenosylmethionine carrier 2;(source:Araport11) |
AT1G02500 | encodes a S-adenosylmethionine synthetase. SAM1 is regulated by protein S-nitrosylation. The covalent binding of nitric oxide (NO) to the Cys114 residue inhibits the enzyme activity. |
AT4G01850 | S-adenosylmethionine synthetase 2;(source:Araport11) |
AT1G58250 | SABRE, putative gene of unknown function, homologous to maize apt1 gene. Required for normal cell expansion in the root cortex. The sabre mutation results in abnormal cell expansion. Encodes a rare message; very low level of expression was detected in roots and shoots. |
AT3G51830 | putative transmembrane protein G5p (AtG5) mRNA, complete. autophagy-related (ATG) gene |
AT5G04990 | Encodes a member of the Sad1/UNC-84 (SUN)-domain proteins: AtSUN1(At5g04990), AtSUN2(AT3G10730). SUN domain proteins are part of the cytoskeletal-nucleoskeletal bridging complexes. AtSUN1 and AtSUN2 are localized to the nuclear envelope and are present as homomers and heteromers in vivo.Encodes an outer nuclear membrane protein that anchors RanGAP1 to the nuclear envelope. It interacts with WPP domain interacting-proteins (WIPs). It is involved in maintaining the elongated nuclear shape of epidermal cells. |
AT3G10730 | Encodes a member of the Sad1/UNC-84 (SUN)-domain proteins: AtSUN1(At5g04990), AtSUN2(AT3G10730). SUN domain proteins are part of the cytoskeletal-nucleoskeletal bridging complexes. AtSUN1 and AtSUN2 are localized to the nuclear envelope and are present as homomers and heteromers in vivo. |
AT1G30835 | Member of Sadhu non-coding retrotransposon family The mRNA is cell-to-cell mobile. |
AT5G14260 | Suppresses singlet oxygen-induced stress responses by protecting grana margins. |
AT2G19390 | SAGA complex subunit. Regulates gene expression by affecting histone H3 acetylation. |
AT4G29790 | SAGA complex subunit. Regulates gene expression by affecting histone H3 acetylation. |
AT2G01980 | Encodes a plasma membrane-localized Na+/H+ antiporter SOS1. Functions in the extrusion of toxic Na+ from cells and is essential for plant salt tolerance. Has 12 predicted transmembrane domains in the N-terminal region and a long cytoplasmic tail of approx. 700 aa at the C-terminal side. SOS1 interacts through its predicted cytoplasmic tail with RCD1, a regulator of oxidative-stress responses, suggesting that SOS1 might function in oxidative-stress tolerance. |
AT5G35410 | encodes a member of the CBL-interacting protein kinase family, is a regulatory component controlling plant potassium nutrition |
AT5G24270 | encodes a calcium sensor that is essential for K+ nutrition, K+/Na+ selectivity, and salt tolerance. The protein is similar to calcineurin B. Lines carrying recessive mutations are hypersensitive to Na+ and Li+ stresses and is unable to grow in low K+. The growth defect is rescued by extracellular calcium. |
AT1G06040 | Encodes salt tolerance protein (STO) which confers salt tolerance to yeast cells. Fully complements calcineurin deficient yeast but does not encode a phosphoprotein phosphatase. Sequence has similarities to CONSTANS. STO co-localizes with COP1 and plays a role in light signaling.STO transcript levels are regulated by photoperiod and phtyohormones. STO competes with FLC in the regulation of floral transition genes SOC1 and FT. |
AT2G31380 | a B-box zinc finger protein that interacts with COP1. contains a novel 11 amino acid motif at the C-terminus (also found at the N-terminus of HY5) that is involved in the COP1 interaction. |
AT1G27760 | Encodes a protein with similarity to human interferon-related developmental regulator (IFRD)that is involved in salt tolerance. Loss of function mutations are hypersensitive to salt stress and have reduced fertility. SAT32 is found in the cytoplasm but appears to translocate to the nucleus when plants are subject to salt stress. |
AT5G60410 | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation. Regulates leaf cell division and expansion through salicylic acid accumulation. signaling |
AT5G52810 | SAR-DEFICIENT4 (SARD4) alias ORNITHINE CYCLODEAMINASE/m-CRYSTALLIN (ORNCD1) is involved in the biosynthesis of pipecolic acid. The reductase converts dehydropipecolic acid intermediates generated from L-Lysine by AGD2-LIKE DEFENSE RESPONSE PROTEIN1 (ALD1) to pipecolic acid (PMID:28330936). |
AT3G18380 | DNA-BINDING TRANSCRIPTION FACTOR 2;(source:Araport11) |
AT2G24120 | DNA/RNA polymerases superfamily protein;(source:Araport11) |
AT2G38440 | Encodes a subunit of the WAVE complex. The WAVE complex is required for activation of ARP2/3 complex which functions in actin microfilament nucleation and branching. Mutations cause defects in both the actin and microtubule cytoskeletons that result in aberrant epidermal cell expansion. itb1 mutants showed irregularities in trichome branch positioning and expansion. The SHD domain of this protein binds to BRK1 and overexpression of the SHD domain results in a dominant negative phenotype. The mRNA is cell-to-cell mobile. |
AT1G21450 | Encodes a scarecrow-like protein (SCL1). Member of GRAS gene family. The mRNA is cell-to-cell mobile. |
AT1G07530 | Encodes a member of the GRAS family of transcription factors. The protein interacts with the TGA2 transcription factor and affects the transcription of stress-responsive genes. The protein is found in the nucleus and is also exported to the cytoplasm. |
AT2G04890 | Encodes a scarecrow-like protein (SCL21). Member of GRAS gene family. |
AT1G50600 | Encodes a scarecrow-like protein (SCL5). Member of GRAS gene family. |
AT5G52510 | SCARECROW-like 8;(source:Araport11) |
AT3G54990 | Encodes a AP2 domain transcription factor that can repress flowering. SMZ and its paralogous gene, SNARCHZAPFEN (SNZ), share a signature with partial complementarity to the miR172 microRNA, whose precursor is induced upon flowering. |
AT2G39250 | Encodes a AP2 domain transcription factor that can repress flowering. SNZ and its paralogous gene, SCHLAFMUTZE (SMZ), share a signature with partial complementarity to the miR172 microRNA, whose precursor is induced upon flowering. |
AT5G46410 | Encodes a SCP1-like small phosphatase (SSP). Three SSPs form a unique group with long N-terminal extensions: AT5G46410 (SSP4), AT5G11860 (SSP5), AT4G18140 (SSP4b). SSP4 and SSP4b were localized exclusively in the nuclei, whereas SSP5 accumulated in both nuclei and cytoplasm. All three SSPs encodes active CTD phosphatases like animal SCP1 family proteins, with distinct substrate specificities: SSP4 and SSP4b could dephosphorylate both Ser2-PO(4) and Ser5-PO(4) of CTD, whereas SSP5 dephosphorylated only Ser5-PO(4). The mRNA is cell-to-cell mobile. |
AT4G15735 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT3G23727 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT3G27503 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT1G65113 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT1G08695 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT2G05117 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT5G51110 | Encodes a protein involved in Rubisco assembly that also mediates Abscisic acid-dependent stress response. It is a ubiquitination target of the intracellular E3 ligase SDIR1. It selectively regulates the expression of the downstream basic region/leucine zipper motif transcription factor gene ABA-INSENSITIVE5, rather than ABA-RESPONSIVE ELEMENTS BINDING FACTOR3 (ABF3) or ABF4, to regulate ABA-mediated seed germination and the plant salt response. |
AT3G62440 | Encodes an F-box protein which is predominantly expressed in flower tissues and interacts with ASK19 protein. Mutations in this gene suggest it acts as a negative regulator of endothecial secondary wall thickening in anthers. |
AT1G56330 | Encodes a small GTP-binding protein implicated in ER to cis-Golgi transport of other proteins. A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. The protein is found associated to the ER and free in the cytosol. |
AT1G09180 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
AT4G02080 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
AT1G02010 | member of KEULE Gene Family |
AT2G18710 | Encodes a component of the thylakoid-localized Sec system involved in the translocation of cytoplasmic proteins into plastid. |
AT3G48460 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G57520 | SIP2 encodes a raffinose-specific alpha-galactosidase that catalyzes the breakdown of raffinose into alpha-galatose and sucrose. This enzyme may function in unloading raffinose from the phloem as part of sink metabolism. Although it was originally predicted to act as a raffinose synthase (RS), that activity was not observed for recombinant SIP2. |
AT4G27170 | seed storage albumin 4;(source:Araport11) |
AT2G34380 | Membrane protein involved in lipid droplet biogenesis primarily in pollen. The interaction between VAP27-1 and SEIPIN3 requires the N-terminal 25 amino acids of SEIPIN3 that contain an FFAT motif. |
AT3G23800 | selenium-binding protein 3;(source:Araport11) |
AT2G29350 | Encodes a senescence associated protein required for resistance against fungal pathogens. Negative regulator of defense against bacterial pathogens. Induced by ROS. Required for defense against ROS and fungal pathogens most likely by activating anthocyanin biosynthesis. |
AT5G13170 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
AT4G30520 | Encodes SARK (SENESCENCE-ASSOCIATED RECEPTOR-LIKE KINASE). Regulates leaf senescence through synergistic actions of auxin and ethylene. It is one of a group of LRR-RLKs, designated as CLAVATA3 INSENSITIVE RECEPTOR KINASES (CIKs), that act as co-receptors and have essential roles in regulating CLV3-mediated stem cell homeostasis. |
AT3G02040 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. Has glycerophosphodiester phosphodiesterase activity. Functions in maintaining cellular phosphate homeostasis under phosphate starvation. The mRNA is cell-to-cell mobile. |
AT1G34370 | Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity. Cell wall of the mutant is unstable in low pH medium (pH 4.5) in low Ca solution. This would mediate Ca-alleviation of low pH stress through pectin-Ca interaction. In vitro binding and mutated-promoter-GUS assays identified that STOP1 directly activates AtALMT1 expression through the binding to the promoter by four zinc finger domains. Binding of STOP1 to promoter is an essential step of Al-inducible AtALMT1 expression. The mRNA is cell-to-cell mobile. |
AT2G03710 | This gene belongs to the family of SEP genes. It is involved in the development of sepals, petals, stamens and carpels. Additionally, it plays a central role in the determination of flower meristem and organ identity. |
AT5G15800 | Encodes a MADS box transcription factor involved flower and ovule development. Functionally redundant with SEP2 and SEP3. |
AT3G53030 | Encodes a protein kinase SRPK4 that specifically targets Arabidopsis Ser/Arg-rich (SR) slicing factors involved in RNA metabolism. In vitro kinase assay showed that SRPK4 phosphorylates the SR protein RSp31. |
AT5G56760 | Encodes a cytosolic serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. |
AT1G55920 | Encodes a chloroplast/cytosol localized serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. The mRNA is cell-to-cell mobile. |
AT2G23000 | serine carboxypeptidase-like 10;(source:Araport11) |
AT2G22970 | serine carboxypeptidase-like 11;(source:Araport11) |
AT2G22920 | serine carboxypeptidase-like 12;(source:Araport11) |
AT5G09640 | encodes a serine carboxypeptidase-like (SCPL) protein. Mutants accumulate sinapoylglucose instead of sinapoylcholine, and have increased levels of choline and decreased activity of the enzyme sinapoylglucose:choline sinapoyltransferase. |
AT4G12910 | serine carboxypeptidase-like 20;(source:Araport11) |
AT2G24000 | serine carboxypeptidase-like 22;(source:Araport11) |
AT2G24010 | serine carboxypeptidase-like 23;(source:Araport11) |
AT2G35780 | serine carboxypeptidase-like 26;(source:Araport11) |
AT3G07990 | serine carboxypeptidase-like 27;(source:Araport11) |
AT4G30810 | serine carboxypeptidase-like 29;(source:Araport11) |
AT1G73280 | serine carboxypeptidase-like 3;(source:Araport11) |
AT4G15100 | serine carboxypeptidase-like 30;(source:Araport11) |
AT1G11080 | serine carboxypeptidase-like 31;(source:Araport11) |
AT1G61130 | serine carboxypeptidase-like 32;(source:Araport11) |
AT3G17180 | serine carboxypeptidase-like 33;(source:Araport11) |
AT5G23210 | serine carboxypeptidase-like 34;(source:Araport11) |
AT5G42230 | Serine carboxypeptidase‐like (SCPL) enzyme involved in membrane lipid metabolism. |
AT5G42240 | serine carboxypeptidase-like 42;(source:Araport11) |
AT2G12480 | serine carboxypeptidase-like 43;(source:Araport11) |
AT2G33530 | serine carboxypeptidase-like 46;(source:Araport11) |
AT2G27920 | serine carboxypeptidase-like 51;(source:Araport11) |
AT2G23010 | serine carboxypeptidase-like 9;(source:Araport11) |
AT4G32520 | Encodes a serine hydroxymethyltransferase SHMT3 located in the plastid. |
AT4G13930 | Encodes a serine hydroxymethyltransferase maximally expressed in root |
AT3G48780 | Encodes one of the two LCB2 subunits (LCB2a and LCB2b) of serine palmitoyltransferase, an enzyme involved in sphingolipid biosynthesis. LCB2a and LCB2b are functional redundant. Double mutants are gametophytic lethal. The mRNA is cell-to-cell mobile. |
AT5G01820 | Encodes a CBL-interacting serine/threonine protein kinase. |
AT2G17700 | ACT-like protein tyrosine kinase family protein;(source:Araport11) |
AT2G24360 | STYK serine threonine kinase that phosphorylates several oil body proteins including OLE1 and CLO4/CAL4. |
AT2G14540 | serpin 2;(source:Araport11) |
AT1G11870 | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana. |
AT5G53430 | Homology Subgroup III; Orthology Group 2 - A putative histone methyltransferase (predicted to methylate H3K4) related to the Drosophila trithorax group proteins TRX and TRR and the yeast gene SET1. A plant line expressing an RNAi construct directed against this gene has reduced agrobacterium-mediated tumor formation. |
AT2G05900 | Predicted to encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. |
AT4G15180 | Encodes SET domain containing protein that acts redundantly with ATX4/5 to regulate histone H3-K4 methylation. |
AT5G42400 | Encodes ATXR7 (ARABIDOPSIS TRITHORAX-RELATED7), required for histone H3-K4 methylation and for transcriptional activation of Flowering Locus C. |
AT1G43850 | Encodes a transcriptional co-regulator of AGAMOUS, that functions with LEUNIG to repress AG in the outer floral whorls. |
AT4G25520 | SEUSS-like 1;(source:Araport11) |
AT5G62090 | Encodes a protein that functions with LUH to promote Al binding to the root cell wall. |
AT3G58040 | Encodes a RING finger domain containing protein that interacts with AtRAP2.2. The mRNA is cell-to-cell mobile. |
AT4G18060 | SH3 domain-containing protein;(source:Araport11) |
AT4G00720 | Encodes ASKtheta, a group III Arabidopsis GSK3/shaggy-like kinase. Functions in the brassinosteroid signalling pathway. |
AT5G26751 | Encodes a SHAGGY-related kinase involved in meristem organization. It regulates the redox stress response by phosphorylating glucose-6-phosphate dehydrogenase 6.Functions as a positive regulator of salt stress tolerance. Phosphorylates and enhances G6PD6 (At5g40760) activity |
AT2G30980 | Encodes a GSK3-like protein kinase. This protein can interact with the BZR1 protein involved in brassinosteroid-mediated signaling in a Y2H assay and promotes BZR1 phosphorylation in protoplasts. |
AT2G25600 | Encodes SPIK, a member of the Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mutant plants have impaired pollen-tube growth. |
AT3G58780 | One of two genes (SHP1 and SHP2) that are required for fruit dehiscence. The two genes control dehiscence zone differentiation and promote the lignification of adjacent cells. |
AT4G26690 | Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development. |
AT3G54430 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
AT2G21400 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
AT4G31120 | Involved in vernalization. Required for epigenetic silencing of FLC, and for vernalization-mediated histone modification. |
AT1G31480 | encodes a novel protein that may be part of a gene family represented by bovine phosphatidic acid-preferring phospholipase A1 (PA-PLA1)containing a putative transmembrane domain. SGR2 is involved in the formation and function of the vacuole. |
AT2G01940 | Encodes a transcription factor that, together with IDD14 and IDD16, regulates auxin biosynthesis and transport and thus aerial organ morphogenesis and gravitropic responses. May be involved in an early event in shoot gravitropism such as gravity perception and/or a signaling process subsequent to amyloplast sedimentation as a putative transcription factor in gravity-perceptive cells. |
AT5G24735 | Has been identified as a translated small open reading frame by ribosome profiling. |
AT2G03150 | Encodes a nuclear-localized calcium-binding protein RSA1 (SHORT ROOT IN SALT MEDIUM 1), which is required for salt tolerance. |
