37 senescence-associated transcription factors (Sen-TFs) ChIP-seq or DAP-seq data
| ABF3 Targets | Description |
| AT3G19500 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT2G16750 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT3G53400 | peptide upstream protein;(source:Araport11) |
| AT3G14280 | LL-diaminopimelate aminotransferase;(source:Araport11) |
| AT3G15180 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G18310 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
| AT5G02180 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G55380 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT5G02890 | Encodes a protein with similarity to transferases in plants and fungi. |
| AT5G06930 | nucleolar-like protein;(source:Araport11) |
| AT1G75770 | hypothetical protein;(source:Araport11) |
| AT3G15630 | plant/protein;(source:Araport11) |
| AT2G22650 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT3G05900 | neurofilament protein-like protein;(source:Araport11) |
| AT1G09980 | Putative serine esterase family protein;(source:Araport11) |
| AT1G64120 | pre-tRNA tRNA-Leu (anticodon: CAA);(source:Araport11, TAIR10) |
| AT2G16245 | Natural antisense transcript overlaps with AT2G16250;(source:Araport11) |
| AT5G63710 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G03370 | C2 calcium/lipid-binding and GRAM domain containing protein;(source:Araport11) |
| AT4G39985 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT5G22794 | hypothetical protein;(source:Araport11) |
| AT5G15175 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
| AT1G07580 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT3G58090 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT2G28360 | SIT4 phosphatase-associated family protein;(source:Araport11) |
| AT5G51400 | PLAC8 family protein;(source:Araport11) |
| AT3G49650 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G44600 | hypothetical protein;(source:Araport11) |
| AT5G19730 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G37520 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
| AT4G22785 | tRNA-Lys (anticodon: CTT) |
| AT4G39200 | Ribosomal protein S25 family protein;(source:Araport11) |
| AT4G03038 | other_RNA;(source:Araport11) |
| AT3G02710 | Encodes a protein with a putative role in mRNA splicing. |
| AT3G24518 | Natural antisense transcript overlaps with AT3G24520;(source:Araport11) |
| AT3G04470 | Ankyrin repeat family protein;(source:Araport11) |
| AT2G28725 | forkhead box protein G1;(source:Araport11) |
| AT3G28750 | hypothetical protein;(source:Araport11) |
| AT3G27845 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT1G56140 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT1G49140 | NADH dehydrogenase ubiquinone 1 beta subcomplex subunit 10-B-like protein (Complex I subunit NDUFS6);(source:Araport11) |
| AT3G20650 | mRNA capping enzyme family protein;(source:Araport11) |
| AT2G30230 | 6,7-dimethyl-8-ribityllumazine synthase;(source:Araport11) |
| AT4G35150 | O-methyltransferase family protein;(source:Araport11) |
| AT5G42930 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G30720 | Thioesterase/thiol ester dehydrase-isomerase superfamily protein;(source:Araport11) |
| AT5G62950 | RNA polymerase II, Rpb4, core protein;(source:Araport11) |
| AT1G75180 | Erythronate-4-phosphate dehydrogenase family protein;(source:Araport11) |
| AT2G31560 | signal transducer/transcription protein, putative (DUF1685);(source:Araport11) |
| AT4G27610 | intracellular protein transporter;(source:Araport11) |
| AT2G15042 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G15980 | Coatomer, beta subunit;(source:Araport11) |
| AT3G52980 | Zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein;(source:Araport11) |
| AT4G10730 | Protein kinase superfamily protein |
| AT1G08950 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
| AT5G19050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G61540 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G43110 | transmembrane protein;(source:Araport11) |
| AT1G33415 | Natural antisense transcript overlaps with AT1G33420 and AT1G33430;(source:Araport11) |
| AT2G37750 | hypothetical protein;(source:Araport11) |
| AT5G41390 | PLAC8 family protein;(source:Araport11) |
| AT5G15700 | Nucleus encoded plastid RNA polymerase. Localized in mitochondria and chloroplast. |
| AT5G19440 | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), apple tree, PIR:T16995; NOT a cinnamyl-alcohol dehydrogenase |
| AT5G63700 | zinc ion binding / DNA binding protein;(source:Araport11) |
| AT1G32660 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G77840 | Translation initiation factor IF2/IF5;(source:Araport11) |
| AT1G77260 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G54460 | wound-responsive protein-like protein;(source:Araport11) |
| AT4G30130 | DUF630 family protein (DUF630 and DUF632);(source:Araport11) |
| AT2G35640 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G50390 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT4G01860 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT5G40150 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G14920 | Peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase A protein;(source:Araport11) |
| AT3G51180 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G73470 | hypothetical protein;(source:Araport11) |
| AT1G15590 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT2G34100 | nonsense-mediated mRNA decay-like protein;(source:Araport11) |
| AT1G67720 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G18265 | zein-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT4G10080 | transmembrane protein;(source:Araport11) |
| AT3G54130 | Josephin family protein;(source:Araport11) |
| AT1G76920 | F-box family protein;(source:Araport11) |
| AT4G17650 | Polyketide cyclase / dehydrase and lipid transport protein;(source:Araport11) |
| AT5G35460 | membrane protein;(source:Araport11) |
| AT3G57570 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G20790 | F-box family protein;(source:Araport11) |
| AT5G02650 | hypothetical protein;(source:Araport11) |
| AT1G10350 | DNAJ heat shock family protein;(source:Araport11) |
| AT2G33280 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G41100 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G77560 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
| AT1G78150 | N-lysine methyltransferase;(source:Araport11) |
| AT3G13940 | DNA binding / DNA-directed RNA polymerase;(source:Araport11) |
| AT1G50270 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G15150 | MATE efflux family protein;(source:Araport11) |
| AT1G61065 | 1,3-beta-glucan synthase component (DUF1218);(source:Araport11) |
| AT4G11355 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT1G04985 | triacylglycerol lipase-like protein;(source:Araport11) |
| AT1G05380 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger protein;(source:Araport11) |
| AT1G26300 | BSD domain-containing protein;(source:Araport11) |
| AT1G15230 | hypothetical protein;(source:Araport11) |
| AT1G76980 | patatin-like phospholipase domain protein;(source:Araport11) |
| AT4G38950 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT3G50030 | ARM-repeat/Tetratricopeptide repeat (TPR)-like protein;(source:Araport11) |
| AT4G23900 | Nucleoside diphosphate kinase family protein;(source:Araport11) |
| AT2G44995 | other_RNA;(source:Araport11) |
| AT1G05150 | Calcium-binding tetratricopeptide family protein;(source:Araport11) |
| AT1G14680 | early endosome antigen;(source:Araport11) |
| AT5G16110 | hypothetical protein;(source:Araport11) |
| AT2G24310 | TPRXL;(source:Araport11) |
| AT4G10955 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G60380 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT3G55640 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT1G19373 | snoRNA;(source:Araport11) |
| AT4G01270 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G49410 | Transcription factor IIIC, subunit 5;(source:Araport11) |
| AT4G36980 | CLK4-associating serine/arginine-rich protein;(source:Araport11) |
| AT5G44330 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G15530 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G62280 | DUF1442 family protein (DUF1442);(source:Araport11) |
| AT3G44820 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT2G39960 | Microsomal signal peptidase 25 kDa subunit (SPC25);(source:Araport11) |
| AT3G46630 | DCL protein (DUF3223);(source:Araport11) |
| AT5G20660 | Zn-dependent exopeptidases superfamily protein;(source:Araport11) |
| AT4G32470 | Cytochrome bd ubiquinol oxidase, 14kDa subunit;(source:Araport11) |
| AT3G03370 | hypothetical protein;(source:Araport11) |
| AT1G10590 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT4G31460 | Ribosomal L28 family;(source:Araport11) |
| AT3G18170 | Glycosyltransferase family 61 protein;(source:Araport11) |
| AT4G01460 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT2G17300 | hypothetical protein;(source:Araport11) |
| AT3G27210 | hypothetical protein;(source:Araport11) |
| AT1G52855 | hypothetical protein;(source:Araport11) |
| AT3G63340 | kinase superfamily protein;(source:Araport11) |
| AT5G20190 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G13460 | Encodes protein phosphatase 2A (PP2A) B'theta subunit. Targeted to peroxisomes. |
| AT5G58720 | smr (Small MutS Related) domain-containing protein;(source:Araport11) |
| AT4G01530 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G26860.1);(source:TAIR10) |
| AT1G02475 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G15825 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G59050 | G patch domain protein;(source:Araport11) |
| AT3G13800 | Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11) |
| AT1G19720 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT2G05290 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G41570.1);(source:TAIR10) |
| AT2G33840 | Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial;(source:Araport11) |
| AT2G18860 | Syntaxin/t-SNARE family protein;(source:Araport11) |
| AT3G62970 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT1G43580 | Sphingomyelin synthetase family protein;(source:Araport11) |
| AT1G79290 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
| AT1G78520 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT3G56880 | VQ motif-containing protein;(source:Araport11) |
| AT5G16375 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT5G45700 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G54620 | Ankyrin repeat family protein;(source:Araport11) |
| AT2G41000 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT4G23040 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT2G27315 | egg cell-secreted-like protein (DUF1278);(source:Araport11) |
| AT4G30010 | ATP-dependent RNA helicase;(source:Araport11) |
| AT5G57150 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G11825 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT5G07860 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G58150 | Optic atrophy 3 protein (OPA3);(source:Araport11) |
| AT3G51478 | pseudogene of glutamate receptor family |
| AT1G76954 | Encodes a defensin-like (DEFL) family protein. |
| AT2G18770 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G45660 | adenine phosphoribosyltransferase;(source:Araport11) |
| AT3G49930 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT1G11740 | ankyrin repeat family protein;(source:Araport11) |
| AT1G05085 | hypothetical protein;(source:Araport11) |
| AT2G41410 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT3G51230 | chalcone-flavanone isomerase family protein;(source:Araport11) |
| AT5G63390 | O-fucosyltransferase family protein;(source:Araport11) |
| AT2G21430 | Papain family cysteine protease;(source:Araport11) |
| AT5G41050 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT5G58090 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT1G02350 | protoporphyrinogen oxidase-like protein;(source:Araport11) |
| AT2G40390 | neuronal PAS domain protein;(source:Araport11) |
| AT1G15060 | alpha/beta hydrolase family protein;(source:Araport11) |
| AT4G28085 | transmembrane protein;(source:Araport11) |
| AT3G56408 | Natural antisense transcript overlaps with AT3G56410;(source:Araport11) |
| AT2G23120 | Late embryogenesis abundant protein, group 6;(source:Araport11) |
| AT1G03590 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT4G24380 | dihydrofolate reductase;(source:Araport11) |
| AT2G41830 | Uncharacterized protein;(source:Araport11) |
| AT1G20270 | 2-oxoglutarate-dependent dioxygenase |
| AT1G10000 | Ribonuclease H-like superfamily protein;(source:Araport11) |
| AT5G05795 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
| AT2G48000 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G12672 | thionin-like protein;(source:Araport11) |
| AT1G09260 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G78070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G02960 | Ribosomal protein S12/S23 family protein;(source:Araport11) |
| AT1G04320 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT2G02600 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT5G25240 | stress induced protein;(source:Araport11) |
| AT3G13404 | hypothetical protein;(source:Araport11) |
| AT5G65100 | Ethylene insensitive 3 family protein;(source:Araport11) |
| AT3G51130 | transmembrane protein;(source:Araport11) |
| AT1G72780 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT1G72800 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G23890 | NHL domain-containing protein;(source:Araport11) |
| AT1G77910 | transmembrane protein;(source:Araport11) |
| AT3G14595 | Ribosomal protein L18ae family;(source:Araport11) |
| AT2G05310 | transmembrane protein;(source:Araport11) |
| AT3G02460 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT2G43590 | Chitinase family protein;(source:Araport11) |
| AT4G17690 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G50730 | hypothetical protein;(source:Araport11) |
| AT4G28915 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
| AT2G42960 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G16900 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT1G43600 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G12450 | zinc finger (C2H2 type) family protein;(source:Araport11) |
| AT1G44608 | hypothetical protein;(source:Araport11) |
| AT1G11940 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G55180 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT3G56250 | hypothetical protein;(source:Araport11) |
| AT3G07115 | pre-tRNA tRNA-Ser (anticodon: TGA);(source:Araport11, TAIR10) |
| AT1G79520 | Cation efflux family protein;(source:Araport11) |
| AT2G03750 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G70350 | hypothetical protein;(source:Araport11) |
| AT1G29350 | RNA polymerase II degradation factor-like protein (DUF1296);(source:Araport11) |
| AT2G41080 | pentatricopeptide (PPR) repeat protein;(source:Araport11) |
| AT3G49320 | Metal-dependent protein hydrolase;(source:Araport11) |
| AT5G09976 | hypothetical protein;(source:Araport11) |
| AT4G11175 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT4G24265 | homeobox protein;(source:Araport11) |
| AT2G21860 | violaxanthin de-epoxidase-like protein;(source:Araport11) |
| AT1G72740 | Single Myb Histone (SMH) gene family member. Contains terminal acidic SANT domain. |
| AT3G56270 | WEB family protein (DUF827);(source:Araport11) |
| AT2G27830 | hypothetical protein;(source:Araport11) |
| AT4G14310 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G60350 | hypothetical protein;(source:Araport11) |
| AT1G10280 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT2G22890 | Kua-ubiquitin conjugating enzyme hybrid localization domain-containing protein;(source:Araport11) |
| AT5G51900 | Cytochrome P450 family protein;(source:Araport11) |
| AT1G36185 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G24600 | hypothetical protein;(source:Araport11) |
| AT3G05165 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G53380 | hypothetical protein (DUF641);(source:Araport11) |
| AT2G44500 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G50690 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G02420 | dihydroflavonol 4-reductase/flavanone protein;(source:Araport11) |
| AT4G39840 | cell wall integrity/stress response component-like protein;(source:Araport11) |
| AT1G64385 | transmembrane protein;(source:Araport11) |
| AT3G25940 | TFIIB zinc-binding protein;(source:Araport11) |
| AT2G20835 | hypothetical protein;(source:Araport11) |
| AT4G38710 | glycine-rich protein;(source:Araport11) |
| AT5G18430 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G50140 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT2G30850 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT1G50290 | hypothetical protein;(source:Araport11) |
| AT5G19060 | cytochrome P450 family protein;(source:Araport11) |
| AT1G54420 | hypothetical protein;(source:Araport11) |
| AT2G14247 | Expressed protein;(source:Araport11) |
| AT3G56760 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G57610 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
| AT5G53140 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G39535 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
| AT4G16560 | HSP20-like chaperone;(source:Araport11) |
| AT3G12000 | S-locus related protein SLR1, putative (S1);(source:Araport11) |
| AT3G04040 | transmembrane protein;(source:Araport11) |
| AT3G52072 | Natural antisense transcript overlaps with AT3G52070;(source:Araport11) |
| AT1G13635 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G77480 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G14090 | pseudogene of Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G26210 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G03160 | B-cell receptor-associated-like protein;(source:Araport11) |
| AT1G04430 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G48980 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT4G13990 | Exostosin family protein;(source:Araport11) |
| AT2G33170 | Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11) |
| AT1G70500 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G54145 | hypothetical protein;(source:Araport11) |
| AT4G26480 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT1G18310 | glycosyl hydrolase family 81 protein;(source:Araport11) |
| AT4G38540 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT1G64130 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT4G35940 | hypothetical protein;(source:Araport11) |
| AT5G25590 | DNA ligase (DUF630 and DUF632);(source:Araport11) |
| AT5G07670 | RNI-like superfamily protein;(source:Araport11) |
| AT1G10750 | carboxyl-terminal peptidase, putative (DUF239);(source:Araport11) |
| AT3G47210 | hypothetical protein (DUF247);(source:Araport11) |
| AT5G07030 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G71695 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G14860 | NHL domain-containing protein;(source:Araport11) |
| AT3G47570 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G43390 | hypothetical protein;(source:Araport11) |
| AT4G13120 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.6e-50 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G45740 | Ubiquitin domain-containing protein;(source:Araport11) |
| AT1G12669 | Encodes a Plant thionin family protein [pseudogene] |
| AT5G59330 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT5G45590 | Ribosomal protein L35;(source:Araport11) |
| AT3G03560 | hypothetical protein;(source:Araport11) |
| AT4G00893 | F-box/kelch-repeat protein;(source:Araport11) |
| AT5G67390 | glycosyltransferase-like protein;(source:Araport11) |
| AT4G14620 | hypothetical protein (DUF506);(source:Araport11) |
| AT1G14890 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G69420 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G59910 | Ankyrin repeat family protein;(source:Araport11) |
| AT2G27430 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G25430 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 8.0e-45 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G21300 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT2G25200 | hypothetical protein (DUF868);(source:Araport11) |
| AT4G09430 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT1G31335 | transmembrane protein;(source:Araport11) |
| AT4G17940 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G46290 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G15110 | transmembrane protein;(source:Araport11) |
| AT4G29103 | transmembrane protein;(source:Araport11) |
| AT3G52220 | leukocyte immunoglobulin-like receptor family A protein;(source:Araport11) |
| AT1G72410 | COP1-interacting protein-like protein;(source:Araport11) |
| AT2G24545 | Natural antisense transcript overlaps with AT2G24540;(source:Araport11) |
| AT4G16680 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G80610 | hypothetical protein;(source:Araport11) |
| AT5G44450 | alpha amino-terminal protein methyltransferase;(source:Araport11) |
| AT5G19230 | Glycoprotein membrane precursor GPI-anchored;(source:Araport11) |
| AT4G17240 | structural maintenance of chromosomes protein;(source:Araport11) |
| AT4G30970 | hypothetical protein;(source:Araport11) |
| AT5G59020 | hepatocyte growth factor activator, putative (DUF3527);(source:Araport11) |
| AT2G45460 | SMAD/FHA domain-containing protein;(source:Araport11) |
| AT3G01311 | actin cross-linking protein, putative (DUF569);(source:Araport11) |
| AT1G63850 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT3G27090 | DCD (Development and Cell Death) domain protein;(source:Araport11) |
| AT3G63095 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT5G12440 | CCCH-type zinc fingerfamily protein with RNA-binding domain-containing protein;(source:Araport11) |
| AT1G64590 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G19397 | transmembrane protein;(source:Araport11) |
| AT3G52330 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G10150 | Carbohydrate-binding protein;(source:Araport11) |
| AT5G43460 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
| AT5G09580 | heat shock protein;(source:Araport11) |
| AT5G66060 | 2-oxoglutarate-dependent dioxygenase |
| AT4G39615 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT5G09655 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT4G21170 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G19360 | Zinc finger (CCCH-type) family protein;(source:Araport11) |
| AT1G15180 | MATE efflux family protein;(source:Araport11) |
| AT1G23120 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G26430 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
| AT1G48745 | hypothetical protein;(source:Araport11) |
| AT2G36440 | hypothetical protein;(source:Araport11) |
| AT5G19420 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
| AT5G48200 | hypothetical protein;(source:Araport11) |
| AT4G32610 | copper ion binding protein;(source:Araport11) |
| AT4G32080 | hypothetical protein;(source:Araport11) |
| AT5G59900 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G52815 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
| AT1G75970 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
| AT4G28260 | acyl-UDP-N-acetylglucosamine O-acyltransferase;(source:Araport11) |
| AT5G60580 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G34350 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
| AT2G33847 | hypothetical protein;(source:Araport11) |
| AT5G40470 | RNI-like superfamily protein;(source:Araport11) |
| AT2G03370 | O-linked-mannose beta-1,4-N-acetylglucosaminyltransferase-like protein;(source:Araport11) |
| AT4G24100 | Protein kinase superfamily protein |
| AT2G36580 | Pyruvate kinase family protein;(source:Araport11) |
| AT4G23460 | Adaptin family protein;(source:Araport11) |
| AT2G40350 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT2G16340 | hypothetical protein;(source:Araport11) |
| AT4G30170 | Peroxidase family protein;(source:Araport11) |
| AT3G23180 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
| AT3G13403 | Encodes a defensin-like (DEFL) family protein. |
| AT1G22600 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT5G65380 | MATE efflux family protein;(source:Araport11) |
| AT5G08580 | Calcium-binding EF hand family protein;(source:Araport11) |
| AT2G18540 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT1G03510 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G22792 | pseudogene of F-box family protein |
| AT4G17098 | Natural antisense transcript overlaps with AT4G17100;(source:Araport11) |
| AT5G67020 | hypothetical protein;(source:Araport11) |
| AT4G23730 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT4G21926 | hypothetical protein;(source:Araport11) |
| AT1G70590 | F-box family protein;(source:Araport11) |
| AT4G33945 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G15830 | hypothetical protein;(source:Araport11) |
| AT5G48675 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
| AT3G13223 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
| AT3G51360 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G67300 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G09513 | pseudogene of hAT dimerisation domain-containing protein |
| AT2G39520 | hypothetical protein;(source:Araport11) |
| AT2G28140 | enabled-like protein (DUF1635);(source:Araport11) |
| AT1G03560 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT4G21437 | unknown pseudogene |
| AT1G14460 | AAA-type ATPase family protein;(source:Araport11) |
| AT2G03350 | DUF538 family protein (Protein of unknown function, DUF538);(source:Araport11) |
| AT1G09812 | multidrug resistance protein;(source:Araport11) |
| AT1G79245 | pseudogene of Winged helix-turn-helix transcription repressor DNA-binding protein;(source:Araport11) |
| AT1G52155 | transmembrane protein;(source:Araport11) |
| AT1G28685 | Natural antisense transcript overlaps with AT1G28680;(source:Araport11) |
| AT3G23910 | reverse transcriptase-like protein;(source:Araport11) |
| AT1G28395 | hypothetical protein;(source:Araport11) |
| AT1G52450 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT5G60930 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G41620 | intracellular protein transporter USO1-like protein;(source:Araport11) |
| AT1G53770 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G15730 | Cobalamin biosynthesis CobW-like protein;(source:Araport11) |
| AT5G11680 | classical AGP protein;(source:Araport11) |
| AT2G11240 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.1e-38 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G21930 | A paternally expressed imprinted gene. |
| AT3G02510 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT4G33700 | CBS domain protein (DUF21);(source:Araport11) |
| AT3G11640 | transmembrane protein;(source:Araport11) |
| AT4G30660 | Low temperature and salt responsive protein family;(source:Araport11) |
| AT1G61260 | cotton fiber (DUF761);(source:Araport11) |
| AT1G59570 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT3G18860 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT3G01860 | hypothetical protein;(source:Araport11) |
| AT3G60540 | Preprotein translocase Sec, Sec61-beta subunit protein;(source:Araport11) |
| AT5G40645 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
| AT2G45500 | AAA-type ATPase family protein;(source:Araport11) |
| AT4G38640 | Plasma-membrane choline transporter family protein;(source:Araport11) |
| AT5G20000 | AAA-type ATPase family protein;(source:Araport11) |
| AT2G26520 | transmembrane protein;(source:Araport11) |
| AT1G03280 | Transcription factor TFIIE, alpha subunit;(source:Araport11) |
| AT5G65520 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G65205 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G26110 | bromodomain protein (DUF761);(source:Araport11) |
| AT5G41060 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT4G04692 | pseudogene of expressed protein;(source:Araport11) |
| AT1G77765 | transmembrane protein;(source:Araport11) |
| AT4G37700 | hypothetical protein;(source:Araport11) |
| AT5G12060 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G47260 | putative disease resistance protein;(source:Araport11) |
| AT1G12180 | 14.7 kDa heat shock-like protein;(source:Araport11) |
| AT2G36680 | Modifier of rudimentary (Mod(r)) protein;(source:Araport11) |
| AT2G15695 | peptide methionine sulfoxide reductase (Protein of unknown function DUF829, transmembrane 53);(source:Araport11) |
| AT5G06280 | hypothetical protein;(source:Araport11) |
| AT2G19700 | hypothetical protein;(source:Araport11) |
| AT5G23610 | DYAD protein;(source:Araport11) |
| AT1G18930 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G12470 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT4G38932 | Natural antisense transcript overlaps with AT4G38930;(source:Araport11) |
| AT1G03440 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT2G46360 | hypothetical protein;(source:Araport11) |
| AT3G47610 | transcription regulator/ zinc ion binding protein;(source:Araport11) |
| AT2G21237 | transmembrane protein;(source:Araport11) |
| AT5G15940 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G76070 | hypothetical protein;(source:Araport11) |
| AT3G11290 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
| AT3G25960 | Pyruvate kinase family protein;(source:Araport11) |
| AT3G63320 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G64880 | transmembrane protein;(source:Araport11) |
| AT3G49115 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G61829 | transmembrane protein;(source:Araport11) |
| AT4G20250 | hypothetical protein;(source:Araport11) |
| AT5G35735 | Auxin-responsive family protein;(source:Araport11) |
| AT4G20730 | transposable_element_gene;(source:Araport11);similar to ASY2, DNA binding [Arabidopsis thaliana] (TAIR:AT4G32200.1);(source:TAIR10) |
| AT3G16680 | DNA binding / DNA-directed RNA polymerase;(source:Araport11) |
| AT4G16563 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G08780 | BRISC complex subunit Abro1-like protein;(source:Araport11) |
| AT4G33910 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G01710 | acyl-CoA thioesterase II;(source:Araport11) |
| AT5G05435 | Natural antisense transcript overlaps with AT5G05430;(source:Araport11) |
| AT5G47360 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G04000 | hypothetical protein;(source:Araport11) |
| AT3G15160 | AP-5 complex subunit zeta-1;(source:Araport11) |
| AT1G35614 | hypothetical protein;(source:Araport11) |
| AT4G02550 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
| AT2G37700 | Fatty acid hydroxylase superfamily;(source:Araport11) |
| AT1G09794 | Cox19 family protein (CHCH motif);(source:Araport11) |
| AT2G23321 | hypothetical protein;(source:Araport11) |
| AT1G14930 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT4G36970 | Remorin family protein;(source:Araport11) |
| AT1G77790 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT1G78170 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT1G11010 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT4G03600 | pyrroline-5-carboxylate reductase;(source:Araport11) |
| AT1G12670 | Encodes a Plant thionin family protein [pseudogene] |
| AT1G75460 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
| AT2G46995 | hypothetical protein;(source:Araport11) |
| AT3G59120 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G46420 | helicase with zinc finger protein;(source:Araport11) |
| AT2G36410 | transcriptional activator (DUF662);(source:Araport11) |
| AT1G07660 | Histone superfamily protein;(source:Araport11) |
| AT3G14410 | Nucleotide/sugar transporter family protein |
| AT3G52500 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G40980 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G28216 | hypothetical protein;(source:Araport11) |
| AT4G28180 | hypothetical protein;(source:Araport11) |
| AT1G03650 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT3G02910 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT5G03560 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G66780 | late embryogenesis abundant protein;(source:Araport11) |
| AT3G60910 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G13820 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G75230 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT5G66090 | cell wall integrity/stress response component;(source:Araport11) |
| AT1G11362 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G47380 | Cytochrome c oxidase subunit Vc family protein;(source:Araport11) |
| AT3G19920 | BTB/POZ domain protein;(source:Araport11) |
| AT3G14970 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G41890 | curculin-like (mannose-binding) lectin family protein / PAN domain-containing protein;(source:Araport11) |
| AT5G09445 | hypothetical protein;(source:Araport11) |
| AT4G02540 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G26742 | hypothetical protein;(source:Araport11) |
| AT1G15405 | other_RNA;(source:Araport11) |
| AT3G48515 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT2G19210 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT5G49640 | hypothetical protein;(source:Araport11) |
| AT3G05510 | Phospholipid/glycerol acyltransferase family protein;(source:Araport11) |
| AT2G10608 | transmembrane protein;(source:Araport11) |
| AT3G26560 | ATP-dependent RNA helicase;(source:Araport11) |
| AT2G19650 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G17600 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G18230 | UDP-N-acetylglucosamine transferase subunit ALG14-like protein;(source:Araport11) |
| AT5G57650 | eukaryotic translation initiation factor-like protein;(source:Araport11) |
| AT5G47620 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G14290 | Mitochondrial ribosomal protein L37;(source:Araport11) |
| AT3G13510 | carboxyl-terminal peptidase, putative (DUF239);(source:Araport11) |
| AT5G37010 | rho GTPase-activating protein;(source:Araport11) |
| AT5G07090 | Ribosomal protein S4 (RPS4A) family protein;(source:Araport11) |
| AT4G00905 | NC domain-containing protein-like protein;(source:Araport11) |
| AT3G18050 | GPI-anchored protein;(source:Araport11) |
| AT1G03810 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT4G37850 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G05200 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G34760 | pseudogene of tubulin beta-9 chain;(source:Araport11) |
| AT2G03240 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT5G44020 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT5G24820 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G59080 | hypothetical protein;(source:Araport11) |
| AT5G57950 | 26S proteasome regulatory subunit;(source:Araport11) |
| AT4G34500 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G66330 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G57220 | Glycosyl transferase family 4 protein;(source:Araport11) |
| AT3G51530 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G63145 | pre-tRNA tRNA-Thr (anticodon: TGT);(source:Araport11, TAIR10) |
| AT1G80250 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT3G04250 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G09995 | DNA repair DEAD helicase RAD3/XP-D subfamily protein;(source:Araport11) |
| AT4G19950 | polyadenylate-binding protein 1-B-binding protein;(source:Araport11) |
| AT3G45256 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
| AT1G58400 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT2G44020 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT1G11210 | cotton fiber protein, putative (DUF761);(source:Araport11) |
| AT2G24390 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT3G45820 | hypothetical protein;(source:Araport11) |
| AT5G62860 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT4G15240 | glycosyltransferase (DUF604);(source:Araport11) |
| AT4G14420 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
| AT4G37682 | DUF1399 domain containing protein. |
| AT1G22470 | Hypothetical protein;(source:Araport11). Target of SR45. |
| AT1G53780 | 26S proteasome regulatory complex ATPase;(source:Araport11) |
| AT2G31985 | lipoprotein (DUF1264);(source:Araport11) |
| AT1G61370 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G24090 | homer protein;(source:Araport11) |
| AT1G20875 | hypothetical protein;(source:Araport11) |
| AT1G20500 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G13640 | Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11) |
| AT4G17440 | chromogranin (DUF1639);(source:Araport11) |
| AT1G23040 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G55856 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT2G16690 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G41570.1);(source:TAIR10) |
| AT4G31860 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT1G61050 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
| AT1G75170 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G04020 | hypothetical protein;(source:Araport11) |
| AT3G01630 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G32420 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT4G15070 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G10210 | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein;(source:Araport11) |
| AT3G63445 | Natural antisense transcript overlaps with AT3G63440;(source:Araport11) |
| AT1G04500 | CCT motif family protein;(source:Araport11) |
| AT1G50325 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G27510 | 2-isopropylmalate synthase;(source:Araport11) |
| AT5G58610 | PHD finger transcription factor;(source:Araport11) |
| AT5G55060 | Rab3 GTPase-activating protein catalytic subunit;(source:Araport11) |
| AT3G13340 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT4G23880 | hypothetical protein;(source:Araport11) |
| AT1G22850 | SNARE associated Golgi protein family;(source:Araport11) |
| AT5G56880 | hypothetical protein;(source:Araport11) |
| AT5G15260 | ribosomal protein L34e superfamily protein;(source:Araport11) |
| AT4G00750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G60164 | Pseudogene of AT3G60966; protein binding / zinc ion binding |
| AT2G34930 | disease resistance family protein / LRR family protein;(source:Araport11) |
| AT2G32315 | Natural antisense transcript overlaps with AT2G32310;(source:Araport11) |
| AT3G50400 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G15950 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT1G24080 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT1G47565 | transposable_element_gene;(source:Araport11);retrotransposon gag protein, contains Pfam:PF03732 Retrotransposon gag protein;(source:TAIR10) |
| AT1G70949 | hypothetical protein;(source:Araport11) |
| AT3G53470 | 2,3-bisphosphoglycerate-independent phosphoglycerate mutase;(source:Araport11) |
| AT5G35870 | transmembrane protein;(source:Araport11) |
| AT2G32650 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT1G73570 | HCP-like superfamily protein;(source:Araport11) |
| AT1G06475 | transmembrane protein;(source:Araport11) |
| AT3G52800 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT2G22790 | hypothetical protein;(source:Araport11) |
| AT1G22110 | structural constituent of ribosome;(source:Araport11) |
| AT3G26750 | HECT-like ubiquitin-conjugating enzyme (E2)-binding protein;(source:Araport11) |
| AT5G19190 | hypothetical protein;(source:Araport11) |
| AT3G13560 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT4G27530 | hypothetical protein;(source:Araport11) |
| AT2G37440 | DNAse I-like superfamily protein;(source:Araport11) |
| AT5G26200 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT1G20690 | SWI-SNF-related chromatin binding protein;(source:Araport11) |
| AT5G66535 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
| AT3G06280 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G05390 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
| AT5G65660 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G50520 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT4G00305 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G19480 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G79300 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
| AT5G55780 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G26270 | transmembrane protein;(source:Araport11) |
| AT2G25780 | hypothetical protein (DUF1677);(source:Araport11) |
| AT3G15470 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G60720 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT2G24285 | zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
| AT3G17020 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT1G11820 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT2G42970 | pre-tRNA tRNA-Arg (anticodon: ACG);(source:Araport11, TAIR10) |
| AT3G58600 | Adaptin ear-binding coat-associated protein 1 NECAP-1;(source:Araport11) |
| AT2G38905 | Low temperature and salt responsive protein family;(source:Araport11) |
| AT1G68620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G11475 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT1G68845 | hypothetical protein;(source:Araport11) |
| AT4G38290 | hemolysin-III related integral membrane protein;(source:Araport11) |
| AT3G22260 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT2G35250 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT1G02110 | bZIP domain class transcription factor (DUF630 and DUF632);(source:Araport11) |
| AT2G21130 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT4G09432 | Natural antisense transcript overlaps with AT4G09430;(source:Araport11) |
| AT4G32765 | pre-tRNA tRNA-Ser (anticodon: CGA);(source:Araport11, TAIR10) |
| AT1G48840 | Plant protein of unknown function (DUF639);(source:TAIR10) |
| AT1G03640 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT1G07750 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT3G51760 | hypothetical protein (DUF688);(source:Araport11) |
| AT2G15960 | Unknown protein. Expression decreased in response to proline. |
| AT4G15430 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
| AT1G10410 | CW14 protein (DUF1336);(source:Araport11) |
| AT3G27330 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT3G01516 | transmembrane protein;(source:Araport11) |
| AT1G21990 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT2G40711 | hypothetical protein;(source:Araport11) |
| AT5G49170 | hypothetical protein;(source:Araport11) |
| AT3G49310 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G47295 | hypothetical protein;(source:Araport11) |
| AT4G14315 | transmembrane protein;(source:Araport11) |
| AT2G04340 | cytoplasmic dynein 2 light intermediate chain;(source:Araport11) |
| AT1G72645 | transmembrane protein;(source:Araport11) |
| AT5G11660 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT2G20230 | Tetraspanin family protein;(source:Araport11) |
| AT1G78265 | Natural antisense transcript overlaps with AT1G78270;(source:Araport11) |
| AT2G46320 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT5G57970 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT2G20390 | cytochrome oxidase complex assembly protein;(source:Araport11) |
| AT2G45590 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G46600 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G38930 | Ubiquitin fusion degradation UFD1 family protein;(source:Araport11) |
| AT2G22795 | hypothetical protein;(source:Araport11) |
| AT1G79640 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G26730 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G12270 | Copper amine oxidase family protein;(source:Araport11) |
| AT1G69900 | Actin cross-linking protein;(source:Araport11) |
| AT2G32140 | transmembrane receptor;(source:Araport11) |
| AT1G58010 | pseudogene of R-protein L3 B;(source:Araport11) |
| AT2G38820 | DNA-directed RNA polymerase subunit beta-beta protein, putative (DUF506);(source:Araport11) |
| AT5G61445 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT4G31890 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G25690 | DUF581 family protein, putative (DUF581);(source:Araport11) |
| AT2G30710 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT3G62400 | cytochrome C oxidase subunit;(source:Araport11) |
| AT3G10770 | Single-stranded nucleic acid binding R3H protein;(source:Araport11) |
| AT5G13980 | Glycosyl hydrolase family 38 protein;(source:Araport11) |
| AT3G51750 | hypothetical protein;(source:Araport11) |
| AT1G10740 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G01715 | pseudogene of RNI-like superfamily protein;(source:Araport11) |
| AT5G38510 | Rhomboid-related intramembrane serine protease family protein;(source:Araport11) |
| AT3G42150 | transmembrane protein;(source:Araport11) |
| AT5G28262 | other_RNA;(source:Araport11) |
| AT5G63380 | Encodes a peroxisomal protein involved in the activation of fatty acids through esterification with CoA. At5g63380 preferentially activates fatty acids with increased chain length (C9:0 to C8:0) and thus shares characteristics with long-chain fatty acyl-CoA synthases. Also able to catalyze the conversion of OPDA to its CoA ester and is therefore thought to be involved in the peroxisomal β-oxidation steps of jasmonic acid biosynthesis. |
| AT4G40065 | other_RNA;(source:Araport11) |
| AT3G19690 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT1G21670 | DPP6 amino-terminal domain protein;(source:Araport11) |
| AT4G01090 | Hypothetical protein; participates in wound-induced lateral root development. |
| AT5G25040 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G54240 | membrane lipoprotein lipid attachment site-like protein, putative (DUF1223);(source:Araport11) |
| AT4G18422 | transmembrane protein;(source:Araport11) |
| AT2G35070 | transmembrane protein;(source:Araport11) |
| AT4G30800 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT5G15240 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G01380 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G55110 | Stigma-specific Stig1 family protein;(source:Araport11) |
| AT4G21930 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT3G58440 | TRAF-like superfamily protein;(source:Araport11) |
| AT3G03000 | Calmodulin like protein localized in the plant vacuolar compartment with a function of binding and modifying the activity of a tonoplast transporter (AtNHX1) from within the vacuole in a Ca+2- and pH-dependent manner |
| AT1G28350 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
| AT1G20300 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G04600 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
| AT5G16090 | RAD23 UV excision repair family protein;(source:Araport11) |
| AT1G08985 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G16235 | Natural antisense transcript overlaps with AT5G16230;(source:Araport11) |
| AT3G05770 | hypothetical protein;(source:Araport11) |
| AT3G24927 | pseudogene of expressed protein;(source:Araport11) |
| AT1G56165 | Natural antisense transcript overlaps with AT1G56160;(source:Araport11) |
| AT5G67220 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
| AT3G53170 | LOW protein: PPR containing protein;(source:Araport11) |
| AT3G54080 | Concanavalin A-like lectin family protein;(source:Araport11) |
| AT4G30380 | Encodes a Plant Natriuretic Peptide (PNP). PNPs are a class of systemically mobile molecules distantly related to expansins; their biological role has remained elusive. |
| AT3G03280 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT3G49980 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G25510 | disease resistance protein (TIR-NBS-LRR class) family protein;(source:Araport11) |
| AT1G11440 | hypothetical protein;(source:Araport11) |
| AT1G11175 | other_RNA;(source:Araport11) |
| AT1G01840 | AP2-like ethylene-responsive transcription factor SNZ;(source:Araport11) |
| AT5G67488 | Natural antisense transcript overlaps with AT5G67490;(source:Araport11) |
| AT1G16290 | transglycosylase;(source:Araport11) |
| AT1G27110 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G51400 | hypothetical protein (DUF241);(source:Araport11) |
| AT5G61412 | hypothetical protein;(source:Araport11) |
| AT3G60420 | phosphoglycerate mutase family protein;(source:Araport11) |
| AT5G24000 | keratin-associated protein (DUF819);(source:Araport11) |
| AT3G50120 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT1G72090 | Methylthiotransferase;(source:Araport11) |
| AT1G17545 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G05060 | SAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; encodes NOP58-like protein |
| AT1G55525 | other_RNA;(source:Araport11) |
| AT1G29640 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT4G08953 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-22 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT2G46200 | U11/U12 small nuclear ribonucleoprotein;(source:Araport11) |
| AT3G54823 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.4e-203 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT4G37570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G52410.1);(source:TAIR10) |
| AT3G11860 | sterile alpha motif (SAM) domain protein;(source:Araport11) |
| AT3G26890 | meiosis chromosome segregation family protein;(source:Araport11) |
| AT5G07340 | Calreticulin family protein;(source:Araport11) |
| AT3G03272 | Encodes a ECA1 gametogenesis related family protein |
| AT1G73210 | hypothetical protein (DUF789);(source:Araport11) |
| AT4G03113 | transmembrane protein;(source:Araport11) |
| AT3G52480 | transmembrane protein;(source:Araport11) |
| AT3G07000 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G27480 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G55340 | hypothetical protein (DUF1639);(source:Araport11) |
| AT4G35680 | selection/upkeep of intraepithelial T-cells protein;(source:Araport11) |
| AT4G39790 | bZIP transcription factor, putative (DUF630 and DUF632);(source:Araport11) |
| AT3G49800 | BSD domain-containing protein;(source:Araport11) |
| AT2G34123 | Encodes a defensin-like (DEFL) family protein. |
| AT2G24750 | pseudogene of glutamate receptor 2.2;(source:Araport11) |
| AT1G77520 | O-methyltransferase family protein;(source:Araport11) |
| AT3G59830 | Integrin-linked protein kinase family;(source:Araport11) |
| AT1G54500 | RBD1 is a thylakoid membrane-bound iron-binding protein that is required for the proper assembly of photosystem II in Arabidopsis. It is found in all oxygenic photoautotrophic organisms (plants, algae and cyanobacteria). |
| AT2G46735 | death domain associated protein;(source:Araport11) |
| AT4G14810 | hypothetical protein;(source:Araport11) |
| AT1G67480 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G43401 | Encodes a defensin-like (DEFL) family protein. |
| AT3G50910 | netrin receptor DCC;(source:Araport11) |
| AT5G18630 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G29660 | zinc finger (C2H2 type) family protein;(source:Araport11) |
| AT1G05950 | hypothetical protein;(source:Araport11) |
| AT5G08250 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT4G13030 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G02390 | hypothetical protein;(source:Araport11) |
| AT5G46025 | Ras-related small GTP-binding family protein;(source:Araport11) |
| AT3G11720 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT2G24420 | DNA repair ATPase-like protein;(source:Araport11) |
| AT5G16900 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G12835 | hypothetical protein;(source:Araport11) |
| AT1G19540 | NmrA-like negative transcriptional regulator family protein;(source:Araport11) |
| AT5G44065 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G01330 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G28193 | transmembrane protein;(source:Araport11) |
| AT3G50825 | snoRNA;(source:Araport11) |
| AT3G61825 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
| AT5G03360 | cysteine/histidine-rich C1 domain protein;(source:Araport11) |
| AT1G20225 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G06470 | Nucleotide/sugar transporter family protein;(source:Araport11) |
| AT1G80450 | VQ motif-containing protein;(source:Araport11) |
| AT1G10050 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
| AT3G11415 | other_RNA;(source:Araport11) |
| AT3G55795 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT4G28990 | RNA-binding protein-like protein;(source:Araport11) |
| AT2G20250 | hypothetical protein;(source:Araport11) |
| AT5G08690 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. The mRNA is cell-to-cell mobile. |
| AT5G18470 | Curculin-like (mannose-binding) lectin family protein;(source:Araport11) |
| AT1G03030 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G19110 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G26580 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G32920 | hypothetical protein;(source:Araport11) |
| AT5G08200 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
| AT2G40480 | WEB family protein (DUF827);(source:Araport11) |
| AT2G18370 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT3G03341 | cold-regulated protein;(source:Araport11) |
| AT4G15120 | VQ motif-containing protein;(source:Araport11) |
| AT1G15830 | hypothetical protein;(source:Araport11) |
| AT1G15810 | S15/NS1, RNA-binding protein;(source:Araport11) |
| AT2G40860 | protein kinase family protein / protein phosphatase 2C ( PP2C) family protein;(source:Araport11) |
| AT5G03900 | Iron-sulfur cluster biosynthesis family protein;(source:Araport11) |
| AT5G35180 | ENHANCED DISEASE RESISTANCE protein (DUF1336);(source:Araport11) |
| AT3G44950 | glycine-rich protein;(source:Araport11) |
| AT5G10455 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
| AT3G23300 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G38760 | nucleoporin (DUF3414);(source:Araport11) |
| AT1G20820 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT4G02370 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
| AT3G51710 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11) |
| AT2G36885 | translation initiation factor;(source:Araport11) |
| AT4G14746 | neurogenic locus notch-like protein;(source:Araport11) |
| AT4G16510 | YbaK/aminoacyl-tRNA synthetase-associated domain-containing protein;(source:Araport11) |
| AT1G02228 | pseudogene of no apical meristem (NAM) family protein |
| AT4G32480 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
| AT1G52550 | transmembrane protein;(source:Araport11) |
| AT1G01450 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G19595 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT3G62470 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G06220 | LETM1-like protein;(source:Araport11) |
| AT1G56690 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G79190 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G73750 | alpha/beta hydrolase family protein;(source:Araport11) |
| AT5G52530 | dentin sialophosphoprotein-like protein;(source:Araport11) |
| AT5G02830 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G26990 | Drought-responsive family protein;(source:Araport11) |
| AT3G08610 | NADH dehydrogenase ubiquinone 1 alpha subcomplex subunit;(source:Araport11) |
| AT5G37160 | P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11) |
| AT1G15740 | Leucine-rich repeat family protein;(source:Araport11) |
| AT1G80570 | RNI-like superfamily protein;(source:Araport11) |
| AT2G36200 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G54000 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT2G33250 | transmembrane protein;(source:Araport11) |
| AT1G12810 | proline-rich family protein;(source:Araport11) |
| AT5G67460 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G50990 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G10100 | transposable_element_gene;(source:Araport11);similar to ASY2, DNA binding [Arabidopsis thaliana] (TAIR:AT4G32200.1);(source:TAIR10) |
| AT3G08020 | PHD finger family protein;(source:Araport11) |
| AT4G30940 | BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11) |
| AT3G09430 | peptide transporter family protein;(source:Araport11) |
| AT1G01830 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G43240 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT5G08695 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G71840 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT1G72420 | NADH:ubiquinone oxidoreductase intermediate-associated protein 30;(source:Araport11) |
| AT3G23600 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G15090 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
| AT5G28370 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G06690 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT1G15970 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT2G28240 | ATP-dependent helicase family protein;(source:Araport11) |
| AT3G56300 | Cysteinyl-tRNA synthetase, class Ia family protein;(source:Araport11) |
| AT2G17295 | snoRNA;(source:Araport11) |
| AT1G32760 | Glutaredoxin family protein;(source:Araport11) |
| AT5G12410 | THUMP domain-containing protein;(source:Araport11) |
| AT1G63720 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G09740 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT5G44040 | eisosome SEG2-like protein;(source:Araport11) |
| AT1G09220 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G09649 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G19500 | nucleoside-triphosphatase/transmembrane receptor/nucleotide binding/ATP binding protein;(source:Araport11) |
| AT3G50250 | transmembrane protein;(source:Araport11) |
| AT5G59940 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G44478 | Cyclophilin;(source:Araport11) |
| AT3G58530 | RNI-like superfamily protein;(source:Araport11) |
| AT5G66568 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT1G69300 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
| AT3G06665 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT4G25170 | Uncharacterized conserved protein (UCP012943);(source:Araport11) |
| AT1G14300 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G25210 | hypothetical protein;(source:Araport11) |
| AT1G23110 | fold protein;(source:Araport11) |
| AT4G30060 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT4G01930 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G24380 | pre-tRNA tRNA-Arg (anticodon: ACG);(source:Araport11, TAIR10) |
| AT2G37680 | glucose-induced degradation-like protein;(source:Araport11) |
| AT5G19070 | SNARE associated Golgi protein family;(source:Araport11) |
| AT2G30925 | transmembrane protein;(source:Araport11) |
| AT5G10560 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT1G66190 | hypothetical protein;(source:Araport11) |
| AT2G39300 | CAP-gly domain linker;(source:Araport11) |
| AT1G76170 | 2-thiocytidine tRNA biosynthesis protein, TtcA;(source:Araport11) |
| AT3G08920 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT2G38800 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
| AT2G42170 | Actin family protein;(source:Araport11) |
| AT1G75300 | encodes a protein whose sequence is similar to an isoflavone reductase |
| AT5G57410 | Encodes a microtubule-associated protein. |
| AT2G37975 | Yos1-like protein;(source:Araport11) |
| AT1G18415 | Natural antisense transcript overlaps with AT1G18420;(source:Araport11) |
| AT1G17430 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G21830 | hypothetical protein;(source:Araport11) |
| AT5G45020 | Glutathione S-transferase family protein;(source:Araport11) |
| AT4G00170 | Plant VAMP (vesicle-associated membrane protein) family protein;(source:Araport11) |
| AT3G07350 | sulfate/thiosulfate import ATP-binding protein, putative (DUF506);(source:Araport11) |
| AT1G11380 | PLAC8 family protein;(source:Araport11) |
| AT1G56145 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT2G16990 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G26020 | transposable_element_gene;(source:Araport11);similar to Glutamic acid-rich protein precursor (GB:P13816);(source:TAIR10) |
| AT3G19790 | hypothetical protein;(source:Araport11) |
| AT5G01750 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT4G27840 | SNARE-like superfamily protein;(source:Araport11) |
| AT4G26820 | GrpE-like protein;(source:Araport11) |
| AT1G48530 | proteasome inhibitor-like protein;(source:Araport11) |
| AT5G49990 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT1G11700 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT1G32700 | PLATZ transcription factor family protein;(source:Araport11) |
| AT1G77370 | Glutaredoxin family protein;(source:Araport11) |
| AT1G52430 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT3G46490 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G00920 | COP1-interacting protein-like protein;(source:Araport11) |
| AT1G02180 | ferredoxin-like protein;(source:Araport11) |
| AT5G47790 | SMAD/FHA domain-containing protein;(source:Araport11) |
| AT1G71970 | hypothetical protein;(source:Araport11) |
| AT5G16380 | autophagy-like protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT3G26550 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G07408 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G48480 | Lactoylglutathione lyase / glyoxalase I family protein;(source:Araport11) |
| AT5G55660 | DEK domain-containing chromatin associated protein;(source:Araport11) |
| AT3G23470 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
| AT3G15055 | pre-tRNA tRNA-Ile (anticodon: TAT);(source:Araport11, TAIR10) |
| AT1G12570 | Ortholog of maize IPE1 gene which is involved in pollen exine development. |
| AT3G46600 | GRAS family transcription factor;(source:Araport11) |
| AT4G37920 | endoribonuclease E-like protein;(source:Araport11) |
| AT3G56750 | plant/protein;(source:Araport11) |
| AT1G58460 | hypothetical protein;(source:Araport11) |
| AT5G52882 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G37175 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
| AT3G24190 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G56160 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G14710 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G31330 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
| AT3G17250 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT1G01300 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G36770 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G30362 | Natural antisense transcript overlaps with AT2G30360;(source:Araport11) |
| AT3G21215 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G56920 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G15548 | transmembrane protein;(source:Araport11) |
| AT5G55750 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G08940 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT3G50850 | Putative methyltransferase family protein;(source:Araport11) |
| AT5G45480 | transmembrane protein, putative (DUF594);(source:Araport11) |
| AT4G16180 | transmembrane protein;(source:Araport11) |
| AT3G10790 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G69290 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G38545 | Natural antisense transcript overlaps with AT4G38530 and AT4G38540;(source:Araport11) |
| AT2G23985 | hypothetical protein;(source:Araport11) |
| AT1G26900 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G51620 | Uncharacterized protein family (UPF0172);(source:Araport11) |
| AT4G05018 | transmembrane protein;(source:Araport11) |
| AT5G44530 | Subtilase family protein;(source:Araport11) |
| AT5G44286 | snoRNA;(source:Araport11) |
| AT2G20210 | RNI-like superfamily protein;(source:Araport11) |
| AT2G34185 | hypothetical protein;(source:Araport11) |
| AT2G45360 | ankyrin repeat/KH domain protein (DUF1442);(source:Araport11) |
| AT3G51730 | saposin B domain-containing protein;(source:Araport11) |
| AT1G26920 | zinc finger CCHC domain protein;(source:Araport11) |
| AT3G22550 | NAD(P)H-quinone oxidoreductase subunit, putative (DUF581);(source:Araport11) |
| AT5G10070 | RNase L inhibitor protein-like protein;(source:Araport11) |
| AT3G27865 | snoRNA;(source:Araport11) |
| AT1G17390 | transposable_element_gene;(source:Araport11);similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT5G36905.1);(source:TAIR10) |
| AT1G21480 | Exostosin family protein;(source:Araport11) |
| AT1G36622 | transmembrane protein;(source:Araport11) |
| AT4G14500 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT4G39195 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT4G37895 | Natural antisense transcript overlaps with AT4G37890;(source:Araport11) |
| AT2G30505 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT3G15810 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT3G06570 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G20655 | pre-tRNA tRNA-Arg (anticodon: ACG);(source:Araport11, TAIR10) |
| AT4G31520 | SDA1 family protein;(source:Araport11) |
| AT2G30945 | None;(source:Araport11) |
| AT4G13160 | zein-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT5G24610 | cyclic AMP-responsive element-binding protein;(source:Araport11) |
| AT3G49140 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G09960 | sorbin/SH3 domain protein;(source:Araport11) |
| AT2G36220 | hypothetical protein;(source:Araport11) |
| AT1G48680 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-298 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G25433 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
| AT3G46020 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G08930 | LMBR1-like membrane protein;(source:Araport11) |
| AT5G48900 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G21830 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G10613 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT2G37870 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G07280 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G47815 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.0e-38 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G01680 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G01110 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G22410 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G23750 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT2G18193 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G47225 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10) |
| AT5G02940 | ion channel POLLUX-like protein, putative (DUF1012);(source:Araport11) |
| AT5G39070 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 3.9e-50 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G33180 | hypothetical protein;(source:Araport11) |
| AT2G24395 | chaperone protein dnaJ-like protein;(source:Araport11) |
| AT3G02750 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT4G36925 | transmembrane protein;(source:Araport11) |
| AT1G77405 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G02816 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
| AT3G11560 | LETM1-like protein;(source:Araport11) |
| AT5G15710 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G57020 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT1G72600 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G23340 | RNI-like superfamily protein;(source:Araport11) |
| AT5G14370 | CCT motif family protein;(source:Araport11) |
| AT1G53180 | hypothetical protein;(source:Araport11) |
| AT2G31585 | other_RNA;(source:Araport11) |
| AT3G56810 | hypothetical protein;(source:Araport11) |
| AT4G01915 | hypothetical protein;(source:Araport11) |
| AT5G51880 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G19650 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G48800 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
| AT3G24612 | snoRNA;(source:Araport11) |
| AT5G11550 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G45720 | AAA-type ATPase family protein;(source:Araport11) |
| AT3G27470 | lysine ketoglutarate reductase trans-splicing protein (DUF707);(source:Araport11) |
| AT5G58390 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G20820 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT4G12220 | hypothetical protein;(source:Araport11) |
| AT4G34103 | pseudogene of protein binding / zinc ion binding protein |
| AT5G23920 | transmembrane protein;(source:Araport11) |
| AT1G73066 | Leucine-rich repeat family protein;(source:Araport11) |
| AT3G53670 | hypothetical protein;(source:Araport11) |
| AT1G11640 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT3G58640 | Mitogen activated protein kinase kinase kinase-like protein;(source:Araport11) |
| AT5G62910 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G04730 | Ankyrin-repeat containing protein;(source:Araport11) |
| AT3G09440 | Heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
| AT5G47210 | Hyaluronan / mRNA binding family;(source:Araport11) |
| AT1G79630 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT2G40710 | hemolysin-III related integral membrane protein;(source:Araport11) |
| AT4G04820 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT2G24930.1);(source:TAIR10) |
| AT3G06880 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G27730 | heparan-alpha-glucosaminide N-acetyltransferase-like protein (DUF1624);(source:Araport11) |
| AT2G33585 | subtilisin-like protease;(source:Araport11) |
| AT1G57700 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G16595 | Translocon-associated protein (TRAP), alpha subunit;(source:Araport11) |
| AT5G16360 | NC domain-containing protein-like protein;(source:Araport11) |
| AT1G69460 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT3G19025 | pseudogene of alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G15820 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G77815 | ribonuclease H superfamily polynucleotidyl transferase;(source:Araport11) |
| AT5G08240 | transmembrane protein;(source:Araport11) |
| AT3G61820 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G66890 | 50S ribosomal-like protein;(source:Araport11) |
| AT5G18460 | carboxyl-terminal peptidase (DUF239);(source:Araport11) |
| AT5G65250 | transmembrane protein;(source:Araport11) |
| AT1G68410 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT4G07825 | transmembrane protein;(source:Araport11) |
| AT1G03540 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT1G11320 | GDSL esterase/lipase;(source:Araport11) |
| AT5G15815 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT3G55780 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT1G65985 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT1G18820 | pre-tRNA tRNA-Leu (anticodon: CAG);(source:Araport11, TAIR10) |
| AT1G56045 | Ribosomal protein L41 family;(source:Araport11) |
| AT3G52710 | hypothetical protein;(source:Araport11) |
| AT3G17120 | transmembrane protein;(source:Araport11) |
| AT3G12150 | alpha/beta hydrolase family protein;(source:Araport11) |
| AT3G60238 | other_RNA;(source:Araport11) |
| AT3G18620 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT2G33360 | cadherin EGF LAG seven-pass G-type receptor, putative (DUF3527);(source:Araport11) |
| AT1G65000 | F-box only protein;(source:Araport11) |
| AT4G15000 | Ribosomal L27e protein family;(source:Araport11) |
| AT1G28140 | integral membrane family protein;(source:Araport11) |
| AT2G31018 | hypothetical protein;(source:Araport11) |
| AT4G16650 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G22850 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G33467 | hypothetical protein;(source:Araport11) |
| AT3G25870 | hypothetical protein;(source:Araport11) |
| AT1G07590 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G15175 | Natural antisense transcript overlaps with AT1G15170;(source:Araport11) |
| AT4G13400 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G27200 | Cupredoxin superfamily protein;(source:Araport11) |
| AT5G60460 | Preprotein translocase Sec, Sec61-beta subunit protein;(source:Araport11) |
| AT1G02630 | Nucleoside transporter family protein;(source:Araport11) |
| AT3G12685 | Acid phosphatase/vanadium-dependent haloperoxidase-related protein;(source:Araport11) |
| AT1G59960 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT1G09590 | Translation protein SH3-like family protein;(source:Araport11) |
| AT1G22410 | Class-II DAHP synthetase family protein;(source:Araport11) |
| AT1G30430 | pre-tRNA tRNA-Glu (anticodon: CTC);(source:Araport11, TAIR10) |
| AT1G12460 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G61510 | GroES-like zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
| AT1G06620 | encodes a protein whose sequence is similar to a 2-oxoglutarate-dependent dioxygenase The mRNA is cell-to-cell mobile. |
| AT3G61020 | pseudogene of TRICHOME BIREFRINGENCE-LIKE 32;(source:Araport11) |
| AT5G19151 | hypothetical protein;(source:Araport11) |
| AT5G40670 | PQ-loop repeat family protein / transmembrane family protein;(source:Araport11) |
| AT3G55430 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT4G01735 | polyhomeotic-like protein;(source:Araport11) |
| AT4G30680 | Initiation factor eIF-4 gamma, MA3;(source:Araport11) |
| AT2G29070 | Ubiquitin fusion degradation UFD1 family protein;(source:Araport11) |
| AT5G16810 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G08660 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT2G46220 | DUF2358 family protein (DUF2358);(source:Araport11) |
| AT1G18940 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
| AT1G18270 | ketose-bisphosphate aldolase class-II family protein;(source:Araport11) |
| AT1G15120 | Ubiquinol-cytochrome C reductase hinge protein;(source:Araport11) |
| AT1G34630 | transmembrane protein;(source:Araport11) |
| AT4G34910 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G55820 | lysine-specific demethylase, putative (DUF1296);(source:Araport11) |
| AT5G15430 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
| AT4G32105 | Beta-1,3-N-Acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT3G62370 | heme binding protein;(source:Araport11) |
| AT3G51010 | protein translocase subunit;(source:Araport11) |
| AT4G37520 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G80540 | envelope glycoprotein B;(source:Araport11) |
| AT3G20555 | hypothetical protein;(source:Araport11) |
| AT4G31960 | hypothetical protein;(source:Araport11) |
| AT4G27290 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G32750 | transmembrane protein;(source:Araport11) |
| AT5G17380 | Thiamine pyrophosphate dependent pyruvate decarboxylase family protein;(source:Araport11) |
| AT4G03610 | Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11) |
| AT3G10015 | pre-tRNA tRNA-Leu (anticodon: TAA);(source:Araport11, TAIR10) |
| AT3G04855 | hypothetical protein;(source:Araport11) |
| AT3G05746 | hypothetical protein;(source:Araport11) |
| AT5G56980 | Pathogen-associated molecular pattern-induced gene.Responsive to jasmonic acid and wounding. |
| AT5G02170 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT4G21020 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT3G11325 | Phospholipid/glycerol acyltransferase family protein;(source:Araport11) |
| AT5G37381 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-121 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT3G52350 | D111/G-patch domain-containing protein;(source:Araport11) |
| AT1G04200 | dyggve-melchior-clausen syndrome protein;(source:Araport11) |
| AT3G22100 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT2G03700 | pre-tRNA tRNA-Thr (anticodon: CGT);(source:Araport11, TAIR10) |
| AT2G04080 | MATE efflux family protein;(source:Araport11) |
| AT1G68470 | Exostosin family protein;(source:Araport11) |
| AT1G77200 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT3G01750 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G56890 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G53440 | LOW protein: zinc finger CCCH domain protein;(source:Araport11) |
| AT3G54510 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT4G32160 | Phox (PX) domain-containing protein;(source:Araport11) |
| AT1G30290 | unknown protein |
| AT2G29610 | pseudogene of the F-box protein family, contains Pfam profile PF00646: F-box domain |
| AT3G28940 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT2G44730 | Alcohol dehydrogenase transcription factor Myb/SANT-like family protein;(source:Araport11) |
| AT2G36280 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT4G24750 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT2G03821 | hypothetical protein;(source:Araport11) |
| AT5G62140 | ATP-dependent Clp protease ATP-binding subunit;(source:Araport11) |
| AT5G64180 | tropomyosin;(source:Araport11) |
| AT4G36945 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT4G24810 | similar to ABC1 family protein, contains InterPro domain ABC1 protein (InterPro:IPR004147) |
| AT3G15080 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G55770 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G26950 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT1G32410 | Vacuolar protein sorting 55 (VPS55) family protein;(source:Araport11) |
| AT4G38670 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT4G24565 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
| AT4G18150 | Serine/Threonine-kinase, putative (DUF1296);(source:Araport11) |
| AT5G44060 | embryo sac development arrest protein;(source:Araport11) |
| AT5G07430 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G26692 | Natural antisense transcript overlaps with AT2G26690;(source:Araport11) |
| AT5G02815 | pre-tRNA tRNA-Ser (anticodon: TGA);(source:Araport11, TAIR10) |
| AT2G47680 | zinc finger (CCCH type) helicase family protein;(source:Araport11) |
| AT3G07670 | Rubisco methyltransferase family protein;(source:Araport11) |
| AT2G18360 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G60720 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT1G50020 | tubulin alpha-6 chain;(source:Araport11) |
| AT3G23330 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G76892 | Natural antisense transcript overlaps with AT1G76890;(source:Araport11) |
| AT1G05840 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G07000 | hypothetical protein;(source:Araport11) |
| AT1G17960 | Threonyl-tRNA synthetase;(source:Araport11) |
| AT1G52720 | hypothetical protein;(source:Araport11) |
| AT4G34140 | D111/G-patch domain-containing protein;(source:Araport11) |
| AT5G04030 | transmembrane protein;(source:Araport11) |
| AT2G34186 | hypothetical protein;(source:Araport11) |
| AT5G42570 | B-cell receptor-associated 31-like protein;(source:Araport11) |
| AT3G13410 | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase;(source:Araport11) |
| AT5G59490 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G75530 | Forkhead-associated (FHA) domain-containing protein;(source:Araport11) |
| AT3G12590 | hypothetical protein;(source:Araport11) |
| AT1G19980 | cytomatrix protein-like protein;(source:Araport11) |
| AT5G55560 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G15360 | transmembrane protein;(source:Araport11) |
| AT1G33450 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G04780.2);(source:TAIR10) |
| AT1G54095 | DUF1677 family protein, putative (DUF1677);(source:Araport11) |
| AT1G30300 | Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11) |
| AT1G55550 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G36750 | Quinone reductase family protein;(source:Araport11) |
| AT5G22788 | other_RNA;(source:Araport11) |
| AT4G11845 | Interleukin-1 receptor-associated kinase 4 protein;(source:Araport11) |
| AT5G35525 | PLAC8 family protein;(source:Araport11) |
| AT4G12990 | transmembrane protein;(source:Araport11) |
| AT4G26810 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
| AT1G67340 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
| AT4G19865 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G25964 | hypothetical protein;(source:Araport11) |
| AT3G55820 | Fasciclin-like arabinogalactan family protein;(source:Araport11) |
| AT2G17845 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G79660 | ephrin-A3 protein;(source:Araport11) |
| AT1G08710 | F-box protein that is induced in roots by drought stress. |
| AT5G52067 | Pseudogene of AT3G43280 |
| AT1G21350 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G27000 | GRIP/coiled-coil protein, putative (DUF1664);(source:Araport11) |
| AT4G13130 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G13996 | Pseudogene of AT2G35345; unknown protein |
| AT1G15430 | hypothetical protein (DUF1644);(source:Araport11) |
| AT4G09150 | T-complex protein 11;(source:Araport11) |
| AT5G37070 | hypothetical protein (Protein of unknown function, DUF538);(source:Araport11) |
| AT3G46080 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT5G55670 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G64505 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT1G67920 | hypothetical protein;(source:Araport11) |
| AT5G19860 | transmembrane protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT1G22520 | MICOS complex subunit Mic10-like protein (DUF543);(source:Araport11) |
| AT5G62290 | nucleotide-sensitive chloride conductance regulator (ICln) family protein;(source:Araport11) |
| AT3G14160 | 2-oxoglutarate-dependent dioxygenase family protein;(source:Araport11) |
| AT1G76110 | HMG (high mobility group) box protein with ARID/BRIGHT DNA-binding domain-containing protein;(source:Araport11) |
| AT5G47710 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT4G37225 | Natural antisense transcript overlaps with AT4G37230;(source:Araport11) |
| AT5G18910 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G07885 | hypothetical protein;(source:Araport11) |
| AT1G77820 | transposable_element_gene;(source:Araport11);pseudogene, endonuclease/exonuclease/phosphatase family protein, contains similarity to reverse transcriptase GI:976278 from (Arabidopsis thaliana);(source:TAIR10) |
| AT2G17710 | Big1;(source:Araport11) |
| AT4G22530 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G19130 | GPI transamidase component family protein / Gaa1-like family protein;(source:Araport11) |
| AT3G47090 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G80170 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G56260 | Ribonuclease E inhibitor RraA/Dimethylmenaquinone methyltransferase;(source:Araport11) |
| AT2G31590 | hypothetical protein;(source:Araport11) |
| AT5G63630 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G01990 | hypothetical protein;(source:Araport11) |
| AT4G12690 | DUF868 family protein (DUF868);(source:Araport11) |
| AT1G50040 | formin-like protein, putative (DUF1005);(source:Araport11) |
| AT1G75710 | C2H2-like zinc finger protein;(source:Araport11) |
| AT5G03880 | Thioredoxin family protein;(source:Araport11) |
| AT2G41710 | Integrase-type DNA-binding superfamily protein;(source:Araport11) |
| AT4G28830 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G79100 | arginine/serine-rich protein-like protein;(source:Araport11) |
| AT3G59926 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT5G43400 | plant/protein;(source:Araport11) |
| AT1G67880 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G56700 | Peptidase C15, pyroglutamyl peptidase I-like protein;(source:Araport11) |
| AT1G51200 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT1G02210 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT2G21180 | transmembrane protein;(source:Araport11) |
| AT4G12700 | calcium ion-binding protein;(source:Araport11) |
| AT5G67430 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT4G36960 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G32645 | B3 domain protein, putative (DUF313);(source:Araport11) |
| AT5G64980 | transcription factor;(source:Araport11) |
| AT4G01023 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G13240 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT5G21020 | transmembrane protein;(source:Araport11) |
| AT1G09520 | hypothetical protein;(source:Araport11) |
| AT3G62450 | DNA mismatch repair protein;(source:Araport11) |
| AT1G07820 | Histone superfamily protein;(source:Araport11) |
| AT3G62180 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G34240 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (Protein with domains of unknown function DUF627 and DUF632);(source:Araport11) |
| AT4G30975 | None;(source:Araport11) |
| AT1G69360 | T-box transcription factor, putative (DUF863);(source:Araport11) |
| AT4G13110 | BSD domain-containing protein;(source:Araport11) |
| AT1G11550 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
| AT5G11080 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT1G21060 | Serine/Threonine-kinase, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT4G35880 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G52870 | IQ calmodulin-binding motif family protein;(source:Araport11) |
| AT3G56410 | hypothetical protein (DUF3133);(source:Araport11) |
| AT5G61830 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G23665 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
| AT1G14500 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G25580 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G12310 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G35720 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT3G10250 | histidine-tRNA ligase;(source:Araport11) |
| AT5G19970 | GRAS family transcription factor family protein;(source:Araport11) |
| AT1G10417 | Encodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens. |
| AT5G54020 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G35750 | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein;(source:Araport11) |
| AT4G21520 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G53840 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G16415 | pseudogene of myrosinase-binding protein 2;(source:Araport11) |
| AT4G21903 | MATE efflux family protein;(source:Araport11) |
| AT4G16190 | Papain family cysteine protease;(source:Araport11) |
| AT4G02110 | transcription coactivator;(source:Araport11) |
| AT2G23330 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-195 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT5G43100 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G37670 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G66770 | GRAS family transcription factor;(source:Araport11) |
| AT3G03040 | F-box/RNI-like superfamily protein. Idenfitied in GWAS as locus involved in response to the defense molecule, allyl glucosinolate. |
| AT1G04140 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT5G66810 | Ran-binding protein in the microtubule-organising centre protein;(source:Araport11) |
| AT1G27100 | Actin cross-linking protein;(source:Araport11) |
| AT1G68140 | zinc finger/BTB domain protein, putative (DUF1644);(source:Araport11) |
| AT1G01940 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT1G22320 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT2G20724 | Annotated as pseudogene of unknown protein.Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 . |
| AT3G01850 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT2G29654 | transmembrane protein;(source:Araport11) |
| AT1G60970 | SNARE-like superfamily protein;(source:Araport11) |
| AT4G01865 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT5G52430 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G47660 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT4G37860 | SPT2 chromatin protein;(source:Araport11) |
| AT4G08230 | glycine-rich protein;(source:Araport11) |
| AT2G30560 | Needs to be reannotated and split into two genes, AtEAL2 and AtEAL3, both encoding maize Ebb apparatus 1-like proteins. The current predicted structure is not well supported (T8, one *). The predicted proteins can be found in doi.org/10.1007/s00425-005-0174-z |
| AT1G14600 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G03240 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G49560 | Putative methyltransferase family protein;(source:Araport11) |
| AT5G03050 | knotted 1-binding protein;(source:Araport11) |
| AT4G10750 | Phosphoenolpyruvate carboxylase family protein;(source:Araport11) |
| AT5G04440 | RAP release 2, galactose-binding-like domain protein, putative (DUF1997);(source:Araport11) |
| AT5G40855 | hypothetical protein;(source:Araport11) |
| AT2G28080 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G58760 | Integrin-linked protein kinase family;(source:Araport11) |
| AT5G26600 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT4G25620 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT2G04690 | Pyridoxamine 5-phosphate oxidase family protein;(source:Araport11) |
| AT5G51390 | hypothetical protein;(source:Araport11) |
| AT3G05170 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT1G29630 | 5-3 exonuclease family protein;(source:Araport11) |
| AT2G31800 | Integrin-linked protein kinase family;(source:Araport11) |
| AT3G52105 | DIS3-exonuclease-like protein;(source:Araport11) |
| AT3G29230 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G12461 | hypothetical protein;(source:Araport11) |
| AT1G49832 | None;(source:Araport11) |
| AT5G65340 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT5G54030 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G09443 | Natural antisense transcript overlaps with AT5G09445;(source:Araport11) |
| AT5G10946 | hypothetical protein;(source:Araport11) |
| AT1G53790 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G22080 | transmembrane protein;(source:Araport11) |
| AT5G01910 | myelin transcription factor;(source:Araport11) |
| AT5G67455 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT5G05090 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT2G46375 | hypothetical protein;(source:Araport11) |
| AT5G41110 | meiosis chromosome segregation family protein;(source:Araport11) |
| AT2G42365 | Natural antisense transcript overlaps with AT2G42360 and AT2G42370;(source:Araport11) |
| AT5G15200 | Ribosomal protein S4;(source:Araport11) |
| AT3G10310 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
| AT3G60075 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
| AT5G05800 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
| AT4G39170 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G25850 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G59385 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
| AT1G80800 | pseudogene of Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
| AT3G06680 | Ribosomal L29e protein family;(source:Araport11) |
| AT1G16560 | Per1-like family protein;(source:Araport11) |
| AT5G22320 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT4G07990 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G04000 | hypothetical protein;(source:Araport11) |
| AT2G18970 | hypothetical protein;(source:Araport11) |
| AT1G34010 | hypothetical protein;(source:Araport11) |
| AT5G56990 | proteinase inhibitor I25, cystatin, motif protein;(source:Araport11) |
| AT2G31740 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G35070 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT3G14185 | other_RNA;(source:Araport11) |
| AT5G59945 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT5G51670 | hypothetical protein (DUF668);(source:Araport11) |
| AT2G01310 | hypothetical protein;(source:Araport11) |
| AT5G37017 | Pseudogene of AT5G16486 |
| AT1G73050 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT3G62650 | hypothetical protein;(source:Araport11) |
| AT1G02813 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
| AT5G01460 | LMBR1-like membrane protein;(source:Araport11) |
| AT2G36370 | ubiquitin-protein ligase;(source:Araport11) |
| AT3G17030 | Nucleic acid-binding proteins superfamily;(source:Araport11) |
| AT3G23085 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.1e-91 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G02360 | transmembrane protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT5G44345 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G47970 | nucleolin;(source:Araport11) |
| AT5G18005 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT4G35510 | PHD finger-like protein;(source:Araport11) |
| AT2G30105 | LRR/ubiquitin-like domain protein;(source:Araport11) |
| AT4G37685 | hypothetical protein;(source:Araport11) |
| AT3G15480 | fiber (DUF1218);(source:Araport11) |
| AT3G28220 | TRAF-like family protein;(source:Araport11) |
| AT4G19140 | exopolysaccharide production negative regulator;(source:Araport11) |
| AT5G19890 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G02090 | hypothetical protein;(source:Araport11) |
| AT4G35850 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G28088 | Low temperature and salt responsive protein family;(source:Araport11) |
| AT5G23460 | hypothetical protein;(source:Araport11) |
| AT3G62000 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G27360 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G02050 | Mitochondrial glycoprotein family protein;(source:Araport11) |
| AT4G23205 | other_RNA;(source:Araport11) |
| AT1G67010 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
| AT3G15578 | hypothetical protein;(source:Araport11) |
| AT5G13810 | Glutaredoxin family protein;(source:Araport11) |
| AT3G20300 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
| AT3G57440 | hypothetical protein;(source:Araport11) |
| AT2G41835 | zinc finger (C2H2 type, AN1-like) family protein;(source:Araport11) |
| AT5G13560 | structural maintenance of chromosomes protein;(source:Araport11) |
| AT4G34360 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G35170 | adenylate kinase family protein;(source:Araport11) |
| AT1G74780 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
| AT4G22440 | hypothetical protein;(source:Araport11) |
| AT1G71710 | DNAse I-like superfamily protein;(source:Araport11) |
| AT4G36170 | hypothetical protein;(source:Araport11) |
| AT3G51980 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G16670 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-190 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
| AT2G21195 | hypothetical protein;(source:Araport11) |
| AT4G18660 | delay of germination protein;(source:Araport11) |
| AT1G45150 | alpha-1,6-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase;(source:Araport11) |
| AT3G52535 | Natural antisense transcript overlaps with AT3G52540;(source:Araport11) |
| AT4G33666 | hypothetical protein;(source:Araport11) |
| AT5G23250 | Succinyl-CoA ligase, alpha subunit;(source:Araport11) |
| AT3G48510 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT2G44370 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G49710 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G53400 | Ubiquitin domain-containing protein;(source:Araport11) |
| AT2G21520 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT4G17280 | Auxin-responsive family protein;(source:Araport11) |
| AT1G18340 | basal transcription factor complex subunit-like protein;(source:Araport11) |
| AT2G37530 | forkhead box protein G1;(source:Araport11) |
| AT2G35840 | Sucrose-6F-phosphate phosphohydrolase family protein;(source:Araport11) |
| AT2G03020 | Heat shock protein HSP20/alpha crystallin family;(source:Araport11) |
| AT3G04650 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT1G56230 | enolase (DUF1399);(source:Araport11) |
| AT3G47680 | DNA binding protein;(source:Araport11) |
| AT3G12390 | Nascent polypeptide-associated complex (NAC), alpha subunit family protein;(source:Araport11) |
| AT5G53990 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G01160 | pre-rRNA-processing ESF1-like protein;(source:Araport11) |
| AT1G12775 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G37445 | calcium ion-binding protein;(source:Araport11) |
| AT1G05640 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G01215 | Natural antisense transcript overlaps with AT5G01210;(source:Araport11) |
| AT5G58640 | Selenoprotein, Rdx type;(source:Araport11) |
| AT2G31751 | Potential natural antisense gene, locus overlaps with AT2G31750 |
| AT3G11402 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G50900 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G68330 | membrane-associated kinase regulator;(source:Araport11) |
| AT3G06270 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G19680 | hypothetical protein (DUF1005);(source:Araport11) |
| AT4G09970 | transmembrane protein;(source:Araport11) |
| AT5G48657 | defense protein-like protein;(source:Araport11) |
| AT1G31150 | K-box region protein (DUF1985);(source:Araport11) |
| AT3G26440 | transmembrane protein, putative (DUF707);(source:Araport11) |
| AT1G73655 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT4G30662 | hypothetical protein;(source:Araport11) |
| AT1G20250 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT4G16748 | other_RNA;(source:Araport11) |
| AT4G01671 | transmembrane protein;(source:Araport11) |
| AT1G33610 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT4G28703 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT5G65610 | hypothetical protein;(source:Araport11) |
| AT1G75360 | transmembrane protein;(source:Araport11) |
| AT5G14350 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G61667 | serine protease, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT2G25590 | Plant Tudor-like protein;(source:Araport11) |
| AT5G59480 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT3G15770 | hypothetical protein;(source:Araport11) |
| AT1G21010 | PADRE proteinup-regulated after infection by S. sclerotiorun. |
| AT2G44310 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT3G02715 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT5G16650 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G78410 | VQ motif-containing protein;(source:Araport11) |
| AT3G63020 | hypothetical protein (DUF3049);(source:Araport11) |
| AT5G17390 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT2G44380 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G52960 | tRNA dimethylallyltransferase;(source:Araport11) |
| AT2G47550 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G29510 | hypothetical protein (DUF3527);(source:Araport11) |
| AT4G17215 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT3G22121 | Natural antisense transcript overlaps with AT3G22120. The RNA is cell-to-cell mobile. |
| AT5G01740 | Unknown gene, induced by abiotic stress treatments. |
| AT1G26730 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT3G48140 | B12D protein;(source:Araport11) |
| AT1G12380 | hypothetical protein;(source:Araport11) |
| AT5G54410 | hypothetical protein;(source:Araport11) |
| AT2G18969 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
| AT5G54760 | Translation initiation factor SUI1 family protein;(source:Araport11) |
| AT3G25400 | dCTP pyrophosphatase-like protein;(source:Araport11) |
| AT2G24960 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
| AT5G24690 | plant/protein, putative (DUF3411);(source:Araport11) |
| AT3G17400 | F-box family protein;(source:Araport11) |
| AT5G25010 | enhanced disease resistance-like protein (DUF1336);(source:Araport11) |
| AT5G01210 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G57030 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT2G46580 | Pyridoxamine 5-phosphate oxidase family protein;(source:Araport11) |
| AT4G31310 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT1G64430 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G24570 | hypothetical protein;(source:Araport11) |
| AT5G44283 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
| AT1G53660 | Nucleotide/sugar transporter family protein |
| AT5G55045 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT4G23895 | Pleckstrin homology (PH) domain-containing protein;(source:Araport11) |
| AT4G01600 | GRAM domain family protein;(source:Araport11) |
| AT1G13990 | plant/protein;(source:Araport11) |
| AT1G01800 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G24093 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT4G30390 | UDP-arabinopyranose mutase;(source:Araport11) |
| AT1G69450 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT2G45610 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G16930 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G17370 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G09630 | transmembrane protein (DUF616);(source:Araport11) |
| AT1G16635 | other_RNA;(source:Araport11) |
| AT5G48270 | DUF868 family protein (DUF868);(source:Araport11) |
| AT4G00520 | Acyl-CoA thioesterase family protein;(source:Araport11) |
| AT1G05860 | INO80 complex subunit D-like protein;(source:Araport11) |
| AT5G38100 | SABATH family methyltransferase. |
| AT2G05786 | hypothetical protein;(source:Araport11) |
| AT2G22820 | hypothetical protein;(source:Araport11) |
| AT2G24440 | selenium binding protein;(source:Araport11) |
| AT5G51150 | Mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein;(source:Araport11) |
| AT1G64680 | beta-carotene isomerase D27;(source:Araport11) |