AT3G08800 | Encodes a nuclear and endosome localized protein with ARM and HEAT domains that interacts with SHR and other non-cell-autonomous proteins and may be involved in their intercellular movement. Hypomorphic mutant phenotypes suggest involvement of the protein in root patterning. |
AT5G52290 | Encodes a protein with similarity to XPF endonucleases. Loss of function mutations have defects in meiosis- specifically a reduction in the number of chiasmata. As a result both pollen and embryo sacs are abnormal and plants have severely reduced fertility. |
AT2G18330 | AAA-type ATPase family protein;(source:Araport11) |
AT5G24740 | Encodes a vacuolar sorting protein that interacts with the plant-specific GRAS family transcription factor SHORT-ROOT and acts in a pathway that controls root growth and radial patterning. It provides a connections between gibberellic acid, SHR and PLT signaling in the root. |
AT3G10440 | Encodes a protein that protects meiotic centromere cohesion. |
AT5G04320 | Encodes a protein that protects meiotic centromere cohesion. |
AT5G55480 | Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development. The mRNA is cell-to-cell mobile. |
AT5G04470 | Encodes a novel nuclear 14-kD protein containing a cyclin binding motif and a motif found in ICK/KRP cell cycle inhibitor proteins. It is required for coordinating cell division and cell differentiation during the development of Arabidopsis trichomes, playing a key role in the mitosis-to-endoreduplication transition. It interacts with D-type cyclins in vivo. |
AT3G10680 | SLI1 is a heat shock like protein that is found in sieve elements, sieve plates and spherical bodies peripheral to the mitochondria. Mutants show increased phloem feeding by aphids and decreased heat tolerance. |
AT3G01680 | Encodes a protein localized to phloem filaments that is required for phloem filament formation. The mRNA is cell-to-cell mobile. |
AT4G33410 | SIGNAL PEPTIDE PEPTIDASE-LIKE 1;(source:Araport11) |
AT1G05820 | SIGNAL PEPTIDE PEPTIDASE-LIKE 5;(source:Araport11) |
AT1G15310 | 54 kDa protein subunit of SRP that interacts with the signal peptide of secreted proteins |
AT2G22300 | Encodes a putative CAM binding transcription factor. Loss of function mutations show enhanced resistance to fungal and bacterial pathogens suggesting that CAMTA functions to suppress defense responses.It acts in the cold response pathway, it can bind to and activate the expression of DREB1 genes. |
AT3G15390 | Encodes a novel protein that is similar to PRL1 interacting factor and is involved in virus induced silencing. |
AT1G44800 | Encodes Siliques Are Red 1 (SIAR1). Functions as a bidirectional amino acid transporter that is crucial for the amino acid homeostasis of siliques. Member of nodulin MtN21-like transporter family. |
AT2G35510 | Encodes a WWE domain-containing protein with 76% similarity to RCD1. The protein also contains a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. |
AT1G70440 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. |
AT3G47720 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. |
AT1G10450 | Encodes SIN3-like 6, a homolog of the transcriptional repressor SIN3 (AT1G24190). |
AT2G22990 | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose. |
AT2G47980 | Essential to the monopolar orientation of the kinetochores during meiosis. |
AT4G20310 | Encodes a Golgi-localized protease that can cleave the transcription factors bZIP17 and bZIP28 that are translocated from the ER through the Golgi so that the transcription factors can be released to translocate into the nucleus. |
AT2G02350 | encodes a protein containing an F-box domain and physically interacts with SCF subunit SKP1/ASK1. The protein also exhibits similarity in sequence to phloem protein 2 (PP2) from cucumber. |
AT4G34470 | SKP1-like 12;(source:Araport11) |
AT3G21830 | SKP1-like 8;(source:Araport11) |
AT2G17030 | Encodes a SKP1/ASK-interacting protein. |
AT4G37160 | SKU5 similar 15;(source:Araport11) |
AT4G22010 | SKU5 similar 4;(source:Araport11) |
AT4G25240 | Encodes GPI-anchored SKU5-like protein. Acts redundantly with SKU5 and SKS1 in roots. |
AT1G76160 | SKU5 similar 5;(source:Araport11) |
AT1G21860 | SKU5 similar 7;(source:Araport11) |
AT4G24210 | F-box protein that is involved in GA signaling. Regulates seed germination. Component of E3 ubiquitin complex. Interacts with DELLA proteins. |
AT5G48170 | encodes an F-box protein whose protein sequence is similar to SLY1, which belongs to SCF-SLY1 E3 ligase complex. SCF-SLY1 E3 ligase degrades DELLA proteins that are involved in promoting growth. Overexpression of SLY2 can partially compensate sly1-10 mutant phenotype of dwarfism. |
AT1G55040 | SED1 is a protein of unknown function that is located in the mitochondrion. sed1 mutants are embryo lethal. |
AT3G61360 | Encodes SLO3 (SLOW GROWTH3), a pentatricopeptide repeat protein required for the splicing of mitochondrial NADH dehydrogenase subunit7 intron 2. Mutants have smaller RAMs are slower growing than wild type. |
AT4G33210 | Encodes SLOMO (SLOW MOTION), a F-box protein required for auxin homeostasis and normal timing of lateral organ initiation at the shoot meristem. |
AT2G47990 | Encodes a transducin family nucleolar protein with six WD40 repeats that is most likely involved in 18S rRNA biogenesis. The slow progression of the gametophytic division cycles in swa1 suggested that the SWA1 protein is required for the normal progression of mitotic division cycles through the regulation of cell metabolism. Ubiquitously expressed throughout the plant. |
AT1G65700 | Defines and confers the functional specificity of the LSM2-8 spliceosome core complex, which is involved in splicing through the stabilization of the U6 snRNA. Client of Hsp90, mediated by PFD4. |
AT1G55270 | SAGL1 is a member of a small family of KELCH domain containing proteins. Loss of function mutants show increased lignin and anthocyanin production suggesting a role in regulation of phenylpropanoid biosynthesis. |
AT2G45210 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G79130 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT3G12830 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G34770 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT3G51200 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G34780 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G13790 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT2G46690 | Regulates ABA-mediated responses to drought stress. |
AT4G22620 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G12410 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G31320 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT3G43120 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G34800 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT2G28085 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G34810 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G34760 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G75590 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G19840 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G19830 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT5G50760 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT3G53250 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G43040 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT3G60690 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G30220 | small nuclear ribonucleoprotein F;(source:Araport11) |
AT1G26233 | Encodes a H/ACA-box snoRNA (snoR95). Gb: AJ505672 |
AT5G05540 | small RNA degrading nuclease 2;(source:Araport11) |
AT5G67240 | small RNA degrading nuclease 3;(source:Araport11) |
AT4G34620 | Encodes ribosomal protein S16, has embryo-defective lethal mutant phenotype |
AT2G32765 | Encodes a small ubiquitin-like modifier (SUMO) protein that becomes covalently attached to various intracellular protein targets through an isopeptide bond. SUMOylation typically has a post-translational effect on the behavior of the target protein. |
AT3G52490 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. |
AT2G40130 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. |
AT2G42030 | Encodes a RING domain E3 ligase. Has overlapping function with MUSE1 in the negative regulation of defence responses. SIKIC2 (and possibly SIKIC1 and 3) is ubiquination target. |
AT3G01090 | encodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It can also interact with PRL1 DWD-containing protein. Based on in vitro degradation assays and cul4cs and prl1 mutants, there is evidence that AKIN10 is degraded in a proteasome-dependent manner, and that this depends on a CUL4-PRL1 E3 ligase |
AT5G39440 | SNF1-related protein kinase 1.3;(source:Araport11) |
AT1G78290 | encodes a member of SNF1-related protein kinase (SnRK2) family whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress and dehydration. |
AT1G60940 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. |
AT3G50500 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. |
AT3G48530 | SNF1-related protein kinase regulatory subunit gamma 1;(source:Araport11) |
AT3G20010 | Encodes a member of the SNF2 family of helicase-like proteins and is involved in RNA-directed DNA methylation. It is functionally redundant with FRG2 and interacts physically with SUVR2, another component of the RdDM pathway. |
AT1G50410 | Encodes a member of the SNF2 family of helicase-like proteins and is involved in RNA-directed DNA methylation. It is functionally redundant with FRG1. |
AT3G16600 | SNF2 domain-containing protein / helicase domain-containing protein / zinc finger protein-like protein;(source:Araport11) |
AT3G19570 | Encodes SCO3 (snowy cotyledon3), a member of a largely uncharacterized protein family unique to the plant kingdom. The sco3-1 mutation alters chloroplast morphology and development, reduces chlorophyll accumulation, impairs thylakoid formation and photosynthesis in seedlings, and results in photoinhibition under extreme CO(2) concentrations in mature leaves. SCO3 is targeted to the periphery of peroxisomes. Together with QWRF2 redundantly modulates cortical microtubule arrangement in floral organ growth and fertility. |
AT5G60750 | Encodes a chloroplast endoproteinase, SNOWY COTYLEDON4 (SCO4), required for photosynthetic acclimation to higher light intensities. |
AT1G26470 | chromatin modification-like protein;(source:Araport11) |
AT3G05030 | Encodes a vacuolar K+/H+ exchanger essential for active K+ uptake at the tonoplast and involved in regulating stomatal closure. |
AT1G71830 | Plasma membrane LRR receptor-like serine threonine kinase expressed during embryogenesis in locules until stage 6 anthers, with higher expression in the tapetal cell layer. SERK1 and SERK2 receptor kinases function redundantly as an important control point for sporophytic development controlling male gametophyte production. SERK1 interacts with and transphosphorylates EMS1 |
AT2G13790 | somatic embryogenesis receptor-like kinase 4;(source:Araport11) |
AT1G79580 | NAC-domain protein. Involved in root cap development. Involved in a regulatory feedback loop with FEZ. FEZ activates SMB in hte root cap daughter cells soon after division, and SMB in turn represses FEZ expression in these cells, thereby preventing further stem cell divisions. |
AT1G03790 | Encodes SOMNUS (SOM), a nucleus-localized CCCH-type zinc finger protein. SOM negatively regulates light-dependent seed germination downstream of PIL5 (AT2G20180). |
AT5G58440 | sorting nexin 2A;(source:Araport11) |
AT3G48195 | Encodes a member of the Arabidopsis sorting nexin family. |
AT5G58380 | Encodes a CBL-interacting protein kinase with similarity to SOS protein kinase. |
AT4G30960 | Encodes CBL-interacting protein kinase 6 (CIPK6). Required for development and salt tolerance. The mRNA is cell-to-cell mobile. |
AT1G05577 | SOK1 is a DUF966 domain containing protein. It is expressed during embryogenesis in the apical-lateral plasma membrane. SOK1 can form homodimers and it's polar localization of SOK1 depends on N terminal domains within the protein. Misexpression of SOK1 or delocalization alters cell division planes. |
AT1G54150 | Encodes a chloroplast-localized putative RING-type ubiquitin E3 ligase. |
AT3G15354 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA3 (and SPA4) predominantly regulates elongation growth in adult plants. |
AT2G19070 | encodes a protein whose sequence is similar to anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (gi:2239091). BAHD acyltransferase. Uses hydroxycinnamoyl CoAs, including caffeoyl/feruoyl/p-coumaroyl/sinapoyl-CoA as acyl donors to fully substitute the N1, N5, and N10 positions of spermidine. |
AT3G61580 | Fatty acid/sphingolipid desaturase;(source:Araport11) |
AT3G58490 | Encodes a long-chain base 1-phosphate (LCBP) phosphatase that is expressed in the endoplasmic reticulum. |
AT4G21534 | Diacylglycerol kinase family protein;(source:Araport11) |
AT4G16340 | Encodes SPIKE1 (SPK1), the lone DOCK family guanine nucleotide exchange factor (GEF) in Arabidopsis. SPK1 is a peripheral membrane protein that accumulates at, and promotes the formation of, a specialized domain of the endoplasmic reticulum (ER) termed the ER exit site (ERES). SPK1 promotes polarized growth and cell-cell adhesion in the leaf epidermis. Mutant has seedling lethal; cotyledon, leaf-shape, trichome defects. |
AT3G11540 | Contains a tetratricopeptide repeat region, and a novel carboxy-terminal region. SPY acts as both a repressor of GA responses and as a positive regulation of cytokinin signalling. SPY may be involved in reducing ROS accumulation in response to stress. Regulates root hair patterning independently of 2 gibberellin signalling. Together with SEC functions to competitively regulate RGA1 (At2g01570). |
AT2G03680 | The SPR1 gene encodes a plant-specific 12-kD protein which has a repeated motif at both ends, separated by a predicted rod-like domain, suggesting that it may act as an intermolecular linker. Ubiquitously expressed and belongs to a six-member gene family in Arabidopsis; expressed in transgenic seedlings localized to microtubules within the cortical array, preprophase band, phragmoplast, and mitotic spindle. |
AT1G26355 | SPIRAL1-LIKE1 belongs to a six-member gene family in Arabidopsis; all members share a high sequence similarity in amino- and carboxy-terminal regions. GUS expression was detected only in pollen; however, no endogenous transcript was found. |
AT4G23496 | Belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
AT1G03060 | Encodes a WD/BEACH domain protein involved in cell morphogenesis and ribonucleoprotein particle formation. It interacts with the P-body core component DCP2, associates to mRNA processing bodies (P-bodies), and regulates their assembly upon salt stress. It accumulates at the root hair apex via post-Golgi compartments and positively regulates tip growth by maintaining tip-focused vesicle secretion and filamentous-actin integrity. |
AT1G17070 | Encodes a homologue of spliceosome disassembly factor NTR1. Required for correct expression and splicing of DOG1, a regulator of seed dormancy. The mRNA is cell-to-cell mobile. |
AT3G45590 | Encodes a catalytic subunit of tRNA splicing endonuclease. |
AT2G02570 | Similar to SPF30 splicing factor. Under circadian control. Mutants have defects in alternative splicing and show more intron retention compared to wt. |
AT3G13170 | Encodes AtSPO11-1, one of the three Arabidopsis homologues of the archaeal DNA topoisomerase VIA subunit (topo VIA). Required for meiotic recombination. AtSPO11-1 and AtSPO11-2 have overlapping functions (i.e. both required for meiotic recombination) whereas AtSPO11-3 functions in DNA replication. AtSPO11-1 accumulates in foci in early G2. At 1 h post-S phase, no foci are observed, but by 3 h a majority (80%) of meiocytes at this time point contain >50 foci. However, by 5 h, AtSPO11-1 foci are no longer detectable. This suggests that the protein undergoes a rapid cycle of accumulation and disappearance in meiocytes over a period of between 1 and 5 h post-S phase. |
AT4G37760 | squalene epoxidase 3;(source:Araport11) |
AT4G34640 | Encodes squalene synthase, which converts two molecules of farnesyl diphosphate (FPP) into squalene via an intermediate: presqualene diphosphate (PSPP). It is generally thought to be one of the key enzymes of sterol biosynthesis, since it catalyzes the first pathway-specific reaction of the sterol branch of the isoprenoid pathway. The mRNA is cell-to-cell mobile. |
AT4G34650 | Encodes a protein with similarity to squalene synthase which catalyzes the first committed step in sterol biosynthesis. To date no experimental evidence exists that SQS2 functions as a squalene synthase and some experiments indicate it does not have this function. |
AT1G69170 | Encodes SPL6. Required for the resistance mediated by the TIR-NB-LRR RPS4 against Pseudomonas syringae carrying the avrRps4 effector. Transcriptome analysis indicates that SPL6 positively regulates a subset of defense genes. |
AT1G27370 | In conjunction with SPL11 and SPL2, SPL10 redundantly controls proper development of lateral organs in association with shoot maturation in the reproductive phase. SPL2, SPL10, and SPL11, suppress root regeneration with age by inhibiting wound-induced auxin biosynthesis. SPL10 also controls lamina shape during vegetative development. |
AT1G20980 | Encodes a nuclear plant-specific protein with features characteristic of a transcriptional regulator, including a nuclear localization signal sequence, a plant-specific DNA binding domain (the SBP box), and a protein interaction motif (ankyrin repeats). It unctions as a transcriptional regulator that plays a role not only in sensitivity to FB1, but also in the development of normal plant architecture. The mRNA is cell-to-cell mobile. |
AT3G57920 | Encodes a putative transcriptional regulator that is involved in the vegetative to reproductive phase transition. Expression is regulated by MIR156b. |
AT5G18830 | Encodes a member of the Squamosa Binding Protein family of transcriptional regulators. SPL7 is expressed highly in roots and appears to play a role in copper homeostasis. Mutants are hypersensitive to copper deficient conditions and display a retarded growth phenotype. SPL7 binds to the promoter of the copper responsive miRNAs miR398b and miR389c. |
AT2G42200 | Encodes a putative transcriptional regulator that is involved in the vegetative to reproductive phase transition. Expression is regulated by MIR156b. SPL activity nonautonomously inhibits initiation of new leaves at the shoot apical meristem. |
AT3G60030 | squamosa promoter-binding protein-like 12;(source:Araport11) |
AT1G27360 | In conjunction with SPL10 and SPL2, SPL11 redundantly controls proper development of lateral organs in association with shoot maturation in the reproductive phase. SPL2, SPL10, and SPL11, suppress root regeneration with age by inhibiting wound-induced auxin biosynthesis. |
AT4G01970 | Encodes a a raffinose and high affinity stachyose synthase as well as a stachyose and Gol specific galactosylhydrolase enzyme activity.AtRS4 is a sequential multifunctional RafS and StaS as well as a high affinity StaS, accepting only Raf and Gol for Sta product formation. AtRS4 possesses a Sta and Gol specific galactosylhydrolase enzyme activity. |
AT1G10760 | Encodes an α-glucan, water dikinase required for starch degradation. Involved in cold-induced freezing tolerance. Mutations that eliminate the GWD protein or affect the dikinase domain of the enzyme dramatically reduce both the amount of phosphate in the amylopectin and the rate of starch degradation. Mature leaves of these mutants accumulate amounts of starch up to seven times greater than those in wild-type leaves. NMR analysis of the mutants, suggests that the gene is specifically involved in the phosphorylation of the glucosyl residues of starch at the C6 position. |
AT5G24300 | SSI is a plastidial enzyme and crucial for the synthesis of normal amylopectin in the leaves of Arabidopsis. The absence of SSI results in a deficiency in the number of shorter glucans which in turn affect the formation and connection of the amylopectin clusters in starch. |
AT3G01180 | Starch synthase 2 involved in amylopectin metabolism. |
AT1G11720 | Encodes a starch synthase that in addition to its role in starch biosynthesis also has a negative regulatory function in the biosynthesis of transient starch. The protein apparently contains a starch-binding domain (SBD). |
AT3G52180 | Encodes a plant-specific glucan phosphatase that contains a noncatalytic carbohydrate-binding module as well as a dual specificity protein phosphatase domain. SEX4 can dephosphorylate C6- and C3-glucosyl residues on native starch grains and related maltodextrin compounds in vitro. This protein interacts with the plant SnRK AKIN11, binds starch, and is localized in the chloroplast. sex4 mutants have elevated levels of starch. |
AT5G19690 | encodes an oligosaccharyl transferase involved response to high salt. Mutants are hypersensitive to high salt conditions The mRNA is cell-to-cell mobile. |
AT1G07420 | Arabidopsis thaliana sterol 4-alpha-methyl-oxidase mRNA. The sterol 4alpha-methyl oxidase2 family proteins SMO2-1 and SMO2-2 function partially through effects on auxin accumulation, auxin response and PIN1 expression to regulate embryogenesis in Arabidopsis. |
AT5G42890 | sterol carrier protein 2;(source:Araport11) |
AT3G07020 | encodes a 3beta-hydroxy sterol UDP-glucosyltransferase. ugt80a2 mutant plants have reduced steryl glycoside and acyl steryl glycoside levels and reduced seed size. ugt80a2/b1 double mutants have normal levels of celluose and normal cold stress tolerance. |
AT2G02480 | STICHEL mutant shows trichomes with fewer than normal branches. |
AT4G18530 | lysine ketoglutarate reductase trans-splicing-like protein, putative (DUF707);(source:Araport11) |
AT1G79200 | Encodes a nuclear localized protein involved in auxin-dependent control of cell proliferation in pistil development. Loss of function mutations have increased cell proliferation in the stigma. |
AT5G65590 | Encodes a plant-specific Dof-type transcription factor expressed in maturing guard cells, but not in guard mother cells. It regulates essential processes of stomatal guard cell maturation and functions as a key transcription factor regulating the final stages of guard cell differentiation. |
AT2G26770 | Encodes a plant-specific actin binding protein SCAB1 (STOMATAL CLOSURE-RELATED ACTIN BINDING PROTEIN1). SCAB1 stabilizes actin filaments and regulates stomatal movement. |
AT3G48860 | coiled-coil protein;(source:Araport11) |
AT1G04110 | Initially identified as a mutation affecting stomatal development and distribution. Encodes a protein similar to serine proteases. |
AT5G54100 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
AT2G21970 | stress enhanced protein 2 (SEP2) chlorophyll a/b-binding protein |
AT1G51805 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G51820 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G31970 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT4G12040 | A20/AN1-like zinc finger family protein;(source:Araport11) |
AT1G74020 | Encodes AtSS-2 strictosidine synthase. |
AT1G74000 | encodes a protein similar to strictosidine synthase, which is involved in the production of monoterpene indole alkaloids. This gene belongs to a family of 13 members in Arabidopsis. |
AT2G41290 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
AT5G42390 | Encodes a chloroplast-localized metalloprotease that is essential for embryo development. Mutants do not progress normally beyond the 16-cell stage. The mRNA is cell-to-cell mobile. |
AT4G03390 | STRUBBELIG-receptor family 3;(source:Araport11) |
AT1G78980 | STRUBBELIG-receptor family 5;(source:Araport11) |
AT4G22130 | STRUBBELIG-receptor family 8;(source:Araport11) |
AT5G48600 | member of SMC subfamily |
AT5G62410 | SMC2-1 (SMC2) |
AT4G36260 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Encodes protein with a single zinc finger motif and a members of a small gene family of putative transcription factors in which the SHORT INTERNODES (SHI) gene is found. STY2/STY1 double mutants showed defective style, stigma as well as serrated leaves. |
AT5G04940 | Encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. SUVH1 has been shown to have a preference for binding methylated DNA. |
AT2G23740 | Encodes a SET-domain protein SUVR5 that mediates H3K9me2 deposition and silencing at stimulus response genes in a DNA methylation-independent manner. |
AT2G05920 | Subtilase family protein;(source:Araport11) |
AT4G21326 | subtilase 3.12;(source:Araport11) |
AT4G10540 | Proteolytic enzyme of that phytaspase family which at pH 5.5 is strictly Asp-specific. Strongly preferred cleavage motifs are YVAD and IETD. |
AT5G59090 | subtilase 4.12;(source:Araport11) |
AT2G39851 | Proteinase inhibitor, propeptide;(source:Araport11) |
AT2G19170 | Encodes a novel subtilisin-like serine protease. |
AT3G10380 | Subunit of the Putative Arabidopsis Exocyst Complex |
AT5G66760 | One of two genes in Arabidopsis that encode a flavoprotein subunit of the mitochondrial succinate dehydrogenase complex. The mRNA is cell-to-cell mobile. |
AT2G18450 | Nuclear encoded mitochondrial flavoprotein subunit of succinate dehydrogenase complex . |
AT3G47833 | predicted to encode subunit 7 of mitochondrial complex II and to participate in the respiratory chain |
AT2G46505 | Encodes succinate dehydrogenase ,a component of mitochondrial respiratory complex II. Nuclear encoded gene which is imported into the mitochondrion. |
AT5G20280 | Encodes a sucrose-phosphate synthase activity. This is the major leaf isoform. |
AT5G11110 | Encodes a sucrose-phosphate synthase involved in pollen exine formation. This is the dominant SPS isoform in leaves with respect to protein levels. |
AT1G04920 | Encodes a sucrose-phosphate synthase whose activity is stimulated by Glc-6-P and inhibited by Pi. |
AT4G10120 | Encodes a sucrose-phosphate synthase. |
AT4G02280 | Encodes a protein with sucrose synthase activity (SUS3). It appears to be important for sucrose metabolism in developing seeds, especially during the late maturation phase, about 18 days after flowering. |
AT1G09960 | low affinity (10mM) sucrose transporter in sieve elements (phloem) |
AT5G10020 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
AT1G71880 | Sucrose transporter gene induced in response to nematodes; member of Sucrose-proton symporter family. The mRNA is cell-to-cell mobile. |
AT1G11260 | Encodes a H+/hexose cotransporter. The mRNA is cell-to-cell mobile. |
AT1G07340 | sugar transporter 2;(source:Araport11) |
AT1G50310 | Sucrose transporter, expressed in pollen tubes. |
AT3G10370 | mitochondrial FAD-dependent glycerol-3-phosphate dehydrogenase. possibly involved in storage lipid catabolism and glycerol assimilation, and in glycerol-3-phosphate shuttle which transports reducing power from cytosol to mitochondrion. |
AT5G04040 | Encodes a triacylglycerol lipase that is involved in storage lipid breakdown during seed germination. The mutant plant exhibits a much slower rate of postgerminative growth than the wild type. |
AT3G47990 | SUGAR-INSENSITIVE 3;(source:Araport11) |
AT1G22150 | sulfate transporter Sultr1;3 |
AT5G10180 | Encodes a low-affinity sulfate transporter expressed in the root cap and central cylinder, where it is induced by sulfur starvation. Expression in the shoot vascular system is not induced by sulfur starvation. |
AT3G51895 | Encodes a chloroplast-localized sulfate transporter. |
AT4G02700 | sulfate transporter 3;(source:Araport11) |
AT3G15990 | Vascular cambium-localized sulfate transporter, mediates xylem-to-phloem transfer of phosphorus. 2 for its preferential distribution |
AT5G13550 | Encodes a sulfate transporter. |
AT3G12520 | Encodes a sulfate transporter that in induced under sulfate limitation. |
AT1G31170 | encodes a cysteine-sulfinic acid reductase (sulfiredoxin - EC 1.8.98.2) capable of reducing overoxidized plastidic 2-Cys-Prx involved in peroxide detoxification and response to oxidative stress |
AT3G45070 | Encodes a sulfotransferase with sulfating activity toward flavonoids. |
AT5G66170 | Encodes a thiosulfate sulfurtransferase/rhodanese. |
AT1G77990 | Encodes a low-affinity sulfate transporter. |
AT5G48850 | Homologous to the wheat sulphate deficiency-induced gene sdi1. Expression in root and leaf is induced by sulfur starvation. Knockout mutants retained higher root and leaf sulfate concentrations, indicating a role in regulation of stored sulfate pools. |
AT4G33620 | Encodes a SUMO protease that, along with ASP1,is required for fertility as asp1/spf2 double mutants have defects in gametogenesis and embroygenesis. |
AT2G21470 | Encodes one of the two subunits of the SUMO activation enzyme required during sumolation. Sumolation is a post-translational protein modification process similar to ubiquitination during which a polypeptide (SUMO) is covalently attached to a target protein. |
AT1G71360 | Encodes a member of the mid-SUN subfamily of SUN-domain proteins that is localized to both the nuclear envelope and the ER. It is involved in early seed development and nuclear morphology. |
AT4G23950 | Encodes a member of the mid-SUN subfamily of SUN-domain proteins. It is involved in early seed development and nuclear morphology. |
AT2G31660 | SAD2 (super sensitive to ABA and drought 2) encodes an importin beta-domain family protein likely to be involved in nuclear transport in ABA signaling. Subcellular localization of GFP-tagged SAD2 showed a predominantly nuclear localization, consistent with a role for SAD2 in nuclear transport. Mutation of SAD2 in Arabidopsis alters abscisic acid sensitivity. SAD2 was ubiquitously expressed at low levels in all tissues except flowers. SAD2 expression was not induced by ABA or stress. Loss of function mutations in SAD2 exhibit increased tolerance for UV stress, increased production of UV protective secondary metabolites and suppression of nuclear localization of MYB4 (a repressor of UV stress response genes). Regulates microRNA activity. Defective trichome activity. |
AT3G23130 | Flower-specific gene controlling the boundary of the stamen and carpel whorls. Similar to zinc finger transcription factors. Involved in shoot regenaration from root explants. |
AT2G20610 | Confers auxin overproduction. Mutants have an over-proliferation of lateral roots. Encodes a C-S lyase involved in converting S-alkylthiohydroximate to thiohydroximate in glucosinolate biosynthesis. Induced in epidermal cells attacked by powdery mildew. The RTY enzyme is expected to function as a dimer (or a higher order multimeric complex), as all RTY-related enzymes with a defined crystal structure are known to form dimers or tetramers. |
AT5G66020 | Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. non-consensus AT donor splice site at exon 7, TA donor splice site at exon 10, AT acceptor splice at exon 13. |
AT3G14205 | Phosphoinositide phosphatase family protein;(source:Araport11) |
AT3G43220 | Phosphoinositide phosphatase family protein;(source:Araport11) |
AT5G20840 | Phosphoinositide phosphatase family protein;(source:Araport11) |
AT1G80680 | Mutant has early-flowering phenotype, encodes a putative nucleoporin. Required for the activation of downstream defense pathways by the snc1 mutation. Involved in basal resistance against bacterial pathogens. |
AT1G33410 | Encodes a nucleoporin that regulates CONSTANS (CO) protein stability through affecting nuclear pore complex localization of an E3-ubiquitin ligase, HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENES1 (HOS1), which destabilizes CO protein in the morning period. |
AT1G25580 | Encodes suppressor of gamma response 1 (SOG1), a putative transcription factor governing multiple responses to DNA damage. |
AT1G71696 | Encodes a Putative Zn2+ carboxypeptidase, 4 splice variants have been identified but not characterized for different functions and/or expression patterns.SOL1 isolated as a suppressor of root- specific overexpression of CLE19, a clavata3 like gene. sol1 partially suppresses the short root phenotype caused by CLE19 overexpression. |
AT5G57710 | SMAX1 (SUPPRESSOR OF MAX2 1) is a member of an eight-gene family in Arabidopsis that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. SMAX1 is an important component of KAR/SL signaling during seed germination and seedling growth, but is not necessary for all MAX2-dependent responses. The mRNA is cell-to-cell mobile. |
AT1G12280 | Encodes a NB-LRR protein SUMM2 involved in defense response to bacterium. |
AT1G66980 | Encodes SNC4 (suppressor of npr1-1, constitutive 4), an atypical receptor-like kinase with two predicted extracellular glycerophosphoryl diester phosphodiesterase domains. |
AT4G16890 | Encodes a Toll Interleukin1 receptor-nucleotide binding-Leu- rich repeat-type resistance gene (TIR-NB-LRR-type) involved in the salicylic acid-dependent defense response pathway. Mutant plants constitutively express pathogenesis-related (PR) genes and are pathogen resistant. Resistance signaling in snc1 requires EDS1, MOS3 and PAD4. |
AT1G21580 | Encodes a zinc-finger protein that co-localizes with the exosome-associated RNA helicase HEN2 and functions as a co-factor of nuclear RNA quality control by the nucleoplasmic exosome. |
AT2G46340 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA1 is a PHYA signaling intermediate, putative regulator of PHYA signaling pathway. Light responsive repressor of photomorphogenesis. Involved in regulating circadian rhythms and flowering time in plants. Under constant light, the abundance of SPA1 protein exhibited circadian regulation, whereas under constant darkness, SPA1 protein levels remained unchanged. In addition, the spa1-3 mutation slightly shortened circadian period of CCA1, TOC1/PRR1 and SPA1 transcript accumulation under constant light. |
AT5G08150 | Encodes SOB5. Activation tagging lines accumulated higher level of cytokinin. |
AT4G25120 | Encodes a homolog of the yeast SRS2 (Suppressor of RAD Six-screen mutant 2) helicase. The Arabidopsis SRS2 is a functional 3?- to 5?-helicase. Biochemical studies show that SRS2 disrupts recombinogenic DNA intermediates and facilitates single strand annealing. |