| AT5G02580 | argininosuccinate lyase;(source:Araport11) |
| AT5G19875 | transmembrane protein;(source:Araport11) |
| AT3G23175 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
| AT5G15420 | hypothetical protein;(source:Araport11) |
| AT5G42290 | transcription activator-like protein;(source:Araport11) |
| AT1G35513 | pseudogene of isochorismate synthase-related / isochorismate mutase-related |
| AT4G01040 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT5G43455 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT4G00895 | ATPase, F1 complex, OSCP/delta subunit protein;(source:Araport11) |
| AT4G13710 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G02040 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT4G31360 | selenium binding protein;(source:Araport11) |
| AT5G12340 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT1G71070 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G01260 | Carbohydrate-binding-like fold;(source:Araport11) |
| AT2G19250 | pseudogene of ALBINA 1;(source:Araport11) |
| AT4G01910 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G20710 | F-box family protein;(source:Araport11) |
| AT1G04810 | 26S proteasome regulatory complex, non-ATPase subcomplex, Rpn2/Psmd1 subunit;(source:Araport11) |
| AT5G42110 | hypothetical protein;(source:Araport11) |
| AT3G62870 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
| AT2G19930 | RNA-dependent RNA polymerase family protein;(source:Araport11) |
| AT4G05150 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT1G68680 | SH3/FCH domain protein;(source:Araport11) |
| AT1G70570 | anthranilate phosphoribosyltransferase;(source:Araport11) |
| AT3G10530 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G18900 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G15242 | other_RNA;(source:Araport11) |
| AT2G46060 | transmembrane protein-like protein;(source:Araport11) |
| AT3G59020 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G05812 | Natural antisense transcript overlaps with AT2G05810;(source:Araport11) |
| AT5G16700 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT2G14520 | CBS domain protein (DUF21);(source:Araport11) |
| AT3G04860 | hypothetical protein (DUF868);(source:Araport11) |
| AT1G06002 | Natural antisense transcript overlaps with AT1G06000;(source:Araport11) |
| AT1G21590 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT2G45685 | Natural antisense transcript overlaps with AT2G45680;(source:Araport11) |
| AT2G43535 | Encodes a defensin-like (DEFL) family protein. |
| AT3G14880 | transcription factor-like protein;(source:Araport11) |
| AT3G20260 | DUF1666 family protein (DUF1666);(source:Araport11) |
| AT1G27470 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT4G12740 | HhH-GPD base excision DNA repair family protein;(source:Araport11) |
| AT2G45720 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G25770 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G10770 | Encodes a putative pectin methylesterase/invertase inhibitor. Anti-sense reduction of this gene's transcript results in pollen tube growth retardation and then partial male sterility and reduced seed set. |
| AT5G45690 | histone acetyltransferase (DUF1264);(source:Araport11) |
| AT3G10915 | Reticulon family protein;(source:Araport11) |
| AT5G49900 | Beta-glucosidase, GBA2 type family protein;(source:Araport11) |
| AT5G35970 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G43405 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43940.1);(source:TAIR10) |
| AT3G07900 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G58480 | calmodulin-binding family protein;(source:Araport11) |
| AT1G64380 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT3G14172 | GPI-anchored adhesin-like protein;(source:Araport11) |
| AT1G67850 | lysine ketoglutarate reductase trans-splicing protein (DUF707);(source:Araport11) |
| AT1G08230 | Codes for a H+-driven, high affinity gamma-aminobutyric acid (GABA) transporter. Localized at the plasma membrane. In planta, AtGAT1 expression was highest in flowers and under conditions of elevated GABA concentrations such as wounding or senescence. |
| AT5G64780 | holocarboxylase synthetase;(source:Araport11) |
| AT1G36380 | transmembrane protein;(source:Araport11) |
| AT3G05936 | hypothetical protein;(source:Araport11) |
| AT1G69485 | Ribosomal L32p protein family;(source:Araport11) |
| AT5G15500 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G68440 | Transmembrane protein;(source:Araport11). Expression induced by abiotic stressors such as ABA, drought, heat, light, NaCl, osmotic stress and wounding. |
| AT1G15540 | 2-oxoglutarate-dependent dioxygenase-like protein;(source:Araport11) |
| AT5G07260 | START (StAR-related lipid-transfer) lipid-binding domain-containing protein;(source:Araport11) |
| AT1G16870 | mitochondrial 28S ribosomal protein S29-like protein;(source:Araport11) |
| AT5G06865 | Natural antisense transcript overlaps with AT5G06860;(source:Araport11) |
| AT5G45472 | Potential natural antisense gene, locus overlaps with AT5G45470 |
| AT2G45023 | other_RNA;(source:Araport11) |
| AT1G19380 | sugar, putative (DUF1195);(source:Araport11) |
| AT5G15220 | Ribosomal protein L27 family protein;(source:Araport11) |
| AT2G17680 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT3G01520 | Encodes a universal stress protein (USP)-like protein that has been crystallized in complex with AMP, suggesting that it belongs to the ATP-binding USP subfamily. The mRNA is cell-to-cell mobile. |
| AT5G01850 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G26810 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G77780 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT1G11050 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G11880 | transferases, transferring hexosyl groups;(source:Araport11) |
| AT3G22670 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G27170 | transmembrane receptors / ATP binding protein;(source:Araport11) |
| AT1G77040 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
| AT4G24410 | hypothetical protein;(source:Araport11) |
| AT1G65845 | transmembrane protein;(source:Araport11) |
| AT5G44418 | pseudogene of cytochrome P450;(source:Araport11) |
| AT2G41170 | F-box family protein;(source:Araport11) |
| AT2G01840 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.6e-34 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G58570 | transmembrane protein;(source:Araport11) |
| AT5G03450 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G41612 | Natural antisense transcript overlaps with AT5G41610;(source:Araport11) |
| AT4G16840 | transmembrane protein;(source:Araport11) |
| AT5G11970 | ABC family ABC transporter, putative (DUF3511);(source:Araport11) |
| AT4G08134 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.6e-103 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10) |
| AT1G30440 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT4G23670 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT5G18200 | encodes an adenylyltransferase |
| AT2G28105 | replication factor-A carboxy-terminal domain protein;(source:Araport11) |
| AT1G59865 | transmembrane protein;(source:Araport11) |
| AT1G35350 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT3G17365 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G23180 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G16270 | transmembrane protein;(source:Araport11) |
| AT2G05518 | other_RNA;(source:Araport11) |
| AT2G38610 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT3G54000 | TIP41-like protein;(source:Araport11) |
| AT2G42485 | other_RNA;(source:Araport11) |
| AT3G57320 | threonine-tRNA ligase 2;(source:Araport11) |
| AT2G45300 | encodes 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase involved in chorismate biosynthesis The mRNA is cell-to-cell mobile. |
| AT2G33051 | Natural antisense transcript overlaps with AT2G33050;(source:Araport11) |
| AT1G16630 | transmembrane protein;(source:Araport11) |
| AT5G60610 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT4G26483 | nicotianamine synthase;(source:Araport11) |
| AT2G42550 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G37980 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G73170 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G29465 | transmembrane protein;(source:Araport11) |
| AT5G52450 | MATE efflux family protein;(source:Araport11) |
| AT1G55160 | WAS/WASL-interacting family protein;(source:Araport11) |
| AT2G38260 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT1G70880 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G03743 | snoRNA;(source:Araport11) |
| AT5G67510 | Translation protein SH3-like family protein;(source:Araport11) |
| AT2G18240 | Rer1 family protein;(source:Araport11) |
| AT3G48440 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G54120 | hypothetical protein;(source:Araport11) |
| AT1G77620 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G02760 | Class II aaRS and biotin synthetases superfamily protein;(source:Araport11) |
| AT1G14230 | GDA1/CD39 nucleoside phosphatase family protein;(source:Araport11) |
| AT3G27680 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT4G14290 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G78915 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G18815 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
| AT2G23100 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G15580 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G65850 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G08670 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. |
| AT4G27020 | inositol-1,4,5-trisphosphate 5-phosphatase;(source:Araport11) |
| AT2G26215 | transposable_element_gene;(source:Araport11) |
| AT2G39280 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT4G01760 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G64330 | myosin heavy chain-like protein;(source:Araport11) |
| AT2G37220 | Encodes a chloroplast RNA binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT5G61200 | myosin heavy chain-like protein;(source:Araport11) |
| AT2G47100 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
| AT5G60430 | antiporter/ drug transporter;(source:Araport11) |
| AT1G10400 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G53800 | muscle M-line assembly protein;(source:Araport11) |
| AT3G19560 | F-box family protein;(source:Araport11) |
| AT4G21740 | transmembrane protein;(source:Araport11) |
| AT1G62650 | pseudogene of P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G14035 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT4G19440 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G62640 | DUF3511 domain protein (DUF3511);(source:Araport11) |
| AT1G15350 | DUF4050 family protein;(source:Araport11) |
| AT1G64065 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G27390 | tagatose-6-phosphate ketose/aldose isomerase, putative (Mog1/PsbP/DUF1795-like photosystem II reaction center PsbP family protein);(source:Araport11) |
| AT5G11000 | hypothetical protein (DUF868);(source:Araport11) |
| AT3G45310 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G73160 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G77770 | forkhead box protein, putative (DUF1644);(source:Araport11) |
| AT3G29075 | glycine-rich protein;(source:Araport11) |
| AT1G78250 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT3G14340 | hypothetical protein;(source:Araport11) |
| AT3G50845 | MIP18 family protein (DUF59);(source:Araport11) |
| AT3G47240 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G54926.1);(source:TAIR10) |
| AT3G56290 | potassium transporter;(source:Araport11) |
| AT2G38950 | Transcription factor jumonji (jmj) family protein / zinc finger (C5HC2 type) family protein;(source:Araport11) |
| AT2G22821 | Natural antisense transcript overlaps with AT2G22820. The RNA is cell-to-cell mobile. |
| AT3G25805 | transmembrane protein;(source:Araport11) |
| AT4G24290 | MAC/Perforin domain-containing protein;(source:Araport11) |
| AT1G05700 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT2G02410 | yacP-like NYN domain protein;(source:Araport11) |
| AT1G20880 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G09460 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT5G63500 | transmembrane protein, putative (DUF 3339);(source:Araport11) |
| AT2G39440 | ribonuclease H2 subunit C-like protein;(source:Araport11) |
| AT3G53640 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G80470 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G10405 | vacuolar acid trehalase;(source:Araport11) |
| AT2G27310 | F-box family protein;(source:Araport11) |
| AT5G43830 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
| AT1G75960 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT3G61010 | Ferritin/ribonucleotide reductase-like family protein;(source:Araport11) |
| AT1G72810 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
| AT4G03030 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G54850 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT1G04830 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT1G51210 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G38250 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT4G16155 | dihydrolipoamide dehydrogenase;(source:Araport11) |
| AT4G30780 | ATP-dependent DNA helicase;(source:Araport11) |
| AT5G57670 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G55000 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
| AT5G47600 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT1G53450 | epstein-barr nuclear antigen;(source:Araport11) |
| AT1G67510 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G28660 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G17165 | hypothetical protein;(source:Araport11) |
| AT4G13470 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G24255.1);(source:TAIR10) |
| AT5G01670 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT1G52590 | Putative thiol-disulfide oxidoreductase DCC;(source:Araport11) |
| AT4G38405 | transmembrane protein;(source:Araport11) |
| AT3G06435 | Expressed protein;(source:Araport11) |
| AT3G63510 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
| AT5G61450 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G54820 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G45638 | other_RNA;(source:Araport11) |
| AT2G41178 | Natural antisense transcript overlaps with AT2G41180;(source:Araport11) |
| AT3G01130 | ATP synthase E chain;(source:Araport11) |
| AT5G35926 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
| AT1G12030 | phosphoenolpyruvate carboxylase, putative (DUF506);(source:Araport11) |
| AT4G35140 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G44415 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G09370.1);(source:TAIR10) |
| AT5G45475 | other_RNA;(source:Araport11) |
| AT3G55930 | pre-mRNA-splicing factor;(source:Araport11) |
| AT4G08250 | GRAS family transcription factor;(source:Araport11) |
| AT3G46570 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT1G71000 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G05210 | Surfeit locus protein 6;(source:Araport11) |
| AT2G02370 | SNARE associated Golgi protein family;(source:Araport11) |
| AT1G19396 | hypothetical protein;(source:Araport11) |
| AT3G08990 | Yippee family putative zinc-binding protein;(source:Araport11) |
| AT3G59210 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G23880 | NHL domain-containing protein;(source:Araport11) |
| AT1G18335 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT4G11970 | YTH family protein;(source:Araport11) |
| AT1G76740 | hypothetical protein;(source:Araport11) |
| AT3G60070 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G65240 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G63835 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-17 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT2G29670 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G19110 | inter-alpha-trypsin inhibitor heavy chain-like protein;(source:Araport11) |
| AT1G01390 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT3G08620 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT5G09225 | transmembrane protein;(source:Araport11) |
| AT3G55870 | ADC synthase superfamily protein;(source:Araport11) |
| AT2G29065 | GRAS family transcription factor;(source:Araport11) |
| AT5G01610 | hypothetical protein (Protein of unknown function, DUF538);(source:Araport11) |
| AT2G19350 | transmembrane protein (DUF872);(source:Araport11) |
| AT3G50123 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G20365 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-254 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT2G47370 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT1G22330 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G61780 | postsynaptic protein-like protein;(source:Araport11) |
| AT2G27090 | bZIP transcription factor (DUF630 and DUF632);(source:Araport11) |
| AT2G42975 | myosin-G heavy chain-like protein;(source:Araport11) |
| AT1G20320 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G10040 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G54950 | Aconitase family protein;(source:Araport11) |
| AT5G15845 | Natural antisense transcript overlaps with AT5G15850;(source:Araport11) |
| AT5G04010 | F-box family protein;(source:Araport11) |
| AT2G45600 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G08885 | pseudogene of ferretin 1;(source:Araport11) |
| AT5G09975 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
| AT4G36197 | pre-tRNA tRNA-Glu (anticodon: CTC);(source:Araport11, TAIR10) |
| AT2G42885 | Encodes a defensin-like (DEFL) family protein. |
| AT2G35470 | ribosome maturation factor;(source:Araport11) |
| AT3G59780 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT5G54480 | hypothetical protein (DUF630 and DUF632);(source:Araport11) |
| AT2G02590 | small multi-drug export protein;(source:Araport11) |
| AT3G19035 | transmembrane protein;(source:Araport11) |
| AT1G75650 | pre-tRNA tRNA-Glu (anticodon: CTC);(source:Araport11, TAIR10) |
| AT2G39130 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT1G21050 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT1G52700 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G74130 | Rhomboid-related intramembrane serine protease family protein;(source:Araport11) |
| AT3G62190 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G69150 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G49440 | hypothetical protein;(source:Araport11) |
| AT1G62950 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
| AT3G45730 | hypothetical protein;(source:Araport11) |
| AT2G23450 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G32920 | glycine-rich protein;(source:Araport11) |
| AT2G25530 | AFG1-like ATPase family protein;(source:Araport11) |
| AT1G14010 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT1G77750 | Ribosomal protein S13/S18 family;(source:Araport11) |
| AT1G03570 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
| AT3G17110 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT1G45230 | DCL protein (DUF3223);(source:Araport11) |
| AT1G72190 | D-isomer specific 2-hydroxyacid dehydrogenase family protein;(source:Araport11) |
| AT4G37480 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G58375 | Methyltransferase-related protein;(source:Araport11) |
| AT4G13530 | transmembrane protein;(source:Araport11) |
| AT1G62510 | Expressed in the root cortex. |
| AT3G27886 | transposable_element_gene;(source:Araport11);pseudogene, similar to SAE1-S9-protein, blastp match of 22%25 identity and 3.3e-08 P-value to GP|4760708|dbj|BAA77394.1||AB012866 SAE1-S9-protein {Brassica rapa};(source:TAIR10) |
| AT1G65010 | Encodes a microtubule-associated protein. Putative role in flower development. Comparison of SALK_061426C to Columbia wild type in normal lighting and under low light of 33 micromoles per meter-squared per second resulted in a trend toward earlier bolting in the mutant under low light (P=0.055) (Ann Stapleton and Patrick Pridgen, 2009, personal communication). |
| AT4G25020 | D111/G-patch domain-containing protein;(source:Araport11) |
| AT1G14470 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G07080 | Thioredoxin superfamily protein;(source:Araport11) |
| AT2G40280 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G16610 | hypothetical protein;(source:Araport11) |
| AT1G08050 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT5G51560 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G15040 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT5G15110 | Pectate lyase family protein;(source:Araport11) |
| AT5G57340 | ras guanine nucleotide exchange factor Q-like protein;(source:Araport11) |
| AT1G50590 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT4G32030 | hypothetical protein;(source:Araport11) |
| AT2G38390 | Peroxidase superfamily protein;(source:Araport11) |
| AT2G39950 | flocculation protein;(source:Araport11) |
| AT3G58470 | nucleic acid binding / methyltransferase;(source:Araport11) |
| AT5G11700 | ephrin type-B receptor;(source:Araport11) |
| AT5G25050 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G70650 | Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11) |
| AT3G15760 | cytochrome P450 family protein;(source:Araport11) |
| AT2G25730 | zinc finger FYVE domain protein;(source:Araport11) |
| AT4G17765 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT4G19970 | nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT3G29240 | PPR containing protein (DUF179);(source:Araport11) |
| AT4G01595 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G25880 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G49142 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G35859 | Natural antisense transcript overlaps with AT2G35860;(source:Araport11) |
| AT1G67310 | Calmodulin-binding transcription activator protein with CG-1 and Ankyrin domain;(source:Araport11) |
| AT1G49980 | DNA/RNA polymerases superfamily protein;(source:Araport11) |
| AT5G13360 | Auxin-responsive GH3 family protein;(source:Araport11) |
| AT3G30460 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G58340 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
| AT5G07620 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G07610 | F-box family protein;(source:Araport11) |
| AT5G58520 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G05932 | Potential natural antisense gene, locus overlaps with AT3G05930 |
| AT4G33540 | metallo-beta-lactamase family protein;(source:Araport11) |
| AT4G17100 | poly(U)-specific endoribonuclease-B protein;(source:Araport11) |
| AT5G25030 | ATP-binding protein (DUF2431);(source:Araport11) |
| AT3G21620 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
| AT1G33600 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G70600 | Ribosomal protein L18e/L15 superfamily protein;(source:Araport11) |
| AT1G70280 | NHL domain-containing protein;(source:Araport11) |
| AT4G38300 | glycosyl hydrolase family 10 protein;(source:Araport11) |
| AT3G51560 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT2G17723 | Encodes a defensin-like (DEFL) family protein. |
| AT3G09590 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT3G54450 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G65050 | TRAF-like superfamily protein;(source:Araport11) |
| AT3G48380 | Peptidase C78, ubiquitin fold modifier-specific peptidase 1/ 2;(source:Araport11) |
| AT1G27050 | Encodes a protein with a RNA recognition motif. Previously annotated as ATHB54, a homeodomain leucine zipper (HD-Zip) family protein. In the TAIR10 genome release (2010), this locus was split into two loci: AT1G27045 (containing homeodomain and leucine zipper domains) and AT1G27050 (containing a RNA recognition motif). AT1G27045 is now named ATHB54. Note that Affymetrix ATH1 Probe Set linked to symbol ATHB54 is in fact directed against the product of the AT1G27050 locus (the mRNA coding for the RNA-recognition-motif protein). |
| AT4G33625 | vacuole protein;(source:Araport11) |
| AT5G66567 | snoRNA;(source:Araport11) |
| AT3G50650 | GRAS family transcription factor;(source:Araport11) |
| AT5G25625 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT1G62045 | ankyrin repeat protein;(source:Araport11) |
| AT1G60020 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:AAC02672 polyprotein (Ty1_Copia-element) (Arabidopsis arenosa);(source:TAIR10) |
| AT4G32140 | EamA-like transporter family;(source:Araport11) |
| AT1G74840 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G66652 | fip1 motif-containing protein;(source:Araport11) |
| AT3G16120 | Dynein light chain type 1 family protein;(source:Araport11) |
| AT1G65830 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT3G05835 | pre-tRNA tRNA-Ile (anticodon: TAT);(source:Araport11, TAIR10) |
| AT5G41460 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT5G18920 | Cox19-like CHCH family protein;(source:Araport11) |
| AT1G07728 | Natural antisense transcript overlaps with AT1G07725;(source:Araport11) |
| AT4G02630 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G20060 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G47610 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT4G12005 | hypothetical protein;(source:Araport11) |
| AT1G03100 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G36550 | haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
| AT3G05425 | hypothetical protein;(source:Araport11) |
| AT5G64910 | Serine/Threonine-kinase;(source:Araport11) |
| AT3G50685 | anti-muellerian hormone type-2 receptor;(source:Araport11) |
| AT4G14385 | histone acetyltransferase subunit NuA4-domain protein;(source:Araport11) |
| AT4G04630 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT5G56840 | myb-like transcription factor family protein;(source:Araport11) |
| AT3G06995 | Encodes a Defensin-like (DEFL) family protein [pseudogene] |
| AT2G11880 | None;(source:Araport11) |
| AT2G43320 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G21187 | Natural antisense transcript overlaps with AT2G21185;(source:Araport11) |
| AT5G61910 | DCD (Development and Cell Death) domain protein;(source:Araport11) |
| AT1G64450 | Glycine-rich protein family;(source:Araport11) |
| AT5G52070 | Agenet domain-containing protein;(source:Araport11) |
| AT3G60980 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G10845 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G38240 | Protein kinase family protein;(source:Araport11) |
| AT3G03870 | transmembrane protein;(source:Araport11) |
| AT1G50630 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
| AT2G44360 | ecotropic viral integration site protein;(source:Araport11) |
| AT3G22440 | FRIGIDA-like protein;(source:Araport11) |
| AT4G24790 | AAA-type ATPase family protein;(source:Araport11) |
| AT2G17760 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G03746 | snoRNA;(source:Araport11) |
| AT1G13360 | hypothetical protein;(source:Araport11) |
| AT2G42425 | other_RNA;(source:Araport11) |
| AT1G62870 | hypothetical protein;(source:Araport11) |
| AT1G49870 | myosin-2 heavy chain-like protein;(source:Araport11) |
| AT3G62140 | NEFA-interacting nuclear protein;(source:Araport11) |
| AT2G26360 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT2G24160 | pseudogene of receptor like protein 37;(source:Araport11) |
| AT2G36026 | Ovate family protein;(source:Araport11) |
| AT1G52330 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G07760 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT4G36500 | hypothetical protein;(source:Araport11) |
| AT3G23530 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
| AT3G59130 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G10020 | formin-like protein (DUF1005);(source:Araport11) |
| AT3G02120 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G23575 | Transmembrane CLPTM1 family protein;(source:Araport11) |
| AT1G72240 | hypothetical protein;(source:Araport11) |
| AT5G24170 | Got1/Sft2-like vescicle transport protein family;(source:Araport11) |
| AT5G23370 | GRAM domain-containing protein / ABA-responsive protein-like protein;(source:Araport11) |
| AT4G15140 | hypothetical protein;(source:Araport11) |
| AT5G44417 | pseudogene of FAD-binding Berberine family protein;(source:Araport11) |
| AT4G37170 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G55050 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. The mRNA is cell-to-cell mobile. |
| AT1G14170 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT1G72100 | late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11) |
| AT5G15870 | glycosyl hydrolase family 81 protein;(source:Araport11) |
| AT4G20450 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G05180 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G50560 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G22690 | zinc ion binding protein;(source:Araport11) |
| AT4G14240 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
| AT3G07580 | hypothetical protein;(source:Araport11) |
| AT1G29650 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-28 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G60410 | hypothetical protein (DUF1639);(source:Araport11) |
| AT4G32110 | Beta-1,3-N-Acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G17680 | tetratricopeptide repeat (TPR)-containing protein;(source:Araport11) |
| AT4G31110 | Wall-associated kinase family protein;(source:Araport11) |
| AT5G64030 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G43610 | Spc97 / Spc98 family of spindle pole body (SBP) component;(source:Araport11) |
| AT1G69470 | heat shock protein-binding protein;(source:Araport11) |
| AT2G28460 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G17975 | pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10) |
| AT3G22415 | hypothetical protein;(source:Araport11) |
| AT1G23850 | transmembrane protein;(source:Araport11) |
| AT1G62305 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT2G22807 | Encodes a defensin-like (DEFL) family protein. |
| AT5G05480 | Peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase A protein;(source:Araport11) |
| AT4G16490 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G35930 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT5G05370 | Cytochrome b-c1 complex, subunit 8 protein;(source:Araport11) |
| AT2G21670 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
| AT1G24440 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G07175 | alternative NAD(P)H dehydrogenase;(source:Araport11) |
| AT3G47830 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G26850 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G13920 | Remorin family protein;(source:Araport11) |
| AT3G15395 | HrpN-interacting protein from malus protein;(source:Araport11) |
| AT5G18490 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
| AT5G45960 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G12170 | F-box family protein;(source:Araport11) |
| AT3G45830 | nuclear factor kappa-B-binding-like protein;(source:Araport11) |
| AT5G10290 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
| AT1G12790 | DNA ligase-like protein;(source:Araport11) |
| AT1G75400 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G42570 | peroxidase family protein;(source:Araport11) |
| AT5G52990 | SNARE-like superfamily protein;(source:Araport11) |
| AT5G43140 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
| AT1G17850 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT2G47720 | hypothetical protein;(source:Araport11) |
| AT5G65910 | BSD domain-containing protein;(source:Araport11) |
| AT5G43260 | chaperone protein dnaJ-like protein;(source:Araport11) |
| AT4G21880 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G11673 | pseudogene of F-box family protein |
| AT5G14700 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G35150 | General transcription factor 2-related zinc finger protein;(source:Araport11) |
| AT1G21722 | transmembrane protein;(source:Araport11) |
| AT5G54165 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
| AT3G03130 | lisH domain-like protein;(source:Araport11) |
| AT1G21770 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT5G49525 | transmembrane protein;(source:Araport11) |
| AT2G36290 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G16765 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G32460 | hypothetical protein;(source:Araport11) |
| AT4G24760 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G22510 | E3 ubiquitin-protein ligase RNF170-like protein (DUF 1232);(source:Araport11) |
| AT1G18430 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT5G22730 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT2G39650 | cruciferin (DUF506);(source:Araport11) |
| AT4G14230 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
| AT2G39390 | Ribosomal L29 family protein;(source:Araport11) |
| AT1G68490 | translocase subunit seca;(source:Araport11) |
| AT3G15420 | Transcription factor TFIIIC, tau55-related protein;(source:Araport11) |
| AT3G57940 | GNAT acetyltransferase (DUF699);(source:Araport11) |
| AT1G19310 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G07280 | None;(source:Araport11) |
| AT1G78210 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G66490 | hypothetical protein;(source:Araport11) |
| AT5G01390 | DNAJ heat shock family protein;(source:Araport11) |
| AT5G25520 | SPOC domain / Transcription elongation factor S-II protein;(source:Araport11) |
| AT1G02610 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT5G52130 | hypothetical protein;(source:Araport11) |
| AT1G75730 | hypothetical protein;(source:Araport11) |
| AT1G05370 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G61810 | Glycosyl hydrolase family 17 protein;(source:Araport11) |
| AT5G07790 | hypothetical protein;(source:Araport11) |
| AT3G56085 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT1G52680 | late embryogenesis abundant protein-related / LEA protein-like protein;(source:Araport11) |
| AT1G78480 | Prenyltransferase family protein;(source:Araport11) |
| AT1G62520 | sulfated surface-like glycoprotein;(source:Araport11) |
| AT5G24355 | hypothetical protein;(source:Araport11) |
| AT2G27870 | transposable_element_gene;(source:Araport11);similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT2G22350.1);(source:TAIR10) |
| AT1G71210 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G70420 | DNA ligase-like protein, putative (DUF1645);(source:Araport11) |
| AT1G76440 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT1G55450 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G45250 | integral membrane hemolysin-III-like protein;(source:Araport11) |
| AT5G10745 | transmembrane protein;(source:Araport11) |
| AT3G21781 | Natural antisense transcript overlaps with AT3G21780;(source:Araport11) |
| AT2G01300 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
| AT1G04570 | Similar to plastid solute transporters. |
| AT3G07120 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G80245 | Spc97 / Spc98 family of spindle pole body (SBP) component;(source:Araport11) |
| AT1G47310 | signal peptidase I;(source:Araport11) |
| AT4G40085 | Natural antisense transcript overlaps with AT4G40080;(source:Araport11) |
| AT5G04060 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G03445 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT5G23690 | Polynucleotide adenylyltransferase family protein;(source:Araport11) |
| AT3G01360 | plant viral-response family protein (DUF716);(source:Araport11) |
| AT4G31410 | E3 ubiquitin-protein ligase, putative (DUF1644);(source:Araport11) |
| AT5G15620 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT2G23690 | PADRE protein. |
| AT4G31760 | peroxidase superfamily protein;(source:Araport11) |
| AT1G67400 | ELMO/CED-12 family protein;(source:Araport11) |
| AT5G39530 | hypothetical protein (DUF1997);(source:Araport11) |
| AT5G53500 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G08680 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G58530 | Glutaredoxin family protein;(source:Araport11) |
| AT3G12502 | Natural antisense transcript overlaps with AT3G12500;(source:Araport11) |
| AT2G25950 | PITH domain protein (DUF1000);(source:Araport11) |
| AT5G46040 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G28060 | Cytochrome c oxidase, subunit Vib family protein;(source:Araport11) |
| AT3G47160 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G62110 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G04540 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT5G07360 | Amidase family protein;(source:Araport11) |
| AT2G12400 | plasma membrane fusion protein;(source:Araport11) |
| AT5G56365 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT3G58140 | phenylalanyl-tRNA synthetase class IIc family protein;(source:Araport11) |
| AT1G50580 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G18560 | BED zinc finger and hAT dimerization domain-containing protein;(source:Araport11) |
| AT5G10770 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G74370 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G29310 | DUF1005 family protein (DUF1005);(source:Araport11) |
| AT1G07985 | Expressed protein;(source:Araport11) |
| AT2G41730 | Expression in rosette leaves is activated by high concentration of boron. |
| AT1G21680 | DPP6 N-terminal domain-like protein;(source:Araport11) |
| AT4G03135 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
| AT2G44010 | hypothetical protein;(source:Araport11) |
| AT5G15320 | ATP synthase E chain;(source:Araport11) |
| AT5G15910 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G41690 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G16840 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G17570 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT3G20340 | Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT4G01130 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G59690 | Histone superfamily protein;(source:Araport11) |
| AT3G47580 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G72790 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G13265 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
| AT5G57890 | Glutamine amidotransferase type 1 family protein;(source:Araport11) |
| AT3G14240 | Subtilase family protein;(source:Araport11) |
| AT5G66800 | membrane-associated kinase regulator-like protein;(source:Araport11) |
| AT1G27350 | Ribosome associated membrane protein RAMP4;(source:Araport11) |
| AT5G35375 | transmembrane protein;(source:Araport11) |
| AT2G30700 | GPI-anchored protein;(source:Araport11) |
| AT4G22265 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT5G49015 | Expressed protein;(source:Araport11) |
| AT5G56350 | Pyruvate kinase family protein;(source:Araport11) |
| AT1G57765 | transmembrane protein;(source:Araport11) |
| AT1G62421 | hypothetical protein;(source:Araport11) |
| AT4G08038 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to reverse transcriptase, putative;(source:TAIR10) |
| AT5G26731 | hypothetical protein;(source:Araport11) |
| AT2G16790 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G28660 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G42670 | Agenet domain-containing protein;(source:Araport11) |
| AT3G24614 | Encodes a Z4 snoRNA. Gb: AJ240073 |
| AT5G37540 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G03620 | MATE efflux family protein;(source:Araport11) |
| AT2G32020 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT4G40045 | transmembrane protein;(source:Araport11) |
| AT2G35830 | ureidoglycolate hydrolase;(source:Araport11) |
| AT3G60110 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT2G21895 | Encodes a ECA1 gametogenesis related family protein [pseudogene] |
| AT1G02890 | AAA-type ATPase family protein;(source:Araport11) |
| AT2G17660 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
| AT5G23950 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G45253 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.0e-48 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G13380 | sodium/hydrogen exchanger (DUF1218);(source:Araport11) |
| AT1G22560 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.4e-20 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G07010 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G46000 | LDL receptor wingless signaling/trafficking chaperone;(source:Araport11) |
| AT1G76878 | Natural antisense transcript overlaps with AT1G76880;(source:Araport11) |
| AT3G09010 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G29180 | DUF1336 family protein (DUF1336);(source:Araport11) |
| AT3G24640 | lyase;(source:Araport11) |
| AT1G28100 | hypothetical protein;(source:Araport11) |
| AT5G20740 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G03740 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G03460 | transmembrane protein;(source:Araport11) |
| AT5G46380 | Serine/Threonine-kinase, putative (DUF1296);(source:Araport11) |
| AT2G19160 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT2G42480 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT5G18015 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT1G63840 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G36670 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G30490 | AFG1-like ATPase family protein;(source:Araport11) |
| AT2G30115 | other_RNA;(source:Araport11) |
| AT2G43880 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G37960 | myosin-M heavy protein;(source:Araport11) |
| AT1G20940 | F-box family protein;(source:Araport11) |
| AT1G50380 | Prolyl oligopeptidase family protein;(source:Araport11) |
| AT1G78230 | Outer arm dynein light chain 1 protein;(source:Araport11) |
| AT1G53040 | tRNA (met) cytidine acetyltransferase, putative (DUF616);(source:Araport11) |
| AT5G03660 | transcriptional activator (DUF662);(source:Araport11) |
| AT3G62380 | F-box/associated interaction domain protein;(source:Araport11) |
| AT1G64650 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G41050 | PQ-loop repeat family protein / transmembrane family protein;(source:Araport11) |
| AT3G28700 | NADH dehydrogenase ubiquinone complex I, assembly factor-like protein (DUF185);(source:Araport11) |
| AT3G15260 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT1G62981 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT1G32650 | hypothetical protein;(source:Araport11) |
| AT3G03350 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G06380 | hypothetical protein;(source:Araport11) |
| AT1G18990 | myosin-binding protein, putative (Protein of unknown function, DUF593);(source:Araport11) |
| AT3G50800 | PADRE protein. |
| AT5G07225 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G19500 | hypothetical protein;(source:Araport11) |
| AT4G17070 | peptidyl-prolyl cis-trans isomerase;(source:Araport11) |
| AT1G75510 | Transcription initiation factor IIF, beta subunit;(source:Araport11) |
| AT5G66290 | hypothetical protein;(source:Araport11) |
| AT3G05050 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G17800 | mRNA level of the MEB5.2 gene (At3g17800) remains unchanged after cutting the inflorescence stem |
| AT2G36770 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G55570 | transmembrane protein;(source:Araport11) |
| AT1G49330 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G19274 | hypothetical protein;(source:Araport11) |
| AT1G35516 | myb-like transcription factor family protein;(source:Araport11) |
| AT2G32030 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT1G56290 | CwfJ-like family protein;(source:Araport11) |
| AT2G26730 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G10090 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT2G24755 | Natural antisense transcript overlaps with AT2G24750 and AT2G24760;(source:Araport11) |
| AT2G45380 | myeloid leukemia factor;(source:Araport11) |
| AT2G24760 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.9e-16 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G67190 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT4G14819 | hypothetical protein (DUF1677);(source:Araport11) |
| AT3G08980 | Peptidase S24/S26A/S26B/S26C family protein;(source:Araport11) |
| AT4G03820 | transmembrane protein, putative (DUF3537);(source:Araport11) |
| AT2G38500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G62780 | dimethylallyl, adenosine tRNA methylthiotransferase;(source:Araport11) |
| AT5G53010 | calcium-transporting ATPase;(source:Araport11) |
| AT3G27050 | plant/protein;(source:Araport11) |
| AT5G52950 | LIM domain protein;(source:Araport11) |
| AT5G55950 | Nucleotide/sugar transporter family protein;(source:Araport11) |
| AT5G62550 | microtubule-associated futsch-like protein;(source:Araport11) |
| AT2G42140 | VQ motif-containing protein;(source:Araport11) |
| AT1G62422 | hypothetical protein;(source:Araport11) |
| AT3G52830 | ankyrin repeat protein;(source:Araport11) |
| AT1G67590 | Remorin family protein;(source:Araport11) |
| AT5G66120 | 3-dehydroquinate synthase;(source:Araport11) |
| AT4G00300 | AT4G00300 has been split into two loci based on new cDNA evidence provided by Aleksander Riise Hansen of University of Copenhagen: AT4G00300.2 becomes AT4G00300.1; a new locus AT4G00295 is created. See comments field for AT4G00295 annotation. |
| AT3G02500 | mental retardation GTPase activating protein;(source:Araport11) |
| AT4G03020 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT5G65260 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT4G29530 | Encodes a thiamin monophosphate phosphatase. Knockouts show no visible defects either in morphology or thiamin, ThMP and ThDP levels suggesting that Arabidopsis at least one other source of ThMPase activity. |
| AT4G03420 | hypothetical protein (DUF789);(source:Araport11) |
| AT5G13140 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT2G03110 | putative RNA-binding protein;(source:Araport11) |
| AT1G73920 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G58007 | multidrug resistance protein;(source:Araport11) |
| AT3G11395 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
| AT1G70780 | hypothetical protein;(source:Araport11) |
| AT5G24879 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT2G40310 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G34320 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G11785 | transmembrane protein;(source:Araport11) |
| AT4G31248 | Natural antisense transcript overlaps with AT4G31250;(source:Araport11) |
| AT5G18590 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G06890 | transmembrane protein;(source:Araport11) |
| AT1G05870 | hypothetical protein (DUF1685);(source:Araport11) |
| AT3G23320 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT3G03828 | transmembrane protein;(source:Araport11) |
| AT5G10730 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G35730 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT3G13690 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT1G59880 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
| AT2G19660 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G78476 | hypothetical protein;(source:Araport11) |
| AT4G13270 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT3G46690 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G32360 | Zinc finger (CCCH-type) family protein;(source:Araport11) |
| AT2G42020 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
| AT1G67785 | hypothetical protein;(source:Araport11) |
| AT1G04680 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G11480 | eukaryotic translation initiation factor-like protein;(source:Araport11) |
| AT1G74929 | hypothetical protein;(source:Araport11) |
| AT1G78895 | Reticulon family protein;(source:Araport11) |
| AT5G08075 | pre-tRNA tRNA-Ala (anticodon: CGC);(source:Araport11, TAIR10) |
| AT3G54680 | proteophosphoglycan-like protein;(source:Araport11) |
| AT5G11420 | Encodes a DUF642 cell wall protein. |
| AT1G80130 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G06070 | hypothetical protein;(source:Araport11) |
| AT4G35500 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G31840 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G38030 | pre-tRNA tRNA-Glu (anticodon: CTC);(source:Araport11, TAIR10) |
| AT3G51238 | Natural antisense transcript overlaps with AT3G51240;(source:Araport11) |
| AT5G09670 | loricrin-like protein;(source:Araport11) |
| AT2G43540 | transmembrane protein;(source:Araport11) |
| AT1G28375 | transmembrane protein;(source:Araport11) |
| AT2G34250 | SecY protein transport family protein;(source:Araport11) |
| AT5G42785 | transmembrane protein;(source:Araport11) |
| AT5G37710 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G56570 | SET domain-containing protein;(source:Araport11) |
| AT5G13250 | RING finger protein;(source:Araport11) |
| AT1G61760 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT3G22845 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT3G03790 | ankyrin repeat family protein / regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT5G32440 | Ubiquitin system component Cue protein;(source:Araport11) |
| AT3G54460 | SNF2 domain-containing protein / helicase domain-containing protein / F-box family protein;(source:Araport11) |
| AT1G61900 | hypothetical protein;(source:Araport11) |
| AT2G17530 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G34570 | Essential protein Yae1, N-terminal;(source:Araport11) |
| AT1G43000 | PLATZ transcription factor family protein;(source:Araport11) |
| AT1G28580 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G08040 | trimethylguanosine synthase (DUF707);(source:Araport11) |
| AT1G69130 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT4G01593 | Natural antisense transcript overlaps with AT4G01595;(source:Araport11) |
| AT2G28200 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT5G05320 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT3G30390 | Encodes a putative amino acid transporter. |
| AT4G30240 | Syntaxin/t-SNARE family protein;(source:Araport11) |
| AT3G28650 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G16660 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G27350 | membrane lipoprotein lipid attachment site-like protein, putative (DUF1223);(source:Araport11) |
| AT5G22820 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G12350 | F-box family protein;(source:Araport11) |
| AT1G17620 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT3G62630 | stress response NST1-like protein (DUF1645);(source:Araport11) |
| AT2G38090 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT1G07210 | Ribosomal protein S18;(source:Araport11) |
| AT5G58150 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G29175 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.8e-22 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT4G01200 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT2G34460 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G06035 | Glycoprotein membrane precursor GPI-anchored;(source:Araport11) |
| AT3G42800 | AF-like protein;(source:Araport11) |
| AT5G64550 | loricrin-like protein;(source:Araport11) |
| AT4G01210 | glycosyl transferase family 1 protein;(source:Araport11) |
| AT5G08680 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. The mRNA is cell-to-cell mobile. |
| AT2G38646 | hypothetical protein;(source:Araport11) |
| AT3G08636 | hypothetical protein;(source:Araport11) |
| AT5G43403 | other_RNA;(source:Araport11) |
| AT2G03040 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT1G48830 | Ribosomal protein S7e family protein;(source:Araport11) |
| AT5G57887 | transmembrane protein;(source:Araport11) |
| AT5G53150 | DnaJ heat shock amino-terminal domain protein;(source:Araport11) |
| AT5G64970 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT3G11800 | Expp1 protein;(source:Araport11) |
| AT2G34110 | hypothetical protein;(source:Araport11) |
| AT3G61826 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G46900 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G29786 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G43320.1);(source:TAIR10) |
| AT2G24240 | BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11) |
| AT5G19870 | transmembrane epididymal protein (DUF716);(source:Araport11) |
| AT1G69480 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT1G19450 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G64395 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G01670 | hypothetical protein;(source:Araport11) |
| AT1G54730 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G17680 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT4G19550 | zinc ion binding / transcription regulator;(source:Araport11) |
| AT1G26580 | ELM2 domain protein;(source:Araport11) |
| AT4G18630 | hypothetical protein (DUF688);(source:Araport11) |
| AT5G16990 | molecular function has not been defined, was shown involved in oxidative stress tolerance. The mRNA is cell-to-cell mobile. |
| AT3G10090 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT4G34480 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G16730 | Encodes a microtubule-associated protein. The mRNA is cell-to-cell mobile. |
| AT1G64050 | hypothetical protein;(source:Araport11) |
| AT5G40690 | histone-lysine N-methyltransferase trithorax-like protein;(source:Araport11) |
| AT2G29370 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G02480 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT3G29762 | pseudogene of DNA-directed RNA polymerase family protein;(source:Araport11) |
| AT1G09176 | transmembrane protein;(source:Araport11) |
| AT1G72020 | TonB-dependent heme receptor A;(source:Araport11) |
| AT1G16170 | ephrin-A3 protein;(source:Araport11) |
| AT4G24480 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G65880 | transmembrane protein;(source:Araport11) |
| AT5G65535 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
| AT3G30300 | O-fucosyltransferase family protein;(source:Araport11) |
| AT2G37650 | GRAS family transcription factor;(source:Araport11) |
| AT3G61840 | auxin response factor, putative (DUF688);(source:Araport11) |
| AT4G36032 | Natural antisense transcript overlaps with AT4G36030;(source:Araport11) |
| AT1G49170 | hypothetical protein;(source:Araport11) |
| AT2G01422 | other_RNA;(source:Araport11) |
| AT5G67140 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G15165 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT2G01818 | PLATZ transcription factor family protein;(source:Araport11) |
| AT3G01513 | hypothetical protein;(source:Araport11) |
| AT2G21960 | transmembrane protein;(source:Araport11) |
| AT3G12510 | MADS-box family protein;(source:Araport11) |
| AT5G25630 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G10140 | Uncharacterized conserved protein UCP031279;(source:Araport11) |
| AT1G22910 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G15220 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G58180 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G39530 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G48670 | auxin-responsive GH3 family protein;(source:Araport11) |
| AT5G05965 | cell wall RBR3-like protein;(source:Araport11) |
| AT1G19410 | FBD / Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT4G33610 | glycine-rich protein;(source:Araport11) |
| AT3G03070 | NADH-ubiquinone oxidoreductase-like protein;(source:Araport11) |
| AT4G30470 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G37610 | Eukaryotic porin family protein;(source:Araport11) |
| AT3G24830 | Ribosomal protein L13 family protein;(source:Araport11) |
| AT5G10420 | MATE efflux family protein;(source:Araport11) |
| AT3G15200 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G05280 | Integral membrane Yip1 family protein;(source:Araport11) |
| AT5G05710 | Pleckstrin homology (PH) domain superfamily protein;(source:Araport11) |
| AT1G28920 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT1G27200 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT5G15690 | zinc ion binding protein;(source:Araport11) |
| AT1G72500 | inter alpha-trypsin inhibitor, heavy chain-like protein;(source:Araport11) |
| AT5G21970 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT2G34450 | HMG-box (high mobility group) DNA-binding family protein;(source:Araport11) |
| AT5G65850 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G09390 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G17350 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT5G42170 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT1G21950 | transmembrane protein;(source:Araport11) |
| AT1G59690 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G59110 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G23070 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
| AT2G22590 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G48790 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT4G39280 | phenylalanyl-tRNA synthetase, putative / phenylalanine-tRNA ligase;(source:Araport11) |
| AT1G27180 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT1G64270 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.0e-06 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT1G52200 | PLAC8 family protein;(source:Araport11) |
| AT1G75900 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G22160 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT4G23030 | MATE efflux family protein;(source:Araport11) |
| AT5G60240 | hypothetical protein;(source:Araport11) |
| AT1G62600 | Flavin-binding monooxygenase family protein;(source:Araport11) |
| AT4G11020 | hypothetical protein;(source:Araport11) |
| AT3G26580 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G66480 | bacteriophage N4 adsorption B protein;(source:Araport11) |
| AT2G35920 | RNA helicase family protein;(source:Araport11) |
| AT1G20170 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
| AT5G52840 | NADH-ubiquinone oxidoreductase-like protein;(source:Araport11) |
| AT1G04210 | Encodes a putative Raf-related kinase. |
| AT1G69000 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT3G62735 | pre-tRNA tRNA-Gly (anticodon: CCC);(source:Araport11, TAIR10) |
| AT1G02670 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G50550 | hypothetical protein;(source:Araport11) |
| AT3G14830 | epstein-barr nuclear antigen;(source:Araport11) |
| AT3G19900 | hypothetical protein;(source:Araport11) |
| AT3G06895 | syntaxin KNOLLE-like protein;(source:Araport11) |
| AT1G32120 | serine/threonine-protein phosphatase 7 long form-like protein;(source:Araport11) |
| AT1G12440 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT5G13890 | plant viral-response family protein (DUF716);(source:Araport11) |
| AT3G18815 | pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10) |
| AT4G16550 | HSP20-like chaperone, expression is induced by stress. |
| AT4G01590 | DNA-directed RNA polymerase III subunit;(source:Araport11) |
| AT5G39560 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G63130 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT3G61870 | plant/protein;(source:Araport11) |
| AT1G07070 | Ribosomal protein L35Ae family protein;(source:Araport11) |
| AT1G49032 | hypothetical protein;(source:Araport11) |
| AT1G67856 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G24390 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT2G47150 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G51840 | junctophilin-like protein;(source:Araport11) |
| AT4G38401 | hypothetical protein;(source:Araport11) |
| AT5G57070 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G48250 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G35400.1);(source:TAIR10) |
| AT3G11590 | golgin family A protein;(source:Araport11) |
| AT5G51260 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT5G24980 | transmembrane protein;(source:Araport11) |
| AT3G22180 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT1G22480 | Cupredoxin superfamily protein;(source:Araport11) |
| AT3G53830 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT2G07010 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.9e-175 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G01740 | Mitochondrial ribosomal protein L37;(source:Araport11) |
| AT1G60010 | PADRE protein down-regulated after infection by S. sclerotiorun. |
| AT3G08890 | hypothetical protein (Protein of unknown function, DUF538);(source:Araport11) |
| AT2G45780 | other_RNA;(source:Araport11) |
| AT2G17972 | transmembrane protein;(source:Araport11) |
| AT2G23673 | Pseudogene of AT2G23680; stress-responsive protein, putative |
| AT2G19220 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
| AT4G25070 | caldesmon-like protein;(source:Araport11) |
| AT3G62850 | zinc finger protein-like protein;(source:Araport11) |
| AT3G56080 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G34330 | LOW protein: protein BOBBER-like protein;(source:Araport11) |
| AT1G50575 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT5G57010 | calmodulin-binding family protein;(source:Araport11) |
| AT2G23780 | Leucine rich extensin protein involved in cell wall biogenesis and organization. Interacts with several members of the RALF family of ligand peptides. |
| AT1G12850 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT2G31730 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G55896 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.7e-49 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G46554 | other_RNA;(source:Araport11) |
| AT4G17760 | PCNA domain-containing protein;(source:Araport11) |
| AT3G02340 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G37140 | Terpenoid synthases superfamily protein;(source:Araport11) |
| AT2G30600 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT1G17660 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT2G24550 | major centromere autoantigen B-like protein;(source:Araport11) |
| AT1G64250 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.2e-20 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT4G13575 | hypothetical protein;(source:Araport11) |
| AT1G28600 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G64500 | Major facilitator superfamily protein |
| AT5G02230 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G63170 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
| AT3G06150 | cytochrome P450 family protein;(source:Araport11) |
| AT1G43910 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G13650 | hypothetical protein;(source:Araport11) |
| AT5G39900 | Small GTP-binding protein;(source:Araport11) |
| AT3G09860 | actin T1-like protein;(source:Araport11) |
| AT3G57010 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT1G07870 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G17540 | dynamin;(source:Araport11) |
| AT3G12345 | FKBP-type peptidyl-prolyl cis-trans isomerase;(source:Araport11) |
| AT1G31790 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G54855 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT4G22360 | SWIB complex BAF60b domain-containing protein;(source:Araport11) |
| AT1G67855 | hypothetical protein;(source:Araport11) |
| AT5G07730 | transmembrane protein;(source:Araport11) |
| AT3G27965 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.5e-26 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
| AT1G11370 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G20770 | coiled-coil protein;(source:Araport11) |
| AT3G49890 | hypothetical protein;(source:Araport11) |
| AT3G15590 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G18773 | acyl thioesterase-like protein;(source:Araport11) |
| AT5G02540 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G04640 | glycine-rich protein;(source:Araport11) |
| AT5G49140 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT2G22070 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT5G47818 | pseudogene of WPP domain interacting protein 1;(source:Araport11) |
| AT3G62285 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT3G01060 | lysine-tRNA ligase;(source:Araport11) |
| AT3G63360 | Encodes a defensin-like (DEFL) family protein. |
| AT1G77400 | extensin-like protein;(source:Araport11) |
| AT1G28590 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G38000 | chaperone protein dnaJ-like protein;(source:Araport11) |
| AT5G54940 | Translation initiation factor SUI1 family protein;(source:Araport11) |
| AT3G07310 | phosphoserine aminotransferase, putative (DUF760);(source:Araport11) |
| AT5G59970 | Histone superfamily protein;(source:Araport11) |
| AT1G63290 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT2G05790 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT2G36300 | Integral membrane Yip1 family protein;(source:Araport11) |
| AT3G15240 | Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11) |
| AT4G06744 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G52280 | Myosin heavy chain-related protein;(source:Araport11) |
| AT3G07930 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G75295 | Natural antisense transcript overlaps with AT1G75290 and AT1G75300;(source:Araport11) |
| AT5G41770 | crooked neck protein, putative / cell cycle protein;(source:Araport11) |
| AT2G39805 | Integral membrane Yip1 family protein;(source:Araport11) |
| AT5G56190 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G19780 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G12650 | rRNA biogenesis RRP36-like protein;(source:Araport11) |
| AT2G01410 | NHL domain-containing protein;(source:Araport11) |
| AT5G23330 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
| AT4G26965 | NADH:ubiquinone oxidoreductase, 17.2kDa subunit;(source:Araport11) |
| AT1G73885 | AT-rich interactive domain protein;(source:Araport11) |
| AT4G14530 | agamous-like MADS-box protein;(source:Araport11) |
| AT1G49030 | PLAC8 family protein;(source:Araport11) |
| AT4G34380 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G29980 | choice-of-anchor C domain protein, putative (Protein of unknown function, DUF642);(source:Araport11) |
| AT5G04550 | type-1 restriction enzyme mjaxp r protein (DUF668);(source:Araport11) |
| AT4G37220 | Cold acclimation protein WCOR413 family;(source:Araport11) |
| AT1G08315 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G33110 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G00090 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G62475 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.3e-55 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
| AT2G41640 | Glycosyltransferase family 61 protein;(source:Araport11) |
| AT5G47510 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G07550 | RNI-like superfamily protein;(source:Araport11) |
| AT5G05790 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT4G05071 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G19150 | AT5G19150 is a dehydratase that converts (S)-NAD(P)HX to NAD(P)H. |
| AT5G12930 | inactive rhomboid protein;(source:Araport11) |
| AT1G15710 | prephenate dehydrogenase family protein;(source:Araport11) |
| AT1G16790 | ribosomal protein-like protein;(source:Araport11) |
| AT1G33250 | beta-1,3-n-acetylglucosaminyltransferase radical fringe protein, putative (DUF604);(source:Araport11) |
| AT1G70900 | hypothetical protein;(source:Araport11) |
| AT3G21050 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.8e-18 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G20720 | amino-terminal region of chorein;(source:Araport11) |
| AT3G16510 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT1G16850 | transmembrane protein;(source:Araport11) |
| AT3G19390 | Granulin repeat cysteine protease family protein;(source:Araport11) |
| AT5G54585 | hypothetical protein;(source:Araport11) |
| AT5G24880 | chromo domain cec-like protein;(source:Araport11) |
| AT5G07850 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT2G30990 | arginine N-methyltransferase, putative (DUF688);(source:Araport11) |
| AT2G39870 | hypothetical protein;(source:Araport11) |
| AT1G77290 | Glutathione S-transferase family protein;(source:Araport11) |
| AT1G50659 | other_RNA;(source:Araport11) |
| AT2G25169 | transmembrane protein;(source:Araport11) |
| AT5G64850 | sorbin/SH3 domain protein;(source:Araport11) |
| AT2G47115 | protein rolling protein;(source:Araport11) |
| AT4G36210 | transmembrane/coiled-coil protein (DUF726);(source:Araport11) |
| AT3G14560 | Its transcript is targeted by miR824. |
| AT5G25470 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT4G19670 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09965 | hypothetical protein;(source:Araport11) |
| AT2G43550 | Encodes a defensin-like (DEFL) family protein. |
| AT2G39270 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G48710 | DEK domain-containing chromatin associated protein;(source:Araport11) |
| AT2G22905 | Expressed protein;(source:Araport11) |
| AT5G34852 | pseudogene of Intron maturase;(source:Araport11) |
| AT3G49970 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT1G02810 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G22870 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT3G04930 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT3G50755 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.3e-35 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G49796 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G74570 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
| AT5G10190 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G53135 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.9e-199 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G13100 | Gap junction beta-4 protein;(source:Araport11) |
| AT5G40945 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
| AT5G01200 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT4G35320 | hypothetical protein;(source:Araport11) |
| AT1G05562 | Natural antisense transcript overlaps with AT1G05560;(source:Araport11) |
| AT3G05937 | hypothetical protein;(source:Araport11) |
| AT1G26950 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT5G33360.1);(source:TAIR10) |
| AT4G33740 | myb-like protein X;(source:Araport11) |
| AT2G23060 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT2G30150 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G61090 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G29880 | glycyl-tRNA synthetase / glycine-tRNA ligase;(source:Araport11) |
| AT1G78840 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT2G34190 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT2G40820 | stomatal closure actin-binding-like protein;(source:Araport11) |
| AT5G47020 | MraZ;(source:Araport11) |
| AT4G05053 | pseudogene of ATRCY1 (arginine-rich cyclin) |
| AT1G10260 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-19 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT4G19191 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G24542 | Beta-galactosidase related protein;(source:Araport11) |
| AT1G10990 | transmembrane protein;(source:Araport11) |
| AT4G14380 | cotton fiber protein;(source:Araport11) |
| AT4G29700 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT5G12120 | Ubiquitin-associated/translation elongation factor EF1B protein;(source:Araport11) |
| AT2G24990 | Serine/threonine-protein kinase Rio1;(source:Araport11) |
| AT1G11482 | pseudogene of hypothetical protein (DUF295);(source:Araport11) |
| AT4G25770 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G54366 | Unknown gene The mRNA is cell-to-cell mobile. |
| AT5G57700 | BNR/Asp-box repeat family protein;(source:Araport11) |
| AT5G18450 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT1G15170 | MATE efflux family protein;(source:Araport11) |
| AT5G66500 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G17705 | methionine-S-oxide reductase;(source:Araport11) |
| AT5G05830 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT5G07315 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT1G50890 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G35660 | selection/upkeep of intraepithelial T-cells protein, putative (DUF241);(source:Araport11) |
| AT2G36860 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT1G57770 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT3G48275 | pre-tRNA tRNA-Thr (anticodon: TGT);(source:Araport11, TAIR10) |
| AT1G63400 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G44010 | fanconi anemia group F protein (FANCF);(source:Araport11) |
| AT2G05160 | CCCH-type zinc fingerfamily protein with RNA-binding domain-containing protein;(source:Araport11) |
| AT5G07800 | Flavin-binding monooxygenase family protein;(source:Araport11) |
| AT1G72820 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT1G71015 | PADRE protein. |
| AT5G18245 | Natural antisense transcript overlaps with AT5G18240;(source:Araport11) |
| AT1G54110 | Membrane fusion protein Use1;(source:Araport11) |
| AT1G63380 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G07055 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT2G01275 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT5G52415 | pseudogene of TRAF-like family protein;(source:Araport11) |
| AT3G60200 | hypothetical protein;(source:Araport11) |
| AT2G05810 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G55680 | glycine-rich protein;(source:Araport11) |
| AT5G44590 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G34920 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT1G22900 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT3G29638 | General transcription factor 2-related zinc finger protein;(source:Araport11) |
| AT4G21910 | MATE efflux family protein;(source:Araport11) |
| AT3G17530 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G07128 | Natural antisense transcript overlaps with AT1G07130;(source:Araport11) |
| AT1G24640 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-37 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G33230 | TMPIT-like protein;(source:Araport11) |
| AT1G18440 | Peptidyl-tRNA hydrolase family protein;(source:Araport11) |
| AT5G66310 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT2G44970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G32140 | F-box family protein;(source:Araport11) |
| AT3G12880 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G15290 | 3-hydroxyacyl-CoA dehydrogenase family protein;(source:Araport11) |
| AT3G08600 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT3G62160 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT4G22350 | Ubiquitin C-terminal hydrolases superfamily protein;(source:Araport11) |
| AT5G62370 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G33845 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT1G78865 | other_RNA;(source:Araport11) |
| AT4G14345 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT5G35560 | DENN (AEX-3) domain-containing protein;(source:Araport11) |
| AT3G04525 | pre-tRNA tRNA-Arg (anticodon: CCG);(source:Araport11, TAIR10) |
| AT5G02330 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G02970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G24625 | Encodes a defensin-like (DEFL) family protein. |
| AT5G14910 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G48953 | hypothetical protein;(source:Araport11) |
| AT5G63135 | transcription termination factor;(source:Araport11) |
| AT3G15585 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT1G28570 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT5G42740 | Sugar isomerase (SIS) family protein;(source:Araport11) |
| AT2G35945 | Natural antisense transcript overlaps with AT2G35940;(source:Araport11) |
| AT2G19825 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G22570 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G49070 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT4G11211 | hypothetical protein;(source:Araport11) |
| AT1G53760 | K+-H+ exchange-like protein;(source:Araport11) |
| AT4G36120 | filament-like protein (DUF869);(source:Araport11) |
| AT2G43340 | hypothetical protein (DUF1685);(source:Araport11) |
| AT1G52325 | Initiation factor eIF-4 gamma, MA3;(source:Araport11) |
| AT3G57450 | hypothetical protein;(source:Araport11) |
| AT4G32390 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT4G03100 | Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11) |
| AT1G68580 | Agenet and bromo-adjacent homology (BAH) domain-containing protein;(source:Araport11) |
| AT5G66455 | pseudogene of pentatricopeptide (PPR) repeat-containing protein |
| AT1G18120 | pseudogene of GDSL-like lipase/acylhydrolase superfamily protein;(source:Araport11) |
| AT5G45120 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G39090 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G53960 | Mid-1-related chloride channel domain-containing protein;(source:Araport11) |
| AT2G31080 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.3e-49 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G24030 | zinc ion binding / nucleic acid binding protein;(source:Araport11) |
| AT1G78890 | hypothetical protein;(source:Araport11) |
| AT2G27180 | hypothetical protein;(source:Araport11) |
| AT1G22830 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G70100 | neurofilament heavy protein;(source:Araport11) |
| AT3G10980 | PLAC8 family protein;(source:Araport11) |
| AT1G74860 | hypothetical protein;(source:Araport11) |
| AT5G01335 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.4e-29 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G03365 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G02260 | Divalent ion symporter;(source:Araport11) |
| AT1G12760 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
| AT5G43450 | encodes a protein whose sequence is similar to ACC oxidase |
| AT2G44383 | Pseudogene of AT2G44400; DC1 domain-containing protein |
| AT4G39952 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G27752 | Ubiquitin system component Cue protein;(source:Araport11) |
| AT2G17787 | cylicin;(source:Araport11) |
| AT5G62400 | transmembrane protein;(source:Araport11) |
| AT4G30650 | Low temperature and salt responsive protein family;(source:Araport11) |
| AT2G04110 | pseudogene of expressed protein;(source:Araport11) |
| AT1G48540 | Outer arm dynein light chain 1 protein;(source:Araport11) |
| AT2G42040 | WRC protein;(source:Araport11) |
| AT1G63880 | Encodes a TIR-NBS-LRR class of disease resistance protein effective against Leptosphaeria maculans. The mRNA is cell-to-cell mobile. |
| AT4G39404 | other_RNA;(source:Araport11) |
| AT5G19120 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G16807 | ATP-dependent caseinolytic protease/crotonase family protein;(source:Araport11) |
| AT5G57815 | Cytochrome c oxidase, subunit Vib family protein;(source:Araport11) |
| AT3G06437 | pseudogene of hypothetical protein;(source:Araport11) |
| AT2G38790 | hypothetical protein;(source:Araport11) |
| AT5G61290 | Flavin-binding monooxygenase family protein;(source:Araport11) |
| AT4G36230 | transmembrane protein;(source:Araport11) |
| AT4G11350 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT1G30190 | cotton fiber protein;(source:Araport11) |
| AT5G45630 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT1G49440 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.6e-05 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT1G07040 | plant/protein;(source:Araport11) |
| AT2G25190 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
| AT1G61230 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT3G25720 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT5G07215 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.9e-34 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT4G26450 | hypothetical protein;(source:Araport11) |
| AT1G20030 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT1G53370 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G67411 | GRAS family transcription factor;(source:Araport11) |
| AT1G77960 | repressor ROX1-like protein;(source:Araport11) |
| AT4G16140 | proline-rich family protein;(source:Araport11) |
| AT3G18430 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT5G43910 | pfkB-like carbohydrate kinase family protein;(source:Araport11) |
| AT1G19060 | hypothetical protein (DUF626);(source:Araport11) |
| AT2G18340 | late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11) |
| AT1G26270 | Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11) |
| AT1G09750 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G31350 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT3G46700 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G65207 | hypothetical protein;(source:Araport11) |
| AT1G20810 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT1G21440 | Phosphoenolpyruvate carboxylase family protein;(source:Araport11) |
| AT1G02320 | hypothetical protein;(source:Araport11) |
| AT1G01540 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G61890 | MATE efflux family protein;(source:Araport11) |
| AT3G05905 | Natural antisense transcript overlaps with AT3G05900;(source:Araport11) |
| AT4G24050 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G07135 | glycine-rich protein;(source:Araport11) |
| AT2G35820 | ureidoglycolate hydrolase;(source:Araport11) |
| AT1G19430 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G30320 | Remorin family protein;(source:Araport11) |
| AT4G06534 | transmembrane protein;(source:Araport11) |
| AT4G21870 | HSP20-like chaperone |
| AT4G08690 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT4G23490 | fringe-like protein (DUF604);(source:Araport11) |
| AT4G13992 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G15350 | G14 enzyme |
| AT1G70360 | F-box family protein;(source:Araport11) |
| AT3G56670 | F-box/associated interaction domain protein;(source:Araport11) |
| AT4G26380 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G45640 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT1G12830 | nucleolin;(source:Araport11) |
| AT5G01881 | transmembrane protein;(source:Araport11) |
| AT5G37790 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G21010 | Transcription initiation factor TFIIE, beta subunit;(source:Araport11) |
| AT4G14360 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G45470 | transmembrane protein, putative (DUF594);(source:Araport11) |
| AT5G63150 | hypothetical protein;(source:Araport11) |
| AT5G48610 | myb-like protein X;(source:Araport11) |
| AT4G16045 | TRAF-like superfamily protein;(source:Araport11) |
| AT1G02030 | C2H2-like zinc finger protein;(source:Araport11) |
| AT1G06700 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G12731 | hypothetical protein;(source:Araport11) |
| AT1G33490 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT3G11880 | transmembrane protein, putative (Protein of unknown function DUF2359, transmembrane);(source:Araport11) |
| AT5G24320 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G31940 | oxidoreductase/transition metal ion-binding protein;(source:Araport11) |
| AT2G37930 | hypothetical protein (DUF3527);(source:Araport11) |
| AT4G30500 | transmembrane protein (DUF788);(source:Araport11) |
| AT5G64110 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G73090 | WD repeat protein;(source:Araport11) |
| AT3G03610 | ELMO/CED-12 family protein;(source:Araport11) |
| AT5G10750 | enhanced disease resistance-like protein (DUF1336);(source:Araport11) |
| AT5G56100 | glycine-rich protein / oleosin;(source:Araport11) |
| AT2G22270 | hematological/neurological-like protein;(source:Araport11) |
| AT5G23470 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G16486 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT2G41270 | pseudogene of strictosidine synthase-like 2;(source:Araport11) |
| AT3G14760 | transmembrane protein;(source:Araport11) |
| AT3G04010 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT1G69430 | Son of sevenless protein;(source:Araport11) |
| AT3G08740 | elongation factor P (EF-P) family protein;(source:Araport11) |
| AT1G63390 | flavin containing monooxygenase FMO GS-OX-like protein;(source:Araport11) |
| AT4G01410 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G70209 | hypothetical protein;(source:Araport11) |
| AT5G25990 | core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT4G02465 | hypothetical protein;(source:Araport11) |
| AT1G22930 | T-complex protein 11;(source:Araport11) |
| AT4G36010 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT1G76660 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G15010 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
| AT1G12510 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT3G56200 | Encodes a putative amino acid transporter. The mRNA is cell-to-cell mobile. |
| AT3G05160 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G40640 | transmembrane protein;(source:Araport11) |
| AT1G61240 | lysine ketoglutarate reductase trans-splicing-like protein (DUF707);(source:Araport11) |
| AT1G70885 | pseudogene of MLP-like protein 31;(source:Araport11) |
| AT2G25250 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT1G63420 | O-glucosyltransferase-like protein (DUF821);(source:Araport11) |
| AT3G06530 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G67350 | NADH-ubiquinone oxidoreductase;(source:Araport11) |
| AT1G63870 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G17280 | oxidoreductase-like protein, amino-terminal protein;(source:Araport11) |
| AT5G54830 | DOMON domain-containing protein / dopamine beta-monooxygenase N-terminal domain-containing protein;(source:Araport11) |
| AT3G58980 | F-box family protein;(source:Araport11) |
| AT5G18950 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G50000 | methyltransferase;(source:Araport11) |
| AT1G03515 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT3G15520 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT5G03495 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT4G23860 | PHD finger protein-like protein;(source:Araport11) |
| AT5G61820 | stress up-regulated Nod 19 protein;(source:Araport11) |
| AT2G25520 | Drug/metabolite transporter superfamily protein;(source:Araport11) |
| AT4G23870 | hypothetical protein;(source:Araport11) |
| AT4G17450 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-306 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G12845 | transmembrane protein;(source:Araport11) |
| AT4G27870 | Vacuolar iron transporter (VIT) family protein;(source:Araport11) |
| AT2G01400 | hypothetical protein;(source:Araport11) |
| AT1G10530 | PADRE protein |
| AT1G28591 | Pseudogene of AT1G28610; GDSL-motif lipase, putative |
| AT5G41800 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT3G42580 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT2G12100.1);(source:TAIR10) |
| AT1G06630 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G27610 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
| AT5G43310 | COP1-interacting protein-like protein;(source:Araport11) |
| AT2G20830 | folic acid binding / transferase;(source:Araport11) |
| AT3G13700 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G50660 | actin cytoskeleton-regulatory complex pan-like protein;(source:Araport11) |
| AT3G46450 | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein;(source:Araport11) |
| AT1G20280 | homeobox-leucine zipper protein-like protein;(source:Araport11) |
| AT5G01050 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G16010 | 3-oxo-5-alpha-steroid 4-dehydrogenase family protein;(source:Araport11) |
| AT3G12010 | C18orf8;(source:Araport11) |
| AT4G13180 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G45990 | ribosomal RNA small subunit methyltransferase G;(source:Araport11) |
| AT1G53080 | Legume lectin family protein;(source:Araport11) |
| AT1G28650 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G35510 | O-fucosyltransferase family protein;(source:Araport11) |
| AT2G39710 | Encodes a Cysteine-rich peptide (CRP) family protein |
| AT3G17770 | Dihydroxyacetone kinase;(source:Araport11) |
| AT1G64140 | WRKY transcription factor;(source:Araport11) |
| AT4G27620 | intracellular protein transporter;(source:Araport11) |
| AT5G03285 | other_RNA;(source:Araport11) |
| AT4G17612 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT2G18876 | Encodes a microtubule-associated protein. |
| AT4G17670 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT2G35637 | Natural antisense transcript overlaps with AT2G35640;(source:Araport11) |
| AT1G61740 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT3G29310 | calmodulin-binding protein-like protein;(source:Araport11) |
| AT1G14730 | Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11) |
| AT2G38330 | MATE efflux family protein;(source:Araport11) |
| AT3G24740 | cellulose synthase, putative (DUF1644);(source:Araport11) |
| AT1G53340 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G59500 | Integral membrane HRF1 family protein;(source:Araport11) |
| AT5G42092 | Natural antisense transcript overlaps with AT5G42090;(source:Araport11) |
| AT5G10850 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / zinc ion binding [Arabidopsis thaliana] (TAIR:AT2G01050.1);(source:TAIR10) |
| AT4G02005 | None;(source:Araport11) |
| AT1G75090 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G35220 | FAM91 carboxy-terminus protein;(source:Araport11) |
| AT5G04860 | splicing factor 3A subunit;(source:Araport11) |
| AT1G70770 | Involved in cell wall modifications resulting in resistance to the biotroph Hpa. |
| AT2G41200 | transmembrane protein;(source:Araport11) |
| AT2G37540 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G76220 | hypothetical protein (DUF241);(source:Araport11) |
| AT3G09690 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G17760 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G03250 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT1G22430 | GroES-like zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT3G62280 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G51950 | Contains single CCCH domain. |
| AT1G11170 | lysine ketoglutarate reductase trans-splicing-like protein (DUF707);(source:Araport11) |
| AT3G57460 | catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding protein;(source:Araport11) |
| AT1G02590 | Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding protein;(source:Araport11) |
| AT2G42290 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G48030 | DNAse I-like superfamily protein;(source:Araport11) |
| AT3G06870 | proline-rich family protein;(source:Araport11) |
| AT3G54880 | zinc finger protein;(source:Araport11) |
| AT1G24610 | Rubisco methyltransferase family protein;(source:Araport11) |
| AT2G42920 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT1G73770 | coiled-coil protein;(source:Araport11) |
| AT2G23960 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
| AT3G12410 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G30260 | galactosyltransferase family protein;(source:Araport11) |
| AT5G15880 | golgin family A protein;(source:Araport11) |
| AT3G55960 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT2G44735 | transmembrane protein;(source:Araport11) |
| AT5G07740 | actin binding protein;(source:Araport11) |
| AT2G47020 | Peptide chain release factor 1;(source:Araport11) |
| AT1G61200 | homeobox-leucine zipper protein-like protein;(source:Araport11) |
| AT5G05430 | RNA-binding protein;(source:Araport11) |
| AT5G66670 | pectinesterase, putative (DUF677);(source:Araport11) |
| AT3G48240 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G65120 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
| AT3G06710 | E3 ubiquitin ligase;(source:Araport11) |
| AT4G19480 | hypothetical protein;(source:Araport11) |
| AT3G52285 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
| AT1G18382 | Natural antisense transcript overlaps with AT1G18380;(source:Araport11) |
| AT3G58795 | Natural antisense transcript overlaps with AT3G58790;(source:Araport11) |
| AT1G25510 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G54970 | hypothetical protein;(source:Araport11) |
| AT2G36630 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT1G12320 | ankyrin repeat/KH domain protein (DUF1442);(source:Araport11) |
| AT1G34420 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
| AT3G59200 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G11020 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT3G47080 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G46540 | ENTH/VHS family protein;(source:Araport11) |
| AT2G31981 | hypothetical protein;(source:Araport11) |
| AT5G54860 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G38595 | transposable_element_gene;(source:Araport11);similar to zinc ion binding [Arabidopsis thaliana] (TAIR:AT1G17277.1);(source:TAIR10) |
| AT5G65840 | Thioredoxin superfamily protein;(source:Araport11) |
| AT3G26720 | Glycosyl hydrolase family 38 protein;(source:Araport11) |
| AT2G47710 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT1G07470 | Transcription factor IIA, alpha/beta subunit;(source:Araport11) |
| AT2G25210 | Ribosomal protein L39 family protein;(source:Araport11) |
| AT3G05670 | RING/U-box protein;(source:Araport11) |
| AT5G52980 | ER-based factor for assembly of V-ATPase;(source:Araport11) |
| AT2G04510 | pseudogene of ribonuclease H;(source:Araport11) |
| AT4G25580 | CAP160 protein;(source:Araport11) |
| AT4G22190 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT5G61800 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G03290 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT3G09020 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
| AT3G15550 | trichohyalin;(source:Araport11) |
| AT5G22315 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
| AT1G76450 | Photosystem II reaction center PsbP family protein;(source:Araport11) |
| AT5G57000 | DEAD-box ATP-dependent RNA helicase;(source:Araport11) |
| AT3G51510 | transmembrane protein;(source:Araport11) |
| AT1G78040 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT3G27997 | pseudogene of expressed protein;(source:Araport11) |
| AT2G20142 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT3G61490 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G50995 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT1G73175 | This is described as a LINE; it is present at this location in 83 natural accessions of Arabidopsis, including Col-0, but it is not present in 13 natural accessions including Cvi-0. This locus is normally methylated in wild type Col plants. BONSAI (At1g73177), an adjacent gene, can become hypermethylated in a ddm1 (At5g66750) mutant, and this seems to depends on the presence of the LINE. But, transcript levels of the gene on the other side of the LINE (At1g73170) do not drop in ddm1 mutant plants. |
| AT5G19850 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G19250 | Glycoprotein membrane precursor GPI-anchored;(source:Araport11) |
| AT1G43590 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G34838.1);(source:TAIR10) |
| AT4G23515 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT3G54363 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT2G45060 | alanine-tRNA ligase;(source:Araport11) |
| AT3G22970 | hypothetical protein (DUF506);(source:Araport11) |
| AT2G34730 | myosin heavy chain-like protein;(source:Araport11) |
| AT1G79120 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT2G20940 | transmembrane protein, putative (DUF1279);(source:Araport11) |
| AT5G47250 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
| AT2G21570 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT2G45040 | Matrixin family protein;(source:Araport11) |
| AT5G03705 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
| AT4G02480 | AAA-type ATPase family protein;(source:Araport11) |
| AT5G25475 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT1G80630 | RNI-like superfamily protein;(source:Araport11) |
| AT1G49580 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
| AT5G46010 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT2G47340 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G04425 | other_RNA;(source:Araport11) |
| AT2G33690 | Late embryogenesis abundant protein, group 6;(source:Araport11) |
| AT1G15030 | Encodes a Cysteine-rich peptide (CRP) family protein |
| AT1G07480 | Transcription factor IIA, alpha/beta subunit;(source:Araport11) |
| AT1G19460 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G69400 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G23710 | hypothetical protein (DUF1645);(source:Araport11) |
| AT1G21790 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT1G72620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G49152 | Natural antisense transcript overlaps with AT5G49150;(source:Araport11) |
| AT2G20725 | CAAX amino terminal protease family protein;(source:Araport11) |
| AT1G62420 | DUF506 family protein (DUF506);(source:Araport11) |
| AT1G18410 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G18320 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT5G46890 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G02270 | Calcium-binding endonuclease/exonuclease/phosphatase family;(source:Araport11) |
| AT2G46150 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT2G19180 | hypothetical protein;(source:Araport11) |
| AT3G60310 | acyl-CoA synthetase family protein;(source:Araport11) |
| AT5G12043 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G03170 | hypothetical protein;(source:Araport11) |
| AT1G66130 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G21745 | PAK-box/P21-Rho-binding family protein;(source:Araport11) |
| AT5G64430 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT1G26860 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G01700.1);(source:TAIR10) |
| AT1G25400 | transmembrane protein;(source:Araport11) |
| AT1G20515 | Natural antisense transcript overlaps with AT1G20520;(source:Araport11) |
| AT3G22104 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G09340 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT1G52510 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G20230 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G35810 | ureidoglycolate hydrolase;(source:Araport11) |
| AT5G66050 | Wound-responsive family protein;(source:Araport11) |
| AT3G15534 | hypothetical protein;(source:Araport11) |
| AT2G31010 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G32290 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G76020 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G12805 | nucleotide binding protein;(source:Araport11) |
| AT1G17830 | hypothetical protein (DUF789);(source:Araport11) |
| AT2G01667 | hypothetical protein;(source:Araport11) |
| AT3G61750 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11) |
| AT1G60150 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 28%25 identity and 3.6e-07 P-value to GP|21952510|gb|AAM82604.1|AF525305_2|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10) |
| AT4G26940 | Galactosyltransferase family protein;(source:Araport11) |
| AT3G11530 | Vacuolar protein sorting 55 (VPS55) family protein;(source:Araport11) |
| AT1G62050 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G13230 | Encodes a leucine-rich repeat protein pii-2. Located in the endoplasmic reticulum/plasma membrane continuum in Arabidopsis roots. Required for growth promotion and enhanced seed production mediated by the endophytic fungus Piriformospora indica in Arabidopsis. |
| AT2G19850 | transcription repressor;(source:Araport11) |
| AT5G13880 | cotton fiber protein;(source:Araport11) |
| AT2G21500 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G32928 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
| AT1G13195 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G79060 | TPRXL;(source:Araport11) |
| AT5G66860 | Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain-containing protein;(source:Araport11) |
| AT5G60290 | hypothetical protein;(source:Araport11) |
| AT3G61755 | pre-tRNA tRNA-Ala (anticodon: CGC);(source:Araport11, TAIR10) |
| AT1G52800 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G36050 | Endoplasmic reticulum vesicle transporter protein;(source:Araport11) |
| AT1G20970 | calponin-like domain protein;(source:Araport11) |
| AT3G47010 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT3G62710 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT1G78800 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G78172 | transmembrane protein;(source:Araport11) |
| AT2G23700 | Itga6 (Protein of unknown function, DUF547);(source:Araport11) |
| AT3G07510 | maternal effect embryo arrest protein;(source:Araport11) |
| AT1G32740 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT5G38200 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
| AT4G19220 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G13970 | midasin-like protein;(source:Araport11) |
| AT3G17640 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G14190 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT1G02380 | transmembrane protein;(source:Araport11) |
| AT3G52070 | RNA/RNP complex-1-interacting phosphatase;(source:Araport11) |
| AT1G33615 | None;(source:Araport11) |
| AT5G58784 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
| AT4G16980 | arabinogalactan-protein family;(source:Araport11) |
| AT1G52540 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G30930 | hypothetical protein;(source:Araport11) |
| AT5G09630 | LisH/CRA/RING-U-box domains-containing protein;(source:Araport11) |
| AT1G31240 | Bromodomain transcription factor;(source:Araport11) |
| AT1G22230 | nucleolar GTP-binding protein;(source:Araport11) |
| AT3G50900 | hypothetical protein;(source:Araport11) |
| AT3G17450 | hAT dimerization domain-containing protein;(source:Araport11) |
| AT5G41780 | myosin heavy chain-like protein;(source:Araport11) |
| AT2G23390 | acyl-CoA;(source:Araport11) |
| AT1G71828 | Potential natural antisense gene, locus overlaps with AT1G71830 |
| AT2G41780 | hypothetical protein;(source:Araport11) |
| AT1G67050 | membrane-associated kinase regulator;(source:Araport11) |
| AT3G11280 | Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay). |
| AT1G28190 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT2G25460 | EEIG1/EHBP1 protein amino-terminal domain protein;(source:Araport11) |
| AT2G36540 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G09012 | Mitochondrial ribosomal protein L27;(source:Araport11) |
| AT4G24350 | Phosphorylase superfamily protein;(source:Araport11) |
| AT2G29605 | Plant protein 1589 of unknown function;(source:Araport11) |
| AT5G54300 | cotton fiber-like protein (DUF761);(source:Araport11) |
| AT4G14270 | Protein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins. |
| AT2G35850 | transmembrane protein;(source:Araport11) |
| AT1G14185 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT3G18760 | Translation elongation factor EF1B/ribosomal protein S6 family protein;(source:Araport11) |
| AT3G15780 | transmembrane protein;(source:Araport11) |
| AT3G07460 | transmembrane protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT4G32050 | neurochondrin family protein;(source:Araport11) |
| AT1G05440 | C-8 sterol isomerase;(source:Araport11) |
| AT5G64501 | pseudogene of pyrophosphorylase 6;(source:Araport11) |
| AT5G47590 | Heat shock protein HSP20/alpha crystallin family;(source:Araport11) |
| AT2G21440 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT4G31075 | pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10) |
| AT2G28730 | pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10) |
| AT1G02360 | Chitinase family protein;(source:Araport11) |
| AT1G72480 | Lung seven transmembrane receptor family protein;(source:Araport11) |
| AT1G12540 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G10250 | paired amphipathic helix Sin3-like protein;(source:Araport11) |
| AT5G58005 | Cytochrome c oxidase, subunit Vib family protein;(source:Araport11) |
| AT5G04880 | pseudogene of ABC transporter family protein |
| AT1G02550 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G20220 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
| AT3G01690 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G24780 | hypothetical protein;(source:Araport11) |
| AT4G29400 | oxidoreductase/transition metal ion-binding protein (DUF3531);(source:Araport11) |
| AT3G03570 | signal transducer, putative (DUF3550/UPF0682);(source:Araport11) |
| AT5G04020 | calmodulin binding protein;(source:Araport11) |
| AT5G14495 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT4G22233 | Natural antisense transcript overlaps with AT4G22235;(source:Araport11) |
| AT1G31030 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.0e-41 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G04090 | histidine-tRNA ligase;(source:Araport11) |
| AT4G39140 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G47341 | transmembrane protein;(source:Araport11) |
| AT1G76600 | PADRE protein up-regulated after infection by S. sclerotiorun. |
| AT2G37480 | hypothetical protein;(source:Araport11) |
| AT3G07250 | RNA-binding (RRM-RBD-RNP motif) domain nuclear transport factor 2 family protein;(source:Araport11) |
| AT2G21580 | Ribosomal protein S25 family protein;(source:Araport11) |
| AT5G62080 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT5G45745 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
| AT1G53560 | Ribosomal protein L18ae family;(source:Araport11) |
| AT1G01440 | hypothetical protein (DUF3133);(source:Araport11) |
| AT2G37130 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G49540 | hypothetical protein;(source:Araport11) |
| AT1G80850 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT5G01070 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT4G31510 | major centromere autoantigen B-like protein;(source:Araport11) |
| AT1G52840 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G13865.1);(source:TAIR10) |
| AT5G59600 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G49270 | extensin-like protein;(source:Araport11) |
| AT5G63900 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
| AT2G23790 | calcium uniporter (DUF607);(source:Araport11) |
| AT4G22110 | GroES-like zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT3G27390 | transmembrane protein;(source:Araport11) |
| AT2G31005 | Encodes a Cysteine-rich peptide (CRP) family protein |
| AT5G46710 | PLATZ transcription factor family protein;(source:Araport11) |
| AT2G47485 | hypothetical protein;(source:Araport11) |
| AT3G09850 | D111/G-patch domain-containing protein;(source:Araport11) |
| AT3G43850 | hypothetical protein;(source:Araport11) |
| AT3G03855 | Annotated as pseudogene of disease resistance protein.Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 . |
| AT1G57540 | 40S ribosomal protein;(source:Araport11) |
| AT1G72230 | Cupredoxin superfamily protein;(source:Araport11) |
| AT3G59340 | solute carrier family 35 protein (DUF914);(source:Araport11) |
| AT1G55152 | hypothetical protein;(source:Araport11) |
| AT1G01305 | hypothetical protein;(source:Araport11) |
| AT3G45050 | transmembrane protein;(source:Araport11) |
| AT2G39920 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT4G18920 | histone acetyltransferase (DUF1264);(source:Araport11) |
| AT3G45530 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G69910 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G67150 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G04450 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G14390 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G36030 | hypothetical protein;(source:Araport11) |
| AT1G63860 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G27410 | D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Aminotransferase, class IV (InterPro:IPR001544); BEST Arabidopsis thaliana protein match is: D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein (TAIR:AT3G05190.1). Note that the At5g27410.2 gene model (TAIR10) has been obsoleted due to the lack of experimental support. |
| AT1G04030 | eisosome protein;(source:Araport11) |
| AT5G44320 | Eukaryotic translation initiation factor 3 subunit 7 (eIF-3);(source:Araport11) |
| AT3G15115 | serine/arginine repetitive matrix protein;(source:Araport11) |
| AT4G39925 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT5G46295 | transmembrane protein;(source:Araport11) |
| AT1G23990 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.0e-30 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G48680 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
| AT1G75070 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT3G50665 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
| AT3G13335 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT3G01580 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G54400 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G60150 | NADH dehydrogenase ubiquinone 1 alpha subcomplex assembly factor-like protein (DUF498/DUF598);(source:Araport11) |
| AT1G69800 | Cystathionine beta-synthase (CBS) protein;(source:Araport11) |
| AT1G65720 | transmembrane protein;(source:Araport11) |
| AT3G14140 | 2-oxoglutarate-dependent dioxygenase family protein;(source:Araport11) |
| AT4G27435 | fiber (DUF1218);(source:Araport11) |
| AT4G27720 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G12735 | Encodes a peroxisomal protein. |
| AT3G49900 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT1G55840 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G54625 | Natural antisense transcript overlaps with AT3G54630;(source:Araport11) |
| AT2G40270 | Protein kinase family protein;(source:Araport11) |
| AT5G61520 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G23370 | cyclin delta-3;(source:Araport11) |
| AT2G18180 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G50910 | hypothetical protein;(source:Araport11) |
| AT5G66540 | U3 small nucleolar ribonucleoprotein;(source:Araport11) |
| AT1G13810 | Restriction endonuclease, type II-like superfamily protein;(source:Araport11) |
| AT3G15357 | phosphopantothenoylcysteine decarboxylase subunit;(source:Araport11) |
| AT3G21320 | EARLY FLOWERING protein;(source:Araport11) |
| AT1G03200 | hypothetical protein;(source:Araport11) |
| AT1G01240 | transmembrane protein;(source:Araport11) |
| AT1G15330 | Cystathionine beta-synthase (CBS) protein;(source:Araport11) |
| AT5G64540 | mucin-like protein;(source:Araport11) |
| AT1G52600 | Peptidase S24/S26A/S26B/S26C family protein;(source:Araport11) |
| AT1G05960 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G49850 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G17180 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT3G61185 | Encodes a defensin-like (DEFL) family protein. |
| AT3G13130 | transmembrane protein;(source:Araport11) |
| AT2G32450 | Calcium-binding tetratricopeptide family protein;(source:Araport11) |
| AT3G12420 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G12100 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G09600 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G15310 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32621.1);(source:TAIR10) |
| AT3G05625 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G24700 | hypothetical protein;(source:Araport11) |
| AT2G19582 | Natural antisense transcript overlaps with AT2G19580;(source:Araport11) |
| AT5G17270 | Protein prenylyltransferase superfamily protein;(source:Araport11) |
| AT5G02370 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT3G60760 | hypothetical protein;(source:Araport11) |
| AT4G29970 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G07025 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT4G01570 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G21780 | hypothetical protein;(source:Araport11) |
| AT5G47180 | Plant VAMP (vesicle-associated membrane protein) family protein;(source:Araport11) |
| AT4G23820 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G30984 | Natural antisense transcript overlaps with AT2G30985;(source:Araport11) |
| AT4G20300 | Serine/Threonine-kinase, putative (DUF1639);(source:Araport11) |
| AT2G39980 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT2G38900 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860. |
| AT5G28620 | kinase C-like protein;(source:Araport11) |
| AT3G25930 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT5G40720 | C3H4 type zinc finger protein (DUF23);(source:Araport11) |
| AT5G17160 | aspartic/glutamic acid-rich protein;(source:Araport11) |
| AT2G42760 | DUF1685 family protein;(source:Araport11) |
| AT2G34610 | cotton fiber protein;(source:Araport11) |
| AT5G49665 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT3G24180 | Beta-glucosidase, GBA2 type family protein;(source:Araport11) |
| AT1G14345 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT2G27500 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT3G51720 | WEB family protein (DUF827);(source:Araport11) |
| AT2G46300 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G51790 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G36052 | Natural antisense transcript overlaps with AT4G36050;(source:Araport11) |
| AT3G07940 | Calcium-dependent ARF-type GTPase activating protein family;(source:Araport11) |
| AT1G24160 | triadin;(source:Araport11) |
| AT5G23760 | Copper transport protein family;(source:Araport11) |
| AT4G16745 | Exostosin family protein;(source:Araport11) |
| AT3G51410 | hypothetical protein (DUF241);(source:Araport11) |
| AT5G22520 | hypothetical protein;(source:Araport11) |
| AT2G24130 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT4G38980 | hypothetical protein;(source:Araport11) |
| AT5G24165 | hypothetical protein;(source:Araport11) |
| AT5G10460 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G77640 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT5G06800 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
| AT5G41550 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G47560 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G35240 | DNA-directed RNA polymerase subunit beta, putative (DUF630 and DUF632);(source:Araport11) |
| AT2G03250 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT3G15090 | GroES-like zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
| AT3G23480 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
| AT5G03330 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT3G52100 | RING/FYVE/PHD zinc finger-containing protein. Part of emdomembrane trafficking system. |
| AT3G18230 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT3G12915 | Ribosomal protein S5/Elongation factor G/III/V family protein;(source:Araport11) |
| AT1G33350 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G44380 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT3G02125 | pinin-like protein;(source:Araport11) |
| AT3G09595 | pre-tRNA tRNA-Ser (anticodon: TGA);(source:Araport11, TAIR10) |
| AT4G12115 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT5G56975 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
| AT3G26134 | pseudogene of hypothetical protein;(source:Araport11) |
| AT1G75490 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT2G05540 | Glycine-rich protein family;(source:Araport11) |
| AT3G05190 | D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein;(source:Araport11) |
| AT5G20110 | Dynein light chain type 1 family protein;(source:Araport11) |
| AT5G19300 | methyltransferase C9orf114 protein;(source:Araport11) |
| AT5G44255 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.5e-09 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT5G49280 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G05350 | Metallopeptidase M24 family protein;(source:Araport11) |
| AT2G38830 | Ubiquitin-conjugating enzyme/RWD-like protein;(source:Araport11) |
| AT2G22060 | galactose oxidase/kelch repeat protein;(source:Araport11) |
| AT3G62360 | Carbohydrate-binding-like fold;(source:Araport11) |
| AT3G19440 | Pseudouridine synthase family protein;(source:Araport11) |
| AT4G32440 | Plant Tudor-like RNA-binding protein;(source:Araport11) |
| AT1G02650 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G51650 | hypothetical protein;(source:Araport11) |
| AT1G01630 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G20070 | hypothetical protein;(source:Araport11) |
| AT2G36780 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G55475 | hypothetical protein;(source:Araport11) |
| AT1G49500 | transcription initiation factor TFIID subunit 1b-like protein;(source:Araport11) |
| AT3G11320 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT1G18290 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT5G18037 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT5G38300 | homeobox Hox-B3-like protein;(source:Araport11) |
| AT1G07440 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G56220 | Dormancy/auxin associated family protein;(source:Araport11) |
| AT1G03990 | Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11) |
| AT4G03340 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G06540 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G48605 | Encodes a defensin-like (DEFL) family protein. |
| AT3G56050 | Protein kinase family protein;(source:Araport11) |
| AT1G67790 | sieve element occlusion protein;(source:Araport11) |
| AT4G15790 | uveal autoantigen with coiled-coil/ankyrin;(source:Araport11) |
| AT4G30670 | Putative membrane lipoprotein;(source:Araport11) |
| AT3G11285 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
| AT1G57980 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT4G29930 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G26690 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT1G12330 | cyclin-dependent kinase-like protein;(source:Araport11) |
| AT5G04250 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT3G60510 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
| AT3G14075 | Mono-/di-acylglycerol lipase, N-terminal;(source:Araport11) |
| AT2G39170 | MEF2BNB-like protein;(source:Araport11) |
| AT3G63540 | Conceptual translation of this open reading frame gave the sequence of a 229-residue hypothetical protein that contains the same sequence as the mature A. thaliana chloroplast luminal 19-kDa protein linked to a putative signal sequence. |
| AT3G19340 | aminopeptidase (DUF3754);(source:Araport11) |
| AT1G75190 | hypothetical protein;(source:Araport11) |
| AT1G23330 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G02450 | Ribosomal protein L36e family protein;(source:Araport11) |
| AT5G58800 | Quinone reductase family protein;(source:Araport11) |
| AT4G38870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G09140 | hypothetical protein (DUF674);(source:Araport11) |
| AT1G64260 | MuDR family transposase;(source:Araport11) |
| AT1G06200 | Peptidase S24/S26A/S26B/S26C family protein;(source:Araport11) |
| AT3G01270 | Pectate lyase family protein;(source:Araport11) |
| AT1G02700 | GATA transcription factor-like protein;(source:Araport11) |
| AT5G48412 | other_RNA;(source:Araport11) |
| AT1G27290 | transmembrane protein;(source:Araport11) |
| AT4G15075 | FBD-like domain family protein;(source:Araport11) |
| AT1G63295 | Remorin family protein;(source:Araport11) |
| AT4G04690 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G50790 | esterase/lipase/thioesterase family protein;(source:Araport11) |
| AT2G33630 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G39610 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT2G21510 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT1G07170 | Similar to human splicing factor 3b, 14 kda subunit, SF3b14b. |
| AT4G38660 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT3G56275 | pseudogene of expressed protein;(source:Araport11) |
| AT4G02715 | flocculation FLO11-like protein;(source:Araport11) |
| AT1G77682 | Encodes a Plant thionin family protein |
| AT2G33320 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G03845 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT1G07100 | pre-tRNA tRNA-Ile (anticodon: TAT);(source:Araport11, TAIR10) |
| AT4G24805 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G12070 | hypothetical protein;(source:Araport11) |
| AT1G55265 | DUF538 family protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT3G12730 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G17147 | VQ motif-containing protein;(source:Araport11) |
| AT3G24615 | Encodes a Z43 snoRNA. Gb: AJ240080 |
| AT1G30130 | DUF1365 family protein;(source:Araport11) |
| AT4G08039 | Encodes a defensin-like (DEFL) family protein. |
| AT1G11230 | transmembrane protein, putative (DUF761);(source:Araport11) |
| AT1G53220 | pre-tRNA tRNA-Ile (anticodon: TAT);(source:Araport11, TAIR10) |
| AT3G49950 | GRAS family transcription factor;(source:Araport11) |
| AT4G19570 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G10080 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G20520 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT4G09060 | hypothetical protein;(source:Araport11) |
| AT5G09430 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G51400 | Photosystem II 5 kD protein;(source:Araport11) |
| AT3G25950 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT2G36500 | CBS / octicosapeptide/Phox/Bemp1 (PB1) domains-containing protein;(source:Araport11) |
| AT5G21105 | Plant L-ascorbate oxidase;(source:Araport11) |
| AT3G47000 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT3G47540 | Chitinase family protein;(source:Araport11) |
| AT1G03520 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT2G33175 | transmembrane protein;(source:Araport11) |
| AT2G16240 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
| AT3G24670 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G66950 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT3G49790 | Carbohydrate-binding protein;(source:Araport11) |
| AT1G25375 | Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11) |
| AT5G15640 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT5G59350 | transmembrane protein;(source:Araport11) |
| AT4G29850 | transmembrane protein (DUF872);(source:Araport11) |
| AT4G21570 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
| AT3G62245 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
| AT2G40230 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G39895 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT3G46385 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G49100 | vitellogenin-like protein;(source:Araport11) |
| AT1G73120 | F-box/RNI superfamily protein;(source:Araport11) |
| AT4G36648 | other_RNA;(source:Araport11) |
| AT3G50380 | vacuolar protein sorting-associated protein, putative (DUF1162);(source:Araport11) |
| AT2G37020 | Translin family protein;(source:Araport11) |
| AT5G07330 | NFU1 iron-sulfur cluster protein;(source:Araport11) |
| AT4G32930 | hypothetical protein;(source:Araport11) |
| AT2G36320 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT1G17670 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT4G28870 | mutator transposase MUDRA protein;(source:Araport11) |
| AT2G46308 | transmembrane protein;(source:Araport11) |
| AT3G11500 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT5G17847 | hypothetical protein;(source:Araport11) |
| AT1G15200 | protein-protein interaction regulator family protein;(source:Araport11) |
| AT2G41790 | Insulinase (Peptidase family M16) family protein;(source:Araport11) |
| AT4G33120 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G12970 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT4G31830 | transmembrane protein;(source:Araport11) |
| AT3G01590 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT2G38350 | hypothetical protein;(source:Araport11) |
| AT5G65015 | pre-tRNA tRNA-Arg (anticodon: ACG);(source:Araport11, TAIR10) |
| AT5G20750 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT3G42690.1);(source:TAIR10) |
| AT4G22235 | Encodes a defensin-like (DEFL) family protein. |
| AT3G48115 | other_RNA;(source:Araport11) |
| AT1G35780 | N-lysine methyltransferase;(source:Araport11) |
| AT2G40110 | Yippee family putative zinc-binding protein;(source:Araport11) |
| AT2G30985 | hypothetical protein;(source:Araport11) |
| AT2G25890 | Oleosin family protein;(source:Araport11) |
| AT1G73740 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G27657 | hypothetical protein;(source:Araport11) |
| AT1G56085 | Cyclophilin;(source:Araport11) |
| AT1G61100 | disease resistance protein (TIR class);(source:Araport11) |
| AT5G59140 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT5G66790 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G03010 | RNI-like superfamily protein;(source:Araport11) |
| AT2G32970 | G1/S-specific cyclin-E protein;(source:Araport11) |
| AT5G23890 | GPI-anchored adhesin-like protein;(source:Araport11) |
| AT5G02000 | hypothetical protein;(source:Araport11) |
| AT3G52230 | hypothetical protein;(source:Araport11) |
| AT5G53270 | Seed maturation protein;(source:Araport11) |
| AT2G30100 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT1G03730 | pyrroline-5-carboxylate reductase;(source:Araport11) |
| AT3G44630 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G17190 | B-cell receptor-associated-like protein;(source:Araport11) |
| AT2G35360 | ubiquitin family protein;(source:Araport11) |
| AT4G25410 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G04750 | F1F0-ATPase inhibitor protein;(source:Araport11) |
| AT1G17230 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT4G25835 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G18362 | None;(source:Araport11) |
| AT5G61190 | putative endonuclease or glycosyl hydrolase with C2H2-type zinc finger domain-containing protein;(source:Araport11) |
| AT5G66530 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT3G06780 | glycine-rich protein;(source:Araport11) |
| AT3G11773 | Thioredoxin superfamily protein;(source:Araport11) |
| AT3G54470 | encodes the bi-functional orotate phosphoribosyltransferase/orotidine-5'-phosphate decarboxylase catalyzing the fifth and sixth step in the de novo pyrimidine ribonucleotide biosynthesis |
| AT2G42320 | nucleolar protein gar2-like protein;(source:Araport11) |
| AT1G04780 | Ankyrin repeat family protein;(source:Araport11) |
| AT4G03200 | catalytics;(source:Araport11) |
| AT2G20670 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
| AT5G45650 | subtilase family protein;(source:Araport11) |
| AT2G39240 | RNA polymerase I specific transcription initiation factor RRN3 protein;(source:Araport11) |
| AT4G18070 | suppressor;(source:Araport11) |
| AT1G78450 | SOUL heme-binding family protein;(source:Araport11) |
| AT3G57380 | Glycosyltransferase family 61 protein;(source:Araport11) |
| AT5G24970 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G25275 | Thionin-like gene involved in resistance against the beet cyst nematode (Heterodera schachtii). |
| AT1G27670 | transmembrane protein;(source:Araport11) |
| AT3G15900 | homoserine O-acetyltransferase;(source:Araport11) |
| AT1G12600 | UDP-N-acetylglucosamine (UAA) transporter family;(source:Araport11) |
| AT5G16210 | HEAT repeat-containing protein;(source:Araport11) |
| AT3G19895 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G20816 | outer envelope pore-like protein;(source:Araport11) |
| AT5G19240 | Glycoprotein membrane precursor GPI-anchored;(source:Araport11) |
| AT5G13770 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT5G26015 | Encodes a Protease inhibitor/seed storage/LTP family protein [pseudogene] |
| AT4G03115 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT3G03150 | hypothetical protein;(source:Araport11) |
| AT5G24155 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT1G80530 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G32310 | CCT motif family protein;(source:Araport11) |
| AT5G66250 | kinectin-like protein;(source:Araport11) |
| AT1G52710 | Rubredoxin-like superfamily protein;(source:Araport11) |
| AT5G56140 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT1G60610 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT1G19070 | F-box family protein;(source:Araport11) |
| AT4G16050 | Aminotransferase-like, plant mobile domain family protein;(source:Araport11) |
| AT4G33905 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
| AT5G59770 | Protein-tyrosine phosphatase-like, PTPLA;(source:Araport11) |
| AT5G27950 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G37550 | hypothetical protein;(source:Araport11) |
| AT3G27350 | transcriptional regulator ATRX-like protein;(source:Araport11) |
| AT3G62580 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT1G03580 | pseudogene of MATH domain/coiled-coil protein;(source:Araport11) |
| AT4G34670 | Ribosomal protein S3Ae;(source:Araport11) |
| AT3G06770 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G19680 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G13390 | translocase subunit seca;(source:Araport11) |
| AT2G35540 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT2G36430 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT1G29140 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT4G25690 | stress response NST1-like protein;(source:Araport11) |
| AT4G00695 | Spc97/Spc98 family of spindle pole body (SBP) component;(source:Araport11) |
| AT3G12210 | DNA binding protein;(source:Araport11) |
| AT5G41250 | Exostosin family protein;(source:Araport11) |
| AT3G25597 | transmembrane protein;(source:Araport11) |
| AT3G10750 | FBD domain family;(source:Araport11) |
| AT3G03230 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G44430 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT5G47540 | Mo25 family protein;(source:Araport11) |
| AT5G11090 | serine-rich protein-like protein;(source:Araport11) |
| AT1G10440 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
| AT1G12990 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G18770 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G29780 | Expression of the gene is affected by multiple stresses. Knockout and overexpression lines show no obvious phenotypes. |
| AT1G34620 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 8.5e-75 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT2G22280 | pre-tRNA tRNA-Arg (anticodon: ACG);(source:Araport11, TAIR10) |
| AT4G03040 | hypothetical protein;(source:Araport11) |
| AT1G27330 | Ribosome associated membrane protein RAMP4;(source:Araport11) |
| AT5G53310 | myosin heavy chain-like protein;(source:Araport11) |
| AT5G56747 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-45 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G19370 | membrane protein;(source:Araport11) |
| AT2G39975 | hypothetical protein;(source:Araport11) |
| AT5G16140 | Peptidyl-tRNA hydrolase family protein;(source:Araport11) |
| AT1G09480 | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase The mRNA is cell-to-cell mobile. |
| AT4G17430 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G29418 | transmembrane protein;(source:Araport11) |
| AT1G44790 | ChaC-like family protein;(source:Araport11) |
| AT1G03290 | ELKS/Rab6-interacting/CAST family protein;(source:Araport11) |
| AT1G56660 | MAEBL domain protein;(source:Araport11) |
| AT5G56310 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G26610 | D111/G-patch domain-containing protein;(source:Araport11) |
| AT5G09760 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G38330 | hemolysin-III integral membrane-like protein;(source:Araport11) |
| AT5G48540 | receptor-like protein kinase-related family protein;(source:Araport11) |
| AT5G56240 | hapless protein;(source:Araport11) |
| AT5G45310 | coiled-coil protein;(source:Araport11) |
| AT4G24590 | RING finger protein;(source:Araport11) |
| AT2G41342 | hypothetical protein;(source:Araport11) |
| AT1G12190 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G02400 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G11280 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G01180 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G07310 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT4G17560 | Ribosomal protein L19 family protein;(source:Araport11) |
| AT4G25290 | DNA photolyase;(source:Araport11) |
| AT5G66755 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
| AT1G68420 | Class II aaRS and biotin synthetases superfamily protein;(source:Araport11) |
| AT4G22320 | golgin family A protein;(source:Araport11) |
| AT3G61080 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G17180 | hypothetical protein;(source:Araport11) |
| AT1G79510 | hypothetical protein (DUF2358);(source:Araport11) |
| AT5G43790 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G07290 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G14878 | other_RNA;(source:Araport11) |
| AT1G14180 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G46550 | transmembrane protein;(source:Araport11) |
| AT3G18215 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
| AT3G02820 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
| AT4G22610 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT5G26740 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
| AT3G27570 | Sucrase/ferredoxin-like family protein;(source:Araport11) |
| AT1G68770 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
| AT3G10035 | pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10) |
| AT2G07070 | transposable_element_gene;(source:Araport11) |
| AT2G31100 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G13830 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT5G57060 | 60S ribosomal L18a-like protein;(source:Araport11) |
| AT3G27825 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT5G15853 | hypothetical protein;(source:Araport11) |
| AT1G52615 | other_RNA;(source:Araport11) |
| AT5G45730 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G11640 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G03400 | A single copy gene that encodes a protein with sequence similarity to tomato E8 (ACC oxidase, the last step in ethylene biosynthesis) involved in ethylene synthesis and fruit ripening in tomato. This gene is not induced by ethylene in siliques. The transcript is found in siliques, etiolated seedlings, leaves, stems and flowers. |
| AT1G62370 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G05140 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT2G02780 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G27660 | hypothetical protein;(source:Araport11) |
| AT2G34985 | pre-tRNA tRNA-Thr (anticodon: CGT);(source:Araport11, TAIR10) |
| AT5G55640 | Na-translocating NADH-quinone reductase subunit A;(source:Araport11) |
| AT1G55675 | transmembrane protein;(source:Araport11) |
| AT4G36600 | Late embryogenesis abundant (LEA) protein;(source:Araport11) |
| AT5G14210 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G59680 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G50361 | hypothetical protein;(source:Araport11) |
| AT5G59732 | Natural antisense transcript overlaps with AT5G59730. The RNA is cell-to-cell mobile. |
| AT5G44290 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G15909 | hypothetical protein;(source:Araport11) |
| AT4G31070 | PPR superfamily protein;(source:Araport11) |
| AT3G10290 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT5G56940 | Ribosomal protein S16 family protein;(source:Araport11) |
| AT2G42955 | F-box/LRR protein;(source:Araport11) |
| AT3G54940 | Papain family cysteine protease;(source:Araport11) |
| AT5G17000 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT2G38420 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G21755 | Natural antisense transcript overlaps with AT3G21760;(source:Araport11) |
| AT3G18350 | Plant protein of unknown function (DUF639);(source:TAIR10) |
| AT1G04420 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT2G35040 | AICARFT/IMPCHase bienzyme family protein;(source:Araport11) |
| AT1G28400 | GATA zinc finger protein;(source:Araport11) |
| AT2G40113 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT2G30840 | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
| AT5G39080 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G17500 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT5G10970 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT1G77500 | DUF630 family protein, putative (DUF630 and DUF632);(source:Araport11) |
| AT1G79540 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G62710 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G39235 | hypothetical protein;(source:Araport11) |
| AT4G09520 | Cofactor-independent phosphoglycerate mutase;(source:Araport11) |
| AT1G67365 | Natural antisense transcript overlaps with AT1G67370;(source:Araport11) |
| AT4G19860 | Encodes a cytosolic calcium-independent phospholipase A. |
| AT5G06278 | pseudogene of abscisic acid-responsive HVA22 family protein |
| AT1G05400 | hypothetical protein;(source:Araport11) |
| AT3G53390 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G61345 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
| AT5G49710 | RING finger protein;(source:Araport11) |
| AT5G66820 | transmembrane protein;(source:Araport11) |
| AT1G08592 | Natural antisense transcript overlaps with AT1G08590;(source:Araport11) |
| AT1G04555 | transmembrane protein;(source:Araport11) |
| AT3G06868 | vitellogenin-like protein;(source:Araport11) |
| AT5G10570 | Encodes a myo-inositol hexakisphosphate kinase. |
| AT1G18210 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT5G52065 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G40680.1);(source:TAIR10) |
| AT5G48620 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT5G19100 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G53870 | Ribosomal protein S3 family protein;(source:Araport11) |
| AT3G03100 | NADH:ubiquinone oxidoreductase, 17.2kDa subunit;(source:Araport11) |
| AT5G20700 | senescence-associated family protein, putative (DUF581);(source:Araport11) |
| AT1G75480 | pseudogene of gamma-glutamyl hydrolase 1;(source:Araport11) |
| AT2G37880 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT1G21780 | BTB/POZ domain-containing protein. Contains similarity to gb:AJ000644 SPOP (speckle-type POZ protein) from Homo sapiens and contains a PF:00651 BTB/POZ domain. ESTs gb:T75841, gb:R89974, gb:R30221, gb:N96386, gb:T76457, gb:AI100013 and gb:T76456 come from this gene;supported by full-length. Interacts with CUL3A and CUL3B. |
| AT2G42370 | hypothetical protein;(source:Araport11) |
| AT1G10419 | Pseudogene of AT1G10419 |
| AT3G48830 | tRNA nucleotidyltransferase/polyA polymerase family protein;(source:Araport11) |
| AT3G17130 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G13485 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.7e-12 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
| AT4G19160 | transglutaminase family protein;(source:Araport11) |
| AT3G14710 | RNI-like superfamily protein;(source:Araport11) |
| AT3G51470 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G09450 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G51160 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G33590 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT4G01740 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G15800 | transposable_element_gene;(source:Araport11) |
| AT1G75200 | flavodoxin family protein / radical SAM domain-containing protein;(source:Araport11) |
| AT5G60630 | transmembrane protein;(source:Araport11) |
| AT1G33420 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT5G52550 | stress response NST1-like protein;(source:Araport11) |
| AT2G23118 | hypothetical protein;(source:Araport11) |
| AT2G47690 | NADH-ubiquinone oxidoreductase-like protein;(source:Araport11) |
| AT5G25280 | serine-rich protein-like protein;(source:Araport11) |
| AT3G61962 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G22608 | hypothetical protein;(source:Araport11) |
| AT2G19240 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT2G44200 | pre-mRNA splicing factor domain-containing protein;(source:Araport11) |
| AT4G38550 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT3G14800 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.1e-83 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
| AT3G10610 | Ribosomal S17 family protein;(source:Araport11) |
| AT4G23493 | hypothetical protein;(source:Araport11) |
| AT1G67000 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G11040 | HSP40/DnaJ peptide-binding protein;(source:Araport11) |
| AT5G61530 | small G protein family protein / RhoGAP family protein;(source:Araport11) |
| AT3G09915 | pseudogene of Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G23080 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G26990 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-294 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G41810 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
| AT2G22440 | non-LTR retroelement reverse transcriptase;(source:Araport11) |
| AT5G01300 | PEBP (phosphatidylethanolamine-binding protein) family protein;(source:Araport11) |
| AT2G20950 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT5G45790 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT2G18940 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G49120 | DUF581 family protein, putative (DUF581);(source:Araport11) |
| AT1G74580 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G15430 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT1G21395 | transmembrane protein;(source:Araport11) |
| AT2G22930 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G22403 | other_RNA;(source:Araport11) |
| AT5G48465 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
| AT2G31990 | Exostosin family protein;(source:Araport11) |
| AT3G50350 | membrane insertase, putative (DUF1685);(source:Araport11) |
| AT1G70640 | octicosapeptide/Phox/Bem1p (PB1) domain-containing protein;(source:Araport11) |
| AT5G01790 | hypothetical protein;(source:Araport11) |
| AT1G04840 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G46380 | extra-large G-like protein, putative (DUF3133);(source:Araport11) |
| AT5G13760 | Plasma-membrane choline transporter family protein;(source:Araport11) |
| AT3G62990 | myelin transcription factor-like protein;(source:Araport11) |
| AT5G25510 | Protein phosphatase 2A regulatory B subunit family protein;(source:Araport11) |
| AT1G16515 | transmembrane protein;(source:Araport11) |
| AT1G07930 | GTP binding Elongation factor Tu family protein;(source:Araport11) |
| AT2G36854 | hypothetical protein;(source:Araport11) |
| AT3G58540 | hypothetical protein;(source:Araport11) |
| AT1G17090 | transmembrane protein;(source:Araport11) |
| AT5G55960 | transmembrane protein C9orf5 protein;(source:Araport11) |
| AT5G16060 | Cytochrome c oxidase biogenesis protein Cmc1-like protein;(source:Araport11) |
| AT3G52700 | hypothetical protein;(source:Araport11) |
| AT5G57885 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT5G45430 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G74790 | catalytics;(source:Araport11) |
| AT5G42440 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G31300 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT1G75800 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT1G51580 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT4G37530 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G55570 | cytoplasmic tRNA 2-thiolation protein;(source:Araport11) |
| AT3G60850 | hypothetical protein;(source:Araport11) |
| AT2G46620 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G55530 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G19850 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G59870 | hypothetical protein;(source:Araport11) |
| AT5G24890 | stress response NST1-like protein;(source:Araport11) |
| AT4G17150 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G36730 | Translation initiation factor IF2/IF5;(source:Araport11) |
| AT5G23850 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT1G06590 | anaphase-promoting complex subunit;(source:Araport11) |
| AT4G02010 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G42950 | Magnesium transporter CorA-like family protein;(source:Araport11) |
| AT1G59710 | actin cross-linking protein (DUF569);(source:Araport11) |
| AT5G46720 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT3G43430 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G26010 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G08139 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G25460 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G28695 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT3G04854 | hypothetical protein;(source:Araport11) |
| AT3G07470 | DUF538 protein |
| AT3G07320 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G25770 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G44660 | ALG6, ALG8 glycosyltransferase family;(source:Araport11) |
| AT2G16230 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT3G57930 | rho GTPase-activating gacO-like protein;(source:Araport11) |
| AT1G20490 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G26160 | Metal-dependent phosphohydrolase;(source:Araport11) |
| AT5G07870 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G06440 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT4G35670 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G43660 | The gene encodes a putative nodulin-like21 protein. |
| AT4G27654 | transmembrane protein;(source:Araport11) |
| AT5G15610 | Proteasome component (PCI) domain protein;(source:Araport11) |
| AT1G54740 | FANTASTIC four-like protein (DUF3049);(source:Araport11) |
| AT4G23620 | Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain-containing protein;(source:Araport11) |
| AT4G33310 | hypothetical protein;(source:Araport11) |
| AT1G64290 | F-box protein-like protein;(source:Araport11) |
| AT3G48120 | serine/arginine-rich splicing factor;(source:Araport11) |
| AT3G29760 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G13310 | hypothetical protein;(source:Araport11) |
| AT4G21460 | Ribosomal protein S24/S35;(source:Araport11) |
| AT5G65470 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G51610 | Ribosomal protein L11 family protein;(source:Araport11) |
| AT2G15045 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT4G08860.1);(source:TAIR10) |
| AT5G14790 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G19340 | hypothetical protein;(source:Araport11) |
| AT2G46490 | hypothetical protein;(source:Araport11) |
| AT4G18900 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G35370 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT5G05250 | hypothetical protein;(source:Araport11) |
| AT4G16146 | cAMP-regulated phosphoprotein 19-related protein;(source:Araport11) |
| AT5G45275 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G39320 | microtubule-associated protein-like protein;(source:Araport11) |
| AT2G23110 | Late embryogenesis abundant protein, group 6;(source:Araport11) |
| AT1G06010 | basic leucine zipper/W2 domain protein;(source:Araport11) |
| AT4G23510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G06760 | Drought-responsive family protein;(source:Araport11) |
| AT5G12040 | Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase family protein;(source:Araport11) |
| AT1G12500 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT1G42480 | TLR4 regulator/MIR-interacting MSAP protein;(source:Araport11) |
| AT5G27035 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.6e-16 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT1G70220 | RNA-processing, Lsm domain-containing protein;(source:Araport11) |
| AT1G80280 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G23955 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.6e-41 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G07820 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
| AT2G32750 | Exostosin family protein;(source:Araport11) |
| AT4G12710 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G41550 | Rho termination factor;(source:Araport11) |
| AT2G21720 | ArgH (DUF639);(source:Araport11) |
| AT3G15359 | hypothetical protein;(source:Araport11) |
| AT2G40095 | Alpha/beta hydrolase related protein;(source:Araport11) |
| AT5G01420 | Glutaredoxin family protein;(source:Araport11) |
| AT3G01430 | NHL domain protein;(source:Araport11) |
| AT4G00085 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT5G55840 | PPR superfamily protein;(source:Araport11) |
| AT1G48960 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT1G23440 | Peptidase C15, pyroglutamyl peptidase I-like protein;(source:Araport11) |
| AT5G39410 | Saccharopine dehydrogenase;(source:Araport11) |
| AT1G77810 | Galactosyltransferase family protein;(source:Araport11) |
| AT1G76550 | Phosphofructokinase family protein. Target of miRNA sRNA6. |
| AT1G35710 | kinase family with leucine-rich repeat domain-containing protein;(source:Araport11) |
| AT4G08240 | histone-lysine N-methyltransferase;(source:Araport11) |
| AT1G05650 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G16220 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT3G59930 | Encodes a defensin-like (DEFL) family protein. |
| AT2G16250 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G78720 | SecY protein transport family protein;(source:Araport11) |
| AT1G51430 | cTAGE family protein;(source:Araport11) |
| AT4G24204 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G35585 | cystic fibrosis transmembrane conductance regulator;(source:Araport11) |
| AT4G21730 | pseudogene of N-ethylmaleimide sensitive factor (NSF) |
| AT1G36070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G18640 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G15002 | Natural antisense transcript overlaps with AT1G15000;(source:Araport11) |
| AT1G16100 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT1G03610 | plant/protein (DUF789);(source:Araport11) |
| AT2G41400 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT1G52347 | None;(source:Araport11) |
| AT1G78260 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT4G36700 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT2G44820 | axoneme-associated protein MST101(2) protein;(source:Araport11) |
| AT1G10220 | ZCF37;(source:Araport11) |
| AT1G71910 | hypothetical protein;(source:Araport11) |
| AT5G11940 | Subtilase family protein;(source:Araport11) |
| AT3G50270 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G58510 | Rab3 GTPase-activating protein catalytic protein;(source:Araport11) |
| AT4G38552 | Natural antisense transcript overlaps with AT4G38550;(source:Araport11) |
| AT2G37660 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G01570 | Oleosin family protein;(source:Araport11) |
| AT4G39760 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G01400 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G45030 | Translation elongation factor EFG/EF2 protein;(source:Araport11) |
| AT5G43000 | hypothetical protein;(source:Araport11) |
| AT2G19340 | Oligosaccharyltransferase complex/magnesium transporter family protein;(source:Araport11) |
| AT1G01448 | Natural antisense transcript overlaps with AT1G01450;(source:Araport11) |
| AT3G23880 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G66340 | hypothetical protein;(source:Araport11) |
| AT1G62880 | Cornichon family protein;(source:Araport11) |
| AT4G37420 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT5G61570 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G38096 | Pseudogene of AT5G38100; methyltransferase-related protein |
| AT3G04140 | Ankyrin repeat family protein;(source:Araport11) |
| AT2G03667 | Asparagine synthase family protein;(source:Araport11) |
| AT1G24530 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G27030 | hypothetical protein;(source:Araport11) |
| AT3G27520 | cryptic loci regulator;(source:Araport11) |
| AT4G26095 | Natural antisense transcript overlaps with AT4G26090;(source:Araport11) |
| AT5G10740 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT4G39270 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G16117 | hypothetical protein;(source:Araport11) |
| AT5G43770 | proline-rich family protein;(source:Araport11) |
| AT3G06433 | pseudogene of nodulin MtN3 family protein |
| AT5G23750 | Remorin family protein;(source:Araport11) |
| AT3G51700 | PIF1 helicase;(source:Araport11) |
| AT1G20890 | caveolin-1 protein;(source:Araport11) |
| AT2G19796 | other_RNA;(source:Araport11) |
| AT4G38940 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G21980 | HAUS augmin-like complex subunit;(source:Araport11) |
| AT1G23340 | carboxyl-terminal proteinase, putative (DUF239);(source:Araport11) |
| AT1G66180 | The gene encodes a putative aspartyl protease (ASP). Its expression is induced in response to light and ascorbate. The mRNA is cell-to-cell mobile. |
| AT5G39970 | catalytics;(source:Araport11) |
| AT1G18610 | Galactose oxidase/kelch repeat superfamily protein, induced by calcium. |
| AT1G70870 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G80290 | a member of the Glycosyltransferase Family 64 (according to CAZy Database) |
| AT3G14960 | Galactosyltransferase family protein;(source:Araport11) |
| AT4G39150 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT1G79529 | Natural antisense transcript overlaps with AT1G79530;(source:Araport11) |
| AT3G57790 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G22680 | F-box protein;(source:Araport11) |
| AT5G14690 | transmembrane protein;(source:Araport11) |
| AT5G01595 | Natural antisense transcript overlaps with AT5G01600;(source:Araport11) |
| AT5G01800 | saposin B domain-containing protein;(source:Araport11) |
| AT3G15356 | Legume lectin family protein;(source:Araport11) |
| AT2G34340 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT4G26960 | hypothetical protein;(source:Araport11) |
| AT5G64790 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G01732 | Natural antisense transcript overlaps with AT5G01730;(source:Araport11) |
| AT2G24280 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G19485 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G22510 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G71520 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT5G48190 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT5G24130 | polypyrimidine tract-binding-like protein;(source:Araport11) |
| AT2G34655 | hypothetical protein;(source:Araport11) |
| AT4G02100 | Heat shock protein DnaJ with tetratricopeptide repeat-containing protein;(source:Araport11) |
| AT1G56720 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G15757 | Encodes a defensin-like (DEFL) family protein. |
| AT2G26600 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT2G03660 | pre-tRNA tRNA-Thr (anticodon: CGT);(source:Araport11, TAIR10) |
| AT5G47380 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT3G15351 | P53/DNA damage-regulated protein;(source:Araport11) |
| AT4G14930 | Survival protein SurE-like phosphatase/nucleotidase;(source:Araport11) |
| AT5G65445 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
| AT2G40050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G10650 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT1G52990 | thioredoxin family protein;(source:Araport11) |
| AT1G64610 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G09950 | hypothetical protein;(source:Araport11) |
| AT1G16550 | Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT1G75370 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT2G47010 | calcium/calcium/calmodulin-dependent Serine/Threonine-kinase;(source:Araport11) |
| AT4G34630 | prostatic spermine-binding-like protein;(source:Araport11) |
| AT3G47965 | hypothetical protein;(source:Araport11) |
| AT5G02860 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G74510 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G11730 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G70550 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT4G39970 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT2G17590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G16740 | Ribosomal protein L20;(source:Araport11) |
| AT3G02335 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT1G11710 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G15250 | TPRXL;(source:Araport11) |
| AT5G07940 | dentin sialophosphoprotein-like protein;(source:Araport11) |
| AT1G50450 | Saccharopine dehydrogenase;(source:Araport11) |
| AT3G24929 | hypothetical protein;(source:Araport11) |
| AT2G20050 | protein phosphatase 2C and cyclic nucleotide-binding/kinase domain-containing protein;(source:Araport11) |
| AT4G13245 | snoRNA;(source:Araport11) |
| AT5G03110 | protamine P1 family protein;(source:Araport11) |
| AT1G49680 | mutator transposase MUDRA protein;(source:Araport11) |
| AT2G02680 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G02340 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G59960 | K-stimulated pyrophosphate-energized sodium pump protein;(source:Araport11) |
| AT2G22180 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G48655 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G38660 | Amino acid dehydrogenase family protein;(source:Araport11) |
| AT2G20635 | protein kinase and Mad3-BUB1-I domain-containing protein;(source:Araport11) |
| AT1G43610 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT2G36895 | D-tagatose-1,6-bisphosphate aldolase subunit;(source:Araport11) |
| AT2G44920 | Encodes a pentapeptide-repeat protein (PRP) composed of 25 repeats capped by N- and C-terminal a-helices. Unlike other PRPs, At2g44920 consists exclusively of type II b-turns |
| AT3G52920 | transcriptional activator (DUF662);(source:Araport11) |
| AT3G47550 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT2G19940 | Putative N-acetyl-gamma-glutamyl-phosphate reductase;(source:Araport11) |
| AT3G01930 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G68500 | hypothetical protein;(source:Araport11) |
| AT5G62130 | Per1-like family protein;(source:Araport11) |
| AT2G35970 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G03668 | Natural antisense transcript overlaps with AT5G03670;(source:Araport11) |
| AT2G25970 | KH domain-containing protein;(source:Araport11) |
| AT3G27600 | SWAP (Suppressor-of-White-APricot)/surp RNA-binding domain-containing protein;(source:Araport11) |
| AT3G20015 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G15190 | hypothetical protein;(source:Araport11) |
| AT3G62430 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
| AT3G50840 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT1G20015 | snoRNA;(source:Araport11) |
| AT5G03700 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11) |
| AT4G28290 | hypothetical protein;(source:Araport11) |
| AT5G45490 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G77550 | tubulin-tyrosine ligase;(source:Araport11) |
| AT3G01730 | Mutants exhibit shorter root hairs under phosphate-deficient conditions. |
| AT4G05060 | PapD-like superfamily protein;(source:Araport11) |
| AT3G13662 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT5G26960 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G18670 | Ankyrin repeat family protein;(source:Araport11) |
| AT2G34740 | protein phosphatase 2C family protein;(source:Araport11) |
| AT5G66564 | snoRNA;(source:Araport11) |
| AT2G22200 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT5G67200 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G53860 | Encodes a protein that is highly methylated in a WT DML background. |
| AT4G32475 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT3G51930 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G35345 | hypothetical protein;(source:Araport11) |
| AT1G04990 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G05090 | dentin sialophosphoprotein-like protein;(source:Araport11) |
| AT1G68070 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
| AT4G01870 | tolB protein-like protein;(source:Araport11) |
| AT1G19376 | snoRNA;(source:Araport11) |
| AT4G39838 | Natural antisense transcript overlaps with AT4G39840;(source:Araport11) |
| AT3G19030 | transcription initiation factor TFIID subunit 1b-like protein;(source:Araport11) |
| AT4G31340 | myosin heavy chain-like protein;(source:Araport11) |
| AT5G19270 | reverse transcriptase-like protein;(source:Araport11) |
| AT3G03826 | transmembrane protein;(source:Araport11) |
| AT5G49435 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT5G51580 | hypothetical protein;(source:Araport11) |
| AT1G15450 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT3G11890 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
| AT2G19802 | transmembrane protein;(source:Araport11) |
| AT1G06645 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT2G42240 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G52342 | hypothetical protein;(source:Araport11) |
| AT2G10940 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G27250 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G08610 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-87 P-value blast match to O22278 /203-375 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT3G26430 | Encodes a functioning member of the GDS(L) lipase family with preference for long chain substrates that does not hydrolyze choline esters. |
| AT4G30180 | hypothetical protein;(source:Araport11) |
| AT5G14120 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G66550 | Maf-like protein;(source:Araport11) |
| AT2G22340 | transmembrane protein;(source:Araport11) |
| AT5G60250 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT5G49215 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G57910 | ribosomal RNA small subunit methyltransferase G;(source:Araport11) |
| AT5G17360 | DNA ligase;(source:Araport11) |
| AT5G11580 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT4G00840 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G49400 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G19970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G25707 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G01935 | insulin-induced protein;(source:Araport11) |
| AT4G39360 | hypothetical protein;(source:Araport11) |
| AT1G78995 | hypothetical protein;(source:Araport11) |
| AT1G47606 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G57100 | Nucleotide/sugar transporter family protein;(source:Araport11) |
| AT3G58610 | ketol-acid reductoisomerase;(source:Araport11) |
| AT1G55680 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G16180 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
| AT5G03440 | zinc finger protein;(source:Araport11) |
| AT5G42250 | Zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
| AT5G13380 | Auxin-responsive GH3 family protein;(source:Araport11) |
| AT1G16620 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.7e-158 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G00530 | UvrABC system protein A;(source:Araport11) |
| AT2G32150 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G80640 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G64460 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT4G13100 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G31115 | DUF1997 family protein, putative (DUF1997);(source:Araport11) |
| AT1G48315 | Natural antisense transcript overlaps with AT1G48320;(source:Araport11) |
| AT4G29450 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G34310 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G19390 | Uncharacterized protein family (UPF0114);(source:Araport11) |
| AT1G02600 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT3G13660 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT1G20310 | syringolide-induced protein;(source:Araport11) |
| AT2G42247 | Natural antisense transcript overlaps with AT2G42250;(source:Araport11) |
| AT3G58035 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
| AT3G61610 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT1G79070 | SNARE-associated protein-like protein;(source:Araport11) |
| AT3G51250 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
| AT1G56345 | Pseudouridine synthase family protein;(source:Araport11) |
| AT4G38700 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT3G50570 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G51000 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G38280 | integral membrane hemolysin-III-like protein;(source:Araport11) |
| AT4G23530 | ROH1, putative (DUF793);(source:Araport11) |
| AT5G66580 | PADRE protein. |
| AT3G26935 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT2G26355 | Natural antisense transcript overlaps with AT2G26360. The RNA is cell-to-cell mobile. |
| AT1G29025 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT5G10235 | pre-tRNA tRNA-Arg (anticodon: ACG);(source:Araport11, TAIR10) |
| AT5G57565 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G03965 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G64255 | MuDR family transposase;(source:Araport11) |
| AT5G49555 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT1G06610 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT4G01960 | transmembrane protein;(source:Araport11) |
| AT5G64690 | neurofilament triplet H protein-like protein;(source:Araport11) |
| AT4G32870 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT3G52110 | interferon-activable protein;(source:Araport11) |
| AT3G56360 | hypothetical protein;(source:Araport11) |
| AT5G54710 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G70160 | zinc finger MYND domain protein;(source:Araport11) |
| AT2G46780 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G10300 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G13930 | Involved in response to salt stress. Knockout mutants are hypersensitive to salt stress. The mRNA is cell-to-cell mobile. |
| AT5G24318 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G18130 | transmembrane protein;(source:Araport11) |
| AT3G12710 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G53030 | encodes a copper chaperone, can functional complements the yeast COX17 null mutant. May play a role in the delivery of copper to mitochondria. Expressed in roots and thus may also play a role in copper transport in the roots. |
| AT1G76700 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT4G39930 | hypothetical protein;(source:Araport11) |
| AT1G05350 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G49000 | transmembrane protein;(source:Araport11) |
| AT4G15260 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G38700 | cotton fiber protein;(source:Araport11) |
| AT1G28390 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G13965 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT5G61370 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G41400 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G59490 | hypothetical protein;(source:Araport11) |
| AT1G64618 | other_RNA;(source:Araport11) |
| AT3G03980 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G02700 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G22426 | hypothetical protein;(source:Araport11) |
| AT3G62840 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT1G67910 | hypothetical protein;(source:Araport11) |
| AT1G54260 | winged-helix DNA-binding transcription factor family protein;(source:Araport11) |
| AT1G32190 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G09490 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G12230 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G15280 | hypothetical protein;(source:Araport11) |
| AT3G21340 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G02430 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G26510 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT3G61545 | pre-tRNA tRNA-Glu (anticodon: CTC);(source:Araport11, TAIR10) |
| AT1G79770 | CASP-like protein (DUF1677);(source:Araport11) |
| AT4G30000 | Dihydropterin pyrophosphokinase / Dihydropteroate synthase;(source:Araport11) |
| AT3G58700 | Ribosomal L5P family protein;(source:Araport11) |
| AT2G22482 | other_RNA;(source:Araport11) |
| AT3G57780 | nucleolar-like protein;(source:Araport11) |
| AT1G21326 | VQ motif-containing protein;(source:Araport11) |
| AT1G71350 | eukaryotic translation initiation factor SUI1 family protein;(source:Araport11) |
| AT5G62865 | hypothetical protein;(source:Araport11) |
| AT5G40680 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G51030 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G30090 | golgin family A protein;(source:Araport11) |
| AT3G57070 | Glutaredoxin family protein;(source:Araport11) |
| AT2G41082 | hypothetical protein;(source:Araport11) |
| AT1G49830 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G78140 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G53460 | craniofacial development protein;(source:Araport11) |
| AT1G58235 | hypothetical protein;(source:Araport11) |
| AT2G18850 | SET domain-containing protein;(source:Araport11) |
| AT4G00500 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G75210 | HAD-superfamily hydrolase, subfamily IG, 5-nucleotidase;(source:Araport11) |
| AT5G46645 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 0.00040 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G03710 | replication factor C large subunit;(source:Araport11) |
| AT5G51980 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G77020 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT3G10415 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT3G57400 | transmembrane protein;(source:Araport11) |
| AT5G19760 | Encodes a novel mitochondrial carrier capable of transporting both dicarboxylates (such as malate, oxaloacetate, oxoglutarate, and maleate) and tricarboxylates (such as citrate, isocitrate, cis-aconitate, and trans-aconitate). |
| AT1G52618 | hypothetical protein;(source:Araport11) |
| AT2G02960 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT5G02350 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G10840 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G07080 | Encodes enzymes that can efficiently convert putrescine and caffeoyl-CoA to di-caffeoyl putrescine. Can convert spermidine/spermine and feruloyl CoA to mono-feruloyl spermidine/spermine. Has a preference for feruloyl-CoA binding, but little acyl-acceptor specificity. |
| AT1G27285 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G37360 | LOW protein: ammonium transporter 1-like protein;(source:Araport11) |
| AT5G23680 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
| AT1G66880 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G31408 | None;(source:Araport11) |
| AT5G05330 | Encodes a protein with a putative HMG-box domain. The high-mobility group (HMG) proteins are chromatin-associated proteins that act as architectural factors in various nucleoprotein structures, which regulate DNA-dependent processes such as transcription and recombination. Expression of this gene was not detected according to Grasser et al. (J. Mol. Biol. 2006:358, 654-664). |
| AT2G19100 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.2e-33 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT3G17580 | SsrA-binding protein;(source:Araport11) |
| AT5G14110 | peroxidase (DUF 3339);(source:Araport11) |
| AT4G16610 | C2H2-like zinc finger protein;(source:Araport11) |
| AT3G01572 | hypothetical protein;(source:Araport11) |
| AT1G77250 | RING/FYVE/PHD-type zinc finger family protein;(source:Araport11) |
| AT3G21770 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G26100 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT1G74940 | cyclin-dependent kinase, putative (DUF581);(source:Araport11) |
| AT3G12870 | transmembrane protein;(source:Araport11) |
| AT5G40860 | transmembrane protein;(source:Araport11) |
| AT1G77145 | transmembrane protein, putative (DUF506);(source:Araport11) |
| AT3G06520 | agenet domain-containing protein;(source:Araport11) |
| AT1G08220 | ATPase complex subunit;(source:Araport11) |
| AT1G69252 | other_RNA;(source:Araport11) |
| AT5G57480 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G15800 | hypothetical protein;(source:Araport11) |
| AT1G52790 | encodes a putative oxidoreductase, 2OG-Fe(II) oxygenase family protein, similar to GS-AOP loci (GI:16118889, GI:16118887, GI:16118891, GI:16118893); contains PF03171 2OG-Fe(II) oxygenase superfamily domain |
| AT4G27810 | hypothetical protein;(source:Araport11) |
| AT1G18090 | 5-3 exonuclease family protein;(source:Araport11) |
| AT5G56745 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT2G18090 | PHD finger family protein / SWIB complex BAF60b domain-containing protein / GYF domain-containing protein;(source:Araport11) |
| AT1G27020 | plant/protein;(source:Araport11) |
| AT3G01830 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT5G28145 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.1e-195 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT2G41250 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G21400 | Thiamin diphosphate-binding fold (THDP-binding) superfamily protein;(source:Araport11) |
| AT5G18850 | Low-density receptor-like protein;(source:Araport11) |
| AT3G56420 | Thioredoxin superfamily protein;(source:Araport11) |
| AT5G21222 | protein kinase family protein;(source:Araport11) |
| AT1G55535 | transmembrane protein;(source:Araport11) |
| AT1G68185 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G36195 | Serine carboxypeptidase S28 family protein;(source:Araport11) |
| AT1G06050 | ENHANCED DISEASE RESISTANCE-like protein (DUF1336);(source:Araport11) |
| AT4G11800 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT2G29628 | hypothetical protein;(source:Araport11) |
| AT1G04930 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G55210 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT5G14500 | aldose 1-epimerase family protein;(source:Araport11) |
| AT5G62770 | membrane-associated kinase regulator, putative (DUF1645);(source:Araport11) |
| AT4G36370 | hypothetical protein;(source:Araport11) |
| AT1G62055 | pseudogene of Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT5G43920 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT5G53900 | Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11) |
| AT4G37230 | Photosystem II manganese-stabilising protein (PsbO) family;(source:Araport11) |
| AT2G42220 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT4G36850 | PQ-loop repeat family protein / transmembrane family protein;(source:Araport11) |
| AT5G64420 | DNA polymerase V family;(source:Araport11) |
| AT3G61160 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G24410 | SMAD/FHA domain protein;(source:Araport11) |
| AT4G37240 | PADRE protein down-regulated after infection by S. sclerotiorun. |
| AT3G11760 | structural maintenance of chromosomes flexible hinge domain protein;(source:Araport11) |
| AT5G57760 | hypothetical protein;(source:Araport11) |
| AT1G68300 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT1G04960 | golgin family A protein (DUF1664);(source:Araport11) |
| AT5G66053 | hypothetical protein;(source:Araport11) |
| AT2G31130 | hypothetical protein;(source:Araport11) |
| AT1G14270 | CAAX amino terminal protease family protein;(source:Araport11) |
| AT3G15890 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G03320 | RNA-binding ASCH domain protein;(source:Araport11) |
| AT1G06640 | encodes a protein whose sequence is similar to a 2-oxoglutarate-dependent dioxygenase The mRNA is cell-to-cell mobile. |
| AT4G38650 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
| AT2G32600 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G40042 | Microsomal signal peptidase 12 kDa subunit (SPC12);(source:Araport11) |
| AT1G01310 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT4G37380 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G59390 | XH/XS domain-containing protein;(source:Araport11) |
| AT3G01170 | Ribosomal protein L34e superfamily protein;(source:Araport11) |
| AT5G05180 | myosin heavy chain, striated protein;(source:Araport11) |
| AT1G25230 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT1G72175 | E3 ubiquitin-protein ligase RNF170-like protein (DUF 1232);(source:Araport11) |
| AT4G20880 | ethylene-responsive nuclear protein / ethylene-regulated nuclear protein (ERT2);(source:Araport11) |
| AT1G17350 | NADH:ubiquinone oxidoreductase intermediate-associated protein 30;(source:Araport11) |
| AT1G11915 | wall-associated receptor kinase galacturonan-binding protein;(source:Araport11) |
| AT1G01170 | ozone-responsive stress-like protein (DUF1138);(source:Araport11) |
| AT4G22730 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G53163 | membrane-associated kinase regulator;(source:Araport11) |
| AT4G10910 | hypothetical protein;(source:Araport11) |
| AT3G54740 | zein-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT2G41060 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G03630 | suppressor SRP40-like protein;(source:Araport11) |
| AT1G43886 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.3e-165 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT2G21188 | other_RNA;(source:Araport11) |
| AT5G04460 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G06840 | hypothetical protein;(source:Araport11) |
| AT4G22830 | YCF49-like protein;(source:Araport11) |
| AT1G35255 | transmembrane protein;(source:Araport11) |
| AT4G34881 | transmembrane protein;(source:Araport11) |
| AT1G12340 | Cornichon family protein;(source:Araport11) |
| AT4G29890 | choline monooxygenase, putative (CMO-like);(source:Araport11) |
| AT2G42900 | Plant basic secretory protein (BSP) family protein;(source:Araport11) |
| AT3G15251 | hypothetical protein;(source:Araport11) |
| AT5G57655 | xylose isomerase family protein;(source:Araport11) |
| AT1G08900 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G29195 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT1G08890 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G60340 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G59765 | None;(source:Araport11) |
| AT4G24200 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT1G66760 | MATE efflux family protein;(source:Araport11) |
| AT1G70150 | zinc ion binding protein;(source:Araport11) |
| AT5G52890 | AT hook motif-containing protein;(source:Araport11) |
| AT1G53282 | Encodes a Plant thionin family protein |
| AT5G50890 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G54440 | glycoside hydrolase family 2 protein;(source:Araport11) |
| AT5G67350 | hypothetical protein;(source:Araport11) |
| AT5G54170 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT3G06750 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G66173 | other_RNA;(source:Araport11) |
| AT4G01350 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G27150 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G21810 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G09870 | histidine acid phosphatase family protein;(source:Araport11) |
| AT5G41900 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G26860 | Putative pyridoxal phosphate-dependent enzyme, YBL036C type;(source:Araport11) |
| AT3G27540 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G69760 | suppressor SRP40-like protein;(source:Araport11) |
| AT3G27040 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT1G01355 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT5G44569 | other_RNA;(source:Araport11) |
| AT4G11985 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT1G53930 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G22791 | F-box family protein;(source:Araport11) |
| AT5G41605 | pre-tRNA tRNA-Leu (anticodon: CAA);(source:Araport11, TAIR10) |
| AT5G51000 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G64405 | hypothetical protein;(source:Araport11) |
| AT2G45750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G16200 | 50S ribosomal protein-like protein;(source:Araport11) |
| AT1G51810 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G10720 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT1G08210 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G23672 | Natural antisense transcript overlaps with AT2G23670;(source:Araport11) |
| AT5G58950 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G19000 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G47490 | HNH endonuclease;(source:Araport11) |
| AT2G35050 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
| AT1G77880 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G07505 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.7e-41 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G22690 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G51402 | hypothetical protein;(source:Araport11) |
| AT2G30000 | PHF5-like protein;(source:Araport11) |
| AT3G07690 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
| AT1G61750 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT4G02555 | snoRNA;(source:Araport11) |
| AT5G67170 | SEC-C motif-containing protein / OTU-like cysteine protease family protein;(source:Araport11) |
| AT1G47860 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-40 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G21835 | Thionin-like gene involved in resistance against the beet cyst nematode (Heterodera schachtii). |
| AT1G07550 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G10740 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G51990 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G33790 | jacalin lectin family protein;(source:Araport11) |
| AT3G16990 | heme oxygenase-like, multi-helical;(source:Araport11) |
| AT3G63006 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
| AT1G01570 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT1G26558 | other_RNA;(source:Araport11) |
| AT4G21420 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.9e-06 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
| AT4G16260 | Encodes a putative beta-1,3-endoglucanase that interacts with the 30C02 cyst nematode effector. May play a role in host defense. |
| AT3G11780 | MD-2-related lipid recognition domain-containing protein / ML domain-containing protein;(source:Araport11) |
| AT4G28440 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT2G24370 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT3G61420 | BSD domain (BTF2-like transcription factors, Synapse-associated proteins and DOS2-like proteins);(source:Araport11) |
| AT2G47440 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G30030 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.5e-30 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
| AT3G02315 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT3G44100 | MD-2-related lipid recognition domain-containing protein;(source:Araport11) |
| AT5G42620 | metalloendopeptidase / zinc ion binding protein;(source:Araport11) |
| AT4G25390 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G21720 | defensin-like protein;(source:Araport11) |
| AT1G07830 | ribosomal protein L29 family protein;(source:Araport11) |
| AT1G68350 | cotton fiber protein;(source:Araport11) |
| AT3G61920 | PADRE protein. |
| AT4G14490 | SMAD/FHA domain-containing protein;(source:Araport11) |
| AT5G24100 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G18970 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G21820 | seed maturation protein;(source:Araport11) |
| AT5G20500 | Glutaredoxin family protein;(source:Araport11) |
| AT1G17450 | B-block binding subunit of TFIIIC;(source:Araport11) |
| AT2G18735 | other_RNA;(source:Araport11) |
| AT1G21080 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT5G65676 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-191 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT2G37240 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G15410 | aspartate-glutamate racemase family;(source:Araport11) |
| AT5G22355 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G55410 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G21740 | DUF630 family protein, putative (DUF630 and DUF632);(source:Araport11) |
| AT5G20885 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G03905 | Iron-sulfur cluster biosynthesis family protein;(source:Araport11) |
| AT3G26910 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G70740 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G39865 | transmembrane protein;(source:Araport11) |
| AT2G02170 | Remorin family protein;(source:Araport11) |
| AT3G11230 | Yippee family putative zinc-binding protein;(source:Araport11) |
| AT3G16210 | F-box family protein;(source:Araport11) |
| AT1G31920 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G48020 | hypothetical protein;(source:Araport11) |
| AT5G01780 | 2-oxoglutarate-dependent dioxygenase family protein;(source:Araport11) |
| AT1G77280 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT3G13000 | ubiquinone biosynthesis protein (Protein of unknown function, DUF547);(source:Araport11) |
| AT3G61270 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT4G30900 | DNAse I-like superfamily protein;(source:Araport11) |
| AT1G33360 | Encodes ClpX3, a subunit of the Clp protease complex. |
| AT1G20100 | DNA ligase-like protein;(source:Araport11) |
| AT5G65615 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
| AT1G18550 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT2G44000 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT4G18380 | F-box family protein;(source:Araport11) |
| AT2G03810 | 18S pre-ribosomal assembly protein gar2-like protein;(source:Araport11) |
| AT5G15340 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G25680 | SLH domain protein;(source:Araport11) |
| AT4G25280 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G25700 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G22180 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G07460 | Concanavalin A-like lectin family protein;(source:Araport11) |
| AT5G57500 | Galactosyltransferase family protein;(source:Araport11) |
| AT3G17780 | B-cell receptor-associated-like protein;(source:Araport11) |
| AT3G57890 | Tubulin binding cofactor C domain-containing protein;(source:Araport11) |
| AT5G56590 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT1G49900 | C2H2 type zinc finger transcription factor family;(source:Araport11) |
| AT1G11520 | pliceosome associated protein-like protein;(source:Araport11) |
| AT2G33350 | CCT motif family protein;(source:Araport11) |
| AT1G79160 | filamentous hemagglutinin transporter;(source:Araport11) |
| AT3G13650 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT1G76120 | Pseudouridine synthase family protein;(source:Araport11) |
| AT2G22241 | hypothetical protein;(source:Araport11) |
| AT1G44140 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G50150 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT5G09620 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT3G55790 | transmembrane protein;(source:Araport11) |
| AT5G51380 | RNI-like superfamily protein;(source:Araport11) |
| AT4G23740 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G02880 | ELKS/Rab6-interacting/CAST family protein;(source:Araport11) |
| AT4G03140 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G67792 | Natural antisense transcript overlaps with AT1G67790;(source:Araport11) |
| AT1G19970 | ER lumen protein retaining receptor family protein;(source:Araport11) |
| AT1G26930 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G22980 | molybdenum cofactor sulfurase-like protein;(source:Araport11) |
| AT1G71080 | RNA polymerase II transcription elongation factor;(source:Araport11) |
| AT4G29680 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT5G27395 | Mitochondrial inner membrane translocase complex, subunit Tim44-related protein;(source:Araport11) |
| AT2G32560 | F-box family protein;(source:Araport11) |
| AT2G18210 | hypothetical protein;(source:Araport11) |
| AT3G01810 | EEIG1/EHBP1 protein amino-terminal domain protein;(source:Araport11) |
| AT4G22850 | SNARE associated Golgi protein family;(source:Araport11) |
| AT3G56260 | hypothetical protein;(source:Araport11) |
| AT2G45315 | Natural antisense transcript overlaps with AT2G45310;(source:Araport11) |
| AT1G11970 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT3G12385 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
| AT3G50340 | hypothetical protein;(source:Araport11) |
| AT1G58110 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT2G04100 | MATE efflux family protein;(source:Araport11) |
| AT5G42825 | hypothetical protein;(source:Araport11) |
| AT4G01335 | TATA box-binding protein associated factor RNA polymerase I subunit B-like protein;(source:Araport11) |
| AT3G47250 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G02010 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G52750 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G38215 | Natural antisense transcript overlaps with AT4G38210;(source:Araport11) |
| AT3G54390 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT4G28310 | microtubule-associated protein;(source:Araport11) |
| AT2G17670 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G25920 | hypothetical protein;(source:Araport11) |
| AT4G18810 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G28053 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-06 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G60780 | hypothetical protein (DUF1442);(source:Araport11) |
| AT5G60570 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G59540 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G29735 | transmembrane protein;(source:Araport11) |
| AT2G35460 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G44690 | RING finger PFF0165c-like protein;(source:Araport11) |
| AT3G44620 | protein-tyrosine phosphatase;(source:Araport11) |
| AT5G16660 | Low-density receptor-like protein;(source:Araport11) |
| AT3G57062 | transmembrane protein;(source:Araport11) |
| AT4G33490 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G20180 | transmembrane protein (DUF677);(source:Araport11) |
| AT5G43020 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G23350 | GRAM domain protein/ABA-responsive-like protein;(source:Araport11) |
| AT1G19860 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT5G65440 | transmembrane protein;(source:Araport11) |
| AT3G19370 | filament-like protein (DUF869);(source:Araport11) |
| AT3G22750 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G10760 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G24840 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G17260 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.6e-27 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
| AT1G78280 | transferases, transferring glycosyl groups;(source:Araport11) |
| AT1G31258 | other_RNA;(source:Araport11) |
| AT5G66052 | transmembrane protein;(source:Araport11) |
| AT4G22250 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G04135 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G33303.1);(source:TAIR10) |
| AT4G13495 | other_RNA;(source:Araport11) |
| AT5G46850 | phosphatidylinositol-glycan biosynthesis class X-like protein;(source:Araport11) |
| AT1G30340 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G01430 | Got1/Sft2-like vescicle transport protein family;(source:Araport11) |
| AT5G53220 | hypothetical protein;(source:Araport11) |
| AT5G14030 | translocon-associated protein beta (TRAPB) family protein;(source:Araport11) |
| AT1G78030 | hypothetical protein;(source:Araport11) |
| AT5G52580 | RabGAP/TBC domain-containing protein;(source:Araport11) |
| AT2G18630 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT2G44770 | ELMO/CED-12 family protein;(source:Araport11) |
| AT3G01820 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G56520 | hypothetical protein;(source:Araport11) |
| AT3G56350 | Iron/manganese superoxide dismutase family protein;(source:Araport11) |
| AT5G15280 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G16810 | VEFS-Box of polycomb protein;(source:Araport11) |
| AT1G72510 | DUF1677 family protein (DUF1677);(source:Araport11) |
| AT2G27950 | Ring/U-Box superfamily protein;(source:Araport11) |
| AT4G25180 | RNA polymerase III RPC4;(source:Araport11) |
| AT4G39160 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT4G26770 | Phosphatidate cytidylyltransferase family protein;(source:Araport11) |
| AT4G14900 | FRIGIDA-like protein;(source:Araport11) |
| AT1G26761 | Arabinanase/levansucrase/invertase;(source:Araport11) |
| AT5G33390 | glycine-rich protein;(source:Araport11) |
| AT5G14020 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT3G29140 | hypothetical protein;(source:Araport11) |
| AT4G18975 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G28540 | Tail-anchored (TA) OEP membrane protein which possesses a single C-terminal transmembrane domain targeting post-translationally to plastids. |
| AT3G59670 | elongation factor;(source:Araport11) |
| AT2G40910 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G38590 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT2G31850 | hypothetical protein;(source:Araport11) |
| AT2G21185 | transmembrane protein;(source:Araport11) |
| AT5G58810 | pseudogene of Subtilase family protein;(source:Araport11) |
| AT3G11165 | hypothetical protein;(source:Araport11) |
| AT1G04560 | AWPM-19-like family protein;(source:Araport11) |
| AT3G59923 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT2G12462 | sterile alpha motif (SAM) domain protein;(source:Araport11) |
| AT1G49730 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G20691 | Natural antisense transcript overlaps with AT1G20690;(source:Araport11) |
| AT5G13845 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
| AT3G20170 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G19570 | Encodes a member of the dehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica.Encodes about 50-60% of extractable leaf GSH-dependent DHAR activity, but single knockout mutants show unaltered ascorbate and glutathione status in optimal and oxidative stress conditions (PMID:28381499). Acts redundantly with DHAR2 to oxidize glutathione in response to increased intracelullar hydrogen peroxide (catalase deficiency) . Complementation of a cat2 dhar1 dhar2 dhar3 quadruple mutant with DHAR1 fully restores cat2 phenotype and pathogenesis-related responses |
| AT1G03410 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G09570 | Lung seven transmembrane receptor family protein;(source:Araport11) |
| AT5G42090 | Lung seven transmembrane receptor family protein;(source:Araport11) |
| AT5G24810 | ABC1 family protein;(source:Araport11) |
| AT4G25570 | Encodes cytochrome b561. |
| AT5G67410 | transcriptional regulator of RNA polII, SAGA, subunit;(source:Araport11) |
| AT1G27930 | Arabinogalactan methylesterase,involved in arabinogalactan glucuronic acid methylation. Interacts with eIF3. |
| AT5G21030 | PAZ domain-containing protein / piwi domain-containing protein;(source:Araport11) |
| AT5G19140 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
| AT3G27250 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G40790 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G21170 | Encodes AKINbeta1, a subunit of the SnRK1 kinase (Sucrose non-fermenting-1-related protein kinase). Involved in regulation of nitrogen and sugar metabolism. As part of the regulatory subunit, it binds maltose which promotes kinase activity. Acts as a global regulator of genes involved in carbon, lipid and nitrogen metabolism. |
| AT3G07030 | Alba DNA/RNA-binding protein;(source:Araport11) |
| AT2G17970 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G59950 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G02530 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G66260 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT4G00370 | Encodes an inorganic phosphate transporter (PHT4;4) that can transport ascorbate and is located in the chloroplast envelope membrane. It has been shown to play a role in the xanthophyll cycle during photosynthesis and may be required for tolerance to strong light stress. |
| AT4G03070 | Encodes a possible 2-oxoglutarate-dependent dioxygenase that is involved in glucosinolate biosynthesis. The gene is expressed in all ecotypes examined but the enzymatic activity has not been determined experimentally. In Col, there is one copy of this gene (aka AOP1.1) but Ler contains two copies, AOP1.1 and a tightly linked AOP1.2. |
| AT2G30020 | Encodes AP2C1. Belongs to the clade B of the PP2C-superfamily. Acts as a MAPK phosphatase that negatively regulates MPK4 and MPK6. |
| AT4G39210 | Encodes the large subunit of ADP-Glucose Pyrophosphorylase which catalyzes the first, rate limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms (ApL1-4) have been identified. ApL3 is the major large subunit isoform present in inflorescences, fruits and roots. |
| AT2G21590 | Encodes the large subunit of ADP-glucose pyrophosphorylase, the enzyme which catalyzes the first and limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms of the large subunit (ApL1-4) have been described. |
| AT4G18020 | Encodes pseudo-response regulator 2 (APRR2) that interacts with a calcium sensor (CML9). |
| AT5G43780 | sulfate adenylyltransferase, ATP sulfurylase |
| AT2G26530 | Pheromone receptor-like protein involved in the early elicitor signaling events which occur within minutes and include ion fluxes across the plasma membrane, activation of MPKs and the formation of ROS related to PGPS1 and WRKY33. |
| AT1G52080 | actin binding protein family;(source:Araport11) |
| AT1G06400 | small GTP-binding protein (ara-2).RabGTPase functioning in anterograde trafficking from trans-Golgi network/early endosomal compartments to the plasma membrane as well as in responses to salinity stress. |
| AT5G67360 | Encodes a subtilisin-like serine protease essential for mucilage release from seed coats. |
| AT1G28670 | Arabidopsis thaliana lipase |
| AT5G43850 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT1G70490 | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
| AT4G32200 | meiotic asynaptic mutant 2, homologue of ASY1 |
| AT3G63350 | member of Heat Stress Transcription Factor (Hsf) family |
| AT4G11660 | member of Heat Stress Transcription Factor (Hsf) family |
| AT4G16640 | Matrix metalloprotease. |
| AT5G64400 | CHCH domain protein;(source:Araport11) involved in mechanotransduction. Loss of both At12cys-1 and At12cys-2 lead to enhanced tolerance to drought and light stress and increased anti-oxidant capacity. |
| AT1G59970 | Matrix metalloproteinase important for root development and root bacterial communities. Modulates auxin/ABA signaling rendering the plant sensitive to drought stress and recruiting differential root bacterial communities. |
| AT1G01720 | Belongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA. The mRNA is cell-to-cell mobile. |
| AT5G08790 | induced by wounding, belongs to a large family of putative transcriptional activators with NAC domain. |
| AT1G18080 | Encodes the Arabidopsis thaliana homolog of the tobacco WD-40 repeat ArcA gene. It is a scaffold protein that acts downstream of and is phosphorylated by WNK8 in the glucose responsiveness and flowering pathways . Knockout mutants show insensitivity to gibberellin in GA-induced seed germination. |
| AT1G20823 | Encodes a RING E3 ubiquitin ligase ATL80. Involved in phosphate mobilization and cold stress response in sufficient phosphate growth conditions. The mRNA is cell-to-cell mobile. |
| AT5G65990 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT1G17720 | type 2A protein serine/threonine phosphatase 55 kDa B |
| AT5G03470 | Encodes B' regulatory subunit of PP2A (AtB'alpha), putative size of 57 kDa.Functions redundantly with the beta subunit do maintain sister chromatid cohesion during meiosis. |
| AT4G15415 | B' regulatory subunit of PP2A (AtB'gamma) |
| AT1G60710 | Encodes ATB2. |
| AT1G30720 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G34575 | FAD-binding Berberine family protein;(source:Araport11) |
| AT2G34810 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G20820 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G20830 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). It is involved in plant immunity. Overexpressing plants are more resistant to B. cinerea. |
| AT5G44390 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44410 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G26420 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G30710 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G65780 | Encodes a chloroplast branched-chain amino acid aminotransferase, can complement the yeast leu/iso-leu/val auxotrophy mutant. Note that the AT5G65780.2 gene model (TAIR10) has been obsoleted due to the lack of experimental support. The mRNA is cell-to-cell mobile. |
| AT1G51160 | TRAPP protein BET5 homolog. |
| AT1G12240 | Encodes a vacuolar invertase betaFruct4. betaFruct4 is transported from the endoplasmic reticulum through the intermediate compartments as a membrane protein. The N-terminal cytoplasmic domain contains multiple sequence motifs that are involved at various stages in the trafficking of betaFruct4 from the ER to the central vacuole. The mRNA is cell-to-cell mobile. |
| AT3G13790 | Encodes a protein with invertase activity. |
| AT1G61660 | Encodes a transcriptional activator that regulates the expression of genes by binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT3G14000 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
| AT2G02160 | Non- tandem CCCH zinc finger protein. |
| AT3G19450 | Encodes a catalytically active cinnamyl alcohol dehydrogenase which uses p-coumaryl aldehyde as a preferred substrate. It can also use caffeyl, coniferyl and d-hydroxyconiferyl aldehydes as substrates. The mRNA is cell-to-cell mobile. |
| AT4G25780 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT4G25790 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT1G02300 | Encodes a capase involved in stress induced cell death. |
| AT1G02305 | Encodes a capase involved in stress induced cell death. |