AT4G37460 | Encodes a tetratricopeptide repeat domain containing protein that shows sequence similarity to those of transcriptional repressors in other organisms. Involved in mediating effector-triggered immunity. |
AT4G33925 | Encodes SSN2 (suppressor of sni1 2), a suppressor of SNI1 (AT4G18470). SSN2 contains a SWIM (SWI2/SNF2 and MuDR) domain found in a variety of prokaryotic and eukaryotic proteins. Involved in plant immune response and homologous recombination. |
AT5G11310 | The SOAR1 gene encodes a pentatricopeptide repeat (PPR) protein which localizes to both the cytosol and nucleus. Down-regulation of SOAR1 strongly enhances, but up-regulation of SOAR1 almost completely impairs, ABA responses, revealing that SOAR1 is a critical, negative, regulator of ABA signalling. Further genetic evidence supports that SOAR1 functions downstream of ABAR and probably upstream of an ABA-responsive transcription factor ABI5. Changes in the SOAR1 expression alter expression of a subset of ABA-responsive genes including ABI5. These findings provide important information to elucidate further the functional mechanism of PPR proteins and the complicated ABA signalling network. |
AT2G24020 | STIC2 was identifided in a screen for suppressors of chloroplast protein import defect in tic40. |
AT2G39140 | Suppressor of var2 variegation phenotype. Chloroplast localized. Loss of function mutant has defects in chloroplast protein translation and rRNA processing. Similar in sequence to pseudouridine synthase proteins. |
AT4G16390 | Encodes a pentatricopeptide repeat protein, SVR7 (SUPPRESSOR OF VARIEGATION7), required for FtsH-mediated chloroplast biogenesis. It is involved in accumulation and translation of chloroplast ATP synthase subunits. |
AT1G73720 | Encodes SMU1, a protein involved in RNA splicing. |
AT2G26460 | Encodes SMU2, a protein involved in RNA splicing. |
AT3G17910 | Encodes one of two Arabidopsis mitochondrial proteins similar to human SURF1 which is known to be involved in cytochrome c oxidase assembly. Mutations result in embryo lethality. |
AT2G01710 | SDJ2 functions partially redundantly with SDJ1 and SDJ3 and interacts with SUVH1 and SUVH3 to form a SUVH-SDJ complex. The complex binds promoters with DNA methylation and mediates transcriptional activation of promoter methylated genes. |
AT1G65660 | Encodes a CCHC zinc finger protein that may function as a step II splicing factor. In an epigenetic allele of SMP1 (in which SMP1 and SMP2 mRNA is reduced) organs are smaller and contain fewer cells. |
AT4G02020 | Encodes a polycomb group protein. Forms part of a large protein complex that can include VRN2 (VERNALIZATION 2), VIN3 (VERNALIZATION INSENSITIVE 3) and polycomb group proteins FERTILIZATION INDEPENDENT ENDOSPERM (FIE) and CURLY LEAF (CLF). The complex has a role in establishing FLC (FLOWERING LOCUS C) repression during vernalization. Performs a partially redundant role to MEA in controlling seed initiation by helping to suppress central cell nucleusendosperm proliferation within the FG. |
AT2G47210 | myb-like transcription factor family protein;(source:Araport11) |
AT5G07880 | member of mammalian SNAP25 Gene Family, a type of SNARE proteins with two chains. There are three members in Arabidopsis: SNAP30, SNAP29, and SNAP33. |
AT1G08560 | member of SYP11 syntaxin Gene Family |
AT5G16830 | member of SYP2 Gene Family. Over-expression of the gene in tobacco protoplasts leads to a disruption of vacuolar transport from the prevacuolar compartment (PVC) to the vacuole, but not from the Golgi apparatus to the plasma membrane. |
AT3G24350 | member of Glycoside Hydrolase Family 17 |
AT3G11820 | Encodes a syntaxin localized at the plasma membrane. SYR1/PEN1 is a member of the SNARE superfamily and functions in positioning anchoring of the KAT1 K+ channel protein at the plasma membrane. Transcription is upregulated by abscisic acid, suggesting a role in ABA signaling. Also functions in non-host resistance against barley powdery mildew. It is a nonessential component of the preinvasive resistance against Colletotrichum fungus. Required for mlo resistance. The syp121 point mutation results in stomatal phenotypes that reduce CO2 assimilation, slow vegetative growth and increase water use efficiency in the whole plant, conditional upon high light intensities and low relative humidity. The R20R21 motif of SYP121 are essential for SEC11 interaction. Mutation of the R20R21 motif blocks vesicle traffic without uncoupling the effects of SYP121 on solute and K+ uptake associated with the F9xRF motif; the mutation also mimicks the effects on traffic block observed on coexpression of the dominant negative SEC11?149 fragment. |
AT1G61290 | member of SYP12 Gene Family |
AT3G03800 | member of SYP13 Gene Family |
AT5G08080 | member of SYP13 Gene Family |
AT1G79590 | Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. |
AT1G28490 | Encodes SYP61, one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. SYP61 and SYP121 coordinate the trafficking of plasma membrane aquaporin PIP2;7 to modulate the cell membrane water permeability. |
AT3G09740 | syntaxin of plants 71 (SYP71) |
AT3G61450 | syntaxin of plants 73 (SYP73) |
AT1G51740 | member of SYP8 Gene Family |
AT3G20050 | Encodes a putative cytoplasmic chaperonin that is similar to mouse Tcp-1 (t complex polypeptide 1). |
AT5G58620 | Involved in control of defence gene expression post-transcriptionally through release from translation arrest within TZF9-PAB2-containing RNA granules. TZF9 shows phospho-mobility shift after flg22 treatment, inferred to be caused by phosphorylation through MPK3 and/or MPK6. The major MPK3/6-targeted phospho-sites are S181, S323, S343, S352, S356, S362 and S377. |
AT1G19290 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G24972 | Encodes a novel small protein which is similar to proteins of unknown function from other plant species. TPD1 is involved in cell specification during anther and pollen development. Identified in a screen for male steriles. Mutants lack tapetal cells and have an increased number of microsporocytes. Expressed in flower buds, leaves and young seedlings. In anthers, TPD1 is expressed throughout pollen development in parietal cells and sporocytes. Physically interacts with the LRR kinase EMS1 and that interaction results in phosphorylation of TPD1. |
AT5G44510 | Encodes TAO1 (Target of AvrB Operation), a TIR-NB-LRR protein that contributes to disease resistance induced by the Pseudomonas syringae effector AvrB. |
AT5G60120 | AP2 family transcription factor that is involved in regulation of flowering and innate immunity.Interacts with CRY1 and CRY2 during flowering as part of a regulatory circuit including FT and CO. TOE1/TOE2 are also targets of MiR172b repression and functions in regulation of innate immunity via repression of FLS. |
AT5G67180 | target of early activation tagged (EAT) 3;(source:Araport11) |
AT5G60200 | Encodes a Dof-type transcription factor. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
AT1G03780 | Homolog of vertebrate TPX2. Protein has three domains involved in nuclear targeting, one in nuclear export and two in microtubule binding. Involved in mitotic spindle assembly during late prophase and early prometaphase. |
AT3G13445 | TBP (TATA binding protein) associates with TAF(II)s (TBP-associated factors) to form the TFIID general transcription factor complex |
AT3G10070 | Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. |
AT1G02680 | Encodes a TBP-Associated Factor (TAF) that functions together with PRC2 in transcriptional regulation during seed development. |
AT1G50300 | TBP-associated factor 15;(source:Araport11) |
AT5G25150 | Encodes a putative TATA-binding-protein associated factor TAF5. TAFs are subunits of the general transcription factor IID (TFIID). |
AT4G31720 | Arabidopsis thaliana putative TBP-associated 15 kDa subunit protein (TAFII15) |
AT1G68800 | Encodes a TCP transcription factor, closely related to teosinte branched1, arrests axillary bud development and prevents axillary bud outgrowth. Transcription level and mutant phenotype are weaker than its homolog BRC1 (At3G18550). |
AT3G45150 | TCP domain protein 16;(source:Araport11) |
AT1G72010 | Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
AT3G15030 | Arabidopsis thaliana TCP family transcription factor. Regulated by miR319. Involved in heterchronic regulation of leaf differentiation. |
AT4G28840 | Encodes TCP INTERACTOR-CONTAINING EAR MOTIF PROTEIN 1 (TIE1), an important repressor of CINCINNATA (CIN)-like TEOSINTE BRANCHED1/CYCLOIDEA/PCF (TCP) transcription factors, which are key for leaf development. |
AT2G20080 | hypothetical protein;(source:Araport11) |
AT1G29010 | verprolin;(source:Araport11) |
AT5G24590 | Member of NAc protein family. Interacts with turnip crinkle virus (TCV) capsid protein. Transcription factor involved in regulating the defense response of Arabidopsis to TCV. |
AT5G13820 | Encodes a protein that specifically binds plant telomeric DNA repeats. It has a single Myb telomeric DNA-binding (SANT) domain in C-terminus that prefers the sequence TTTAGGG. Single Myb Histone (SMH) gene family member. |
AT1G25560 | Encodes a member of the RAV transcription factor family that contains AP2 and B3 binding domains. Involved in the regulation of flowering under long days. Loss of function results in early flowering. Overexpression causes late flowering and repression of expression of FT. Novel transcriptional regulator involved in ethylene signaling. Promoter bound by EIN3. EDF1 in turn, binds to promoter elements in ethylene responsive genes. |
AT5G60970 | TCP gene involved in heterochronic control of leaf differentiation. Transcription factor which controls thermomorphogenesis by positively regulating PIF4 activity. |
AT1G30210 | TCP family protein involved in heterochronic regulation of leaf differentiation. |
AT3G47620 | Encodes a transcription factor AtTCP14 that regulates seed germination. AtTCP14 shows elevated expression level just prior to germination. AtTCP14 is predominantly expressed in the vascular tissue of the embryo, and affects gene expression in radicles in a non-cell-autonomous manner. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
AT1G67770 | Similar to terminal ear1 in Zea mays. A member of mei2-like gene family; phylogenetic analysis revealed that TEL2 belongs to the third clade of mei2-like proteins (TEL clade), with conserved two N-terminal RNA recognition motifs (RRM), in addition to the C-terminal RRM, shared among all mei2-like proteins. Expression patterns were similar to TEL1, with lower expression levels in most tissues examined. |
AT5G17690 | Regulates the meristem response to light signals and the maintenance of inflorescence meristem identity. Influences developmental processes controlled by APETALA1. TFL2 silences specific genes within euchromatin but not genes positioned in heterochromatin. TFL2 protein localized preferentially to euchromatic regions and not to heterochromatic chromocenters. Involved in euchromatin organization. Required for epigenetic maintenance of the vernalized state. |
AT4G15870 | encodes a putative terpene synthase |
AT2G24210 | terpene synthase 10;(source:Araport11) |
AT5G48110 | The Col variant has no enzyme activity due to various substitution and deletion mutations. |
AT4G14770 | Regulates fate transition and cell Divisions in the stomatal lineage. |
AT2G03840 | TET13 encodes a member of the TETRASPANIN gene family that is expressed in the hypophysis, QC, root stem cells, lateral root primordia and is involved in primary root growth and lateral root development. |
AT5G57810 | Member of TETRASPANIN family |
AT4G28050 | Member of TETRASPANIN family |
AT4G30430 | Member of TETRASPANIN family |
AT3G43210 | Encodes a kinesin TETRASPORE. Required for cytokinesis in pollen. In mutants, all four microspore nuclei remain within the same cytoplasm after meiosis. |
AT4G30480 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808). Interacts with Hsp90/Hsp70 as co-chaperone. |
AT5G10090 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT2G41520 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT5G12430 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT1G04130 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808). Interacts with Hsp90/Hsp70 as co-chaperone. |
AT1G58450 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT5G21990 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808). Functions as a chaperone receptor at the chloroplast outer envelope, mediating Hsp70-dependent protein targeting to chloroplasts. It has been localized to the ER membrane, interacts with the Sec translocon, and has a potential function in post-translational protein transport into the ER. The mRNA is cell-to-cell mobile. |
AT3G14950 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. |
AT2G42580 | Encodes a member of the TTL family and contains a thioredoxin like domain and three tandom TPRs. Interacts physically with BRL2/VH1 and appears to play a role in brassiosteroid and auxin signaling. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. The mRNA is cell-to-cell mobile. |
AT5G10030 | Encodes a member of basic leucine zipper transcription gene family. Nomenclature according to Xiang, et al. (1997). |
AT3G12250 | basic leucine zipper transcription factor involved in the activation of SA-responsive genes. |
AT1G77920 | bZIP transcription factor family protein;(source:Araport11) |
AT1G24460 | Encodes a novel protein that co-immunoprecipitates with SYP41. It is involved in vacuolar trafficking and salt tolerance, potentially via a role in vesicle fusion and in maintaining TGN structure or identity. Mutants display delayed formation of the Brefeldin A (BFA) compartment in cotyledons upon application of BFA. |
AT5G48010 | Encodes an oxidosqualene cyclase involved in the biosynthesis of thalianol, a tricyclic triterpenoid of unknown function. Overexpression of THAS leads to dwarfing in the aerial tissues of Arabidopsis plants, but increases their root length. THAS is part of a small operon-like cluster of genes (with At5g48000 (THAH) and At5g47990 (THAD)) involved in thalianol metabolism. |
AT1G75030 | encodes a PR5-like protein |
AT5G54380 | Encodes THESEUS1 (THE1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
AT5G26000 | member of Glycoside Hydrolase Family 1. encodes one of two known functional myrosinase enzymes in Arabidopsis. The enzyme catalyzes the hydrolysis of glucosinolates into compounds that are toxic to various microbes and herbivores. |
AT5G48375 | Is a myrosinase pseudogene that codes for a truncated and frameshifted protein. Although TGG3 apparently is a pseudogene, its mRNA is expressed specifically in stamen and petal according to RT-PCR analysis. Western analysis shows no band of the size expected for a TGG3 protein. |
AT5G39950 | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. |
AT3G02730 | Encodes a type-f thioredoxin. Has a role in the short-term activation of carbon metabolism. Loss affects growth under short-day conditions. |
AT1G59730 | Thioredoxin H-type 7 , oxidoreductase located in cytosol and ER. Interacts with GPT1. |
AT1G03680 | Encodes a m-type thioredoxin (Trx-m1) localized in chloroplast stroma. |
AT2G35010 | Localized in mitochondria; associated with redox-active functions and effects on plant growth in constant light; joint role with Trx h2 in regulating NADPH redox balance and photosynthetic performance in fluctuating light. |
AT1G50320 | encodes a prokaryotic thioredoxin |
AT3G06730 | Encodes a plastidial thioredoxin (TRX) isoform that defines a branch of plastidial TRXs lying between x- and y-type TRXs and thus was named TRX z. Possesses disulfide reductase activity in vitro. TRX z was previously named as Trx p (thioredoxin putative and plastidic) before its thioredoxin activity was confirmed (Meng et al., PNAS 2010, 107:3900). Knockout mutant of TRX z has a severe albino phenotype and is inhibited in chloroplast development. Two fructokinase-like proteins (FLN1 and FLN2), members of the pfkB-carbohydrate kinase family, are potential TRX z targets. |
AT1G65980 | thioredoxin-dependent peroxidase |
AT1G65970 | thioredoxin-dependent peroxidase 2 |
AT4G01050 | hydroxyproline-rich glycoprotein family protein, contains a rhodanese homology domain. Required for anchoring the FNR flavoenzyme to the thylakoid membranes and sustaining high efficiency photosynthetic linear electron flow. The mRNA is cell-to-cell mobile. |
AT4G27800 | Choroplast protein phosphatase TAP38/PPH1 is required for efficient dephosphorylation of the LHCII anthena and state transition from state 2 to state 1. |
AT1G77490 | Encodes a chloroplastic thylakoid ascorbate peroxidase tAPX. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
AT3G07800 | Encodes a thymidine kinase that salvages DNA precursors. |
AT5G23070 | Encodes a thymidine kinase that salvages DNA precursors. The pyrimidine salvage pathway is crucial for chloroplast development and genome replication, as well as for the maintenance of its integrity. |