| AT4G01610 | Encodes a capase involved in stress induced cell death. Activity detected in leaf and cell culture. |
| AT3G59440 | Encodes an endomembrane localized member of the CML subfamily VII. Contains a canonical CaM domain and unique N-terminal extension that distinguishes it from other members of the subfamily. |
| AT2G27490 | AT2G27490 encodes dephospho-CoA kinase. The molecular function was shown to phosphorylate the ribosyl moiety forming CoA. |
| AT5G56340 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G27840 | Encodes a DDB1a interacting protein ATCSA-1 required for UV-B tolerance and genomic integrity. |
| AT5G03760 | encodes a beta-mannan synthase that is required for agrobacterium-mediated plant genetic transformation involves a complex interaction between the bacterium and the host plant. 3' UTR is involved in transcriptional regulation and the gene is expressed in the elongation zone of the root. |
| AT4G13410 | encodes a gene similar to cellulose synthase |
| AT5G66940 | Encodes a nuclear localized DOF-domain binding transcription factor. |
| AT5G44050 | MATE efflux family protein;(source:Araport11) |
| AT1G79940 | J domain protein localized in ER membrane. Mutants have defective pollen germination. |
| AT4G21180 | J domain protein localized in ER membrane. |
| AT3G08970 | J domain protein localized in ER lumen. Can compensate for the growth defect in jem1 scj1 mutant yeast. Also shows similarity to HSP40 proteins and is induced by heat stress. At high temperatures, mutant alleles are not transmitted through the pollen due to defects in pollen tube growth. |
| AT3G62600 | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast. Forms a complex SDF2-ERdj3B-BiP that is required for the proper accumulation of the surface-exposed leucine-rich repeat receptor kinases EFR. EFR is involved in PAMP (pathogen associated molecular patterns) triggered immunity. |
| AT1G22810 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. Overexpression leands to delayed senescence and delayed flowering. Negatively regulates plant resistance to P. parasitica by suppressing PAMP-triggered immunity. |
| AT5G48460 | Encodes a member of the fimbrin family. Different members of the fimbrin/plastin family have diverged biochemically during evolution to generate either tight actin bundles or loose networks with distinct biochemical and biophysical properties. FIM4 generates both actin bundles and branched actin filaments whereas FIM5 only generates actin bundles. |
| AT5G55400 | Encodes a member of the fimbrin family. Different members of the fimbrin/plastin family have diverged biochemically during evolution to generate either tight actin bundles or loose networks with distinct biochemical and biophysical properties. FIM4 generates both actin bundles and branched actin filaments whereas FIM5 only generates actin bundles. |
| AT3G11730 | Encodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. It has also been identified as an isoprenylated protein. |
| AT2G05630 | in the Arabidopsis autophagy pathway |
| AT5G48400 | member of Putative ligand-gated ion channel subunit family |
| AT4G37900 | Protein of unknown function that contains DUF1399 domain and putative RNA binding motif. Expressed in many plant tissues and is involved in many aspects of plant growth and development as well as response to salt stress. |
| AT5G66030 | Involved in golgi protein trafficking. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner. Localized to the golgi apparatus, tyrosine 717 in AtGRIP is crucial for Golgi localization. |
| AT3G08030 | The mRNA of this gene is expressed in viable seeds. Its detection in a dry seed lot has potential for use as a molecular marker for germination performance as absence of expression correlates with decreased germination. Encodes DUF642 cell wall protein. |
| AT1G69780 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein which is expressed during the seed-to-seedling transition, regulates some of the network nodes, and affects late seedling establishment. Knock-out mutants for athb13 showed increased primary root length as compared with wild type (Col-0) seedlings, suggesting that this transcription factor is a negative regulator of early root growth, possibly repressing cell division and/or cell elongation or the length of time cells elongate. |
| AT4G03520 | Encodes a redox activated co-chaperone, chloroplast localized thioredoxin, similar to prokaryotic types. |
| AT1G73130 | ATG8A/F interacting protein containing a WxxL LIR motif at the C terminus which is essential for interaction with ATG8. Stress (abiotic or biotic) results in the formation of ATG8- and ATI3-labeled punctate structures, likely reflecting increased formation of ATG8-labeled phagophores or autophagosomes. ATI3 proteins probably act as selective autophagy receptors that target specific cellular components during the plant stress response. ATI3 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
| AT1G09300 | Encodes a mitochondrial protease ICP55. Alters the stability of proteins by removal of a single amino acid from their sequence. |
| AT2G31140 | Peptidase S24/S26A/S26B/S26C family protein;(source:Araport11) |
| AT4G30690 | SVR9-LIKE1 (SVR9L1) |
| AT5G05810 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G17905 | Putative RING-H2 finger protein ATL4H. |
| AT1G76410 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G53165 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G01910 | Binds microtubules. Induces a crisscross mesh of microtubules, not bundles. Not involved in microtubule polymerization nor nucleation. Localizes to mitochondria. The mRNA is cell-to-cell mobile. |
| AT1G18150 | Encodes mitogen-activated protein kinase 8 (MPK8). MPK8 connects protein phosphorylation, Ca2+, and ROS in the wound-signaling pathway. |
| AT3G05830 | Encodes alpha-helical IF (intermediate filament)-like protein.NEAP1 is a member of a small family containing coiled-coil domains, a nuclear localization signal and a C-terminal predicted transmembrane domain. It localizes to the nuclear periphery. Mutants have altered nuclear morphology and chromatin structure. |
| AT5G26770 | NEAP2 is a member of a small family containing coiled-coil domains, a nuclear localization signal and a C-terminal predicted transmembrane domain. It localizes to the nuclear periphery. Mutants have altered nuclear morphology and chromatin structure. |
| AT1G09470 | NEAP3 is a member of a small family containing coiled-coil domains, a nuclear localization signal and a C-terminal predicted transmembrane domain. It localizes to the nuclear periphery. Mutants have altered nuclear morphology and chromatin structure. |
| AT5G62720 | Integral membrane HPP family protein. Putative nitrate transporter. |
| AT4G16160 | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. Two OEP16 genes are closely related to each other and are conserved in all land plants, OEP16-2, also named OEP16-S, and OEP16-1 (renamed OEP16-L) are result of the gene duplication event that occurred prior to divergence of bryophytes and seed plants. Predominantly expressed in seed and is not inducible by cold treatment. atOEP16-S gained an additional exon. The promoter region of atOEP16-S (but not atOEP16-L) contains multiple G-box ABA-responsive elements. The atOEP16-S promoter conferred developmentally regulated seed- and pollen-specific GUS expression in tobacco. |
| AT3G62880 | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT1G01230 | ORM1 is an ER localized orosomucoid-like protein involved in sphingolipid homeostasis. |
| AT5G42000 | Interacts with serine palmitoyltransferase (SPT) to negatively regulate sphingolipid biosynthesis. |
| AT5G57345 | OXR is a single copy gene in Arabidopsis. It is localized to the ER. It is expressed throughout the plant and expression is induced in response to abiotic stress. While the function of OXR is unknown, overexpression results in increased abiotic stress tolerance and increased ascorbic acid content. |
| AT4G04640 | One of two genes (with ATPC2) encoding the gamma subunit of Arabidopsis chloroplast ATP synthase. |
| AT3G27580 | D6PK family kinase involved in pulse-induced phototropism but also for time-dependent second positive phototropism, and continuous light-induced hypocotyl phototropism.D6PKL3 is polarly localized within the plasma membrane. It is involved in pollen aperture formation. The protein is localized within distinct regions of the pollen plasma membrane and mutants are also defective in pollen aperture formation. |
| AT1G62760 | Pectin methylesterase inhibitor that controls PME activity and pectin methylesterification during Botrytis infection. |
| AT4G11570 | Encodes plastid localized protein involved in riboflavin biosynthesis. It dephosphorylates 5-amino-6-ribitylamino- 2,4(1H,3H) pyrimidinedione 5′-phosphate (ARPP) . |
| AT5G21280 | Seed plant lineage specific gene that is expressed in response to oxidative and abiotic stresses. |
| AT5G59840 | Ras-related small GTP-binding family protein;(source:Araport11) |
| AT1G19230 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
| AT4G25090 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
| AT4G39220 | Key player of retrieval of ER membrane proteins |
| AT1G32200 | Encodes a chloroplast glycerol-3-phosphate acyltransferase.Involved in the biosynthesis of chloroplast phosphatidylglycerol. |
| AT4G01810 | Sec23 homolog , forms a distinct clade with SEC23D.Mutants have defects in pollen exine patterning, tapetal development and pollen intine formation. |
| AT2G27460 | Sec23 homolog , forms a distinct clade with SEC23A.Mutants have defects in pollen exine patterning, tapetal development and pollen intine formation. |
| AT1G29060 | Encodes a golgi localized QcSNARE involved in response to salt and osmotic stress. Overexpression confers increased resistance to NaCl, mannitol and LiCl. SFT12 may act by mediating vacuolar sequestration of NaCl and other ions. |
| AT3G05840 | Glycogen synthase kinase-3 member which encodes a SHAGGY-like kinase involved in meristem organization. Regulates flowering through mediating CONSTANS stability. |
| AT2G16860 | GCIP-interacting family protein;(source:Araport11) |
| AT1G18320 | Mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein;(source:Araport11) |
| AT5G51460 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
| AT1G68020 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain and a trehalose phosphatase (TPP)-like domain. It can complement a yeast mutant lacking both of these activities suggesting that this is a bifunctional enzyme. |
| AT1G19730 | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. |
| AT2G03300 | TX12 is a Toll/Interleukin-1 receptor domain containing protein. Misexpression results in ectopic activation of defense response genes. |
| AT1G80420 | Encodes a component of plant break excision repair and functions at several stages during active DNA demethylation in Arabidopsis. |
| AT4G34720 | vacuolar H+-pumping ATPase 16 kDa proteolipid (ava-p1) |
| AT1G15690 | Encodes a H(+)-translocating (pyrophosphate-energized) inorganic pyrophosphatase (H(+)-PPase; EC 3.6.1.1) located in the vacuolar membrane. Expression is found in all tissues examined, including meristems and floral organ primordium. Expression is particularly enhanced in pollen, and is repressed by light. Over expression and loss of function phenotypes suggest AVP1 is involved in regulation of apoplastic pH and auxin transport. The effect on auxin transport likely involves effects of extracellular pH on subcellular localization of auxin efflux carriers such as PIN1. The mRNA is cell-to-cell mobile. |
| AT2G01340 | Encodes a protein whose expression is responsive to nematode infection; PADRE protein up-regulated after infection by S. sclerotiorun. |
| AT1G78690 | Encodes a lysoglycerophospholipid O-acyltransferase that acylates 1-acyl lyso PE and 1-acyl lyso PG but not PE or PG. |
| AT5G44380 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G79500 | Encodes a protein with 3-deoxy-8-phosphooctulonate synthase (KDOP synthase) activity which is involved in the biosynthesis of KDO, a component of cell wall rhamnogalacturonan II. |
| AT1G79900 | encodes a mitochondrial ornithine transporter that exports ornithine from the mitochondria to the cytosol |
| AT3G59660 | Encodes a C2-GRAM domain-containing protein that is induced by B. cinerea infection. It is required for cleavage of BAG6 and thus plays a role in mediating resistance to fungal infection. |
| AT3G06850 | dihydrolipoamide branched chain acyltransferase |
| AT4G32460 | BDX is a DUF642 cell wall protein primarily expressed in vascular tissues of roots, leaves and embryos. Mutants show defects in seed and embryo development. |
| AT5G04885 | Encodes a beta-glucosidase involved in xyloglucan metabolism. |
| AT1G66280 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT1G03040 | Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT1G22490 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT2G43140 | bHLH129 is a nuclear localized basic helix loop helix protein. It has been shown to function as a transcriptional repressor. Overexpression of bHLH129 regulates root elongation and ABA response. |
| AT2G42300 | Together with bHLH60 associates with phytochrome interacting factor 7 to regulate hypocotyl elongation. |
| AT3G57800 | Together with bHLH48 associates with phytochrome interacting factor 7 to regulate hypocotyl elongation. |
| AT5G28540 | Encodes the luminal binding protein BiP, an ER-localized member of the HSP70 family. BiP is composed of an N-terminal ATP binding domain and a C-terminal domain that binds to hydrophobic patches on improperly/incompletely folded proteins in an ATP-dependent manner. Involved in polar nuclei fusion during proliferation of endosperm nuclei. |
| AT5G42020 | Luminal binding protein (BiP2) involved in polar nuclei fusion during proliferation of endosperm nuclei. |
| AT2G39760 | Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). |
| AT3G09360 | Cyclin/Brf1-like TBP-binding protein. Double mutants with BRF1 show defects in pollen development. Controls FES1A regulated thermosensitivity. |
| AT4G37390 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. May function as a negative component in auxin signaling by regulating auxin activity. |
| AT3G12300 | Similar to Bug22p in Paramecium, a conserved centrosomal/ciliary protein. This protein is widespread in eukaryotes harboring centrioles/cilia at some stage of their life cycles. Among eukaryotes devoid of centrioles/cilia, plants possess BUG22 genes whereas some fungi (at least ascomycetes) do not. |
| AT3G10800 | Encodes bZIP28, a putative membrane-tethered transcriptional factor. Up-regulated in response to heat; a bZIP28 null mutant has a heat-sensitive phenotype. bZIP28 has a similar domain structure to the mammalian ATF6 protein involved in the unfolded protein response (UPR), and shares a bZIP domain, transmembrane domain, and a canonical S1P cleavage site. The bZIP28 seems to be glycosylated in vivo. bZIP28 does not appear to be transcriptionally up-regulated by UPR-inducing tunicamycin (TM) treatment. But, the expression level of three UPR-related genes is reduced in TM-treated zip28 mutants relative to wild type seedlings. And several UPR genes are transcriptionally upregulated when an N-terminal portion of the bZIP28 protein is expressed using the 35S promoter. A myc:bZIP28 fusion protein appears to be cleaved, likely at a canonical S2 cleavage site, following a TM treatment or a DTT stress-inducing treatment, but not a salt treatment. A portion of the mGFP:bZIP28 protein present in root cells appears to translocate from the cytoplasm and ER to the nucleus following TM treatment. It is cleaved by S2P to allow translocation to the nucleus. The mRNA is cell-to-cell mobile. |
| AT2G42380 | Encodes a member of the BZIP family of transcription factors. Forms heterodimers with the related protein AtbZIP61. Binds to G-boxes in vitro and is localized to the nucleus in onion epidermal cells. |
| AT3G58120 | Encodes a member of the BZIP family of transcription factors. Forms heterodimers with the related protein AtbZIP34. Binds to G-boxes in vitro and is localized to the nucleus in onion epidermal cells. |
| AT5G28770 | BASIC LEUCINE ZIPPER protein which regulates the circadian oscillator gene PSEUDO RESPONSE REGULATOR7 (PRR7) to change the circadian phase in response to sugars. It upregulates PRR7 in response to low energy. bZIP63 and PRR7 are required for correct oscillator phase under light/dark cycles. bZIP protein BZO2H3 mRNA, partial cds |
| AT5G19430 | Encodes a C3HC4-type RING finger E3 ubiquitin ligase of the RING/U-box superfamily whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. |
| AT3G57060 | Similar to mamalian condensin. Mutants have reduced fertility. |
| AT5G57580 | Calmodulin-binding protein;(source:Araport11) |
| AT4G25800 | Calmodulin-binding protein;(source:Araport11) |
| AT2G24300 | Calmodulin-binding protein;(source:Araport11) |
| AT5G03455 | Encodes a homolog of yeast cell cycle regulator CDC25. It has a sole catalytic domain and devoid of the N-terminal regulatory region found in the human CDC25 and is capable of reducing the mitotic cell length of transformed fission yeast. Non-plant CDC25 proteins have been shown to do this. However, the gene is more or less constant, regardless of whether the tissue examined contained proliferative cells. Also described as having arsenate reductase activity involved in arsenate resistance. |
| AT2G33510 | CFL1 is a negative regulator of cuticle development. Overexpression of CFL1 causes defects in cuticle formation. Interacts with FBH1, FBH3 and HDG1 to regulate cuticle formation. The physical interaction requires the C terminal 50 amino acids. |
| AT1G62820 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G12130 | Encodes a mitochondrial COG0354 protein that requires folate for its function in Fe/S cluster biogenesis. |
| AT1G19140 | ubiquinone biosynthesis COQ9-like protein;(source:Araport11) |
| AT4G33320 | DUF641 domain protein, probable psuedogene. |
| AT1G56190 | One of a pair of plastid localized phosphoglycerate kinases involved in galactolipid biosynthesis. Functions redundantly with AT3g12780 (PGK1) in the chloroplast in the biosynthesis of thylakoid membrane galactolipids. Double mutants are photosynthetically incompetent, plants are albino and seedling lethal. |
| AT5G18820 | Encodes a subunit of chloroplasts chaperonins that are involved in mediating the folding of newly synthesized, translocated, or stress-denatured proteins. Cpn60 subunits are: Cpn60alpha1 (At2g28000), AtCpn60alpha2 (At5g18820), AtCpn60beta1 (At1g55490), AtCpn60beta2 (At3g13470), AtCpn60beta3 (At5g56500), AtCpn60beta4 (At1g26230). |
| AT2G04030 | Encodes a chloroplast-targeted 90-kDa heat shock protein located in the stroma involved in red-light mediated deetiolation response and crucial for protein import into the chloroplast stroma. Mutants are resistant to chlorate, have elongated hypocotyls in light, and affect the expression of NR2, CAB, and RBCS but NOT NR1 and NiR. |
| AT5G24870 | Ubiquitin E3 ligase, works with WDL7 in module which regulates microtubule disassembly to mediate stomatal closure in response to drought stress and ABA treatment. MREL57 interacts with, ubiquitinates and degrades WDL7, effect is enhanced by ABA. |
| AT4G31450 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G73760 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G17970 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G46390 | C-terminal peptidase |
| AT1G59650 | Encodes CW14. |
| AT1G59620 | Encodes CW9. |
| AT3G48690 | Encodes a protein with carboxylesterase whose activity was tested using both pNA and 2,4-D-methyl. |
| AT4G19560 | Cyclin family protein;(source:Araport11) |
| AT2G40140 | zinc finger (CCCH-type) family protein;(source:Araport11) |
| AT5G54290 | Encodes CcdA, a thylakoid membrane protein required for the transfer of reducing equivalents from stroma to thylakoid lumen. |
| AT1G62500 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G29200 | Over-expressed by salt stress. |
| AT3G07090 | Interacts with C3H59 via its WD40 domain and C-terminal region, respectively, in the nucleus. |
| AT1G76880 | DF1 is a putative transcription factor required for the synthesis of seed mucilage polysaccharides. The df1 seeds produce almost 50% less mucilage than wild-type, but show less severe defects than the myb5 and ttg2 mutants. |
| AT3G02720 | Encodes a glyoxalase with high activity towards glyoxal and methylglyoxal. It differs from its animal and bacterial homologs with respect to the configuration of its catalytic residues and the oligomeric property of the enzyme. The mRNA is cell-to-cell mobile. |
| AT1G56300 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G02470 | core cell cycle genes |
| AT2G40340 | Encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT4G39520 | Encodes a member of the DRG (developmentally regulated G-protein) family. Has GTPase activity. |
| AT2G41750 | Involved in posttranscriptional modification of tRNA. Can form acp3U20b on a tRNA expressed in yeast cells. The aspartate and tryptophan residues in the DXTW motif of this protein are required for modification activity. Required for the acp3U20a modification of cytosolic tRNA. |
| AT1G47530 | MATE efflux family protein;(source:Araport11) |
| AT1G69890 | Encodes a member of a conserved DUF domain family that is induced by NO. Based on mutant phenotype may be involved in NO stress response. |
| AT3G55410 | Encodes the E1 subunit of the 2-oxoglutarate dehydrogenase. |
| AT4G26910 | Encodes the E2 subunit of the 2-oxoglutarate dehydrogenase. |
| AT5G55070 | Encodes the E2 subunit of the 2-oxoglutarate dehydrogenase. |
| AT1G31580 | Encodes cell wall protein. ECS1 is not a Xcc750 resistance gene, but the genetic data indicate that ECS1 is linked to a locus influencing resistance to Xcc750. The mRNA is cell-to-cell mobile. |
| AT1G31450 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G13880 | ELM2 domain-containing protein;(source:Araport11) |
| AT2G24290 | ubiquitin-associated protein (DUF1068);(source:Araport11) |
| AT1G07920 | GTP binding Elongation factor Tu family protein;(source:Araport11) |
| AT5G41120 | Esterase/lipase/thioesterase family protein;(source:Araport11) |
| AT5G41130 | Esterase/lipase/thioesterase family protein;(source:Araport11) |
| AT5G39960 | GTP-binding protein;(source:Araport11) |
| AT5G11480 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G58370 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G13800 | magnesium transporter NIPA (DUF803);(source:Araport11) |
| AT1G71900 | magnesium transporter, putative (DUF803);(source:Araport11) |
| AT4G32620 | Polycomb related protein that is part of a protein complex involved in histone deacetylation and heterochromatin silencing. |
| AT5G04670 | Polycomb related protein that is part of a protein complex involved in histone deacetylation and heterochromatin silencing. |
| AT5G66470 | GTP-binding protein Era-like protein;(source:Araport11) |
| AT3G05210 | encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10. |
| AT1G19210 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT5G07580 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT2G37640 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT1G60950 | encodes a major leaf ferredoxin |
| AT1G69572 | Circadian regulated lncRNA, natural antisense gene of CDF5 (AT1G69570). Displays antiphasic expression pattern in relation to CDF5 expression (PMID:28758689). |
| AT5G62980 | Encodes an enzyme that can act as a aldolase or an epimerase for 7,8-dihydroneopterin and 7,8-dihydromonapterin in vitro. It is likely to act in folate biosynthesis as a homooctamer in vivo. |
| AT3G12570 | FYD;(source:Araport11) |
| AT1G52343 | Similar to GET2, transmembrane protein that interacts with GET1. |
| AT3G51820 | Encodes a protein with chlorophyll synthase activity. This enzyme has been shown to perform the esterification of chlorophyllide (a and b), the last step of chlorophyll biosynthesis. Although it can use either geranylgeranyl pyrophosphate (GGPP) or phytyl pyrophosphate (PhyPP) as substrates, the esterification reaction was faster with GGPP than with PhyPP. |
| AT3G06580 | Encodes a protein with galactose kinase activity. The gene was shown to complement the yeast Agal1 mutant defective in the galactokinase gene GAL1. |
| AT1G27120 | Encodes a Golgi-localized hydroxyproline-O-galactosyltransferase. |
| AT5G62620 | Encodes a Golgi-localized hydroxyproline-O-galactosyltransferase. Mutants display multiple phenotypes including reduced seed coat mucilage and accelerated leaf senescence. |
| AT3G13040 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
| AT1G29670 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. The mRNA is cell-to-cell mobile. |
| AT1G17890 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G14960 | encodes a protein similar to IAA-amido synthases. Lines carrying an insertion in this gene are hypersensitive to auxin. |
| AT3G49880 | glycosyl hydrolase family protein 43;(source:Araport11) |
| AT1G11860 | T-protein is the aminomethyltransferase of the glycine cleavage multienzyme system GCS. |
| AT1G13120 | nucleoporin GLE1-like protein;(source:Araport11) |
| AT2G41540 | Encodes a protein with NAD-dependent glycerol-3-phosphate (G3P) dehydrogenase which was shown to complement an Escherichia coli strain: BB20-14, auxotrophic for glycerol/G3P due to a loss-of-function mutation in the gpsA gene. |
| AT1G76890 | encodes a plant trihelix DNA-binding protein |
| AT4G01070 | the glycosyltransferase (UGT72B1) is involved in metabolizing xenobiotica (chloroaniline and chlorophenole). Comparison between wild type and knock-out mutant demonstrates the central role of this gene for metabolizing chloroaniline but significantly less for chlorophenole. The glucosyltransferase preferred UDP-xylose over UDP-glucose indicating its (additional) functioning as a xylosyltransferase in planta |
| AT5G61840 | Encodes a UDP-Xyl:beta-(1,4)-xylosyl transferase. |
| AT1G08880 | Encodes HTA5, a histone H2A protein. H2AX is a meiosis-specific isoform of histone H2A. Upon DSB formation, rapid accumulation of phosphorylated H2AX (γ-H2AX) occurs around the break site. H2AX foci accumulate in early G2. Immunolocalization studies in spread preparations of wild-type meiocytes at G2/early leptotene revealed the accumulation of numerous rather diffuse γ-H2AX foci throughout the chromatin. However, their accumulation is not contemporaneous with that of AtSPO11-1. At 3 h post-S, no γ-H2AX foci are detected. During the 3- to 5-h window when AtSPO11-1 foci rapidly disappear, there is an equally swift accumulation of γ-H2AX to a maximum of >50 diffuse foci. The level of γH2AX then remains constant for a further 13 h before undergoing a gradual decrease to 10?20 foci in the 18- to 24-h post-S period. By 30 h the foci have disappeared from the chromatin. |
| AT1G32750 | This gene is predicted to encode a histone acetyltransferase. Five lines with RNAi constructs directed against HAF1 grow normally and can produce root calli, but have defects in agrobacterium-mediated transformation. |
| AT4G36710 | GRAS family transcription factor;(source:Araport11) |
| AT3G14130 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT3G14150 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT5G47370 | homeobox-leucine zipper genes induced by auxin, but not by other phytohormones. Plays opposite roles in the shoot and root tissues in regulating auxin-mediated morphogenesis. |
| AT2G22800 | Encodes homeobox protein HAT9. |
| AT2G27840 | Belongs to the plant specific HD2 type proteins; similar to nucleolar Zea mays histone deacetylase; HD2-p39 |
| AT1G58290 | Encodes a protein with glutamyl-tRNA reductase (GluTR) activity, catalyzing the NADPH-dependent reduction of Glu-tRNA(Glu) to glutamate 1-semialdehyde (GSA) with the release of free tRNA(Glu). It is involved in the early steps of chlorophyll biosynthesis. |
| AT1G09940 | Encodes glutamyl-tRNA reductase. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins |
| AT3G14930 | Uroporphyrinogen decarboxylase;(source:Araport11) |
| AT2G40490 | Uroporphyrinogen decarboxylase;(source:Araport11) |
| AT5G57960 | GTP-binding protein, HflX;(source:Araport11) |
| AT1G68670 | HHO2 is a HRS1 homolog. Nitrate-inducible expression. Also induced in roots by low Pi and is likely involved in maintaining phosphate homeostasis. It is target of PHR1.Both HHO2 and HRS1 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
| AT5G24580 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G25900 | Homocysteine S-methyltransferase family protein;(source:Araport11) |
| AT3G18035 | A linker histone like protein |
| AT4G36830 | ELO family protein. |
| AT5G49760 | Leucine rich receptor kinase. Encodes a receptor of extracellular reactive oxygen species. |
| AT1G54050 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT2G29500 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT1G07400 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT5G02570 | Histone superfamily protein;(source:Araport11) |
| AT3G46030 | Histone superfamily protein;(source:Araport11) |
| AT2G28720 | Histone superfamily protein;(source:Araport11) |
| AT5G59910 | Histone superfamily protein;(source:Araport11) |
| AT2G37470 | Histone superfamily protein;(source:Araport11) |
| AT3G53650 | Histone superfamily protein;(source:Araport11) |
| AT3G09480 | Histone superfamily protein;(source:Araport11) |
| AT3G45980 | Encodes a histone 2B (H2B) protein. This protein can be ubiquitinated in planta, and this modification depends on the HUB1 and HUB2 E3 ubiquitin ligases as well as the UBC1 and UBC2 E2 ubiquitin conjugating enzymes. Lysine 146 appears to be the site of the ubiquitin addition. |
| AT1G01370 | Encodes a centromere-identifying protein histone H3 variant. Localized at centromeres in both mitotic and meiotic cells. Aurora3 phosphorylates CENH3 at S65; this post-translational modification is required for the proper development of the floral meristem. |
| AT5G10390 | Histone superfamily protein;(source:Araport11) |
| AT1G75600 | Histone superfamily protein;(source:Araport11) |
| AT5G02490 | Heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
| AT2G23430 | Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. |
| AT5G58100 | Encodes a membrane protein involved in pollen nexine and sexine development. |
| AT2G47350 | HIT zinc finger and PAPA-1-like domain-containing protein;(source:Araport11) |
| AT3G06660 | PAPA-1-like family protein / zinc finger (HIT type) family protein;(source:Araport11) |
| AT4G30630 | hypothetical protein;(source:Araport11) |
| AT3G51500 | hypothetical protein;(source:Araport11) |
| AT1G15320 | seed dormancy control protein;(source:Araport11) |
| AT2G26190 | IQM4 is a plastid localized, Ca2+ independent calmodulin binding protein that is involved in promoting seed dormancy. |
| AT5G24360 | IRE1A and IRE1B catalyze bZIP60 mRNA splicing, producing the active bZIP60 transcription factor. |
| AT5G61220 | LYR family of Fe/S cluster biogenesis protein;(source:Araport11) |
| AT4G22220 | Encodes a mitochondrial protein similar to E.coli IscU. In bacteria, IscU is a scaffold protein accepting sulfur and iron to build a transient Fe-S cluster,which is subsequently transferred to a target apoprotein. |
| AT1G32130 | The C-terminal portion of this protein has high homology to the C-termini of the IWS1 (Interacts With Spt6) proteins found in yeast and humans. Interacts with transcription factor BES1. Involved in brassinosteroid-regulated gene expression. |
| AT1G70480 | Protein residing in the chloroplast outer membrane, has channel-like properties facilitating the export of the jasmonate precursor 12-oxophytodienoic acid (OPDA) from the chloroplast. |
| AT1G11950 | Transcription factor jumonji (jmjC) domain-containing protein;(source:Araport11) |
| AT1G62310 | Encodes a probable H3K9me2 demethylase. Functions in trichome morphogenesis via regulation of GL3. |
| AT3G08960 | Ran effector. |
| AT4G10920 | Transcriptional co-activator. Forms homodimers or heterodimers with the kiwi protein. Both proteins are involved in gene activation during pathogen defense and plant development. |
| AT3G12130 | KHZ1 is a CCCH zinc-finger and KH domain protein belonging to the VII subfamily. It is expressed throughout the plant. Highly similar to KHZ2. khz1 mutants are late flowering and double mutants with khz2 are even more late flowering. Overexpression leads to increased rates of leaf senescence. |
| AT5G06770 | KHZ2 is a CCCH zinc-finger and KH domain protein belonging to the VII subfamily. It is expressed throughout the plant. Highly similar to KHZ1.Double mutants with khz1 are late flowering. Overexpression leads to increased rates of leaf senescence. |
| AT3G50240 | Encodes a kinesin-related protein. |
| AT5G15960 | cold and ABA inducible protein kin1, possibly functions as an anti-freeze protein. Transcript level of this gene is induced by cold, ABA, dehydration and osmoticum (mannitol). However, protein activity of GUS fused to the promoter of this gene is inhibited by cold treatment, suggesting an inhibition of the protein by increased transcript level. |
| AT1G55460 | DNA/RNA-binding protein Kin17, conserved region;(source:Araport11) |
| AT5G15970 | Encodes a gene that can be induced by cold and abscisic acid and may be involved in cold acclimation and salt tolerance. The mRNA is cell-to-cell mobile. |
| AT3G23670 | Microtubule motor kinesin PAKRP1L/Kinesin-12B. Together with PAKRP1/Kinesin-12A, serve as linkers of the plus ends of antiparallel microtubules in the phragmoplast. |
| AT3G16630 | Kinesin-13A localized to entire Golgi stacks. Involved in trichome development. |
| AT2G34480 | Encodes a nuclear localized member of the ribosomal L18ae/LX protein family. Loss of function mutations show reduced transmission through the gametophytes and embryo lethality. |
| AT1G04970 | Encodes one of the two LBP/BPI related proteins (AT1G04970/LBR-1, AT3G20270/LBR-2) that bind to LPS directly and regulate PR1 expression. Putative BPI/LBP family protein. |
| AT1G24170 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT3G22400 | Encodes lipoxygenase5 (LOX5). LOX5 activity in roots facilitates green peach aphid colonization of Arabidopsis foliage by promoting green peach aphid feeding from sieve element and water consumption from xylem. |
| AT1G09970 | RLK7 belongs to a leucine-rich repeat class of receptor-likekinase (LRR-RLKs). It is involved in the control of germination speed and the tolerance to oxidant stress. The mRNA is cell-to-cell mobile. |
| AT2G41280 | Encodes a hydrophilic protein similar to Late Embryogenesis Activated (LEA) proteins expressed during embryogenesis, which are thought to be involved in the acquisition of desiccation tolerance. |
| AT1G18680 | HNH endonuclease domain-containing protein;(source:Araport11) |
| AT1G18160 | required for ABA- and osmotic-stress-MAP3 kinase required for activation of SnRK2 kinases, enabling robust ABA and osmotic stress signal transduction. |
| AT1G30050 | tropomyosin;(source:Araport11) |
| AT5G13240 | Global repressor of RNA polymerase III (Pol III). Maf1 repressor activity is critical for plant survival during environmental stresses, and is regulated by its phosphorylation/dephosphorylation through the activity of TOR and PP4/PP2A phosphatases. |
| AT3G62860 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G11650 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G16120 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G19290 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G18360 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G73480 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G77420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G39400 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G39420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G20680 | Encodes a mannanase belonging to clade 1 of the GH5 7 phylogenetic tree that exhibits high substrate affinity and catalytic efficiency on mannan substrates with main chains containing both glucose and mannose units such as konjac glucomannan and spruce galactoglucomannan. It is likely a glycoprotein. |
| AT1G03090 | MCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion. |
| AT4G36820 | Mitochondrial calcium channel. |
| AT5G03630 | Pyridine nucleotide-disulfide oxidoreductase family protein;(source:Araport11) |
| AT4G13020 | Encodes a member of the cdc2+ family of protein kinases MHK. Similar to the mak genes of rats. mak encodes a protein kinase that may play a role in spermatogenesis. |
| AT1G74440 | Similar to MPH1, can complement mph1-1 salt sensitivity phenotype. |
| AT1G18720 | Contains DUF962 domain. Localizes to ER and cam complement yeast Mpo1 dioxygenase function. Interacts with ABI1. May be involved in ER stress response. |
| AT4G32060 | Encodes an EF-hand protein with homology to constituents of the mitochondrial Ca2+ uniporter machinery in mammals. MICU binds Ca2+ and localizes to the mitochondria in Arabidopsis. It is a negative regulator of mitochondrial calcium uptake. Mutants display elevated matrix calcium at steady state and modified calcium transient kinetics in vivo. |
| AT4G01883 | Polyketide cyclase / dehydrase and lipid transport protein;(source:Araport11) |
| AT1G78830 | In combination with MYB4, MAN3, and Mannose part of signaling cascade which regulates cadmium tolerance. Mannose is able to bind to the GNA-related domain of MNB1; mannose binding to the GNA-related domain of MNB1 is required for MAN3-mediated Cd tolerance. |
| AT4G19045 | Member of a conserved family of proteins. Functions redundantly with MOB1A to regulate cell proliferation and JA metabolism. |
| AT5G26340 | Encodes a protein with high affinity, hexose-specific/H+ symporter activity. The activity of the transporter appears to be negatively regulated by phosphorylation. Importantly, microarray analysis, as well as the study of the expression of this gene in mutants involved in programmed cell death (PCD) demonstrated a tight correlation between this gene's expression and PCD. |
| AT2G34620 | Mitochondrial transcription termination factor family member. |
| AT1G79220 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT5G06810 | transcription termination factor family protein;(source:Araport11) |
| AT5G23930 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT5G55580 | Encodes a mitochondrial transcription termination factor (mTERF) family protein. The gene product is targeted to the chloroplast nucleoid and mutants are affected in plastid gene expression and chloroplast development. Mutants, named as twirt1 (twr-1), display altered root meristem function resulting in short roots. Mutation also affects shoot meristem function. |
| AT2G39450 | Encodes a Golgi-localized manganese transporter that is involved in Mn tolerance. When expressed into yeast cells, this gene confer Mn2+ and Cu2+ tolerance. |
| AT3G58060 | TP8 is a tonoplast localized member of CDF family of cation transporters. It functions in roots as an Mn transporter.MTP8 transports manganese into root vacuoles of iron-deficient plants and thereby prevents inhibition of iron deficiency-induced ferric chelate reductase by manganese. In seed embryos, MTP8 is responsible for manganese and iron enrichment in the subepidermal cell layer (particularly in vit1 mutant background.) |
| AT5G05100 | R3H RNA binding protein that interacts with AGO2 and miRNA. |
| AT1G63680 | Encodes AtMurE, a homolog of the bacterial MurE that catalyze the ATP-dependent formation of UDP-N-acetylmuramic acid-tripeptide in bacterial peptidoglycan biosynthesis. Localized to plastids. AtMurE is involved in chloroplast biogenesis. |
| AT2G40970 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G70000 | Encodes a MYB-like Domain transcription factor that plays a positive role in anthocyanin accumulation in response to light and cytokinin via repression of MYBL2.MYBD expression increased in response to light or cytokinin, and MYBD enhanced anthocyanin biosynthesis via the repression of MYBL2 encoding for a transcription factor that had a negative effect on this process. In addition, MYBD can bind in vivo to the MYBL2 promoter and a lower level of histone H3K9 acetylation (H3K9ac) at upstream region of MYBL2 in MYBD-OX in comparison to wild-type plants, implies that MYBD represses MYBL2 expression via an epigenetic mechanism. |
| AT5G08520 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT1G32640 | Encodes a MYC-related transcriptional activator with a typical DNA binding domain of a basic helix-loop-helix leucine zipper motif. Binds to an extended G-Box promoter motif and interacts with Jasmonate ZIM-domain proteins. MYC2 interacts with EIN3 and EIL1 to repress hook curvature and resistance to Botrytis cinera.Its transcription is induced by dehydration stress, ABA treatment and blue light via CRY1. Negative regulator of blue light-mediated photomorphogenic growth and blue and far-red-light-regulated gene expression. Positive regulator of lateral root formation. Regulates diverse JA-dependent functions. Negatively regulates Trp metabolism and biosynthesis of Trp-derived secondary metabolites. Positively regulates flavonoid biosynthesis, resistance to insects, and response to oxidative stress. Regulates other transcription factors, and negatively regulates its own expression. For example it binds to and regulates the expression of NST1. Its stability is modulated by PUB10 through polyubiquitination. |
| AT5G46760 | MYC3 is a JAZ-interacting transcription factor that act together with MYC2 and MYC4 to activate JA-responses. The mRNA is cell-to-cell mobile. |
| AT5G57830 | zein-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT4G13630 | zein-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT3G11850 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT2G22770 | Regulates the development of ER bodies. also involves in response to the endophytic fungus Piriformospora indica. |
| AT3G15950 | Similar to TSK-associating protein 1 (TSA1), contains 10 EFE repeats, a novel repeat sequence unique to plants. Expressed preferentially in the roots.Protein is localized to ER bodies- an endoplasmic reticulum derived structure. Loss of function mutations lack ER bodies. |
| AT5G02290 | Encodes a candidate protein kinase NAK that is similar to the oncogenes met and abl. |
| AT5G04370 | A member of the Arabidopsis SABATH methyltransferase gene family. Encodes NAMT1, a methyltransferase that methylates nicotinic acid to yield methyl nicotinate. |
| AT3G54630 | kinetochore protein;(source:Araport11) |
| AT2G04039 | NdhV is loosely associated with the NDH complex and is required for stabilizing NDH subcomplexes A and E. |
| AT5G02130 | SSR1 encodes a tetratricopeptide repeat- containing protein localized in mitochondria. It is involved in root development, possibly by through effects on auxin transport. In ssr1 mutants, the expression PIN genes and trafficking of PIN2 is altered which in turn affects distribution of auxin in the roots. |
| AT3G54200 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT2G41930 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G73600 | Encodes a S-adenosyl-L-methionine-dependent phosphoethanolamine N-methyltransferase whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in roots. It catalyzes the three sequential P-base methylation of phosphoethanolamine to phosphocholine. Homologous biochemical function to NMT1 (At3g18000). Double mutants of NMT1 and NMT3 are defective in leaf, root, flower, seed, and pollen development. |
| AT5G55850 | NOI protein |
| AT4G26600 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G18230 | transcription regulator NOT2/NOT3/NOT5 family protein;(source:Araport11) |
| AT2G28540 | RNA binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G32550 | Cell differentiation, Rcd1-like protein;(source:Araport11) |
| AT1G22540 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G72130 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
| AT1G72140 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
| AT1G22550 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
| AT5G47800 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT1G67900 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT1G49670 | molecular function has not been defined. Was shown involved in oxidative stress tolerance. |
| AT3G52090 | Non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB11 and the E. oli RNA polymerase alpha subunit. |
| AT4G16265 | One of two highly similar, non-catalytic subunits common to nuclear DNA-directed RNA polymerases II, IV and V; homologous to budding yeast RPB9. Appears to be redundant with At3g16980 |
| AT4G17300 | Asparaginyl-tRNA synthetase protein involved in amino acid activation/protein synthesis. |
| AT1G51130 | δ-kleisin component of the SMC5/6 complex, possibly involved in synaptonemal complex formation. |
| AT1G05500 | Encodes a endomembrane-localized synaptotagmin. Synaptotagmin family proteins are calcium sensors that regulate exocytosis in mammalian cells. |
| AT3G19830 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G14590 | Ca2+-dependent lipid-binding protein |
| AT3G56320 | PAP/OAS1 substrate-binding domain superfamily;(source:Araport11) |
| AT3G61690 | Putative TNAase |
| AT3G10650 | Encodes a nucleoporin involved in mRNA export from the nucleus. It is also involved in the regulation of nuclear morphology. |
| AT1G07615 | GTP-binding protein Obg/CgtA;(source:Araport11) |
| AT2G42210 | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT1G76405 | outer envelope pore 21B-like protein;(source:Araport11) |
| AT3G57990 | Encodes a ?-barrel protein, named OEP40, locates in in the outer envelope of chloroplasts, and functions as a solute channel which is selectively permeable for glucose. |
| AT5G51740 | Mitochondrial ATP-independent protease .Important for maintenance of proper function of the oxphos system. |
| AT1G74930 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. The mRNA is cell-to-cell mobile. |
| AT1G11960 | Calcium channel that is phosphorylated by BIK1 in the presence of PAMPS and required for stomatal immunity. |
| AT4G35870 | early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT5G40660 | Encodes an F-type ATP Synthase Assembly factor that binds to beta subunits of mitochondrial ATPase. |
| AT5G16680 | PHD protein which cooperates with AIPP2 and BAH domain protein AIPP3 to read H3K4 histone marks. The BAH-PHD bivalent histone reader complex silences a substantial subset of H3K27me3-enriched loci, including development and stress response-related genes. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
| AT2G35795 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT3G52780 | Purple acid phosphatases superfamily protein;(source:Araport11) |
| AT1G30690 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G51670 | PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells. |
| AT4G31300 | Encodes 20S proteasome subunit PBA1 (PBA1). PBA1 acts as a plant caspase-3-like enzyme. |
| AT5G14710 | proteasome assembly chaperone-like protein;(source:Araport11) |
| AT3G27430 | Encodes 20S proteasome beta subunit PBB1 (PBB1). |
| AT5G35580 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G76360 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G24710 | Encodes an AAA+ ATPase that mediates meiotic chromosome remodeling and crossover maturation. |
| AT1G77600 | One of 5 PO76/PDS5 cohesion cofactor orthologs of Arabidopsis. |
| AT5G07500 | Encodes an embryo-specific zinc finger transcription factor required for heart-stage embryo formation. |
| AT4G22890 | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I). The mRNA is cell-to-cell mobile. |
| AT5G12150 | Encodes a protein with similarity to REN1, a Rho GTPase activating protein.It is cytoplasmic and plasma membrane associated in interphase, but during mitosis localizes to the CDZ/CDS in a POK-dependent manner. |
| AT5G19390 | Encodes a protein with similarity to REN1, a Rho GTPase activating protein.It is cytoplasmic and plasma membrane associated in interphase, but during mitosis localizes to the CDZ/CDS in a POK-dependent manner. |
| AT4G40080 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT5G10410 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT2G01600 | ANTH domain-containing protein which functions as adaptor protein for clathrin-mediated endocytosis (CME) of the secretory vesicle-associated longintype R-SNARE VAMP72 group. Interacts with the SNARE domain of VAMP72 and clathrin at the plasma membrane. Required for recycling of R-SNARE proteins. |
| AT1G14910 | ANTH domain-containing protein which functions as adaptor protein for clathrin-mediated endocytosis (CME) of the secretory vesicle-associated longintype R-SNARE VAMP72 group. Interacts with the SNARE domain of VAMP72 and clathrin at the plasma membrane. Required for recycling of R-SNARE proteins. |
| AT2G25430 | AP180 N-terminal homology domain, TPLATE complex protein involved in clathrin-mediated endocytosis. |
| AT2G01920 | ENTH/VHS/GAT family protein;(source:Araport11) |
| AT1G10900 | Phosphatidylinositol-4-phosphate 5-kinase family protein;(source:Araport11) |
| AT1G01460 | Type I phosphatidylinositol-4-phosphate 5-kinase, subfamily A. |
| AT2G06925 | Encodes a secretory phospholipase A2 enzyme, which specifically hydrolyzes the sn-2 position of phospholipids. The enzyme has a preference towards linoleoyl acyl chain over palmitoyl acyl chain. It also has a slight preference for phosphatidylcholine over phosphatidylethanolamine. |
| AT1G21000 | PLATZ transcription factor family protein;(source:Araport11) |
| AT3G60670 | PLATZ transcription factor family protein;(source:Araport11) |
| AT4G17900 | PLATZ transcription factor family protein;(source:Araport11) |
| AT1G76590 | PLATZ transcription factor family protein;(source:Araport11) |
| AT5G47400 | sphingomyelin phosphodiesterase;(source:Araport11) |
| AT5G11560 | catalytics;(source:Araport11) |
| AT1G33612 | Encodes a receptor for the Plant Natriuretic Peptide (At2g18660, AtPNP-A). The receptor contains a functional guanylyl cyclase catalytic center embedded in the cytosolic kinase domain. This catalytic center can convert GTP into cGMP (and PPi) which enables ligand-specific downstream signalling. It is therefore consistent with the reported cGMP dependence of AtPNP-A effects (see DOI:10.1007/s11103-016-0465-8). |
| AT1G78650 | Similar to DNA polymerase delta (POLD3), which in other organism was shown to be involved in the elongation of DNA replication. |
| AT4G01690 | Encodes protoporphyrinogen oxidase (PPOX). |
| AT1G55190 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
| AT3G13720 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
| AT1G77800 | PHD finger family protein;(source:Araport11) |
| AT5G52800 | primase/polymerase protein |
| AT4G31250 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G72460 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G44570 | Encodes a PPR protein involved in mitochondrial functioning. Mutants suppress cell wall defects caused by C17 chemical inhibitor. Mutants are defective in cytochrome c maturation and activation of mitochondrial retrograde signalling. |
| AT5G44572 | transmembrane protein;(source:Araport11) |
| AT5G44574 | transmembrane protein;(source:Araport11) |
| AT2G40650 | PRP38 family protein;(source:Araport11) |
| AT5G46400 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G39580 | Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
| AT5G64040 | Encodes the only subunit of photosystem I located entirely in the thylakoid lumen. May be involved in the interaction between plastocyanin and the photosystem I complex. Phosphorylation of this protein is dependent on calcium. |
| AT1G03600 | PSB27 is a chloroplast lumen localized protein that is involved in adaptation to changes in light intensity. |
| AT5G01830 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G67340 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G37490 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G09800 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G65920 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT2G45910 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT4G36550 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G61560 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G01660 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G01670 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G56030 | RING/U-box protein;(source:Araport11) |
| AT1G56040 | HEAT/U-box protein;(source:Araport11) |
| AT1G24330 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT2G40640 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT3G05230 | Signal peptidase subunit;(source:Araport11) |
| AT3G09260 | Encodes beta-glucosidase.The major constituent of ER bodies. One of the most abundant proteins in Arabidopsis seedlings. Exist in an soluble (inactive) and non-soluble (active) form, most probably formed in a polymerization process. Involved in the mutualistic interaction between Arabidopsis and the endophytic fungus Piriformospora indica. |
| AT2G44610 | Golgi-localized small GTPase, participates in the trafficking of CESA6 to the plasma membrane, maintaining Golgi organization and morphology, possible role in exocytosis. Plays and important role in hypocotyl growth by influencing cell elongation/growth and deposition of cellulose microfibrils in the cell wall. Plays an important role in cellulose synthesis. Influences both the distribution and velocity of cellulose synthase complexes in the plasma membrane. Encodes a GTP-binding protein with similarity to yeast YPT6 . RAB6 can complement the yeast YTP mutant. |
| AT5G16630 | DNA repair protein Rad4 family;(source:Araport11) |
| AT2G31970 | Encodes the Arabidopsis RAD50 homologue. It is involved in double strand break repair. Component of the meiotic recombination complex that processes meiotic double-strand-breaks to produce single-stranded DNA ends, which act in the homology search and recombination. Accumulates in the nucleus during meiotic prophase, a process regulated by PHS1. |
| AT2G28560 | Encodes a protein of the RAD51B family involved in double stranded DNA repair. Homozygous mutant plants show increased sensitivity to mitomycin which induces DS breaks. |
| AT1G70200 | Encodes a RNA-Binding Protein RBD1. Promotes chilling tolerance through 23S rRNA processing. |
| AT4G11230 | NADPH-oxidase RbohI is expressed highly in seeds and roots. Mutants have inreased sensitivity to osmotic stress suggesting a role in mediating cellular response to stress in roots. |
| AT1G11650 | Encodes an RNA binding protein with three RNA recognition motifs. The mRNA is cell-to-cell mobile. |
| AT1G10930 | DNA helicase involved in the maintenance of genome stability by modulation of the DNA damage response and suppression of homologous recombination. |
| AT3G06160 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G41170 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT4G26540 | Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11) |
| AT4G19700 | Encodes BOI (Botrytis Susceptible 1 Interactor). Has E3 ubiquitin ligase activity. Interacts with and ubiquitinates BOS1 (Botrytis Susceptible 1). It prevents caspase activation and attenuates cell death. |
| AT5G10380 | Encodes a RING finger domain protein with E3 ligase activity that is localized to the lipid rafts of the plasma membrane. Expression is increased in response to fungal pathogen. May be involved in regulation of programmed cell death by facilitating degredation of regulation of PDC activators. The mRNA is cell-to-cell mobile. |
| AT5G08050 | Encodes a grana core localized protein. Mutant plants have reduced NPQ, affected organization of light-havesting complex II and an enhanced grana stacking. |
| AT1G74730 | Encodes a grana core localized protein, is homologous to RIG1. Mutant plants have reduced NPQ, affected organization of light-havesting complex II and an enhanced grana stacking. |
| AT1G08390 | Involved in preserving the stability of 45S rDNA repeats. |
| AT1G71980 | RMR2 is a secretory pathway protein localized to the trans-golgi network. It belongs to a family of vacuolar sorting receptors. If forms heterodimers with RMR1. |
| AT1G55140 | Encodes one of two chloroplast Mini-RNase III-like enzymes in Arabidopsis. Double mutants display imprecise maturation of 23S rRNA and other rRNAs. |
| AT3G13740 | Encodes one of two chloroplast Mini-RNase III-like enzymes in Arabidopsis. Double mutants display imprecise maturation of 23S rRNA and other rRNAs. |
| AT1G24090 | RNase H family protein;(source:Araport11) |
| AT1G74450 | Plants overexpressing At1g74450 are stunted in height and have reduced male fertility. |
| AT5G18600 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT4G33040 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
| AT5G45400 | Replication factor-A protein 1-like protein;(source:Araport11) |
| AT5G61000 | Replication factor-A protein 1-like protein;(source:Araport11) |
| AT4G29390 | Ribosomal protein S30 family protein;(source:Araport11) |
| AT3G61620 | exonuclease RRP41 (RRP41) |
| AT5G22070 | Putative glycosyltransferase that negatively regulates leaf senescence in a SID2 dependent manner. |
| AT2G28620 | Mutants have radially swollen roots but do not exhibit defects in abundance or orientation of cortical microtubules, nor are microfibrils reduced. Cellulose synthesis is also unchanged with respect to wild type. There is a disruption in the normal pattern of cell wall placement. |
| AT1G58520 | GDSL-like lipase/acylhydrolase superfamily protein;(source:Araport11) |
| AT4G35740 | Encodes RECQ3, an ATP-dependent helicase. |
| AT5G09460 | transcription factor bHLH143;(source:Araport11) |
| AT4G08685 | Encodes a protein, expressed in leaves, with similarity to pollen allergens. The mRNA is cell-to-cell mobile. |
| AT5G63980 | Encodes a bifunctional protein that has 3'(2'),5'-bisphosphate nucleotidase and inositol polyphosphate 1-phosphatase activities and rescues sulfur assimilation mutants in yeast. It is involved in the response to cold, drought (negative regulator of drought tolerance), and ABA. Mutants in this gene exhibit enhanced induction of stress genes in response to cold, ABA, salt and dehydration and increased levels of 3'-phosphoadenosine 5'-phosphate (PAP). Involved in degradation of small mRNAs. Mutants also affect the accumulation of miRNA target cleavage products. Regulates light-dependent repression of hypocotyl elongation and flowering time via its 3'(2'),5'-bisphosphate nucleotidase activity. Its activity is sensitive to the redox state of its environment, decreasing under oxidative conditions and is regulated by dimerization and intra and inter-molecular disulfide bond formation. |
| AT2G47820 | arginine-glutamic acid dipeptide repeat protein;(source:Araport11) |
| AT5G51340 | SCC4 is a tetratricopeptide repeat containing protein and a likely component of a plant cohesion loading complex along with its partner SSC2 It is expressed primarily in dividing cells. Loss of function mutants are embryo lethal, arresting by globular stage. |
| AT4G12120 | member of KEULE Gene Family |
| AT1G18830 | Together with SEC31B a component of the coat protein complex II (COPII) which promotes the formation of transport vesicles from the endoplasmic reticulum (ER). |
| AT3G63460 | Together with SEC31A a component of the coat protein complex II (COPII) which promotes the formation of transport vesicles from the endoplasmic reticulum (ER). |
| AT1G71820 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
| AT3G48900 | Encodes one of two GEN1 homologs in Arabidopsis. It is a member of the class IV Rad2/XPG family of nucleases that processes Holliday junctions in a manner analogous to the HJ resolvases of phages, archaea, and bacteria. |
| AT2G34980 | Encodes a putative phosphatidylinositol-glycan synthase subunit C gene. It is involved in the first step of the glycosylphosphatidylinositol (GPI) biosynthetic pathway. |
| AT3G23325 | Splicing factor 3B subunit 5/RDS3 complex subunit 10;(source:Araport11) |
| AT4G14342 | Splicing factor 3B subunit 5/RDS3 complex subunit 10;(source:Araport11) |
| AT5G27350 | Encodes a sugar-porter family protein that is induced during leaf senescence. The increase in its gene expression during leaf senescence is paralleled by an accumulation of monosaccharides. The mRNA is cell-to-cell mobile. |
| AT5G58575 | Component of the deubiquitination module of the SAGA complex. |
| AT5G54840 | Monomeric G protein. Expressed in the root quiescent center, flowers, and leaf guard cells and hydathodes. |
| AT3G21700 | Monomeric G protein. Expressed in root epidermal cells that are destined to become atrichoblasts. Also expressed during pollen development and in the pollen tube tip. |
| AT1G78880 | Plasma membrane-localized proteins that negatively regulate cellulose synthesis by inhibiting the exocytosis of CESAs. |
| AT1G69220 | Encodes serine/threonine kinase 1 (SIK1), a Hippo homolog. Regulates cell proliferation and cell expansion. |
| AT3G61790 | SINAT E3 ubiquitin ligase involved in mediation of FREE1 and VPS23A degradation to modulate abscisic acid signaling. |
| AT1G54385 | At1G54385 encodes the plant KASH protein SINE1; SINE1 interacts with SUN1 and SUN2, is colocalized with F-actin, and is localized at the nuclear envelope. |
| AT4G24950 | Encodes the plant KASH protein SINE4; SINE4 interacts with SUN1 and SUN2 and is localized at the nuclear envelope. |
| AT5G18290 | Belongs to a family of plant aquaporins.Similar to yeast and radish aquaporins. Located on ER |
| AT1G07140 | Encodes a putative Ran-binding protein (siRanBP). |
| AT1G76630 | SKI3 encodes a cytplasmically localized component of the SKI complex which is involved in exosome mediated RNA decay. |
| AT1G21410 | AtSKP2;1 is a homolog of human SKP2, the human F-box protein that recruits E2F1. Contains an F-box motif at the N-terminal region and a C-terminal Leu-rich repeat domain. Forms part of an E3-ubiquitin-ligase SCF (Skp1, cullin, F-box) complex and recruits phosphorylated AtE2Fc, a transcriptional factor that might play a role in cell division and during the transition from skotomorphogenesis to photomorphogenesis. AtSKP2;1 (At1g21410) and AtSKP2;2 (At1g77000) may be duplicated genes. |
| AT1G77000 | AtSKP2;2 is a homolog of human SKP2, the human F-box protein that recruits E2F1. Contains an F-box motif at the N-terminal region and a C-terminal Leu-rich repeat domain. Forms part of an E3-ubiquitin-ligase SCF (Skp1, cullin, F-box) complex and recruits phosphorylated AtE2Fc, a transcriptional factor that might play a role in cell division and during the transition from skotomorphogenesis to photomorphogenesis. AtSKP2;1 (At1g21410) and AtSKP2;2 (At1g77000) may be duplicated genes. AtSKP2b may also be involved in the degradation of KRP1/ICK1, a CDK inhibitor. |
| AT4G12420 | Encodes a protein of unknown function involved in directed root tip growth. It is a member of 19-member gene family and is distantly related structurally to the multiple-copper oxidases ascorbate oxidase and laccase, though it lacks the copper-binding domains. The protein is glycosylated and GPI-anchored. It is localized to the plasma membrane and the cell wall. The gene is expressed most strongly in expanding tissues. |
| AT3G07590 | SmD1a is one of two Yeast SmD1 orthologs, lower levels than SmD1b.It is localized to the nucleus and may play a minor role in RNA splicing and indirectly facilitating PTGS. |
| AT2G37610 | hypothetical protein;(source:Araport11) |
| AT5G02420 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
| AT4G29160 | SNF7 family protein;(source:Araport11) |
| AT2G19830 | SNF7 family protein;(source:Araport11) |
| AT1G14200 | E3 ligase involved in the regulation of the homeostasis of sensor NLR immune receptors. |
| AT2G37970 | Encodes a cytosolic heme binding protein(cHBP)that can reversibly bind tetrapyrroles including heme, protoporphyrin IX and Mg-protoporphyrin IX dimethyl ester with distinct binding affinities. |
| AT2G47090 | zinc ion binding/nucleic acid binding protein;(source:Araport11) |
| AT3G62240 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G17520 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT5G44568 | Secreted peptide which functions in plant growth and pathogen defense. |
| AT1G07130 | Encodes a protein with similarity to yeast STN1, an OB fold protein involved in protecting yeast telomeres. In Arabidopsis, loss of STN1 function mutations exhibit gross morphological abnormalities and defects in telomere architecture and maintenance. STN1 likely plays a role in telomere end capping. |
| AT1G71890 | Encodes a sucrose transporter that is expressed in the endosperm. Mutants have delayed accumulation of fatty acids and embryo maturation. |
| AT5G65300 | Gene of unknown function. Expression is induced by a variety of biotic (P. syringae) and abiotic stresses (salt, ABA,IAA, and more.)Member of a small family that includes AT1G35210, AT1G72240, and AT1G22470.Mutants have no obvious loss of function phenotype but overexpressors are early flowering. |
| AT3G04380 | Encodes SUVR4, a nucleolar histone methyltransferase with preference for monomethylated H3K9. One of the four closely related Arabidopsis SUVR proteins that belong to the SU(VAR)3-9 subgroup of SET-domain proteins. Proteins containing the evolutionarily conserved SET domain are involved in regulation of eukaryotic gene expression and chromatin structure through their histone lysine methyltransferase (HMTase) activity. SUVR1, SUVR2 and SUVR4 proteins contain a novel domain at their N-terminus, and a SUVR specific region preceding the SET domain. |
| AT1G09310 | ABA responsive trichome formation regulator. |
| AT4G25010 | Encodes a member of the SWEET sucrose efflux transporter family proteins. Together with SWEET13, it is likely involved in modulating the GA response and is required for proper development of anthers, seeds and seedlings. |
| AT3G16690 | Nodulin MtN3 family protein;(source:Araport11) |
| AT4G15920 | Encodes a vacuolar fructose transporter expressed in parenchyma and xylem that controls leaf fructose content. When its expression is reduced, fructose accumulates in leaves. |
| AT3G14770 | Nodulin MtN3 family protein;(source:Araport11) |
| AT3G48600 | SWIB complex BAF60b domain-containing protein;(source:Araport11) |
| AT2G14880 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
| AT2G35605 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
| AT5G40840 | Cohesion family protein SYN2 (SYN2). Plays a role in somatic DNA double strand break damage repair. |
| AT1G20080 | Encodes a synaptotagmin localized on the Golgi apparatus and that regulates protein secretion via the unconventional protein transport from the cytosol to the extracellular matrix in plant cells. |
| AT5G04220 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT5G11100 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT1G29310 | SecY protein transport family protein;(source:Araport11) |
| AT5G15570 | Bromodomain transcription factor;(source:Araport11) |
| AT5G65540 | transcription initiation factor TFIID subunit;(source:Araport11) |
| AT3G19100 | Encodes a protein kinase that positively regulates gibberellic acid (GA) signaling by inactivating the E3 ubiquitin ligase GARU. GARU mediates ubiquitin-dependent degradation of GID1s, which are GA receptors. |
| AT4G29000 | Tesmin/TSO1-like CXC domain-containing protein which is a transcriptional repressor of genes required for maintenance of DNA methylation, including MET1, CMT3, DDM1, KYP and VIMs. Functions redundantly with its paralogue TCX6 in repressing the expression of these genes. |
| AT3G16160 | TCX8 is a transcriptional regulatory protein. It binds the LOX2 promoter and represses its expression. |
| AT4G23050 | PAS domain-containing protein tyrosine kinase family protein;(source:Araport11) |
| AT5G54770 | Encodes a thiamine biosynthetic gene that has a dual function in thiamine biosynthesis and mitochondrial DNA damage tolerance. It appears to be involved in producing the thiazole portion of thiamine (vitamin B1). A crystal structure of the protein reveals that it forms a 2-ring homo-octamer. The mRNA is cell-to-cell mobile. |
| AT5G09860 | Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. One of the pathways affected by THO1 is the miRNA399-PHO2 pathway that regulates root APase activity. |
| AT1G74950 | Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators. |
| AT1G70700 | JAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. The mRNA is cell-to-cell mobile. |
| AT5G25100 | Endomembrane protein 70 protein family;(source:Araport11) |
| AT1G72840 | NBS TIR LRR protein. It is induced in response to bacterial pathogens and overexpression results in cell death in leaves. |
| AT5G27840 | Encodes a Type One Protein Phosphatase that acts as a nucleocytoplasmic negative regulator of tip growth. Mutants affect pollen germination, pollen tube growth, and root hair growth. It acts genetically downstream of ANX1 (AT3G04690) and ANX2 (AT5G28680) and is functionally redundant with ATUNIS1/TOPP9 (AT3G05580). |
| AT1G02510 | Encodes AtTPK4, a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK4 is targeted to the plasma membrane. In contrast other members of the AtTPK proteins are located in tonoplast. AtTPK4 forms a voltage-independent K+ channel that is blocked by extracellular calcium ions. May form homomeric ion channels in vivo. |
| AT3G01780 | Encodes TPLATE, a cytokinesis protein targeted to the cell plate. Functions in vesicle-trafficking events required for site-specific cell wall modifications during pollen germination and for anchoring of the cell plate to the mother wall at the correct cortical position. |
| AT5G15510 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
| AT5G54750 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
| AT5G02280 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
| AT1G78010 | tRNA modification GTPase;(source:Araport11) |
| AT1G30660 | A truncated version of Twinkle that retains only the DNA primase domain. |
| AT1G14205 | Member of the uL18 RNA-binding protein family. uL18 proteins share a short structurally conserved domain that binds the 5S rRNA and allow its incorporation into ribosomes. Essential for the splicing of the first intron of rps12 in plastid. |
| AT5G42820 | U2 auxiliary factor small subunit. The atU2AF35b protein and its homolog, atU2AF35a, contain most of the conserved domains of hsU2AF35, including the psiRRM, one RS domain, two zinc fingers, and the two regions for interacting with U2AF large subunit. Both proteins lack the stretch of glycines present in human U2AF35. The sequences are overall 83% identical, and each Arabidopsis homolog shows approximately 70% similarity to hsU2AF35. U2AF(35) homologs were also identified from maize, rice and other plants with large-scale EST projects. Both genes are expressed in all major tissues, with atU2AF(35)a expressed at a higher level than atU2AF(35)b in most tissues. The expression patterns were different in roots: atU2AF(35)b expressed strongly in whole young roots and root tips and atU2AF(35)a limited to root vascular regions. |
| AT2G41160 | ATI3A interacting protein containing a large N-terminal rhomboid-like transmembrane domain and a UBA domain at their C terminus, localized in the ER with a role in plant heat tolerance. UBAC2 proteins may act as both cargo receptors and inducers of an ATI3-mediated selective autophagy pathway, where ATI3 and UBAC2 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
| AT4G02890 | Polyubiquitin gene containing 4 ubiquitin repeats. |
| AT5G66690 | UGT72E2 is an UDPG:coniferyl alcohol glucosyltransferase which glucosylates sinapyl- and coniferyl aldehydes as well as sinapyl- and coniferyl alcohol. The enzyme is thought to be involved in lignin metabolism. A knockdown mutant line (72E2KD) was obtained using RNAi silencing. A twofold reduction in coniferyl alcohol 4-O-glucoside and sinapyl alcohol 4-O-glucoside was detected in this line compared to wildtype. In comparison, both knockout and knockdown lines of UGT72E1 and UGT72E3, respectively, failed to display the same reduction in phenylpropanoid 4-O-glucosides. The mRNA is cell-to-cell mobile. |
| AT4G27560 | Encodes a UDP-glycosyltransferase that contributes to cold, salt and drought stress tolerance via modulating anthocyanin accumulation. |
| AT4G15480 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
| AT4G15490 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
| AT1G22400 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G06000 | encodes a flavonol-7-O-rhamnosyltransferase involved in the formation of rhamnosylated flavonols |
| AT2G39260 | Nonsense mediated decay (NMD)factor. |
| AT3G61800 | ENTH/VHS protein;(source:Araport11) |
| AT4G24060 | Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis. |
| AT3G58730 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
| AT4G02620 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
| AT1G16780 | Encodes a type II H+-PPases that localizes to and function as a proton pump of the Golgi apparatus in most tissues except for mature leaves. |
| AT2G06530 | SNF7 family protein;(source:Araport11) |
| AT5G63880 | SNF7 family protein;(source:Araport11) |
| AT5G22950 | SNF7 family protein;(source:Araport11) |
| AT5G04920 | EAP30/Vps36 family protein;(source:Araport11) |
| AT1G73030 | Encodes an ESCRT-related protein: CHMP1A/AT1G73030; CHMP1B/AT1G17730. CHMP1A and B mediate multivesicular body sorting of auxin carriers and are required for plant development. ESCRT: Endosomal Sorting Complexes Required For Transport machinery; CHMP: Charged Multivesicular Body Protein/Chromatin Modifying Protein. |
| AT4G19490 | Putative homolog of yeast Vps54. Thought to associate with POK and ATVPS53 in a plant GARP-like complex involved in the membrane trafficking system. |
| AT3G10640 | SNF7 family protein;(source:Araport11) |
| AT2G22880 | VQ motif-containing protein;(source:Araport11) |
| AT1G29170 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
| AT4G27260 | encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. It is involved in camalexin biosynthesis via conjugating indole-3-carboxylic acid (ICA) and cysteine (Cys). The mRNA is cell-to-cell mobile. |
| AT5G65130 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT1G49160 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its |
| AT4G01720 | member of WRKY Transcription Factor; Group II-b |
| AT1G62300 | Encodes a transcription factor WRKY6. Regulates Phosphate1 (Pho1) expression in response to low phosphate (Pi) stress. |
| AT2G04240 | Encodes a small protein with an N-terminal trans-membrane domain and a RING-H2 zinc finger motif located at the C-terminus. Gene expression is induced by salt and osmotic stress. Transcrips levels are induced by DELLA proteins and repressed by gibberellic acid. Involved in ABA metabolism. |
| AT1G58440 | Encodes a putative protein that has been speculated, based on sequence similarities, to have squalene monooxygenase activity. |
| AT5G20490 | Encodes a member of the type XI myosin protein family involved in root hair growth, trichome development, and organelle trafficking. Required for fast root hair growth. This gene appears to be expressed at low levels throughout the plant. |
| AT2G46520 | cellular apoptosis susceptibility protein, putative / importin-alpha re-exporter;(source:Araport11) |
| AT1G51510 | This gene is predicted to encode a protein involved in the exon junction complex. Though there is a predicted RNA binding motif, in the Drosophila ortholog (33% identity), this motif mediates interactions with Mago and is not available for RNA binding. The Arabidopsis Y14 protein appears to be predominantly nucleolar, but there is also some evidence for its presence in the cytoplasm. |
| AT5G58060 | Constitutively expressed SNARE protein of the YKT6 family. |
| AT5G21920 | One of four Arabidopsis homologs of bacterial ymlg proteins. |
| AT1G59590 | ZCF37 mRNA, complete cds The mRNA is cell-to-cell mobile. |
| AT1G59560 | Encodes a chloroplast-localized putative RING-type ubiquitin E3 ligase. |
| AT1G58340 | Encodes a plant MATE (multidrug and toxic compound extrusion) transporter that is localized to the Golgi complex and small organelles and is involved in determining the rate of organ initiation. It is also involved in iron homeostasis when plants are under osmotic stress. |
| AT3G52530 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G57640 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G58270 | ZW9 mRNA, complete cds The mRNA is cell-to-cell mobile. |
| AT1G22260 | One of two nearly identical proteins (ZYP1b) identified by similarity to transverse filament (TF) proteins. These proteins are involved in chromosome synapsis during meiosis I and localize to the synaptonemal complex (SC). Single mutants have reduced fertility and double mutants (induced by RNAi) have severely reduced fertility. |
| AT4G35040 | Basic-region leucine zipper (bZIP19) transcription factor involved in the adaptation to zinc deficiency. Binds ZDRE motifs. |
| AT4G03205 | Coproporphyrinogen III oxidase;(source:Araport11) |
| AT2G20960 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT3G48050 | Encodes a large protein with N-terminal bromo-adjacent homology (BAH) and transcription elongation factor S-II (TFS2N) domains and two C-terminal GW (glycine and tryptophan) repeats. It is nuclear and colocalizes with the processing-body component DCP1 in the cytoplasm. SOU is a component of the miRNA pathway and is involved in translational repression. |
| AT5G19820 | Encodes an importin that transports HYL1, a component of the microprocessor, from the cytoplasm to the nucleus to constitute functional microprocessor, thereby affecting miRNA processing. Knockdown amiR mutants significantly reduced nuclear portion of HYL1 protein and correspondingly compromised the pri-miRNA processing in the nucleus.KETCH1 may protect RPs from the 26S proteasome-mediated degradation. |
| AT3G47020 | E3 ubiquitin ligase involved in SGS3 degradation leading to inhibited biosynthesis of tasiRNA. The heat-induced activation of SGIP1 is inherited in the progeny. |
| AT1G01480 | a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family, isolated from a flower-specific cDNA library. |
| AT4G08040 | encodes an aminotransferase that belongs to ACC synthase gene family structurally |
| AT2G22810 | key regulatory enzyme in the biosynthesis of the plant hormone ethylene. ACS4 is specifically induced by indoleacetic acid (IAA). |
| AT2G31360 | Encodes a protein homologous to delta 9 acyl-lipid desaturases of cyanobacteria and acyl-CoA desaturases of yeast and mammals. expression up-regulated by cold temperature. It is involved in the synthesis of the 24:1n-9 and 26:1n-9 components of seed lipids, sphingolipids and the membrane phospholipids phosphatidylserine (PS), and phosphatidylethanolamine (PE). |
| AT1G09780 | Encodes a 2,3-biphosphoglycerate-independent phosphoglycerate mutase that is involved in pollen development and stomatal movement. |
| AT3G08590 | Encodes a 2,3-biphosphoglycerate-independent phosphoglycerate mutase that is involved in pollen development and stomatal movement. |
| AT3G11630 | Encodes a 2-Cys peroxiredoxin (2-Cys PrxA) that contains two catalytic Cys residues. Functions in redox cascade with TrxL2 via the ferredoxin-thioredoxin reductase (FTR)/thioredoxin (Trx) pathway to mediate the light-responsive reductive control of target proteins. Continuously transfers reducing power from TrxL2 to H2O2. |
| AT5G06290 | Encodes a 2-Cys peroxiredoxin (2-Cys PrxB) that contains two catalytic Cys residues. The mRNA is cell-to-cell mobile. |
| AT5G47760 | serine/threonine protein kinase |
| AT1G53850 | Encodes alpha5 subunit of 20s proteosome involved in protein degradation and RNA degradation. |
| AT2G20580 | encoding the RPN subunits of the 26S proteasome The mRNA is cell-to-cell mobile. |
| AT5G53000 | PP2A-associated protein with a possible function in the chilling response |
| AT4G33510 | Enzyme catalyzing the first committed step in aromatic amino acid biosynthesis The mRNA is cell-to-cell mobile. |
| AT4G39980 | Encodes a 2-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase, which catalyzes the first committed step in aromatic amino acid biosynthesis. Gene expression is induced by wounding and pathogenic bacteria Pseudomonas syringae. The mRNA is cell-to-cell mobile. |
| AT2G26800 | Mutant has increased seed ile, leu and val as well as his and arg. |
| AT1G01120 | Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis. |
| AT2G26250 | epidermis-specific, encodes KCS10, a putative 3-ketoacyl-CoA synthase. probably involved in the synthesis of long-chain lipids found in the cuticle. |
| AT2G26640 | Encodes KCS11, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT2G28630 | Encodes KCS12, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT2G46720 | Encodes KCS13, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G04220 | Encodes KCS2, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT5G43760 | Encodes KCS20, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). The mRNA is cell-to-cell mobile. |
| AT1G07720 | Encodes KCS3, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G19440 | Encodes KCS4, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G25450 | Encodes KCS5, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G68530 | Encodes KCS6, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT2G16280 | Encodes KCS9, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G17745 | encodes a 3-Phosphoglycerate dehydrogenase The mRNA is cell-to-cell mobile. |
| AT1G18640 | Encodes a 3-phosphoserine phosphatase acting in the last step of serine biosynthesis within the chloroplast. Essential for embryo, pollen and root development. |
| AT1G51680 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. In addition to 4-coumarate, it also converts ferulate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, ferulic acid, caffeic acid and 5-OH-ferulic acid. At4CL1 was unable to use sinapic acid as substrate. |
| AT3G21240 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, ferulic acid, 5-OH-ferulic acid and cinnamic acid. At4CL2 was unable to use sinapic acid as substrate. |
| AT3G21230 | The gene encodes a 4-coumarate coenzyme A ligase being able to use sinapate as substrate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, 5-OH-ferulic acid, ferulic acid and sinapic acid. At4CL5 was unable to use cinnamic acid as substrate. Knockout of At4CL5 (4cl5) revealed no effect on syringyl lignin content indicating that the activity observed does probably not occur in vivo. |
| AT4G34350 | Arabidopsis ISPH is involved in the plastid nonmevalonate pathway of isoprenoid biosynthesis. It was shown to complement the lethal phenotype of E. coli ispH mutant and is therefore most likely encodes a protein with 4-hydroxy-3-methylbut-2-en-1-yl diphosphate reductase activity involved in the last step of mevalonate-independent isopentenyl biosynthesis. Mutant has Albino seedling. |
| AT5G60600 | Encodes a chloroplast-localized hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate (HMBPP) synthase (HDS), catalyzes the formation of HMBPP from 2-C-methyl-D-erythrytol 2,4-cyclodiphosphate (MEcPP). The HDS enzyme controls the penultimate steps of the biosynthesis of IPP and dimethylallyl diphosphate (DMAPP) via the MEP pathway and may serve as a metabolic control point for SA-mediated disease resistance. In the light, the electrons required for the reaction catalyzed by HDS are directly provided by the electron flow from photosynthesis via ferredoxin. In the dark however, the enzyme requires an electron shuttle: ferredoxin-NADP+ reductase. The mRNA is cell-to-cell mobile. |
| AT1G75660 | Encodes a protein with similarity to yeast 5'-3'exonucleases and can functionally complement the yeast mutations. In Arabidopsis XRN3 acts as a suppressor of posttranscriptional gene silencing. Mutants accumulate excised miRNA products suggesting that XRN3 is involved in degradation of these products. |
| AT1G62180 | encodes a adenosine 5'-phosphosulfate reductase, involved in sulfate assimilation. Is a major effect locus for natural variation of shoot sulfate content in Arabidopsis. |
| AT5G08530 | 51 kDa subunit of complex I;(source:Araport11) |
| AT5G41670 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
| AT1G13700 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
| AT3G49360 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
| AT5G24410 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
| AT1G01100 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
| AT4G00810 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
| AT5G47700 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
| AT1G54060 | Member of the trihelix DNA binding protein family. Nuclear localized. Involved in repressing seed maturation genes during seed germination and seedling development. |
| AT5G14920 | Encodes a GASA domain containing protein that regulates increases in plant growth through GA-induced and DELLA-dependent signal transduction and that can increase abiotic stress resistance by reducing ROS accumulation. |
| AT5G67030 | Encodes a single copy zeaxanthin epoxidase gene that functions in first step of the biosynthesis of the abiotic stress hormone abscisic acid (ABA). Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. |
| AT1G52340 | Encodes a cytosolic short-chain dehydrogenase/reductase involved in the conversion of xanthoxin to ABA-aldehyde during ABA biosynthesis. Mutants are insensitive to sucrose and glucose. |
| AT5G57050 | Encodes a protein phosphatase 2C and is involved in ABA signal transduction. Binds fibrillin preprotein in vitro and in vivo. |
| AT3G24650 | Homologous to the maize transcription factor Viviparous-1. Full length ABI3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of ABI3 requires the B3 DNA-binding domain and an activation domain. In addition to the known N-terminal-located activation domain, a second transcription activation domain was found in the B1 region of ABI3. ABI3 is essential for seed maturation. Regulator of the transition between embryo maturation and early seedling development. Putative seed-specific transcriptional activator. ABI3 is a central regulator in ABA signaling and is unstable in vivo. It interacts with and can by polyubiquitinated by AIP2 in vivo. Based on double mutant analyses, ABI3 interacts genetically with both FUS3 and LEC1 and is involved in controlling accumulation of chlorophyll and anthocyanins, sensitivity to abscisic acid, and expression of the members of the 12S storage protein gene family. In addition, both FUS3 and LEC1 regulate positively the abundance of the ABI3 protein in the seed. Alternative splicing of ABI3 is developmentally regulated by SUA (AT3G54230). |
| AT2G36270 | Encodes a member of the basic leucine zipper transcription factor family, involved in ABA signalling during seed maturation and germination. The Arabidopsis abscisic acid (ABA)-insensitive abi5 mutants have pleiotropic defects in ABA response, including decreased sensitivity to ABA inhibition of germination and altered expression of some ABA-regulated genes. Comparison of seed and ABA-inducible vegetative gene expression in wild-type and abi5-1 plants indicates that ABI5 regulates a subset of late embryogenesis-abundant genes during both developmental stages. Responsible for reducing cadmium uptake, mediated by interaction with MYB49 . |
| AT4G23450 | AtAIRP1 gene encodes a C3H2C3-type RING E3 Ub ligase. It has been shown to be a positive regulator in the Arabidopsis ABA-dependent drought response. |
| AT5G01520 | Encodes a cytosolic RING-type E3 ubiquitin (Ub) ligase that is critical for ABA and high salinity responses during germination. AtAIRP2 and SDIR1 likely play a combinatory role in ABA signaling and the response to high salt in Arabidopsis. |
| AT5G58787 | Encodes a cytosolic protein with E3 ligase activity that is involved in positive regulation of ABA responses. |
| AT5G04895 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G66600 | A member of WRKY Transcription Factor; Group III. Involved in the regulation of plant responses to ABA and drought stress. |
| AT5G51760 | Encodes AHG1 (ABA-hypersensitive germination 1), a putative protein phosphatase 2C (PP2C). Expressed in seeds. AHG1 functions in seed development and germination. |
| AT5G50360 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT3G18950 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G49450 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G46510 | Encodes a nuclear localized BLH domain containing transcriptional activator involved in response to ABA. Overexpression confers enhanced ABA responsiveness while loss of function mutants are ABA sensitive.bHLH17 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH13 and bHLH14 to negatively regulate jasmonate responses. |
| AT5G13680 | A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1?ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. Mutants have no ncm5U (5-carbamoylmethyluridine). |
| AT5G66070 | E3 ubiquitin ligase that functions in negative regulation of ABA signaling. |
| AT1G05805 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G01660 | Encodes an ABC1-like protein, member of the ATH subfamily; putative ABC transporter; isolated by functional complementation of a yeast abc1 mutant The mRNA is cell-to-cell mobile. |
| AT1G79600 | Encodes a chloroplast ABC1-like kinase that regulates vitamin E metabolism. |
| AT5G64940 | ABC1K8 is a member of an atypical protein kinase family that is induced by heavy metals. Loss of function mutations affect the metabolic profile of chloroplast lipids. It appears to function along with ABC1K7 in mediating lipid membrane changes in response to stress. The mRNA is cell-to-cell mobile. |
| AT2G40090 | member of ATH subfamily |
| AT3G10572 | APEM9 is required for both PTS1- and PTS2-dependent protein transport. APEM9 interacts with PEX6 in BiFC assay and mating-based Split ubiquitin system. BiFC data shows that APEM9 is required for peroxisomal localization of PEX1-PEX6 complex. These results indicate that APEM9 functions like mammalian PEX26 and yeast PEX15. |
| AT5G01450 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G69260 | ABI five binding protein;(source:Araport11) |
| AT1G13740 | Encodes a member of a small plant-specific gene family whose members interact with ABI5 and appear to be involved in mediating stress responses. AFP2 mutants affect a number of ABA mediated processes such as germination and response to osmotic and sugar stress. AFP2 nuclear localization is stress dependent. |
| AT3G29575 | ABI five binding protein 3;(source:Araport11) |
| AT2G46225 | Encodes a subunit of the WAVE complex. The WAVE complex is required for activation of ARP2/3 complex which functions in actin microfilament nucleation and branching. One of four ABI-like proteins. |
| AT5G42030 | ABL interactor-like protein 4;(source:Araport11) |
| AT2G36080 | Encodes a plant-specific B3 DNA-binding domain transcription factor. Has transcription repressor activity. |
| AT5G57790 | Encodes a nuclear localized protein of unknown function that is involved in pollen and embryo sac development. |
| AT3G19290 | bZIP transcription factor with specificity for abscisic acid-responsive elements (ABRE). Mediates ABA-dependent stress responses.ABF4 acts through SnRK2 pathway and binds to ABA response elements of the promoters of NYE1 and regulates their expression to promote chlorophyll degradation. |
| AT1G67080 | Encodes a protein involved in the photoprotection of PSII. An aba4-1 mutant completely lacks neoxanthin,a component of the chromophore of the peripheral antenna system in PSII. ABA4 is required for neoxanthin biosynthesis, an intermediary step in abscisic acid biosynthesis, but no catalytic activity has been detected for the ABA4 protein. |
| AT1G49720 | Identified as a protein that binds to abscisic acid response elements. May mediate transcriptional regulation of ABA responses. |
| AT4G34000 | Encodes an ABA-responsive element-binding protein with similarity to transcription factors that is expressed in response to stress and abscisic acid. |
| AT2G27150 | Encodes the aldehyde oxidase delta isoform catalyzing the final step in abscisic acid biosynthesis. |
| AT2G19590 | encodes a protein whose sequence is similar to 1-aminocyclopropane-1-carboxylate oxidase |
| AT1G62380 | Encodes a protein similar to 1-aminocyclopropane-1-carboxylic oxidase (ACC oxidase). Expression of the AtACO2 transcripts is affected by ethylene. |
| AT1G62960 | Encodes an aminotransferase with broad specificity for aspartate and aromatic amino aids such as tyrosine and phenylalanine. It does not act on branched chain amino acids and does not have ACC synthase activity. |
| AT5G65800 | 1-aminocyclopropane-1-carboxylate synthase (ACS) is encoded by a multigene family consisting of at least five members whose expression is induced by hormones, developmental signals, and protein synthesis inhibition. |
| AT3G44880 | Encodes a pheide a oxygenase (PAO). Accelerated cell death (acd1) mutants show rapid, spreading necrotic responses to both virulent and avirulent Pseudomonas syringae pv. maculicola or pv. tomato pathogens and to ethylene. |
| AT4G37000 | Mutants have spontaneous spreading cell death lesions and constitutive activation of defenses in the absence of pathogen infection. Its product was shown to display red chlorophyll catabolite reductase (RCCR), which catalyzes one step in the breakdown of the porphyrin component of chlorophyll. The enzyme was further assessed to be a Type-1 (pFCC-1-producing) RCCR.Upon P. syringae infection, ACD2 localization shifts from being largely in chloroplasts to partitioning to chloroplasts, mitochondria, and to a small extent, cytosol. Overexpression of ACD2 delayed cell death and the replication of P. syringae. |
| AT4G14400 | encodes a novel protein with putative ankyrin and transmembrane regions. It is a member of one of the largest uncharacterized gene families in higher plants. The gene is involved in resistance to Pseudomonas syringae. |
| AT1G75010 | Encodes ARC3 (Accumulation and Replication of Chloroplast 3), a chloroplast division factor functioning in the initiation of chloroplast division. ARC3 is a chimera of the prokaryotic FtsZ and part of the eukaryotic phosphatidylinositol-4-phosphate 5-kinase (PIP5K). Located on the outer surface of the chloroplast in a ring-like structure at the early stage of chloroplast division. The arc3 mutant has a small number of abnormally large chloroplasts in the cell. |
| AT5G57930 | ACCUMULATION OF PHOTOSYSTEM ONE 2 |
| AT5G48230 | Encodes an acetoacetyl-CoA thiolase that generates the bulk of the acetoacetyl-CoA precursor needed for the cytosolic localized, mevalonate-derived isoprenoids biosynthetic pathway. Loss-of-function mutants are embryo lethal. |
| AT2G31810 | ACT domain-containing small subunit of acetolactate synthase protein;(source:Araport11) |
| AT2G23600 | Encodes a protein shown to have carboxylesterase activity, methyl salicylate esterase activity, methyl jasmonate esterase activity, and methyl IAA esterase activity in vitro. MES2 appears to be involved in MeSA hydrolysis in planta. This protein does not act on MeGA4, or MEGA9 in vitro and has been show to be capable of hydrolyzing methyl ester nicotinate back to nicotinate. |
| AT2G38040 | encodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis |
| AT3G09980 | Encodes ACIP1, a microtubules-associated protein required for bacterial immunity. The mRNA is cell-to-cell mobile. |
| AT4G26970 | Encodes an aconitase that can catalyze the conversion of citrate to isocitrate through a cis-aconitate intermediate, indicating that it may participate in the TCA cycle and other primary metabolic pathways. The protein is believed to accumulate in the mitochondria and the cytosol. It affects CSD2 (At2g28190 - a superoxide dismutase) transcript levels and may play a role in the response to oxidative stress. One member of the family (ACO1 - At35830) was shown to specifically bind to the 5' UTR of CSD2 in vitro. The mRNA is cell-to-cell mobile. |
| AT5G65890 | Member of ACT domain containing protein family. ACT domains are amino acid binding domains. Shows strongest expression in flowers and siliques. |
| AT1G76990 | ACT domain repeat 3;(source:Araport11) |
| AT2G03730 | Member of a small family of ACT domain containing proteins. ACT domains are thought to be involved in amino acid binding. |
| AT4G22780 | Member of a family of ACT domain containing proteins . ACT domains are involved in amino acid binding . |
| AT1G12420 | ACT domain repeat 8;(source:Araport11) |
| AT1G16880 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. The mRNA is cell-to-cell mobile. |
| AT5G04740 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. |
| AT2G39570 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. |
| AT3G18780 | Encodes an actin that is constitutively expressed in vegetative structures but not pollen. ACT2 is involved in tip growth of root hairs. |
| AT5G09810 | Member of Actin gene family.Mutants are defective in germination and root growth. The mRNA is cell-to-cell mobile. |
| AT1G49240 | Member of a subclass of actins composed of ACT2 and ACT8. Its mRNA is strongly expressed in strongly expressed in leaves, roots, stems, flowers, pollen, and siliques. However, protein expression, assayed by a ACT8:GUS fusion reporter, is very low in pollen. |
| AT3G46010 | Actin-depolymerizing factor (ADF) and cofilin define a family of actin-binding proteins essential for the rapid turnover of filamentous actin in vivo. |
| AT3G46000 | Encodes depolymerizing factor 2. |
| AT5G59880 | Encodes actin depolymerizing factor 3 (ADF3). |
| AT5G59890 | actin depolymerizing factor 4 (ADF4) mRNA, complete cds |
| AT2G16700 | Encodes actin depolymerizing factor 5 (ADF5). |
| AT3G12110 | Encodes an actin that is expressed predominantly during reproductive development. |
| AT3G46520 | Member of actin subclass composed of ACT12 and ACT4. RNA is expressed at very low levels in vegetative organs, low levels in flowers and very high levels in pollen. Expression of an ACT12/GUS fusion was found in vascular tissues, tapetum, developing and mature pollen, the root cap and in a ring of pericycle tissues during lateral root initiation and early development. |
| AT2G01330 | nucleotide binding protein;(source:Araport11) |
| AT1G18450 | Encodes a gene similar to actin-related proteins in other organisms. Member of nuclear ARP family of genes. Component of chromatin remodeling complexes, involved in chromatin-mediated gene regulation. Phenotype of the arp4-1 mutant allele revealed partial sterility due to defects in anther development. Targeting the distinct, 3' UTR of AtARP4 transcripts with RNA interference caused a drastic reduction in the level of AtARP4 protein expression, and resulted in strong pleiotropic phenotypes such as altered organization of plant organs, early flowering, delayed flower senescence and high levels of sterility. Western blot analysis and immunolabelling demonstrated a clear correlation between reductions in the level of AtARP4 expression and severity of the phenotypes. |
| AT3G12380 | Encodes a gene similar to actin-related proteins in other organisms. Member of nuclear ARP gene family. |
| AT5G56180 | encodes a protein whose sequence is similar to actin-related proteins (ARPs) in other organisms. Member of nuclear ARP family of genes. |
| AT2G33385 | actin-related protein C2B;(source:Araport11) |
| AT1G60430 | actin-related protein C3;(source:Araport11) |
| AT1G73910 | Encodes a gene similar to actin-related proteins in other organisms. Member of nuclear ARP family of genes. Component of chromatin remodeling complexes, involved in chromatin-mediated gene regulation. |
| AT4G29140 | Encodes Activated Disease Susceptibility 1 (ADS1), a putative MATE (multidrug and toxic compound extrusion) transport protein that negatively regulates plant disease resistance. |
| AT1G11390 | Atypical kinase which functions in plant salt stress tolerance by regulating reactive oxygen species (ROS). |
| AT3G16170 | Encodes a malonyl-CoA synthetase that is localized to the cytosol and mitochondrion. AAE13 produces two transcripts one of which includes an N terminal mitochondrial targeting motif. Loss of function of the mtAAE13 product results in growth arrest and lethality. |
| AT5G16370 | acyl activating enzyme 5;(source:Araport11) |
| AT3G05020 | encodes an acyl carrier protein expressed in leaves, roots, and dry seeds. Protein is not regulated by light. |
| AT4G25050 | encodes an acyl carrier protein predominantly expressed in leaves. Gene expression is upregulated by light. |
| AT1G66120 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G30520 | Encodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal. |
| AT5G23050 | acyl-activating enzyme 17;(source:Araport11) |
| AT3G48990 | Encodes an oxalyl-CoA synthetase and is required for oxalate degradation, for normal seed development, and for defense against an oxalate-producing fungal pathogen. |
| AT3G16910 | Encodes a peroxisomal protein with acetyl-CoA synthetase activity that is responsible for the activation of acetate for entry into the glyoxylate cycle. |
| AT5G16240 | Redundant Δ9 stearoyl-ACP desaturase gene which together with FAB2 and AAD5 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with FAB2, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase. |
| AT5G16230 | Encodes one of two ∆9 palmitoyl-ACP desaturases responsible for the biosynthesis of ω-7 fatty acids in the maturing endosperm. |
| AT3G05420 | Acyl-CoA binding protein with high affinity for oleoyl-CoA. Expressed in all plant organs. Involved in fatty acid transport. Plays a role in determining seed oil content. |
| AT4G16760 | Encodes a medium to long-chain acyl-CoA oxidase. Catalyzes the first step of fatty acid beta-oxidation. Involved in jasmonate biosynthesis. Gene expression is induced by wounding, drought stress, abscisic acid, and jasmonate. |
| AT5G65110 | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. |
| AT3G51840 | Encodes a short-chain acyl-CoA oxidase, which catalyzes the first step of peroxisomal fatty acid beta-oxidation during early, post-germinative growth in oilseed species. Null mutants virtually lack short-chain acyl-CoA and are resistant to 2,4-dichlorophenoxybutyric acid, which is converted to the herbicide and auxin analogue 2,4-dichlorophenoxyacetic acid by beta-oxidation. Despite the almost complete loss of short-chain activity, lipid catabolism and seedling growth and establishment was unaltered in the acx4 mutant. However, double mutants in acx3acx4 (acx3 encodes medium chain acyl CoA oxidase) were not viable and arrested during embryogenesis. |
| AT2G35690 | Encodes an acyl-CoA oxidase. Involved in jasmonate biosynthesis. Expressed uniformly in seedlings and throughout development. |
| AT3G51970 | acyl-CoA sterol acyl transferase 1;(source:Araport11) |
| AT4G24230 | acyl-CoA-binding protein ACBP3. Localized extracellularly in transiently expressed tobacco BY-2 cells and onion epidermal cells. Binds arachidonyl-CoA with high affinity. Microarray data shows up-regulation of many biotic- and abiotic-stress-related genes in an ACBP3 OE-1 in comparison to wild type. |
| AT1G31812 | Acyl-CoA-binding protein. Bind acyl-CoA esters and protect acyl-CoAs from degradation by microsomal acyl-hydrolases. Plays a role in determining seed oil content. |
| AT1G06120 | Membrane bound acyl-lipid desaturases which can perform Δ9 desaturation. |
| AT1G35250 | Thioesterase superfamily protein;(source:Araport11) |
| AT3G50860 | Clathrin adaptor complex small chain family protein;(source:Araport11) |
| AT1G31730 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
| AT2G19790 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
| AT4G01100 | Adenine nucleotide transporter. Located in mitochondrion. Expressed in a broad range of tissues, but predominantly in root tips. Loss of function mutants exhibit reduced root growth and respiration. |
| AT1G27450 | Adenosine phosphoribosyl transferase(E.C:2.4.2.7), involved in the one-step salvage of adenine to AMP. |
| AT4G22570 | Encodes an adenine phosphoribosyltransferase (APT; EC 2.4.2.7), which is a constitutively expressed enzyme involved in the one-step salvage of adenine to AMP. APT3 has higher affinity for zeatin, isopentenyladenine and benzyladenine than APT1 but lower Vmax than APT1. |
| AT2G37250 | encodes adenylate kinase that is located in the chloroplast involved in the coordination of metabolism and growth |
| AT5G03300 | Encodes adenosine kinase 2 (ADK2), a typical, constitutively expressed housekeeping enzyme. Shows a high sequence identity with ADK1. Involved in salvage synthesis of adenylates and methyl recycling. Enzyme activity is substantially inhibited in roots, siliques and dry seeds by an unknown compound. May contribute to cytokinin interconversion. The mRNA is cell-to-cell mobile. |
| AT3G03900 | Provides activated sulfate for the sulfation of secondary metabolites, including the glucosinolates. Redundant with APK4. |
| AT5G67520 | Provides activated sulfate for the sulfation of secondary metabolites, including the glucosinolates. Redundant with APK3. |
| AT5G19220 | Encodes the large subunit of ADP-glucose pyrophosphorylase which catalyzes the first, rate limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms (ApL1-4) have been identified. ApL1 is the major large subunit isoform present in leaves. Mutational analysis of APS1 suggests that APL1 and APL2 can compensate for loss of APS1 catalytic activity,suggesting both have catalytic as well as regulatory functions. |
| AT1G23490 | Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. A member of ARF GTPase family. Arabidopsis has 21 known members, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
| AT3G62290 | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. The mRNA is cell-to-cell mobile. |
| AT3G49870 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
| AT5G67560 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. Possible pseudogene because it lacks an N-terminal part that is conserved among the other ARL8 proteins. The mRNA is cell-to-cell mobile. |
| AT3G08580 | mitochondrial ADP/ATP carrier |
| AT5G13490 | Encodes mitochondrial ADP/ATP carrier |
| AT4G28390 | Encodes a mitochondrial ADP/ATP carrier protein. Shown in heterologous systems to be located in the plasma membrane. Has comparable affinity for ADP and ATP (in E.coli). |
| AT4G33300 | Encodes a member of the ADR1 family nucleotide-binding leucine-rich repeat (NB-LRR) immune receptors. |
| AT5G04720 | Encodes a member of the ADR1 family nucleotide-binding leucine-rich repeat (NB-LRR) immune receptors. The mRNA is cell-to-cell mobile. |
| AT4G18960 | Floral homeotic gene encoding a MADS domain transcription factor. Specifies floral meristem and carpel and stamen identity. Binds CArG box sequences. It is the only C function gene. It interacts genetically with the other homeotic genes to specify the floral organs. |
| AT1G47760 | AGAMOUS-like 102;(source:Araport11) |
| AT1G71692 | Encodes a member of the MADS box family of transcription factors. Involved in root cell differentiation and flowering time. Loss of function mutations have abnormal cellular differentiation in the roots and are late flowering. AGL12 along with AGL14, and AGL17 is preferentially expressed in root tissues and represent the only characterized MADS box genes expressed in roots. |
| AT4G11880 | AGL12, AGL14, and AGL17 are all preferentially expressed in root tissues and therefore represent the only characterized MADS box genes expressed in roots. The mRNA is cell-to-cell mobile. |
| AT3G57230 | MADS-box transcription factor. Expressed in leaf, root and stem, with higher RNA accumulation in guard cells and trichomes. AGL16 can directly interact with SVP and indirectly interact with FLC. Furthermore, the accumulation of AGL16 transcripts is modulated by miR824 (AT4G24415). The flowering time effect for the miR824/AGL16 module is more obvious in the Col-FRI background than in the Col-0 background. AGL16 controls flowering via a allelic dosage effect in long-day non-vernalized conditions. |
| AT2G22630 | Encodes a MADs domain containing protein involved in promoting flowering. Loss of function mutations show delayed flowering in long days and reduced levels of LFY and AP1 expression. |
| AT2G45660 | Controls flowering and is required for CO to promote flowering. It acts downstream of FT. Overexpression of (SOC1) AGL20 suppresses not only the late flowering of plants that have functional FRI and FLC alleles but also the delayed phase transitions during the vegetative stages of development. AGL20/SOC1 acts with AGL24 to promote flowering and inflorescence meristem identity.AGL20 upregulates expression of AGL24 in response to GA. |
| AT4G37940 | encodes a MADS box protein, highly expressed in the root. |
| AT5G65050 | Originally published as Agamous like MADS-box protein AGL31. One of a group of MADS box genes involved in control of flowering time. Four variant sequences have been identified for this locus but have not been characterized for differences in expression pattern and/or function. |
| AT5G62165 | Encodes a MADS box transcription factor. Expressed in quiescent center. Involved in floral transition. |
| AT2G14210 | MADS box gene, transcription factor |
| AT3G05860 | MADS-box transcription factor family protein;(source:Araport11) |
| AT2G45650 | Sequence suggests this encodes a MADS-box transcription factor. Negatively regulates the FLC/MAF clade genes and positively regulates FT in Arabidopsis. |
| AT1G72350 | MADS-box transcription factor family protein;(source:Araport11) |
| AT1G77980 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL66 is expressed in pollen.It forms heterodimers with other MICK family members (AGL104). Involved in late stages of pollen development and pollen tube growth. |
| AT1G77950 | Cooperates with the histone mark reader EBS to modulate seed germination under high temperature. |
| AT5G51870 | Encodes a MADS-box transcription factor involved in floral transition. |
| AT5G38740 | AGAMOUS-like 77;(source:Araport11) |
| AT5G60910 | MADS box gene negatively regulated by APETALA1 |
| AT5G58890 | AGAMOUS-like 82;(source:Araport11) |
| AT3G66656 | AGAMOUS-like 91;(source:Araport11) |
| AT5G26950 | AGAMOUS-like 93;(source:Araport11) |
| AT1G69540 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. |
| AT1G79250 | AGC kinase 1.7;(source:Araport11) |
| AT2G36350 | Member of AGC VIIIa Kinase gene family. |
| AT3G25250 | Arabidopsis protein kinase The mRNA is cell-to-cell mobile. |
| AT3G44610 | Kinase involved in the first positive phototropism and gravitropism. Phosphorylates serine residues in the cytoplasmic loop of PIN1 and shares phosphosite preferences with D6PK. Critical component for both hypocotyl phototropism and gravitropism, control tropic responses mainly through regulation of PIN-mediated auxin transport by protein phosphorylation. |
| AT5G03640 | AGCVIII kinase involved in the pulse-induced first positive phototropism. |
| AT1G09320 | Heterochromatin-binding protein which can bind to three H3K9me2 tails. Preferentially binds to long TEs. Required for transcriptional silencing, non-CG DNA methylation, and H3K9 dimethylation at some loci. |
| AT4G21060 | Encodes an endomembrane system-localized, hydroxyproline-O-galactosyltransferase specific for arabinogalactan-protein biosynthesis. |
| AT1G74800 | Encodes a Golgi-localized hydroxyproline galactosyltransferase GALT5. Functions together with GALT2 as redundant GALTs that control AGP (arabinogalactan-proteins) O-glycosylation, which is essential for normal growth and development. Mutants display multiple phenotypes including reduced root hair growth. |
| AT5G10510 | Encodes an AP2-domain transcription factor involved in root stem cell identity and root development. It is also required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions. Intronic sequences are required for its expression in flowers.Acts redundantly with PLT5 and 7 in lateral root pattern formation. |
| AT5G65510 | Encodes one of three PLETHORA transcription factors required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions. |
| AT3G12740 | Physically interacts with ALA3, and is required for the phospholipid translocase activity of ALA3. The mRNA is cell-to-cell mobile. |
| AT1G79450 | ALA-interacting subunit 5;(source:Araport11) |
| AT1G72330 | Encodes for alanine aminotransferase ALAAT2. |
| AT1G70580 | Encodes a protein with glyoxylate aminotransferase activity. It can act on a number of different small substrates and amino acids in vitro. |
| AT2G13360 | Encodes a peroxisomal photorespiratory enzyme that catalyzes transamination reactions with multiple substrates. It is involved in photorespiration. |
| AT4G39660 | alanine:glyoxylate aminotransferase 2 homolog (AGT2). The mRNA is cell-to-cell mobile. |
| AT2G28800 | member of Chloroplast membrane protein ALBINO3 family. Similar to pea PPF1 and may play a role in plant senescence. |
| AT2G36230 | Encodes a BBMII isomerase involved in histidine biosynthesis. |
| AT4G01800 | Encodes the ATPase subunit of the chloroplast Sec translocation machinery which plays an essential role in chloroplast biogenesis and the regulation of photosynthesis, the absence of which triggers a retrograde signal, eventually leading to a reprogramming of chloroplast and mitochondrial gene expression. |
| AT5G01370 | Nuclear protein with a lysine-rich domain and a C-terminal serine-rich domain. Interacts with Alcatraz (ALC). ACI1 is mainly expressed in the vascular system. Involved in cell separation during fruit dehiscence. |
| AT5G67110 | encodes a myc/bHLH transcription factor-like protein. Gene product is involved in fruit dehiscence. Mutant siliques fail to dehisce. |
| AT1G77120 | Catalyzes the reduction of acetaldehyde using NADH as reductant. Requires zinc for activity. Dimer. Anaerobic response polypeptide (ANP). Fermentation. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. The mRNA is cell-to-cell mobile. |
| AT2G14170 | Arabidopsis thaliana methylmalonate-semialdehyde dehydrogenase |
| AT5G62530 | Encodes mitochondrial Delta-pyrroline-5- carboxylate dehydrogenase. Involved in the catabolism of proline to glutamate. Involved in protection from proline toxicity. Induced at pathogen infection sites. P5CDH and SRO5 (an overlapping gene in the sense orientation) generate 24-nt and 21-nt siRNAs, which together are components of a regulatory loop controlling reactive oxygen species (ROS) production and stress response. |
| AT3G48000 | Encodes a putative (NAD+) aldehyde dehydrogenase. |
| AT3G24503 | Arabidopsis thaliana aldehyde dehydrogenase AtALDH1a mRNA. a sinapaldehyde dehydrogenase catalyzes both the oxidation of coniferylaldehyde and sinapaldehyde forming ferulic acid and sinapic acid, respectively |
| AT4G36250 | Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures. |
| AT1G44170 | Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. It is also able to oxidize beta-unsaturated aldehydes, but not aromatic aldehydes. Activity of ALDH3H1 is NAD +-dependent. |
| AT4G34240 | Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. It is also able to oxidize beta-unsaturated aldehydes, but not aromatic aldehydes. ALDH3I1 was able to use both NAD+ and NADP+ as cofactors. |
| AT1G79440 | Encodes a mitochondrial succinic semialdehyde dehydrogenase (SSADH). Nomenclature according to Kirch, et al (2004). |
| AT1G54100 | Aldehyde dehydrogenase |
| AT3G43600 | Encodes an aldehyde oxidase. AAO2 does not appear to act on abscisic aldehyde in vitro but it is possible that it may function in abscisic acid biosynthesis when the activity of At2g27150 (AAO3), the primary abscisic aldehyde oxidase, is lost. |
| AT3G53880 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT2G37760 | Encodes an NADPH-dependent aldo-keto reductase that can act on a wide variety of substrates in vitro including aliphatic and aromatic aldehydes and steroids. Transcript levels for this gene are up-regulated in response to cold, salt, and drought stress. |
| AT4G24080 | aldolase like;(source:Araport11) |
| AT5G60360 | Encodes a senescence-associated thiol protease. The mRNA is cell-to-cell mobile. |
| AT5G26210 | Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7). |
| AT4G34860 | Plant neutral invertase family protein;(source:Araport11) |
| AT3G06500 | Encodes an alkaline/neutral invertase which localizes in mitochondria. It may be modulating hormone balance in relation to the radicle emergence. Mutants display severely reduced shoot growth and reduced oxygen consumption. Mutant root development is not affected as reported for A/N-InvA mutant (inva) plants. The mRNA is cell-to-cell mobile. |
| AT5G22510 | Encodes a chloroplast-targeted alkaline/neutral invertase that is implicated in the development of the photosynthetic apparatus and nitrogen assimilation in seedlings to control the sucrose to hexose ratio. |
| AT1G23740 | AOR is an alkenal/one oxidoreductase that acts on compounds with unsaturated alpha,beta-carbonyls. The activity of this enzyme with a number of substrates, including acrolein and 3-buten-2-one, was demonstrated in vitro using a truncated form of the protein that lacked approximately 80 of the first amino acids. This protein appears to localize to the chloroplast where it likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation. |
| AT4G20070 | The gene encoding Arabidopsis thaliana Allantoate Amidohydrolase (AtAAH)which catalyzes the allantoate deiminase reaction (EC 3.5.3.9)is expressed in all parts of the plant being consistent with a function in purine turnover in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT5G42650 | Encodes a member of the cytochrome p450 CYP74 gene family that functions as an allene oxide synthase. This enzyme catalyzes dehydration of the hydroperoxide to an unstable allene oxide in the JA biosynthetic pathway. It shows a dual catalytic activity, the major one being a 13-AOS but also expressing a 9-AOS activity. CFA-Leu, CFA-Val, CFA-Met and CFA-Ala can induce the expression of AOS. |
| AT3G52720 | Encodes an alpha carbonic anhydrase (CAH1) located in the chloroplast stroma. Most chloroplast proteins are encoded by the nuclear genome and imported with the help of sorting signals that are intrinsic parts of the polypeptides. CAH1 takes an alternative route through the secretory pathway, and becomes N-glycosylated before entering the chloroplast. Glycosylation and intra-molecular disulfide bridge fromation are necessary for the correct folding, ER export, trafficking and activity of the protein. |
| AT5G04180 | alpha carbonic anhydrase 3;(source:Araport11) |
| AT1G73680 | Encodes an alpha dioxygenase. Recombinant protein catalyzes the conversion of a wide range of fatty acids into 2(R)-hydroperoxy derivatives. |
| AT5G22770 | AP-2 complex subunit alpha-1. Part of endomembrane trafficking system. |
| AT4G25000 | Predicted to be secreted protein based on signalP prediction. Involved in starch mobilization. Mutants are defective in alpha-amylase activity. (Note: AMY1 has been found in the literature to be referred to as AMY3, which is not to be confused with AMY3/At1g69830). |
| AT1G76130 | alpha-amylase, putative / 1,4-alpha-D-glucan glucanohydrolase, putative, strong similarity to alpha-amylase GI:7532799 from (Malus x domestica);contains Pfam profile PF00128: Alpha amylase, catalytic domain. Predicted to be secreted based on SignalP analysis. |
| AT1G69830 | Encodes a plastid-localized α-amylase. Expression is reduced in the SEX4 mutant. Loss of function mutations show normal diurnal pattern of starch accumulation/degradation. Expression follows circadian rhythms. |
| AT3G56310 | Member of Glycoside Hydrolase Family 27 (GH27)that functions as an α-galactosidase. |
| AT3G29320 | Encodes a plastidic alpha-glucan phosphorylase. In vitro, the enzyme has a preference for maltooligosaccharides, such as maltoheptaose. The mRNA is cell-to-cell mobile. |
| AT5G11720 | Glycosyl hydrolases family 31 protein;(source:Araport11) |
| AT3G10740 | Encodes a bifunctional alpha-l-arabinofuranosidase/beta-d-xylosidase that belongs to family 51 of glycoside hydrolases. It may be involved in cell wall modification. |
| AT3G21160 | Encodes an alpha-mannosidase I enzyme responsible for N-glycan maturation. |
| AT4G10030 | Alpha/beta hydrolase domain containing protein involved in lipid biosynthesis. |
| AT1G18460 | Alpha/beta hydrolase |
| AT2G24100 | ATP-dependent DNA helicase;(source:Araport11) |
| AT5G10940 | ASG2 is farnesylated protein and this post-translational modification impacts its subcellular localization. It is the homolog of the human anti-obesity factor WDTC1 and is involved in the negative regulation of fatty acid biosynthesis. The non-farnesylated form displays a nucleo-cytosolic subcellular localization. The farnesylated form displays a cytosolic subcellular localization. Interaction with At4g05420 (DDB1a) was shown using BiFC approach. |
| AT2G44980 | SNF2 domain-containing protein / helicase domain-containing protein;(source:Araport11) |
| AT1G01520 | RVE3 is one of eleven homologous MYB-like transcription factors in Arabidopsis and a member of the RVE8 clade. Plays a minor role in clock regulation. |
| AT1G20650 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G40475 | hypothetical protein;(source:Araport11) |
| AT3G03210 | Pmr5/Cas1p GDSL/SGNH-like acyl-esterase family protein;(source:Araport11) |
| AT1G07180 | Internal NAD(P)H dehydrogenase in mitochondria. The predicted protein sequence has high homology with other designated NAD(P)H DHs from microorganisms; the capacity for matrix NAD(P)H oxidation via the rotenone-insensitive pathway is significantly reduced in the Atndi1 mutant plant line; the in vitro translation product of AtNDI1 is imported into isolated mitochondria and located on the inside of the inner membrane. |
| AT3G22370 | Encodes AOX1a, an isoform of alternative oxidase that is expressed in rosettes, flowers, and root. The alternative oxidase of plant mitochondria transfers electrons from the ubiquinone pool to oxygen without energy conservations. It is regulated through transcriptional control and by pyruvate. Plays a role in shoot acclimation to low temperature. Also is capable of ameliorating reactive oxygen species production when the cytochrome pathway is inhibited. AOX1a also functions as a marker for mitochondrial retrograde response. The mRNA is cell-to-cell mobile. |
| AT5G64210 | encodes an isoform of alternative oxidase, which is expressed in rosettes, stems, and roots. Transcript accumulates in dry seeds and decreased upon germination and is not affected by actinomycin A. Protein is localized to mitochondria. |
| AT1G18420 | Involved in malate efflux response to P-deficiency in root hairs. |
| AT3G18440 | Belongs to the aluminum-activated malate transporter family. Encodes a vacuolar malate channel. Expressed in all parts of plants. Almost exclusively expressed in mesophyll cells of leaves. The mRNA is cell-to-cell mobile. |
| AT4G17970 | Anion transporter involved in stomatal closure. Gene has 3 splicing variants. |
| AT5G27610 | protein ALWAYS EARLY 1;(source:Araport11) |
| AT3G05380 | ALWAYS EARLY 2;(source:Araport11) |
| AT3G21430 | DNA binding protein;(source:Araport11) |
| AT1G08980 | Encodes an enzyme with similarity to bacterial acylamidohydrolases and exhibits indole-3-acetamide amidohydrolase activity in vitro. This enzyme may be involved in the in vivo biosynthesis of indole-acetic acid from indole-3-acetamide, a native metabolite of A. thaliana. It appears to exist as a monomer. |
| AT4G14940 | atao1 gene of Arabidopsis thaliana encodes an extracellular copper amine oxidase expressed during early stages of vascular tissue development. |
| AT1G58360 | Encodes AAP1 (amino acid permease 1), a neutral amino acid transporter expressed in seeds. Functions in amino acid uptake into embryos. The transporter also functions in acquisition of glutamate and neutral amino acids by the root. |
| AT1G44100 | amino acid permease 5 |
| AT5G23810 | Encodes nonfunctional amino acid transporter. AAP7 is the most distantly related member of the AAP family, a group of well characterized amino acid transporters within the ATF1 superfamily. Expression of this gene has not been detected with RNA gel blots or promoter GUS studies. |
| AT3G25585 | aminoalcoholphosphotransferase (AAPT2) |
| AT4G36760 | Arabidopsis aminopeptidase P1 The mRNA is cell-to-cell mobile. |
| AT1G59820 | Encodes a phospholipid translocase. Involved in secretory vesicle formation from trans-Golgi in peripheral columella cells at the root tip. Mutants have short primary roots and grow slower. The mRNA is cell-to-cell mobile. |
| AT1G72700 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
| AT3G27870 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
| AT4G21530 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G39090 | tetratricopeptide repeat (TPR)-containing protein;(source:Araport11) |
| AT3G05870 | Subunit of the anaphase promoting complex, a ubiquitin ligase complex that regulates progression through the cell cycle. |
| AT1G28530 | Encodes a protein that localizes to both chloroplasts and amyloplasts and is required for both chloroplast and mesophyll development. |
| AT1G01510 | Encodes a homolog of human CtBP. Mutant has longer and thicker leaves than wild type. Involved in controlling polar cell expansion in the leaf width direction. It has been shown to localize to cytosolic stress granules and is involved in their formation. |
| AT5G66055 | A locus involved in embryogenesis. Mutations in this locus result in embryo lethality. |
| AT5G61230 | Encodes ANK6, a mitochondrial ankyrin repeat protein required for male-female gamete recognition. |
| AT4G35450 | A molecular chaperone that binds to the transmembrane domains of interacting proteins to prevent aggregation and direct them to the right location after translation.Involved in targeting of chloroplast outer membrane proteins to the chloroplast. Double mutants of AKR2A and the highly homologous AKR2B have yellow leaves, significantly reduced chloroplast proteins, and no thylakoid membranes. |
| AT1G35720 | Encodes a member of the annexin gene family, a diverse, multigene family of calcium-dependent, membrane-binding proteins. The protein was determined to have peroxidase activity. This activity is thought to be dependent on the presence of post-translational modifications (most likely phosphorylation). The protein was shown to be present as a mixture of monomer and homodimer. The homodimerization seems to be dependent on the presence of Ca2+ or H2O2. The dimerization was prevented by the addition of DTT, β-mercaptoethanol and TCEP. Annat1 mRNA is expressed in flowers, roots,leaves and stems and is most abundant in stems. mRNA levels are increased in response to oxidative stress. Developmental expression patterns suggest a role in Golgi-mediated polysaccharide secretion. It is a Ca 2+-permeable transporter providing a molecular link between reactive oxygen species and cytosolic Ca 2+ in plants. The mRNA is cell-to-cell mobile. |
| AT2G38760 | Annexins are calcium binding proteins that are localized in the cytoplasm. When cytosolic Ca2+ increases, they relocate to the plasma membrane. The mRNA is cell-to-cell mobile. |
| AT2G38750 | Annexins are a family of calcium dependent membrane binding proteins though to be involved in Golgi mediated secretion. This is one of four annexins identified in Arabidopsis. |
| AT5G10230 | Encodes a calcium-binding protein annexin (AnnAt7). |
| AT1G05020 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT4G28395 | related to lipid transfer proteins |
| AT4G00730 | Encodes a homeodomain protein of the HD-GLABRA2 group. Involved in the accumulation of anthocyanin and in root development. Loss of function mutants have increased cell wall polysaccharide content. |
| AT1G25220 | Catalyzes the first step of tryptophan biosynthesis: Chorismate L-Glutamine = Anthranilate Pyruvate L-Glutamate. Functions as a heterocomplex with anthranilate synthase alpha subunit (ASA1 or ASA2). |
| AT4G38730 | magnesium transporter, putative (DUF803);(source:Araport11) |
| AT1G72570 | Integrase-type DNA-binding superfamily protein;(source:Araport11) |
| AT1G69120 | Floral homeotic gene encoding a MADS domain protein homologous to SRF transcription factors. Specifies floral meristem and sepal identity. Required for the transcriptional activation of AGAMOUS. Interacts with LEAFY.Binds to promoter and regulates the expression of flowering time genes SVP, SOC1 and AGL24. |
| AT5G10760 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G78860 | curculin-like (mannose-binding) lectin family protein, low similarity to Ser/Thr protein kinase (Zea mays) GI:2598067; contains Pfam profile PF01453: Lectin (probable mannose binding) but not the protein kinase domain of the Z. mays protein |
| AT3G03860 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. The mRNA is cell-to-cell mobile. |
| AT4G08930 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. The mRNA is cell-to-cell mobile. |
| AT4G39940 | adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete The mRNA is cell-to-cell mobile. |
| AT4G36050 | Encodes a base excision repair protein with 3'-phosphatase activity and strong 3'-5' exonuclease activity. Together with ZDP, it plays overlapping roles in the maintenance of epigenome and genome stability in plants. |
| AT3G04080 | Encodes an Golgi-localized integral membrane enzyme with nucleoside diphosphate activity that when mutated in combination with ATAPY2 causes a complete inhibition of pollen germination.With respect to substrate specificity, APY1 shows the following preferences UTP>IDP>GDP. |
| AT5G18280 | Encodes an enzyme with ATPase and ADPase activity (an apyrase) that when mutated in combination with ATAPY1 causes a complete inhibition of pollen germination. |
| AT2G02970 | Encodes a putative apyrase involved in pollen exine pattern formation and anther dehiscence. |
| AT1G14240 | GDA1/CD39 nucleoside phosphatase family protein;(source:Araport11) |
| AT4G38220 | Peptidase M20/M25/M40 family protein;(source:Araport11) |
| AT3G14180 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT2G01440 | Encodes an ortholog of the bacterial RecG translocase, an organellar protein with multiple roles in mtDNA maintenance. The protein is targeted to mitochondria and plastids and is required for recombination-dependent repair and for suppression of ectopic recombination in mitochondria, most likely because of its role in recovery of stalled replication forks. |
| AT1G78790 | Encodes a protein with high similarity to mammalian MHF2 that acts in the same pathway as FANCM to restrain class II meiotic crossing over. |
| AT1G79090 | Encodes a component of the mRNA decapping machinery that is found in complexes with and is phosphorylated by MPK4. The protein can be found in P-bodies after treatment with PAMPs. Pat1 mutants exhibit dwarfism and de-repressed immunity dependent on the immune receptor SUMM2. The pat1 constitutive defense phenotype is suppressed by summ2 such that pat1 summ2 mutants display a wild-type phenotype in response to biotrophic and necrotrophic pathogens. |
| AT3G01310 | Encodes a functional VIP1/PPIP5K-type ATP-grasp kinase that is involved in both InsP6 to InsP7 conversion and InsP7 to InsP8 conversion, producing the InsP8 cofactor of the ASK1-COI1-JAZ-jasmonate co-receptor complex. It is the major isoform in plants, is required for jasmonate-dependent defenses, and plays an important role in plant defenses against necrotrophic fungi and insect herbivores. |
| AT3G54020 | Inositol phosphorylceramide synthase |
| AT5G18270 | NAC domain containing protein 87;(source:Araport11) |
| AT1G77360 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G38520 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G02760 | Encodes a phosphatase that functions in sustaining proper leaf longevity and preventing early senescence by suppressing or perturbing SARK-mediated senescence signal transduction. |
| AT5G66080 | Type 2C protein phosphatase located in the plasma membrane. Functions in heat shock response memory mantainance. |
| AT5G65530 | Encodes a protein kinase involved in mediating resistance to fungi and also trichome branch number. Kinase activity is increased by ROP6 which also affects its sub-cellular localization (becomes localized to the cell periphery_ |
| AT2G33550 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT2G28130 | NSE5 subunit of the SMC5/6 complex. |
| AT1G09730 | Encodes a SUMO protease that positively regulates the transition to flowering in long and short days. Along with SPF2, its activity is required for fertility as asp1/spf2 double mutants have defects in gametogenesis and embroygenesis. |
| AT1G49220 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G72200 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G30400 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G43420 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G17245 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G35840 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G40070 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G37580 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G34990 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G40250 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G57750 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G03550 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G18670 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G33480 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G47560 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G18930 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G46160 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G61550 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G10150 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G49200 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G49210 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G18773 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G47610 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G33565 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G28920 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G60966 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G20395 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G46493 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G53110 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G21630 | TPLATE Adaptor complex subunit. |
| AT1G17860 | Member of Kunitz trypsin inhibitor (KTI) family involved in plant defense response against spider mites. |
| AT5G61670 | Encodes a close homolog of the Cauliflower OR (Orange) protein that is located in the chloroplast of light grown organs but in the nucleus of etiolated cotyledons. The function of OR is to induce the differentiation of proplastids or other noncolored plastids into chromoplasts for carotenoid accumulation. Both proteins contain a Cysteine-rich zinc finger domain that is highly specific to DnaJ-like molecular chaperons. The AtOR protein interacts directly with the PSY (phytoene synthase) protein and acts as a positive posttranscriptional regulator of its expression, thereby affecting carotenoid biosynthesis. |
| AT3G05200 | Encodes a putative RING-H2 zinc finger protein ATL6 (ATL6). The mRNA is cell-to-cell mobile. |
| AT2G35000 | ATL9 is an E3 ligase-like protein that is induced by chitin oligomers and contributes to fungal resistance.It differs from other members of the ATL family in that it has a PEST domain. It is a short lived protein that is subject to proteosome mediated degradation. It is expressed in many aerial tissues in a pattern that varies with developmental stage. |
| AT1G30680 | Twinkle is a dual localized (mitochondria and chloroplast) DNA primase-helicase. It synthesizes RNA primers from a 5′ -(G/C)GGA-3′ template, where the last two 3' nucleotides are cryptic. Mitochondrial protein involved in DNA replication which binds to DNA polymerases, Pol1A and Pol1B. |
| AT4G37450 | AGP18 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP17 and AGP19, other lysine-rich AGPs. It is expressed in young leaves, shoots, roots and flowers and is active in the regulation of the selection and survival of megaspores. |
| AT5G64310 | Encodes arabinogalactan-protein (AGP1). The mRNA is cell-to-cell mobile. |
| AT4G09030 | Encodes arabinogalactan protein (AGP10). The mRNA is cell-to-cell mobile. |
| AT3G01700 | Encodes an arabinogalactan protein that is expressed in pollen, pollen sac and pollen tube. Loss of AGP11 function results in decreased fertility due to defects in pollen tube growth. |
| AT3G13520 | Encodes a GPI-anchored arabinogalactan (AG) peptide with a short 'classical' backbone of 10 amino acids, seven of which are conserved among the 4 other Arabidopsis AG peptides. These peptides may be involved in cell signaling. |
| AT5G56540 | Encodes arabinogalactan protein (AGP14). Mutants exhibit longer root hairs. The mRNA is cell-to-cell mobile. |
| AT5G11740 | Encodes arabinogalactan protein (AGP15). The mRNA is cell-to-cell mobile. |
| AT2G46330 | Encodes arabinogalactan protein (AGP16). |
| AT2G22470 | Encodes arabinogalactan-protein (AGP2). |
| AT3G61640 | arabinogalactan protein 20;(source:Araport11) |
| AT5G53250 | arabinogalactan protein 22;(source:Araport11) |
| AT5G40730 | Encodes an arabinogalactan-protein (AGP24). |
| AT5G18690 | arabinogalactan protein 25;(source:Araport11) |
| AT2G47930 | arabinogalactan protein 26;(source:Araport11) |
| AT5G10430 | Encodes arabinogalactan-protein (AGP4) that is expressed in female reproductive tissues. It is involved in promoting degeneration of the persistent synergid after fertilization. In mutant ovules, the persistent synergid does not degrade resulting in polytuby. |
| AT5G65390 | arabinogalactan protein 7;(source:Araport11) |
| AT2G14890 | putative proline-rich protein (At2g14890) mRNA, complete The mRNA is cell-to-cell mobile. |
| AT4G16130 | Arabinokinase. |
| AT3G45230 | Encodes the arabinogalactan protein core of plant cell wall proteoglycan that contains arabinogalactan and cell wall matrix glycan pectin and/or xylan domains. |
| AT5G36925 | hypothetical protein;(source:Araport11) |
| AT3G17660 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes; AGD15 belongs to the class 4, together with AGD14. |
| AT5G54310 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. Regulates membrane trafficking and organ separation. |
| AT4G17890 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT1G24120 | encodes a DnaJ-like protein similar to ARG1 and ARL2 that are both involved in root and hypocotyl gravitropism response. However, null mutation in this gene does not result in defects in gravitropism. Gene is expressed in all tissues examined. |
| AT4G34710 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1. |
| AT5G05700 | Encodes an arginyl-tRNA:protein transferase (ATE1), a component of the N-end rule pathway that targets protein degradation through the identity of the amino-terminal residue of specific protein substrates. Arabidopsis contains two ATE genes: At5g05700/ATE1, At3g11240/ATE2. Another component of the N-end rule pathway is At5g02310/PROTEOLYSIS6 (PRT6). PRT6 and ATE were shown to regulate seed after-ripening, seedling sugar sensitivity, seedling lipid breakdown, and abscisic acid (ABA) sensitivity of germination. Mutants of ATE1 also display delayed leaf senescence and altered responses to pathogens. |
| AT1G16610 | Encodes SR45, a member of the highly conserved family of serine/arginine-rich (SR) proteins, which play key roles in pre-mRNA splicing and other aspects of RNA metabolism. SR45 is a spliceosome protein, interacts with SR33 and the U1-70K protein of the U1 snRNP. Also involved in plant sugar response. sr45-1 mutation confers hypersensitivity to glucose during early seedling growth. |
| AT3G61860 | encodes an arginine/serine-rich splicing factor. transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT2G46610 | Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT1G48410 | Encodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus. |
| AT2G27040 | AGO4 is a member of a class of PAZ/PIWI domain containing proteins involved in siRNA mediated gene silencing.Loss of function mutations have reduced site specific CpNpG and CpHpH methylation, abnormal ovule/megagametophyte develoment and increased susceptibility to bacterial pathogens including Tobacco rattle virus. |
| AT2G32940 | Encodes a nuclear localized 879-amino-acid protein that contains conserved PAZ and PIWI domains that is important for the accumulation of specific heterochromatin-related siRNAs, and for DNA methylation and transcriptional gene silencing. |
| AT1G69440 | Encodes ARGONAUTE7, a member of the ARGONAUTE family, characterised by the presence of PAZ and PIWI domains. Involved in the regulation of developmental timing. Required for the accumulation of TAS3 ta-siRNAs but not for accumulation of miR171, miR173, miR390 or mi391. Localized in mature rosette leaves and floral buds. |
| AT2G44080 | Encodes ARL, a gene similar to ARGOS involved in cell expansion-dependent organ growth. Upregulated by brassinosteroid. Acts downstream of BRI1. The mRNA is cell-to-cell mobile. |
| AT1G16060 | Encodes ADAP, an AP2-domain protein that interacts with ARIA. ADAP is a positive regulator of the ABA response and is also involved in regulating seedling growth. |
| AT2G31760 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G63760 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G31770 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G01950 | Encodes a member of the armadillo/beta-catenin repeat kinesin motor family. Mutants have twisted roots due to abnormal cell file rotation; the phenotype is dependent on microtubules. |
| AT5G66200 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT4G36030 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT1G11790 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT5G22630 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile. |
| AT3G11900 | encodes an amino acid transporter that transports aromatic and neutral amino acids, IAA, and 2,4-D. Expressed in all tissues with highest abundance in flowers and cauline leaves. a member of a small gene family in Arabidopsis and represents a new class of amino acid transporters. |
| AT1G68310 | Encodes a protein that has been shown to specifically interact with a sequence motif, PIEPPPHH, in the cytoplasmic tail of a membrane protein that directs the protein from the ER to vacuoles where it is internalized. Required for both leaf adaxial?abaxial polarity formation and normal cell proliferation. It is part of a protein complex with CIA1, NAR1, and MET18, which are highly conserved in eukaryotes and are involved in the biogenesis of cytosolic and nuclear Fe-S proteins. |
| AT1G07890 | Encodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. The mRNA is cell-to-cell mobile. |
| AT1G05970 | Anti-silencing factor. Forms a complex with ASI1-EDM2 that is required for expression of some nonintronic HC-TRE genes |
| AT3G02890 | PHD protein which cooperates with PAIPP2 and BAH domain protein AIPP3 to read H3K4 histone marks. The BAH-PHD bivalent histone reader complex silences a substantial subset of H3K27me3-enriched loci, including development and stress response-related genes. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
| AT4G11560 | BAH domain protein which cooperates with PHD protein AIPP2 to read H3K27me3 histone marks. The BAH-PHD bivalent histone reader complex silences a substantial subset of H3K27me3-enriched loci, including development and stress response-related genes. Responsible for preventing flowering by suppressing the expression of flowering genes. Binding of BDT1 to the H3K27me3 peptide, which is enhanced by PHD proteins, is critical for preventing early flowering. |
| AT5G65010 | Encodes asparagine synthetase (ASN2). |
| AT5G10240 | Encodes asparagine synthetase (ASN3). |
| AT2G47760 | Encodes an α-1,3-mannosyltransferase. Plants with mutations in the ALG3 protein have abnormal gylcoslation profiles. They also exhibit abnormal responses to MAMPs possibly because the glycan properties of FL22 are affected. |
| AT5G42050 | Stress responsive asparagine-rich protein. Binds to PevD (Verticillium dahliae ) fungal effector protein. NRP interacts with CRY2, leading to increased cytoplasmic accumulation of CRY2 in a blue light-independent manner (PMID:28633330).NRP also binds FyPP3 and recruits it to endosomes and thus targets it for degradation. |
| AT5G11520 | Encodes the chloroplastic isozyme of aspartate aminotransferase. Involved in aspartate biosynthesis and nitrogen metabolism. mRNA is expressed in senescing leaves. |
| AT1G62800 | Encodes aspartate aminotransferase (Asp4). |
| AT1G31230 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
| AT4G19710 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
| AT3G18490 | Encodes ASPG1 (ASPARTIC PROTEASE IN GUARD CELL 1). Functions in drought avoidance through abscisic acid (ABA) signalling in guard cells. |
| AT1G11910 | Encodes an aspartic proteinase that forms a heterodimer and is stable over a broad pH range (ph 3-8). |
| AT1G10600 | associated molecule with the SH3 domain of STAM 2;(source:Araport11) |
| AT2G37630 | Encodes a MYB-domain protein involved in specification of the leaf proximodistal axis. Mutation results in lobed and dissected leaves with a characteristic asymmetry. Homologous to the Antirrhinum PHANTASTICA (PHAN) and maize ROUGH SHEATH2 (RS2) genes Asymmetric placement of auxin response at the distal leaf tip precedes visible asymmetric leaf growth. Acts alongside AXR1 to exclude BP expression in leaves and with PIN1 to repress BP and promote lateral organ growth. Interacts physically with AS2 to form a complex that binds to the BP promoter and silences BP. Also functions as a regulator of the plant immune response. |
| AT2G42440 | Lateral organ boundaries (LOB) domain family protein;(source:Araport11) |
| AT1G67370 | Meiotic asynaptic mutant 1 (ASY1). ASY1 protein is initially distributed as numerous foci throughout the chromatin. During early G2, the foci are juxtaposed to the nascent chromosome axes to form a continuous axis associated signal. |
| AT2G46980 | Encodes ASY3, a coiled-coil domain protein that is required for normal meiosis. |
| AT2G17410 | AT Rich domain protein. |
| AT3G09470 | Protein similar to UNC93 of C.elegans. Mutants are hypersensitive to ABA treatment and salt sensitive and have disregulated K+ accumulation. |
| AT3G61310 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT5G49700 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
| AT4G22770 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT4G17800 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
| AT4G22810 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
| AT1G14490 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
| AT5G62260 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT4G00200 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT5G46640 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT4G12080 | AT-hook motif nuclear-localized protein 1;(source:Araport11) |
| AT2G42940 | Encodes a nuclear matrix protein with AT-hook DNA binding motifs that acts in the maintenance of genomic integrity by silencing TEs and repeat-containing genes through epigenetic machinery. It interacts with FVE and MSI5 which are components of HDAC corepressor complexes. It is expressed in tapetum during the tetrad stage. |
| AT3G04570 | AT-hook motif nuclear-localized protein 19;(source:Araport11) |
| AT4G14465 | AT-hook protein. Overexpression results in early flowering in short and long days. |
| AT2G45430 | Encodes a nuclear localized AT hook domain containing protein that can bind AT rich DNA in vitro. Overexpression of the gene results in delayed flowering. Is likely to act redundantly with AHL18, AHL27 and AHL29 in the regulation of flowering. It is also involved in both photo- and skotomorphogenesis. |
| AT1G20900 | Encodes an AT hook domain containing protein that acts redundantly with SOB3 to modulate hypocotyl growth inhibition in response to light. |
| AT2G46040 | Encodes a transcriptional activator that is involved in pollen development. ARID1 is expressed in nuclear bodies of microspore, vegetative and generative cells, and binds to and activates DUO during microgametogenesis. |
| AT4G32830 | Encodes a member of a family of Ser/Thr kinases whose activities peak during cell division. Transcripts are abundant in tissues rich in dividing cells like roots and flowers but are low or absent in fully expanded leaves and stems. In interphase cells, the protein is predominantly nuclear. During mitosis, the protein associates with plant-specific cytoskeletal structures (preprophase band, phragmoplast, nascent cell plate) that are necessary for cytokinesis as well as with the microtubule spindle. It specifically phosphorylates Ser10 of histone H3 and colocalizes with phosphorylated histone H3 during mitosis. |
| AT2G25880 | Encodes a member of a family of Ser/Thr kinases whose activities peak during cell division. Transcripts are abundant in tissues rich in dividing cells like roots and flowers but are low or absent in fully expanded leaves and stems. In interphase cells, the protein is predominantly nuclear. During mitosis, the protein associates with plant-specific cytoskeletal structures (preprophase band, phragmoplast, nascent cell plate) that are necessary for cytokinesis as well as with the microtubule spindle. |
| AT2G45490 | Encodes a member of a family of Ser/Thr kinases whose activities peak during cell division. Transcripts are abundant in tissues rich in dividing cells like roots and flowers but are low or absent in fully expanded leaves and stems. In interphase cells, the protein is predominantly nuclear. During mitosis, the protein associates with plant-specific cytoskeletal structures (preprophase band, phragmoplast, nascent cell plate) that are necessary for cytokinesis as well as with the microtubule spindle. The protein is concentrated in nuclear dots arranged around the nucleolus and the nuclear periphery in early prophase cells. |
| AT3G06590 | Encodes RITF1, a bHLH transcription factor that regulates the transcription of several genes involved in the detoxification of reactive oxygen species generated by salt stress. |
| AT3G17100 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT3G05800 | AtBS1(activation-tagged BRI1 suppressor 1)-interacting factor 1;(source:Araport11) |
| AT2G45980 | Encodes an Atg8-interacting protein that is partially associated with the ER during favorable growth conditions and becomes mainly associated with a spherical compartment that dynamically moves along the ER network. In stress induced plants, ATI1 is localized to a novel plastid associated bodies that are transported to vesicles, in what appears to be an autophagy dependent process. ATI1 interacts with number of other plastid proteins such as NPQ4 and APE1. |
| AT3G62690 | Encodes a RING-H2 zinc finger protein related to ATL2. The ATL gene family is represented by fifteen sequences that contain, in addition to the RING, a transmembrane domain which is located in most of them towards the N-terminal end. |
| AT1G09795 | ATP phosphoribosyl transferase, catalyses first step of histidine biosynthesis |
| AT4G09650 | Encodes the chloroplast ATPase delta-subunit. The mRNA is cell-to-cell mobile. |
| AT1G71960 | Encodes a plasma membrane localized ABC transporter involved in abscisic acid transport and responses. |
| AT2G41700 | ATP-binding cassette A1;(source:Araport11) |
| AT5G44110 | Encodes a member of the NAP subfamily of ABC transporters whose expression pattern is regulated by light and sucrose. |
| AT3G47750 | member of ATH subfamily |
| AT2G36910 | Belongs to the family of ATP-binding cassette (ABC) transporters. Also known as AtMDR1.Possibly regulates auxin-dependent responses by influencing basipetal auxin transport in the root. Exerts nonredundant, partially overlapping functions with the ABC transporter encoded by AT3G28860. PGP1 mediates cellular efflux of IAA and interacts with PIN genes that may confer an accelerated vectoral component to PGP-mediated transport. The non-polar localization of PGP1 at root and shoot apices, where IAA gradient-driven transport is impaired, may be required to confer directionality to auxin transport in those tissues. The mRNA is cell-to-cell mobile. |
| AT3G28860 | Encodes a member of the ATP-binding cassette (ABC) transporter family that is involved in auxin transport and is involved in postembryonic organ separation. Also known as AtMDR11 and PGP19. Possibly regulates auxin-dependent responses by influencing basipetal auxin transport in the root. Acts upstream of phyA in regulating hypocotyl elongation and gravitropic response. Exerts nonredundant, partially overlapping functions with the ABC transporter encoded by AtPGP1. |
| AT3G62150 | Encodes a facultative transporter controlling auxin concentrations in plant cells. |
| AT4G28630 | Half-molecule ABC transporter ATM1. Arabidopsis thaliana has three ATM genes, namely ATM1, ATM2 and ATM3. Only ATM3 has an important function for plant growth. |
| AT4G28620 | Half-molecule ABC transporter ATM2. Arabidopsis thaliana has three ATM genes, namely ATM1, ATM2 and ATM3. Only ATM3 has an important function for plant growth. |
| AT1G70610 | member of TAP subfamily |
| AT4G25450 | member of NAP subfamily |
| AT4G01820 | member of MDR subfamily |
| AT2G47000 | Encodes an auxin efflux transmembrane transporter that is a member of the multidrug resistance P-glycoprotein (MDR/PGP) subfamily of ABC transporters. Functions in the basipetal redirection of auxin from the root tip. Exhibits apolar plasma membrane localization in the root cap and polar localization in tissues above and is involved in root hair elongation. |
| AT2G39480 | P-glycoprotein 6;(source:Araport11) |
| AT5G46540 | P-glycoprotein 7;(source:Araport11) |
| AT1G30400 | glutathione S-conjugate transporting ATPase (AtMRP1) mRNA. An ABCC-type arsenite-phytochelatin transporter. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
| AT1G30420 | member of MRP subfamily |
| AT1G30410 | member of MRP subfamily |
| AT3G62700 | member of MRP subfamily |
| AT2G47800 | Encodes a plasma membrane localized ATPase transporter involved in multidrug transport. The expression of this gene is upregulated by herbicide safeners such as benoxacor, fluxofenim and fenclorim. The mRNA is cell-to-cell mobile. |
| AT1G04120 | encodes a high-affinity inositol hexakisphosphate transporter that plays a role in guard cell signaling and phytate storage. It is a member of MRP subfamily / ABC transporter subfamily C. |
| AT3G13640 | member of RLI subfamily |
| AT4G30300 | member of NAP subfamily |
| AT5G60790 | Member of GCN subfamily; essential for translation inhibition under cold stress through interacting with GCN2 to phosphorylate eukaryotic translation initiation factor 2. GCN1 regulated gens are involved in flower development, seed dormancy and seed development, response to osmotic stress, amino acid biosynthesis, photosynthesis, cell wall organization, protein transport and localization, lipid biosynthesis, transcription, macroautophagy, proteolysis and cell death. |
| AT5G64840 | ABCF5 is one of five members of the ABCF gene family in Arabidopsis, which are homologs of the yeast ABCF protein GCN20. |
| AT2G39350 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT1G17840 | Encodes a plasma membrane-localized ATP-binding cassette transporter, that is required for cutin transport to the extracellular matrix. The mRNA is cell-to-cell mobile. |
| AT5G06530 | Encodes ABCG22, an ABC transporter gene. Mutation results in increased water transpiration and drought susceptibility. |
| AT1G53390 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G16340 | Encodes a p-coumaryl alcohol exporter involved in lignin biosynthesis. |
| AT2G36380 | pleiotropic drug resistance 6;(source:Araport11) |
| AT1G15210 | pleiotropic drug resistance 7;(source:Araport11) |
| AT4G15233 | ABC-2 and Plant PDR ABC-type transporter family protein;(source:Araport11) |
| AT2G01320 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G20320 | Encodes a permease-like component of an ABC transporter involved in lipid transfer from ER to chloroplast. A phosphatidic acid-binding protein with a predicted mycobacterial cell entry domain. It is tethered to the inner chloroplast envelope membrane facing the outer envelope membrane. Presumed bacterial orthologs of TGD1 and TGD2 in Gram-negative bacteria are typically organized in transcriptional units, suggesting their involvement in a common biological process. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
| AT1G03900 | member of NAP family, an heterogeneous subfamily of the ATP-binding Cassette (ABC) superfamily of membrane transporters. The NAPs proteins are characterized by having only one nucleotide-binding folds (NBFs) domain. |
| AT1G03905 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G02270 | member of NAP subfamily |
| AT1G60810 | One of the three genes encoding subunit A of the trimeric enzyme ATP Citrate lyase |
| AT3G06650 | One of the two genes encoding subunit B of the trimeric enzyme ATP Citrate lyase |
| AT4G14680 | Encodes one of three A. thaliana ATP-sulfurylases. APS is the first enzyme of sulfate assimilation that catalyzes the formation of adenosine-5'-phosphosulfate from ATP and sulfate. |
| AT5G61810 | Encodes the predominant of three APC isoforms in Arabidopsis, a calcium-dependent mitochondrial ATP-Mg/Pi transporter. |
| AT5G07320 | Encodes an APC isoform in Arabidopsis, a calcium-dependent mitochondrial ATP-Mg/Pi transporter. |
| AT1G13690 | AtE1 - stimulates the ATPase activity of DnaK/DnaJ |
| AT1G56310 | DEDDy-type 3′ -> 5′ exoribonuclease involved in miRNA degradation. |
| AT4G18980 | Encodes a nuclear-targeted protein AtS40-3 that modulates senescence associated gene expression. |
| AT2G24540 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G40800 | TIM domain protein. Associates with components of mitochondrial complex I and III. May be involved in biogenesis of respiratory chain components. |
| AT4G29670 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase. |
| AT2G33270 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. |
| AT2G41350 | Encodes AUG1, likely to be in an augmin-like complex with AUG3. |
| AT2G32980 | HAUS augmin-like complex subunit;(source:Araport11) |
| AT5G40740 | Encodes a conserved AUGMIN subunit 6 (AUG6) which is known to be involved in microtuble nucleation. Mutants affect both male and female gametogenesis. |
| AT5G17620 | nuclear matrix protein;(source:Araport11) |
| AT3G22910 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
| AT2G41560 | Encodes a calmodulin-regulated Ca(2+)-ATPase that improves salt tolerance in yeast. Localized to the vacuole. Lesion mimic phenotype when mutation in the gene is combined with a mutation in ACA11. Lesion mimic phenotype of double knockout can be suppressed by nutritional supplements that increase anion levels (e.g. 15 mM Nitrate, Chloride, or Phosphate). |
| AT5G57110 | Arabidopsis-autoinhibited Ca2+ -ATPase, isoform 8, contains all of the characteristic motifs of Ca2+ -transporting P-type Ca2+ -ATPases and is localized to the plasma membrane. |
| AT3G57330 | Lesion mimic phenotype when mutation in the gene is combined with a mutation in ACA4. Lesion mimic phenotype of double knockout can be suppressed by nutritional supplements that increase anion levels (e.g. 15 mM Nitrate, Chloride, or Phosphate) |
| AT1G54210 | Autophagy protein. |
| AT3G13970 | Autophagy protein. |
| AT5G50230 | autophagy-related (ATG) gene |
| AT2G44140 | Autophagy protein |
| AT5G17290 | Autophagy protein ATG5. Forms a conjugate with ATG12 with an essential role in plant nutrient recycling. Mutants missing ATG5 display early senescence and are hypersensitive to nitrogen or carbon starvation, accompanied by a more rapid loss of organellar and cytoplasmic proteins. |
| AT4G21980 | Encodes APG8, a component of autophagy conjugation pathway. Delivered to the lumens of vacuole under nitrogen-starvation condition. Highest expression in flowers. mRNA abundance increased during dark-induced carbon starvation. Predominantly cytoplasmic with or without N starvation. Upon concanamycin A the protein accumulates in the central vacuole as punctuate structures that resemble autophagic bodies. This localization is more abundant upon N starvation. The mRNA is cell-to-cell mobile. |
| AT1G62040 | Autophagy protein. |
| AT2G45170 | Involved in autophagy. Under nutrient starvation the protein localizes to autophagosomes. Involved in submergence (hypoxia) tolerance; ethanol induces autophagy. |
| AT4G16520 | Autophagy protein. |
| AT3G60640 | Autophagy protein. |
| AT3G15580 | Encodes APG8, a component of autophagy conjugation pathway. Delivered to the lumens of vacuole under nitrogen-starvation condition. |
| AT3G06420 | Autophagy protein. |
| AT5G66930 | meiotically up-regulated protein;(source:Araport11) |
| AT3G49590 | Autophagy protein. |
| AT5G05150 | autophagy-related protein 18E;(source:Araport11) |
| AT3G61960 | autophagy gene |
| AT1G21660 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT4G36520 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G49980 | auxin F-box protein 5;(source:Araport11) |
| AT5G43700 | Auxin inducible protein similar to transcription factors. |
| AT2G38120 | Encodes an auxin influx transporter. AUX1 resides at the apical plasma membrane of protophloem cells and at highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning. Shoot supplied ammonium targets AUX1 and inhibits lateral root emergence. The mRNA is cell-to-cell mobile. |
| AT1G04250 | Transcription regulator acting as repressor of auxin-inducible gene expression. Auxin-inducible AUX/IAA gene. Short-lived nuclear protein with four conserved domains. Domain III has homology to beta alpha alpha dimerization and DNA binding domains. Involved in auxin signaling and is a positive modulator of natural leaf senescence. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. |
| AT1G54990 | auxin response mutant (AXR4) The mRNA is cell-to-cell mobile. |
| AT2G28350 | Involved in root cap cell differentiation. |
| AT1G19220 | Encodes an auxin response factor that contains the conserved VP1-B3 DNA-binding domain at its N-terminus and the Aux/IAA-like domains III and IV present in most ARFs at its C-terminus. The protein interacts with IAA1 (yeast two hybrid) and other auxin response elements such as ER7 and ER9 (yeast one hybrid). ARF19 protein can complement many aspects of the arf7 mutant phenotype and , together with ARF7, is involved in the response to ethylene. In the arf7 arf19 double mutant, several auxin-responsive genes (e.g. IAA5, LBD16, LBD29 and LBD33) are no longer upregulated by auxin. |
| AT5G62000 | Encodes an auxin response factor. Mutants have many defects including enlarged rosette leaves, reduced fertility, later senescence, hypocotyl elongation defects, enlarged seeds and enlarged cotyledons. May not mediate auxin effects. Increase in seed size due to increased cell proliferation. The mRNA is cell-to-cell mobile. |
| AT1G30330 | Encodes a member of the auxin response factor family. Mediates auxin response via expression of auxin regulated genes. Acts redundantly with ARF8 to control stamen elongation and flower maturation. Expression of ARF6 is controlled by miR167. |
| AT5G37020 | Encodes a member of the auxin response factor family. Mediates auxin response via expression of auxin regulated genes. Acts redundantly with ARF6 to control stamen elongation and flower maturation. Expression of ARF8 is controlled by miR167. |
| AT4G24390 | RNI-like superfamily protein;(source:Araport11) |
| AT1G78100 | F-box family protein;(source:Araport11) |
| AT3G07390 | isolated from differential screening of a cDNA library from auxin-treated root culture. sequence does not show homology to any known proteins and is predicted to be extracellular. The mRNA is cell-to-cell mobile. |
| AT2G33310 | Auxin induced gene, IAA13 (IAA13). |
| AT2G32410 | Involved in chiasma distribution, affects expression of key DNA repair and meiotic genes, signifcant role in DNA repair. |
| AT1G28050 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT1G25440 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT1G73870 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT1G49130 | Regulated by heat shock. |
| AT4G38960 | BBX19 is a B-box containing transcriptional regulator involved in photomorphogenesis and flowering. |
| AT1G75540 | Encodes a B-box zinc finger transcription factor BBX21 (also named STH2/salt tolerance homolog2 and LHUS/long hypocotyl under shade). Interacts with COP1 to control de-etiolation. Also genetically interacts with COP1 to regulate shade avoidance. The mRNA is cell-to-cell mobile. |
| AT1G68190 | B-box zinc finger family protein;(source:Araport11) |
| AT4G27310 | Encodes an atypical B-box domain protein that negatively regulates photomorphogenic development by interfering with the binding of the transcription factor HY5 to target gene promoters. Degradation of BBX28 in darkness is dependent on COP1 and occurs via the 26S proteasome pathway. BBX28 acts as a key factor in the COP1-HY5 regulatory hub by maintaining proper HY5 activity to ensure normal photomorphogenic development in plants. Interacts with CO via B-box domain resulting in decreased FT expression and delayed flowering. |
| AT5G54470 | B-box type zinc finger family protein;(source:Araport11) |
| AT4G15248 | B-box type zinc finger family protein;(source:Araport11) |
| AT3G21890 | B-box type zinc finger family protein;(source:Araport11) |
| AT3G21150 | Encodes a protein with a B-box domain predicted to act as a transcription factor. Expression of the BBX32 gene is affected by monochromatic red light. Genetic analysis shows BBX32 is under circadian control; it is a morning gene under clock regulation. |
| AT5G48250 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT3G18080 | B-S glucosidase 44;(source:Araport11) |
| AT1G16270 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
| AT3G23750 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G27190 | Activated by TCP8/14/15/22, involved in modulation of GA-dependent stamen filament elongation. |
| AT2G35260 | CAAX protease self-immunity protein;(source:Araport11) |
| AT4G17840 | CAAX protease self-immunity protein;(source:Araport11) |
| AT3G45260 | BIB is a member of the BIRD family of zinc finger proteins that includes JKD. BIB functions redundantly with JKD to retain SHR in the nucleus and thereby restrict SHR movement in root tissues. |
| AT5G15160 | BNQ2 belongs to a family of atypical non-DNA binding basic helix-loop-helix (bHLH) proteins that heterodimerize with and negatively regulate bHLH transcription factors. Directly and negatively regulated by AP3 and PI in petals.Required for appropriate regulation of flowering time. |
| AT5G65700 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM2,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM1 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. The mRNA is cell-to-cell mobile. |
| AT3G49670 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM1,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM2 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. The mRNA is cell-to-cell mobile. |
| AT3G12500 | encodes a basic chitinase involved in ethylene/jasmonic acid mediated signalling pathway during systemic acquired resistance based on expression analyses. |
| AT4G29100 | Member of basic helix loop helix protein family. Expressed primarily in vascular system. Overexpression causes ABA sensitivity. Together with PFA1 and PFA2 governs the competence of pericycle cells to initiate lateral root primordium formation. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT2G31220 | Encodes a bHLH transcription factor that together with bHLH089 and bHLH091 is important for the normal transcriptome of the developing Arabidopsis anther, possibly by forming a feed-forward loop with DYT1. |
| AT1G06170 | Encodes a bHLH transcription factor that together with bHLH010 and bHLH091 is important for the normal transcriptome of the developing Arabidopsis anther, possibly by forming a feed-forward loop with DYT1. Recognizes the TCATGTGC box to activate the expression of target genes, including ATA20, EXL4, and MEE48. |
| AT1G51070 | bHLH115 is a basic helix loop helix protein of the IVc subgroup that plays a role in iron homeostasis. It interacts with related family members and targets PYE and other genes involved in response to Fe. |
| AT3G23210 | bHLH34 is a basic helix loop helix transcription factor. It can bind GAGA and E-box cis elements.It is induced by abiotic stressors including ABA, salt and glucose. PGR, a plasma membrane glucose responsive regulator is a target of bHLH34. Involved in Fe regulation. |
| AT2G41240 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT3G51960 | bZIP transcription factor induced by salt stress and promoted salt tolerance. Localized to the cytoplasm and nucleus under control conditions and targeted preferentially to the nucleus under salt stress |
| AT3G54620 | bZIP transcription factor-like protein mRNA |
| AT5G49450 | Encodes a transcription activator is a positive regulator of plant tolerance to salt, osmotic and drought stresses. |
| AT2G18160 | Encodes a b-ZIP transcription factor. |
| AT4G38900 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT5G15830 | basic leucine-zipper 3;(source:Araport11) |
| AT1G75390 | basic leucine-zipper 44;(source:Araport11) |
| AT2G04038 | basic leucine-zipper 48;(source:Araport11) |
| AT3G49760 | basic leucine-zipper 5;(source:Araport11) |
| AT1G06850 | bZIP protein involved in heat stress response. Under heat stress localization moves exclusively to nucleus. |
| AT2G22850 | basic leucine-zipper 6;(source:Araport11) |
| AT1G06070 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT1G14685 | Encodes a member of the BASIC PENTACYSTEINE (BPC) proteins. BPC proteins are plant-specific transcription factors present throughout land plants. BPC transcription factor family is integral for a wide range of processes that support normal growth and development.Along with BPC1, BPC2 binds to the promoter of and represses GALS1 thereby reducing beta 1,4- galactan accumulation. |
| AT4G38910 | Encodes a basic pentacysteine protein that is localized to the nucleus and specifically binds in vitro to GA dinucleotide repeats. |
| AT2G01930 | BASIC PENTACYSTEINE1 (BPC1) is a regulator of the homeotic Arabidopsis thaliana gene SEEDSTICK (STK), which controls ovule identity. BPC1 induces conformational changes by cooperative binding to purine-rich elements present in the STK regulatory sequence. STK is upregulated in bpc1 mutant.Along with BPC2, BPC1 binds to the promoter of and represses GALS1 thereby reducing beta 1,4- galactan accumulation. |
| AT3G09000 | Encodes a microtubule-associated protein. Plays a minor role in cortical microtubule organization during leaf development. |
| AT3G08670 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT3G51540 | mucin-5AC-like protein;(source:Araport11) |
| AT3G62420 | Encodes a group-S bZIP transcription factor. Forms heterodimers with group-C bZIP transcription factors. The heterodimers bind to the ACTCAT cis-element of proline dehydrogenase gene. |
| AT1G42990 | bZIP60 consists of a bZIP DNA binding domain followed by a putative transmembrane domain. bZIP60 mRNA is upregulated by the addition of ER stress inducers, tunicamycin (inhibitor of N-linked glycosylation), DTT (inhibitor of disulfide bond formation) and azetin-2-carboxylate (proline analog perturbing protein structure). Upon ER stress, bZIP60 mRNA is spliced by IRE1A and IRE1B to produce bZIP60-S, an active transcription factor without the transmembrane domain. bZIP60-U, a product of unspliced form of bZIP60 mRNA, is localized at the ER membrane and bZIP60-S is localized in the nucleus. |
| AT3G56660 | basic region/leucine zipper motif protein 49;(source:Araport11) |
| AT2G35530 | Encodes a G group bZIP transcription factor family member that can bind cis elements with an ACGT core, such as G-box, Hex, C-box and As-1. The protein is localized in the nucleus and can homodimerize and can heterodimerize with other G group members. |
| AT1G32150 | Encodes a G group bZIP transcription factor family member that can bind cis elements with an ACGT core, such as G-box, Hex, C-box and As-1. The protein is localized in the nucleus and can homodimerize and can heterodimerize with other G group members. |
| AT5G47120 | Encodes BI-1, a homolog of mammalian Bax inhibitor 1. Functions as an attenuator of biotic and abiotic types of cell death. Bax-induced cell death can be downregulated by ectopically expressing AtBI in planta. The mRNA is cell-to-cell mobile. |
| AT3G60080 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G10815 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G55530 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G56130 | biotin/lipoyl attachment domain-containing protein;(source:Araport11) |
| AT5G52060 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT5G07220 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT3G51780 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. BD domain of ATBAG4 had highest similarity to human DB domain of BAG protein. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT5G62390 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. Localized to the ER. Necessary for the proper maintenance of the unfolded protein response during heat and cold tolerance. |
| AT1G58230 | binding protein;(source:Araport11) |
| AT2G35940 | Encodes a member of the BEL-like homeodomain protein family. Ecotopic expression in the embryo sac leads to defects in nuclear migration and cellularization and embryo sacs with multiple egg cells. Loss of function alleles have no female gametophyte defects. The ecotopic expression phenotype requires KNAT3 because it can be suppressed by loss of KNAT3 function alleles. Localized to the nucleus but interaction with OFP1 relocates it to the cytoplasm. |
| AT1G19700 | Encodes a member of the BEL family of homeodomain proteins. Its interaction with PLP (PAS/LOV PROTEIN) is diminished by blue light. |
| AT4G36870 | Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw1/saw2 may act redundantly to repress BP in leaves. Regulates together with BLH4 demethylesterification of homogalacturonan in seed mucilage. |
| AT1G75410 | BEL1-like homeodomain 3 (BLH3) |
| AT2G23760 | Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw2 and saw1 may act redundantly to repress BP in leaves. Regulates together with BLH2 demethylesterification of homogalacturonan in seed mucilage. |
| AT2G16400 | BEL1-like homeodomain 7;(source:Araport11) |
| AT4G02990 | Encodes BELAYA SMERT (BSM), a plastid-localized protein homologous to mitochondrial transcription termination factors (mTERF) found in animal. Mutant bsm cells are albino, are compromised in growth, and suffer defects in global plastidic gene expression. The mRNA is cell-to-cell mobile. |
| AT5G41410 | Homeodomain protein required for ovule identity.Loss of function mutations show homeotic conversion of integuments to carpels.Forms heterodimers with STM and KNAT1. Interacts with AG-SEP heterodimers is thought to restrict WUS expression. BEL interacts with MADS box dimers composed of SEP1(or SEP3) and AG, SHP1, SHP2 and STK. The interaction of BEL1 with AG-SEP3 is required for proper integument development and specification of integument identity. |
| AT1G69010 | Encodes BES1-INTERACTING MYC-LIKE 2 (BIM2), a PAR1 (PHYTOCHROME RAPIDLY REGULATED 1)-interacting protein that positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT3G50750 | BES1/BZR1 homolog 1;(source:Araport11) |
| AT4G36780 | BES1/BZR1 homolog 2;(source:Araport11) |
| AT4G18890 | BES1/BZR1 homolog 3;(source:Araport11) |
| AT1G78700 | BES1/BZR1 homolog 4;(source:Araport11) |
| AT3G61320 | Encodes a bestrophin-like protein (Best1). Located in the stroma thylakoid membrane. Functions as a chloride ion channel. Proposed to modulate proton motive force partitioning by mediating chloride ion influx in the thylakoid lumen. Major isoform (based on transcript analysis), redundant function with AtBest2. |
| AT3G58170 | Encodes a Bet1/Sft1-like SNARE protein which fully suppresses the temperature-sensitive growth defect in sft1-1 yeast cells; however, it cannot support the deletion of the yeast BET1 gene (bet1Δ). |
| AT1G70410 | Encodes a putative beta-carbonic anhydrase betaCA4. Together with betaCA1 (At3g01500) regulates CO2-controlled stomatal movements in guard cells, as well as attenuates immunity. Differential CA gene expression in response to changing atmospheric CO2 conditions contribute to altered disease resistance levels. |
| AT4G33580 | beta carbonic anhydrase 5;(source:Araport11) |
| AT1G58180 | beta carbonic anhydrase 6;(source:Araport11) |
| AT4G27830 | Encodes a beta-glucosidase that may be responsible for acyl-glucose-dependent anthocyanin glucosyltransferase activity in Arabidopsis. In vitro efforts to demonstrate AAGT activity for BGLU10 have been unsuccessful but experiments with mutants in this gene suggest at least an indirect involvement in anthocyanin formation. |
| AT2G44450 | beta glucosidase 15;(source:Araport11) |
| AT3G60130 | beta glucosidase 16;(source:Araport11) |
| AT2G44480 | beta glucosidase 17;(source:Araport11) |
| AT3G03640 | Encodes beta-glucosidase (GLUC). |
| AT3G60120 | beta glucosidase 27;(source:Araport11) |
| AT2G44470 | beta glucosidase 29;(source:Araport11) |
| AT3G18070 | beta glucosidase 43;(source:Araport11) |
| AT1G61820 | beta glucosidase 46;(source:Araport11) |
| AT3G62740 | beta glucosidase 7;(source:Araport11) |
| AT4G27820 | beta glucosidase 9;(source:Araport11) |
| AT5G65640 | bHLH093/NFL encodes a bHLH transcription factor involved in GA mediated control of flowering time. Mutants are non-flowering in short days and phenotype can be reversed with GA application. Based on the expression of GA biosynthetic genes in the mutant, it likely acts through regulation of GA metabolism. Its expression shows developmental stage and tissue specificity. In short days it is expressed mainly in root tips and SAM, with weak expression in cotyledons throughout development. In LD GUS activity was observed in the hypocotyl and in root tips and SAM throughout the developmental stages. |
| AT1G62710 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteases that is expressed specifically in seeds and is essential for the proper processing of storage proteins. |
| AT5G42100 | encodes a plasmodesmal (Pd)-associated membrane protein involved in plasmodesmal callose degradation, i.e. beta-1,3-glucanase (EC 3.2.1.39), and functions in the gating of Pd |
| AT3G52060 | Encodes a plasmodesmal glycosyltransferase-like protein. Mutation results in defects in seed germination and delayed plant growth. |
| AT3G23920 | Encodes a chloroplast beta-amylase. Is necessary for leaf starch breakdown in the absence of BAM3.Activity of BAM1 increases 4 days after osmotic stress. BAM1 has a higher temperature optimum than BAM3 (PMID:25293962). |
| AT4G00490 | Encodes a chloroplast beta-amylase. The enzyme activity is very weak compared to BAM1 and BAM3. It forms a tetramer whose activity requires K+ and exhibits sigmoidal kinetics Mutants of BAM2 have no visible phenotype. |
| AT5G18670 | putative beta-amylase BMY3 (BMY3) |
| AT5G55700 | In vitro assay indicates no beta-amylase activity of BAM4. However mutation in BAM4 impairs starch breakdown. BAM4 may play a regulatory role. |
| AT2G45880 | Encodes a beta-amylase-like protein present in the nucleus rather than targeted to the chloroplast. Contains BRASSINAZOLE RESISTANT1 (BZR1)-type DNA binding domains. Activates gene expression in protoplast transactivation assays. |
| AT5G52570 | Converts β-carotene to zeaxanthin via cryptoxanthin. |
| AT1G55120 | Encodes a protein with fructan exohydrolase (FEH) activity acting on levan-type fructans (6-FEH, levanase). The enzyme does not have invertase activity. |
| AT1G77410 | beta-galactosidase 16;(source:Araport11) |
| AT3G52840 | beta-galactosidase 2;(source:Araport11) |
| AT5G56870 | beta-galactosidase 4;(source:Araport11) |
| AT5G20710 | beta-galactosidase 7;(source:Araport11) |
| AT2G28470 | putative beta-galactosidase (BGAL8 gene) |
| AT1G61810 | beta-glucosidase 45;(source:Araport11) |
| AT4G21760 | beta-glucosidase 47;(source:Araport11) |
| AT1G65590 | Encodes a protein with beta-hexosaminidase activity. Located on the plasma membrane. |
| AT5G65940 | hydrolyzes beta-hydroxyisobutyryl-CoA |
| AT4G25700 | Converts beta-carotene to zeaxanthin via cryptoxanthin. |
| AT1G67730 | Encodes one of the two Arabidopsis homologues to YBR159w encoding a S. cerevisiae beta-ketoacyl reductase (KCR), which catalyzes the first reduction during VLCFA (very long chain fatty acids, >18 carbon) elongation: KCR1 (At1g67730), KCR2 (At1g24470). Complementation of the yeast ybr159Delta mutant demonstrated that the two KCR proteins are divergent and that only AtKCR1 can restore heterologous elongase activity similar to the native yeast KCR gene. The mRNA is cell-to-cell mobile. |
| AT1G02640 | encodes a protein similar to a beta-xylosidase located in the extracellular matrix. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
| AT4G31490 | Required for plant growth, salt tolerance, and maintenance of the structure of the Golgi apparatus. |
| AT1G75380 | Encodes a nuclease involved in ABA-mediated callose deposition. It has been shown to interact with JAZ proteins, binds to a jasmonic acid-responsive element (JARE) and repress AtJMT expression. |
| AT1G19660 | Wound-responsive family protein;(source:Araport11) |
| AT3G63530 | Encodes a novel E3 ubiquitin ligase that acts as a central negative regulator of Arabidopsis floral organ size. Organ size is limited by restricting the period of proliferative growth, rather than the rate of growth and appears to act in a novel pathway, independent of ANT and JAG. Both mRNA and protein are expressed in all actively growing regions of the plant and the vasculature and the protein is rapidly turned over by proteasome-mediated degradation. |
| AT1G54200 | DNA mismatch repair Msh6-like protein;(source:Araport11) |
| AT3G13980 | SKI/DACH domain protein;(source:Araport11) |
| AT1G69160 | suppressor;(source:Araport11) |
| AT1G59640 | A basic helix-loop-helix encoding gene (BIGPETAL, BPE) involved in the control of petal size. BPE is expressed via two mRNAs derived from an alternative splicing event. The BPEub (AT1G59640.1)transcript is expressed ubiquitously, whereas the BPEp (AT1G59640.2) transcript is preferentially expressed in petals. Plants that lack the petal-expressed variant BPEp have larger petals as a result of increased cell size. BPEp is positively regulated downstream of APETALA3, PISTILLATA, APETALA1 and PISTILLATA3 and is negatively regulated downstream of AGAMOUS. |
| AT4G22840 | Sodium Bile acid symporter family;(source:Araport11) |
| AT1G78560 | Chloroplast inner membrane, pantothenate transporter. |
| AT5G16840 | Binds to ACD11 and fungal elicitor RxLR207. Regulates ROS mediated defense response. |
| AT1G09080 | Heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
| AT5G04430 | Gene model AT5G04430.1 produces active protein. (BTS1S). Binds to ToMV genomic RNA and prevents viral multiplication. |
| AT5G57590 | Encodes a bifunctional enzyme with both dethiobiotin synthetase and diaminopelargonic acid aminotransferase activities that is involved in biotin synthesis. |
| AT1G64150 | Encodes an integral thylakoid membrane protein that is required for normal operation of oxygen-evolving complex (as evidenced by oxygen evolution rates) and for manganese incorporation. PAM71 belongs to a small gene family in Arabidopsis comprising five members. PAM71 is well conserved in the green lineage and shares homology with putative Ca2+/H+ exchangers from yeast (Saccharomyces cerevisiae) (GDT1) and human (Homo sapiens) (TMEM165). |
| AT4G13590 | Chloroplast manganese transporter required for chloroplast manganese homeostasis and photosynthetic function. |
| AT3G57130 | Encodes BOP1. Contains Pfam domain, PF00023: Ankyrin repeat and Pfam domain, PF00651: BTB/POZ domain. Lines carrying recessive mutations exhibit a number of visible defects, most pronounced being ectopic outgrowths of in leaf petioles of rosette leaves. Along with BOP2, BOP1 is required for nectary development and formation of normal abscission zones.Forms homodimers and heterodimers with BOP2. Nuclear localization is required for activity which includes positive regulation of AS2 in leaves. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP1 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP1 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP1 expression is restricted to pedicel axils by BP and PNY. BOP1 promotes KNAT6 (At1g23380) expression.BOP1 Interacts with BIL1/BZR1 and Inhibits BIL1/BZR1 transport into the nucleus. |
| AT2G41370 | Encodes BOP2, a cytoplasmic and nuclear-localized NPR1 like protein with BTB/POZ domain and ankyrin repeats. Interacts with BOP1 and appears to be genetically redundant with BOP1.bop1/bop2 double mutants have longer leaves, often with leaflets on the petiole, asymmetric flowers with extra organs and no nectaries. Also defective in floral organ abscission. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP2 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP2 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP3 expression is restricted to pedicel axils by BP and PNY; promotes KNAT6 (At1g23380) expression. |
| AT5G49550 | Putative homolog of mammalian BLOC-1 Subunit 2. Protein - protein interaction with BLOS1. |
| AT4G18950 | BHP1 is a Raf-like protein kinase involved in mediating blue light dependent stomatal opening. |
| AT3G54810 | Encodes a protein containing a GATA type zinc finger domain that is expressed in the embryo axis and involved in germination. Mutants have a reduced rate of germination even when stratified. |
| AT5G20230 | Encodes a Al-stress-induced gene. Along with TCF, it promotes lignin biosynthesis in response to cold stress. The mRNA is cell-to-cell mobile. |
| AT1G14580 | C2H2-like zinc finger protein;(source:Araport11) |
| AT1G64670 | Encodes a epidermally expressed extracellular protein that likely functions as an alpha-beta hydrolase and is required for normal cuticle formation. Homozygous mutant plants are dwarfed and have abnormal leaves, collapsed cells, reduced numbers of trichomes. The specific role of BDG is unclear: it may function in cutin biosynthesis or as a cross-linking enzyme in the cell wall itself. |
| AT1G79110 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT3G12920 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT3G61190 | Encodes a protein with a C2 domain that binds to BON1 in yeast two hybrid analyses. Its ability to bind to phospholipids is enhanced by calcium ions. Involved in maintaining cell homeostasis. |
| AT2G45760 | encodes a protein that is similar to BONZAI1-binding protein BAP1. |
| AT5G61900 | Encodes a plasma-membrane localized, copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Mutants exhibit temperature-sensitive growth defects and increased hypersensitive response where permissive conditions are low temperature (22 degrees Celsius) and low humidity. Gene is expressed at 22 but not at 28 (restrictive condition) degrees. Lethality of double mutants with BON3 can be partially suppressed by SNC1. Double mutants show defects in development that are genetically separable from hypersensitive/cell death response. |
| AT5G07300 | Encodes a copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. |
| AT4G39630 | translation initiation factor;(source:Araport11) |
| AT1G79420 | C-type mannose receptor (DUF620);(source:Araport11) |
| AT3G19540 | glutamyl-tRNA (Gln) amidotransferase subunit A (DUF620);(source:Araport11) |
| AT1G49840 | glutamyl-tRNA (Gln) amidotransferase subunit A (DUF620);(source:Araport11) |
| AT5G66740 | spindle assembly abnormal protein (DUF620);(source:Araport11) |
| AT3G01210 | ACD11 binding partner, may be involved in negative regulation of ROS-mediated defense response. |
| AT4G17720 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G14340 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
| AT5G32450 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
| AT5G46870 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
| AT1G18400 | Encodes the brassinosteroid signaling component BEE1 (BR-ENHANCED EXPRESSION 1). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT4G36540 | Encodes the brassinosteroid signaling component BEE2 (BR-ENHANCED EXPRESSION 2). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT1G73830 | Encodes the brassinosteroid signaling component BEE3 (BR-ENHANCED EXPRESSION 3). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT4G31910 | Encodes an acyltransferase that can modify brassinosteroids (BRs) by acylation and may modulate endogenous BR levels. |
| AT2G46020 | Encodes a SWI/SNF chromatin remodeling ATPase that upregulates transcription of all three CUC genes and is involved in the formation and/or maintenance of boundary cells during embryogenesis. Also mediates repression of expression of seed storage proteins in vegetative tissues. Interacts strongly with AtSWI3C, also with AtSWI3B, but not with AtSWI3A or AtSWI3D. |
| AT3G03460 | One of two paralogous GLTSCR domain containing proteins and a core component of SWI/SNF complexes. Interacts with BRM and may be responsible for ensuring proper complex assembly and association with chromatin. Function is dependent upon the GLTSCR domain. |
| AT1G55510 | branched-chain alpha-keto acid decarboxylase E1 beta |
| AT1G10060 | encodes a mitochondrial branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. |
| AT1G10070 | Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. Involved in cell wall development. |
| AT3G49680 | Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. |
| AT2G42160 | Encodes a RING domain containing protein BRIZ1. BRIZ1 (At2g42160) and BRIZ2 (At2g26000) proteins form a heteromeric E3 ligase complex required for seed germination and post-germination growth. |
| AT1G75080 | Encodes a positive regulator of the brassinosteroid (BR) signalling pathway that mediates both downstream BR responses and negative feedback regulation of BR biosynthesis. There is evidence for phosphorylation-dependent nucleocytoplasmic shuttling of BZR1. GSK3-like kinases (including BIN2), 14-3-3 proteins, and the phosphatase BSU1 seem to participate in this process. Phosphorylation also appears to affect BZR1's transcriptional activities. |
| AT4G39400 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction. BRI1 ligand is brassinolide which binds at the extracellular domain. Binding results in phosphorylation of the kinase domain which activates the BRI1 protein leading to BR responses. Residue T-1049 and either S-1044 or T-1045 were essential for kinase function in vitro and normal BRI1 signaling in planta. The structure of BRI1 ligand-binding domain has been determined at 2.5A resolution. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. BRI1 appears to be involved in the autonomous pathway that regulates the transition to flowering, primarily through its effects on FLC expression levels, as uncovered by double mutant analyses. This most likely occurs as a result of BRI1-dependent effects on histone acetylation, but not histone triMeH3K4 methylation, at the FLC locus. The mRNA is cell-to-cell mobile. |
| AT5G38970 | Encodes a polypeptide involved in the C-6 oxidation of brassinosteroids. Heterologous expression of the protein in yeast conferred the ability to catalyze multiple reactions in which the C-6 position of 6-deoxocastasterone, 6-deoxotyphasterol, 3-dehydro-6-deoxoteasterone and 6-deoxoteasterone are oxidized. |
| AT3G30180 | Encodes a cytochrome p450 enzyme that catalyzes the last reaction in the production of brassinolide. It is capable of converting 6-deoxocastasterone into castasterone, a C-6 oxidation, as well as the further conversion of castasterone into brassinolide by a Baeyer-Villinger oxidation reaction at C-6, resulting in the formation of an unusual seven-membered lactone ring. The enzyme possesses high affinity for both C28- and C27-Brassinosteroids. The expression of the gene using a CYP85A2 promoter:LUC fusion construct was shown to be under circadian and light control. |
| AT4G18710 | Encodes BIN2, a member of the ATSK (shaggy-like kinase) family. BIN2 functions in the cross-talk between auxin and brassinosteroid signaling pathways. BIN2 regulates root epidermal cell fate specification by phosphorylating EGL3 and TTG1. BIN2-mediated phosphorylation appears to promote BZR1 export from the nucleus. KIB1 interacts with BIN2 blocking its interaction with substrates and promotes BIN2 degradation. |
| AT3G61460 | Encodes a novel ring finger protein and forms an N-terminal hydrophobic domain and a C-terminal RING-H2 signature. Expression is down regulated by brassinolide. |
| AT4G35230 | Encodes BR-signaling kinase 1 (BSK1), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
| AT4G00710 | Encodes BR-signaling kinase 3 (BSK3), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
| AT5G41260 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
| AT3G15120 | Encodes BRP1, an ATPase domain-containing protein that interacts with BRAT1 to negatively regulate transcriptional silencing at methylated genomic regions. |
| AT5G01630 | Ortholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with with both Rad51 and Dss1(I) or both Dmc1 and Dss1(I) in a tripartite complex. |
| AT4G00020 | Ortholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with either AtRad51 or AtDmc1 and ATDSS1(I). Involved in embryo sac development and defense gene transcription during plant immune responses. |
| AT1G04020 | Encodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein-protein interactions. Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression. |
| AT1G31880 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. BRX encodes a key regulator of cell proliferation and elongation in the root, which has been implicated in the brassinosteroid (BR) pathway as well as regulation of auxin-responsive gene expression. Also involved in cytokinin-mediated inhibition of lateral root initiation. A loss-of-function allele, named brx-2 in Rodrigues et al. (2009) Plant Physiol. but changed to brx-3 to resolve nomenclature conflict (Li et al. Planta 2009:229(3):593-603), shows enhanced response to ABA-mediated inhibition of root growth. Plasma-membrane-associated element of a molecular rheostat that modulates auxin flux through developing protophloem sieve elements (PPSEs) while interacting with PAX, thereby timing PPSE differentiation. Dampens PIN-mediated auxin efflux. |
| AT2G35600 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
| AT1G54180 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
| AT5G42750 | Encodes a plasma-membrane associated phosphoprotein that interacts directly with the kinase domain of BRI1 through the evolutionarily conserved C-terminal BIM motif binding to the C-lobe of the BRI1 kinase domain. It interferes with the interaction between BRI1 with its signalling partner, the plasma membrane localised LRR-receptor kinase BAK1 by inhibiting the transphosphorylation to keep BRI1 at a basal level of activity. It is phosphorylated by BRI1 at Ser270 & Ser274 and at tyrosine site Tyr211 and dissociates from plasma membrane to end up in the cytosol after phosphorylation. Its loss-of-function mutant shows higher sensitivity to BR treatment. |
| AT4G30610 | Encodes a secreted glycosylated serine carboxypeptidase with broad substrate preference that is involved in brassinosteroid signalling via BRI1. It is proteolytically processed in vivo by a separate as yet unidentified protease. |
| AT4G03080 | Protein phosphatase which promotes stomatal ACD by establishing kinase-based signalling asymmetry in the two daughter cells. |
| AT1G08420 | Protein phosphatase which promotes stomatal ACD by establishing kinase-based signalling asymmetry in the two daughter cells. |
| AT2G45400 | involved in the regulation of brassinosteroid metabolic pathway |
| AT4G33430 | Leu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. Contributes to postinvasive immunity against Alternaria brassicola. |
| AT1G19350 | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes. Works with BRAVO to regulate QC division in the root. AT1G19350.3(BES1-L) is the long isoform of BES1. It contains an additive N-terminal NLS compared with the canonical BES1-S. This recently evolved isoform is expressed specifically in the Arabidopsis lineage |
| AT2G38740 | HAD-type phosphosugar phosphatase. |
| AT3G01770 | Bromodomain protein that functions as a negative regulator of sugar and ABA signaling. |
| AT5G55040 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
| AT1G76380 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
| AT5G59570 | Encodes BOA (BROTHER OF LUX ARRHYTHMO), a component of the circadian clock. The mRNA is cell-to-cell mobile. |
| AT3G18290 | Encodes BRUTUS (BTS), a putative E3 ligase protein with metal ion binding and DNA binding domains, which negatively regulates the response to iron deficiency. The mRNA is cell-to-cell mobile. |
| AT1G74770 | zinc ion binding protein;(source:Araport11) |
| AT3G63310 | Mediates cell elongation in brassinosteroid signaling. |
| AT2G40400 | Encodes a chloroplast localized protein of unknown function that is involved in regulation of chloroplast development. |
| AT5G67480 | BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves. |
| AT4G37610 | BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves. |
| AT5G21010 | Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). |
| AT1G50280 | BTB/POZ protein that forms a complex with CUL3a. Involved in repression of ABA responses. |
| AT3G19590 | Encodes a protein that may have a role in the spindle assembly checkpoint. |
| AT1G49910 | Encodes a homolog of the yeast and human BUB3 (BUDDING UNINHIBITED BY BENZYMIDAZOL 3) protein. Yeast and human BUB3s function in spindle assembly checkpoint control. |
| AT5G04480 | Encodes a protein with sequence similarity to glycosyltransferases that is localized to the golgi apparatus and is involved in pollen tube development. |
| AT5G18930 | S-adenosylmethionine decarboxylase family member. |
| AT3G17590 | Encodes the Arabidopsis homologue of yeast SNF5 and represents a conserved subunit of plant SWI/SNF complexes. |
| AT1G01550 | Encodes a protein with no functionally characterized domains that to prevent the synthesis of a novel substance that moves from the root to the shoot, where it modifies shoot growth by interfering with auxin signaling. Synthesis and delivery of this substance requires neither phloem nor endodermis. |
| AT2G46080 | Encodes a protein related to BYPASS1 (BPS1). Regulates production of mobile compound: bps signal. |
| AT4G01360 | Encodes a protein related to BYPASS1 (BPS1). Regulates production of mobile compound: bps signal. |
| AT1G18740 | DUF793 domain containing protein. Expression is induced by cold. Loss of function mutations are more sensitive to freezing and have reduced levels of CBFs. May act by preventing degradation of CBFs. |
| AT1G19490 | Putative bZIP transcription factor. Expression is induced by drought and mutants are sensitive to drought. |
| AT4G39070 | Encodes BZS1, a brassinosteroids-regulated BZR1 target (BRBT) gene. BZS1 is a putative zinc finger transcription factor. Expression of BZS1 was increased under BR-deficient condition and repressed by BR. Transgenic Arabidopsis plants overexpressing BZS1 showed a hypersensitivity to the BR biosynthetic inhibitor brassinazole (BRZ). In contrast, transgenic plants expressing reduced level of BZS1 had longer hypocotyls than wild type when grown on BRZ. |
| AT5G51990 | encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF4). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to drought stress and abscisic acid treatment, but not to low temperature. |
| AT4G25490 | Transcriptional activator that binds to the DRE/CRT regulatory element and induces COR (cold-regulated) gene expression increasing plant freezing tolerance. It encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. |
| AT4G25470 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature, abscisic acid, and circadian rhythm. Overexpressing this gene leads to increased freeze tolerance and induces the expression level of 85 cold-induced genes and reduces the expression level of 8 cold-repressed genes, which constitute the CBF2 regulon. Mutations in CBF2 increases the expression level of CBF1 and CBF3, suggesting that this gene may be involved in a negative regulatory or feedback circuit of the CBF pathway. |