AT3G63180 | TIC-like protein;(source:Araport11) |
AT3G15070 | Encodes a RING-type E3 ligase that positively regulates CIN-like TCP activity to promote leaf development by mediating the degradation of the TCP repressor TIE1. |
AT4G32570 | TIFY domain protein 8;(source:Araport11) |
AT1G08260 | Similar to POL2A, DNA polymerase epsilon catalytic subunit. Essential for Arabidopsis growth. Null homozygotes are embryo lethal, partial loss of function alleles show embryo patterning defects such as root pole displacement. Delayed progression through cell cycle results in embryos with smaller numbers of larger cells. |
AT2G27120 | Encodes a protein with similarity to DNA polymerase epsilon catalytic subunit. Based on yeast two hybrid analysis, not predicted to be a subunit of the DNA polymerase epsilon complex. No phenotype observed in homozygous mutant embryos or plants but in combination with TIL1-1/til1-1 heterozygotes arrest earlier than til1 homozygotes suggesting TIL2 functions redundantly with TIL1. |
AT3G22380 | Encodes a nucleus-acting plant-specific clock regulator working close to the central oscillator and affecting the circadian gating of light responses. Circadian gating is the alteration of circadian phase according to the photoperiod of the entraining day/light cycle and the rhythmic antagonism of light responses in the early subjective night. TIC differentially regulates CCA1 and PRR9 from LHY, with LHY expression as a dominant genetic target of TIC action. Also shown to be invoved in the maintenance of Arabidopsis thaliana metabolic homeostasis. |
AT5G25810 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family (TINY). The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Ectopic or overexpression of this gene in a Ds tagged line has reduced cell expansion. The expression of this gene is induced by ethylene and light and appears to stimulate cytokinin biosynthesis. |
AT4G23640 | Functions as a potassium transporter and is required for the establishment of root tip growth. |
AT5G20350 | Encodes a protein containing ankyrin and DHHC-CRD domain. Acts to restrict the size of the swelling that forms at the beginning of root hair cell growth, possibly by a mechanism that requires RHD1. Mutant displays defects in both root hair and pollen tube growth. The mRNA is cell-to-cell mobile. |
AT4G23440 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
AT1G72890 | NBS TIR protein. |
AT3G60740 | Encodes tubulin-folding cofactor D. Mutants arrest during embryogenesis with embryos that are small, mushroom-shaped ('pilz') and consist of only one or few large cells each containing one or more variably enlarged nuclei and often cell wall stubs. Gene product necessary for continuous microtubule organization. |
AT2G27170 | Encodes a member of the Arabidopsis cohesin complex that is essential for viability and sister chromatid alignment. |
AT4G21790 | encodes a host factor that is required for TMV virus multiplication. The mRNA is cell-to-cell mobile. |
AT2G02180 | Necessary for the efficient multiplication of tobamoviruses. The mRNA is cell-to-cell mobile. |
AT3G55580 | TCF1 encodes a member of the RCC1 gene family and is required for chromatin based gene regulation of cold responsive genes in a CBF-independent manner. It is expressed in response to cold but not ABA. |
AT1G76970 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT2G38410 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT5G01760 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT4G32760 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT4G11780 | GAR2-like protein;(source:Araport11) |
AT3G61380 | Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11) |
AT4G00440 | GPI-anchored adhesin-like protein, putative (DUF3741);(source:Araport11) |
AT2G20240 | GPI-anchored adhesin-like protein, putative (DUF3741);(source:Araport11) |
AT3G53540 | afadin;(source:Araport11) |
AT5G43880 | methyl-coenzyme M reductase II subunit gamma, putative (DUF3741);(source:Araport11) |
AT1G67040 | DnaA initiator-associating protein;(source:Araport11) |
AT5G62170 | LOW protein: M-phase inducer phosphatase-like protein;(source:Araport11) |
AT2G17550 | RB1-inducible coiled-coil protein;(source:Araport11) |
AT2G36420 | nucleolin-like protein;(source:Araport11) |
AT5G03670 | histone-lysine N-methyltransferase SETD1B-like protein;(source:Araport11) |
AT5G42710 | hypothetical protein;(source:Araport11) |
AT3G05750 | Encodes a member of the TRM superfamily, that plays a role in preprophase band formation during plant cell division and controls the robustness of the orientation of that cell division. |
AT5G26910 | Encodes a member of the TRM superfamily, that plays a role in preprophase band formation during plant cell division and controls the robustness of the orientation of that cell division. |
AT3G55000 | Encodes a protein of unknown function that is involved in cortical microtubule organization. Mutants exhibit abnormal cell growth and patterns of division. TON1A can functionally complement TON1B and their roles appear to be redundant in plants. Encodes a novel protein that is similar to human FOP and OFD1 centrosomal proteins. Localizes to the preprophase band, cytoplasm and cell cortex where it is probably associated with the cortical cytoskeleton. TON1A associates with plant centrins CEN1 and CEN2. |
AT3G26520 | gamma tonoplast intrinsic protein 2 (TIP2). expressed throughout the plant and transcript level is increased upon NaCl or ABA treatments. NaCl stress-sensitive yeast mutant strains exhibit more resistance to salt when expressing this protein. |
AT4G35300 | tonoplast monosaccharide transporter2;(source:Araport11) |
AT3G16830 | TOPLESS family member which directly binds the N-terminal domain of SNC1 and interacts with TPR1. |
AT5G27030 | TOPLESS family member involved in the negative regulation of SNC1-dependent phenotypes. |
AT3G23890 | Encodes a topoisomerase II that is highly expressed in young seedlings. The protein is localized in the nucleus and gene expression levels are increased in proliferative tissues. |
AT5G16750 | Encodes a nucleolar localized WD-40 repeat protein that is preferentially expressed in dividing cells and is required for regulated division planes and embryo development. |
AT5G37770 | Encodes a protein with 40% similarity to calmodulin. Binds Ca(2+) and, as a consequence, undergoes conformational changes. CML24 expression occurs in all major organs, and transcript levels are increased from 2- to 15-fold in plants subjected to touch, darkness, heat, cold, hydrogen peroxide, abscisic acid (ABA), and indole-3-acetic acid. However, CML24 protein accumulation changes were not detectable. The putative CML24 regulatory region confers reporter expression at sites of predicted mechanical stress; in regions undergoing growth; in vascular tissues and various floral organs; and in stomata, trichomes, and hydathodes. CML24-underexpressing transgenics are resistant to ABA inhibition of germination and seedling growth, are defective in long-day induction of flowering, and have enhanced tolerance to CoCl(2), molybdic acid, ZnSO(4), and MgCl(2). Also regulates nitric oxide levels. |
AT5G57560 | Encodes a cell wall-modifying enzyme, rapidly upregulated in response to environmental stimuli. |
AT3G60220 | Encodes a putative RING-H2 zinc finger protein ATL4 (ATL4). |
AT4G22860 | TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of aurora kinase activity |
AT5G26290 | MATH domain containing TRAF-like protein. Mutants show defects in both male and female gametophyte development.Potentially regulated by siRNA/miRNA as a number of siRNA's map to the locus as well as miR777. |
AT3G25795 | Encodes a trans-acting siRNA that is phosphate starvation-upregulated and activated by PAP1 (MYB75). Has been identified as a translated small open reading frame by ribosome profiling. |
AT5G49615 | trans-acting siRNA (tasi-RNA) |
AT2G41630 | Encodes a transcription factor, TFIIB1, that plays important roles in pollen tube growth, guidance, and reception as well as endosperm development and is partially functionally different from AtTFIIB2 and AtTFIIB3/AtpBRP2. |
AT3G10330 | Cyclin-like family protein;(source:Araport11) |
AT3G23230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
AT4G35610 | Interacts with EIN3 to regulate transcriptional repression that leads to an inhibition of shoot growth in response to ethylene. |
AT5G58450 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G45290 | Transketolase;(source:Araport11) |
AT5G27640 | encodes a member of eukaryotic translation initiation factor 3B family. |
AT3G05540 | Encodes TCTP2, a homolog of Translationally Controlled Tumor Protein. Enhances in vitro plant regeneration. |
AT4G18270 | Encodes protein similar to similar to bacterial translocase I (mra Y). Expressed during flower bud development. |
AT5G11690 | mitochondrial inner membrane translocase |
AT1G72750 | translocase inner membrane subunit 23-2;(source:Araport11) |
AT1G17530 | Encodes a translocase of inner mitochondrial membrane. |
AT5G40930 | Form of TOM20, which is a component of the TOM complex involved in transport of nuclear-encoded mitochondrial proteins |
AT1G64220 | translocase of outer membrane 7 kDa subunit 2;(source:Araport11) |
AT3G46560 | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. Together with AtTIM10, AtTIM9 is non-redundantly essential for maintaining mitochondrial function of early embryo proper cells and endosperm free-nuclei. |
AT4G03320 | Encodes a component of the TIC (translocon at the inner envelope membrane of chloroplasts) protein translocation machinery mediating the protein translocation across the inner envelope of plastids. The Arabidopsis genome encodes four Tic20 homologous proteins, AT1G04940(Tic20-I), AT2G47840(Tic20-II), AT4G03320(Tic20-IV) and AT5G55710(Tic20-V). |
AT3G23710 | Tic22-like family protein;(source:Araport11) |
AT4G33350 | Tic22-like family protein;(source:Araport11) |
AT4G23430 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G16620 | chloroplast protein import (Tic40) |
AT2G24820 | translocon at the inner envelope membrane of chloroplasts 55-II;(source:Araport11) |
AT5G01590 | histone-lysine N-methyltransferase ATXR3-like protein;(source:Araport11) |
AT1G02280 | Encodes a GTP-binding GTP-ase. Component of the chloroplast protein import machinery. Required for import of POR B into plastids. Toc33 phosphorylation may not play an important role in vivo. |
AT5G09420 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT1G66150 | Receptor-like transmembrane kinase I (TMK1); key regulator in auxin signaling. High auxin and TMK1 play essential and positive roles in ABA signaling through regulating ABA INSENSITIVE 1 and 2 (ABI1/2). Inhibits the phosphatase activity of ABI2 by direct phosphorylation of threonine 321 (T321), a conserved phosphorylation site in ABI2 proteins, whose phosphorylation status is important for both auxin and ABA responses. |
AT2G01820 | Transmembrane kinase (TMK), member of the plant receptor-like kinase (RLK) family. TMKs are characterized by an extracellular leucine-rich-repeat (LRR) domain, a single transmembrane region and a cytoplasmic kinase domain. TMKs have been shown to act as critical modulators of cell expansion and cell proliferation. |
AT3G24660 | member of Receptor kinase-like protein family |
AT1G10950 | Encodes an Arabidopsis Transmembrane nine (TMN) protein. Transmembrane nine (TM9) proteins are localized in the secretory pathway of eukaryotic cells and are involved in cell adhesion and phagocytosis. Functions in the deposition of rhamnogalacturonan II and I for cell growth. |
AT1G34790 | Encodes a zinc finger protein; involved in photomorphogenesis, flavonoid biosynthesis, flower and seed development. |
AT4G09820 | TT8 is a regulation factor that acts in a concerted action with TT1, PAP1 and TTG1 on the regulation of flavonoid pathways, namely proanthocyanidin and anthocyanin biosynthesis. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Also important for important for marginal trichome development. It binds the promoter of both AT3G26790 and AT1G28300.TT8 interacts with JAZ proteins to regulate anthocyanin accumulation. TT8 acts maternally to affect seed FA biosynthesis and inhibits seed FA accumulation by down-regulating a group of genes either critical to embryonic development or important in the FA biosynthesis pathway. TT8 represses the activities of LEAFY COTYLEDON1, LEAFY COTYLEDON2, and FUSCA3, the critical transcriptional factors important for seed development. |
AT3G28430 | Encodes a peripheral membrane protein localized at the Golgi apparatus that is involved in membrane trafficking, vacuole development and in flavonoid accumulation in the seed coat. Mutant seed color is pale brown. |
AT5G24520 | Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes. Auxin and ethylene responsiveness of TTG1 transcription is lost in myb12 mutants. |
AT2G16950 | TRN1 is an importin beta protein that functions as a nuclear import receptor for AtGRP7 and in interacts with AGO1 to affect miRNA loading. |
AT4G27550 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active but no trehalose phosphatase (TPP)-like domain. |
AT1G78090 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
AT1G22210 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT2G22190 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT4G12430 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G65140 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G78580 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain but no trehalose phosphatase (TPP)-like domain. ATTPS1 is able to complement yeast tps1 mutants in vivo. The gene product modulates cell growth but not cell differentiation by determining cell wall deposition and cell division. The N-terminal domain of TPS1 has a nuclear localization signal and an autoinhibitory function. The C-terminal domain is important for catalytic fidality of TPS1 and for appropriate signaling of the sucrose status by trehalose 6-phosphate levels in the plant (10.1105/tpc.19.00837). |
AT1G16980 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active but no trehalose phosphatase (TPP)-like domain. |
AT1G17000 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active but no trehalose phosphatase (TPP)-like domain. |
AT3G46590 | Encodes a protein that specifically binds plant telomeric DNA (TTTAGGG)n repeats. Involved in bending DNA. Expressed throughout the plant with highest levels in flowers. |
AT1G17460 | Arabidopsis thaliana myb family transcription factor (At1g17460) |
AT2G37025 | TRF-like 8;(source:Araport11) |
AT3G12560 | Encodes a telomeric DNA-binding protein. |
AT2G19450 | Encodes Acyl-CoA:diacylglycerol acyltransferase (DGAT) catalyzes the final step of the triacylglycerol synthesis pathway. An insertion mutation in the TAG1 gene results in altered lipid phenotype. Role in senescence and seed development. Its preferred substrate is linolenoyl-CoA (C18:3-CoA). |
AT1G45201 | Target of AtGRP7 regulation. |
AT3G12060 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT3G06080 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT2G37720 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT1G60790 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT3G28150 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. A putative xyloglucan O-acetyltransferase. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT1G01430 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers.Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT4G01080 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT2G40320 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). Chemical evidence for function comes from xylan NMR analysis. Secondary wall thickening phenotype can be only observed in double or triple mutant with esk1. |
AT2G38320 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).TBL34 are required only for xylan 3-O-monoacetylation and 2,3-di-O-acetylation. This biochemical phenotype can be observed in tbl34 esk1, double mutant and tbl34 tbl35 esk1 triple mutants. |
AT2G34070 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TBL37 expression is regulated by MYC2 and activated in response to JA. |
AT1G29050 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT5G20590 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT3G11570 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT1G45231 | Encodes a trimethylguanosine synthase that is required for chilling tolerance. tgs1 mutant have a striking chilling sensitive phenotype in which leaf and flower development are dramatically disrupted after long-term chilling treatment. |
AT3G55440 | Encodes triosephosphate isomerase. |
AT1G73980 | TTM1 is a triphosphate tunnel metalloenzyme that displays pyrophosphatase activity. It contains both a uridine kinase (UK) domain,CYTH domain, a coiled-coil domain and a transmembrane domain at the C-terminal Mutants show a delay in leaf senescence. Can functionally complement TTM1 and vise versa. (PMID:28733390) |