| AT1G11530 | Encodes a monocysteinic thioredoxin, thioredoxin in which the second cysteine of the redox site is replaced by a serine, with low disulfide reductase but efficient disulfide isomerase activity. The mRNA is cell-to-cell mobile. |
| AT2G33540 | C-terminal domain phosphatase-like 3;(source:Araport11) |
| AT3G19600 | Encodes a Ser-2-specific RNAPII CTD phosphatase with two tandem-repeated CTD phosphatase domains that belongs to the group III CTD phosphatase-like (CPL) family. It positively regulates ABA and drought responses. |
| AT3G17980 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT1G73580 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G56170 | Encodes a calcium-dependent nuclease with similarity to staphylococcal nuclease. |
| AT5G46370 | Encodes AtTPK2 (KCO2), a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK2 is targeted to the vacuolar membrane. May form homomeric ion channels in vivo. |
| AT4G01840 | Encodes AtTPK5, a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK5 is targeted to the vacuolar membrane. May form homomeric ion channels in vivo. |
| AT4G18160 | Encodes AtTPK3 (KCO6), a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK3 is found in the thylakoid stromal lamellae. May form homomeric ion channels in vivo. It modulates the partitioning of the proton motive force (pmf) between the delta psi and delta pH in chloroplasts in vivo at physiological light intensities. Vacuolar K+-conducting TPC1 and TPK1/TPK3 channels act in concert to provide for Ca2+- and voltageinduced electrical excitability to the central organelle of plant cells. |
| AT5G49480 | AtCP1 encodes a novel Ca2+-binding protein, which shares sequence similarities with calmodulins. The expression of AtCP1 is induced by NaCl. The mRNA is cell-to-cell mobile. |
| AT4G27280 | EF-hand Ca2 + -binding protein, which is a Ca2+-dependent transducer of auxin-regulated gene expression and interacts with ICR1. |
| AT5G44070 | Phytochelatin synthase gene confers tolerance to cadmium ions. Catalyzes phytochelatin (PC) synthesis from glutathione (GSH) in the presence of Cd2+, Zn2+, Cu2+ and Fe3+, but not by Co2+ or Ni2+. The mRNA is cell-to-cell mobile. |
| AT4G34050 | Methyltransferase in the lignin biosynthetic pathway. |
| AT4G26570 | member of AtCBLs (Calcineurin B-like Calcium Sensor Proteins) |
| AT5G21326 | Ca2+regulated serine-threonine protein kinase family protein;(source:Araport11) |
| AT4G17615 | Member of AtCBL (Calcineurin B-like Calcium Sensor Proteins) family. Protein level is increased upon high salt, mannitol, and cold stresses. CBL1 interacts with CIPK23 and recruits the kinase to the plasma membrane where the substrate(s) of CIPK23 may reside. CBL1 localization is regulated by protein modification including myristolation and acylation. |
| AT4G01420 | Encodes calcineurin B-like protein 5 (CBL5). Overexpression confers tolerance to drought and salt stress. |
| AT1G64480 | calcineurin B-like protein 8, member of plant-specific family of calcium sensor proteins containing 3 EF-hand motifs |
| AT5G47100 | member of AtCBLs (Calcineurin B-like Calcium Sensor Proteins. CBL9 interacts with and targets CIPK23 to the plasma membrane in vivo. |
| AT4G32820 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G37640 | Encodes a calmodulin-regulated Ca(2+)-pump located in the endoplasmic reticulum. Belongs to plant 2B ATPase's with an N-terminal autoinhibitor. |
| AT1G16020 | vacuolar fusion protein (DUF1712);(source:Araport11) |
| AT5G04870 | A calcium-dependent protein kinase that can phosphorylate phenylalanine ammonia lyase (PAL), a key enzyme in pathogen defense.Phosphorylates, in vivo, the transcription factor ORE1, a master regulator of senescence. |
| AT2G17290 | Encodes calcium dependent protein kinase 6 (CPK6), a member of the Arabidopsis CDPK gene family. CDPKs contain an intrinsic Ca2+-activation domain with four EF hand Ca2+-binding sites. CDPKs protein kinases have been proposed to function in multiple plant signal transduction pathways downstream of [Ca2+]cyt elevations, thus transducing various physiological responses. CPK6 is expressed in both guard cells and mesophyll cells. Functions in guard cell ion channel regulation. ABA and Ca(2+) activation of slow-type anion channels and, interestingly, ABA activation of plasma membrane Ca(2+)-permeable channels were impaired in independent alleles of single and double cpk3cpk6 mutant guard cells. Furthermore, ABA- and Ca(2+)-induced stomatal closing were partially impaired in these cpk3cpk6 mutant alleles. The protein kinase CPK6 is shown in biochemical assays to be directly activated by elevations in calcium concentrations in the physiological range (Laanements et al., 2013 PlantPhys.; PMID: 23766366). These data correlate with the in vivo function of CPK6 in Ca2+ and ABA activation of S-type anion channels (Mori et al., 2006 PLoS Biol.; PMID: 17032064) and the ability of CPK6 to mediate ABA activation of SLAC1 (Brandt et al., 2012 PNAS; PMID: 22689970). The mRNA is cell-to-cell mobile. |
| AT5G17860 | Cation/Ca2+ exchanger family member. Double mutants with CCX4 show delayed greening and defects in ROS response. |
| AT4G38810 | SnRK2-Interacting Calcium Sensor. Encodes two different isoforms that can both inhibit SnRK2. The longer form (AT4G38810.2) is calcium dependant, the other is not. |
| AT2G17990 | Calcium-dependent protein kinase 1 adaptor protein involved in vacuolar transport and lytic vacuole biogenesis. |
| AT2G41860 | member of Calcium Dependent Protein Kinase |
| AT5G19450 | calcium-dependent protein kinase (CDPK19) mRNA, complete |
| AT2G38910 | member of Calcium Dependent Protein Kinase |
| AT2G35890 | member of Calcium Dependent Protein Kinase |
| AT5G66210 | Calcium Dependent Protein Kinase. Functions in the BIK1 innate immune response pathway. |
| AT3G57530 | Calcium-dependent Protein Kinase. ABA signaling component that regulates the ABA-responsive gene expression via ABF4. AtCPK32 has autophosphorylation activity and can phosphorylate ABF4 in vitro |
| AT4G23650 | Encodes calcium dependent protein kinase 3 (CPK3), a member of the Arabidopsis CDPK gene family. CDPKs contain an intrinsic Ca2+-activation domain with four EF hand Ca2+-binding sites. CDPKs protein kinases have been proposed to function in multiple plant signal transduction pathways downstream of [Ca2+]cyt elevations, thus transducing various physiological responses. CPK3 is expressed in both guard cells and mesophyll cells. Functions in guard cell ion channel regulation. ABA and Ca(2+) activation of slow-type anion channels and, interestingly, ABA activation of plasma membrane Ca(2+)-permeable channels were impaired in independent alleles of single and double cpk3cpk6 mutant guard cells. Furthermore, ABA- and Ca(2+)-induced stomatal closing were partially impaired in these cpk3cpk6 mutant alleles. CPK6 is also a member of the Arabidopsis CDPK family. |
| AT5G54590 | Splice variant At5g54590.2 encodes CRLK1 (440-amino acid in length) calcium/calmodulin-regulated receptor-like kinase crucial for cold tolerance. CRLK1 is Primarily localized in the plasma membrane. |
| AT1G05570 | Encodes a callose synthase 1 catalytic subunit . Member of Glycosyltransferase Family- 48. |
| AT2G13680 | Responsible for the synthesis of callose deposited at the primary cell wall of meiocytes, tetrads and microspores. Required for exine formation during microgametogenesis and for pollen viability. Highest expression in meiocytes, tetrads, microspores and mature pollen. |
| AT2G41010 | Encodes a novel calmodulin binding protein whose gene expression is induced by dehydration and ionic (salt) and non-ionic (mannitol) osmotic stress. Lines over-expressing this gene are more sensitive and anti-sense lines are more tolerant to osmotic stress, suggesting this gene may be a negative regulator of response to osmotic stress. |
| AT5G37780 | encodes a calmodulin that is involved in thigmomorphogenesis. Gene expression is rapidly induced upon a variety of abiotic stimuli, including water spray, subirrigation, wind, touch, wounding, or darkness. |
| AT2G41110 | Encodes a touch-inducible calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. The mRNA is cell-to-cell mobile. |
| AT3G56800 | encodes a calmodulin |
| AT3G51920 | encodes a divergent member of calmodulin, which is an EF-hand family of Ca2+-binding proteins. This gene is expressed in leaves, flowers and siliques. The gene functionally complements yeast calmodulin 1 (CAM1) but only when selected against the plasmid harboring wild-type yeast sequences. Also the protein does not form formed a complex with a basic amphiphilic helical peptide in the presence of Ca2+ in vitro. Authors suggest that this gene may represent a Ca2+-binding sensor protein that interacts with a more limited set of target proteins than do more conventional CaM isoforms. Mutations in this gene alter plant responses to abiotic stress and abscisic acid. |
| AT2G41090 | Encodes a cytoplasmic, calcium binding calmodulin variant. CML10 interacts with phosphomannomutase (PMM)in vivo and increases its activity thereby affecting ascorbic acid biosynthesis. Its expression is induced by oxidative and other stress. The mRNA is cell-to-cell mobile. |
| AT5G42380 | calmodulin like 37;(source:Araport11) |
| AT4G00330 | high overall homology to CRCK1 |
| AT5G64220 | CAMTA2 proteins bind to the AtALMT1 promoter at in vitro. The gene itself is Al inducible, and AtALMT1 expression is partially repressed in camta2 mutant. The mRNA is cell-to-cell mobile. |
| AT4G16150 | CATMA5 is a transcriptional activator. It acts in the cold response pathway, it can bind to and activate the expression of DREB1 genes. |
| AT3G16940 | Calmodulin binding transcription factor. Mutants display increased salt tolerance during early germination. Involved in regulation of salt stress responsive genes. |
| AT4G35310 | calmodulin-domain protein kinase CDPK isoform 5 (CPK5) |
| AT3G20410 | calmodulin-domain protein kinase CDPK isoform 9 (CPK9) |
| AT3G10660 | predicted to encode calcium-dependent protein kinase and is localized to the ER. Protein is myristoylated in a cell-free extract. Changing the proposed myristoylated site, G residue in the amino terminal, to A prevented the meristoylation . The G to A mutation decreased AtCPK2 membrane association by approximately 50%. |
| AT1G76650 | calmodulin-like 38;(source:Araport11) |
| AT5G39670 | Calmodulin like protein involved in negative regulation of pattern triggered immunity. |
| AT5G61790 | calnexin 1;(source:Araport11) |
| AT1G56340 | Encodes one of three Arabidopsis calreticulins. In CRT-deficient mouse fibroblasts, this protein restores ER Ca2+ levels. Post-transcriptionally regulates together with CRT2 VAMP721/722 levels under ER stress. Loss-of-function results in activation of the ethylene signaling pathway, reduced susceptibility to Verticillium longisporum. |
| AT1G09210 | Encodes one of three Arabidopsis calreticulins.Post-transcriptionally regulates together with CRT1 VAMP721/722 levels under ER stress. |
| AT1G04260 | Encodes protein that interacts with CaMV movement protein. Colocalizes in the cytoplasm with the movement protein. Has similarity to mammalian proteins (such as the rat PRA1) which have been described as rab acceptors. |
| AT1G57680 | plasminogen activator inhibitor;(source:Araport11) |
| AT3G05520 | Encodes a capping protein that acts as a phosphatidic acid biosensor and key transducer of fluxes in membrane signaling phospholipids into changes in actin cytoskeleton dynamics. |
| AT4G01060 | Encodes a Myb-related protein similar to CPC. Involved in epidermal cell differentiation. Mutants have reduced numbers of root hairs and increased trichome branching. Involved in endoreduplication. Loss of function mutants are hypertrophic and early flowering. |
| AT5G27420 | Encodes CNI1 (Carbon/Nitrogen Insensitive1) (also named as ATL31), a RING type ubiquitin ligase that functions in the Carbon/Nitrogen response for growth phase transition in Arabidopsis seedlings. The mRNA is cell-to-cell mobile. |
| AT5G14740 | Encodes a beta carbonic anhydrase likely to be localized in the cytoplasm. Expression of its mRNA is seen in etiolated seedlings and points to a possible nonphotosynthetic role for this isoform. |
| AT3G48700 | carboxyesterase 13;(source:Araport11) |
| AT5G14310 | carboxyesterase 16;(source:Araport11) |
| AT1G49660 | Encodes a protein with carboxylesterase whose activity was tested using pNA. |
| AT5G01270 | Encodes CPL2, a carboxyl-terminal domain (CTD) phosphatase that dephosphorylates CTD Ser5-PO4 of the RNA polymerase II complex. Regulates plant growth, stress and auxin responses. |
| AT4G04870 | Encodes a protein with cardiolipin synthase activity that is localized to the mitochondiria. |
| AT3G63520 | Encodes a protein with 9-cis-epoxycarotenoid dioxygenase activity. The enzyme was shown to act on a variety of carotenoid including β-carotene, lutein, zeaxanthin, and all-trans-violaxanthin. When those compounds are used as substrates, the major reaction product detected is a C14 dialdehyde: 4,9-dimethyldodeca-2,4,6,8,10-pentaene-1,12-dial. The enzyme did not cleave as efficiently carotenoids containing 9-cis-double or allenic bonds. The mRNA is cell-to-cell mobile. |
| AT4G32810 | Encodes a protein with similarity to carotenoid cleaving deoxygenases, the enzymes that cleave beta-carotene. Involved in the production of a graft transmissable signal to suppress axillary branching. Protein is localized to chloroplast stroma and expressed primarily in root tip. Mutants in the gene exhibit increased shoot branching, and light-dependent defects in hook opening and hypocotyl/root elongation. Only upregulated by auxin in the root and hypocotyl, and this is not required for the inhibition of shoot branching. |
| AT1G72710 | Encodes a member of the casein kinase 1 protein family that is localized to the cytoplasm and nucleus. The mRNA is cell-to-cell mobile. |
| AT5G67380 | Casein kinase II (CK2) catalytic subunit (alpha 1). One known substrate of CK2 is Phytochrome Interacting Factor 1 (PIF1). CK2-mediated phosphorylation enhances the light-induced degradation of PIF1 to promote photomorphogenesis. |
| AT5G57015 | Member of CKL gene family (member of CKL-B group). |
| AT4G28880 | Member of CKL gene family (CKL-A group) |
| AT4G28860 | Member of CKL gene family (CKL-A group) |
| AT4G28540 | Member of CKL gene family (CKL-C group). |
| AT5G43320 | Member of CKL gene family (CKL-C group) |
| AT4G17640 | Encodes casein kinase II beta (regulatory) subunit. |
| AT1G04440 | Member of CKL gene family (CKL-C group). |
| AT5G15450 | Encodes a chloroplast-targeted Hsp101 homologue. Functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. APG6 expression is upregulated in response to heat shock in various organs, but not in response to other abiotic stresses. Apg6 mutants have a pale-green phenotype. |
| AT4G03540 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G15610 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G15620 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT1G79780 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT5G62820 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G55390 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT2G39530 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT2G39518 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT5G02060 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G37235 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G50810 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G11550 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT2G27370 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT5G15290 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT1G73875 | Deadenylase. |
| AT1G20630 | Catalyzes the reduction of hydrogen peroxide using heme group as cofactor. Protects cells from toxicity by H2O2. |
| AT4G35090 | Encodes a peroxisomal catalase, highly expressed in bolts and leaves. mRNA expression patterns show circadian regulation with mRNA levels being high in the subjective early morning. Loss of function mutations have increased H2O2 levels and increased H2O2 sensitivity. Mutants accumulate more toxic ions yet show decreased sensitivity to Li+. This decreased sensitivity is most likely due to an insensitivity to ethylene. Note that in Queval et al. (2007) Plant Journal, 52(4):640, SALK_057998 is named as cat2-1, SALK_076998 is named as cat2-2; in Bueso et al. (2007) Plant Journal, 52(6):1052, SALK_076998 is named as cat2-1. TAIR has adopted the nomenclature consistent with that in Bueso et al. (2007) after consultation with the authors: SALK_076998 (cat2-1), SALK_057998 (cat2-2). |
| AT1G20620 | Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen. The mRNA is cell-to-cell mobile. |
| AT1G54115 | Involved in cation (Na and K) homeostasis. |
| AT1G08960 | Encodes a member of the Potassium-dependent sodium-calcium exchanger like-family that localizes to the plasma membrane and nuclear periphery, and has a role in mediating high-affinity K+ uptake and Na+ transport in yeast. |
| AT3G51860 | cation exchanger 3;(source:Araport11) |
| AT1G55730 | member of Low affinity calcium antiporter CAX2 family |
| AT3G14070 | Involved in cation (K, Na and Mn) homeostasis and transport |
| AT5G17850 | CCX2 is a putative cation/Ca2+ exchange protein. It is located in the endoplasmic reticulum. It plays a role in salt induced calcium signaling. Loss of function results in decreased cytosolic and increased ER Ca2+ concentrations. |
| AT5G22910 | member of Putative Na+/H+ antiporter family |
| AT4G23700 | member of Putative Na+/H+ antiporter family |
| AT5G41610 | member of Putative Na+/H+ antiporter family |
| AT1G08135 | cation/H+ exchanger 6B;(source:Araport11) |
| AT1G06970 | member of Putative Na+/H+ antiporter family |
| AT5G36940 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. |
| AT5G04770 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. Expressed in sink tissues. Induced during infestation of roots by the plant parasitic root-knot nematode, Meloidogyne incognita. Localized in the plasma membrane. |
| AT1G17120 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. |
| AT3G54900 | A.thaliana PICOT protein.It activates CAX1 gene Calcium transport activity.In other organisms, PICOT proteins appear to play a negative regulatory role in cellular stress responses. |
| AT2G28910 | Encodes a CAX-interacting protein (CXIP4). The gene product is located in the nucleus of GFP-CXIP4-expressing yeast cells. When transiently expressed in the tobacco leaves, GFP-CXIP4 locates to the nucleus as well as in discrete areas of the cytoplasm (which do not overlap with mitochondria). |
| AT1G48260 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.21), which has also been reported as a member of the CBL-interacting protein kinases (CIPK17). |
| AT3G17510 | Encodes a CBL-interacting protein kinase. Specifically interacts with ECT1 and ECT2. |
| AT4G18700 | Encodes CBL-interacting protein kinase 12 (CIPK12). |
| AT2G34180 | Encodes CBL-interacting protein kinase 13 (CIPK13). |
| AT5G01810 | Encodes a CBL-interacting serine/threonine protein kinase, also has similarities to SOS2 kinase. |
| AT2G25090 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.18), which has also been reported as a member of the CBL-interacting protein kinases (CIPK16) and is involved in salinity tolerance. |
| AT1G29230 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.20), which has also been reported as a member of the CBL-interacting protein kinases (CIPK18). |
| AT5G07070 | Encodes CBL-interacting protein kinase 2 (CIPK2). |
| AT5G57630 | CBL-interacting protein kinase.When mutated plants are hypersensitive to salt and osmotic stress. |
| AT1G30270 | Arabidopsis thaliana CBL-interacting protein kinase 23. CIPK23 serves as a positive regulator of the potassium transporter AKT1 by directly phosphorylating AKT1. CIPK23 is activated by the binding of two calcineurin B-like proteins, CBL1 and CBL9. The mRNA is cell-to-cell mobile. |
| AT5G25110 | salt- and anoxia-induced member of AtCIPK family. |
| AT5G10930 | Encodes CBL-interacting protein kinase 5 (CIPK5). |
| AT4G24400 | Encodes a CBL (calcineurin B-like calcium sensor proteins) -interacting serine/threonine protein kinase. Regulates the low-affinity phase of the primary nitrate response. The mRNA is cell-to-cell mobile. |
| AT1G01140 | Encodes a CBL-interacting protein kinase with similarity to SOS2 |
| AT5G10860 | Encodes a single cystathionine beta-Synthase domain-containing protein. Modulates development by regulating the thioredoxin system. |
| AT1G80090 | Cystathionine beta-synthase (CBS) family protein;(source:Araport11) |
| AT4G27460 | Cystathionine beta-synthase (CBS) family protein;(source:Araport11) |
| AT2G33590 | Encodes a protein with homology to members of the dihydroflavonol-4-reductase (DFR) superfamily. The expression pattern of AtCRL1 indicates that CRL1 has a role in embryogenesis and seed germination. AtCRL1 is induced by ABA, drought and heat, and is highly expressed in seeds. The mRNA is cell-to-cell mobile. |
| AT3G44260 | Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses. |
| AT5G10960 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT5G02800 | Encodes CDL1, a homolog of CDG1. CDL1 positively regulates brassinosteroid signaling and plant growth. |
| AT1G62430 | Encodes a CDP-diacylglycerol synthase, involved in phospholipid biosynthesis. |
| AT2G46700 | CDPK-related kinase 3;(source:Araport11) |
| AT3G25100 | Required for normal meiosis, may act in the last round of DNA replication prior to meiosis, sequence similar to yeast CDC45 |
| AT2G03670 | CDC48 - like protein AAA-type ATPaseCell. division control protein 48 homolog B |
| AT5G64620 | Plant cell wall (CWI) and vacuolar invertases (VI) play important roles in carbohydrate metabolism, stress responses and sugar signaling. |
| AT3G22120 | Cell wall-plasma membrane linker protein homolog (CWLP) |
| AT1G02800 | Encodes a protein with similarity to endo-1,4-b-glucanases and is a member of Glycoside Hydrolase Family 9. CEL2 is induced by nemotodes and is expressed in syncitia induced by Heterodera schachtii.May be involved in the development and function of syncitia. |
| AT1G22880 | cellulase 5;(source:Araport11) |
| AT4G32410 | Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. |
| AT5G09870 | Encodes a cellulose synthase CESA5 that produces seed mucilage cellulose.Mutants are defective in seed coat mucilage.Involved in the regulation of mucilage composition and/or mucilage synthesis. |
| AT5G64740 | Encodes a cellulose synthase isomer. CESA6 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA6, along with CESA1 and CESA3 are present in the same plasma membrane complex for cellulose biosynthesis. CESA2 and CESA5 are related to CESA6, having partially redundant roles. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. The mRNA is cell-to-cell mobile. |
| AT4G39350 | Encodes a cellulose synthase isomer, related to CESA6. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. The mRNA is cell-to-cell mobile. |
| AT3G56000 | encodes a gene similar to cellulose synthase |
| AT2G22125 | Encodes a protein involved in cell elongation in root and anther filaments. Mutants have greater cell volumes in root tissues and have additive phenotypes with other cell expansion mutants such as those carrying mutations in COB, QUI and POM1 loci. POM2/CSI1 promotes Cellulose Synthase and microtubule co-alignment. The mRNA is cell-to-cell mobile. |
| AT4G16590 | encodes a gene similar to cellulose synthase |
| AT5G22740 | Encodes a beta-mannan synthase based on in vitro enzyme assays from heterologously expressed protein. CSLA2 synthesizes the backbone of galactoglucomannan in seed coat epidermal cells. Both CSLA2 and MUCI10, which may be part of a protein complex, are critical for mucilage architecture. |
| AT1G24070 | encodes a gene similar to cellulose synthase |
| AT1G23480 | encodes a gene similar to cellulose synthase |
| AT2G32530 | encodes a gene similar to cellulose synthase |
| AT3G03050 | encodes a cellulose synthase like protein. mutations initiate root hairs that rupture at their tip soon after initiation. is required for the synthesis of a noncellulosic wall polysaccharide. |
| AT3G28180 | encodes a gene similar to cellulose synthase The mRNA is cell-to-cell mobile. |
| AT4G31590 | encodes a XyG glucan synthase; gene similar to cellulose synthase |
| AT3G07330 | encodes a XyG glucan synthase; gene similar to cellulose synthase |
| AT4G37010 | Encodes a member of the Centrin family. Mutants are hypersensitive to UV and prone to UV induced DNA damage. Based on sequence similarity and mutant phenotype CEN2 is thought to be involved in nucelotide excision repair/DNA repair. |
| AT3G50360 | CAM like protein with four EF-hand domains. Binds calcium. Loss of function mutants affect ABA regulation of guard cell channels and accumulation of stress responsive transcripts(PMID:28603528). |
| AT1G34750 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT2G30370 | Encodes a small, potentially secreted protein that acts as an inhibitor of stomatal production though likely not through direct interaction with the TMM receptor. It is homologous to known stomatal regulators EPF1 and EPF2. Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT4G14723 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT2G47450 | A component of the chloroplast signal recognition particle pathway that is involved in LHCP targeting. It is downregulated in response to high light. It recognizes the DPLG motif in Lhcb1. The mRNA is cell-to-cell mobile. |
| AT5G20720 | Encodes a chloroplast co-chaperonin with similarity to CPN21 from spinach, E.coli GroES. |
| AT1G55490 | encodes the beta subunit of the chloroplast chaperonin 60, a homologue of bacterial GroEL. Mutants in this gene develops lesions on its leaves, expresses systemic acquired resistance (SAR) and develops accelerated cell death to heat shock stress. The protein has molecular chaperone activity for suppressing protein aggregation in vitro. |
| AT5G20890 | TCP-1/cpn60 chaperonin family protein;(source:Araport11) |
| AT3G02530 | TCP-1/cpn60 chaperonin family protein;(source:Araport11) |
| AT5G56500 | Encodes a subunit of chloroplasts chaperonins that are involved in mediating the folding of newly synthesized, translocated, or stress-denatured proteins. Cpn60 subunits are: Cpn60alpha1 (At2g28000), AtCpn60alpha2 (At5g18820), AtCpn60beta1 (At1g55490), AtCpn60beta2 (At3g13470), AtCpn60beta3 (At5g56500), AtCpn60beta4 (At1g26230). |
| AT2G45260 | Negatively regulates autophagy by direct interaction with the key autophagy adaptor ATG8E, thus directly linking autophagy and drought tolerance. Contains a DUF641 domain which is is plant specific. |
| AT3G14870 | hypothetical protein (DUF641);(source:Araport11) |
| AT3G60680 | DUF641 family protein (DUF641);(source:Araport11) |
| AT3G21630 | LysM receptor-like kinase, based on protein sequence alignment analysis, it has a typical RD signaling domain in its catalytic loop and possesses autophosphorylation activity. Involved in the perception and transduction of the chitin oligosaccharide elicitor. Located in the plasma membrane. CERK1 phosphorylates LIK1, a LLR-RLK that is involved in innate immunity, |
| AT2G43570 | chitinase;(source:Araport11) |
| AT3G16920 | Encodes a chitinase-like protein expressed predominantly in stems. Mutants accumulate ligning in etiolated hypocotyls. |
| AT5G40890 | Encodes a member of the voltage-dependent chloride channel. Also functions as a NO3-/H+ exchanger that serves to accumulate nitrate nutrient in vacuoles. Mutants homozygous for the T-DNA insertion mutation have reduced nitrate uptake capacity in high nitrate environment and exhibit hypersensitivity to chlorate. Role in cytosolic pH homeostasis. |
| AT4G35440 | Enclodes a choride channel protein that is localized to the thlakoid membrane. |
| AT1G44446 | Encodes chlorophyllide a oxygenase which converts chlorophyllide a to chlorophyllide b by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide a . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll b and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22. |
| AT1G29930 | Subunit of light-harvesting complex II (LHCII),which absorbs light and transfers energy to the photosynthetic reaction center. The mRNA is cell-to-cell mobile. |
| AT5G38520 | CLD1 is involved in steady-state chlorophyll turnover; CLD1 dephytylates chlorophyll a, chlorophyll b, and pheophytin a in vitro; CLD1 and CHLG form a salvage cycle in recycling chlorophyll. Suppression of CLD1 expression results in reduced tolerance to moderately high temperature. |
| AT1G19670 | Chlorophyllase is the first enzyme involved in chlorophyll degradation. It catalyzes the hydrolysis of the ester bond to yield chlorophyllide and phytol. AtCLH1 lacks a typical signal sequence for the chloroplast. Its expression is induced rapidly by methyljasmonate, a known promoter of senescence and chlorophyll degradation. |
| AT3G04000 | ChlADR is an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. The N-terminal region of this protein directs GFP to the chloroplast where where ChlADR likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation. In addition, this enzyme can also reduce cis-3-hexenal, a major plant volatile compound that contributes to green leaf odor, as well as methylglyoxal in vitro. |
| AT4G13010 | Oxidoreductase, zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT2G47390 | Prolyl oligopeptidase family protein;(source:Araport11) |
| AT1G36390 | Chloroplast GrpE protein. |
| AT4G24280 | Involved in protein import into chloroplasts during early developmental stages. The mRNA is cell-to-cell mobile. |
| AT5G49910 | Stromal heat shock protein involved in protein import into chloroplast. The mRNA is cell-to-cell mobile. |
| AT5G57180 | Transcription regulator responsible for specific upregulation of the translocon genes atToc33 and atToc75 in leaves. Involved in protein import into chloroplast. |
| AT2G16800 | Encodes a nuclear-encoded chloroplast protein that plays an important role in vegetative growth, female gametogenesis, and embryogenesis likely by mediating chloroplast integrity and development. |
| AT3G14330 | Encodes a pentatricopeptide repeat protein involved in chloroplast mRNA editing. Mutants display defects in C-U editing of psbE. |
| AT5G66520 | Encodes a pentatricopeptide repeat protein involved in chloroplast mRNA editing. Mutants display defects in C-U editing of ndhB. |
| AT3G52380 | Encodes a chloroplast RNA-binding protein that stabilizes chloroplast RNAs as evidenced by analyses of transcript accumulation in null mutants. Essential for seedling development (albino, strongly retarded growth even on sucrose-containing medium). |
| AT5G03940 | mutant has Yellow first leaves; Chloroplast Signal Recognition Particle Subunit |
| AT3G25690 | actin binding protein required for normal chloroplast positioning The mRNA is cell-to-cell mobile. |
| AT2G25625 | Histone deacetylase-like protein;(source:Araport11). Induced by senescence and abiotic stresses. |
| AT5G66650 | Chloroplast localized mitochondrial calcium uniporter. |
| AT5G16390 | Encodes for the biotin carboxyl-carrier subunit of the multi-enzyme plastidial acetyl-coenzyme A carboxylase complex. |
| AT1G76080 | Encodes a thioredoxin like protein. Localizes to the chloroplast and is redistributed to the chloroplast envelope under heat stress. It is involved in non host resistance and thermotolerance. |
| AT1G08490 | Chloroplastic NifS-like protein that can catalyze the conversion of cysteine into alanine and elemental sulfur (S(0)) and of selenocysteine into alanine and elemental Se (Se(0)). Overexpression enhances selenium tolerance and accumulation. |
| AT5G55740 | Encodes a member of the E+ subgroup of the PPR protein family, containing the E and E+ motifs following a tandem array of PPR motifs. It also contains an unknown motif consisting of 15 aa, which is highly conserved in some PPR proteins, including CRR4. CRR21 is involved in RNA editing of the site 2 of ndhD (ndhD-2),which encodes a subunit of the NDH complex. The RNA editing changes aa 128 from Ser to Leu. Mutants have impaired NDH complex activity. |
| AT2G47910 | Encodes a chloroplast thylakoid membrane protein. Required for the assembly/accumulation of the NAD(P)H dehydrogenase complex of the photosynthetic electron transport chain. |
| AT4G21445 | CRR9 gene encodes a novel stromal protein without any known functional domains or motifs. It is highly conserved in cyanobacteria and land plants but not in green algae. |
| AT1G11290 | Pentatricopeptide Repeat Protein containing the DYW motif. Required for editing of multiple plastid transcripts. Endonuclease activity. |
| AT1G71697 | Encodes choline kinase. mRNA levels are increased in response to wounding. The mRNA is cell-to-cell mobile. |
| AT1G74320 | encodes a choline kinase, whose expression is induced by high salt and mannitol. |
| AT5G10870 | Encodes chorismate mutase AtCM2. |
| AT1G69370 | Encodes chorismate mutase 3 (CM3). |
| AT5G66750 | Protein is similar to SWI2/SNF2 chromatin remodeling proteins. DDM1 is appears to act as a chromatin-remodeling ATPase involved in cytosine methylation in CG and non-CG contexts. Involved in gene silencing and maintenance of DNA methylation and histone methylation. Hypomethylation of many genomic regions occurs in ddm1 mutants, and can cause several phenotypic abnormalities, but some loci, such as BONSAI (At1g73177) can be hypermethylated in ddm1 mutants after several generations, leading to different phenotypes. DDM1 might be involved in establishing a heterochromain boundary. A line expressing an RNAi targeted against DDM1 shows some resistance to agrobacterium-mediated root transformation. |
| AT5G44800 | Interacts with transcription factors involved in floral meristem identity and affects the expression of key floral regulators. Affects H3K27me3 and H3K4me3 levels at a subset of loci in the genome. |
| AT5G18620 | Encodes a member of the A. thaliana imitation switch (AtISWI) subfamily of chromatin remodeling factors. Double mutation in CHR17 and CHR11 results in the loss of the evenly spaced nucleosome pattern in gene bodies, but does not affect nucleosome density. |
| AT4G19020 | Encodes a plant DNA methyltransferase that methylates mainly cytosines in CHH (H = any base but G) contexts. It is involved in heat tolerance. |
| AT3G23690 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT2G30490 | Encodes a cinnamate-4-hydroxylase. Mutations in this gene impact phenylpropanoid metabolism, growth and development. |
| AT1G80820 | Encodes an cinnamoyl CoA reductase isoform. Involved in lignin biosynthesis. |
| AT1G15950 | Encodes a cinnamoyl CoA reductase. Involved in lignin biosynthesis. The mRNA is cell-to-cell mobile. |
| AT4G34230 | Encodes a catalytically active cinnamyl alcohol dehydrogenase which uses p-coumaryl aldehyde as a preferred substrate. It can also use sinapyl, caffeyl, coniferyl and d-hydroxyconiferyl aldehydes as substrates. |
| AT4G39330 | cinnamyl alcohol dehydrogenase 9;(source:Araport11) |
| AT2G21890 | cinnamyl alcohol dehydrogenase homolog 3;(source:Araport11) |
| AT2G46830 | Encodes a transcriptional repressor that performs overlapping functions with LHY in a regulatory feedback loop that is closely associated with the circadian oscillator of Arabidopsis. Binds to the evening element in the promoter of TOC1 and represses TOC1 transcription. CCA1 and LHY colocalize in the nucleus and form heterodimers in vivo. CCA1 and LHY function synergistically in regulating circadian rhythms of Arabidopsis. CCA1 binds the GI promoter. |
| AT2G17570 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
| AT2G23400 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
| AT5G58770 | AtCPT7 synthesizes medium-chain polyprenols of approximately 55 carbons in length. The enzyme utlizes geranylgeranyl pyrophosphate (GGPP) and isopentenyl pyrophosphate (IPP) as substrates. The enzymatic product accumulates into plastdial membranes (DOI:10.1105/tpc.16.00796). |
| AT3G58740 | Encodes a peroxisomal citrate synthase that is expressed in siliques and developing seeds. |
| AT3G58750 | Encodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development. |
| AT2G42790 | Encodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development. |
| AT3G60100 | citrate synthase 5;(source:Araport11) |
| AT4G32285 | Putative clathrin assembly protein, component of TPLATE complex that functions in clathrin-mediated endocytosis. |
| AT3G08530 | CHC2 heavy chain subunit of clathrin. Involved in vesicle mediated trafficking. Mutants show reduced rates of endocytosis and defects clathrin mediated exocytosis Mutants have increased drought tolerance due to defects in stomatal movement. |
| AT2G20760 | Clathrin light chain protein;(source:Araport11) |
| AT2G40060 | Encodes a clathrin that is localized to the cortical division zone and the cell plate and colocalizes with TPLATE during cell plate anchoring. The mRNA is cell-to-cell mobile. |
| AT3G51890 | Clathrin light chain protein;(source:Araport11) |
| AT1G75820 | Putative receptor kinase with an extracellular leucine-rich domain. Controls shoot and floral meristem size, and contributes to establish and maintain floral meristem identity. Negatively regulated by KAPP (kinase-associated protein phosphatase). CLV3 peptide binds directly CLV1 ectodomain. |
| AT5G65480 | CCL1 is induced by WUS and binds to the kinase domains of BAM1 and CLV1. Localizes to lipid rich plasma membrane rafts. Likely to be involved in WUS/CLV signaling pathway. |
| AT4G38060 | hypothetical protein;(source:Araport11) |
| AT1G68795 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT1G70895 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT5G12990 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT1G25425 | CLAVATA3/ESR-RELATED 43;(source:Araport11) |
| AT4G13195 | Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini. The C-terminal 12 amino acid sequence of CLE44 is identical to that of a dodeca peptide (TDIF, tracheary element differentiation inhibitory factor) isolated from Arabidopsis and functions as a suppressor of plant stem cell differentiation. TDIF sequence is also identical to the C-terminal 12 amino acids of CLE41 (At3g24770). The protein is expressed in the vascular system and is involved in axillary bud formation. |
| AT5G23880 | Encodes a protein similar to the 100kD subunit of cleavage and polyadenylation specificity factor (CPSF), the factor responsible for the recognition of the AAUAAA motif during mRNA polyadenylation. The protein interacts with a portion of a nuclear poly(A) polymerase. It is likely to be a part of the mRNA 3'end formation apparatus. |
| AT5G51660 | cleavage and polyadenylation specificity factor 160;(source:Araport11) |
| AT2G01730 | a homolog of cleavage and polyadenylation specificity factor that plays an essential role in the development of female gametophyte and embryo |
| AT4G15560 | Encodes a protein with 1-deoxyxylulose 5-phosphate synthase activity involved in the MEP pathway. It is essential for chloroplast development in Arabidopsis |
| AT5G45390 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). The mRNA is cell-to-cell mobile. |
| AT3G04680 | Encodes a nuclear protein that functions in mRNA processing. Mutations in this gene cause embryo lethality and reduced transmission through the female gametophyte. Over-expression of a CLPS3:TAP protein changes the relative levels of two alternatively processed FCA transcripts. It also causes abnormal phyllotaxy and flower development, early flowering under long and short days, and increased levels of CUC1 and WUS expression. |
| AT5G50920 | Encodes a protein that is similar to ATP-dependent Clp protease ATP-binding subunit / ClpC. Involved in protein import into the chloroplast. May provide ATP source that drives the TIC (Translocon at the Inner envelope membrane of Chloroplasts) translocation machinery. Association of Hsp93 with the inner envelope membrane through its N domain is important for the functions of Hsp93 in vivo. |
| AT1G76730 | Encodes a paralog of ATP-dependent folate salvage enzyme 5-formyltetrahydrofolate cycloligase (5-FCL) that is targeted to chloroplasts and to be required for embryo viability and lacks 5-FCL activity. |
| AT1G53000 | Encodes a mitochondrial-localized CMP-KDO (3-deoxy-D-manno-octulosonate) synthetase. This is the enzyme activating KDO as a nucleotide sugar prior to its incorporation into rhamnogalacturonan-II. Heterozygous mutants are defective in pollen development and in pollen tube elongation. |
| AT5G60920 | Encodes a glycosylphosphatidylinositol-anchored protein localized primarily in the plasma membrane of the longitudinal sides of root cells. Necessary for oriented cell expansion in Arabidopsis. Cob mutants have abnormal roots that expand radially rather than longitudinally under certain growth conditions. |
| AT1G09790 | COBRA-like protein 6 precursor;(source:Araport11) |
| AT1G01290 | COFACTOR OF NITRATE REDUCTASE AND XANTHINE DEHYDROGENASE 3. Encodes a protein involved in molybdenum cofactor biosynthesis. Homologous to E.coli MoaC. Expression is low in all tissues examined, except in roots. Appears to have targeting signals for chloroplast or mitochondria |
| AT2G44050 | 6,7-dimethyl-8-ribityllumazine synthase / DMRL synthase / lumazine synthase / riboflavin synthase [Arabidopsis thaliana]. Acts in the jasmonic acid signaling pathway. The mRNA is cell-to-cell mobile. |
| AT1G29395 | Integral membrane protein in the inner envelope of chloroplasts. Provide freezing tolerance. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. involved in response to salt tolerance |
| AT1G29390 | Integral membrane protein in the inner envelope of chloroplasts. Provide freezing tolerance. |
| AT2G15970 | encodes an alpha form of a protein similar to the cold acclimation protein WCOR413 in wheat. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. The mRNA is cell-to-cell mobile. |
| AT5G42900 | Acts with COR28 as a key regulator in the COP1-HY5 regulatory hub by regulating HY5 activity to ensure proper skotomorphogenic growth in the dark and photomorphogenic development in the light. |
| AT4G36020 | Encodes a cold shock domain protein. Involved in cold acclimation by blocking the secondary structure of mRNA which in turn facilitates translation at cold temperature. |
| AT2G17870 | Encodes COLD SHOCK DOMAIN PROTEIN 3 (CSP3), involved in the acquisition of freezing tolerance. |
| AT2G21660 | Encodes a small glycine-rich RNA binding protein that is part of a negative-feedback loop through which AtGRP7 regulates the circadian oscillations of its own transcript. Gene expression is induced by cold. GRP7 appears to promote stomatal opening and reduce tolerance under salt and dehydration stress conditions, but, promotes stomatal closing and thereby increases stress tolerance under conditions of cold tolerance. Loss of function mutations have increased susceptibility to pathogens suggesting a role in mediating innate immune response. Mutants are also late flowering in a non-photoperiodic manner and are responsive to vernalization suggesting an interaction with the autonomous flowering pathway. There is a reduction of mRNA export from the nucleus in grp7 mutants. GRP7:GFP fusion proteins can be found in the cytosol and nucleus. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). |
| AT2G42540 | A cold-regulated gene whose product is targeted to the chloroplast. Cor15am protects stromal proteins from aggregation under various stress conditions. Constitutive expression increases freezing tolerance in protoplasts in vitro and chloroplasts in vivo. NMR and x-ray diffraction studies suggest that COR15a alters the intrinsic curvature of the inner membrane of chloroplast envelope. Late Embryogenesis abundant protein (LEA). Protects chloroplast membranes during freezing. |
| AT3G50830 | cold acclimation protein WCOR413-like protein beta form. Transcript is not detectable. |
| AT1G20440 | Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. Cold regulated gene, amino acid sequence homology with Group II LEA (late embryogenesis abundant) proteins. Also responds to osmotic stress, ABA, dehydration and inhibits e.coli growth while overexpressed. COR47 and RAB18 double overexpressor plants are cold tolerant. Regulated by heat shock. |
| AT4G33980 | Acts with COR27 as a key regulator in the COP1-HY5 regulatory hub by regulating HY5 activity to ensure proper skotomorphogenic growth in the dark and photomorphogenic development in the light. |
| AT1G45688 | CC1 is a plant specific gene that interacts with with the cellulose synthase complex and microtubules. It appears to play a role in localizing CESA to the membrane, microtuble dynamics , particularly during salt stress. |
| AT2G41990 | late embryogenesis abundant protein;(source:Araport11) |
| AT2G25240 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11). Involved in stress response regulated cell death. |
| AT5G67370 | DUF1230 family protein (DUF1230);(source:Araport11) |
| AT1G67930 | Golgi transport complex protein-like protein;(source:Araport11) |
| AT5G03190 | peptide upstream protein;(source:Araport11) |
| AT5G15840 | Encodes a protein showing similarities to zinc finger transcription factors, involved in regulation of flowering under long days. Acts upstream of FT and SOC1. |
| AT5G15850 | Homologous to the flowering-time gene CONSTANS. |
| AT3G02380 | homologous to the flowering-time gene CONSTANS (CO) encoding zinc-finger proteins |
| AT2G24790 | Positive regulator of photomorphogenesis that acts downstream of COP1 but can promote lateral root development independently of COP1 and also function as a daylength-sensitive regulator of shoot branching. The mRNA is cell-to-cell mobile. |
| AT5G24930 | Flowering repressor in long days (LD) and short days (SD) and acts on the expression of FT and FT-like genes as well as on SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1). |
| AT5G57660 | CONSTANS-like 5;(source:Araport11) |
| AT3G07650 | This gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO. The mRNA is cell-to-cell mobile. |
| AT3G26940 | Receptor-like cytoplasmic kinase, RLCKVII subfamily. Overexpression causes abnormal differential and elongation growth after organ differentiation. |
| AT5G64930 | Regulator of expression of pathogenesis-related (PR) genes. Participates in signal transduction pathways involved in plant defense (systemic acquired resistance -SAR). |
| AT5G05170 | Encodes a cellulose synthase isomer. CESA3 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA3, along with CESA1 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. The xylem cells in primary root have reduced cell expansion and higher than normal lignification. |
| AT2G32950 | Represses photomorphogenesis and induces skotomorphogenesis in the dark. Contains a ring finger zinc-binding motif, a coiled-coil domain, and several WD-40 repeats, similar to G-beta proteins. The C-terminus has homology to TAFII80, a subunit of the TFIID component of the RNA polymerase II of Drosophila. Nuclear localization in the dark and cytoplasmic in the light. The mRNA is cell-to-cell mobile. |
| AT5G14250 | Encodes subunit 3 of the COP9 signalosome. |
| AT5G05690 | Encodes a member of the CP90A family, a cytochrome P450 monooxygenase which converts 6-deoxocathasterone to 6-deoxoteasterone in the late C6 oxidation pathway and cathasterone to teasterone in the early C6 oxidation pathway of brassinolide biosynthesis. Expressed in cotyledons and leaves. Mutants display de-etiolation and derepression of light-induced genes in the dark, dwarfism, male sterility and activation of stress-regulated genes in the light. The expression of the gene using a CPD promoter:LUC fusion construct was shown to be under circadian and light control. Additionally, the circadian regulation was shown to be independent of BR levels as it remains unchanged in bri1 mutant lines. CPD appears to be involved in the autonomous pathway that regulates the transition to flowering, primarily through a BRI1-mediated signaling pathway that affects FLC expression levels, as uncovered by double mutant analyses. |
| AT5G03730 | Homologous to the RAF family of serine/threonine protein kinases. Negative regulator in the ethylene signal transduction pathway. Interacts with the putative ethylene receptors ETR1 and ERS. Constitutively expressed. |
| AT3G01490 | Belongs to the Raf-like kinase subfamily of the mitogen-activated protein kinase kinase kinase (MAPKKK) family. Negatively regulates stomatal opening by negatively regulating plasma membrane H+-ATPase phosphorylation. |
| AT5G50000 | Belongs to the Raf-like kinase subfamily of the mitogen-activated protein kinase kinase kinase (MAPKKK) family. Negatively regulates stomatal opening by negatively regulating plasma membrane H+-ATPase phosphorylation. |
| AT3G50260 | Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. Involved in defense and freezing stress responses. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. The mRNA is cell-to-cell mobile. |
| AT1G02330 | Encodes a nuclear coiled-coil domain-containing protein that interacts with and negatively regulates COP1's E3 ubiquitin ligase activity, and represses COP1 mediated HY5 degradation in cell-free extracts. |
| AT5G63440 | Encodes a single copy protein in Arabidopsis containing a DUF167 domain that is conserved in eukaryotes. Genetically CSU suppresses mutations in COP1. In vitro, it interacts with CACTIN and in vivo with CCA1. CSU4 promotes photomorphogenesis via negative regulation of CCA1 and PIF4 expression. |
| AT5G41790 | encodes a protein that physically interacts specifically with the putative coiled-coil region of COP1 in vitro. In hypocotyl and cotyledon protoplasts, it is associated to the cytoskeleton, but not in the root. expression is not regulated by light. The mRNA is cell-to-cell mobile. |
| AT1G71230 | Encodes a subunit of the COP9 complex, similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Involved in protein deneddylation. Double mutants with CSN5A are constitutively photomorphogenic (de-etiolated) and have abnormal auxin responses. |
| AT1G31710 | Copper amine oxidase family protein;(source:Araport11) |
| AT3G43670 | Copper amine oxidase family protein;(source:Araport11) |
| AT2G42490 | Peroxisome-localized copper amine oxidase involved in lateral root formation. |
| AT1G62810 | Encodes COPPER AMINE OXIDASE1 (CuAO1). Contributes to abscisic acid- and polyamine-induced nitric oxide biosynthesis and abscisic acid signal transduction. |
| AT1G12520 | Copper-zinc superoxide dismutase copper chaperone (delivers copper to the Cu-Zn superoxide dismutase). Localized to the chloroplast. Expressed in roots and shoots. Up-regulated in response to copper and senescence. The AtACC activates all three CuZnSOD activities located in three different subcellular compartments. Contains three domains, central, ATX-1 like and C-terminal. ATX-1 like domain essential for the copper chaperone function of AtCCS in planta. |
| AT3G56940 | Encodes a putative ZIP protein with varying mRNA accumulation in leaves, stems and roots. Has a consensus carboxylate-bridged di-iron binding site. The mRNA is cell-to-cell mobile. |
| AT1G08830 | Encodes a cytosolic copper/zinc superoxide dismutase CSD1 that can detoxify superoxide radicals. Its expression is affected by miR398-directed mRNA cleavage. Regulated by biotic and abiotic stress. Activation of CSD1 in the cytoplasm involves both a CCS-dependent and -independent pathway. |
| AT2G39940 | Encodes a protein containing Leu-rich repeats and a degenerate F-box motif. Associates with AtCUL1, AtRbx1, and the Skp1-like proteins ASK1 and ASK2 to assemble SCF COI1 ubiquitin-ligase complexes in planta. A single amino acid substitution in the F-box motif of COI1 abolishes the formation of the SCF(COI1) complexes and results in loss of the JA response. Required for wound- and jasmonates-induced transcriptional regulation. Amino acid mutations in COI1 distinctively affect jasmonate-regulated male fertility.CFA-Ile, CFA-Leu, CFA-Val, CFA-Met and CFA-Ala could not inhibit the root length and restoration of fertility in coi1-1 mutants. |
| AT2G47400 | CP12-1 encodes a small peptide found in the chloroplast stroma. It belongs to the CP12 gene family thought to be involved in the formation of a supramolecular complex with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) embedded in the Calvin cycle. The mRNA is cell-to-cell mobile. |
| AT3G62410 | CP12-2 encodes a small peptide found in the chloroplast stroma. It belongs to the CP12 gene family thought to be involved in the formation of a supramolecular complex with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) embedded in the Calvin cycle. CP12-2 is coordinately regulated by light with the photosynthetic GAPDH and PRK. The annotation of this gene is based on article 32494. The mRNA is cell-to-cell mobile. |
| AT1G76560 | CP12 domain-containing protein 3;(source:Araport11) |
| AT1G69180 | Putative transcription factor with zinc finger and helix-loop-helix domains, the later similar to HMG boxes. Involved in specifying abaxial cell fate in the carpel. Four putative LFY binding sites (CCANTG) and two potential binding sites for MADS box proteins known as CArG boxes (CC(A/T)6GG) were found in the region spanning 3.8 Kb upstream of the CRC coding region. CRC targets YABBY genes such as YUC4 in gynoecium development. |
| AT3G09780 | CRINKLY4 related 1;(source:Araport11) |
| AT3G55950 | CRINKLY4 related 3;(source:Araport11) |
| AT3G01370 | Encodes a protein containing a CRM domain that is involved in group I and group II intron splicing. |
| AT4G39040 | RNA-binding CRS1 / YhbY (CRM) domain protein;(source:Araport11) |
| AT5G19380 | Encodes one of the CRT-Like transporters (CLT1/AT5G19380, CLT2/AT4G24460, CLT3/AT5G12170). Required for glutathione homeostasis and stress responses. Mutants lacking these transporters are heavy metal-sensitive, glutathione(GSH)-deficient, and hypersensitive to Phytophthora infection. |
| AT5G12170 | Encodes one of the CRT-Like transporters (CLT1/AT5G19380, CLT2/AT4G24460, CLT3/AT5G12170). Required for glutathione homeostasis and stress responses. Mutants lacking these transporters are heavy metal-sensitive, glutathione(GSH)-deficient, and hypersensitive to Phytophthora infection. The mRNA is cell-to-cell mobile. |
| AT5G44120 | Encodes a 12S seed storage protein. The Landsberg erecta genome contains another copy of 12S globulin gene, CRA2, which is located tandemly with CRA1. Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT5G51020 | Encodes CRL (CRUMPLED LEAF), a protein localized in the outer envelope membrane of plastids. Mutation in this gene affects the pattern of cell division, cell differentiation and plastid division. |
| AT5G48560 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G08920 | Encodes CRY1, a flavin-type blue-light photoreceptor with ATP binding and autophosphorylation activity. Functions in perception of blue / green ratio of light. The photoreceptor may be involved in electron transport. Mutant phenotype displays a blue light-dependent inhibition of hypocotyl elongation. Photoreceptor activity requires light-induced homodimerisation of the N-terminal CNT1 domains of CRY1. Involved in blue-light induced stomatal opening. The C-terminal domain of the protein undergoes a light dependent conformational change. Also involved in response to circadian rhythm. Mutants exhibit long hypocotyl under blue light and are out of phase in their response to circadian rhythm. CRY1 is present in the nucleus and cytoplasm. Different subcellular pools of CRY1 have different functions during photomorphogenesis of Arabidopsis seedlings. The mRNA is cell-to-cell mobile. |
| AT1G04400 | Blue light receptor mediating blue-light regulated cotyledon expansion and flowering time. Positive regulator of the flowering-time gene CONSTANS. This gene possesses a light-induced CNT2 N-terminal homodimerisation domain.Involved in blue-light induced stomatal opening. Involved in triggering chromatin decondensation. An 80-residue motif (NC80) is sufficient to confer CRY2's physiological function. It is proposed that the PHR domain and the C-terminal tail of the unphosphorylated CRY2 form a "closed" conformation to suppress the NC80 motif in the absence of light. In response to blue light, the C-terminal tail of CRY2 is phosphorylated and electrostatically repelled from the surface of the PHR domain to form an "open" conformation, resulting in derepression of the NC80 motif and signal transduction to trigger photomorphogenic responses. Cry2 phosphorylation and degradation both occur in the nucleus.The life-time of cry2 signaling state in situ (in planta) is about 16 min. |
| AT5G24850 | Binds flavin adenine dinucleotide and DNA. It does not have photolyase activity, and it is likely to act as photoreceptor. Closely related to Synechocystis cryptochrome. |
| AT1G32790 | RNA-binding protein, putative, similar to RNA-binding protein GB:CAB40027 GI:4539439 from (Arabidopsis thaliana).Member of a family of PAB2 binding domain proteins. |
| AT4G10610 | RNA-binding protein, putative. Member of a family of proteins having an PABC binding domain (PAM motif). |
| AT3G14010 | hydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2. |
| AT4G02120 | Cytidine triphosphate synthase. |
| AT3G15170 | Encodes a transcription factor involved in shoot apical meristem formation and cotyledon separation. Functions redundantly with CUC2 and CUC3. The cuc1 cuc2 double mutant phenotype is first detectable at the heart stage, as embryos lacking two distinct bulges of cotyledonary primordia.In post embryonic development it plays a role in axillary meristem formation, boundary separation, gynoecium and ovule development.Contains a MIR164 binding site. |
| AT4G39830 | role in the degradation of ascorbate to (mono)dehydroascorbate |
| AT3G18210 | Belongs to the 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily proteins and contains an oxoglutarate/iron-dependent oxygenase domain (InterPro:IPR005123) of the prolyl 4-hydroxylase, alpha subunit subtype (P4Hc; InterPro:IPR006620), participates in epigenetic repression of flowering genes, works redundantly with ICU11 to repress several members of the MADS-box transcription factors family, during vegetative development via histone modification. |
| AT2G23380 | Similar to the product of the Polycomb-group gene Enhancer of zeste. Catalytic component of the PRC2 complex.Required for stable repression of AG and AP3. Putative role in cell fate determination. Involved in the control of leaf morphogenesis. mutants exhibit curled, involute leaves. AGAMOUS and APETALA3 are ectopically expressed in the mutant. |
| AT4G01150 | Integral thylakoid membrane protein required for proper grana stack curvature. |
| AT1G52220 | Thylakoid membrane localized protein that interacts with other CURT family proteins. Oligomerization is associated with grana thylakoid curavature. |
| AT3G23490 | Encodes a cyanase that catalyzes the bicarbonate-dependent breakdown of cyanate to ammonia and bicarbonate. CYN forms a hexadecamer and is believed to be a cytosolic protein. Long-term exposure to NaCl increases CYN transcript levels. It is also expressed at higher levels in flowers relative to stems, roots, and seedlings. |
| AT4G34490 | CYCLASE ASSOCIATED PROTEIN |
| AT4G34180 | Encodes a cyclase-family protein that is a negative regulator of cell death that regulates pathogen-induced symptom development. |
| AT3G17690 | member of Cyclic nucleotide gated channel family |
| AT2G46430 | Encodes a cyclic nucleotide gated channel, downstream component of the signaling pathways leading to hypersensitive response (HR) resistance. |
| AT5G57940 | Encodes a cyclic GMP activated Ca2+-permeable cation channel in the plasma membrane of guard cells. Required for constitutive growth of root hairs as Ca2+-permeable channels. |
| AT3G17700 | cyclic nucleotide-binding transporter 1, member of a family of cyclic nucleotide gated channels. The mRNA is cell-to-cell mobile. |
| AT5G54250 | member of Cyclic nucleotide gated channel family, downstream component of the signaling pathways leading to HR resistance. mutant plants exhibit gene-for-gene disease resistance against avirulent Pseudomonas syringae despite the near-complete absence of the hypersensitive response (HR). Salicylic acid accumulation in dnd2 mutants is completely PAD4-independent. |
| AT2G46440 | Member of Cyclic nucleotide gated channel family. Positive regulator of resistance against avirulent fungal pathogen. The mRNA is cell-to-cell mobile. |
| AT2G46450 | Member of Cyclic nucleotide gated channel family.Positive regulator of resistance against avirulent fungal pathogen.Suppresses the phenotype conferred by cpr22 in a dosage-dependent manner. |
| AT2G28260 | member of Cyclic nucleotide gated channel family |
| AT3G48010 | member of Cyclic nucleotide gated channel family |
| AT2G23980 | Encodes a cyclic GMP-activated non-selective cation channel in the plasma membrane of guard cells. Required for constitutive growth of root hairs as Ca2+-permeable channels. |
| AT1G17330 | cGMP-activated phosphodiesterase responsible for UVA induced decrease in cGMP. |
| AT1G44110 | Cyclin A1;(source:Araport11) |
| AT1G77390 | Encodes a core cell cycle gene involved in meiosis II during microsporogenesis. Recessive mutants exhibit delayed and asynchronous meiosis in pollen mother cell populations and uncoordinated nuclear division and cytokinesis resulting in dyad microspores. |
| AT1G80370 | Encodes a A2-type cyclin. Contributes to the fine-tuning of local proliferation during plant development. |
| AT2G26760 | Cyclin B1;(source:Araport11) |
| AT1G20610 | Cyclin B2;(source:Araport11) |
| AT1G70210 | Encodes a D-type cyclin that physically interacts with CDC2A. Its expression is upregulated early during germination. |
| AT4G34160 | encodes a cyclin D-type protein involved in the switch from cell proliferation to the final stages of differentiation. The gene is transcriptionally regulated by cytokinin and brassinosteroid. Protein interacts with cyclin-dependent kinase inhibitor ICK1. |
| AT5G67260 | Encode CYCD3;2, a CYCD3 D-type cyclin. Important for determining cell number in developing lateral organs and mediating cytokinin effects in apical growth and development. With PPD and NINJA, it plays a crucial role in leaf morphogenesis. |
| AT3G50070 | Encode CYCD3;3, a CYCD3 D-type cyclin. Important for determining cell number in developing lateral organs. Mediating cytokinin effects in apical growth and development. |
| AT5G65420 | Encodes a D-type cyclin CYCD4;1 that physically interacts with CDC2A and is expressed during vascular tissue development, embryogenesis, and formation of lateral root primordia. Its expression is upregulated early during germination.Involved in stomatal cell lineage proliferation in the hypocotyl. |
| AT5G02110 | Encodes CYCLIN D7;1. Overexpression of CYCD7;1 induces cell proliferation and cell enlargement in the embryo and endosperm leading to overgrowth. |
| AT2G01905 | cyclin J18 (cycJ18) |
| AT3G63120 | cyclin p1;(source:Araport11) |
| AT3G21870 | cyclin p2;(source:Araport11) |
| AT3G60550 | cyclin p3;(source:Araport11) |
| AT2G44740 | cyclin p4;(source:Araport11) |
| AT5G07450 | cyclin p4;(source:Araport11) |
| AT1G76540 | Encodes a cyclin-dependent protein kinase involved in regulation of the G2/M transition of the mitotic cell cycle. Specifically binds to the cyclin CYCD4;1, expressed in shoot meristem, young leaves and vascular tissue during the G2/M phase. Required for proper organization of the shoot apical meristem and for hormone signaling. |
| AT1G20930 | Cyclin-dependent kinase, expressed in flowers and suspension cell culture, expression peaks during M phase in synchronized cultures. Required for proper organization of the shoot apical meristem and for hormone signaling. Expressed in the shoot apical meristem. Involved in regulation of the G2/M transition of the mitotic cell cycle. |
| AT5G63610 | significant sequence similarity to plant and animal cyclin-dependent protein kinases, and was classified as an E-type CDK with a SPTAIRE cyclin binding motif in the kinase domain. |
| AT5G63370 | CDKG1 interacts with the splicing factor RSZ33 to regulate proper splicing of Cals5 Pre-mRNA. |
| AT5G62430 | Dof-type zinc finger domain-containing protein, similar to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Represses expression of Constans (CO), a circadian regulator of flowering time. Interacts with LKP2 and FKF1. Expression oscillates under constant light conditions. Mainly expressed in the vasculature of cotyledons, leaves and hypocotyls, but also in stomata. Localized to the nucleus and acts as a repressor of CONSTANS through binding to the Dof binding sites in the CO promoter. Protein gets degraded by FKF1 in the afternoon. CDF1 binds to the TOPLESS co-repressor protein through an N-terminal motif which is conserved across CDF-like proteins throughout land-plants. This interaction is important for the repression of CO and FT genes during the morning. Loss of CDF1 dependent repression through omission of TPL coordinating residues or through the loss of TPL function in phloem companion cells results in early flowering due to an up regulation of FT. |
| AT5G39660 | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions. |
| AT3G47500 | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions. |
| AT1G69570 | CDF5 is a circadian regulated transcript that is antiphasic with respect to its natural antisense transcript (NAT) FLORE (AT1G69572).CDF5 transcript accumulation delays flowering. CDF5 links circadian oscillation and photoperiodism. |
| AT1G26790 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
| AT2G07050 | Involved in the biosynthesis of brassinosteroids. Catalyzes the reaction from epoxysqualene to cycloartenol. |
| AT3G01480 | Encodes a chloroplast cyclophilin functioning in the assembly and maintenance of photosystem II (PSII) supercomplexes. The mRNA is cell-to-cell mobile. |
| AT1G53720 | Encodes a cyclophilin, member of a family modular proteins consisting of a peptidyl-prolyl cis? trans isomerase (PPIase) domain, followed by an RNA recognition motif (RRM), and a C-terminal domain enriched in charged amino acids. Interacts with with SCL33/SR33 and with a majority of Arabidopsis SR proteins and the largest subunit of RNA polymerase II. Localizes to the nucleus, but it does not significantly colocalize with SR proteins in nuclear speckles. |
| AT3G66654 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT1G66160 | CYS, MET, PRO, and GLY protein 1;(source:Araport11) |
| AT5G64660 | CYS, MET, PRO, and GLY protein 2;(source:Araport11) |
| AT3G57050 | Encodes cystathionine beta-lyase, the second enzyme in the methionine biosynthetic pathway. Mutants show defects in root development, reduced methylation and maintenance of the quiescent center. |
| AT2G40880 | Encodes a protein with cysteine proteinase inhibitor activity. Overexpression increases tolerance to abiotic stressors (i.e.salt,osmotic, cold stress). The mRNA is cell-to-cell mobile. |
| AT3G12490 | Encodes a protein with cysteine proteinase inhibitor activity. Overexpression increases tolerance to abiotic stressors (i.e.salt,osmotic, cold stress). |
| AT3G48350 | Involved in starvation-related responses that curtail primary root growth under severe nutrient limitation. |
| AT5G47550 | Putative phytocystatin expressed in seedlings and induced by heat stress and abscisic acid. Overexpression increases germination rate and heat stress tolerance. CYS5 is a target of ABF1 and ABF3 transcriptional regulators which bind to its promoter. |
| AT4G36880 | cysteine proteinase1;(source:Araport11) |
| AT3G03630 | Encodes a protein that possesses S-sulfocysteine synthase activity and lacks O-acetylserien(thiol)lyase activity. |
| AT3G61440 | Encodes a cysteine synthase isomer CysC1. The isomer is however less effective in cysteine biosynthesis. It is involved in beta-cyanoalanine biosynthesis, an intermediate of cyanide detoxification pathway. The mRNA is cell-to-cell mobile. |
| AT3G04940 | Encodes cysteine synthase CysD1. |
| AT5G28020 | Encodes cysteine synthase CysD2. |
| AT4G23190 | Encodes putative receptor-like protein kinase that is induced by the soil-borne vascular bacteria, Ralstonia solanacearum. Naming convention from Chen et al 2003 (PMID 14756307) |
| AT4G23260 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23270 | Encodes a cysteine-rich receptor-like protein kinase. The mRNA is cell-to-cell mobile. |
| AT4G38830 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G21410 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT1G70530 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT1G70520 | Encodes a cysteine-rich receptor-like protein kinase located to the plasma membrane. Involved in regulating microbe-associated molecular pattern-triggered ROS production and stress induced callose deposition at the plasmodesmata in roots. Required for MAMP-triggered responses and resistance to Pseudomonas syringae pv. tomato 118 DC3000 . |
| AT1G05340 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
| AT4G33660 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
| AT2G32190 | cysteine-rich/transmembrane domain A-like protein;(source:Araport11) |
| AT2G32200 | cysteine-rich/transmembrane domain A-like protein;(source:Araport11) |
| AT2G31170 | Encodes the cysteinyl t-RNA synthetase SYCO ARATH (SYCO), which is expressed and required in the central cell but not in the antipodals. SYCO, localized to the mitochondria, is necessary for mitochondrial cristae integrity. Mutation of this gene affects the lifespan of adjacent accessory cells. |
| AT2G32720 | Participates with ELO2 in VLCFA synthesis. |
| AT3G50930 | Encodes a protein that is present in a homo-multimeric protein complex on the outer mitochondrial membrane and plays a role in cell death and amplifying salicylic acid signalling. The mRNA is cell-to-cell mobile. |
| AT5G56090 | Encodes a homolog of COX15. Microarray analysis show a 3.2 fold increase in transcription after treatment with rotenone, an electron transport chain inhibitor. |
| AT4G10040 | Encodes cytochrome c. Promoter directs preferential expression in vascular tissues of cotyledons, leaves, roots, and hypocotyls, and in anthers. Double mutants with CYTC-1 accumulate starch during the day, have delayed growth and development and reduced GA and DELLA proteins linking cellular metabolism and GA homeostasis. |
| AT2G24180 | Encodes a cytochrome P450 monooxygenase that converts indole-3-acetonitrile to indole-3-aldehyde / indole-3-carboxylic acid and cyanide. The mRNA is cell-to-cell mobile. |
| AT1G17060 | Encodes a protein with similarity to other cytochrome P450's and is a homolog of BAS1. Over expression causes a dwarf phenotype resembling brassinolide resistant mutants. Double mutant analysis of sob7/bas1 loss of function mutants suggests these genes have redundant functions in light responsiveness. SOB7 may function in metabolizing brassinolides. Expressed in leaf, root, stem and silique but expression highest in flower and cauline leaves. Dominant overexpressing plants have dwarf phenotype, short siliques/seeds, rounded dark green leaves and short hypocotyls in light and dark. Loss of function alleles result in plants with long hypocotyls. |
| AT3G61880 | Encodes a cytochrome p450 monooxygenase. Overexpression of this gene allows fruit growth independently of fertilization. The gene is normally expressed only in floral organs(during the Arabidopsis stage 14 flower) and in the funiculus at anthesis. |
| AT5G04330 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT4G15393 | a member of the cytochrome P450 gene family. molecular function unknown. |
| AT4G15396 | cytochrome P450, family 702, subfamily A, polypeptide 6;(source:Araport11) |
| AT1G01280 | member of CYP703A CYP703A2 is expressed specifically in anthers of land plants, catalyzing the in-chain hydroxylation at the C-7 position of medium-chain saturated fatty acids (lauric acid in-chain hydroxylase) which is involved in pollen development (sporopollenin synthesis). |
| AT1G69500 | Encodes a cytochrome P450, designated CYP704B1. Expressed in the developing anthers. Essential for pollen exine development. Mutations in CYP704B1 result in impaired pollen walls that lack a normal exine layer and exhibit a characteristic striped surface, termed zebra phenotype. Heterologous expression of CYP704B1 in yeast cells demonstrated that it catalyzes omega-hydroxylation of long-chain fatty acids, implicating these molecules in sporopollenin synthesis. |
| AT3G20090 | cytochrome P450, family 705, subfamily A, polypeptide 18;(source:Araport11) |
| AT3G20100 | member of CYP705A The mRNA is cell-to-cell mobile. |
| AT3G20120 | cytochrome P450, family 705, subfamily A, polypeptide 21;(source:Araport11) |
| AT3G20130 | Encodes a member of the CYP705A family of cytochrome P450 enzymes. Mutants show altered gravitropic responses. |
| AT4G22690 | member of CYP706A The mRNA is cell-to-cell mobile. |
| AT4G12300 | member of CYP706A |
| AT4G12310 | member of CYP706A |
| AT4G19230 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. CYP707A1 appears to play an important role in determining the ABA levels in dry seeds. Gene involved in postgermination growth. Overexpression of CYP707A1 leads to a decrease in ABA levels and a reduction in after-ripening period to break dormancy. |
| AT2G29090 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. This gene predominantly accumulates in dry seeds and is up-regulated immediately following imbibition. CYP707A2 appears to play a major role in the rapid decrease in ABA levels during early seed imbibition. |
| AT5G45340 | Encodes a protein with ABA 8'-hydroxylase activity; involved in ABA catabolism. Mutant analyses show that disruption in the gene results in more drought tolerance whereas overexpression results in increased transpiration rate and reduced drought tolerance. Gene involved in postgermination growth. Plant P450 CYP707A3, ABA 8'-hydroxylase, binds enantioselectively (+)-ABA but not (-)-ABA, whereas the enzyme binds both enantiomers of AHI1 (a structural ABA analogue used as ABA 8'-hydroxylase competitive inhibitor). |
| AT3G19270 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. |
| AT2G46950 | cytochrome P450, family 709, subfamily B, polypeptide 2;(source:Araport11) |
| AT4G27710 | member of CYP709B The mRNA is cell-to-cell mobile. |
| AT1G13110 | member of CYP71B The mRNA is cell-to-cell mobile. |
| AT5G42590 | putative cytochrome P450 |
| AT5G25120 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT5G25130 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT5G25140 | putative cytochrome P450 |
| AT1G13080 | cytochrome P450 monooxygenase |
| AT3G26190 | putative cytochrome P450 |
| AT3G26200 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT3G26210 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT1G13090 | putative cytochrome P450 |
| AT1G13100 | putative cytochrome P450 |
| AT3G26220 | cytochrome P450 monooxygenase |
| AT3G26300 | putative cytochrome P450 |
| AT3G26310 | putative cytochrome P450 |
| AT2G34500 | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze in the presence of NADPH the conversion of β-sitosterol to stigmasterol, but not that of 24-epi-campesterol to brassicasterol (unlike CYP710A2). |
| AT2G34490 | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze the conversion of both 24-epi-campesterol and β-sitosterol to brassicasterol and stigmasterol, respectively, in the presence of NADPH. |
| AT2G26170 | Encodes a protein with similarity to thromboxane-A synthase, member of the CYP711A cytochrome P450 family. MAX1 is a specific repressor of vegetative axillary buds generated by the axillary meristem. Expressed in vascular traces in the rosette stem and axillary buds throughout plant development. Mutants have increased axillary branches. Along with MAX3,4 thought to mediate control of shoot branching via synthesis of a signal molecule which is transported over long distance mediated by MAX2. cDNA supports the existence of the longer transcript predicted for this locus, no cDNA isolated for shorter transcript. MAX1 downregulates 11 genes involved in flavonoid pathway (CHS, CHI, F3H, F3'H, FLS, DFR, ANS, UFGT, RT, AAC and GST). |
| AT2G42250 | member of CYP712A |
| AT5G24910 | Member of CYP714A. Encodes one of the two tandemly duplicated gene pair ELA1 (CYP714A1) and ELA2 (CYP714A2), homologs of the rice cytochrome P450 monooxygenase gene EUI1. Double mutation of ELA1 and ELA2 results in increased biomass and enlarged organs. |
| AT5G52400 | member of CYP715A |
| AT3G14640 | putative cytochrome P450 |
| AT3G14650 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT3G14660 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT3G14680 | putative cytochrome P450 |
| AT3G14690 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT1G19630 | cytochrome P450, family 722, subfamily A, polypeptide 1;(source:Araport11) |
| AT3G52970 | member of CYP76G |
| AT5G04660 | encodes a protein with cytochrome P450 domain |
| AT3G10570 | member of CYP77A |
| AT2G46660 | Encodes a member of CYP78A cytochrome P450 monooxygenase protein family that is required in the sporophytic tissue of the mother plant to promote seed growth. |
| AT4G39950 | Belongs to cytochrome P450 and is involved in tryptophan metabolism. Converts Trp to indo-3-acetaldoxime (IAOx), a precursor to IAA and indole glucosinolates. The mRNA is cell-to-cell mobile. |
| AT1G79370 | member of CYP79C |
| AT3G28740 | Encodes a member of the cytochrome p450 family. Expression is upregulated in response to cis-jasmonate treatment. Overexpression induces synthesis of volatile compounds that affect chemical ecology and insect interactions. |
| AT4G37340 | member of CYP81D |
| AT4G37330 | member of CYP81D |
| AT4G37320 | member of CYP81D |
| AT5G67310 | member of CYP81G |
| AT4G37310 | member of CYP81H |
| AT4G31500 | Encodes an oxime-metabolizing enzyme in the biosynthetic pathway of glucosinolates. Is required for phytochrome signal transduction in red light. Mutation confers auxin overproduction. |
| AT4G00360 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems. |
| AT1G01600 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly at highest level in mature stems and flowers. |
| AT1G63710 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at highest level in mature stems and flowers. |
| AT2G45970 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems.Mutant seeds have reduced seed longevity, higher tetrazolium salt uptake and reduction, and reduced lipid polyester barriers (PMID:32519347). |
| AT3G03470 | P450 monooxygenase CYP89A9. Involved in NDCC accumulation during Arabidopsis leaf senescence. |
| AT1G05160 | Encodes an ent-kaurenoic acid hydroxylase, a member of the CYP88A cytochrome p450 family. |
| AT1G64900 | Encodes cytochrome P450 (CYP89A2). The mRNA is cell-to-cell mobile. |
| AT1G64950 | member of CYP89A The mRNA is cell-to-cell mobile. |
| AT3G13730 | Encodes a cytochrome P-450 gene that is involved in brassinosteroid biosynthesis, most likely in the conversion step of teasterone (TE) to 3-dehydroteasterone (3DT), and/or 6-deoxoteasterone (6-deoxoTE) to 6-deoxo-3-dehydroteasterone (6-deoxo3DT); or the conversion of cathasterone (CT) to TE, and/or 6-deoxocathasterone (6-deoxoCT) to 6-deoxoTE. Recently, CYP90D1 was shown to catalyse the C-23 hydroxylation of several brassinosteroids (the enzyme has a broad specificity for 22-hydroxylated substrates). Member of the CYP90C CYP450 family. Similar to Cytochrome P450 90C1 (ROT3). |
| AT5G63450 | AtWRKY33 regulates root apoplastic barrier formation by controlling AtCYP94B1 leading to increased salt tolerance of Arabidopsis plants. Regulation by WRKY33 to control apoplastic barrier formation in roots to confer salt tolerance. |
| AT3G01900 | member of CYP94B |
| AT3G48520 | CYP94B3 is a jasmonoyl-isoleucine-12-hydroxylase that catalyzes the formation of 12-OH-JA-Ile from JA-Ile. By reducing the levels of this the biologically active phytohormone, CYP94B3 attenuates the jasmonic acid signaling cascade. CYP94B3 transcript levels rise in response to wounding. |
| AT2G23180 | member of CYP96A |
| AT4G39510 | member of CYP96A |
| AT1G31800 | Encodes a protein with β-ring carotenoid hydroxylase activity. The mRNA is cell-to-cell mobile. |
| AT2G40890 | encodes coumarate 3-hydroxylase (C3H), a P450-dependent monooxygenase. Involved in lignin biosynthesis and flavonoid biosynthesis. Also affects the biosynthesis of coumarins such as scopoletin and scopolin as a branching-out-pathway from the phenylpropanoid acid level. |
| AT1G75450 | This gene used to be called AtCKX6. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT5G21482 | This gene used to be called AtCKX5. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. Enzyme assays show preference for N6 -(2-isopentenyl)adenine 9-glucoside substrate. |
| AT4G11140 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT1G68550 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT1G25470 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT4G23750 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Monopteros target gene. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT5G53290 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT4G27950 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT2G46310 | CRF5 encodes one of the six cytokinin response factors. It is transcriptionally upregulated in response to cytokinin. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves. |
| AT3G61630 | CRF6 encodes one of the six cytokinin response factors. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves. |
| AT3G44326 | Cytokinin induced F-Box protein. Forms a unique F-Box family with AT2G27310 and AT2G36090. It is primarily expressed in the root. |
| AT1G15300 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.1e-59 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
| AT2G29560 | Encodes a putative phosphoenolpyruvate enolase that is localized both to the nucleus and the cytoplasm. The mRNA is cell-to-cell mobile. |
| AT4G09510 | CINV2 appears to function as a neutral invertase based on the phenotype of a cinv1(AT1G35580)/cinv2 double mutant. It is predicted to be a cytosolic enzyme. CINV1, CINV2, and possibly other cytosolic invertases may play an important role in supplying carbon from sucrose to non-photosynthetic tissues. |
| AT1G65930 | Encodes a NADP+-isocitrate dehydrogenase that is believed to function in the cytosol. It appears to contribute to NADPH production under oxidative stress, and thereby to participate in redox signalling linked to defense responses. The mRNA is cell-to-cell mobile. |
| AT1G04270 | Encodes cytosolic ribosomal protein S15. |
| AT1G04410 | predicted to encode a cytosolic malate dehydrogenase. |
| AT3G04620 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT1G25360 | DYW-type pentatricopeptide repeat protein involved in C to U editing in mitochondria and chloroplasts. |
| AT3G51370 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT4G39800 | ** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT5G61410 | Arabidopsis thaliana ribulose-5-phosphate-3-epimerase mRNA |
| AT3G24420 | DLK2 is a divergent member of the DWARF14 family. It's expression is dependent on D14 and KAI2 but it does not appear to play a role in stringolactone metabolism. |
| AT5G55910 | Member of AGC VIIIa Kinase family. D6PK is a protein kinase involved that plays a role in polar auxin transport. Most likely acts redundantly with the related proteins: D6PKL1,D6PKL2,and D6PKL3. PIN1 is a target of D6PK phosphorylation. D6PK is associated with sterol enriched membrane rafts and may be involved in regulation of the switch from basal to planar polarity during root hair initiation. Involved in pulse-induced phototropism but also for time-dependent second positive phototropism. Works with PIN3 in the same genetic pathway of hypocotyl phototropism under all light conditions. Involved in the generation of auxin asymmetrical distribution induced by phototropic stimulation. |
| AT4G26610 | D6PK family kinase involved in pulse-induced phototropism but also for time-dependent second positive phototropism, and continuous light-induced hypocotyl phototropism. |
| AT1G78420 | Activates the latent peptidases DA1, DAR1 and DAR2 by mono-ubiquitination at multiple sites. Subsequently, these activated peptidases destabilize various positive regulators of growth. |
| AT5G66620 | DA1-related protein 6;(source:Araport11) |
| AT5G66610 | DA1-related protein 7;(source:Araport11) |
| AT2G30550 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT3G10910 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G01880 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G58760 | Encodes a DDB1a interacting protein DDB2 required for UV-B tolerance and genomic integrity. |
| AT5G20250 | encodes a member of glycosyl hydrolase family 36. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile. |
| AT3G49620 | encodes a protein similar to 2-oxoacid-dependent dioxygenase. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT3G60140 | Encodes a protein similar to beta-glucosidase and is a member of glycoside hydrolase family 1. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile. |
| AT3G13450 | branched chain alpha-keto acid dehydrogenase E1 beta |
| AT1G67070 | Encodes a protein with phosphomannose isomerase activity that is involved in synthesis of ascorbic acid. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT3G20550 | Encodes a nuclear localized FHA (forhkead) domain containing protein.Mutant plants have shortened roots, delayed flowering time, altered floral organ number, defective floral organs and reduced fertility.Ddl mutants also show reduced levels of pri-miRNAs as well as mature miRNAs suggesting involvement in biogenesis of miRNAs. DDL does not affect transcription of miRNAs directly but may act through other proteins such as DCL. |
| AT4G31040 | Chlorplast membrane protein that modulates H+ homeostasis and regulates NPQ. |
| AT3G42170 | transposase-like gene with conserved domains from the family of hAT transposases that includes hobo from Drosophila melanogaster, Activator (Ac) from maize, and Tam3 from snapdragon but lacks several amino acids known to be essential for Ac transposition5. The DAYSLEEPER gene lacks 8 bp duplications and TIRs (a common feature of transcriptionally silent hAT transposases), however, DAYSLEEPER expression was detected, and several expressed sequence tags are available. The expression seems to be under the control of factors determining the circadian rhythm. DAYSLEEPER was isolated as a factor binding to a motif (Kubox1) present in the upstream region of the Arabidopsis DNA repair gene Ku70. Mutant plants lacking DAYSLEEPER or strongly overexpressing this gene do not develop in a normal manner. |
| AT5G03210 | Encodes a small polypeptide contributing to resistance to potyvirus. |
| AT5G08630 | DDT domain-containing protein;(source:Araport11) |
| AT2G38050 | Similar to mammalian steroid-5-alpha-reductase. Involved in the brassinolide biosynthetic pathway. |
| AT1G12840 | Encodes subunit C of the vacuolar H(+)-ATPase (V-ATPase). Bound and phosphorylated by AtWNK8. The mRNA is cell-to-cell mobile. |
| AT1G77030 | Required for functional maturation of male and female gametophytes. |
| AT1G03310 | Encodes a protein with strong similarity to isoamylase (EC:3.2.1.68) however lacks critical residues known to be important for activity. Appears to co localize with ISA1 in the chloroplast isoamylase complex. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. It has been postulated that AtISA2 interacts with AtISA1 to form the Iso1 complex. |
| AT5G61590 | Encodes an AP2/ERF-type transcription factor that is preferentially expressed in the epidermis and induced by darkness and negatively regulates cuticular wax biosynthesis. |
| AT1G72490 | DRO1 is a member of the IGT gene family and has a unknown function . It is expressed in roots and involved in leaf root architecture, specifically the orientation of lateral root angles. Involved in determining lateral root branch angle. |
| AT2G44810 | Mutant has defects in anther dehiscence, pollen maturation, and flower opening. The DAD1 protein is a chloroplastic phospholipase A1 that catalyzes the initial step of jasmonic acid biosynthesis. |
| AT4G33400 | Together with DEM2 plays an essential role in cell division in plants, most likely through an interaction with RAN1. |
| AT1G19100 | Encodes a member of the conserved Microrchidia (MORC) adenosine triphosphatase (ATPase) family, predicted to catalyze alterations in chromosome superstructure. Required for heterochromatin condensation and gene silencing. |
| AT1G55350 | Similar to maize DEK1, a gene encoding a membrane protein of the calpain gene superfamily required for aleurone cell development in the endosperm of maize grains. A key component of the embryonic L1 cell-layer specification pathway. It localizes to membranes and undergoes intramolecular autolytic cleavage events that release the calpain domain into the cytoplasm. |
| AT5G10250 | Encodes a protein with an N-terminal BTB/POZ domain and a C-terminal NPH3 family domain. dot3 mutants have defects in shoot and primary root growth and produce an aberrant parallel venation pattern in juvenile leaves. |
| AT4G18750 | Encodes a pentatricopeptide (PPR) protein involved in leaf and root development. dot4 mutants have an aberrant midgap venation pattern in juvenile leaves and cotyledons. |
| AT1G32210 | Encodes protein involved in suppression of apoptosis. Complements a mammalian apoptosis suppressor mutation. |
| AT5G15410 | 'defense, no death' gene (DND1) encodes a mutated cyclic nucleotide-gated cation channel; Same as CNGC2 (article ID 229): Cyclic nucleotide gated channel, activated by cAMP, conducts K+ and other monovalent cations but excludes Na+, does not contain the GYG amino acid sequence found in other channels with this conductivity profile. Conducts Ca2+ into cells which is linked to the generation of NO and the NO signaling pathway involved in the innate immune response to pathogens. CNGC2 could be the key step mediating bulk Ca2+ influx into leaf cells after unloading from the vascular and have no direct roles in the leaf development and HR. |
| AT1G13870 | Encodes a homolog of the yeast TOT4/KTI12 protein. Yeast TOT4/KTI12 associates with Elongator, a multisubunit complex that binds the RNA polymerase II transcription elongation complex. Ds insertion mutant has enlarged shoot apical region, 4 to 6 long slender leaves followed by spike-like structures, short roots. Mutants also have no ncm5U (5-carbamoylmethyluridine). |
| AT2G47940 | Encodes DegP2 protease (DEGP2); nuclear gene for chloroplast product. |
| AT4G18370 | Encodes DEG5. Forms a hexamer with DEG8 in the thylakoid lumen. Involved in the cleavage of photodamaged D2 protein of photosystem II (PSII). |
| AT3G03380 | Encodes a putative DegP protease. The mRNA is cell-to-cell mobile. |
| AT5G53850 | Encodes a trifunctional dehydratase / enolase / phosphatase involved in the methionine salvage. |
| AT4G25480 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF3). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. |
| AT2G38340 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT1G21910 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT1G54410 | Encodes a KS-type dehydrin can reduce the formation of reactive oxygen species (ROS) from Cu. |
| AT3G50980 | dehydrin xero 1;(source:Araport11) |
| AT5G16710 | DHAR3 protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide.Encodes 30-40% of extractable leaf GSH-dependent DHAR activity. Single knockout mutants show unaltered ascorbate and glutathione status in optimal and oxidative stress conditions.Makes a minor contribution to glutathione oxidation in response to increased intracellular hydrogen peroxide (catalase deficiency) (PMID:28381499). |
| AT4G26630 | Encodes a chromatin-associated protein that specifically binds histones H3 and H4 and contributes to modulation of Arabidopsis chromatin structure and function. |
| AT5G45830 | Encodes DOG1 (DELAY OF GERMINATION 1). A quantitative trait locus involved in the control of seed dormancy. Belongs to a novel plant-specific gene family whose members include: DOG1-like 1-4 (DOGL1-4, At4g18660, At4g18680, At4g18690, At4g18650 respectively) and DOG1. DOG1 expression is seed-specific. |
| AT3G16240 | Delta tonoplast intrinsic protein, functions as a water channel and ammonium (NH3) transporter. Highly expressed in flower, shoot, and stem. Expression shows diurnal regulation and is induced by ammonium (NH3). Protein localized to vacuolar membrane. The mRNA is cell-to-cell mobile. |
| AT1G65520 | encodes a peroxisomal delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation |
| AT2G39800 | encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. P5CS1 appears to be involved in salt stress responses related to proline accumulation, including protection from reactive oxidative species. P5CS1 appears to be present in different cells and/or different subcellular locations from P5CS2 in a tissue-dependent manner. |
| AT5G04560 | Encodes a DNA glycosylase DEMETER (DME). Responsible for endosperm maternal-allele-specific hypomethylation at the MEDEA (MEA) gene. DME can excise 5-methylcytosine in vitro and when expressed in E. coli. DME establishes MEA imprinting by removing 5-methylcytosine to activate the maternal allele. |
| AT1G72040 | Encodes a multisubstrate deoxyribonucleoside kinase that salvages DNA precursors. |
| AT4G29330 | DERLIN-1;(source:Araport11) |
| AT1G07645 | Ortholog of HC205/ Xhdsi-1voc from Xerophyta humilis. Member of VOC metalloenzyme superfamily. Not involved in response to abiotic stress, unlike its Xerophyta ortholog. |
| AT4G21310 | DUF1218 family member. |
| AT5G41560 | Encodes a substrate receptor for CRL4-CDD complexes that provides substrate specificity for CRL4 by interacting with ubiquitination targets. By its interaction and regulation of levels of PYL8 through proteasomal degradation, it negatively regulates ABA-mediated developmental responses, including inhibition of seed germination, seedling establishment, and root growth |
| AT5G38030 | MATE transporter involved in auxin homeostasis in roots. |
| AT4G25640 | Encodes a multidrug and toxin efflux family transporter. Involved in flavonoid metabolism, affecting Root growth, seed development and germination, and pollen development, release and viability. |
| AT3G23637 | Member of a family of small polypeptides found only in angiosperm lineages.Contains a conserved 29 amino acid domain (RTF or DVL domain). |
| AT3G55630 | Encodes one of the three folylpolyglutamate synthetase isoforms (FPGSs): FPGS1 (At5g05980, plastidic), FPGS2 (At3g10160, mitochondrial) and FPGS3 (At3g55630, cytosolic). |
| AT1G48320 | Encodes one of the two functional DHNA-CoA (1,4-dihydroxy-2-naphthoyl-CoA) thioesterases found in Arabidopsis. |
| AT1G48300 | Cytosolic iron-sulfur protein with a [2Fe-2S] cluster which synthesizes triacylglycerol (DGAT activity). |
| AT5G63770 | a member of the diacylglycerol kinase gene family. Encodes a functional diacylglycerol kinase. Involved in root elongation and plant development. Gene expression is induced by wounding or cold. |
| AT2G18730 | diacylglycerol kinase 3;(source:Araport11) |
| AT4G30340 | encodes a diacylglycerol kinase. Applying a specific diacylglycerol kinase inhibitor to the growth media resulted in reduced root elongation and plant growth. Gene is expressed throughout the plant but is strongest in flowers and young seedlings. |
| AT5G07920 | Encodes a putative diacylglycerol kinase that is mainly expressed in roots, shoots and leaves, but its enzyme product was not active in vitro. |
| AT1G63900 | Encodes a RING-type ubiquitin E3 ligase of the chloroplast outer membrane that associates with TOC complexes and mediates ubiquitination of TOC components, promoting their degradation. It not only regulates chloroplast protein import but also targets components of the peroxisome protein import apparatus, PEX13 in particular. Several studies have been done to examine the peroxisomal localization of this protein, with varying interpretations. |
| AT4G24570 | Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470). The mRNA is cell-to-cell mobile. |
| AT1G01040 | Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state, others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs. The mRNA is cell-to-cell mobile. |
| AT3G11670 | Responsible for the final assembly of galactolipids in photosynthetic membranes. Provides stability to the PS I core complex (e.g. subunits PsaD, PsaE). |
| AT2G45440 | Encodes a protein that likely has dihydropicolinate synthase activity based on its mutant phenotype of decreased lysine levels and increased aspartate levels. The mutant also has increased levels of threonine. The enzyme is predicted to localize to the chloroplast. |
| AT5G42800 | dihydroflavonol reductase. Catalyzes the conversion of dihydroquercetin to leucocyanidin in the biosynthesis of anthocyanins. Not expressed in roots (qRT-PCR). The mRNA is cell-to-cell mobile. |
| AT1G27980 | Encodes an ER-localized sphingoid long-chain base-1-phosphate lyase involved in the dehydration stress response. |
| AT1G14130 | DAO1 is an IAA oxidase expressed in many different plant parts. it is a member of a family of dioxygenase and 2OG Fe(II) oxygenase domain and DAO domain containing proteins. It appears to be the major IAA oxidase in planta and major contributor to IAA degradation. |
| AT2G45180 | nsLTP family-related gene. Expression is strongly suppressed by bacterial pathogens. Mutants are more susceptible to pathogens and abiotic stressors suggesting a function in basal stress response. |
| AT5G64860 | Encodes a maltotriose-metabolizing enzyme with chloroplastic α-1,4-glucanotransferase activity. Mutant has altered starch degradation. |
| AT3G22880 | Expression of the AtDMC1 is restricted to pollen mother cells in anthers and to megaspore mother cells in ovules. Similar to meiosis-specific yeast DMC gene. |
| AT5G58900 | R-R-type MYB protein |
| AT3G14990 | Encodes a homolog of animal DJ-1 superfamily protein. In the A. thaliana genome, three genes encoding close homologs of human DJ-1 were identified AT3G14990 (DJ1A), AT1G53280 (DJ1B) and AT4G34020 (DJ1C). Among the three homologs, DJ1C is essential for chloroplast development and viability. It exhibits glyoxalase activity towards glyoxal and methylglyoxal. The mRNA is cell-to-cell mobile. |
| AT1G53280 | Encodes a homolog of animal DJ-1 superfamily protein. In the A. thaliana genome, three genes encoding close homologs of human DJ-1 were identified AT3G14990 (DJ1A), AT1G53280 (DJ1B) and AT4G34020 (DJ1C). Among the three homologs, DJ1C is essential for chloroplast development and viability. It exhibits glyoxalase activity towards glyoxal and methylglyoxal. |
| AT3G10270 | Protein targeting to mitochondria is influenced by UTR sequences. |
| AT5G04130 | Encodes a protein that when expressed together with GYRA generates an active supercoiling DNA gyrase enzyme that shares similar properties to its bacterial counterpart, including sensitivity to gyrase-specific antibiotics. |
| AT2G17880 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT3G13310 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT2G42750 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT1G08130 | Encodes the Arabidopsis DNA ligase 1 that provides the major DNA ligase activity in cells and plays a key role in both DNA replication and excision repair pathways. In addition, it is an important component of the active DNA demethylation machinery and is indispensable for cell viability. AtLIG1 expresses one major and two minor mRNA transcripts differing only in the length of the 5' untranslated leader sequences preceding a common ORF. Translation from the first in-frame start codon produces an AtLIG1 isoform that is targeted exclusively to the mitochondria. Translation initiation from the second in-frame start codon produces an AtLIG1 isoform targeted only to the nucleus. |
| AT1G66730 | Encodes a novel plant specific DNA ligase that is involved in seed germination and DNA repair. |
| AT1G10520 | Encodes a homolog of the mammalian DNA polymerase lambda that is involved in the repair of UV-B induced DNA damage. |
| AT2G25620 | Encodes DBP1, a member of the DBP factors (DNA-binding protein phosphatases) featuring sequence-specific DNA-binding and protein phosphatase activity. DBP1 is involved in plant-potyvirus interactions. Loss-of-function of DBP1 renders resistance to potyviruses. Negatively regulates drought and salt tolerance through altering leaf surface permeability. |
| AT4G21080 | Dof-type zinc finger domain-containing protein;(source:Araport11) |
| AT5G18070 | encodes a novel protein involved in DNA repair from UV damage. Isolated by functional complementation of E. coli UV-sensitive mutants (UVR genes). |
| AT1G20340 | recombination and DNA-damage resistance protein (DRT112) One of two Arabidopsis plastocyanin genes. Predominant form, expressed 10x higher than PETE1. PETE2 is thought to be post-transcriptionally regulated via copper accumulation and is involved in copper homeostasis. Mutation of this gene does not have obvious effect on photosynthesis. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the membrane. |
| AT2G20560 | DNAJ heat shock family protein;(source:Araport11) |
| AT4G13830 | DnaJ-like protein (J20); nuclear gene |
| AT4G36040 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT2G46590 | Encodes a protein containing Dof zinc finger motifs that is a positive regulator of light-mediated seed germination. Its expression is limited to vascular system of the mother plant. A recessive mutation is inherited as maternal-effect and expression is not detected in the embryo. Mutants are defective in seed germination and are more dependent on light and cold treatment and less sensitive to gibberellin during seed germination. It plays its main role downstream of PIL5 and DAG1 in the phytochrome B (phyB)-mediated pathway. |
| AT1G51700 | Encodes dof zinc finger protein (adof1). The mRNA is cell-to-cell mobile. |
| AT3G45040 | Encodes a putative dolichol kinase that is localized to the endoplasmic reticulum and involved in pollen tube reception in the female gametophyte. |
| AT3G19800 | Encodes the DUF177B version of the two DUF177 proteins in Arabidopsis. This version differs from DUF177A in containing a 23 aa insertion compared to the DUF177A sequence. |
| AT1G03300 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
| AT2G47220 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
| AT2G47230 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. |
| AT3G62300 | Encodes a protein with Agenet/Tudor and DUF724 domains. It can interact with ABAP1, a negative regulator of DNA replication and transcription, with the plant histone modification 'reader' LHP1, and with non-modified histones. It may act as a link between DNA replication, transcription and chromatin remodeling during flower development. Loss of function mutant has a WT phenotype. |
| AT5G23770 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
| AT5G15380 | Encodes methyltransferase involved in the de novo DNA methylation and maintenance of asymmetric methylation of DNA sequences. |
| AT5G14620 | A putative DNA methyltransferase with rearranged catalytic domains; similar to mammalian DNMT3 methyltransferases; contains UBA domains. The 3'-end proximal part of the gene coding region is highly methylated at both adenine and cytosine residues. |
| AT4G12010 | Leucine-rich repeat domain (NLR) receptor. Dominant negative alleles suppress catma3 autoimmunity. Co-regulates with WRKY19 basal levels of immunity to root-knot nematodes. |
| AT2G33830 | Negative regulator of local and systemic acquired resistance; target of FLD for activation of SAR. |
| AT1G28330 | dormancy-associated protein (DRM1) |
| AT4G25670 | stress response NST1-like protein;(source:Araport11) |
| AT2G45830 | downstream target of AGL15 2;(source:Araport11) |
| AT1G79760 | Identified as target of the AGL15 binding motif CArG. |
| AT5G24530 | Encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility to downy mildew. The mRNA is cell-to-cell mobile. |
| AT5G05410 | Encodes a transcription factor that specifically binds to DRE/CRT cis elements (responsive to drought and low-temperature stress). Belongs to the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2A). There are eight members in this subfamily including DREB2B. The protein contains one AP2 domain. Overexpression of transcriptional activation domain of DREB2A resulted in significant drought stress tolerance but only slight freezing tolerance in transgenic Arabidopsis plants. Microarray and RNA gel blot analyses revealed that DREB2A regulates expression of many water stress?inducible genes. The mRNA is cell-to-cell mobile. |
| AT3G11020 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2B). The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A. |
| AT5G67190 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT2G23340 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT1G09710 | Paralog of DRMY1 with unknown function. |
| AT5G17460 | glutamyl-tRNA (Gln) amidotransferase subunit C;(source:Araport11) |
| AT4G15910 | encodes a gene whose transcript level in root and leaves increases to progressive drought stress. The transcript level is also affected by changes of endogenous or exogenous abscisic acid level. It appears to be a member of plant-specific gene family that includes late embryo-abundant and zinc- IAA-induced proteins in other plants. The mRNA is cell-to-cell mobile. |
| AT3G05700 | Encodes a DNA binding protein with transcription activation activity. It is expressed in response to osmotic, drought and ABA stress. |
| AT3G26932 | dsRNA-binding protein 3;(source:Araport11) |
| AT5G45010 | Member of the intrinsically disordered protein family, interacts with different protein partners forming complexes involved in diverse biological mechanisms such as DNA repair, regulation of protein homeostasis, mRNA export. Role in the post-translational protein modification named DSSylation. Involved in molecular mechanisms underlying plant abiotic stress responses. |
| AT1G03930 | Phosphorylates serine, threonine, and tyrosine |
| AT4G17505 | carboxyl-terminal proteinase-like protein (DUF239);(source:Araport11) |
| AT5G03390 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G67040 | F-box protein, putative (DUF295);(source:Araport11) |
| AT4G14260 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G54450 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G53240 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G25460 | Encodes a DUF642 cell wall protein. |
| AT1G64110 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT5G39650 | Target promoter of the male germline-specific transcription factor DUO1. Knock down mutants result in an aborted seed phenotype that is transmitted through the male, together with loss-of-function mutation in DMP9 induces maternal haploids, with an average haploid induction rate of 2.1 ? 1.1%. |
| AT4G35560 | Target promoter of the male germline-specific transcription factor DUO1. The mRNA is cell-to-cell mobile. |
| AT3G19820 | Involved in the conversion of the early brassinosteroid precursor 24-methylenecholesterol to campesterol. Brassinosteroids affect cellular elongation. Mutants have dwarf phenotype. DWF1 is a Ca2+-dependent calmodulin-binding protein. |
| AT3G03990 | Encodes an alpha/beta hydrolase essential for strigolactone signaling. Degradation of the protein is promoted by strigolactone. The mRNA is cell-to-cell mobile. |
| AT3G50660 | Encodes a 22α hydroxylase whose reaction is a rate-limiting step in brassinosteroid biosynthetic pathway. The protein is a member of CYP90B gene family. CLM is an epi-allele with small, compressed rosette, reduced internode length, and reduced fertility, appears in selfed ddm mutant plants possibly due to loss of cytosine methylation. Transcripts accumulate in actively growing tissues, and GUS expression is negatively regulated by brassinosteroids. Localized in the endoplasmic reticulum. The in vitro expressed protein can perform the C-22 hydroxylation of a variety of C27-, C28- and C29-sterols. Cholesterol was the best substrate, followed by campesterol. Sitosterol was a poor substrate. |
| AT1G50430 | Mutants are defective in Brassinosteroid biosynthesis (delta7-sterol-C7 reduction step) and have a dwarf phenotype. EXO70 interactor and presumed negative secretion regulator. |
| AT1G12610 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (DDF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. Overexpression of this gene results in delayed flowering and dwarfism, reduction of gibberellic acid biosynthesis, and increased tolerance to high levels of salt. This gene is expressed in all tissues examined, but most abundantly expressed in upper stems. Overexpression of this gene is also correlated with increased expression of GA biosynthetic genes and RD29A (a cold and drought responsive gene). Under salt stress it induces the expression of GAOX7, which encodes ad C20-GA inhibitor. |
| AT1G61210 | DWA3 encodes a DWD(DDB1 binding WD40) protein. Invitro analyses suggest its involvement in the negative regulation of ABA responses.One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
| AT4G34280 | Encodes a putative substrate receptor for the cullin4-RING ubiquitin E3 ligase complex that is involved in negative regulation of plant UV-B response. |
| AT3G61760 | DYNAMIN-like 1B;(source:Araport11) |
| AT2G44590 | DYNAMIN-like 1D;(source:Araport11) |
| AT3G60190 | At3g60190 encodes Arabidopsis dynamin-related protein 1E, DRP1E, also known as EDR3, ADL4 and ADL1E, which is 624 amino acid residues long, has a predicted mass of 69.8 kDa and a pI of 7.5. Dynamin-related protein 1E belongs to a plant-specific subclass of dynamin-related proteins (DRP1), consisting of five members in Arabidopsis (A, B, C, D, E). This class is characterized by having an N-terminal GTPase domain, a central `dynamin 2` domain and a C-terminal GTPase effector domain (GED), a typical structure for plant dynamin-related proteins. However, this class lacks a PH domain and a proline-rich domain, which are found in classical animal dynamin-like proteins. Based on work on animal dynamins, the plant DRP1 proteins should be able to form polymeric structures that wrap around membranes to facilitate membrane tubulation and pinching off of vesicles, processes that are essential to vesicle trafficking and membrane compartmentalization. The edr3 mutation causes a P77L substitution in the G2 motif of the GTPase domain of DRP1E. edr3 mutant Arabidopsis plants display enhanced cell death in response to powdery mildew infection. |
| AT4G33650 | Encodes a protein with high sequence similarity to the dynamin superfamily. Among those members ADL2 was most closely related to Dnm1p of yeast and likely a member of the Vps1p subfamily. Widely expressed in various tissues with highest expression in flower tissues. Localizes to the chloroplast, mitochondrion and peroxisome. Involved in peroxisome and mitochondria fission in combination with DRP3B. |
| AT3G16800 | EGR3 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress, EGR3 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
| AT2G33850 | Stigmatic factor that plays a role during the early post-pollination stages. |
| AT3G58110 | Encodes an adaptor protein that connects JAZ repressors with the TPR2 co-repressor to suppress jasmonate-responsive anthocyanin accumulation. |
| AT2G40080 | Encodes a novel nuclear 111 amino-acid phytochrome-regulated component of a negative feedback loop involving the circadian clock central oscillator components CCA1 and LHY. ELF4 is necessary for light-induced expression of both CCA1 and LHY, and conversely, CCA1 and LHY act negatively on light-induced ELF4 expression. ELF4 promotes clock accuracy and is required for sustained rhythms in the absence of daily light/dark cycles. It is involved in the phyB-mediated constant red light induced seedling de-etiolation process and may function to coregulate the expression of a subset of phyB-regulated genes. |
| AT5G62640 | nuclear targeted protein involved in flowering time regulation that affects flowering time independent of FLC |
| AT5G04240 | Early Flowering 6 (ELF6) encodes a Jumonji N/C and zinc finger domain-containing protein that acts as a repressor in the photoperiod pathway. ELF6 interacts with BES1 in a Y2H assay, in vitro, and in Arabidosis protoplasts (based on BiFC). ELF6 may play a role in brassinosteroid signaling by affecting histone methylation in the promoters of BR-responsive genes. |
| AT5G16260 | Encodes a RNA binding protein ELF9 (EARLY FLOWERING9). Loss of ELF9 function in the Wassilewskija ecotype causes early flowering in short days. ELF9 reduces SOC1 (SUPPRESSOR OF OVEREXPRESSION OF CO1) transcript levels, possibly via nonsense-mediated mRNA decay. The mRNA is cell-to-cell mobile. |
| AT1G77300 | Encodes a protein with histone lysine N-methyltransferase activity required specifically for the trimethylation of H3-K4 in FLC chromatin (and not in H3-K36 dimethylation). Acts as an inhibitor of flowering specifically involved in the autonomous promotion pathway. EFS also regulates the expression of genes involved in carotenoid biosynthesis and nitrogen assimilation.Modification of histone methylation at the CRTISO locus reduces transcript levels 90%. The increased shoot branching seen in some EFS mutants is likely due to the carotenoid biosynthesis defect having an effect on stringolactones.Required for ovule, embryo sac, anther and pollen development. |
| AT3G22840 | Encodes an early light-inducible protein. |
| AT2G23990 | early nodulin-like protein 11;(source:Araport11) |
| AT4G31840 | early nodulin-like protein 15;(source:Araport11) |
| AT3G01070 | early nodulin-like protein 16;(source:Araport11) |
| AT5G15350 | early nodulin-like protein 17;(source:Araport11) |
| AT1G08500 | early nodulin-like protein 18;(source:Araport11) |
| AT4G27520 | early nodulin-like protein 2;(source:Araport11) |
| AT5G14345 | Encodes a Uclacyanin/Basic blue family protein |
| AT4G32490 | early nodulin-like protein 4;(source:Araport11) |
| AT1G79800 | early nodulin-like protein 7;(source:Araport11) |
| AT1G64640 | early nodulin-like protein 8;(source:Araport11) |
| AT1G76180 | Encodes a dehydrin protein whose expression is induced early on in response to dehydration stress. This gene's expression to cold occurs in two waves, with early induction occurring within 1 h and secondary induction occurring 5 h after the beginning of cold stress. Expression is also induced in response to ABA but not in response to 2,4-D, BA, and GA3. ERD14 protein is capable of binding Ca2+, especially when the protein is phosphorylated. |
| AT1G08930 | encodes a putative sucrose transporter whose gene expression is induced by dehydration and cold. The mRNA is cell-to-cell mobile. |
| AT5G51070 | ATP-dependent Clp protease regulatory subunit The mRNA is cell-to-cell mobile. |
| AT1G20450 | Encodes a gene induced by low temperature and dehydration. Inhibits e.coli growth while overexpressed. Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. LTI29 and LTI30 double overexpressors confer cold tolerance. Localized to membranes and cytoplasm. |
| AT2G41430 | Encodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2. |
| AT3G30775 | Encodes a proline oxidase that is predicted to localize to the inner mitochondrial membrane, its mRNA expression induced by high levels of Al and by osmotic stress. The promoter contains an L-proline-inducible element. |
| AT1G18330 | EARLY-PHYTOCHROME-RESPONSIVE1 |
| AT4G19120 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G30360 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT2G17840 | Identified as drought-inducible gene by differential hybridization. Upregulated by high light, drought, cold and salt stress determined by microarray analysis. |
| AT1G10370 | Encodes GSTU17 (Glutathione S-Transferase U17). Functions as a negative component of stress-mediated signal transduction pathways in drought and salt stress responses. |
| AT1G02205 | Expression of the CER1 gene associated with production of stem epicuticular wax and pollen fertility. Biochemical studies showed that cer1 mutants are blocked in the conversion of stem wax C30 aldehydes to C29 alkanes, and they also lack the secondary alcohols and ketones. These suggested the CER1 protein is an aldehyde decarbonylase, but the exact molecular function of this protein remains to be determined. |
| AT4G24510 | Encodes a component of the fatty acid elongation machinery required for C28 to C30 fatty acid elongation. It does not require the acyltransferase catalytic site for biological function. |
| AT4G34100 | Encodes a putative E3 ubiquitin ligase that is involved in cuticular wax biosynthesis and regulates 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) activity. HMGR catalyzes the major rate-limiting step of the mevalonic acid (MVA) pathway from which sterols and other isoprenoids are synthesized. Lines carrying a recessive mutation in this locus have reduced chain-length distribution, weakly glaucous stem surface, and has reduced fertility in early flowers, non-spreading floret, downward cupped leaves, leaf waxes nearly pure C24 and C26 acid. |
| AT1G02190 | Fatty acid hydroxylase superfamily;(source:Araport11) |
| AT1G80350 | encodes a p60 katanin protein that is expressed throughout the plant. Required for the specification of cell fates from early in development (in the meristem) through differentiation and for normal postmitotic organization of cortical microtubules into transverse arrays in root epidermis cells. Mutants display cytoskeletal defects. |
| AT3G55830 | A member of the Glycosyltransferase Family 64, homologous to Poplar cambium-expressed GT64 gene. The EPC1 protein plays a critical role during plant development in maintaining the integrity of organs via cell-cell adhesion, thereby providing mechanical strength and facilitating the movement of metabolites throughout the plant.Loss of function specifically affects glycosylinositolphosphorylceramide (GIPC) mannosylation. |
| AT5G15440 | EID1-like 1;(source:Araport11) |
| AT5G39360 | EID1-like 2;(source:Araport11) |
| AT3G63060 | EDL3 is an F-box protein involved that mediated the regulation of abscisic acid signalling. |
| AT1G54270 | member of eIF4A - eukaryotic initiation factor 4A |
| AT4G24800 | MA3 domain-containing protein;(source:Araport11) |
| AT3G18980 | EIN2 targeting protein1;(source:Araport11) |
| AT5G25350 | Arabidopsis thaliana EIN3-binding F-box protein 2 (EBF2) mRNA. Part of the SCF complex, it is located in the nucleus and is involved in the ethylene-response pathway. |
| AT5G43430 | Encodes the electron transfer flavoprotein ETF beta, a putative subunit of the mitochondrial electron transfer flavoprotein complex (ETF alpha is At1g50940) in Arabidopsis. Mutations of the ETF beta gene result in accelerated senescence and early death compared to wild-type during extended darkness. Also involved in the catabolism of leucine and chlorophyll degradation pathway activated during darkness-induced carbohydrate deprivation. |
| AT2G43400 | Encodes a unique electron-transfer flavoprotein:ubiquinone oxidoreductase that is localized to the mitochondrion. Mutants are more sensitive to sugar starvation when plants are kept in the dark for long periods. |
| AT1G72630 | ELF4-like 2;(source:Araport11) |
| AT1G17455 | ELF4-like 4;(source:Araport11) |
| AT5G64905 | elicitor peptide 3 precursor;(source:Araport11) |
| AT5G09980 | elicitor peptide 4 precursor;(source:Araport11) |
| AT3G11220 | A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1?ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. |
| AT3G09150 | Required for biosynthesis of the tetrapyrrole phytochrome chromophore phytochromobilin. Encodes phytochromobilin synthase, a ferredoxin-dependent biliverdin reductase. It is necessary for coupling the expression of some nuclear genes to the functional state of the chloroplast. |
| AT5G11260 | Basic leucine zipper (bZIP) transcription factor. Nuclear localization. Involved in light-regulated transcriptional activation of G-box-containing promoters. Negatively regulated by Cop1. Although cytokinins do not appear to affect the gene's promoter activity, they appear to stabilize the protein. HY5 plays a role in anthocyanin accumulation in far-red light and blue light, but not in red light or in the dark. Mutant studies showed that the gene product is involved in the positive regulation of the PHYA-mediated inhibition of hypocotyl elongation. Binds to G- and Z-boxes, and other ACEs, but not to E-box. Loss of function mutation shows ABA resistant seedling phenotypes suggesting involvement for HY5 in mediating ABA responses. Binds to the promoter of ABI5 and regulates its expression.Involved in the regulation of response to nutrient levels. |
| AT5G22350 | fission ELM1-like protein (DUF1022);(source:Araport11) |
| AT5G09900 | Encodes one of two isoforms for the 26S proteasome regulatory protein (RN) subunit RPN5. For many functions it acts redundantly with the paralogous gene RPN5b but also appears to exert independent effects. |
| AT1G79350 | Encodes the Arabidopsis thaliana orthologue of metazoan Strawberry notch, a highly conserved co-activator of the developmental regulator Notch. It mediates stress-induced chromatin memory by modulating nucleosome occupancy by interacting with chromatin remodeling proteins of the ISWI and SWI/SNF classes. |
| AT1G56200 | Encodes a chloroplast localized protein that is essential for chloroplast development. |
| AT1G58210 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It colocalizes with filamentous actin and is localized to the plasma membrane. |
| AT5G62990 | Nucleus-encoded RNA-binding protein which exists only in embryophytes, catalyzes nuclear pre-mRNA and chloroplast group II intron splicing. |
| AT1G21690 | ATPase family associated with various cellular activities (AAA);(source:Araport11) |
| AT3G07060 | NHL domain-containing protein;(source:Araport11) |
| AT2G22870 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G05680 | Encodes a splicing/methylation factor that is a homologue to the mammalian VIRILIZER, is member of a core set of mRNA m6A writer proteins and is required for N6-adenosine methylation of mRNA. Analysis of transcriptional profiles of the vir-1 mutant suggests that VIR is likely involved in regulation of gene expression, but the function of VIR is rather general than specific and knock-down of VIR does not affect overall splicing rates. |
| AT5G24400 | Encodes a protein with 6-phosphoglucunolactonase activity that localizes to the chloroplasts and the peroxisome. However, mutant phenotypes observed in pgl3 mutant plants can be complemented with a chloroplast-targeted version of the protein. PGL3 likely functions in the oxidative branch of the pentose phosphate pathway. pgl3 mutant phenotypes suggest that it is important in pathogen defense and maintenance of cellular redox homeostasis. |
| AT1G21390 | embryo defective 2170;(source:Araport11) |
| AT2G21710 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT5G16715 | protein EMBRYO DEFECTIVE 2247;(source:Araport11) |
| AT1G30610 | Pentatricopeptide repeat protein .Mutations in this locus result in embryo lethality due to defects in chloroplast development. Embryo shape at seed maturity is globular. |
| AT1G05190 | Encodes the plastid 50S ribosomal protein L6. |
| AT1G24340 | A locus involved in embryogenesis. Mutations in this locus result in embryo lethality. The mRNA is cell-to-cell mobile. |
| AT4G39620 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G41720 | Encodes a pentatricopeptide repeat protein that is essential for trans-splicing of a chloroplast small ribosomal subunit transcript. |
| AT3G12670 | Cytidine triphosphate synthase; essential for CTP supply in developing embryos. |
| AT5G63420 | Encodes a member of the metallo-beta-lactamase protein family that plays a vital role in embryo morphogenesis and apical-basal pattern formation by regulating chloroplast development. In bacteria, RNase J plays an important role in rRNA maturation and in the 5′ stability of mRNA. |
| AT4G36630 | Vacuolar sorting protein 39;(source:Araport11) |
| AT4G29860 | Encodes a WD repeat protein with seven WD repeat motifs, predicted to function in protein-protein interaction. Mutations caused defects in both embryo and seedling development. |
| AT5G63050 | embryo defective 2759;(source:Araport11) |
| AT2G45000 | Encodes a nucleoporin, a component of the nuclear pore complex, that appears to be a major negative regulator of auxin signalling. Loss of function mutants are embryo lethal. |
| AT5G15540 | Encodes Adherin SCC2. Essential for viability. Required for normal seed development. Plays a role in the establishment of sister-chromatid cohesion and chromosome organization during meiosis. |
| AT2G32590 | condensin complex subunit;(source:Araport11) |
| AT2G39080 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G10220 | Encodes a tubulin-binding cofactor. Homozygous mutant plants are embryo lethal. Heterozygous mutant plants showed increased ploidy and higher numbers of spindles and phragmoplasts, suggesting a role in cell division. The mRNA is cell-to-cell mobile. |
| AT5G13010 | Encodes a nuclear localized DEAH-box containing protein that is involved in miRNA biogenesis. Loss of function mutants are embryo lethal. Gene silencing experiments demonstrated its role in the localization of DCL-1 and HYL1 to the nuclear D-body. In silenced lines, miRNA production is suppressed and plants have developmental abnormalities and are hypersensitive to fungal pathogens. |
| AT5G40480 | embryo defective 3012;(source:Araport11) |
| AT1G10910 | Member of the P subfamily of PRR proteins. Loss of function results in defects in abnormal plastid RNA edit and chloroplast biogenesis |
| AT3G63490 | Ribosomal protein L1p/L10e family;(source:Araport11) |
| AT5G51200 | Originally identified as EDS4, enhanced disease sensitive phenotype and subsequently cloned and identified as NUCLEOPORIN205. Affects circadian clock and downstream genes including those involved in defense response. |
| AT2G30200 | Malonyl-ACP expressed in developing seeds. Loss of function mutants are embryo lethal and over expression in seeds leads to increased seed oil content. |
| AT2G01860 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G35950 | embryo sac development arrest 12;(source:Araport11) |
| AT4G00140 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G33050 | Encodes a calmodulin-binding protein involved in stomatal movement. |
| AT4G37890 | Involved in shoot regenaration from root explants. |
| AT3G23440 | embryo sac development arrest 6;(source:Araport11) |
| AT4G34200 | Encodes a 3-phosphoglycerate dehydrogenase that is essential for embryo and pollen development. |
| AT1G10747 | Encodes a Maternally expressed gene (MEG) family protein |
| AT3G48110 | glycine-tRNA ligase |
| AT2G41475 | Embryo-specific protein 3, (ATS3);(source:Araport11) |
| AT5G11530 | Involved in regulating reproductive development |
| AT4G02440 | EID1 is an F-box protein that functions as a negative regulator in phytochrome A (phyA)-specific light signalling. Expressed at all stages of plant development independently of light conditions, localizes to the nucleus, and forms nuclear speckles under continuous far-red light. Forms stable dimeric and trimeric complexes with several ASK proteins and Cullin1 in yeast and in planta. |
| AT1G71220 | Encodes UDP-glucose:glycoprotein glucosyltransferase. Non-receptor component required for EFR-mediated immunity. Mutants show de-repressed anthocyanin accumulation in the presence of elf18, and EFR accumulation and signalling. |
| AT1G18260 | Encodes an Arabidopsis homolog of the yeast Hrd3/mammlian Sel1L protein. Involved in ERAD (Endoplasmic reticulum-associated degradation). |
| AT2G44440 | Emsy N Terminus (ENT) domain-containing protein;(source:Araport11) |
| AT5G62500 | Encodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis. |
| AT1G02310 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT5G66460 | Encodes a endo-beta-mannanase involved in seed germination and silique dehiscence. |
| AT5G05460 | Encodes a cytosolic beta-endo-N-acetyglucosaminidase (ENGase). ENGases N-glycans cleave the O-glycosidic linkage between the two GlcNAc residues of the N-glycan core structure and thus generate a protein with a single GlcNAc attached to asparagine. |
| AT3G11040 | Encodes a cytosolic beta-endo-N-acetyglucosaminidase (ENGase). ENGases N-glycans cleave the O-glycosidic linkage between the two GlcNAc residues of the N-glycan core structure and thus generate a protein with a single GlcNAc attached to asparagine. |
| AT5G10840 | Endomembrane protein 70 protein family;(source:Araport11) |
| AT1G07670 | TPLATE complex protein involved in clathrin-mediated endocytosis. |
| AT1G68290 | Encodes an endonuclease ENDO2. ENDO2 purified from transgenic Arabidopsis digests RNA, ssDNA, and dsDNA, with a substrate preference for ssDNA and RNA. ENDO2 produced and purified from Nicotiana benthamiana expression showed no demonstrable endonuclease activity, either towards single stranded DNA or mismatches, in vitro. |
| AT4G21600 | Encodes a protein with mismatch-specific endonuclease activity with a preference for T/G, A/G, and G/G of single base mismatches. It also has the ability to cleave indel types of mismatches (heteroduplexes with loops). |
| AT4G02980 | Auxin binding protein involved in cell elongation and cell division. ABP1 is ubiquitinated in vitro and in planta by AtRma2. ABP1 was thought to be embryo lethal but further experimentation has demonstrated that lethality is due to a linked mutation in another gene. |
| AT3G07100 | Encodes SEC24a/ERMO2. Required for endoplasmic reticulum (ER) morphology. Has epistatic interactions with AT1G55350, AT3G59420, and AT3G10525. |
| AT1G72280 | Encodes an oxidoreductin required for oxidative protein folding in the ER and exists in two distinct oxidized isoforms (Ox1 and Ox2), which are determined by the formation or breakage of the putative regulatory disulfide. AtERO1 is mainly present in the Ox1 redox state. |
| AT1G29330 | Encodes a protein similar in sequence to animal and yeast endoplasmic reticulum retention signal receptor. This protein can functionally complement the yeast homologue. Transcript is detected in flower buds, stems, root, and leaves. |
| AT1G10130 | Encodes a golgi localized P2A-type Ca2+ ATPase involved in Mn nutrition and homeostasis. |
| AT2G01850 | EXGT-A3 has homology to xyloglucan endotransglucosylases/hydrolases (XTHs). Mutants in this gene show a lesion mimic phenotype associated with leaf maturation and a reduction in the number of tertiary veins. Individual tracheary elements in the mutants are shorter, but phloem transport activity is not severely affected. EXGT-A3 plays a role in xyloglucan degradation in the differentiating tracheary elements of rosette leaves. The mRNA is cell-to-cell mobile. |
| AT1G08720 | enhanced disease resistance 1 (EDR1) confers resistance to powdery mildew disease caused by the fungus Erysiphe cichoracearum The mRNA is cell-to-cell mobile. |
| AT4G19040 | Encodes a PH and START domain-containing protein that mediates resistance to pathogenic fungi. Resistance requires salicylic acid signalling. Mutants are resistant to E. cichoracearum. Expressed throughout plant tissues and possibly localized to membranes /mitochondrion. |
| AT3G48090 | Component of R gene-mediated disease resistance in Arabidopsis thaliana with homology to eukaryotic lipases. |
| AT4G39030 | Encodes an orphan multidrug and toxin extrusion transporter. Essential component of salicylic acid-dependent signaling for disease resistance. Member of the MATE-transporter family. Expression induced by salicylic acid. Mutants are salicylic acid-deficient. |
| AT1G74710 | Encodes a protein with isochorismate synthase activity. Mutants fail to accumulate salicylic acid. Its function may be redundant with that of ICS2 (AT1G18870). |
| AT5G55390 | Encodes EDM2 (enhanced downy mildew 2). The predicted protein bears typical features of transcriptional regulators. EDM2 contains two putative bipartite nuclear localization signals (NLS) two zinc-finger-like motifs, a Proline-rich region and a large aspartic acid-rich region. Both zinc-finger-like stretches resemble the PHD (plant homeodomain) finger motif. Mutations in EDM2 comprise RPP7 mediated resistance against Hyaloperonospora parasitica isolate Hiks1 (HpHiks1). EDM2 may function as a direct or indirect regulator of RPP7 expression. |
| AT1G17440 | Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. The gene product is an EIN3-interacting TFIID transcription factor required for proper ethylene response, including ERF1 induction. Loss of function mutants show enhanced response to ethylene. Located in nucleus and expressed throughout the plant. Required for ERF1 expression. Cytokinin-hypersensitive 1 (CKH1) mutants are characterized by rapidly growing calli with a green color at low levels of cytokinins, which are insufficient to induce such cytokinin responses in wild-type explants. It is hypothesized that CKH1 acts as a negative regulator of cytokinin signaling in Arabidopsis. |
| AT5G67160 | Encodes a member of the BAHD acyltransferase superfamily. Mutants have enhanced susceptibility to virulent and avirulent pathogens and are defective in pathogen induced SA biosynthesis. EPS1 may act upstream of SA biosynthesis as application of SA can rescue the mutant phenotype. |
| AT5G40280 | encodes a beta subunit of farnesyl-trans-transferase, which is involved in meristem organization and ABA-mediated signal transduction pathway. Mutant phenotypes have been observed in meristem organization, and response to abscisic acid and drought. The mRNA is cell-to-cell mobile. |
| AT1G73840 | Resembles the CstF64 family of RNA processing factors that are conserved between yeast and mammals. In mammals, CstF64 is a component of the CstF complex which is required for mRNA 3'end formation along with other factors. |
| AT5G22090 | EAR1 is a negative regulator of ABA signaling that enhances the activity of all six clade A PP2Cs (ABI1, ABI2, HAB1, HAB2, AHG1, AHG3) by interacting with and releasing the N-terminal autoinhibition of these proteins. EAR1 indirectly affects OST1 activity through enhancing ABI1 activity. The EAR1 141-287 fragment is sufficient for the functioning of EAR1 in ABA responses; the 131-248 region harbors an intrinsically disordered region and only 249-278 can form a predicted regular structure. EAR1 is located in the ER, nuclei, and cytoplasm; ABA signaling promotes the translocation of EAR1 from the ER and/or cytoplasm to the nucleus. Mutations showed that it functions in seed germination, primary root growth, and drought tolerance. |
| AT3G12680 | Member of the floral homeotic AGAMOUS pathway. |
| AT3G17668 | DnaJ/Hsp40 cysteine-rich domain superfamily protein;(source:Araport11) |
| AT5G17170 | rubredoxin family protein;(source:Araport11) |
| AT1G01380 | ETC1 is involved in trichome and root hair patterning in Arabidopsis. |
| AT1G31410 | putrescine-binding periplasmic protein-like protein;(source:Araport11) |
| AT1G76150 | Encodes a monofunctional enoyl-CoA hydratase 2, involved in the degradation of even cis-unsaturated fatty acids, gene expression is enhanced during the first 2 days of germination, as well as in senescent leaves. |
| AT2G32440 | ent-kaurenoic acid hydroxylase (KAO2) |
| AT1G34245 | Encodes a secretory peptide EPF2 expressed in proliferating cells of the stomatal lineage, known as meristemoids, and in guard mother cells, the progenitors of stomata. Controls asymmetric cell divisions during stomatal development. EPF2 is related to EPF1, also involved in stomatal development. Its transcript levels change after inducing MUTE expression in a mute background. EPF2 binds to the ER receptor triggering MAPK activation that in turn inhibits stomatal development. EPF2 competes with STOMAGEN for binding to receptor protein kinases ER, and TMM. |
| AT1G80133 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT3G14210 | A semidominant QTL which has an epistatic effect on the Epithiospecifier gene. Represses nitrile formation and favors isothiocyanate production during glucosinolate hydrolysis. The functional allele deters the insect herbivory T. ni. |
| AT3G20290 | Encodes AtEHD1, one of the Arabidopsis Eps15 homology domain proteins involved in endocytosis (AtEHD2, At4g05520). |
| AT1G30630 | Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation. |
| AT2G43160 | Involved in plant trans-Golgi network (TGN) transport. |
| AT3G59290 | Involved in plant trans-Golgi network (TGN) transport. |
| AT4G00900 | Type IIA (SERCA-type) Ca2+ ATPase, catalyzes the efflux of calcium from the cytoplasm. |
| AT1G08920 | Encodes ESL1, a transporter for monosaccharides. |
| AT1G75220 | Encodes a vacuolar glucose exporter that is induced in response to factors that activate vacuolar glucose pools like darkness, heat stress and wounding and repressed during conditions that trigger glucose accumulation in the vacuole like cold stress and external sugar supply. |
| AT2G26330 | Homologous to receptor protein kinases. Involved in specification of organs originating from the shoot apical meristem. Contains a cytoplasmic protein kinase catalytic domain, a transmembrane region, and an extracellular leucine-rich repeat. ER has been identified as a quantitative trait locus for transpiration efficiency by influencing epidermal and mesophyll development, stomatal density and porosity of leaves. It has been implicated in resistance to the bacterium Ralstonia solanacearum and to the necrotrophic fungus Plectosphaerella cucumerina. Together with ERL1 and ERL2, ER governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. ER binds to the peptides STOMAGEN and EPF2 which compete for the same binding site. The ER-EFP2 complex activates MAPK signaling that inhibits stomatal development. ER-STOMAGEN does not activate MAPK signaling. Plants harboring loss of function alleles of er are more susceptible to heat stress than wild type. In Arabidopsis and other organisms, overexpression of ER confers thermotolerance via as yet undefined mechanisms. |
| AT5G62230 | Encodes a receptor-like kinase that, together with ER and ERL2 governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. It is important for maintaining stomatal stem cell activity and preventing terminal differentiation of the meristemoid into the guard mother cell. Along with erl2 functionally compensates for loss of erecta during integument development. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT2G20880 | Encodes ERF53, a drought-induced transcription factor. Belongs to the AP2/ERF superfamily, and has a highly conserved AP2 domain. Regulates drought-responsive gene expressions by binding to the GCC box and/or dehydration-responsive element (DRE) in the promoter of downstream genes. Overexpression of AtERF53 driven by the CaMV35S promoter resulted in an unstable drought-tolerant phenotype in T2 transgenic plants. Involved in heat shock response. |
| AT1G03800 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-10). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT1G28370 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT1G28360 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ERF12). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. Regulates floral development. |
| AT5G44210 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-9). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT2G35700 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Thought to be involved in secondary cell wall metabolism. |
| AT1G44830 | Encodes a nuclear-localized member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. Overexpression in cultured cells results in an increase in pectin deposition.ERF014 differentially regulates responses to bacterial and fungal pathogens. |
| AT1G19400 | Tail-anchored (TA) OEP membrane protein which possesses a single C-terminal transmembrane domain targeting post-translationally to plastids. |
| AT3G55990 | Encodes ESK1 (Eskimo1). A member of a large gene family of DUF231 domain proteins whose members encode a total of 45 proteins of unknown function. ESK1 functions as a negative regulator of cold acclimation. Mutations in the ESK1 gene provides strong freezing tolerance. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). The mRNA is cell-to-cell mobile. |
| AT2G01480 | ESMD1 is a golgi localized putative O-fucosyltransferase. |
| AT5G43060 | Peptidase, activity detected in extracts of root, leaf and cell culture. |
| AT5G42950 | EXA1 is a GYF domain-containing gene of the SMY2 subgroup. Mutants exhibit resistance to potexviruses. |
| AT1G31660 | Encodes a protein that is a ribosome biogenesis co-factor. Mutants display aberrant RNA processing and male and female gametophyte development. |
| AT4G29960 | EBS7 encodes a plant specific, endoplasmic reticulum localized protein that is involved in endoplasmic reticulum-associated degradation (ERAD). It interacts with the ERAD component AtHRD1a and may regulate HRD1a stability. Identified in a screen for supressors of a mutation in bri1 that causes bri1 to be retained in the ER. Loss of EBS7 function restores BR sensitivity in the bri1-9 mutant allele. |
| AT5G25190 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT5G09410 | calmodulin-binding protein, similar to another ethylene-upregulated calmodulin-binding protein ER1 GI:11612392 from (Nicotiana tabacum) |
| AT5G03280 | Involved in ethylene signal transduction. Acts downstream of CTR1. Positively regulates ORE1 and negatively regulates mir164A,B,C to regulate leaf senescence. A maternally expressed imprinted gene. Mutations in ein2 block ethylene stimulation of flavonol synthesis. The mRNA is cell-to-cell mobile. |
| AT3G23150 | Involved in ethylene perception in Arabidopsis The mRNA is cell-to-cell mobile. |
| AT5G21960 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT5G61600 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture. |
| AT5G51190 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture and the response to cold stress. |
| AT3G16280 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT3G20310 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-7). The protein contains one AP2 domain. Phosphorylated by PKS3 in vitro. Involved in ABA-mediated responses. Acts as a repressor of GCC box?mediated transcription together with AtSin3 and HDA19. |
| AT1G33760 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT1G04310 | encodes an ethylene receptor related to bacterial two-component histidine kinases. |
| AT4G17500 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. The mRNA is cell-to-cell mobile. |
| AT5G47220 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-2). The protein contains one AP2 domain. Functions as activator of GCC box?dependent transcription. Positive regulator of JA-responsive defense genes and resistance to F. oxysporum and enhances JA inhibition of root elongation. |
| AT4G17490 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-6). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. It is involved in the response to reactive oxygen species and light stress. Involved in regulating root architecture and the response to cold stress. |
| AT4G28140 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. Regulated by heat shock. |
| AT1G17870 | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442?454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171?179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria. Mediates chloroplastic ROS homeostasis and promotes retrograde signaling in response to salt stress. |
| AT3G20770 | Encodes EIN3 (ethylene-insensitive3), a nuclear transcription factor that initiates downstream transcriptional cascades for ethylene responses. EIN3 interacts with MYC2, MYC3 and MYC4 to inhibit jasmonate-induced expression of wound-responsive genes and herbivory-inducible genes, and plant defense against generalist herbivores. |
| AT2G27050 | ethylene-insensitive3-like1 (EIL1) The mRNA is cell-to-cell mobile. |
| AT2G31230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT2G44940 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT4G16750 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT4G02680 | Encodes a paralog of ETO1, which is a negative regulator of ACS5 (a key enzyme in ethylene biosynthesis pathway). EOL1 also interacts with and inhibits the activity of ACS5. |
| AT1G13950 | Encodes eukaryotic translation initiation factor 5A (EIF-5A).In mammalian cells it functions as a shuttle protein that translocates mRNA from the nucleus to cytoplasmic ribosomes. Overexpression results in an increase in both primary and secondary xylem formation. In RNAi suppressed lines, xylem formation is reduced. |
| AT1G69410 | Encodes eIF5A-2, a putative eukaryotic translation initiation factor. There are three eIF5A coding genes in Arabidopsis: eIF5A-1/At1g13950, eIF5A-2/At1g26630 and eIF5A-3/At1g69410. |
| AT2G39990 | translation initiation factor eIF2 p47 subunit homolog |
| AT4G33250 | Encodes initiation factor 3k (EIF3k). |
| AT3G26400 | member of eIF4B - eukaryotic initiation factor 4B The mRNA is cell-to-cell mobile. |
| AT2G39050 | Encodes a nucleocytoplasmic lectin that is capable of binding carbohydrates. It is involved in ABA mediated stomatal movement and increased expression is correlated with increased resistance to Pseudomonas syringae. |
| AT3G13460 | Physically interacts with CIPK1. ECT2 regulates the mRNA levels of the roteasome regulator PTRE1 and of several 20S proteasome subunits, resulting in enhanced 26S proteasome activity. YTHDF protein which togeteher with ECT3 and ECT4 is involved in cell proliferation during plant organogenesis. |
| AT5G61020 | YTHDF protein which togeteher with ECT2 and ECT4 is involved in cell proliferation during plant organogenesis. |
| AT1G55500 | YTHDF protein which togeteher with ECT2 and ECT3 is involved in cell proliferation during plant organogenesis. |
| AT1G48110 | evolutionarily conserved C-terminal region 7;(source:Araport11) |
| AT1G79270 | evolutionarily conserved C-terminal region 8;(source:Araport11) |
| AT5G07280 | Encodes EMS1 (EXCESS MICROSPOROCYTES1), a putative leucine-rich repeat receptor protein kinase that controls somatic and reproductive cell fates in Arabidopsis anther. |
| AT4G33630 | Encodes one of the two plastid proteins EXECUTER (EX1, AT4G33630) and EX2 (AT1G27510). Mediates singlet oxygen induced programmed cell death. |
| AT4G02350 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. The mRNA is cell-to-cell mobile. |
| AT1G47550 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. It binds phosphoinositide lipids. |
| AT1G47560 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
| AT5G58430 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. Targeted by AvrPtoB to manipulate the defense molecule secretion machinery. |
| AT1G07000 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G13150 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. This particular member is expressed in pollen and, together with EXO70C2, is involved in pollen tube elongation. Found in the cytoplasm and surprisingly, not found in the plasma membrane. |
| AT5G13990 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. This particular member is expressed in pollen and is involved in pollen tube elongation. Found in the cytoplasm and surprisingly, not found in the plasma membrane and is not found to colocalize with or interact with core exocyst subunits. |
| AT1G54090 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G61010 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G50380 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT3G09530 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT3G09520 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT2G28640 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT1G07725 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G59730 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. The mRNA is cell-to-cell mobile. |
| AT4G08950 | Phosphate-responsive 1 family protein;(source:Araport11) |
| AT5G64260 | EXORDIUM like 2;(source:Araport11) |
| AT5G51550 | EXORDIUM like 3;(source:Araport11) |
| AT5G09440 | EXORDIUM like 4;(source:Araport11) |
| AT2G17230 | EXORDIUM like 5;(source:Araport11) |
| AT1G54490 | Involved in the ethylene response. XRN4 does not appear to regulate ethylene signaling via an RNA-INDUCED SILENCING COMPLEX-based RNA silencing mechanism but acts by independent means. Endogenous suppressor of posttranscriptional gene silencing. The mRNA is cell-to-cell mobile. |
| AT1G69530 | Member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G28950 | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G40610 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G20750 | member of BETA-EXPANSINS. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT4G28250 | putative beta-expansin/allergen protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT3G45970 | member of EXPANSIN-LIKE. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) The mRNA is cell-to-cell mobile. |
| AT4G38400 | member of EXPANSIN-LIKE. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT2G43150 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT1G70990 | Short extensin family protein required during the first phase of dark-grown hypocotyl elongation, regulates the moment and extent of the growth acceleration by modulating cell wall extensibility. |
| AT3G57630 | Encodes a glycoprotein glycosyl transferase ExAD. Knockout mutants show truncated root hair phenotype. |
| AT2G23460 | encodes a novel G-alpha protein that shares similarity to plant, yeast, and animal G-alpha proteins at the C-terminus. It contains an N-terminus that is as large as the C-terminus, is a member of a small family, and is expressed in all tissues examined, including roots, leaves, stems, flowers, and fruits. |
| AT4G34390 | extra-large GTP-binding protein 2;(source:Araport11) |
| AT3G14100 | Triple RNA Recognition Motif protein involved in the dynamic and reversible aggregation of translationally repressed mRNAs during hypoxia.During hypoxia, UBP1C association with non? uracil-rich mRNAs is enhanced concomitant with its aggregation into microscopically visible cytoplasmic foci, referred to as UBP1 stress granules (SGs). This mRNA association occurs as global levels of protein synthesis decline during hypoxia. Upon reoxygenation, rapid UBP1 SG disaggregation coincides with the return of the stabilized mRNAs to polysomes. |
| AT1G21760 | This gene is predicted to encode an F-box protein that is evolutionarily conserved between Arabidopsis and other eukaryotes including S.cerevisiae and humans. It may play a role in regulating translation under conditions of temperature stress. FBP7 transcript levels are increased at high and low temperatures. The mRNA is cell-to-cell mobile. |
| AT3G07870 | FBX92 is an F-box containing protein. Overexpression produces plants with smaller leaves while reduced expression is correlated with increased leaf size and increased rates of cell proliferation. |
| AT1G61340 | Encodes a F-box protein induced by various biotic or abiotic stress. |
| AT4G21510 | F-box family protein;(source:Araport11) |
| AT4G05010 | F-box family protein;(source:Araport11) |
| AT4G35930 | F-box family protein;(source:Araport11) |
| AT4G08980 | Encodes an F-box gene that is a novel negative regulator of AGO1 protein levels and may play a role in ABA signalling and/or response. It is a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins. |
| AT1G44080 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT5G24040 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT4G10820 | F-box family protein;(source:Araport11) |
| AT4G22060 | F-box protein (DUF295);(source:Araport11) |
| AT4G22165 | F-box protein (DUF295);(source:Araport11) |
| AT4G22170 | F-box protein (DUF295);(source:Araport11) |
| AT1G80790 | Belongs to a subgroup of SGS3-like proteins that act redundantly in RNA-directed DNA methylation: AT1G15910 (FDM1), AT4G00380 (FDM2), AT3G12550 (FDM3), AT1G13790 (FDM4), AT1G80790 (FDM5). The mRNA is cell-to-cell mobile. |
| AT1G48360 | Encodes a FAN1 homolog that is involved in interstrand crosslink repair. FAN1 appears to act in in a different pathway from MUS81 but in similar pathway with RECQ4A, RAD5A and MFH1. |
| AT2G37678 | Positive regulator of photomorphogenesis in far-red light. Most abundant in young seedlings in the dark. Downregulated in the light and older as plants develop. Localized in the nucleus and the cytoplasm. Nuclear localization strongest in the dark. Degraded through the 26S proteasome. Regulated by PHYA. It is specifically required for the light-regulated nuclear accumulation of phyA ( but not phyB) likely by shuttling PHYA into the nucleus. |
| AT3G22170 | A component of the PHYA signaling network, mediates the FR-HIR response to far-red light in concert with FAR1. Expression is induced by age; involved in negative regulation of leaf senescence. |
| AT4G15090 | Encodes a nuclear localized protein involved in far red light response signaling. Loss of function mutants are defective in far red light responses. For example:prevents leaf senescence under high ratio of red/far-red light conditions.Interacts with homologous gene FHY3. |
| AT5G02200 | Encodes a small plant-specific protein with both nuclear localization and nuclear export signals that is specifically required, together with FHY1, for the light-regulated nuclear accumulation of phyA. |
| AT4G19990 | FAR1-related sequence 1;(source:Araport11) |
| AT1G10240 | FAR1-related sequence 11;(source:Araport11) |
| AT5G18960 | Transcriptional repressor that accumulates in short-day conditions. Regulates together with FRS7 and NINJA glucosinolate biosynthesis. |
| AT1G52520 | FAR1-related sequence 6;(source:Araport11) |
| AT4G38170 | FAR1-related sequence 9;(source:Araport11) |
| AT3G59470 | Encodes one of four FRS (FAR1-RELATED SEQUENCE) factor-like genes in Arabidopsis. FRS factors are characterized by having an N-terminal C2H2-type chelating motif of the WRKY- Glial Cell Missing1 family, a central core transposase domain of Mutator-like element transposases, and a C-terminal SWIM domain. The four FRF-like genes in Arabidopsis share only the N-terminal motif with FRS proteins. FRF1 has been shown to bind the RB-box in vitro. The RB-box contributes to restricting SHOOTMERISTEMLESS expression to the shoot apical meristem. |
| AT3G07500 | Encodes one of four FRS (FAR1-RELATED SEQUENCE) factor-like genes in Arabidopsis. FRS factors are characterized by having an N-terminal C2H2-type chelating motif of the WRKY- Glial Cell Missing1 family, a central core transposase domain of Mutator-like element transposases, and a C-terminal SWIM domain. The four FRF-like genes in Arabidopsis share only the N-terminal motif with FRS proteins. |
| AT3G44860 | Encodes a farnesoic acid carboxyl-O-methyltransferase. The mRNA is cell-to-cell mobile. |
| AT3G44870 | Encodes a protein with 93% identity to a farnesoic acid methyl transferase. SABATH family methyltransferase. |
| AT5G58560 | FOLK is a farnesol kinase that can phosphorylate farnesol using an NTP donor. It can also phosphorylate geraniol, or geranylgeraniol, but it prefers farnesol in experiments performed using yeast membranes. folk loss-of-function mutants show ABA hypersensitivity in a seed germination assay and the mutants also exhibit abnormal flower development, including extra carpel formation, when subjected to water stress. The mRNA is cell-to-cell mobile. |
| AT5G47770 | Encodes a protein with farnesyl diphosphate synthase activity. |
| AT4G38580 | putative farnesylated protein (At4g38580) mRNA, complete |
| AT2G36305 | Encodes an endoprotease involved in the cleavage of prenylated CaaX-box proteins. In vitro, it can cleave a farnesylated tetrapeptide and it can promote membrane-localization of a farnesylated GFP:AtROP9 protein when both are expressed in yeast. |
| AT5G64630 | Chromatin Assembly Factor-1 (CAF-1) p60 subunit. Involved in organization of the shoot and root apical meristems. In Arabidopsis, the three CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1, respectively. Mutations in FAS1 or FAS2 lead to increased frequency of homologous recombination and T-DNA integration in Arabidopsis. |
| AT4G12730 | AF333971 Arabidopsis thaliana fasciclin-like arabinogalactan-protein 2 (Fla2) mRNA, complete cds. Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT5G44130 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT3G52370 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT2G35860 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT5G06390 | FASCICLIN-like arabinogalactan protein 17 precursor;(source:Araport11) |
| AT3G11700 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT1G15190 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT5G06920 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT2G45470 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT3G60900 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT1G03870 | fasciclin-like arabinogalactan-protein 9 (Fla9). Possibly involved in embryogenesis and seed development. |
| AT3G25110 | Encodes a FatA acyl-ACP thioesterase |
| AT1G74960 | Encodes a plastidic beta-ketoacyl-ACP synthase II, involved in fatty acid elongation from 16:0-ACP to 18:0-ACP. Homozygous knock-out mutants are embryo lethal, indicating early embryo development is sensitive to elevated 16:0. |
| AT3G12120 | Major enzyme responsible for the synthesis of 18:2 fatty acids in the endoplasmic reticulum. Contains His-rich motifs, which contribute to the interaction with the electron donor cytochrome b5. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
| AT2G29980 | Endoplasmic reticulum enzyme responsible for the synthesis of 18:3 fatty acids from phospholipids. Uses cytochrome b5 as electron donor. |
| AT3G15850 | Chloroplastic enzyme responsible for the synthesis of 16:1 fatty acids from galactolipids and sulpholipids. Uses ferredoxin as electron donor. The mRNA is cell-to-cell mobile. |
| AT3G11170 | Chloroplastic enzyme responsible for the synthesis of 16:3 and 18:3 fatty acids from galactolipids, sulpholipids and phosphatidylglycerol. Uses ferredoxin as electron donor. Gene expression is induced by wounding in shoot and root. The wound-response in shoot is independent of jasmonic acid mediated pathway whereas the root response is mediated by jasmonic acid. The mRNA is cell-to-cell mobile. |
| AT4G27030 | Encodes an unusual palmitate desaturase that is highly substrate specific. It introduces a delta-3 trans double bond at palmitate at the sn-2 position of phosphatidylglycerol. The mRNA is cell-to-cell mobile. |
| AT2G34770 | encodes a fatty acid hydroxylase, required for the AtBI-1-mediated suppression of programmed cell death. |
| AT4G20870 | encodes a fatty acid hydroxylase, required for the AtBI-1-mediated suppression of programmed cell death. |
| AT1G08510 | Encodes an acyl-acyl carrier protein thioesterase. Hydrolyzes primarily saturated acyl-ACPs with chain lengths that vary between 8 and 18 carbons. Involved in saturated fatty acid synthesis. Nuclear-encoded, plastid-targeted globular protein that is functional as dimer. |
| AT3G23410 | Encodes a fatty alcohol oxidase. |
| AT5G63560 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G63170 | Encodes a plastid stroma localized fatty acid binding protein involved in fatty acid metabolism. |
| AT1G53520 | Encodes a plastid stroma localized fatty acid binding protein involved in fatty acid metabolism. |
| AT1G78020 | FCS like zinc finger 6 is induced during energy starvation through SnRK1 signaling. Mutants accumulate more SnRK1alpha1 which results in the inhibition of seedling growth under favorable growth conditions. Increased SnRK1 activity in the mutant also results in the downregulation of TOR signaling (DOI:10.1111/tpj.13854). |
| AT4G25100 | Fe-superoxide dismutase |
| AT1G31420 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots. |
| AT2G35620 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots.Mucilage is easily detached from fei2 mutants seeds, and forms a capsule that is >50% smaller relative to wild-type. |
| AT2G28160 | Encodes a putative transcription factor that regulates iron uptake responses. mRNA is detected in the outer cell layers of the root and accumulates in response to iron deficiency. The expression of many iron-regulated genes is dependent on FIT1. It specifically regulates FRO2 at the level of mRNA accumulation and IRT1 at the level of protein accumulation.Similar to FER in tomato and is a regulator of iron uptake. It is post-transcriptionally controlled. |
| AT3G51550 | Encodes a synergid-expressed, plasma-membrane localized receptor-like kinase that accumulates asymetrically in the synergid membrnane at the filiform apparatus and mediates male-female gametophyte interactions during pollen tube reception. Also involved in powdery mildew infection. Mutants show faster root elongation under dim light, the protein is required for intracellular accumulation of AHA2 under dim-light growth conditions. Positively regulates flowering by modulating the transcript accumulation and mRNA alternative splicing of certain flowering-related genes, including FLOWERING LOCUS C (FLC) and its homolog MADS AFFECTING FLOWERING (MAF). However, the RALF1 ligand negatively regulates flowering compared with FER. |
| AT1G10960 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT4G14890 | 2Fe-2S ferredoxin-like superfamily protein;(source:Araport11) |
| AT1G32550 | Encodes FdC2, a ferredoxin protein capable of alternative electron partitioning. FdC1 level increases in conditions of acceptor limitation at PSI. |
| AT1G15140 | FAD/NAD(P)-binding oxidoreductase;(source:Araport11) |
| AT5G66190 | Encodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the thylakoid. The affinity of this enzyme for ferredoxin is slightly, but significantly, higher than AtLFNR2, an isoform of the same enzyme. AtLFNR1 forms a heterodimer with AtFNR2 and is also a prerequisite to attach AtFNR2 to the thylakoid membrane. |
| AT5G08410 | ferredoxin/thioredoxin reductase subunit A (variable subunit) 2;(source:Araport11) |
| AT5G01600 | Encodes a ferretin protein that is targeted to the chloroplast. Member of a Ferritin gene family. Gene expression is induced in response to iron overload and by nitric oxide. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT3G08040 | Encodes a member of the MATE (multidrug and toxin efflux family), expressed in roots but not shoots. Mutants accumulate excess iron, manganese and zinc, and express root Fe(III) chelatase activity even under iron sufficiency conditions. FRD3 is likely to function in root xylem loading of an iron chelator or other factor necessary for efficient iron uptake out of the xylem or apoplastic space and into leaf cells. |
| AT1G23020 | Encodes a ferric chelate reductase whose transcription is regulated by FIT1. Expressed in the root, shoot, flower and cotyledon. |
| AT5G23980 | Encodes a ferric chelate reductase that is expressed at low levels in roots,shoots and cotyledons, but not flowers. Its transcription is regulated by FIT1. |
| AT5G49730 | Encodes a plasma membrane-located ferric chelate reductase. Its mRNA is expressed in green aerial tissues (shoot, flower and cotyledon) in a light- and cell differentiation-specific manner. |
| AT5G50160 | Encodes a ferric chelate reductase that is expressed in shoots and flowers. |
| AT3G11050 | ferritin 2;(source:Araport11) |
| AT3G56090 | Encodes FERRITIN 3, AtFER3. Ferritins are a class of 24-mer multi-meric proteins found in all kingdoms of life. Function as the main iron store in mammals. Evidence suggests that Arabidopsis ferritins are essential to protect cells against oxidative damage, but they do not constitute the major iron pool. |
| AT2G40300 | Encodes FERRITIN 4, AtFER4. Ferritins are a class of 24-mer multi-meric proteins found in all kingdoms of life. Function as the main iron store in mammals. Evidence suggests that Arabidopsis ferritins are essential to protect cells against oxidative damage, but they do not constitute the major iron pool. Localize to mitochondria. Knock out mutants are not sensitive to abiotic stress. |
| AT2G30390 | Encodes one of two ferrochelatase genes in Arabidopsis. Ferrochelatase is the terminal enzyme of heme biosynthesis. FC-II is speculated to operate in photosynthetic cytochromes. |
| AT4G36220 | encodes ferulate 5-hydroxylase (F5H). Involved in lignin biosynthesis. |
| AT3G09350 | Encodes one of the Arabidopsis orthologs of the human Hsp70-binding protein 1 (HspBP-1) and yeast Fes1p: Fes1A (AT3G09350), Fes1B (AT3G53800), Fes1C (AT5G02150). Fes1A is cytosolic and associates with cytosolic Hsp70. Mutants showed increased heat-sensitive phenotype suggestion the involvement of Fes1A in acquired thermotolerance. Does not have nucleotide exchange factor activity in vitro. |
| AT3G53800 | Encodes one of the Arabidopsis orthologs of the human Hsp70-binding protein 1 (HspBP-1) and yeast Fes1p: Fes1A (AT3G09350), Fes1B (AT3G53800), Fes1C (AT5G02150). |
| AT5G02150 | Encodes one of the Arabidopsis orthologs of the human Hsp70-binding protein 1 (HspBP-1) and yeast Fes1p: Fes1A (AT3G09350), Fes1B (AT3G53800), Fes1C (AT5G02150). |
| AT1G28200 | VirF-interacting protein FIP1 |
| AT4G04020 | Fibrillin precursor protein. The fibrillin preprotein, but not the mature protein interacts with ABI2. Regulated by abscisic acid response regulators. Involved in abscisic acid-mediated photoprotection. The mRNA is cell-to-cell mobile. |
| AT4G22240 | Involved in photoprotection of photosystem II. The RVSI and twin-positive motifs in the transit peptide are necessary for efficient leucoplast import of prFB. |
| AT3G23400 | Encodes FIBRILLIN 4 (FIB4). The fibrillins are a large family of chloroplast proteins that have been linked with stress tolerance and disease resistance. FIBRILLIN 4 is required for plastoglobule development and stress resistance.Iinvolved in plastoquinone transport. |
| AT5G19940 | Enables plants to cope with moderate light stress and affects cadmium tolerance. |
| AT1G07050 | FITNESS encodes a protein with a single CCT domain and belongs to the CCT motif family genes (CMF). FITNESS acts upstream JUB1 thereby controlling H2O2 levels. FITNESS has a role in cellular redox homeostasis controlling H2O2 levels, due to changes in enzymes, metabolites and transcripts related to ROS detoxification. |
| AT5G13840 | FIZZY-related 3;(source:Araport11) |
| AT5G64350 | Encodes FK506-binding protein 12 (FKBP12 or FKP12). FKP12 overexpression dramatically enhances rapamycin sensitivity, whereas rapamycin inhibition is relieved in transgenic plants deficient in FKP12. |
| AT5G46330 | Encodes a leucine-rich repeat serine/threonine protein kinase that is expressed ubiquitously. FLS2 is involved in MAP kinase signalling relay involved in innate immunity. Essential in the perception of flagellin, a potent elicitor of the defense response. FLS2 is directed for degradation by the bacterial ubiquitin ligase AvrPtoB. The mRNA is cell-to-cell mobile. |
| AT3G51240 | Encodes flavanone 3-hydroxylase that is coordinately expressed with chalcone synthase and chalcone isomerases and is involved in flavonoid biosynthesis. Not responsive to auxin or ethylene stimulus (qRT-PCR). |
| AT1G79790 | Encodes a chloroplast-localized FMN hydrolase that whose phosphatase activity is FMN-specific. |
| AT1G12200 | Putative flavin monooxygenase. |
| AT1G68050 | Encodes FKF1, a flavin-binding kelch repeat F box protein, is clock-controlled, regulates transition to flowering. Forms a complex with GI on the CO promoter to regulate CO expression. |
| AT1G62570 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
| AT5G54500 | Encodes a flavin mononucleotide-binding flavodoxin-like quinone reductase that is a primary auxin-response gene. |
| AT5G08640 | Encodes a flavonol synthase that catalyzes formation of flavonols from dihydroflavonols. Co-expressed with CHI and CHS (qRT-PCR). |
| AT5G63600 | encodes a protein whose sequence is similar to flavonol synthase |
| AT5G43935 | flavonol synthase 6;(source:Araport11) |
| AT4G28300 | Encodes a protein with 13.6% proline amino acids that is predicted to localize to the cell wall. The mRNA is cell-to-cell mobile. |
| AT3G01560 | proline-rich receptor-like kinase, putative (DUF1421);(source:Araport11) |
| AT5G64870 | Belongs to the group of plant flotillins, which are plasma membrane proteins. Flot3 is found in membrane nanodomains. |
| AT1G50370 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT3G19980 | Encodes catalytic subunit of serine/threonine protein phosphatase 2A. It can associate with phytochromes A and B in vitro. Mutant plants display an accelerated flowering phenotype.Acts antagonistically to SnRK2 to regulate ABI5 phosphorylation. It inteacts with NRP which results in tethering to endosomes leading to its degradation. |
| AT1G35460 | Encodes a bHLH transcription factor involved in CFL1-mediated regulation of cuticle development. Overexpression leads to abnormal cuticle development. |
| AT4G09180 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G51140 | Encodes a basic helix-loop-helix-type transcription factor involved in photoperiodism flowering. Binds to the E-box cis-element in the CONSTANS (CO) promoter to regulate flowering. Interacts with CFL1 and along with CFLAP2 negatively regulates cuticle development. Binds to the potassium channel gene KAT1 as a dimer. The DNA-binding capacity is inhibited in response to ABA through phosphorylation-dependent monomerization. |
| AT5G10140 | MADS-box protein encoded by FLOWERING LOCUS C - transcription factor that functions as a repressor of floral transition and contributes to temperature compensation of the circadian clock. Expression is downregulated during cold treatment. Vernalization, FRI and the autonomous pathway all influence the state of FLC chromatin. Both maternal and paternal alleles are reset by vernalization, but their earliest activation differs in timing and location. Histone H3 trimethylation at lysine 4 and histone acetylation are associated with active FLC expression, whereas histone deacetylation and histone H3 dimethylation at lysines 9 and 27 are involved in FLC repression. Expression is also repressed by two small RNAs (30- and 24-nt) complementary to the FLC sense strand 3? to the polyA site. The small RNAs are most likely derived from an antisense transcript of FLC. Interacts with SOC1 and FT chromatin in vivo. Member of a protein complex. |
| AT2G41705 | Encodes a fluoride export protein. |
| AT3G14750 | structural maintenance of chromosomes domain protein;(source:Araport11) |
| AT5G43870 | FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT4G14740 | FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT4G16670 | FORKED-LIKE family member, part of Group 3 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT5G57770 | FORKED-LIKE family member, part of Group 2 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT5G14780 | Encodes a NAD-dependent formate dehydrogenase. |
| AT2G43800 | Localizes to plasmodesmata (PD) through its transmembrane domain and is required for normal intercellular trafficking. Functions in a partially redundant manner with its closest homolog AtFH1. Regulates PD's permeability by anchoring actin filaments to PD. Caps the barbed end of actin filaments and stabilizes them in vitro. |
| AT1G70140 | Encodes a group I formin. Binds to F-actin barbed ends. Has severing actin filaments activity. Binds profilin. Involved in the initiation and tip growth of root hairs through regulation of actin cytoskeleton. |
| AT5G07780 | Encodes a class II formin that nucleates actin assembly, binds to the barbed-end of actin filaments and antagonizes the effect of FH1 on actin dynamics. The mRNA is cell-to-cell mobile. |
| AT5G67470 | formin homolog 6;(source:Araport11) |
| AT1G59910 | Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. |
| AT3G25500 | Poly-L-proline-containing (PLP) protein that form part of the signal-transduction cascade that leads to rearrangement of the actin cytoskeleton. AFH1 is a nonprocessive formin that moves from the barbered end to the side of an actin filament after the nucleation event. |
| AT5G58160 | Class II formin; modulator of pollen tube elongation. |
| AT4G33240 | Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant. |
| AT3G14270 | Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant. |
| AT1G71010 | Encodes a protein that is predicted to act as a phosphatidylinositol-3P 5-kinase, but, because it lacks a FYVE domain, it is unlikely to be efficiently targeted to membranes containing the proposed phosphatidylinositol-3P substrate. Therefore, its molecular function remains unknown. The mRNA is cell-to-cell mobile. |
| AT4G31380 | encodes a small protein with unknown function and is similar to flower promoting factor 1. This gene is not expressed in apical meristem after floral induction but is expressed in roots, flowers, and in low abundance, leaves. |
| AT5G22940 | Homolog of FRA8 (AT2G28110), a member of a member of glycosyltransferase family 47; exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. |
| AT2G28110 | Homolog to AT5G22940, a member of glycosyltransferase family 47 that is involved in secondary cell wall biosynthesis. It exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. Protein has a domain that shares significant similarity with the pfam03016 domain. It is expressed specifically in developing vessels and fiber cells, and FRA8 is targeted to Golgi. Mutants have irregular xylem formation, reduced cellulose levels and plants are smaller than normal siblings. |
| AT4G00650 | Encodes a major determinant of natural variation in Arabidopsis flowering time. Dominant alleles of FRI confer a vernalization requirement causing plants to overwinter vegetatively. Many early flowering accessions carry loss-of-function fri alleles .Twenty distinct haplotypes that contain non-functional FRI alleles have been identified and the distribution analyzed in over 190 accessions. The common lab strains- Col and Ler each carry loss of function mutations in FRI. |
| AT4G17060 | Encodes one of the FRI interacting proteins: FRIGIDA INTERACTING PROTEIN 1 (FIP1)/At2g06005, FIP2/ At4g17060. FRI (At4G00650) is a major determinant of natural variation in Arabidopsis flowering time. |
| AT1G31814 | family member of FRI-related genes that is required for the winter-annual habit. Genbank accession BK004885 |
| AT5G51830 | Encodes one of the several Arabidopsis fructokinases. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). Important for seed oil accumulation and vascular development. |
| AT1G43670 | Encodes a fructose-1,6-bisphosphatase. This enzyme, in addition to catalyzing the formation of fructose-6-phosphate for sucrose biosynthesis, appears to play a role in fructose-mediated signaling that is independent of its enzymatic activity. atcfbp-1/fins1 mutants have reduced photosynthetic rates, elevated levels of starch and reduced levels of sucrose during the day. Although the protein is expected to be cytosolic, a GFP-tagged version localizes to the cytoplasm and the nucleus. The mRNA is cell-to-cell mobile. |
| AT1G07110 | Encodes the bifunctional enzyme fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase. |
| AT2G21330 | fructose-bisphosphate aldolase 1;(source:Araport11) |
| AT4G38970 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT4G26530 | Aldolase superfamily protein;(source:Araport11) |
| AT2G36460 | Aldolase superfamily protein;(source:Araport11) |
| AT3G52930 | Aldolase superfamily protein;(source:Araport11) |
| AT1G07510 | encodes an FtsH protease that is localized to the mitochondrion |
| AT2G26140 | Encodes an FtsH protease that is localized to the mitochondrion. Loss of function results in increased determinacy of the meristem that is exacerbated when plants are grown at higher temperatures. |
| AT3G47060 | encodes an FtsH protease that is localized to the chloroplast |
| AT1G06430 | encodes a FtsH protease that is localized to the chloroplast |
| AT5G58870 | encodes an FtsH protease that is localized to the chloroplast |
| AT5G02160 | Zinc-finger domain containing protein involved in abiotic stress response. Possesses an N-terminal transit peptide followed by a hydrophobic domain and a zinc-finger domain. Despite the presence of a zinc-finger domain (C4-type) with two CXXCXGXG conserved repeats, characteristic of DNAJ protein, the conserved J domain is absent in FIP. Interacts with FtsH5. Gene expression levels are reduced and negatively regulates stress response genes during stress conditions. |
| AT1G17220 | Encodes a chloroplast localized protein with similarity to translation initiation factor 2. Can complement loss of INFB in E.coli suggesting FUG1 does function as a translation initiation factor in vivo. Identified as a suppressor of the leaf variegation mutant var2-6. Suppression is only seen in hypomorphs as complete loss of function alleles are embryo lethal. The mRNA is cell-to-cell mobile. |
| AT1G49710 | Encodes a protein with core α1,3-fucosyltransferase activity. |
| AT2G15390 | Encodes an alpha-(1,2)-fucosyltransferase. |
| AT1G14100 | member of Glycosyltransferase Family- 37. FUT8 was previously associated to AT1G14110 |
| AT4G05120 | Encodes an equilibrative nucleoside transporter AtENT3. Mutations of this locus allow mutants to grow on uridine analogue fluorouridine. |
| AT5G50950 | Encodes a fumarase enzyme initially shown to be in the mitochondria through proteomic studies but later shown to be present in the cytosol using an RFP fluorescent protein tag. It appears to be important for the accumulation of fumarate from malate in leaves in the light, and helps to promote nitrogen assimilation under high nitrogen conditions. It does not appear to be necessary for lipid metabolism and seedling growth. Inhibition of fumarate accumulation results in an overall shift in the cold response of leaves, with a complete inhibition of cold acclimation of photosynthesis. |
| AT3G16700 | Fumarylacetoacetate hydrolase homolog. |
| AT4G24740 | a LAMMER-type protein kinase that co-precipitates with serine/arginine-rich (SR) proteins in vitro, interaction modulated by phosphorylation of the proteins. |
| AT3G61140 | Represses photomorphogenesis and induces skotomorphogenesis in the dark. Component of the nuclear-localized COP9 complex. Mutants display striking purple coloration due to anthocyanin accumulation in their cotyledons, first become defective during embryogenesis and exhibit limited seedling development. |
| AT3G13550 | Encodes a protein similar to ubiquitin-conjugating enzyme (E2) variant proteins (UEV); lacks catalytic cysteine residue found in ubiquitin-conjugating enzyme E2. Represses photomorphogenesis and induces skotomorphogenesis in the dark. |
| AT1G20110 | Encodes a protein that is localized to the peripheral membrane of late endosomal compartments. Involved in the regulation of mulitivesicular/prevacuolar compartment protein sorting. Loss of function mutations are embryo lethal. Regulates IRT1-dependent metal transport and metal homeostasis. The mRNA is cell-to-cell mobile. |
| AT4G36730 | member of a gene family encoding basic leucine zipper proteins (GBFs) which bind the G-box |
| AT4G01120 | bZIP (basic leucine zipper) transcription factor that binds to the G-box regulatory element found in many plant promoters. GBF2 nuclear localization is increased by blue light |
| AT2G46270 | encodes a bZIP G-box binding protein whose expression is induced by ABA. It has been shown to bind to Adh that contains the G-box and is induced by cold and water deprivation. GBF3 has been shown to be expressed mostly in the root and dark-grown leaves. GBF3 can act as homodimers and as heterodimers with GFB1, GBF2 and GBF4. In addition, GBF3!?s DNA binding activity is enhanced by GIP1, GPRI1 and GPRI2. |
| AT4G34590 | Encodes a basic domain leucine zipper (bZip) transcription factor bZIP11. Translation is repressed by sucrose. Directly regulates gene expression of ASN1 and ProDH2, which are enzyme-coding genes involved in amino acid metabolism. Susceptibility factor during Pseudomonas syringae infection. |
| AT5G10450 | Encodes a member of the 14-3-3 gene family that is a lambda isoform (14-3-3λ). Interacts with APX3 (ascorbate peroxidase) and AKR2 , suggesting a role in mediating oxidative metabolism in stress response. This protein was shown to colocalize and interact with SERK1 by which it is phosphorylated. This protein is also reported to interact with the phosphorylated form of the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1. Interacts with JAZ10.4 which lacks the Jas motif. It is also phosphorylated by CRPK1 as part of the response to cold and translocates to the nucleus after phosphorylation. |
| AT4G17330 | gene of unknown function expressed in seedlings, flower buds and stems |
| AT3G05120 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. The DELLA region alone can interact with GID1A in GA-dependent manner in a Y2H assay. |
| AT3G63010 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. The mRNA is cell-to-cell mobile. |
| AT5G27320 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. |
| AT1G79460 | Encodes for a protein with ent-kaurene synthase B activity which catalyzes the second step in the cyclization of GGPP to ent-kaurene in the gibberellins biosynthetic pathway. |
| AT1G74670 | Gibberellin-regulated family protein;(source:Araport11) |
| AT2G33570 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT5G44670 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT4G20170 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT2G47180 | GolS1 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS1 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS1 have increased tolerance to salt, chilling, and high-light stress. |
| AT1G56600 | GolS2 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS2 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS2 have increased tolerance to salt, chilling, and high-light stress. |
| AT1G09350 | Predicted to encode a galactinol synthase |
| AT1G60450 | Predicted to encode a galactinol synthase. |
| AT3G53950 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT1G14430 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT1G26810 | Encodes a protein with β1,3-galactosyltransferase activity involved in the biosynthesis of the Lewis a epitope of certain glycoproteins. |
| AT3G58790 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT2G46480 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT5G47780 | Encodes a protein with putative galacturonosyltransferase activity. The mRNA is cell-to-cell mobile. |
| AT1G06780 | Encodes a protein with putative galacturonosyltransferase activity. Required for synthesis of native homogalacturonan in growing pollen tubes; critical role in pollen tube growh and male fertility. |
| AT2G38650 | Galacturonosyltransferase (GAUT) family member, interacts with GAUT1. Required for synthesis of native homogalacturonan in growing pollen tubes; critical role in pollen tube growh and male fertility. |
| AT3G02350 | Encodes a protein with putative galacturonosyltransferase activity. The mRNA is cell-to-cell mobile. |
| AT3G28340 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT3G50760 | Encodes a protein with putative galacturonosyltransferase activity. The mRNA is cell-to-cell mobile. |
| AT1G13250 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT4G02130 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT3G62660 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT5G62270 | Ribosomal protein L20;(source:Araport11). Required for proper mitochondrial cristae formation. Expressed throughout plant. Mutants are defective in late stages of megagametogenesis. Pollen tube defective. Gametophytic lethality is probably due to mitochondrial disfunction. |
| AT5G49150 | Encodes a transmembrane domain containing protein expressed in sperm cells. Mutants are defective in gamete fusion. Target promoter of the male germline-specific transcription factor DUO1. |
| AT1G19580 | Encodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex. |
| AT5G66510 | Encodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex. |
| AT5G63510 | Encodes a mitochondrial gamma carbonic anhydrase-like protein. Component of the NADH dehydrogenase complex. |
| AT3G52115 | Induced in response to ionizing radiation, shows basal expression in mitotically active cells and high expression in endoreduplicating cells. May be involved in DNA damage-induced growth arrest. Protein sequence contains a PEST destruction box. |
| AT2G33040 | gamma subunit of Mt ATP synthase;(source:Araport11) |
| AT2G36830 | Encodes a tonoplast intrinsic protein, which functions as water channel. It has also been shown to be able to facilitate the transport of urea and hydrogen peroxide. Highly expressed in vascular tissues of the root, stem, cauline leaves and flowers but not in the apical meristems. The mRNA is cell-to-cell mobile. |
| AT4G32940 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteinases that is expressed in vegetative organs and is upregulated in association with various types of cell death and under stressed conditions. They are essential in processing seed storage proteins and for mediating the susceptible response of toxin-induced cell death. |
| AT1G23900 | Encodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane. |
| AT1G78660 | The Arabidopsis protein AtGGH1 is a gamma-glutamyl hydrolase cleaving pentaglutamates to yield di- and triglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. |
| AT1G78680 | The Arabidopsis protein AtGGH2 is a gamma-glutamyl hydrolase acting specifically on monoglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. |
| AT1G78670 | gamma-glutamyl hydrolase 3;(source:Araport11) |
| AT4G30530 | Encodes a gamma-glutamyl peptidase, outside the GGT family, that can hydrolyze gamma-glutamyl peptide bonds. The mRNA is cell-to-cell mobile. |
| AT4G39640 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in vascular tissues (predominantly phloem) of leaves and is involved in the degradation of glutathione. The encoded enzyme also mitigates oxidative stress by metabolizing GSSG (oxidized form of GSH - glutathione) in the apoplast. |
| AT4G39650 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in the apoplast of young siliques (within the ovules of the carpel) and is involved in the degradation of glutathione. The encoded enzyme also acts as part of a GSH pumping gamma-glutamyl cycle in this tissue and may also be involved in gamma-glutamyl amino acid formation. |
| AT4G34450 | Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation. |
| AT5G15230 | Encodes gibberellin-regulated protein GASA4. Promotes GA responses and exhibits redox activity. |
| AT3G02885 | GASA5, is involved in the regulation of seedling thermotolerance. |
| AT3G24050 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT5G49300 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT3G16870 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT2G45050 | Encodes a member of the GATA factor family of zinc finger transcription factors. A positive regulator of photomorphogenesis. |
| AT3G60530 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT5G66320 | Encodes GATA transcription factor gene GNC, involved in regulating carbon and nitrogen metabolism. Expression occurs in aerial tissue at an early stage of development and is inducible by nitrate. |
| AT4G32890 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT5G56860 | Encodes a member of the GATA factor family of zinc finger transcription factors. Modulate chlorophyll biosynthesis and glutamate synthase (GLU1/Fd-GOGAT) expression. |
| AT4G16141 | GATA type zinc finger transcription factor family protein;(source:Araport11) |
| AT2G20570 | Encodes GLK1, Golden2-like 1, one of a pair of partially redundant nuclear transcription factors that regulate chloroplast development in a cell-autonomous manner. GLK2, Golden2-like 2, is encoded by At5g44190. GLK1 and GLK2 regulate the expression of the photosynthetic apparatus. GLK1 is also a member of the GARP transcription factor family. |
| AT3G13222 | Encodes a protein that binds to G-box binding transcription factors and enhances their binding affinities to G-box in vitro. This protein localizes to the nucleus and is expressed predominantly in the root. |
| AT1G72030 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT4G19985 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT2G06025 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT4G28030 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT5G65280 | Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor. Loss of function mutations in GCL1 show no ABA response defects based on assays of seed germination and seedling development.GCL1 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase. |
| AT2G20770 | Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor.GCL2 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase. |
| AT5G28840 | Encodes a protein with GDP-D-mannose 3',5'-epimerase activity. The enzyme is involved in ascorbate biosynthesis. It catalyzes the conversion of GDP-D-mannose to GDP-L-galactose. |
| AT1G53920 | Contains lipase signature motif and GDSL domain. |
| AT4G10950 | GDSL-type esterase/lipase. Required for pollen development. |
| AT2G36340 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT5G13200 | Encodes a protein with unknown function that is involved in hormone mediated regulation of seed germination/dormancy. |
| AT2G18440 | Encodes a noncoding RNA, a member of an emerging class of transcripts that lack significant open reading frames and encode RNA as their final product. Has been identified as a translated small open reading frame by ribosome profiling. |
| AT4G09000 | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available. |
| AT1G22300 | Encodes a 14-3-3 protein. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1. Might act as a stabilization factor to mediate the oligomerization of REM on the plasma membrane. |
| AT1G78220 | 14-3-3 protein GF14 pi |
| AT1G78300 | G-box binding factor GF14 omega encoding a 14-3-3 protein The mRNA is cell-to-cell mobile. |
| AT5G38480 | general regulatory factor, a 14-3-3 gene |
| AT5G16050 | Encodes GF14 upsilon chain, a 14-3-3 gene family member. |
| AT3G02520 | Encodes GF14 ν, a 14-3-3 protein isoform (14-3-3ν). |
| AT5G65430 | member of 14-3-3 proteins. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 |
| AT2G42590 | 14-3-3 gene. Binds calcium and displays induced structural changes. |
| AT5G13630 | Encodes magnesium chelatase involved in plastid-to-nucleus signal transduction. |
| AT2G18620 | Terpenoid synthases superfamily protein;(source:Araport11) |
| AT1G72610 | germin-like protein (GLP1) |
| AT1G18970 | Encodes a germin-like protein with possible oxalate oxidase activity (based on GenBank record). |
| AT1G09560 | Encodes a plasodesmata-located protein involved in regulating primary root growth by controlling phloem-mediated allocation of resources between the primary and lateral root meristems. The mRNA is cell-to-cell mobile. |
| AT3G05930 | germin-like protein (GLP8) |
| AT1G02335 | Encodes a plasodesmata-located protein involved in regulating primary root growth by controlling phloem-mediated allocation of resources between the primary and lateral root meristems. |
| AT2G36690 | Protein belonging to the Fe-dependent 2-oxoglutarate dioxygenase superfamily, catalyzes the stereospecific hydration of GA12 to produce DHGA12, negatively regulates ABA sensitivity during germination, phototrophic establishment and seedling development. |
| AT3G27490 | GSR1 is a tandem plant PhD homeodomain protein involved in auxin mediated seed dormancy and germination. It was identified in a screen for mutations resistant to the compound germostatin. It interacts with components of the auxin signaling pathway and may function as an auxin stimulated co-repressor. |
| AT4G32680 | Similar to yeast GET2 encodes an ER localized transmembrane protein that interacts with GET1 receptor via its transmembrane domain. |
| AT1G35160 | GF14 protein phi chain member of 14-3-3 protein family. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 The mRNA is cell-to-cell mobile. |
| AT1G14920 | Similar to a putative transcription factor and transcriptional coactivators. Repressor of GA responses and involved in gibberellic acid mediated signaling. Member of the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. GAI may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. |
| AT1G30040 | Encodes a gibberellin 2-oxidase that acts on C-19 gibberellins. AtGA2OX2 expression is responsive to cytokinin and KNOX activities. |
| AT1G47990 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins. AtGA2OX4 expression is responsive to cytokinin and KNOX activities. |
| AT1G02400 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins but not C20 gibberellins. |
| AT4G21200 | Encodes a protein with gibberellin 2-oxidase activity which acts specifically on C-20 gibberellins. |
| AT5G51810 | Encodes gibberellin 20-oxidase. Involved in gibberellin biosynthesis. Up-regulated by far red light in elongating petioles. Not regulated by a circadian clock. Mutation of GA20ox2 delays flowering. |
| AT1G15550 | Involved in later steps of the gibberellic acid biosynthetic pathway. Activated by AGAMOUS in a cal-1, ap1-1 background. Deletion of 208 bp from -1016 to -809 (Δ-808) resulted in loss of GA-negative feedback (this sequence, which contains a 43-bp sequence GNFEI, was shown to be sufficient for GA-negative feedback). |
| AT2G47790 | Encodes GIGANTUS1 (GTS1), a member of Transducin/WD40 protein superfamily. Controls seed germination, growth and biomass accumulation. |
| AT5G15050 | Encodes GlcAT14B. Has glucuronosyltransferase activity adding glucuronic acid residues to beta-1,3- and beta-1,6-linked galactans. |
| AT2G37585 | Encodes GlcAT14C. Has glucuronosyltransferase activity adding glucuronic acid residues to beta-1,3- and beta-1,6-linked galactans. |
| AT2G19880 | Encodes Glucosylceramide synthase (GCS) which catalyzes the final step in glucosylceramide (GlcCer) synthesis by transferring a glucosyl residue from UDP-Glc to the ceramide backbone. |
| AT4G34740 | Encodes glutamine 5-phosphoribosylpyrophosphate amidotransferase. Mutants are deficient in leaf, but not cotyledon, plastid and palisade cell development. Mutants exhibit defective chloroplast development under non-low light, suggesting that the defect in chloroplast development is caused by photo-oxidative damage. Plays role in differential development of vascular-associated cells. Demonstrates a cell-specific difference in chloroplast development.Mutant leaves are highly reticulate with a green vascular pattern. |
| AT5G10550 | This gene is predicted to encode a bromodomain-containing protein. A plant line expressing RNAi constructs targeted against GTE7 shows some resistance to agrobacterium-mediated root transformation. |
| AT1G73150 | Bromodomain and extra terminal domain family protein. Binds to acetyl-histone H3. Binding is reduced when GTE3 is SUMOylated by SIZ1. |
| AT5G65630 | This gene is predicted to encode a bromodomain-containing protein. Plant lines expressing RNAi constructs targeted against GTE7 show some resistance to agrobacterium-mediated root transformation. |
| AT3G27260 | Kinase like protein with similarity to yeast BDF1 and human RING3 protein, which have two bromodomains GTE8 has a single bromodomain |
| AT4G04970 | encodes a gene similar to callose synthase The mRNA is cell-to-cell mobile. |
| AT3G07160 | Encodes GSL10, a member of the Glucan Synthase-Like (GSL) family believed to be involved in the synthesis of the cell wall component callose. GSL10 is required for male gametophyte development and plant growth. Has a role in entry of microspores into mitosis. GSL10 mutation leads to perturbation of microspore division symmetry, irregular callose deposition and failure of generative cell engulfment by the vegetative cell cytoplasm. Also refer to GSL8 (At2g36850). |
| AT3G59100 | encodes a protein similar to callose synthase |
| AT5G13000 | encodes a gene similar to callose synthase |
| AT2G31960 | encodes a protein similar to callose synthase |
| AT4G03550 | Encodes a callose synthase that is required for wound and papillary callose formation in response to fungal pathogens Erysiphe and Blumeria. Mutants are resistant to P. parasitica and exhibit an exaggerated PR1 response.Contributes to PAMP-induced basal defense. The mRNA is cell-to-cell mobile. |
| AT2G36850 | Encodes GSL8, a member of the Glucan Synthase-Like (GSL) family believed to be involved in the synthesis of the cell wall component callose. GSL8 is required for male gametophyte development and plant growth. Has a role in entry of microspores into mitosis. Also refer to GSL10 (At3g07160). |
| AT5G04500 | Encodes a member of the CAZy Glycosyltransferase Family 64 that is involved in glycosylinositolphosphorylceramide and sphingolipid glycosylation. In mutants, seed germination was less sensitive to salt stress than in wild-type plants. [The protein was expected to be Golgi-localized based on function as well as the Golgi localization of its homolog GMT1. However, GFP-fusion proteins localized both to the ER and Golgi, and especially to ER when co-expressed with Golgi markers. Therefore, localization cannot confidently be defined. (pers. communication, J. Mortimer)] |
| AT5G13110 | Encodes a plastidic glucose-6-phosphate dehydrogenase that is sensitive to reduction by DTT and whose mRNA is most highly expressed in root. |
| AT1G61800 | glucose6-Phosphate/phosphate transporter 2. Expression is upregulated in the shoot of cax1/cax3 mutant. The mRNA is cell-to-cell mobile. |
| AT2G25450 | Encodes a 2-oxoacid-dependent dioxygenase involved in the production of 2-hydroxybut-3-enyl glucosinolate. |
| AT1G70090 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT3G01640 | AtGlcAK is a sugar kinase able to phosphorylate D-GlcA to D-GlcA-1-phosphate in the presence of ATP. |
| AT1G33800 | Encodes a glucuronoxylan(GX)-specific 4-O-methyltransferase responsible for methylating GlcA residues in GX. Reduced methylation of GX ingxmt1-1 plants is correlated with altered lignin composition. The mRNA is cell-to-cell mobile. |
| AT5G17330 | Encodes one of two isoforms of glutamate decarboxylase. The mRNA is cell-to-cell mobile. |
| AT1G65960 | glutamate decarboxylase (GAD2) The mRNA is cell-to-cell mobile. |
| AT2G02000 | glutamate decarboxylase 3;(source:Araport11) |
| AT3G17760 | glutamate decarboxylase 5;(source:Araport11) |
| AT5G18170 | Encodes the 43 kDa alpha-subunit of the glutamate dehydrogenase with a putative mitochondrial transit polypeptide and NAD(H)- and alpha-ketoglutarate-binding domains. Mitochondrial localization confirmed by subcellular fractionation. Combines in several ratios with GDH2 protein (GDH-beta) to form seven isoenzymes. Catalyzes the cleavage of glycine residues. May be involved in ammonia assimilation under conditions of inorganic nitrogen excess. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells. |
| AT2G32390 | Encodes a ionotropic glutamate receptor ortholog, a member of a putative ligand-gated ion channel subunit family. |
| AT3G04110 | putative glutamate receptor (GLR1.1). Contains a functional cation - permeable pore domain. Involved in cellular cation homeostasis. |
| AT5G48410 | member of Putative ligand-gated ion channel subunit family |
| AT3G07520 | member of Putative ligand-gated ion channel subunit family. Contains a functional cation - permeable pore domain. Involved in cellular cation homeostasis. |
| AT1G42540 | member of Putative ligand-gated ion channel subunit family |
| AT1G05200 | Encodes a putative glutamate receptor GLR3 with dual localization in plastid and plasma membrane. |
| AT2G32400 | Glr5 |
| AT5G04140 | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation. The mRNA is cell-to-cell mobile. |
| AT2G41220 | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression is most abundant in root. The mRNA is cell-to-cell mobile. |
| AT5G64050 | Glutamate-tRNA ligase. Targeted to mitochondria and chloroplast. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana. |