AT1G26190 | TTM2 is a triphosphate tunnel metalloenzyme that displays pyrophosphatase activity.It contains both a uridine kinase (UK) domain and CYTH domain. TTM2 is involved in negative regulation defense response to pathogens (PMID:28733390). |
AT5G53200 | Encodes a R3MYB transcription inhibitor that regulates trichome patterning. Mutants produce trichome clusters whereas other transcriptional inhibitors involved in this patterning are involved in trichome density regulation. Natural hypofunctional alleles producing trichome development in fruits have been found. |
AT1G05830 | Encodes a homolog of trithorax, a histone-lysine N-methyltransferase. Paralog of ATX1. Unlike ATX1 which is involved in trimethylating of histone H3-mysine 4, ATX2 is involved in dimethylating of histone H3-lysine 4. ATX1 and ATX2 influence the expression of largely nonoverlapping gene sets. The expression pattern of ATX2 is also different from that of ATX1. |
AT2G26200 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G17610 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
AT5G14600 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G31600 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G27760 | Encodes tRNA isopentenyltransferase, similar to yeast MOD5. |
AT1G74700 | Encodes a protein with RNAse Z activity suggesting a role in tRNA processing. |
AT1G52160 | Encodes a tRNase Z. |
AT2G29330 | tropinone reductase;(source:Araport11) |
AT1G70560 | TAA1 is involved in the shade-induced production of indole-3-pyruvate (IPA), a precursor to IAA, a biologically active auxin. It is also involved in regulating many aspects of plant growth and development from embryogenesis to flower formation and plays a role in ethylene-mediated signaling. This enzyme can catalyze the formation of IPA from L-tryptophan. Though L-Trp is expected to be the preferred substrate in vivo, TAA1 also acts as an aminotransferase using L-Phe, L-Tyr, L-Leu, L-Ala, L-Met, and L-Gln. Lines carrying mutations in this gene are unaffected by auxin transporter inhibitor NPA. Double mutant analysis and exogenous auxin treatment suggest that this gene is required for auxin signaling during lateral root and root meristem development. The activity of TAA1 can be controlled by phosphorylation of residue T101, which, when phosphorylated results in loss of activity. TAA1 is a target of TMK4. |
AT4G24670 | Encodes a protein with similarity to the TAA1 trytophan aminotransferase involved in IAA biosynthesis. Double mutant analyses suggest that this protein is involved in regulating many aspects of plant growth and development from embryogenesis to flower formation and plays a role in ethylene-mediated signaling.TAR2 is required for reprogramming root architecture in response to low nitrogen conditions. |
AT3G54640 | Catalyzes the conversion of indole-3-glycerolphosphate to indole, the penultimate reaction in the biosynthesis of tryptophan. Functions as a heterocomplex with tryptophan synthase beta subunit (TSA2). |
AT5G38530 | TSBtype2 encodes a type 2 tryptophan synthase beta subunit that catalyzes a condensation reaction between serine and indole to generate tryptophan.It appears to form a homodimer. Its biological role has not yet been determined, but it has a very high affinity for indole which may be involved in allowing TSBtype2 to carefully limit free indole build-up. But, to date no overall change in plant morphology or seedling root growth have been observed in tsbtype2 mutants, indicating that this gene is not essential under optimum conditions. n most organs, TSBtype2 is transcripts are expressed at a lower level than TSB1 but in dry seeds they are expressed at comparable levels. |
AT2G36960 | Arabidopsis thaliana myb/SANT domain protein |
AT3G27060 | Encodes one of the 3 ribonucleotide reductase (RNR) small subunit genes. TSO2 transcription occurs predominantly at the S-phase of the cell cycle and its expression pattern is consistent with its role in dNDP biosynthesis during DNA replication in actively dividing cells. Critical for cell cycle progression, DNA damage repair and plant development. |
AT1G76900 | Member of plant TLP family. Contains terminal F-box domain, interacts with ASK proteins. Tethered to the PM. |
AT1G25280 | Member of TLP family |
AT1G43640 | Member of TLP family of tubby like proteins that also contain an F-Box. |
AT1G16070 | Member of TLP family |
AT5G23860 | beta-tubulin, preferentially expressed in endodermal and phloem cells of primary roots and in the vascular tissues of leaves, stems, and flowers. The mRNA is cell-to-cell mobile. |
AT5G62690 | encodes tubulin beta-2/beta-3 chain The mRNA is cell-to-cell mobile. |
AT2G29550 | Encodes a beta-tubulin that is expressed in leaves, roots and flowers. |
AT4G20890 | tubulin 9 The mRNA is cell-to-cell mobile. |
AT5G07350 | RNA binding protein with nuclease activity essential for stress response. Involved in mechanisms acting on mRNAs entering the secretory pathway. Functionally redundant with TSN2. |
AT5G46220 | Encodes a protein with alkaline ceramidase activity that is involved in regulation of turgor during pollen tube growth and silique stomatal movement. Tod1 is expressed specifically in pollen and silique guard cells. Loss of function mutations have reduced fertility due to defects in pollen transmission. |
AT1G14610 | Required for proper proliferation of basal cells. |
AT4G20370 | Encodes a floral inducer that is a homolog of FT. Plants overexpressing this gene flower earlier than Col. Loss-of-function mutations flower later in short days. TSF and FT play overlapping roles in the promotion of flowering, with FT playing the dominant role and together playing an antagonistic role to TFL1 in the determination of inflorescence meristem identity. .TSF sequences show extensive variation in different accessions and may contribute to quantitative variation in flowering time in these accessions. TSF has a complex pattern of spatial expression; it is expressed mainly in phloem and expression is regulated by daylength and vernalization. |
AT3G02140 | Encodes a protein that acts in the nucleus and is an important negative regulator of ABA and salt stress responses, and could play a critical role in controlling root elongation, floral initiation and starch degradation. |
AT4G03560 | Encodes a depolarization-activated Ca(2+) channel. Anti-sense experiments with this gene as well as Sucrose-H(+) symporters and complementation of yeast sucrose uptake mutant cch1 suggest that this protein mediates a voltage-activated Ca(2+ )influx. Mutants lack detectable SV channel activity suggesting TPC1 is essential component of the SV channel. Patch clamp analysis of loss of function mutation indicates TPC1 does not affect Ca2+ signaling in response to abiotic and biotic stress. |
AT5G15170 | Tyrosyl-DNA phosphodiesterase 1 involved in DNA repair. TDP1 is involved the repair of Topoisomerase 1 cleavage complexes (tdp1 mutants are camptotecin hypersensitive). tdp1/wss1A double mutants show a synergistic sensitivity after camptothecin treatment. tdp1/mus81 double mutants show an elevated number of dead cells in root meristems after camptothecin treatment (compared to the single mutants). |
AT3G50670 | Encodes U1 snRNP 70K |
AT3G10400 | Encodes a U12-type spliceosomal protein U11/U12-31K. Involved in U12 intron splicing via RNA chaperone activity and affects plant development. |
AT1G09230 | Encodes a U12-type spliceosomal protein that is an indispensible component of the minor spliceosome and plays a crucial role in U12 intron splicing and plant development. |
AT2G30260 | encodes U2B", which is a component of the U2 snRNP complex. Its precise role in pre-mRNA splicing is still unknown. It has been suggested that U2B0 may not be required for the splicing reaction itself but may have a role in U2 snRNP biogenesis. Deletion analysis of the U2B0 gene fusion has identified the N-terminal RNP-80 motif as sufficient for localization to the coiled body and the nucleus. |
AT3G57765 | encodes a small nuclear RNA, which is a part of small nuclear ribonuclear particle (snRNP) and is involved in RNA processing such as splicing and polyadenylation. |
AT5G09585 | U2;(source:Araport11) |
AT3G56705 | U2-6;(source:Araport11) |
AT4G00690 | UB-like protease 1B;(source:Araport11) |
AT1G21610 | wound-responsive family protein;(source:Araport11) |
AT1G55060 | Ubiquitin-like gene, believed to be a pseudogene because of amino acid substitutions in 3 of the 5 ubiquitin repeats found in the UBQ12 gene product |
AT3G62250 | ubiquitin 5;(source:Araport11) |
AT2G35635 | encodes a ubiquitin-like protein that contains tandem repeats of the ubiquitin coding region, but at least one repeat per gene encodes a protein with amino acid substitutions. The mRNA is cell-to-cell mobile. |
AT5G41340 | Belongs to Ubiquitin conjugating enzyme family. Gene expression is developmentally regulated. |
AT2G36170 | 60S ribosomal protein L40-1;(source:Araport11) |
AT5G66240 | Encodes a WD40-repeat protein that interacts with the E3 Cullin Ring Ligase subunit DDB1a and is involved in secondary wall modification and thickening by regulating the degradation of specific proteins. RNAi-mediated silencing results in anther indehiscence and infertility. |
AT3G17205 | ubiquitin protein ligase 6;(source:Araport11) |
AT2G30110 | Encodes a ubiquitin-activating enzyme (E1), involved in the first step in conjugating multiple ubiquitins to proteins targeted for degradation. Gene is expressed in most tissues examined. Mutant is able to revert the constitutive defense responses phenotype of snc1, which indicates the gene is involved in defense response. It also indicates that ubiquitination plays a role in plant defense signalling. |
AT5G53300 | Encodes a ubiquitin conjugating enzyme. |
AT1G75440 | ubiquitin-conjugating enzyme 16;(source:Araport11) |
AT5G42990 | ubiquitin-conjugating enzyme 18;(source:Araport11) |
AT1G50490 | Encodes one of two ubiquitin-conjugating enzymes belonging to the E2-C gene family (the other being UBC19). Transcript is always found in diving cells, but also in other non-dividing cells. |
AT2G16920 | ubiquitin-conjugating enzyme 23;(source:Araport11) |
AT3G15355 | ubiquitin-conjugating enzyme 25;(source:Araport11) |
AT1G53025 | Ubiquitin-conjugating enzyme family protein;(source:Araport11) |
AT3G17000 | Group XIV ubiquitin-conjugating enzyme that functions negative regulation of drought stress. |
AT1G16890 | UBC36/UBC13B encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair. It can bind to the MMZ/UEV1 proteins in vitro. |
AT2G46030 | Ubiquitin conjugating enzyme E2 |
AT5G02880 | encodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis. The mRNA is cell-to-cell mobile. |
AT3G53090 | encodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis. |
AT2G32780 | ubiquitin-specific protease 1;(source:Araport11) |
AT5G06600 | Encodes a ubiquitin-specific protease which together with UBP13 deubiquitinates DA1, DAR1 and DAR2, hence reducing their peptidase activity. Works upstream of DA1, DAR1 and DAR2 to restrict their protease activity and hence fine-tune plant growth and development. |
AT1G17110 | Encodes a ubiquitin-specific protease, and its activity has been confirmed in an in vitro assay. ubp15 mutants have defects in cell proliferation, and the associated processes of leaf, root, stem, flower, and silique development. UBP15 can be found in the nucleus and cytoplasm in transient assays. Though UBP15 is expressed in many tissues, UBP15 transcript levels are higher in rosette leaves and inflorescences than in other parts of the plant. Together with CUC2/CUC3-DA1 part of a regulatory module controls the initiation of axillary meristems, thereby determining plant architecture. As a direct substrate of DA1 peptidase, it represses the initiation of axillary meristems. |
AT4G24560 | Encodes a ubiquitin-specific protease. There is no evidence for a phenotype in ubp16-1 mutants, however, double mutant analysis with ubp15 mutants reveals a role for UBP16 in plant development and cell proliferation. |
AT2G24640 | ubiquitin-specific protease 19;(source:Araport11) |
AT5G57990 | Encodes a ubiquitin-specific protease. |
AT3G49600 | Encodes a ubiquitin-specific protease which catalyzes deubiquitination of histone H2B and is required for heterochromatin silencing.Loss of function mutations display autonomous endosperm development and embryo arrest. Loss of function also results in an increase in expression of the PcG complex target gene PHE1. |
AT2G40930 | Encodes ubiquitin-specific protease with nuclear localization signals that is likely to be involved in ubiquitin-mediated protein degradation. |
AT3G21280 | Encodes a ubiquitin-specific protease. |
AT4G10570 | encodes a ubiquitin-specific protease family member, UBP9. |
AT2G32300 | Encodes a uclacyanin, a protein precursor that is closely related to precursors of stellacyanins and a blue copper protein from pea pods. |
AT1G12780 | Encodes a UDP-glucose epimerase that catalyzes the interconversion of the sugar nucleotides UDP-glucose UDP-galactose via a UDP-4-keto-hexose intermediate. Responsive to stress. |
AT1G63180 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in pollen development. |
AT3G23820 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. The mRNA is cell-to-cell mobile. |
AT3G11340 | Encodes a uridine diphosphate-dependent glucosyltransferase that conjugates isoleucic acid and modulates plant defense via glucosylation of N-hydroxypipecolic acid. |
AT4G23010 | UDP-galactose transporter 2;(source:Araport11) |
AT1G14360 | UDP-galactose transporter 3;(source:Araport11) |
AT3G46180 | UDP-galactose transporter 5;(source:Araport11) |
AT4G32272 | Golgi-localized nucleotide sugar (UDP-GlcNAc) transporter that delivers an essential substrate for the maturation of N-glycans and the GIPC class of sphingolipids. |
AT3G03250 | Is thought to encode a cytosolic UDP-glucose pyrophosphorylase with strong similarity to potato UTP--glucose-1-phosphate uridylyltransferase. Downregulated by flooding. |
AT5G17310 | UDP-glucose pyrophosphorylase 2;(source:Araport11) |
AT2G29750 | UDP-glucosyl transferase 71C1;(source:Araport11) |
AT2G15480 | UDP-glucosyl transferase 73B5;(source:Araport11) |
AT2G36790 | The At2g36790 gene encodes a UDP-glucose:flavonol-3-O-glycoside-7-O-glucosyltransferase (UGT73C6)attaching a glucosyl residue to the 7-O-position of the flavonols kaempferol, quercetin and their 3-O-glycoside derivatives. |
AT3G53160 | UGT73C7 is induced by pathogen infection. It glycosylates p-coumaric acid and ferulic acid to modulate phenylpropanoid metabolism and induce innate immune response. |
AT5G05870 | UDP-glucosyl transferase 76C1;(source:Araport11) |
AT2G26480 | UDP-glucosyl transferase 76D1;(source:Araport11) |
AT1G22360 | UDP-glucosyl transferase 85A2;(source:Araport11) |
AT2G43820 | Encodes a nicotinate-O-glycosyltransferase. Induced by Salicylic acid, virus, fungus and bacteria. Also involved in the tryptophan synthesis pathway. Independent of NPR1 for their induction by salicylic acid. UGT74F1 transfers UDP:glucose to salicylic acid (forming a glucoside (SAG) and a glucose ester (SGE)), benzoic acid, and anthranilate in vitro. UGT74F2 shows a weak ability to catalyze the formation of the p-aminobenzoate-glucose ester in vitro. But, UGT75B1 appears to be the dominant pABA acylglucosyltransferase in vivo based on assays in leaves, flowers, and siliques. |
AT3G53520 | Encodes a Golgi localized isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
AT5G42420 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT4G09810 | Nucleotide-sugar transporter family protein. Can function in yeast as glucose transporter. |
AT1G34020 | Nucleotide-sugar transporter family protein. Can function in yeast as glucose transporter. |
AT5G52560 | Encodes a protein with UTP:sugar 1-phosphate uridylyltransferase activity, which has been shown to use a wide range of substrates including glucose-1-P, galactose-1-P, xylose-1-P, arabinose-1-P and glucuronate-1-P. The enzyme was shown to require Mg2+ or Mn2+ for activity. Mutations in USP can lead to a complete loss of male fertility. |
AT3G46440 | Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase. UDP-glucuronic acid decarboxylase produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
AT2G28760 | Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase. |
AT2G28315 | UXT1 is a member of the NST-KT subfamily of nucleotide/sugar transporters. It is localized to the golgi and ER. UXT1 functions as a UDP-Xyl transporter. The mRNA is cell-to-cell mobile. |
AT2G30460 | UXT2 is a member of the NST-KT subfamily of nucleotide/sugar transporters. It is localized to the golgi and functions as a UDP-Xyl transporter. |
AT1G06890 | UXT3 is a member of the NST-KT subfamily of nucleotide/sugar transporters. It is localized to the golgi and functions as a UDP-Xyl transporter. |
AT3G28030 | Required for repair of pyrimidine-pyrimidinone (6-4) dimers. The mRNA is cell-to-cell mobile. |
AT1G03190 | UV damage and heat induce a common stress response in plants that leads to tissue death and reduced chloroplast function. The UVH6 product is suggested to be a negative regulator of this response. |
AT5G58970 | UCP2 and its paralog UCP1 is a member of the PUMP2 family of uncoupling proteins. It functions as a mitochondrial transporter of spartate, glutamate and dicarboxylates. |
AT4G12920 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT2G47470 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. The mRNA is cell-to-cell mobile. |
AT3G03690 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT3G10560 | member of CYP77A |
AT4G02030 | Vps51/Vps67 family (components of vesicular transport) protein;(source:Araport11) |
AT3G58450 | USP domain containing protein, member of the universal stress protein family, regulated by ABA and possibly regulated by the ABA-dependent transcription factor AREB/ABF. Involved in the regulation of seed germination. |
AT2G47270 | Encodes UPBEAT1 (UPB1), a transcription factor with a bHLH domain. Regulates the expression of a set of peroxidases that modulate the balance of reactive oxygen species (ROS) between the zones of cell proliferation and the zone of cell elongation where differentiation begins. Disruption of UPB1 activity alters this ROS balance, leading to a delay in the onset of differentiation. Regulates growth by mediating cell cycle progression. |
AT1G65740 | ascorbic acid mannose pathway regulator (DUF295);(source:Araport11) |
AT3G53900 | Encodes UPP, a plastidial uracil phosphoribosyltransferase (UPRT) involved in uracil salvage. Loss-of-function mutation causes dramatic growth retardation, a pale-green to albino phenotype, abnormal root morphology and chloroplastic disorders. |
AT2G26230 | Encodes a urate oxidase that is involved in peroxisome maintenance. |
AT2G03590 | Encodes a member of a class of allantoin transporters. |
AT4G17050 | Encodes a protein with ureidoglycine aminohydrolase activity. |
AT5G43600 | Encodes a protein with ureidoglycolate amidohydrolase activity in vitro. It is 27% identical and 43% similar to the E. coli allantoate amidohydrolase (AAH), but, in vitro assays with purified protein and allantoate as a substrate do not show any increase in ammonium concentration, indicating that there this enzyme has no AAH activity. The mRNA is cell-to-cell mobile. |
AT3G27190 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
AT1G55810 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
AT3G27440 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
AT2G36310 | Encodes a cytoplasmic nucleoside hydrolase. It has the highest levels of activity with uridine followed by xanthosine. It shows little activity with inosine and none with cytidine. Mutant analyses indicate that it plays a role in purine and pyrimidine catabolism. |
AT3G56620 | nodulin MtN21-like transporter family protein |
AT2G40900 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
AT2G39510 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
AT5G13670 | nodulin MtN21-like transporter family protein |
AT4G08300 | nodulin MtN21-like transporter family protein |
AT4G08290 | nodulin MtN21-like transporter family protein |
AT5G64700 | nodulin MtN21-like transporter family protein |
AT1G11450 | nodulin MtN21-like transporter family protein |
AT4G01440 | nodulin MtN21-like transporter family protein |
AT4G28040 | nodulin MtN21-like transporter family protein |
AT1G60050 | nodulin MtN21-like transporter family protein |
AT5G40212 | Pseudogene of AT5G40240; nodulin MtN21 family protein |
AT3G18200 | nodulin MtN21-like transporter family protein |
AT3G28060 | nodulin MtN21-like transporter family protein |
AT3G28130 | nodulin MtN21-like transporter family protein |
AT3G53210 | nodulin MtN21-like transporter family protein |
AT5G07050 | nodulin MtN21-like transporter family protein |
AT5G59920 | Isolated in a screen for UV-B insensitive mutants using a hypocotyl growth inhibition assay. Mutants are defective in a number of UV-B responses. |
AT5G63860 | UV-B-specific signaling component that orchestrates expression of a range of genes with vital UV-protective functions. Located in the nucleus and the cytosol. Associates with chromatin via histones. UV-B light promotes URV8 protein accumulation in the nucleus. UVR8 interaction with COP1 is negatively regulated by RUP1 and RUP2. |
AT4G38510 | One of three genes encoding the vacuolar ATP synthase subunit B1. The protein binds to and co-localizes with F-actin, bundles F-actin to form higher-order structure, and stabilizes actin filaments in vitro. |
AT3G28715 | Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes, which plays an important role in plant growth. VHA-d2 is one of the two subunit isoforms. Plays a role in response to oxidative stress by affecting H+ flux and AHA gene expression. |
AT2G14740 | Encodes a vacuolar sorting receptor that participates in vacuolar sorting in vegetative tissues and in seeds. The mRNA is cell-to-cell mobile. |
AT4G25950 | V-ATPase G-subunit like protein |
AT4G11150 | Encodes a vacuolar H+-ATPase subunit E isoform 1 which is required for Golgi organization and vacuole function in embryogenesis. The mRNA is cell-to-cell mobile. |
AT4G23710 | vacuolar ATP synthase subunit G2;(source:Araport11) |
AT3G03090 | Encodes a vacuolar membrane-localized glucose transporter that can also transport fructose. Mutations in these gene have effects on seed germination and time to flowering. |
AT3G08560 | vacuolar H+-ATPase subunit E isoform 2;(source:Araport11) |
AT1G75630 | vacuolar H+-pumping ATPase 16 kD proteolipid (ava-p) mRNA, The mRNA is cell-to-cell mobile. |
AT1G62660 | Glycosyl hydrolases family 32 protein;(source:Araport11) |
AT2G01770 | Encodes an iron transporter required for iron sequestration into vacuoles. Expressed in developing embryo and seed. Localized in the vacuolar membrane. |
AT1G48550 | VPS26C is a component of a retromer complex, it is involved in endosome to lysosome protein transport and root hair growth. |
AT1G12470 | zinc ion binding protein;(source:Araport11) |
AT5G53530 | Homolog of yeast retromer subunit VPS26. Part of a retromer-like protein complex involved in endosome to lysosome protein transport. |
AT4G27690 | vacuolar protein sorting 26B;(source:Araport11) |
AT1G22860 | Vacuolar sorting protein 39;(source:Araport11) |
AT1G08190 | Might be involved in protein sorting to the vacuole. The mRNA is cell-to-cell mobile. |
AT1G77140 | A peripheral membrane protein that associates with microsomal membranes, likely to function in the transport of proteins to the vacuole. It is a member of Sec1p protein family. It may be involved in the regulation of vesicle fusion reactions through interaction with t-SNAREs at the Golgi trans face. |
AT4G21560 | vacuolar protein sorting-associated protein-like protein;(source:Araport11) |
AT2G28520 | Vacuolar proton ATPase subunit VHA-a isoform 1. Localized in the trans-Golgi network. The mRNA is cell-to-cell mobile. |
AT2G21410 | Vacuolar proton ATPase subunit VHA-a isoform 2. Localized in the tonoplast. Required for efficient nutrient storage but not for sodium accumulation. |
AT4G39080 | Vacuolar proton ATPase subunit VHA-a isoform 3. Localized in the tonoplast. The mRNA is cell-to-cell mobile. |
AT1G30900 | VACUOLAR SORTING RECEPTOR 6;(source:Araport11) |
AT1G08820 | Encodes VAP33-like protein that interacts with cowpea mosaic virus protein 60K. Is a SNARE-like protein that may be involved in vesicular transport to or from the ER. |
AT2G47040 | Share high homologies with a group of pectin methylesterases (PME), pollen specific, and is required for enhancing the growth of pollen tube in style and transmitting tract tissues. |
AT1G57820 | Encodes a 645-amino acid methylcytosine-binding protein with a PHD domain, two RING finger domains, and an SRA domain that is involved in centromere heterochromatinization. This protein functions as an E3 ubiquitin ligase in vitro. The protein has been shown to bind to methylated cytosines of CG, CNG and CNN motifs via its SRA domain but has a preference for the former. It plays a role in the establishment/maintenance of chromatin structure during cell division and is localized in the nucleus. Plants over-expressing VIM1/ORTH2 show an inhibition in root growth and a delay in flowering. Both over-expression of GFP:ORTH2 and loss of ORTH2/VIM1 lead to decreased levels of DNA methylation. GFP:ORTH2 over-expressers also have increased levels of FWA transcripts. |
AT3G13290 | varicose-like protein;(source:Araport11) |
AT1G79620 | VRLK1 is a LRR kinase involved in switching between cell elongation and secondary cell wall thickening.VRLK1 is a member of a gene family that includes a small number of recently duplicated paralogs. |
AT3G20557 | hypothetical protein;(source:Araport11) |
AT2G32280 | Encodes a member of a plant-specific gene family that is required for embryo provasculature development. The gene product regulates vascular network complexity and connectivity in cotyledons. |
AT3G24440 | Encodes Vernalization Insensitive 3-like 1 (VIL1). VIL1 is involved in the photoperiod and vernalization of Arabidopsis by regulating expression of the related floral repressors Flowering Locus C (FLC) and Flowering Locus M (FLM). VIL1, along with VIN3 (Vernalization Insensitive 3) is necessary for the chromatin modification to FLC and FLM. |
AT5G61150 | Encodes highly hydrophilic protein involved in positively regulating FLC expression. Mutants are early flowering and show a loss of FLC expression in the absence of cold. Member of PAF-C complex. |
AT1G61040 | Encodes a yeast Paf1C subunit homolog required for the expression of the MADS box gene FLC and other members of the FLC/MAF MADS-box gene family. Member of PAF-C complex. |
AT5G57380 | Encodes a plant homeodomain protein VERNALIZATION INSENSITIVE 3 (VIN3). In planta VIN3 and VRN2, VERNALIZATION 2, are part of a large protein complex that can include the polycomb group (PcG) proteins FERTILIZATION INDEPENDENT ENDOSPERM (FIE), CURLY LEAF (CLF), and SWINGER (SWN or EZA1). The complex has a role in establishing FLC (FLOWERING LOCUS C) repression during vernalization. |
AT2G18880 | vernalization5/VIN3-like protein;(source:Araport11) |
AT3G29100 | Encodes a member of the Arabidopsis v-SNARE (vesicle soluble NSF attachment protein receptor) family that has 3 members: VTI11, VTI12, and VTI13. This gene is not expressed at levels detectable by RT-PCR. However, one EST corresponding to this gene has been isolated. |
AT1G26670 | member of VTI1 Gene Family. Normally localizes to the transgolgi network and plasma membrane. A dominant mutation (zip1) alters the subcellular localization of VTI12 and suppresses loss of function mutation (zag1) of VTI11. Interacts with members of the SYP family. Involved in protein trafficking to protein storage vacuoles. |
AT4G32150 | AtVAMP711 is a member of Synaptobrevin-like AtVAMP7C, v-SNARE (soluble N-ethyl-maleimide sensitive factor attachment protein receptors) protein family. SNAREs have been divided into four subgroups: Qa-, Qb-, Qc- and R-SNAREs. R-SNAREs are classified into three groups, the Sec22-, YKT6- and VAMP7-like R-SNAREs. One R-SNARE and three Q-SNAREs (one of each subgroup) form the trans-SNARE complex, which governs specific membrane fusions. VAMP7 proteins consist of three distinct domain, the N-terminal longin-domain (LD), the SNARE motif (SNM) and a transmembrane domain. In spite of the high similarities among the VAMP7 proteins, they show different subcellular localizations. VAMP7C is vacuolar-localized and its LD is essential for the correct localization. Generally, it is suggested that the complete LD is the determinant of subcellular sorting in both animal and plant R-SNAREs. |
AT2G33110 | member of VAMP72 Gene Family |
AT1G04760 | member of Synaptobrevin -like protein family |
AT3G54300 | Encodes a member of Synaptobrevin -like protein family. VAMP727 is a R-SNARE and interacts with SYP22/VTI11/SYP51. It is required for trafficking of storage proteins to the protein storage vacuoles (PSV) and also for PSV organization and biogenesis. Loss of function mutations have no phenotype but double mutants with SYP22 are embryo lethal. |
AT3G50080 | Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,3, and 4. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes. |
AT2G29890 | Encodes a ubiquitously expressed villin-like protein, whose mRNA may be alternatively processed. Villin belongs to a superfamily of actin binding proteins called the villin/gelsolin family. Animal villins are involved in actin binding. VLN1 protein co-localizes with actin filaments in several assays. VLN1 binds and bundles F-actin in a calcium-independent manner. It does not nucleate, cap or sever actin filaments and it stabilizes actin filaments, protecting them from ADF-mediated depolymerization. |
AT3G57410 | Encodes a protein with high homology to animal villin. VLN3 is a Ca2+-regulated villin involved in actin filament bundling. |
AT4G30160 | Encodes a major actin filament bundling protein that is involved in root hair growth through regulating actin organization in a Ca2+-dependent manner. |
AT5G57320 | actin filament bundling protein P-115-ABP protein;(source:Araport11) |
AT4G11220 | VIRB2-interacting protein 2;(source:Araport11) |
AT1G43700 | Encodes a VirE2-interacting protein. VIP1 mediates nuclear translocation of VirE2 via its amino half, and interacts with histone H2A via it carboxyl half. Involved in osmosensory response. The mRNA is cell-to-cell mobile. |
AT5G15090 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. Purified VDAC3 is shown to have voltage-dependent anion channel activity. |
AT3G49920 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. |
AT4G21550 | VP1/ABI3-like 3;(source:Araport11) |
AT2G17790 | Encodes a protein with similarity to yeast VPS35 which encodes a component of the retromer involved in retrograde endosomal transport. Mutants partially suppress the loss of VTI11 function in Arabidopsis and restores gravitropism in the double mutant. The mRNA is cell-to-cell mobile. |
AT2G44340 | VQ18 is an ABA responsive gene and interacts with the ABI5 transcription factor. Along with its paralog VQ26, it is involved in negative regulation of ABA responses during early seedling development. |
AT3G60090 | VQ26 is an ABA responsive gene and interacts with the ABI5 transcription factor. Along with its paralog VQ18, it is involved in negative regulation of ABA responses during early seedling development. |
AT1G21210 | cell wall-associated ser/thr kinase involved in cell elongation and lateral root development |
AT1G16120 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
AT1G16150 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. Likely involved in Arabidopsis root mineral responses to Zn2+, Cu2+, K+, Na+ and Ni+. The mRNA is cell-to-cell mobile. |
AT1G75500 | An Arabidopsis thaliana homolog of Medicago truncatula NODULIN21 (MtN21). The gene encodes a plant-specific, predicted integral membrane protein and is a member of the Plant-Drug/Metabolite Exporter (P-DME) family (Transporter Classification number: TC 2.A.7.3) and the nodulin MtN21-like transporter family. |
AT1G72290 | Encodes a Kunitz-protease inhibitor, a water-soluble chlorophyll protein involved in herbivore resistance activation. |
AT2G22680 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT3G23090 | Member of the microtubule regulatory protein WVD2/WDL family WDL3 stabilizes cortical microtubules and is involved in light induced hypocotyl elongation. WDL3 is ubiquinated by COP1, leading to its degadation in the dark, |
AT5G20520 | Encodes a Bem46-like protein. WAV2 negatively regulates root bending when roots alter their growth direction. It's not involved in sensing environmental stimuli (e.g. gravity, light, water, touch). |
AT5G54200 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G26570 | Encodes a coiled-coil protein WEB1 (weak chloroplast movement under blue light 1). WEB1, together with another coiled-coil protein WEB2/PMI2 (At1g66840), maintains the chloroplast photorelocation movement velocity. |
AT3G07760 | Ortholog of Peach WEEP gene containing a sterile alpha motif. In peach, WEEP is responsible for pendulous branching phenotype. However in Arabidopsis no morphological branching defect has been observed in mutant lines. |
AT4G13870 | Encodes a protein with homology to the exonuclease domain of hWRN-p of human protein Werner Syndrome Exonuclease (WEX). Forms a complex with the heterodimeric factor Ku. The interaction with KU stimulates WEX exonuclease activity. |
AT2G39120 | Encodes a mitochondrial protein essential for the splicing of group II introns in two mitochondrial genes for which splicing factors had not previously been identified: rpl2 and ccmFc. |
AT1G14410 | Encodes a homolog of the potato p24 protein. Binds single strand telomeric repeats. Negatively regulates telomerase activity and telomere length. |
AT2G41420 | proline-rich family protein;(source:Araport11) |
AT1G08290 | WIP domain protein 3;(source:Araport11) |
AT1G51220 | Encodes a WIP domain containing protein. Putative target of WRKY53.WIP5 is a paralog of NTT and along with WIP4,acts redundantly in cell fate determination during primary root development. MP binds to AuxRE motifs within the WIP5 gene and likely regulates its expression. |
AT2G34150 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
AT3G04910 | Serine/threonine protein kinase, whose transcription is regulated by circadian rhythm. |
AT3G22420 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
AT2G01830 | Histidine kinase: cytokinin-binding receptor that transduces cytokinin signals across the plasma membrane |
AT4G28240 | Member of the wound-induced polypeptide (WIP) family. Positively regulates plant resistance against Pst DC3000 by enhancing PTI responses. |
AT5G56210 | Encodes an outer nuclear membrane protein that anchors RanGAP1 to the nuclear envelope. It interacts with SUN proteins and is required for maintaining the elongated nuclear shape of epidermal cells. |
AT5G27940 | WPP domain protein 3;(source:Araport11) |
AT5G11390 | Encodes one of the WPP domain-interacting proteins (WIT1/AT5G11390, WIT2/AT1G68910) required for RanGAP nuclear envelope association in root tip cells. Ran GTPase plays essential roles in multiple cellular processes, including nucleocytoplasmic transport, spindle formation, and postmitotic nuclear envelope reassembly. The cytoplasmic Ran GTPase activating protein RanGAP is critical to establish a functional RanGTP/RanGDP gradient across the nuclear envelope and is associated with the outer surface of the nuclear envelope in metazoan and higher plant cells. Arabidopsis thaliana RanGAP association with the root tip nuclear envelope requires a family of likely plant-specific nucleoporins combining coiled-coil and transmembrane domains (CC-TMD) and WPP domain-interacting proteins (WIPs). WIT1 and WIT2 have been identified as a second family of CC-TMD proteins, structurally similar, yet clearly distinct from the WIP family, that is required for RanGAP nuclear envelop association in root tip cells. |
AT3G54320 | WRINKLED1 encodes transcription factor of the AP2/ERWEBP class. Protein has two plant-specific (AP2/EREB) DNA-binding domains and is involved in the control of storage compound biosynthesis in Arabidopsis. Mutants have wrinkled seed phenotype, due to a defect in the incorporation of sucrose and glucose into triacylglycerols. Transgenic sGsL plants (21-day-old) grown on 6% sucrose for 24 hours had 2-fold increase in levels of expressions (sGsL line carries a single copy of T-DNA containing the Spomin::GUS-Spomin::LUC dual reporter genes in the upper arm of chromosome 5 of ecotype Col-0. The sporamin .minimal. promoter directs sugar-inducible expression of the LUC and GUS reporters in leaves). Regulation by LEC2 promotes fatty acid accumulation during seed maturation. Splice form 3 is the major form expressed in seedlings.Mutations in the C terminal intrinsically disordered region increase the stability of WRI1 and lead to increased oil production. |
AT1G55600 | member of WRKY Transcription Factor; Group I. It has WRKY domain at its N terminal end and zinc-finger like motif. |
AT2G44745 | WRKY gene family member involved in vascular/pith development. |
AT1G30650 | member of WRKY Transcription Factor; Group II-e |
AT2G23320 | Encodes WRKY DNA-binding protein 15 (WRKY15). |
AT2G24570 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
AT4G31800 | Pathogen-induced transcription factor. Binds W-box sequences in vitro. Forms protein complexes with itself and with WRKY40 and WRKY60. Constitutive expression of WRKY18 enhanced resistance to P. syringae, but its coexpression with WRKY40 or WRKY60 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. The mRNA is cell-to-cell mobile. |
AT2G47260 | Encodes a member of WRKY Transcription Factor; Group I. Involved in nematode feeding site establishment and auxin mediated PIN polar localization in roots. Expression is induced by auxin. |
AT5G07100 | Encodes WRKY DNA-binding protein 26 (WRKY26). |
AT5G52830 | Encodes a WRKY transcription factor WRKY27. Mutation in Arabidopsis WRKY27 results in delayed symptom development in response to the bacterial wilt pathogen Ralstonia solanacearum. |
AT2G03340 | Encodes WRKY DNA-binding protein 3 (WRKY3). |
AT2G34830 | member of WRKY Transcription Factor; Group II-e |
AT1G13960 | Encodes WRKY DNA-binding protein 4 (WRKY4). |
AT1G80840 | Pathogen-induced transcription factor. Binds W-box sequences in vitro. Forms protein complexes with itself and with WRKY40 and WRKY60. Coexpression with WRKY18 or WRKY60 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. The mRNA is cell-to-cell mobile. |
AT2G46130 | member of WRKY Transcription Factor; Group II-c |
AT3G01970 | member of WRKY Transcription Factor; Group I |
AT2G46400 | Encodes a WRKY transcription factor that contributes to the feedforward inhibition of osmotic/salt stress-dependent LR inhibition via regulation of ABA signaling and auxin homeostasis. |
AT5G49520 | Encodes WRKY48, a member of the WRKY Transcription Factor. WRKY48 is a stress- and pathogen-induced transcriptional activator that represses plant basal defense. The mRNA is cell-to-cell mobile. |
AT5G64810 | member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses. |
AT1G64000 | member of WRKY Transcription Factor; Group II-c |
AT1G69310 | Encodes WRKY57, a member of the WRKY Transcription Factor. Activation of WRKY57 confers drought tolerance. |
AT3G01080 | member of WRKY Transcription Factor; Group I |
AT1G18860 | member of WRKY Transcription Factor; Group II-b |
AT1G66560 | member of WRKY Transcription Factor; Group III |
AT1G29280 | member of WRKY Transcription Factor; Group II-e The mRNA is cell-to-cell mobile. |
AT3G58710 | member of WRKY Transcription Factor; Group II-e |
AT5G12420 | WSD7 can function in vitro as wax ester synthase but does not appear to be essential for cuticular wax biosynthesis. |
AT5G35690 | WT-like growth phenotype mutants of WSS1B do not display hypersensitivities after treatment with DNA-Protein crosslink inducing agents like camptothecin or cis-platin. |
AT3G18010 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Its mRNA is expressed in the initiating vascular primordium of the cotyledons during heart and torpedo stages. |
AT1G20710 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
AT3G03660 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
AT5G17810 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Together with WOX11, WOX12 is involved in de novo root organogenesis. |
AT5G55820 | Encodes a plant ortholog of the inner centromere protein (INCENP), which is implicated in the control of chromosome segregation and cytokinesis in yeast and animals. Required for female gametophytic cell specification and seed development. |
AT4G34890 | Encodes a xanthine dehydrogenase, involved in purine catabolism. Ubiquitously expressed, but the transcript level is altered during aging, senescence, salt and cold stress, ABA treatment, and dark treatment. RNAi lines that suppress both XDH1 and XDH2 produce small plants with reduced fertility and accelerated leaf senescence. Role in drought tolerance. |
AT2G21150 | Encodes a nuclear localized XAP5 family protein involved in light regulation of the circadian clock and photomorphogenesis. XCT loss of function mutations also show decreased levels of DCL1, 3 and 4 and correspondingly lower levels of certain small RNAs suggesting a role in sRNA biogenesis. |
AT2G28840 | Putative E3 Ub protein ligase; regulates thermoresponsive hypocotyl growth through mediating degradation of the thermosensor ELF3. |
AT5G57740 | Encodes a RING-type E3 ligase XBAT32. Mediates the proteasomal degradation of the ethylene biosynthetic enzyme, 1-aminocyclopropane-1-carboxylate synthase 7. |
AT4G14365 | hypothetical protein;(source:Araport11) |
AT3G23280 | Encodes a ubiquitin ligase that is a novel player in ethylene signaling involved in negatively regulating apical hook curvature, with alternative splicing controlling dual targeting to the nuclear and cytoplasmic compartments. |
AT1G20850 | Cysteine peptidase. Enzyme activity detected in leaf. |
AT5G49660 | The gene encodes receptorlike kinase (RLK). Involved in the maintenance organization of cell files or cell morphology in conductive elements. Functions as a receptor for CEP1 peptide. Mediates nitrate uptake signaling. |
AT5G33290 | Acts as a xylogalacturonan xylosyltransferase within the XGA biosynthesis pathway. Involved in pectin biosynthesis. |
AT5G64080 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT5G57540 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. |
AT4G25820 | Encodes a xyloglucan endotransglycosylase with a clear preference for non-fucosylated xyloglucan polymer. The mRNA is cell-to-cell mobile. |
AT4G14130 | xyloglucan endotransglycosylase-related protein (XTR7) |
AT1G65310 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. |
AT4G30280 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. |
AT4G30290 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed throughout both the main and the lateral root, with intensive expression at the dividing and elongating regions. Is expressed in lateral root primordia but expression ceases after lateral root begins to grow. Involved in cell proliferation in incised inflorescence stems. |
AT5G48070 | putative xyloglucan endotransglycosylase/hydrolase, expressed primarily in the stele of mature non-elongating regions of both the main and the lateral root. Is expressed in lateral root primordia but expression ceases after lateral root begins to grow. Involved in cell proliferation in incised inflorescence stems. |
AT5G57550 | xyloglucan endotransglycosylase-related protein (XTR3) |
AT4G18990 | xyloglucan endotransglucosylase/hydrolase 29;(source:Araport11) |
AT2G06850 | endoxyloglucan transferase (EXGT-A1) gene |
AT5G65730 | xyloglucan endotransglucosylase/hydrolase 6;(source:Araport11) |
AT4G25810 | xyloglucan endotransglycosylase-related protein (XTR6) |
AT5G07720 | Galactosyl transferase GMA12/MNN10 family protein;(source:Araport11) |
AT1G18690 | Galactosyl transferase GMA12/MNN10 family protein;(source:Araport11) |
AT1G74380 | xyloglucan xylosyltransferase 5;(source:Araport11) |
AT2G35610 | Encodes an arabinosyltransferase that modifies extensin proteins in root hair cells. |
AT4G05410 | Encodes a nucleolar protein with seven WD40-repeats that plays a role in embryo sac development and is critical for the correct positioning of the division plane of zygote and the apical cell lineage in Arabidopsis. YAO may act by modulating nucleolar function, such as rRNA biogenesis, during early embryogenesis and gametogenesis. |
AT2G27200 | Encodes a cytosolic protein that shares 77.3% identity with AtLSG1-2 at the protein sequence level. The mRNA is cell-to-cell mobile. |
AT2G39340 | Putative mRNA export factor that is highly co-expressed with PRP4KA. |
AT3G06290 | Encodes a component of the conserved TREX-2 complex that couples mRNA transcription with nucleo-cytoplasmic export, that is required for prevention of epigenetic gene silencing and has additional roles in regulating siRNAs and DNA methylation. |
AT4G24120 | Member of a small family of oligopeptide transporters similar to the yellow stripe locus of maize (ZmYS1). |
AT5G24380 | closest Arabidopsis homolog of Zea maize metal-phytosiderophore/metal-nicotianamine transporter ZmYS1 |
AT3G17650 | Arabidopsis thaliana metal-nicotianamine transporter YSL5 |
AT3G27020 | Arabidopsis thaliana metal-nicotianamine transporter YSL6 |
AT1G65730 | Arabidopsis thaliana metal-nicotianamine transporter YSL4 |
AT1G48370 | Arabidopsis thaliana metal-nicotianamine transporter YSL4 |
AT5G51640 | Encodes leaf-senescence-related protein. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT4G06634 | Encodes an ABA responsive C2H2-type zinc finger transcription factor with both transcriptional repression and activation domains, that binds a G-rich, 11-bp DNA-binding motif. YY1 binds to the promoter of ABR1 and disruption represses ABA- and salt-induced ABR1 expression. |
AT1G63700 | Member of MEKK subfamily, a component of the stomatal development regulatory pathway. Mutations in this locus result in embryo lethality. |
AT4G30260 | Encodes one of the two YPT/RAB GTPase Interacting Protein 4a (YIP4a) and YIP4b (formerly YIP2), which form a TGN-localized complex with ECHIDNA (ECH). This complex is required for the secretion of cell wall polysaccharides. |
AT1G48910 | A paternally expressed imprinted gene. |
AT1G04610 | Encodes a member of the YUC family that is expressed in the root apex and is ethylene inducible in the root. |
AT2G33230 | Encodes a flavin monooxygenase gene which belongs to the tryptophan-dependent auxin biosynthetic pathway and enhances drought resistance. |
AT4G28720 | Auxin biosynthetic gene regulated by RVE1. Overexpression leads to suppression of bri1 phenotype. |
AT5G11320 | Belongs to the YUC gene family. Encodes a predicted flavin monooxygenase. YUC4 is part of a pathway linking auxin biosynthesis and gynoecium development. It is expressed in the stigma and the apical meristem and is ethylene inducible. |
AT5G43890 | Encodes a YUCCA-like putative flavin monooxygenase, the activation tagging mutant has increased level of IAA, increased auxin response and phenotype of auxin overproduction, rescues erecta mutant phenotype |
AT5G25620 | Encodes a member of a family of flavin monooxygenases with an important role in auxin biosynthesis. YUC6 possesses an additional thiol-reductase activity that confers drought resistance independently of auxin biosynthesis. |
AT5G57360 | Encodes clock-associated PAS protein ZTL; Also known as FKF1-like protein 2 or ADAGIO1(ADO1). A protein containing a PAS domain ZTL contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. ZTL is the F-box component of an SCF complex implicated in the degradation of TOC1. |
AT1G64760 | ZERZAUST is an atypical β-1,3 glucanase. The protein is localized to punctate regions of the apoplast, near cellular junctions. Mutants in Ler background display aberrant floral morphology and twisted siliques and stems. Biochemcial analysis of mutant cell wall composition indicates cell wall defects. However, in Col background, there is no phenotype due to compensatory effect of ZETH gene expression. |
AT1G56590 | Involved in vesicle trafficking between the trans -Golgi network and vacuoles. |
AT2G32930 | Encodes a zinc finger protein. |
AT2G37430 | Encodes a member of the zinc finger family of transcriptional regulators. It is expressed in many root tips, primary roots, cotyledons and hypocotyl. The protein is localized to the nucleus. Overexpression of ZAT11 causes increased root growth and increased sensitivity to nickel ions. The mRNA is cell-to-cell mobile. |
AT3G02830 | Encodes a zinc finger protein that binds to PORA mRNA in vivo and recruits the Pfr form of phytochrome to the 5′-UTR of PORA mRNA to regulate translation of the mRNA. |
AT3G43790 | zinc induced facilitator-like 2;(source:Araport11) |
AT3G54826 | Zim17-type zinc finger protein;(source:Araport11) |
AT5G62160 | member of Fe(II) transporter isolog family |
AT3G20870 | ZIP metal ion transporter family;(source:Araport11) |
AT2G32270 | A member of Zrt- and Irt-related protein (ZIP) family. transcript is induced in response to zinc deficiency in the root. also response to iron deficiency. |
AT2G46800 | Encodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis. |
AT2G37740 | zinc-finger protein 10;(source:Araport11) |
AT3G19580 | Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild desiccation. The protein is localized to the nucleus and acts as a transcriptional repressor. |
AT5G65930 | encodes a novel member of the kinesin superfamily of motor proteins. recessive mutations have reduced number of trichome branches. |
AT5G61350 | Encodes a membrane-localized receptor-like kinase that regulates root hair tip growth by maintaining cytoplasmic Ca2+ gradients. Knockouts of CAP1 produced more cytoplasmic NH4+ and ceased growth of root hairs on MS medium except when NH4+ was depleted; NH4+ depletion reestablished the Ca2+ gradient necessary for normal growth. The lower net NH4+ influx across the vacuolar membrane and relatively alkaline cytosolic pH of root hairs in cap1-1 relative to wild type implied that mutation of CAP1 results in more NH4+ accumulation in the cytoplasm. Furthermore, CAP1 functionally complemented npr1 kinase yeast mutant defective in high-affinity NH4+ uptake via MEP2, distinguishing CAP1 as a cytosolic modulator of NH4+ level that participates in NH4+ homeostasis-regulated root hair growth by modulating tip-focused cytoplasmic Ca2+ gradients. |
AT2G25095 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC. Pri-mRNA coordinates for MIR156a (converted to TAIR10 based on PMID19304749): Chr2: 10677064-10673957 (reverse), length: 3108 bp; exon coordinates: exon 1: 10677064 to 10676955, exon 2: 10676613 to 10676366, exon 3: 10674380 to 10674338, exon 4: 10674245 |
AT4G31877 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC. Pri-mRNA coordinates for MIR156c (converted to TAIR10 based on PMID19304749): Chr4: 15415873-15413295 (reverse), length: 2580 bp; exon coordinates: exon 1: 15415873 |