| AT5G63570 | Encodes a protein with homology to glutamate-1-semialdehyde 2,1-aminomutase catalyzing the conversion of glutamate-1-semialdehyde (GSA) into 5-amino levulinate. The expression of this gene was demonstrated to be light-induced. The mRNA is cell-to-cell mobile. |
| AT4G23100 | Encodes the enzyme glutamate-cysteine ligase catalyzing the first, and rate-limiting, step of glutathione biosynthesis. Required for cell proliferation at the root tip. Involved in susceptibility to the bacterial pathogen Pseudomonas syringae. Mutants are phytoalexin defective. |
| AT1G23310 | Identified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway. |
| AT1G15040 | Encodes a nitrogen regulated putative glutamine amidotransferase that represses shoot branching. |
| AT4G25760 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
| AT2G24762 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
| AT3G17820 | encodes a cytosolic glutamine synthetase, the enzyme has low affinity with substrate ammonium The mRNA is cell-to-cell mobile. |
| AT1G48470 | Encodes cytosolic glutamine synthase isozyme. Expression of mRNA is not detectable in roots. |
| AT5G35630 | chloroplastic glutamine synthetase The mRNA is cell-to-cell mobile. |
| AT3G47340 | encodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT4G28730 | Encodes a glutaredoxin GrxC5. GrxC5 exists as two forms when expressed in Escherichia coli. The monomeric apoprotein possesses deglutathionylation activity mediating the recycling of plastidial methionine sulfoxide reductase B1 and peroxiredoxin IIE, whereas the dimeric holoprotein incorporates a [2Fe-2S] cluster. |
| AT2G25080 | Encodes glutathione peroxidase. The mRNA is cell-to-cell mobile. |
| AT2G31570 | glutathione peroxidase GPx |
| AT2G43350 | Glutathione peroxidase. Functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses. Interacts with ABI2 and ABI1. |
| AT3G63080 | Encodes glutathione peroxidase. |
| AT4G11600 | Encodes glutathione peroxidase. Exhibits moderate binding affinity with dinotefuran. |
| AT3G54660 | Encodes glutathione reductase that is most likely localized in the chloroplast. Flavoenzyme-encoding gene. |
| AT1G49860 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). The mRNA is cell-to-cell mobile. |
| AT2G02930 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT2G30870 | early dehydration-induced gene ERD13 homologous to tobacco and maize glutathione S-transferases. Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002) |
| AT2G47730 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT2G29450 | Encodes a member of the TAU glutathione S-transferase gene family. Gene expression is induced by exposure to auxin, pathogen and herbicides. Naming convention according to Wagner et al. (2002) |
| AT1G27130 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). GSTU13 acts in the pathogen triggered pathway for indole glucosinolate metabolisms that involves also PENETRATION2 myrosinase. It is likely the enzyme that conjugates GSH with unstable indol-3-ylmethyl-ITCs formed upon PEN2-mediated IG hydrolysis, particularly in the branch of this pathway in which 4-substituted IGs are processed. |
| AT1G27140 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G59700 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). The mRNA is cell-to-cell mobile. |
| AT1G10360 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT5G62480 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT5G27380 | Encodes a protein with similarity to glutathione synthetases, which catalyzes one of the early steps in glutathione biosynthesis. Two transcripts have been detected; the longer transcript is less abundant and the protein is localized to the chloroplast. The smaller transcript, in which the transit peptide is truncated, is localized to the cytosol. Increased glutathione accumulation in response to cesium stress. |
| AT5G02790 | GST functions in reductive deglutathionylation of glutathione conjugates of quercetin. |
| AT5G02780 | Encodes a member of the lambda family of glutathione transferases. It has thiol transferase activity and self S-glutathionylation activity in vitro. |
| AT3G24170 | Encodes a cytosolic glutathione reductase. |
| AT3G04120 | encodes cytosolic GADPH (C subunit) involved in the glycolytic pathway but also interacts with H2O2 potentially placing it in a signalling cascade induced by ROS. The mRNA is cell-to-cell mobile. |
| AT1G79530 | Encodes one of the chloroplast/plastid localized GAPDH isoforms (GAPCp1/At1g79530 and GAPCp2/At1g16300). gapcp double mutants display a drastic phenotype of arrested root development, dwarfism and sterility. GAPCps are important for the synthesis of serine in roots. |
| AT1G16300 | Encodes one of the chloroplast/plastid localized GAPDH isoforms (GAPCp1/At1g79530 and GAPCp2/At1g16300). gapcp double mutants display a drastic phenotype of arrested root development, dwarfism and sterility. GAPCps are important for the synthesis of serine in roots. |
| AT1G80380 | encodes a glycerate kinase which catalyzes the last step of photorespiration C2 cycle. |
| AT4G25840 | glycerol-3-phosphatase 1;(source:Araport11) |
| AT5G60620 | Glycerol-3-phosphate acyltransferase localized to the ER. Similar to mammalian cells involved in storage oil formation. ER-localized GPAT enzyme responsible for plant membrane lipid and oil biosynthesis. |
| AT1G30560 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). |
| AT4G17550 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). |
| AT1G02390 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT4G01950 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT5G06090 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT5G41080 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
| AT1G71340 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
| AT5G45350 | proline-rich family protein;(source:Araport11) |
| AT4G19200 | Glycine and proline rich protein.Mutants have increased size. |
| AT5G17650 | glycine/proline-rich protein;(source:Araport11) |
| AT4G33010 | glycine decarboxylase P-protein 1;(source:Araport11) |
| AT4G38680 | Encodes a glycine-rich protein that binds nucleic acids and promotes DNA melting. Its transcript and protein levels are up-regulated in response to cold treatment with protein levels peaking earlier in shoots (~10-14 days) than in roots (~21 days). It is normally expressed in meristematic regions and developing tissues where cell division occurs. RNAi and antisense lines with lower levels of CSP2/GRP2 transcripts flower earlier than wild type plants and have some defects in anther and seed development. |
| AT2G22660 | Encodes a member of a family of DUF1399 domain containing proteins. GRDP1 is involved in germination and response to ABA. Loss of function mutants have reduced germination in the presence of osmotic stressors. |
| AT2G21060 | Glycine-rich protein (AtGRP2b). Also named as CSP4 (cold shock domain protein 4) containing a well conserved cold shock domain (CSD) and glycine-rich motifs interspersed by two retroviral-like CCHC zinc fingers. AtCSP4 is expressed in all tissues but accumulates in reproductive tissues and those undergoing cell divisions. Overexpression of AtCSP4 reduces silique length and induces embryo lethality. |
| AT2G05520 | Encodes a glycine-rich protein that is expressed mainly in stems and leaves. AtGRP3 functions in root size determination during development and in Al stress. mRNA levels are upregulated in response to ABA, salicylic acid and ethylene but downregulated in response to desiccation. The mRNA is cell-to-cell mobile. |
| AT2G05380 | glycine-rich protein 3 short isoform (GRP3S) mRNA, complete The mRNA is cell-to-cell mobile. |
| AT2G16260 | pseudogene of glycine-rich RNA-binding protein |
| AT3G14415 | Encodes a glycolate oxidase that modulates reactive oxygen species-mediated signal transduction during nonhost resistance. The mRNA is cell-to-cell mobile. |
| AT4G18360 | Encodes a glycolate oxidase that modulates reactive oxygen species-mediated signal transduction during nonhost resistance. |
| AT2G33470 | glycolipid transfer protein 1;(source:Araport11) |
| AT1G21360 | glycolipid transfer protein 2;(source:Araport11) |
| AT3G21260 | Glycolipid transfer protein (GLTP) family protein;(source:Araport11) |
| AT5G49720 | Encodes a membrane-bound endo-1,4-beta-D-glucanase, involved in cellulose biosynthesis. Loss-of-function mutants have severe cellulose-deficient phenotypes. During cell elongation, KOR1 is associated with Golgi apparatus and early endosome. Inhibition of cellulose biosynthesis promoted a redistribution of KOR1 in subcellular locations. These observations suggest that deposition of cellulose involves the intracellular cycling of KOR1. |
| AT4G24260 | Encodes a protein with similarity to endo-1,4-b-glucanases. KOR3 is induced by nemotodes and is expressed in syncitia induced by Heterodera schachtii.May be involved in the development and function of syncitia. |
| AT1G70710 | endo-1,4-beta-glucanase. Involved in cell elongation. |
| AT4G39010 | Cellulase involved in cell wall modification during valve dehiscence. |
| AT1G23210 | glycosyl hydrolase 9B6;(source:Araport11) |
| AT1G75680 | glycosyl hydrolase 9B7;(source:Araport11) |
| AT2G32990 | glycosyl hydrolase 9B8;(source:Araport11) |
| AT1G27950 | Encodes LTPG1, a lipid transfer protein with a predicted GPI (glycosylphosphatidylinositol)-anchor domain. Localized in the plasma membrane. Disruption of the LTPG1 gene causes alterations of cuticular lipid composition, but no significant changes on total wax and cutin monomer loads are seen. The mRNA is cell-to-cell mobile. |
| AT2G44300 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G22570 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G58550 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G14805 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G14815 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G18280 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G55260 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G62790 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G73550 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT1G73560 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT5G62220 | Encodes a Golgi apparatus-localized galactosyltransferase involved in galactosyl-substitution of xyloglucan at position 2. |
| AT4G37690 | Unlike its close paralog MUCI10 (At2g22900), GT6 is not required for the biosynthesis of seed coat mucilage. GT6 is preferentially expressed in sub-epidermal cell layers of the seed coat. |
| AT1G32930 | Galactosyltransferase family protein;(source:Araport11) |
| AT2G31350 | Encodes a mitochondrial glyoxalase 2 that can accommodate a number of different metal centers and with the predominant metal center being Fe(III)Zn(II). |
| AT1G11840 | Encodes Ni+ dependent glyoxalase I homolog ATGLX1. |
| AT2G32090 | Lactoylglutathione lyase / glyoxalase I family protein;(source:Araport11) |
| AT1G53580 | Mononuclear Fe(II)-containing member of the b-lactamase fold superfamily. ETHE1 is homodimeric in solution, exhibits low-level esterase activity, and specifically binds a single Fe(II) atom in the active site. |
| AT1G15380 | Glyoxalase which affects ABA?JA crosstalk. |
| AT3G25530 | Encodes gamma-hydroxybutyrate dehydrogenase (AtGHBDH). Contains a NADP-binding domain. GHBDH is proposed to function in oxidative stress tolerance. |
| AT5G44190 | Encodes GLK2, Golden2-like 2, one of a pair of partially redundant nuclear transcription factors that regulate chloroplast development in a cell-autonomous manner. GLK1, Golden2-like 1, is encoded by At2g20570. GLK1 and GLK2 regulate the expression of the photosynthetic apparatus. |
| AT1G07290 | Encodes a GDP-mannose transporter. |
| AT5G19980 | Encodes a Golgi-localized nucleotide-sugar transporter. |
| AT3G03180 | Got1/Sft2-like vescicle transport protein family;(source:Araport11) |
| AT1G79830 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC5 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (139 aa) portion of the protein. The C-terminal portion of the protein can also specifically interact with two members of the Rab family of GTPases (RabH1b and RabH1c). |
| AT1G31140 | Encodes a B-sister MADS-box protein, GORDITA which is specific to the Brassicaceae. GOA is the most closely related paralog of ABS. GOA represses fruit growth and contributes to integument development. Over-expression of GOA results in disorganized floral structure and addition of carpel-like features to sepals. |
| AT1G50900 | Encodes GDC1 (Grana Deficient Chloroplast 1), an ankyrin domain containing protein required fro chloroplast thylakoid grana formation. The mRNA is cell-to-cell mobile. |
| AT1G32900 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G58960 | Mutant plants display impaired light-regulation of the hypocotyl randomization response. |
| AT5G13370 | IBA - specific acyl acid amido synthetase which conjugates glutamine to IBA. It is involved in generating inactive and/or storage forms of IBA in the seedling, root, and silique. May play a role in auxin homeostasis by modulating the levels of IBA for peroxisomal conversion to IAA. |
| AT1G28130 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. |
| AT4G00850 | Arabidopsis thaliana GRF1-interacting factor 3 (GIF3) mRNA |
| AT2G22840 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower |
| AT2G36400 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower. |
| AT3G13960 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in root, shoot and flower. |
| AT4G24150 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in shoot and flower. |
| AT4G03190 | Encodes an F box protein belonging to the TIR1 subfamily. This protein forms SCF complexes with ASK1 and CUL1 and interacts with Aux/IAA proteins in an auxin-dependent manner. It also has sequence similarity to the yeast protein GRR1, which is involved in glucose repression. |
| AT5G13190 | Encodes a plasma membrane localized LITAF domain protein that interacts with LSD1 and acts as a negative regulation of hypersensitive cell death. |
| AT1G06390 | encodes a GSK3/shaggy-like protein kinase. Gene expression is induced by NaCl and ABA but not KCl, suggesting that this gene may be involved in response to osmotic stress. This protein can interact with the BZR1 protein involved in brassinosteroid-mediated signaling in a Y2H assay and promotes BZR1 phosphorylation in protoplasts. |
| AT1G13450 | Encodes GT-1, a plant transcription factor that binds to one of the cis-acting elements, BoxII, which resides within the upstream promoter region of light-responsive genes. GT-1 was assumed to act as a molecular switch modulated through Ca(2+)-dependent phosphorylation/dephosphorylation in response to light signals. |
| AT1G33240 | Encodes a plant transcriptional activator that contains two separate, but similar, trihelix DNA-binding domains, similar to GT-2. Gene is expressed in all aerial parts of the plant, with higher level of expression in siliques. At-GTL2 was thought to be a duplicated copy of this gene but is likely to be a cloning artefact, the result of a chimeric clone. Regulates ploidy-dependent cell growth in trichome. |
| AT5G28300 | Encodes a Ca(2+)-dependent CaM-binding protein. AtGT2L specifically targets the nucleus and possesses both transcriptional activation and DNA-binding abilities, implicating its function as a nuclear transcription factor. |
| AT5G64300 | encodes GTP cyclohydrolase II that can functionally complement E. coli mutant deficient in this gene. It also has 3,4-dihydroxy-2-butanone-4-phosphate synthase activity which makes it a bifunctional enzyme involved in the formation of the pyrimidine and of the carbohydrate from GTP and ribulose-5-phosphate, respectively The mRNA is cell-to-cell mobile. |
| AT5G52210 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
| AT3G57550 | guanylate kinase |
| AT2G41880 | Guanylate kinase. Involved in nucleotide metabolism. |
| AT1G03830 | Assembles liquid?liquid phase separation (LLPS)-driven condensates within the nucleus to protect against infection and autoimmunity. Pseudo-GTPase which sequesters catalytically active GBPL3 under basal conditions but is displaced by GBPL3 LLPS when it enters the nucleus following immune cues to drive the formation of unique membraneless organelles. |
| AT2G38840 | Guanylate-binding family protein;(source:Araport11) |
| AT4G16444 | GET1 membrane receptor homolog . ER localized protein that Interacts with GET3a and GET2 orthologs. Disruption of both genes results in a decreased membrane localization of the SNARE proteinSYP123 and defects in root hair elongation. |
| AT2G18960 | Encodes a plasma membrane proton ATPase. Mutants have a reduced ability to close their stomata in response to drought and are affected in stomatal but not seed responsiveness to ABA. The mRNA is cell-to-cell mobile. |
| AT5G62670 | H[+]-ATPase 11;(source:Araport11) |
| AT4G30190 | Belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal domain. Its plasma membrane localization is light-dependent. |
| AT5G57350 | member of Plasma membrane H+-ATPase family |
| AT3G60330 | H[+]-ATPase 7;(source:Araport11) |
| AT1G80660 | H[+]-ATPase 9;(source:Araport11) |
| AT1G17100 | Encodes a cytosolic heme binding protein(cHBP)that can reversibly bind tetrapyrroles including heme, protoporphyrin IX and Mg-protoporphyrin IX dimethyl ester with distinct binding affinities. |
| AT5G20140 | Encodes a haem-binding protein, HBP5. HBP5 binds haem and interacts with the haem oxygenase, HY1. Disrupting the binding of HBP5 to HY1 leads to oxidative stress. |
| AT4G28490 | Member of Receptor kinase-like protein family. Controls the separation step of floral organ abscission. The mRNA is cell-to-cell mobile. |
| AT1G28440 | HAESA-like 1;(source:Araport11) |
| AT5G65710 | Encodes a protein controlling the separation step of floral organ abscission.Necessary for pathogen-triggered leaf abscission. |
| AT2G35230 | Contains a plant-specific VQ motif. Involved in endosperm growth and seed size determination. IKU1 is expressed in the early endosperm and its progenitor, the central cell.IKU1 interacts with MINI3 in the yeast two-hybrid system. |
| AT2G45160 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
| AT4G00150 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
| AT5G56250 | hapless 8;(source:Araport11) |
| AT2G36450 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Ectopic overexpression of HRD increases the density of the root network and improves water and salt stress tolerance in Arabidopsis. Overexpression of HRD in rice causes an increase in plant biomass and drought resistance. |
| AT2G43910 | HARMLESS TO OZONE LAYER 1;(source:Araport11) |
| AT2G43920 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G09450 | Encodes a protein kinase that phosphorylates histone H3 at Thr3 and Thr11 and plays a role in mitotic cell division. |
| AT3G61590 | F-box protein that is involved in some aspect of regulation of gene silencing by miRNA. Loss of function mutations have increased levels of some miRNAs. Its activity depends on the presence of functional F-box. |
| AT1G06840 | Homomultimers interact with cytoplasmic signaling molecule PBL27, resulting in herbivory resistance, in an ethylene-dependent manner. |
| AT5G10010 | myosin-H heavy protein;(source:Araport11) |
| AT5G02500 | Encodes a member of heat shock protein 70 family. Hsc70-1 negatively regulates the expression of Hsp101 through HsfA1d, HsfA1e and HsfA2. During non-HS condition, Hsc70-1 attenuates the activity of HsfAs and finally affects the expression of HsfA2 and Hsp101 genes. hsc70-1 mutant showed thermotolerance phenotype due to higher expression of Hsp101 and other HS inducible genes. |
| AT5G16820 | Encodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes. |
| AT4G36990 | Encodes a protein whose sequence is similar to heat shock factors that regulate the expression of heat shock proteins. Transcript level is increased in response to heat shock. However, overexpression of this gene did not result in the increase of decrease of heat shock proteins. |
| AT1G74310 | Encodes ClpB1, which belongs to the Casein lytic proteinase/heat shock protein 100 (Clp/Hsp100) family. Involved in refolding of proteins which form aggregates under heat stress. Also known as AtHsp101. AtHsp101 is a cytosolic heat shock protein required for acclimation to high temperature. |
| AT5G12030 | Encodes a cytosolic small heat shock protein with chaperone activity that is induced by heat and osmotic stress and is also expressed late in seed development. |
| AT5G59720 | encodes a low molecular weight heat shock protein that contains the heat shock element in the promoter region. Expression is induced in response to heat shock. |
| AT4G16660 | heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
| AT3G07770 | HEAT SHOCK PROTEIN 89.1;(source:Araport11) |
| AT4G18880 | Encodes a member of Heat Stress Transcription Factor(Hsf) family that is a substrate of the MPK3/MPK6 signaling and regulates stress responses. |
| AT5G43840 | member of Heat Stress Transcription Factor (Hsf) family |
| AT3G51910 | member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. |
| AT1G67970 | member of Heat Stress Transcription Factor (Hsf) family |
| AT5G54070 | A member of Heat Stress Transcription Factor (Hsf) family. Not responding to heat stress. Is regulated by the seed-specific transcription factor ABI3. In turn, it regulates other heat stress proteins including Hsp17.4-CI, Hsp17.7-CII and Hsp101 during seed maturation. |
| AT5G62020 | member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. |
| AT3G24520 | member of Heat Stress Transcription Factor (Hsf) family |
| AT1G32330 | Member of Heat Stress Transcription Factor (Hsf) family. Negatively regulated by HSP90.2. |
| AT3G02990 | member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. |
| AT2G26150 | member of Heat Stress Transcription Factor (Hsf) family. Involved in response to misfolded protein accumulation in the cytosol. Regulated by alternative splicing and non-sense-mediated decay. |
| AT5G03720 | Member of Heat Stress Transcription Factor (Hsf) family. Expression is regulated by DREB2A and in turn HSFA3 regulates the expression of hsps Hsp18.1-CI and Hsp26.5-MII35S. Involved in establishing thermotolerence. |
| AT5G18040 | target of trans acting-siR480/255 protein;(source:Araport11) |
| AT4G21320 | Encodes heat-stress-associated 32-kD protein. Up-regulated by heat shock. Thermotolerance in a knockout mutant was compromised following a long recovery period (> 24 h) after acclimation heat shock treatment. |
| AT1G22990 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G35060 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G66110 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G56210 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT2G18196 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT2G36950 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G05220 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G05920 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G06130 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G24450 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G16380 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G39700 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G03380 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G19090 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G23000 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G30120 | encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc |
| AT2G19110 | Encodes a protein with similarity to Zn ATPase. Can rescue Zn deficiency in yeast and Cd resistance, suggesting a role in Zn and Cd transport. The mRNA is cell-to-cell mobile. |
| AT5G67060 | Encodes a bHLH transcription factor that is involved in transmitting tract and stigma development and acts as a local modulator of auxin and cytokinin responses to control gynoecium development. HEC1 affects auxin transport by acting as a transcriptional regulator of PIN1 and PIN3. Inhibits thermomorphogenesis. |
| AT3G50330 | Encodes a bHLH transcription factor that is involved in transmitting tract and stigma development. Inhibits thermomorphogenesis. |
| AT2G30800 | Has RNA or DNA helicase activity and expressed specifically in tapetum and vascular tissue. First identified member of a new group of the mle helicase group of the DEAH family. |
| AT2G26550 | Encodes a heme oxygenase-like protein lacking the conserved histidine residue at the active site that is usually involved in heme-iron coordination. It is unable to bind and degrade heme. Mutant analyses suggest a role in photomorphogenesis. The protein can bind the heme precursor, proto IX, which could be biologically significant and point to a role in the regulation of the two tetrapyrrole biosynthetic pathways. |
| AT3G13440 | Encodes a HemK class glutamine‐methyltransferase that is involved in the termination of translation and essential for iron homeostasis. |
| AT4G32690 | Encodes a hemoglobin (Hb) with a central domain similar to the 'truncated Hbs of bacteria, protozoa and fungi. The 3D structure of these types of Hbs is a 2-on-2 arrangement of alpha-helices as opposed to the 3-on-3 arrangement of the standard globin fold. This type of Hb is not found in animals or yeast. |
| AT2G39740 | Encodes HESO1 (HEN1 suppressor 1), a terminal nucleotidyl transferase that uridylates miRNAs and siRNAs at 3′ end. HESO1-mediated 3′ uridylation destabilizes small RNAs in hen1. |
| AT2G24150 | heptahelical transmembrane protein HHP3 |
| AT4G37680 | heptahelical transmembrane protein HHP4 |
| AT4G38320 | heptahelical transmembrane protein HHP5 |
| AT4G30850 | heptahelical transmembrane protein homologous to human adiponectin receptors and progestin receptors |
| AT3G46290 | Encodes HERCULES1 (HERK1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
| AT5G63620 | Encodes an oxidoreductase involved in transducing the perception of E-2-hexenal, which changes the redox status of the mitochondria. |
| AT4G29130 | Encodes a hexokinase (HXK1) in the plant glucose-signaling network. Functions as a glucose sensor to interrelate nutrient, light, and hormone signaling networks for controlling growth and development in response to the changing environment. |
| AT2G19860 | Encodes a protein with hexokinase activity (AtHXK2) and acts as a sensor for plant sugar responses. |
| AT4G37840 | Encodes a putative hexokinase. |
| AT5G62940 | HCA2 induces the formation of interfascicular cambium and regulates vascular tissue development in the aerial parts of the plant. Evidence from both gain of function and dominant negative alleles. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT5G23120 | encodes a stability and/or assembly factor of photosystem II The mRNA is cell-to-cell mobile. |
| AT3G15095 | Encodes HCF243 (high chlorophyll fluorescence), a chloroplast-localized protein involved in the D1 protein stability of the photosystem II complex1. |
| AT1G16720 | Encodes HCF173, a protein with weak similarities to the superfamily of the short-chain dehydrogenases/reductases. HCF173 is involved in the initiation of translation of the psbA mRNA and binds a specific site in the 5' UTR of psbA mRNA. Mutants shows a high chlorophyll fluorescence phenotype (hcf) and are severely affected in the accumulation of PSII subunits. The protein HCF173 is localized in the chloroplast, where it is mainly associated with the membrane system and is part of a higher molecular weight complex with psbA mRNA as a component of this complex. |
| AT4G35250 | HCF244 is a member of the atypical short-chain dehydrogenase/reductase superfamily, a modified group, which has lost enzyme activity.HCF244 interacts with unknown partners in a 200-400 kD membrane associated complex. |
| AT3G17040 | It is a RNA tetratricopeptide repeat-containing protein required for normal processing of transcripts from the polycistronic chloroplast psbB-psbT-psbH-petB-petD operon coding for proteins of the photosystem II and cytochrome b6/f complexes. Localizes to the chloroplast membrane. Involved in regulating plastidial gene expression and biogenesis. It binds in the psbT?psbH intercistronic region and blocks the progression of 5′ → 3′ exoribonucleases, which defines the 5′ end of processed psbH transcripts and also stabilizes the downstream RNA segment. In addition, HCF107 binding remodels the structure of the psbH 5′ UTR in a way that can account for its ability to enhance psbH translation. |
| AT5G36170 | Required for normal processing of polycistronic plastidial transcripts |
| AT3G54050 | Encodes a chloroplastic fructose 1,6-bisphosphate phosphatase. also known as HCEF1 (High Cyclic Electron Flow 1). hcef1 mutants have constitutively elevated electron flow (CEFI) and plants with antisense suppression of this enzyme have higher levels of net leaf photosynthesis and increased sucrose biosynthesis. The mRNA is cell-to-cell mobile. |
| AT2G39810 | A novel protein with a RING finger motif near the amino terminus. Negative regulator of cold responses. Functions as an E3 ligase required for the ubiquitination of ICE1. HOS1 physically interacts with ICE1 and mediates the ubiquitination of ICE1 both in vitro and in vivo. Overexpression represses the expression of CBFs and their downstream genes and confers increased sensitivity to freezing stress. The mRNA is cell-to-cell mobile. |
| AT5G67320 | Encodes a WD-40 protein involved in histone deacetylation in response to abiotic stress.Identified in a screen for mutations with altered expression of stress induced genes. Functions as a repressor of cold tolerance induced genes. Loss of function mutants are hypersensitive to freezing.Part of a PWR-HOS15-HD2C complex to regulate expression of COR genes involved in cold tolerance via histone modification. |
| AT1G14900 | Encodes a protein belonging to the subgroup of HMGA (high mobility group A) proteins that interact with A/T-rich stretches of DNA. |
| AT1G48620 | This gene is predicted to encodes a histone H1/H5 family member. A plant line expressing an RNAi construct targeted against HON5 shows a reduced level of agrobacterium-mediated root transformation. |
| AT1G20693 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. The mRNA is cell-to-cell mobile. |
| AT1G20696 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. The mRNA is cell-to-cell mobile. |
| AT2G17560 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. |
| AT1G35515 | high response to osmotic stress 10;(source:Araport11) |
| AT5G23420 | Encodes HMGB6, a protein belonging to the subgroup of HMGB (high mobility group B) proteins. Localized in the nucleus. Binds to supercoiled DNA in vitro. HMGB6 is phosphorylated by protein kinase CK2alpha within its acidic C-terminal domain. |
| AT5G59220 | Encodes a member of the PP2C family (Clade A protein phosphatases type 2C). Functions as a negative regulator of osmotic stress and ABA signaling. |
| AT1G07430 | Encodes a member of the group A protein phosphatase 2C (PP2C) family that is responsible for negatively regulating seed dormancy. |
| AT2G29380 | highly ABA-induced PP2C protein 3;(source:Araport11) |
| AT1G18370 | Encodes a kinesin HINKEL. Required for cytokinesis in pollen. Mutant has cytokinesis defects; seedling lethal. |
| AT3G56490 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
| AT5G35750 | Encodes histidine kinase AHK2. |
| AT1G27320 | Encodes a histidine kinases, a cytokinin receptor that controls cytokinin-mediated leaf longevity through a specific phosphorylation of the response regulator, ARR2. The mRNA is cell-to-cell mobile. |
| AT1G80100 | AHP6 lacks the conserved histidine residue (Asn83 in AHP6b), which is required for phosphotransfer, present in the other AHPs. AHP6 does not appear to have phosphotransfer activity. Acts as an inhibitor of cytokinin signaling by interacting with the phosphorelay machinery. Expressed in developing protoxylem and associated pericycle cell files. Negative regulator of cytokinin signaling. Expression is down-regulated by cytokinins. There are two alternatively spliced genes for this locus, AHP6a and AHP6b, differing in the length of the first exon. In ahp6-2 seedlings, only the AHP6a transcript is present. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
| AT5G48545 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
| AT4G16566 | Encodes a protein that has an unexpected bifunctional capability in vitro. The purified enzyme has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) and ADP-sulfurylase activity (E.C. 2.7.7.5). The latter is activated at low pH. The enzyme can exert it phosphorylase activity on a range of related substrates in vitro, but it acts best with APS (adenosine 5'-phsophosulfate). This protein appears to function as a homodimer. |
| AT3G21510 | Encodes AHP1, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
| AT5G39340 | Encodes AHP3, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs) involved in Histidine (His)-to-Aspartate (Asp) phosphorelay signal transduction. AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
| AT5G63890 | Encodes histidinol dehydrogenase. Up-regulated in response to UV-B. |
| AT5G10400 | Histone superfamily protein;(source:Araport11) |
| AT3G27360 | Histone superfamily protein;(source:Araport11) |
| AT4G40040 | Histone superfamily protein;(source:Araport11) |
| AT5G10980 | Histone superfamily protein;(source:Araport11) |
| AT1G79000 | Homologous to CREB-binding protein, a co-activator of transcription with histone acetyl-transferase activity. No single prior lysine acetylation is sufficient to block HAC1 acetylation of the H3 or H4 peptides, suggesting that HAC1, HAC5, and HAC12 can acetylate any of several lysines present in the peptides. HAM2 acetylates histone H4 lysine 5. A plant line expressing an RNAi construct targeted against HAC1 has reduced rates of agrobacterium-mediated root transformation. |
| AT1G16710 | Encodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC12 acetylation of the H3 or H4 peptides, suggesting that HAC12 can acetylate any of several lysines present in the peptides. |
| AT5G56740 | Encodes an enzyme with histone acetyltransferase activity. Histone H4 is the primary substrate for the enzyme. Prior acetylation of lysine 12 of histone H4 reduces radioactive acetylation by HAG2. HAG2 acetylates histone H4 lysine 12. |
| AT5G64610 | Encodes an enzyme with histone acetyltransferase activity. HAM1 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM1. HAM1 acetylates histone H4 lysine 5. |
| AT5G22880 | Encodes a histone 2B (H2B) protein. This protein can be ubiquitinated in planta, and this modification depends on the HUB1 and HUB2 E3 ubiquitin ligases. |
| AT4G33470 | Encodes HDA14, a member of the histone deacetylase family proteins that can deacetylate a-tubulin, associates with a/b-tubulin and is retained on GTP/taxol-stabilized microtubules, at least in part, by direct association with the PP2A-A2 subunit. The association of a histone deacetylase with PP2A suggests a direct link between protein phosphorylation and acetylation. Class II RPD3-like family HDAC member which controls negative responses to salinity stress. |
| AT5G03740 | HD2-type histone deacetylase HDAC. Involved in the ABA and stress responses. Mediates transcriptional repression via histone modification. |
| AT5G61060 | Encodes a member of the histone deacetylase family. Class II RPD3-like family HDAC member which controls negative responses to salinity stress. |
| AT5G61070 | Encodes a protein with similarity to histone deacetylases, a class of chromatin remodeling factors which act on H3/H4 histones. Class II RPD3-like family HDAC member which controls negative responses to salinity stress. Expressed in roots where it appears to regulate the expression of epidermal cell fate genes controlling hair cell differentiation. |
| AT2G18050 | encodes a structurally divergent linker histone whose gene expression is induced by dehydration and ABA. The mRNA is cell-to-cell mobile. |
| AT1G51060 | Encodes HTA10, a histone H2A protein. The mRNA is cell-to-cell mobile. |
| AT5G02560 | Encodes HTA12, a histone H2A protein. |
| AT5G27670 | Encodes HTA7, a histone H2A protein. |
| AT2G38810 | Encodes HTA8, a histone H2A protein. Loss of all H2A.Z (triple mutant with HTA9 and HTA11) results in a reduction in DNA methylation of transposons but not that of genes. Loss of H2A.Z causes misregulation of many genes involved in the response to developmental and environmental cues, and that these genes tend to have high levels of gene-body H2A.Z. |
| AT2G28740 | histone 4 |
| AT3G59960 | histone-lysine N-methyltransferase ASHH4;(source:Araport11) |
| AT3G01470 | Encodes a homeodomain leucine zipper class I (HD-Zip I) transcriptional activator involved in leaf and hypocotyl development. Its promoter is bound by PIF1 which likely regulates its expression. Its translation is regulated by a conserved upstream ORF (CPuORF33). |
| AT5G66700 | Encodes a homeodomain protein. Member of HD-ZIP 1 family, most closely related to HB5. AtHB53 is auxin-inducible and its induction is inhibited by cytokinin, especially in roots therefore may be involved in root development. |
| AT4G32880 | member of homeodomain-leucine zipper family, acting as a differentiation-promoting transcription factor of the vascular meristems. |
| AT4G40060 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT4G16780 | Encodes a homeodomain-leucine zipper protein that is rapidly and strongly induced by changes in the ratio of red to far-red light. It is also involved in cell expansion and cell proliferation and in the response to auxin. The mRNA is cell-to-cell mobile. |
| AT3G01220 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Expressed during seed germination in the micropylar endosperm and in the root cap, and increases ABA sensitivity and seed dormancy when mutated. The mRNA is cell-to-cell mobile. |
| AT1G26960 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Participates in the gene regulatory network controlling root branching by mediating the regulation of LAX3 by ARF7/19. |
| AT5G39760 | Functions together with TZP in co-regulation of the expression of blue-light dependent transcriptional regulators. Coassociates with and regulates the expression of light-regulated loci as well as transcriptional regulators to shape plant development in response to environmental stimuli with targets in RNA processing factors as well as proteins involved in salt stress and ABA signaling, in addition to embryo development. Acts downstream of TZP action with regard to blue-light-regulated hypocotyl elongation. |
| AT2G18350 | homeobox protein 24;(source:Araport11) |
| AT3G50890 | homeobox protein 28;(source:Araport11) |
| AT5G15210 | Encodes ZFHD3, a member of the zinc finger homeodomain transcriptional factor family. |
| AT3G28920 | homeobox protein 34;(source:Araport11) |
| AT5G53980 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT1G27045 | Encodes ATHB54, a member of the homeodomain leucine zipper (HD-Zip) family protein. Please note that this locus was split from AT1G27050 in the TAIR10 genome release (2010). Affymetrix ATH1 Probe Set linked to symbol ATHB54 is in fact directed against the product of the AT1G27050 locus (the mRNA coding for the RNA-recognition-motif protein). |
| AT2G22430 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein that is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis. |
| AT5G46880 | homeobox-7;(source:Araport11) |
| AT2G01430 | ATHB17 is a member of the HD-Zip transcription factor family. It is expressed most strongly in roots at different stages of development and induced by ABA, paraquat, drought, and NaCl treatments. Loss of function mutants are more sensitive to salt and drought stress.The protein is nuclear localized and has been shown to bind to the promoter of SIG5 and other genes. |
| AT1G70920 | homeobox-leucine zipper protein 18;(source:Araport11) |
| AT3G60390 | Encodes homeobox protein HAT3. |
| AT2G44910 | Encodes a homeodomain protein whose expression displays a dependence on phyB for both red and far-red light response. Also involved in the shade avoidance syndrome. |
| AT3G61150 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT2G32370 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. Together with ATML1 and PDF2, it is involved in cotyledon development. |
| AT3G03260 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT5G54080 | Encodes a homogentisate 1,2-dioxygenase that can convert homogentisate to malylacetoacetate and is likely to be involved in tyrosine catabolism. |
| AT2G18950 | Encodes homogentisate phytyltransferase involved in tocopherol biosynthesis. Has impact on seed longevity and plays a role in the adaptation to low temperature stress, notably phloem loading. |
| AT4G29820 | Encodes a homolog of the protein CFI-25, a polyadenylation factor subunit. |
| AT5G17560 | BolA-like family protein;(source:Araport11) |
| AT5G03160 | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast. |
| AT2G22450 | riboflavin biosynthesis protein;(source:Araport11) |
| AT3G50450 | Homolog of RPW8 |
| AT3G50480 | Homolog of RPW8 |
| AT1G04050 | Encodes SUVR1, one of the four closely related Arabidopsis SUVR proteins that belong to the SU(VAR)3-9 subgroup of SET-domain proteins. Proteins containing the evolutionarily conserved SET domain are involved in regulation of eukaryotic gene expression and chromatin structure through their histone lysine methyltransferase (HMTase) activity. SUVR1, SUVR2 and SUVR4 proteins contain a novel domain at their N-terminus, and a SUVR specific region preceding the SET domain. Localized to the nucleolus, maybe involved in regulation of rRNA expression. |
| AT2G23670 | homolog of Synechocystis YCF37;(source:Araport11) |
| AT3G23100 | A. thaliana homologue of the human DNA ligase IV-binding protein XRCC4. Yeast two-hybrid analysis demonstrated a strong interaction between A. thaliana DNA ligase IV and the A. thaliana homologue of the human DNA ligase IV-binding protein XRCC4. This interaction is shown to be mediated via the tandem BRCA C-terminal domains of A. thaliana DNA ligase IV protein. |
| AT5G02410 | Encodes ALG10, an ER-resident alpha1,2-glucosyltransferase that is required for lipid-linked oligosaccharide biosynthesis and subsequently for normal leaf development and abiotic stress response. |
| AT2G40810 | yeast autophagy-like protein;(source:Araport11) |
| AT2G31270 | Encodes a cyclin-dependent protein kinase. Involved in nuclear DNA replication and plastid division. Located in nucleus and chloroplast. |
| AT3G54710 | Encodes a cyclin-dependent protein kinase. Involved in nuclear DNA replication and plastid division. |
| AT1G65040 | Encodes one of the Arabidopsis homologs of the yeast/human Hrd1 protein: AT3G16090 (Hrd1A), AT1G65040 (Hrd1B). Involved in ERAD (Endoplasmic reticulum-associated degradation). |
| AT5G48120 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G23320 | Encodes a prenylcysteine alpha-carboxyl methyltransferase involved in methylation of isoprenylated proteins. This protein appears to have lower catalytic activity and a lower transcript expression level than the other ICMT present in Arabidopsis (At5g08335). Analysis of ICMT RNAi lines suggests that this protein may be involved in flower and stem development. |
| AT4G39740 | Encodes HCC2, one of the two Arabidopsis genes (HCC1 and HCC2) resulting from a duplication with homology to the SCO proteins involved in copper insertion during cytochrome c oxidase (COX) assembly in other organisms. HCC2, which lacks the cysteines and histidine putatively involved in copper binding, functions in copper sensing and redox homeostasis. |
| AT4G04330 | Encodes a chloroplast thylakoid localized RbcX protein that acts as a chaperone in the folding of Rubisco. |
| AT5G19855 | Encodes a chloroplast stromal localized RbcX protein that acts as a chaperone in the folding of Rubisco. |
| AT3G57150 | Encodes a putative pseudouridine synthase (NAP57). |
| AT2G31650 | Encodes a homolog of trithorax, a histone-lysine N-methyltransferase. Involved in trimethylating histone H3-lysine 4. Involved in bolting/flowering time together with ATX3 and ATX4. Involved in the formation, placement, and identity of flower organs. Role in regulation of homeotic genes. Functions as a receptor of phosphatidylinositol 5-phosphate. Localizes to cytoplasm, plasma membrane and nuclei, shifting to nuclei in the presence of PI5P. |
| AT1G17550 | Protein Phosphatase 2C |
| AT4G13940 | Encodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing. The mRNA is cell-to-cell mobile. |
| AT4G37580 | involved in apical hook development. putative N-acetyltransferase |
| AT1G70690 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT4G31750 | Encodes HopW1-1-Interacting protein 2 (WIN2). Interacts with the P. syringae effector HopW1-1. WIN2 has protein phosphatase activity. Modulates plant defenses against bacteria. Three WIN proteins are identified so far (WIN1: AT1G80600; WIN2: AT4G31750; WIN3: AT5G13320). |
| AT3G16360 | Encodes AHP4, a histidine-containing phosphotransmitter involved in Histidine (His)-to-Aspartate (Asp) phosphorelay signal transduction. AHP4 is one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
| AT1G25550 | Member of HHO/HRS GARP type transcriptional repressor family. Involved in Pi uptake and Pi starvation signaling. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
| AT1G49560 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT4G32010 | Transcriptional repressor involved in the recruitment of PRC2 for genome-wide polycomb silencing. |
| AT2G06990 | Encodes a putative DExH-box RNA helicase that acts redundantly with HEN1, HUA1, and HUA2 in the specification of floral organ identity in the third whorl. |
| AT5G08230 | HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. |
| AT3G63070 | HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. The mRNA is cell-to-cell mobile. |
| AT1G17560 | Encodes HUELLENLOS (HLL), a mitochondrial ribosome protein, similar to L14 ribosomal protein of eubacteria. HLL is essential for normal ovule development. |
| AT3G49660 | Encodes a structural core component of a COMPASS-like H3K4 histone methylation complex. |
| AT5G62490 | Part of the AtHVA22 family. Protein expression is ABA- and stress-inducible. |
| AT4G24960 | Homologous to a eukaryote specific ABA- and stress-inducible gene first isolated from barley. Groups in one subfamily with ATHVA22E. Along with other members of the ATHVA22 family, it may be involved in regulation of autophagy during development. The mRNA is cell-to-cell mobile. |
| AT5G50720 | Encodes one of five HVA22 homologs in Arabidopsis. HVA22 is an ABA- and stress-inducible gene first isolated from barley. Members of this gene family have only been found in eukaryotes. AtHVA22e mRNA is upregulated to varying degrees in response to cold stress, salt stress, ABA treatment or dehydration. |
| AT1G75700 | HVA22-like protein G;(source:Araport11) |
| AT4G36720 | HVA22-like protein K;(source:Araport11) |
| AT3G24715 | HCR1 belongs to the B4 group of Raf-like MAPKKKs. It corresponds to a root hydraulic pressure QTL between Col-0 and Bur-0 accessions and appears to contribute to variation in root pressure in different haplotypes. It is involved in potassium-dependent response to hypoxia. |
| AT1G76490 | Encodes a 3-hydroxy-3-methylglutaryl coenzyme A reductase, which is involved in melavonate biosynthesis and performs the first committed step in isoprenoid biosynthesis. Expression is activated in dark in leaf tissue but not controlled by light in the root (confine The mRNA is cell-to-cell mobile. |
| AT5G48930 | At5g48930 has been shown to encode for the hydroxycinnamoyl-Coenzyme A shikimate/quinate hydroxycinnamoyltransferase (HCT) both synthesizing and catabolizing the hydroxycinnamoylesters (coumaroyl/caffeoyl shikimate and quinate) involved in the phenylpropanoid pathway. Influence on the accumulation of flavonoids which in turn inhibit auxin transport and reduce plant growth. The mRNA is cell-to-cell mobile. |
| AT4G20930 | Encodes a 3-hydroxyisobutyrate dehydrogenase. |
| AT5G08280 | Encodes a protein with porphobilinogen deaminase activity. This protein is targeted to the chloroplast. Mutants spontaneously develop chlorotic leaf lesions in the absence of pathogen attack, resembling the phenotype of lesion-mimic mutants. It has been shown to interact with the PPR protein AtECB2 for chloroplast RNA editing. |
| AT4G11820 | Encodes a protein with hydroxymethylglutaryl-CoA synthase activity which was characterized by phenotypical complementation of the S. cerevisiae mutant. Involved in glucosinolate biosynthesis. |
| AT2G45630 | Hydroxyphenylpyruvate reductase (HPPR) family member with low activity. |
| AT5G13500 | Hyp O-arabinosyltransferase-like protein;(source:Araport11) |
| AT1G68010 | Encodes hydroxypyruvate reductase. |
| AT1G12550 | Encodes a hydroxypyruvate reductase that reduces HP to glycerate and shows even more activity with glyoxylate, a more upstream intermediate of the photorespiratory cycle. It is likely targeted to the chloroplast where it could provide a compensatory bypass for the reduction of HP and glyoxylate within this compartment. Together with HPPR2 and TAT1 involved in the biosynthesis of pHPL from tyrosine. |
| AT1G69840 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT3G01290 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT5G51570 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT1G72770 | mutant has ABA hypersensitive inhibition of seed germination; Protein Phosphatase 2C; regulates the activation of the Snf1-related kinase OST1 by abscisic acid. The mRNA is cell-to-cell mobile. |
| AT1G67700 | multidrug resistance protein;(source:Araport11) |
| AT1G09700 | Encodes a nuclear dsRNA binding protein. Involved in mRNA cleavage. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin. |
| AT3G21760 | Encodes HYR1, a UDP glycosyltransferase (UGT). HYR1 glucosylates hypostatin, an inhibitor of cell expansion in vivo to form a bioactive glucoside. |
| AT3G01100 | unknown protein, has cDNAs and ESTs associated to it |
| AT3G27770 | plant/protein;(source:Araport11) |
| AT4G27450 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
| AT3G10020 | plant/protein;(source:Araport11) |
| AT1G33055 | hypothetical protein;(source:Araport11) |
| AT4G24110 | NADP-specific glutamate dehydrogenase;(source:Araport11) |
| AT3G10040 | Encodes HRA1 (HYPOXIA RESPONSE ATTENUATOR1), a low oxygen-inducible transcription factor. |
| AT3G03270 | HRU1 is a hypoxia induced universal stress protein. It exists as two splice variants with AT3G03270.2 , which contains a putative dimerization domain, the predominant transcript found under anoxia. It is induced by RAP2.12. Subcellular localization is dynamic; under anoxia the localization of HRU1 shifts from cytoplasm to the plasma membrane. |
| AT3G48030 | Mitochondria localized, hypoxia induced gene similar to rice HIGD. |
| AT5G55250 | Encodes an enzyme which specifically converts IAA to its methyl ester form MelIAA. This gene belongs to the family of carboxyl methyltransferases whose members catalyze the transfer of the methyl group from S-adenosyl-L-methionine to carboxylic acid-containing substrates to form small molecule methyl esters. Expression of TCP genes is downregulated in mutant iamt1-D. SABATH methyltransferase. |
| AT1G51760 | encodes a member of the six Arabidopsis IAA-amino acid conjugate hydrolase subfamily and conjugates and conjugates IAA-Ala in vitro. Gene is expressed most strongly in roots, stems, and flowers. The mRNA is cell-to-cell mobile. |
| AT1G44350 | encodes a protein similar to IAA amino acid conjugate hydrolase. |
| AT3G02875 | Hydrolyzes amino acid conjugates of the plant growth regulator indole-3-acetic acid (IAA), including IAA-Leu and IAA-Phe. Uses Mg and Co ions as cofactors. |
| AT5G54140 | encodes a protein similar to IAA amino acid conjugate hydrolase |
| AT4G37550 | Indole-3-acetamide (IAM) hydrolase gene required for the auxin effects of IAM. |
| AT1G18660 | Membrane localized protein of unknown function. Involved in negative regulation of immune response. Mutants have increased resistance to pathogens. |
| AT1G17210 | IAP-like protein 1;(source:Araport11) |
| AT4G30410 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT2G31580 | ICA1 is a nuclear localized member of the tRNA(His) guanylyl transferase superfamily. Loss of function alleles show increased sensitivity to growth at high temperatures defects in cell cycle progression and DNA repair. |
| AT2G32320 | Interacts genetically with its homolog ICA1; alters growth and flowering time plasticity in relation to temperature. Mutants display effects on growth, flowering and plant development, and ploidy level depending on ambient temperature (effects specific at >27C). |
| AT2G43060 | ILI1 binding bHLH 1;(source:Araport11) |
| AT4G22260 | Similar to mitochondrial alternative oxidase. im mutants have a variegated phenotype and fail to differentiate chloroplasts in the majority of their cells under high light intensity continuous illumination. The white tissues of immutans accumulate phytoene, a non-colored C40 carotenoid intermediate. This suggests that immutans controls, either directly or indirectly, the activity of phytoene desaturase (PDS), the enzyme that converts phytoene to zeta-carotene in higher plants. However, im is not the structural gene for PDS. It is located in the lumenar face of the thylakoid membrane. IM is expressed ubiquitously in plant tissues. |
| AT1G18670 | Encodes a cyclin-dependent kinase-like protein with a ser/thr protein kinase domain and an N-terminal myristoylation sequence. Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. |
| AT3G06720 | Encodes importin alpha involved in nuclear import. Protein interacts with Agrobacterium proteins VirD2 and VirE2. Is not individually essential for Agrobacterium-mediated root transformation, but when overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT4G16143 | Protein interacts with Agrobacterium proteins VirD2 and VirE2. Is not individually essential for Agrobacterium-mediated root transformation, but when overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT1G09270 | Protein interacts with Agrobacterium proteins VirD2 and VirE2. |
| AT1G02690 | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT5G03070 | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT5G62310 | Encodes a protein with a serine/threonine kinase domain. There are two other closely related members in Arabidopsis. Knock-out mutation results in incomplete root hair elongation. Expression is found all organs examined but is especially strong in elongating root hairs. |
| AT5G11470 | SG1 is a Bromo-Adjacent Homology (BAH) domain containing protein involved in CHG methylation within genebodies. Loss of function results in pleiotrophic developmental effects that increase after 4 generations. |
| AT5G40830 | Encodes an SAM‐dependent methyltransferase superfamily protein that has an N‐terminal transmembrane domain and a putative methyltransferase domain, DUF248, and is strongly expressed in the vasculature. Overexpression results in increased phloem and xylem in the plant. |
| AT1G54840 | Encodes an atypical member of the sHSP20 family that is involved in histone demethylation. Loss of function mutations show increased methylation. IMD2 co-localizes to the nucleus with, and physically interacts with, IMD1, a protein involved in RNA directed DNA methylation. IMD2 contains an alpha crystallin domain , that is required for its function. |
| AT1G20870 | Encodes an anti-silencing factor that prevents gene repression and DNA hypermethylation. |
| AT5G65040 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT5G66730 | C2H2-like zinc finger protein;(source:Araport11) |
| AT3G13810 | indeterminate(ID)-domain 11;(source:Araport11) |
| AT4G02670 | indeterminate(ID)-domain 12;(source:Araport11) |
| AT1G68130 | Encodes the longer of two splice variants of a transcription factor involved in regulating starch metabolism in response to cold. |
| AT3G50700 | zinc finger protein, similar to maize Indeterminate1 (ID1) |
| AT2G02080 | C2H2 BIRD transcription factor family. |
| AT2G02070 | RAVEN is part of the network regulated by BLJUEJAY, JACKDAW, SACRECROW and SHORT-ROOT to regulate root tissue patterning through cell lineage specification and asymmetric cell division. RAVEN is directly activated by SHORT-ROOT and directly repressed by JACKDAW. |
| AT1G21100 | O-methyltransferase family protein;(source:Araport11) |
| AT1G21120 | O-methyltransferase family protein;(source:Araport11) |
| AT1G21130 | O-methyltransferase family protein;(source:Araport11) |
| AT1G76790 | Encodes a protein with similarity to N-acetylserotonin O-methyltransferase (ASMT) but it does not have ASMT activity in vitro. |
| AT4G15550 | UDP-glucose:indole-3-acetate beta-D-glucosyltransferase |
| AT1G52830 | An extragenic dominant suppressor of the hy2 mutant phenotype. Also exhibits aspects of constitutive photomorphogenetic phenotype in the absence of hy2. Mutants have dominant leaf curling phenotype shortened hypocotyls and reduced apical hook. Induced by indole-3-acetic acid. |
| AT3G23050 | Transcription regulator acting as repressor of auxin-inducible gene expression. Plays role in the control of gravitropic growth and development in light-grown seedlings. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. Pseudomonas syringae type III effector AvrRpt2 stimulates AXR2 protein turnover. |
| AT4G14560 | auxin (indole-3-acetic acid) induced gene (IAA1) encoding a short-lived nuclear-localized transcriptional regulator protein. The mRNA is cell-to-cell mobile. |
| AT4G28640 | Auxin induced gene, IAA11 (IAA11). Check the Comments field on the locus page to view updated sequence annotation. |
| AT4G14550 | IAA14 is a member of the Aux/IAA protein family. Involved in lateral root development. Gain of function mutation decreases auxin-inducible gene expression. Protein is localized to the nucleus. Expressed in stele and root tip epidermis. Functions as a negative regulator of ARF7/19. |
| AT3G15540 | Primary auxin-responsive gene. Involved in the regulation stamen filaments development. |
| AT3G23030 | auxin inducible gene expressed in the nucleus |
| AT2G46990 | Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA20 lacks the conserved degron (domain II) found in many family members, and IAA20 fusion proteins are stable in Arabidopsis seedlings. IAA20 transcripts are induced by auxin treatment, and overexpression of IAA20 leads to defects in gravitropism, root development, root meristem maintenance, etiolation, and cotyledon vascular development. |
| AT5G25890 | encodes a protein that may be a negative regulator of lateral root formation in response to auxin. It is a member of IAA/ARF gene family and is plant-specific. Gain of function mutations in this gene suppresses lateral root formation and is resistant to inhibition of root elongation by auxin, cytokinin, and ethylene. |
| AT4G32280 | indole-3-acetic acid inducible 29;(source:Araport11) |
| AT3G62100 | Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA30 lacks the conserved degron (domain II) found in many family members. IAA30 transcripts are induced by auxin treatment and accumulate preferentially in the quiescent center cells of the root meristem. Overexpression of IAA30 leads to defects in gravitropism, root development, root meristem maintenance, and cotyledon vascular development. Target of LEC2 and AGL15. Promotes somatyic embryogenesis. |
| AT1G15050 | Belongs to auxin inducible gene family. |
| AT1G15580 | auxin induced protein |
| AT5G65670 | auxin (indole-3-acetic acid) induced gene The mRNA is cell-to-cell mobile. |
| AT4G14430 | Encodes a peroxisomal delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation. This enzyme might also be involved in the conversion of indole-3-butyric acid to indole-3-acetic acid via a beta-oxidation-like pathway. |
| AT2G04550 | Encodes a protein phosphatase that interacts with MPK12, but not with other MAP kinases. It can dephosphorylate a dually phosphorylated MPK12 in vitro and can inactivate MPK12 in vivo. ibr5 mutants have reduced sensitivity to auxin and abscisic acid. IBR5 promotes auxin responses, including auxin-inducible transcription, differently than the TIR1 auxin receptor and without destabilizing Aux/IAA repressor proteins. It plays a role in male gametophyte development, auxin and TCP growth regulatory pathways. Regulates leaf serrations development via modulation of the expression of PIN1. |
| AT3G04730 | early auxin-induced (IAA16) |
| AT2G22670 | Encodes a transcriptional repressor of the auxin response that is auxin inducible and is involved in lateral root formation. The mRNA is cell-to-cell mobile. |
| AT3G26744 | Encodes a MYC-like bHLH transcriptional activator that binds specifically to the MYC recognition sequences in the CBF3 promoter. It also binds to and inhibits the expression of ABI3. Mutants are defective in cold-regulated gene expression and ABA signaling druing seed germination.. Cold stress triggers protein degradation of nuclear GFPICE1 protein, and the RING finger protein HOS1 is required. Sumoylation of ICE1 controls CBF3/DREB1A expression and freezing tolerance. Together with ZOU, ICE1 determines primary seed dormancy depth independently of their joint role in endosperm development.ICE1 interacts with ABI5. Also members of the DELLA family, which repress ICE1 function. |
| AT3G56370 | LRR-RLK with distinct polar localization within the plasma membrane in different cell types of the root. Mutants show defects in cell divisions within the root ground tissue. |
| AT1G68765 | Encodes a small protein of 77 amino acids. Loss of function mutations are defective in the process of ethylene independent floral organ abscission. Although the mutants have a normal appearing abscission zone, the floral organs do not abscisce. The peptide appears to be secreted and may function as a ligand. Arabidopsis 35S:IDA lines constitutively overexpressing IDA exhibit earlier abscission of floral organs, showing that the abscission zones are responsive to IDA soon after the opening of the flowers. In addition, ectopic abscission was observed at the bases of the pedicel, branches of the inflorescence, and cauline leaves. The silique valves also dehisced prematurely. |
| AT5G09805 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
| AT1G54390 | ING2 encodes a member of the Inhibitor of Growth family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA. |
| AT5G52200 | Encodes an inhibitor of protein phosphatase one (PP1). |
| AT1G28760 | Encodes an orthlog of the Xenopus inner nuclear membrane (INM) protein Nemp1/TMEM194A. |
| AT5G16760 | Encodes a inositol 1,3,4-trisphosphate 5/6-kinase. Catalyzes the phosphorylation of phytic acid (InsP6) to the symmetric InsP7 isomer 5-InsP7. |
| AT4G33770 | Inositol pyrophosphate kinase. Catalyzes the phosphorylation of phytic acid (InsP6) to the symmetric InsP7 isomer 5-InsP7. |
| AT2G01900 | Encodes an inositol polyphosphate phosphatidylinositol 5-phosphatase that is expressed in roots and is involved in mediating salt tolerance through endocytosis. |
| AT2G43330 | Encodes a tonoplast-localized myo-inositol exporter, involved in efflux of myo-inositol from the vacuole to the cytosol. The gene is ubiquitously expressed. Reduced root growth in knock-out mutants grown on low inositol agar medium. |
| AT1G30220 | Inositol transporter presenting conserved extracellular loop domains homologs of plexins/semaphorin/integrin (PSI) domains from animal type I receptors. |
| AT4G16480 | Encodes a high affinity H+:myo-inositol symporter. The only other compound shown to be transported was pinitol, a methylated derivative of myo-inositol. The mRNA is cell-to-cell mobile. |
| AT4G18010 | Encodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not appear to be active against phosphatidylinositol 4,5 bisphosphate. Overexpression of this gene renders plants insensitive to ABA in germination and growth assays. |
| AT5G42810 | Encodes an inositol tetra-/pentaphosphate 2-kinase, involved in the biosynthesis of phytic acid, a regulator of intracellular signaling, a highly abundant animal antinutrient, and a phosphate and mineral storage compound in plant seeds. Is also required for growth and modulates phosphate homeostasis at the transcriptional level. |
| AT2G43900 | Encodes a 5-inositol-phosphate phosphatase, that, in vitro, shows activity against IP(1,4,5). |
| AT1G05630 | Encodes an inositol polyphosphate 5-phosphatase with phosphatase activity toward only Ins(1,4,5)P3. Induced in response to ABA and wounding treatments. Expressed in young seedlings and flowers, while no transcripts were detectable in maturated roots, stems, and rosette leaves Modulates the development of cotyledon veins through its regulation of auxin homeostasis. Involved in blue light light?stimulated increase in cytosolic calcium ion. |
| AT1G17140 | Encodes a ROP/RAC effector, designated interactor of constitutive active ROPs 1 (ICR1), that interacts with GTP-bound ROPs. ICR1 is a scaffold mediating formation of protein complexes that are required for cell polarity. ICR1 is comprised of coiled-coil domains and forms complexes with itself and the exocyst vesicle-tethering complex subunit SEC3. |
| AT3G05820 | Encodes a putative plastid-targeted alkaline/neutral invertase.Expression is induced by salt, osmotic and ABA treatments. Loss of function affects mitochondrial functioning and ROS production. |
| AT3G07170 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
| AT4G25550 | Cleavage/polyadenylation specificity factor, 25kDa subunit;(source:Araport11) |
| AT1G48280 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G09710 | Ca(2+)-dependent calmodulin-binding protein. Targeted to the nucleus. Involved in glucosinolate metabolism in response to biotic challenge. Expressed in vascular tissue.Member of IQ67 (CaM binding) domain containing family. |
| AT5G13460 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G00820 | Member of IQ67 (CaM binding) domain containing family. |
| AT1G01110 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G14750 | Member of IQ67 (CaM binding) domain containing family. |
| AT5G62070 | Member of IQ67 (CaM binding) domain containing family. |
| AT5G07240 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G29150 | Member of IQ67 (CaM binding) domain containing family. |
| AT1G14380 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
| AT3G52290 | Member of IQ67 (CaM binding) domain containing family. |
| AT1G19870 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
| AT3G22190 | Member of IQ67 (CaM binding) domain containing family. |
| AT5G03570 | Encodes FPN2, a tonoplast localized nickel transport protein. FPN2 is one of the Arabidopsis orthologs (AT2G38460/IREG1/FPN1 and AT5G03570/IREG2/FPN2) the iron efflux transporter ferroportin (FPN) identified in animals. |
| AT1G60960 | Encodes a plasma membrane localized zinc/iron transporter. |
| AT5G26820 | Mutations in MAR1 confer resistance, while MAR1 overexpression causes hypersensitivity to multiple aminoglycoside antibiotics. Localizes to the chloroplast envelope. MAR1 may act as a plastid transporter involved in cellular iron homeostasis. The mRNA is cell-to-cell mobile. |
| AT4G36890 | IRX14 was identified as MUCI64 in a reverse genetic screen for MUCILAGE-RELATED genes. IRX14/MUCI64 is a GT43 protein essential for xylan elongation in seed coat mucilage. The xylan backbone maintains the attachment of mucilage to the seed surface and the distribution of cellulose. It was identified based on its gene expression co-variance with the IRX3 gene involved in secondary cell wall synthesis. A biochemical assay using the irx14 mutant indicates that IRX14 might function in xylose chain elongation. |
| AT5G67230 | Encodes a member of the GT43 family glycosyltransferases involved in glucuronoxylan biosynthesis: AT2G37090 (IRX9) and AT1G27600 (IRX9-L or I9H, IRX9 homolog); AT4G36890 (IRX14) and AT5G67230 (IRX14-L or I14H, IRX14 homolog). They form two functionally non-redundant groups essential for the normal elongation of glucuronoxylan backbone. I9H functions redundantly with IRX9, I14H is redundant with IRX14. IRX9 or I9H do not complement IRX14, IRX14 or I14H do not complement IRX9. |
| AT1G27600 | Encodes a member of the GT43 family glycosyltransferases involved in glucuronoxylan biosynthesis: AT2G37090 (IRX9) and AT1G27600 (IRX9-L or I9H, IRX9 homolog); AT4G36890 (IRX14) and AT5G67230 (IRX14-L or I14H, IRX14 homolog). They form two functionally non-redundant groups essential for the normal elongation of glucuronoxylan backbone. I9H functions redundantly with IRX9, I14H is redundant with IRX14. IRX9 or I9H do not complement IRX14, IRX14 or I14H do not complement IRX9. |
| AT4G30370 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G39930 | Encodes an isoamylase-type debranching enzyme. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. Mutants have reduced starch content and abnormally structured amylopectins and phytoglycogens. It has been postulated that AtISA1 interacts with AtISA2 to form the Iso1 complex. |
| AT4G09020 | Encodes an isoamylase-like protein. Mutant studies show that the gene is strongly involved in starch breakdown. A GUS-protein fusion product was shown to localize to the surface of chloroplastic structures reminiscent of starch granules. In the mutants, the chloroplastic α-amylase AMY3 is upregulated. The mRNA is cell-to-cell mobile. |
| AT1G18870 | Encodes a protein with isochorismate synthase activity involved in phylloquinone biosynthesis. Mutant studies of this gene's function suggest that its function is redundant with that of ICS1 (AT1G7410). |
| AT4G35260 | Encodes a regulatory subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase. |
| AT5G03290 | Encodes a catalytic subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase. The mRNA is cell-to-cell mobile. |
| AT5G19040 | Encodes cytokinin synthase. |
| AT3G23630 | Encodes an isopentenyl transferase involved in cytokinin biosynthesis. |
| AT3G02410 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G14200 | The AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. Encodes methylthioalkylmalate dehydrogenase. Involved in glucosinolate biosynthesis, in methionine chain elongation. The mRNA is cell-to-cell mobile. |
| AT1G80560 | The AtIMD2 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. The mRNA is cell-to-cell mobile. |
| AT3G58990 | Small subunit, which together with IPMI SSU1, IPMISSU2 and IPMI LSU1, is a member of heterodimeric isopropylmalate isomerase (IPMI). Together with IPMI SSU3 participates in the Met chain elongation pathway. |
| AT3G45300 | Encodes isovaleryl-coenzyme a dehydrogenase. Mutants have increases in 12 seed free amino acids, accumulation of seed homomethionine and 3-isovaleroyloxypropyl-glucosinolate, with a concomitant decrease in seed 3-benzoyloxypropyl-glucosinolate. The mRNA is cell-to-cell mobile. |
| AT4G29440 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT2G19710 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT4G32350 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT1G79910 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT1G75100 | Contains a J-domain at the C-terminus which is similar to the J-domain of auxilin, a clathrin-uncoating factor in cow, yeast and worm. Arabidopsis contains 6 other proteins similar to auxilin. Expressed in leaves and stems, but not in roots. Localized in the cytoplasm. Required for the chloroplast accumulation response, but not for the avoidance response. No molecular function known. Influences the composition of photosynthetic pigments, the efficiency of photosynthesis, and the CO2 uptake rate. Positive effect on water use efficiency (WUE) by reducing stomatal aperture and water vapor conductance; involved in the fine-tuning of H2O2 foliar levels, antioxidant enzymes activities and cell death after UV-C photooxidative stress. |
| AT2G39310 | jacalin-related lectin 22;(source:Araport11) |
| AT3G16430 | Encodes a protein that increases the beta-glucosidase activities of three scopolin glucosidases in vitro. |
| AT3G16450 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT3G16460 | Mannose-binding protein |
| AT5G03150 | JKD is a nuclear-localized putative transcription factor of the BIRDS/IDD C2H2 zinc finger family. JKD and its homologue BIB, restrict SHR movement to a single layer, the endodermis, and delimit tissue boundaries in the root meristem through a process that involves nuclear retention through protein complex formation. JKD mutation leads to periclinal divisions in the cortex, increased cell numbers in the circumference of the cortical and epidermal layers, a disrupted QC marker expression pattern, and disorganized QC and columella cells. This effect is enhanced in jkd bib double mutants where tissue boundaries cannot be maintained due to excessive SHR movement. JKD and BIB restrict CYCIND6 expression to cortex and endodermis stem cells to prevent formative divisions in the ground tissue. JKD physically interacts with cell fate determinants SCR and SHR in a cell type specific manner. Native FRET-FLIM analysis showed higher JKD-SCR complex in the endodermis and predominant JKD-SHR in the QC and cortex/endodermis stem cells. In addition, JKD, SCR and SHR form a ternary complex whose conformation is cell type dependent, conformational changes of this complex differentially regulate SCR and WOX5 expression to specify endodermal cell fate and QC function respectively. Its mRNA is cell-to-cell mobile. |
| AT2G46370 | Encodes a jasmonate-amido synthetase that is a member of the GH3 family of proteins. JAR1 catalyzes the formation of a biologically active jasmonyl-isoleucine (JA-Ile) conjugate. JA-Ile promotes the interaction between JAZ1 and COI1 in the jasmonate signaling pathway. JAR1 localizes to the cytoplasm and is also a phytochrome A signaling component. JAR1 is an auxin-induced gene. Loss of function mutants are defective in a variety of responses to jasmonic acid. JAR1 has additional enzymatic activities in vitro, (e.g. the ability to synthesize adenosine 5'-tetraphosphate and other JA conjugates), but there are no data to show whether JAR1 catalyzes many of these reactions in vivo. JAR1 is involved in pathogen defense, sensitivity to ozone, and wound responses. |
| AT3G16470 | Encodes a JA-responsive gene that coordinates with GRP7 in shaping plant development through the regulation of RNA processing in Arabidopsis. AtJAC1 interacts with RNA binding protein GRP7 specifically in the cytoplasm to regulate its nucleocytoplasmic distribution. |
| AT5G13220 | Plants overexpressing At5g13220.3, but not At5g13220.1 showed enhanced insensitivity to MeJa. |
| AT5G20900 | jasmonate-zim-domain protein 12;(source:Araport11) |
| AT3G17860 | JAZs are direct targets of the SCFCOI1 E3 ubiquitin-ligase and JA treatment induces their proteasome-mediated degradation. Furthermore, JAI3 negatively regulates the key transcriptional activator of JA responses, AtMYC2. The C-terminal portion of JAZ3, including the Jas domain, appears to be important for JAZ3-COI1 binding in the presence of coronatine. |
| AT1G17380 | jasmonate-zim-domain protein 5;(source:Araport11) |
| AT1G72450 | JAZ6 transcript levels rise in response to a jasmonate stimulus and a GFP:JAZ6 fusion protein localizes to the nucleus. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ6:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. |
| AT2G34600 | Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators. |
| AT1G19640 | Encodes a S-adenosyl-L-methionine:jasmonic acid carboxyl methyltransferase that catalyzes the formation of methyljasmonate from jasmonic acid. Its expression is induced in response to wounding or methyljasmonate treatment. |
| AT5G05600 | Encodes a protein with similarity to flavonol synthases that is involved in the detoxifcation polycyclic aromatic hydrocarbons.One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT4G00990 | jJumonji-domain-containing H3K9 histone demethylase. Loss of function mutants are susceptible to bacterial infection and early flowering. |
| AT3G20810 | JMJD5 encodes a protein which contains a jumonji-C (jmjC) domain. jmjd5 mutant plants have a short-period circadian phenotype. JMJD5 has histone demethylase activity and interacts with EFM to repress FT. |
| AT1G60160 | Member of the KT/KUP/HAK family of proton-coupled potassium transporters which have potential effect on cellular expansion. |
| AT1G01790 | Encodes a member of the cation/proton antiporters-2 antiporter superfamily, the K efflux antiporter KEA1 that is localized to the chloroplast envelope. |
| AT4G00630 | Encodes a K(+)/H(+) antiporter that modulates monovalent cation and pH homeostasis in plant chloroplasts or plastids. |
| AT4G04850 | Encodes a potassium efflux antiporter; has three splice forms KEA3.1, KEA3.2, and KEA3.3, KEA3.2 is the most abundant splice form in all plant organs (silique, flower, leaf and root). KEA3.1 and KEA3.3 are minor variants that can be found in flowers and in leaves. KEA3 is localized to the thylakoid membrane and enriched in the stromal lamellae. It allows proton efflux from the thylakoid lumen by proton/potassium antiport. |
| AT2G19600 | member of Putative potassium proton antiporter family |
| AT5G51710 | member of Putative potassium proton antiporter family |
| AT1G31120 | potassium transporter |
| AT2G35060 | potassium transporter |
| AT4G33530 | potassium transporter |
| AT1G70300 | potassium transporter |
| AT5G09400 | Encodes a potassium uptake permease with a functional adenylate cyclase (AC) center. The first 100 aa of this protein can complement AC-deficient E. coli and display AC activity in vitro. KUP7 is localized to the plasma membrane where it functions in potassium uptake and translocation. |
| AT4G19960 | Encodes a potassium ion transmembrane transporter. Also mediates cesium uptake when expressed in E. coli. The mRNA is cell-to-cell mobile. |
| AT3G02050 | potassium transporter KUP3p (KUP3) |
| AT5G16560 | Encodes a KANADI protein (KAN) that regulates organ polarity in Arabidopsis. KAN is required for abaxial identity in both leaves and carpels, and encodes a nuclear-localized protein in the GARP family of putative transcription factors. Together with KAN2, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN2 and KAN4, KAN1 appears to be required for proper regulation of PIN1 in early embryogenesis. |
| AT4G17695 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G31350 | KAR-UP F-box 1;(source:Araport11) |
| AT4G37470 | HTL belonging to the alpha/beta fold hydrolase superfamily. Mutant and over-expression studies indicates its involvement in seedling de-etiolation process. Involved in the perception of karrikins. Interacts with MAX2. Important for cotyledon expansion. |
| AT1G11160 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
| AT3G61980 | Encodes a Kazal-type serine proteinase inhibitor that is highly expressed in seedlings and flowers. |
| AT4G01575 | Encodes a putative Kazal-type serine proteinase inhibitor that is highly expressed in seeds, mature roots and flowers. |
| AT1G23390 | A kelch domain-containing F-box protein. Its N terminus contains a typical F-box motif but its C-terminal domain only consists of one predicted kelch motif. Predicted to be stu Interacts with chalcone synthase CHS to mediate CHS ubiquitination and degradation. |
| AT1G26945 | Encodes a basic helix-loop-helix (bHLH) protein involved in blue/far-red light signaling. Physically interacts with HFR1 and negatively regulates its activity. |
| AT1G05360 | KMS2 encode a endoplasmic reticulum protein involved in the early secretory pathway. |
| AT3G02880 | Probable inactive receptor kinase; Commonly-enriched candidate LPS-interacting PM-associated proteins from the three affinity chromatography systems with LPS chemotype Xcc 8530 as ligand. |
| AT5G19280 | kinase associated protein phosphatase composed of three domains: an amino-terminal signal anchor, a kinase interaction (KI) domain, and a type 2C protein phosphatase catalytic region |
| AT4G21270 | Encodes a kinesin-like motor protein heavy chain. Loss of function mutations have reduced fertility and are defective in spindle formation in male meiosis. |
| AT3G63480 | Encodes a protein with sequence similarity to rice kinesin protein. Homozygous loss of function mutations have reduced seed set due to defects in megagametogenesis and reduced pollen viability. |
| AT5G54670 | Encodes a truncated KatC polypeptide (KatC(207-754)), which includes the carboxyl-terminal region of KatC. This was expressed in Escherichia coli and was shown to possess microtubule-stimulated ATPase activity. |
| AT1G21730 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G12020 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G10840 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
| AT4G12810 | KIB1 contains an F-box domain at the N-terminal region and three kelch repeats at the C-terminal region. It is expressed ubiquitously and accumulates in the nucleolus and to a lesser extent in the cytoplasm. |
| AT3G50630 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Gene was isolated from a yeast two hybrid screen as an interacting protein of CDC2A. Recombinant protein has a strong kinase inhibitor activity in vitro. Transcript is expressed in all tissues examined but is differentially distributed from ICK1. Controls the onset of the endoreduplication cycle through inhibition of CDKA;1. The KRP2 protein abundance is regulated by proteolysis through CDKB1;1 phosphorylation. |
| AT2G32710 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI). A member of seven KRP genes found in Arabidopsis thaliana. Negative regulator of cell division. Expressed in actively dividing cells. |
| AT3G19150 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type cyclins. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. KRP6 appears to be targeted for degradation by RHF1a and RHF2a to allow mitotic divisions during gametogenesis. In addition, KRP6 transcript levels rise prior to and drop following the meitotic divisions of gametogenesis. Elevated levels of KRP6 negatively affect plant development and fertility. |
| AT1G80440 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB20, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. The mRNA is cell-to-cell mobile. |
| AT1G15670 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB1, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. |
| AT2G44130 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family. Component of SCF ubiquitin protein ligase, interacts with phenylalanine ammonia-lyase. AtKFB39 is a homolog of previously identified AtKFB50 (At3g59940) and specifically interacts with Arabidopsis PAL3 and PAL4 in vitro. In planta, together with AtKFB01, KFB20 and KFB50, it regulates PAL protein stability thus controlling phenylpropanoid biosynthesis . |
| AT3G59940 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB50, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. The mRNA is cell-to-cell mobile. |
| AT4G08150 | A member of class I knotted1-like homeobox gene family (together with KNAT2). Similar to the knotted1 (kn1) homeobox gene of maize. Normally expressed in the peripheral and rib zone of shoot apical meristem but not in the leaf primordia. It is also expressed in the fourth floral whorl, in the region that would become style, particularly in the cell surrounding the transmitting tissue. No expression was detected in the first three floral whorls. Expression is repressed by auxin and AS1 which results in the promotion of leaf fate. |
| AT1G70510 | A member of class I knotted1-like homeobox gene family (together with KNAT1). Similar to the knotted1 (kn1) homeobox gene of maize. KNAT2 acts synergistically with cytokinins and antagonistically with ethylene based on ectopic expression studies in different mutant backgrounds and hormone treatments. In addition, KNAT2 is negatively regulated by AS and YABBY genes. KNAT2 is strongly expressed in the shoot apex of seedlings, while in mature plants the gene is primarily expressed in flowers and inflorescence stems. |
| AT1G62990 | Encodes a homeodomain transcription factor of the Knotted family. May be involved in secondary cell wall biosynthesis. Mutants have moderately irregular xylem development. Expression of this gene is upregulated by SND1 and MYB46. |
| AT5G11060 | A member of Class II KN1-like homeodomain transcription factors (together with KNAT3 and KNAT5), with greatest homology to the maize knox1 homeobox protein. Expression regulated by light. Detected in all tissues examined, but most prominent in leaves and young siliques. Transient expression of GFP translational fusion protein suggests bipartite localization in nucleus and cytoplasm. KNAT4 promoter activity showed cell-type specific pattern along longitudinal root axis; GUS expression pattern started at the elongation zone, predominantly in the phloem and pericycle cells, extending to endodermis toward the base of the root. |
| AT1G23380 | homeodomain transcription factor KNAT6, belonging to class I of KN transcription factor family (which also includes KNAT1 and KNAT2). Expression is increased in as and bop1 leaf mutants. |
| AT5G14010 | Encodes KNUCKLES (KNU), a C2H2-type zinc finger protein with a conserved transcriptional repression motif. Mediates the repression of WUS in floral meristem determinacy control. |
| AT3G08550 | mutant is Dwarfed and shows defects in cell elongation; Cellulose deficient; Plasma Membrane Protein |
| AT2G46750 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
| AT5G11540 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
| AT5G56490 | D-arabinono-1,4-lactone oxidase family protein;(source:Araport11) |
| AT2G46740 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
| AT5G14760 | At5g14760 encodes for L-aspartate oxidase involved in the early steps of NAD biosynthesis. In contrary to the EC 1.4.3.16 (l-aspartate oxidase - deaminating) the enzyme catalyzes the reaction L-aspartate + O2 = iminoaspartate (alpha-iminosuccinate) + H2O2. Flavoenzyme-encoding gene. |
| AT3G62130 | Encodes an enzyme that decomposes L-cysteine into pyruvate, H2S, and NH3. |
| AT4G33670 | Encodes a L-galactose dehydrogenase, involved in ascorbate biosynthesis |
| AT3G24090 | Encodes a glutamine-fructose-6-phosphate transaminase that likely plays a role in UDP-N-acetylglucosamine biosynthesis. |
| AT3G10050 | first enzyme in the biosynthetic pathway of isoleucine |
| AT5G60270 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G60300 | Encodes a legume-type lectin receptor kinase that is structurally distinct from the mammalian extracellular ATP receptors and acts as an extracellular ATP receptor in Arabidopsis. Extracellular ATP acts as a damage-associated molecular pattern in plants, and its signaling through P2K1 is important for mounting an effective defense response against various pathogenic microorganisms. It also plays a role in cell wall-plasma membrane adhesion. |
| AT2G37710 | Induced in response to Salicylic acid. The mRNA is cell-to-cell mobile. |
| AT4G02410 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G10530 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G65600 | L-type lectin receptor kinase which modulates metabolites and abiotic stress responses. Phosphorylates AvrPtoB which in turn reduces its virulence. |
| AT1G15530 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G32800 | protein kinase family protein;(source:Araport11) |
| AT5G55830 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G43700 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G53380 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G03140 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G66100 | Encodes a LAM domain containing protein that is involved in leaf senescence. |
| AT1G18140 | putative laccase, a member of laccase family of genes (with 17 members in Arabidopsis). |
| AT2G29130 | Putative laccase, knockout mutant had reduced root elongation under PEG-induced dehydration.miR397b regulates root lignin deposition by regulating LACCASE2 expression during drought and phosphate deficiency. |
| AT3G25540 | Encodes a ceramide synthase that together with LOH3 is essential for production of ceramides containing Very Long Chain Fatty acid VLCFA-Ceramides(mainly C 22 to 26). |
| AT1G15420 | Encodes a novel plant specific protein that is co-expressed with components of pre-rRNA processing complex. Co-localizes with NuGWD1 and SWA1. |
| AT1G01060 | LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1 |
| AT1G01470 | Encodes late-embryogenesis abundant protein whose mRNA levels are induced in response to wounding and light stress. Might be involved in protection against desiccation. |
| AT2G35300 | Encodes LEA4-2/LEA18, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. |
| AT2G44060 | Late embryogenesis abundant protein, group 2;(source:Araport11) |
| AT2G46140 | Late embryogenesis abundant protein;(source:Araport11) |
| AT1G32560 | Encodes LEA4-1, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. |
| AT5G06760 | Encodes LEA4-5, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. Most of the diverse set of LEA proteins can be grouped according to properties such as high hydrophilicity and high content of glycine or other small amino acids in what has been termed hydrophilins. LEA4-5 protects enzyme activities from the adverse effects induced by freeze-thaw cycles in vitro. |
| AT1G52690 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT3G21420 | LATERAL BRANCHING OXIDOREDUCTASE (LBO), encodes an oxidoreductase-like enzyme of the 2-oxoglutarate and Fe(II)-dependent dioxygenase superfamily. It is involved in the biosynthesis of strigolactones. |
| AT5G63090 | Involved in lateral organ development |
| AT3G58190 | This gene contains two auxin-responsive element (AuxRE). Required for triggering cell reprogramming during callus formation. |
| AT5G12330 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Expressed in lateral root primordia and induced by auxin. SWP1 is involved in the repression of LRP1 via histone deacetylation. |
| AT1G55580 | Encodes a member of the GRAS family of putative transcriptional regulators. It is involved in the initiation of axillary meristems during both the vegetative and reproductive growth phases and functions upstream of REV and AXR1 in the regulation of shoot branching. |
| AT1G77220 | LAZ1H1 is a DUF300 that is localized to the tonoplast. Along with LAZ1 it appears to play a role in maintaining the structural integrity of vacuoles and regulating BR signaling by modulating downstream subcellular distribution of BAK1. |
| AT4G38360 | LAZ1 is a DUF300 domain protein that appears to function in vacuolar transport effecting brassinosteroid and programmed cell dealth signaling pathways. |
| AT1G67360 | Encodes a small rubber particle protein homolog. Plays dual roles as positive factors for tissue growth and development and in drought stress responses. |
| AT2G47780 | Encodes a small rubber particle protein homolog. Plays dual roles as positive factors for tissue growth and development and in drought stress responses. |
| AT5G16550 | Lipid droplet protein associated with LDAP3. |
| AT1G27340 | Encodes a putative F-box protein that is involved in the regulation of leaf morphology. |
| AT1G18390 | Serine/Threonine kinase family catalytic domain protein;(source:Araport11) |
| AT5G38210 | Protein kinase family protein;(source:Araport11) |
| AT5G61850 | Encodes transcriptional regulator that promotes the transition to flowering.Involved in floral meristem development. LFY is involved in the regulation of AP3 expression, and appears to bring the F-box protein UFO to the AP3 promoter. Amino acids 46-120 define a protein domain that mediates self-interaction. |
| AT3G03310 | lecithin:cholesterol acyltransferase 3;(source:Araport11) |
| AT5G01560 | Encodes LecRKA4.3, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. |
| AT4G20380 | LSD1 monitors a superoxide-dependent signal and negatively regulates a plant cell death pathway. contains zinc-finger motifs. LSD1 negatively regulates a basal defense pathway that can act upstream or independently of both NIM1/NPR1 function and SA accumulation following avirulent or virulent pathogen challenge |
| AT1G02050 | Chalcone and stilbene synthase family protein;(source:Araport11) |
| AT5G16590 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G59820 | LETM1-like protein;(source:Araport11) |
| AT3G24480 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT4G18670 | Leucine rich extensin protein involved in cell wall biogenesis and organization. Interacts with several members of the RALF family of ligand peptides. |
| AT1G07650 | Leucine-rich repeat receptor-like kinase with extracellular malectin-like domain, which possesses cell death induction activity in plant leaves. |
| AT4G33970 | Pollen expressed protein required for pollen tube growth.Along with other members of the LRX family, itnteracts with RALF4 to control pollen tube growth and integrity. Loss of function results in premature pollen tube rupture and reduced fertility. |
| AT1G62440 | encodes a paralog of LRX1 (LEUCINE-RICH REPEAT/EXTENSIN 1) which acts synergistically with LRX1 in root hair cell morphogenesis. |
| AT4G13340 | Leucine rich extensin protein involved in cell wall biogenesis and organization. Interacts with several members of the RALF family of ligand peptides. |
| AT1G49490 | Pollen expressed protein required for pollen tube growth.Along with other members of the LRX family, itnteracts with RALF4 to control pollen tube growth and integrity. Loss of function results in premature pollen tube rupture and reduced fertility. |
| AT4G22880 | encodes leucoanthocyanidin dioxygenase, which is involved in proanthocyanin biosynthesis. Mutant analysis suggests that this gene is also involved in vacuole formation. |
| AT4G32551 | LEUNIG regulates floral organ identity,gynoecium and ovule development. Negatively regulates AGAMOUS . Encodes a glutamine-rich protein with seven WD repeats similar to transcriptional corepressors. |
| AT4G00830 | Encodes a heterogeneous nuclear ribonucleoprotein (hnRNP-Q) that is involved in the plant innate immune response and may function as a suppressor of cell-autonomous immunity. |
| AT5G02840 | Encodes RVE4, a homolog of the circadian rhythm regulator RVE8. rve4 rve6 rve8 triple mutants display an extremely long circadian period, with delayed and reduced expression of evening-phased clock genes. Involved in heat shock response. |
| AT4G14730 | Stress induced membrane protein. Mutants show enhanced cell death under stress. |
| AT4G02690 | Stress induced membrane protein. Mutants show enhanced cell death under stress. |
| AT4G15470 | Bax inhibitor-1 family protein;(source:Araport11) |
| AT5G01530 | light harvesting complex photosystem II;(source:Araport11) |
| AT3G08940 | Lhcb4.2 protein (Lhcb4.2, protein involved in the light harvesting complex of photosystem II The mRNA is cell-to-cell mobile. |
| AT2G40100 | Lhcb4:3 protein (Lhcb4.3, light harvesting complex of photosystem II The mRNA is cell-to-cell mobile. |
| AT1G15820 | Lhcb6 protein (Lhcb6), light harvesting complex of photosystem II. |
| AT3G04510 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT2G31160 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT1G07090 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT4G18610 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT3G47470 | Encodes a chlorophyll a/b-binding protein that is more similar to the PSI Cab proteins than the PSII cab proteins. The predicted protein is about 20 amino acids shorter than most known Cab proteins. |
| AT2G34430 | Photosystem II type I chlorophyll a/b-binding protein The mRNA is cell-to-cell mobile. |
| AT1G76570 | Chlorophyll A-B binding family protein;(source:Araport11) |
| AT5G47110 | Encodes a light-harvesting-like protein that is involved in chlorophyll and tocopherol biosynthesis anchoring geranylgeranyl reductase in the thylakoid membrane. |
| AT1G78600 | light-regulated zinc finger protein 1;(source:Araport11) |
| AT2G46260 | Involvement in protein ubiquitylation is predicted based on physical interaction with CULLIN 3 proteins. LRBs physically interact with photoexcited and phosphorylated CRY2, at the CCE domain of CRY2, to facilitate polyubiquitination and degradation of CRY2 in response to blue light. |
| AT5G19740 | LAMP is an AMP paralog that overlaps in expression within the vascular system. Along with LAMP it suppresses meristem activity within the peripheral zone of the shoot apical meristem. LAMP is localized to the endoplasmic reticulum. |
| AT1G77690 | Encodes an auxin influx carrier LAX3 (Like Aux1) that promotes lateral root emergence. Auxin-induced expression of LAX3 in turn induces a selection of cell-wall-remodelling enzymes, which are likely to promote cell separation in advance of developing lateral root primordia. |
| AT5G01240 | Encodes LAX1 (LIKE AUXIN RESISTANT), a member of the AUX1 LAX family of auxin influx carriers. Required for the establishment of embryonic root cell organization. |
| AT2G21050 | Encodes LAX2 (LIKE AUXIN RESISTANT), a member of the AUX1 LAX family of auxin influx carriers. Required for the establishment of embryonic root cell organization. |
| AT1G43130 | like COV 2;(source:Araport11) |
| AT3G01510 | Encodes a putative phosphatase, LSF1, required for normal starch turnover in leaves. |
| AT1G15080 | Encodes phosphatidic acid phosphatase. Involved in ABA signaling. Functions as a negative regulator upstream of ABI4. Expressed during germination and seed development. Expressed overall in young seedlings, in roots, hypocotyls, and vascular cells of cotyledons and leaves of 10 day-old seedlings, in flower filaments and stem elongation zones. Not expressed in anthers, pollen nor petals. |
| AT3G50920 | Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene (LPPepsilon1) and LPPepsilon2, appear to be less important for diacylglycerol formation in the plastids than LPPgamma. |
| AT5G03080 | Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene, LPPgamma appears to be more important for diacylglycerol formation than LPPepsilon1 and LPPepsilon2 in the plastids. Heterozygous lppgamma mutants produce pollen that have defects in pollen tube germination and no homozygous mutants have been recovered. The mRNA is cell-to-cell mobile. |
| AT2G38530 | Involved in lipid transfer between membranes and plays a role in maintaining the integrity of the cuticle-cell wall interface. Belongs to a family of Lipid transfer proteins. Sequence similarity to other plant/Arabidopsis LPT genes but highest similarity to LPT1. Stress and pathogen-inducible motifs found in the upstream region. Expressed in flower, leaves and siliques but absent in roots. Predicted to be a member of PR-14 pathogenesis-related protein family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT5G59320 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. The mRNA is cell-to-cell mobile. |
| AT4G21220 | Trimeric LpxA-like enzymes superfamily protein;(source:Araport11) |
| AT1G67560 | PLAT/LH2 domain-containing lipoxygenase family protein;(source:Araport11) |
| AT5G08415 | Radical SAM superfamily protein;(source:Araport11) |
| AT1G67230 | Encodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
| AT1G13220 | Encodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
| AT5G65770 | Encodes a protein that localizes to the nuclear periphery and affects nuclear morphology. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
| AT2G45450 | ZPR1, a small leucine zipper-containing protein that interacts with REV HD-ZIPIII and is involved in the establishment of leaf polarity. |
| AT4G30980 | Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair and sperm cell development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3). |
| AT5G58010 | Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3). |
| AT2G28500 | LOB domain-containing protein 11;(source:Araport11) |
| AT2G45420 | LOB domain-containing protein 18;(source:Araport11) |
| AT4G00210 | LOB domain-containing protein 31;(source:Araport11) |
| AT5G06080 | LOB domain-containing protein 33;(source:Araport11) |
| AT5G67420 | Encodes a LOB-domain protein involved in nitrogen metabolism and affecting leaf morphogenesis. |
| AT3G49940 | LOB domain-containing protein 38;(source:Araport11) |
| AT1G31320 | LOB domain-containing protein 4;(source:Araport11) |
| AT1G67100 | LOB domain-containing protein 40;(source:Araport11) |
| AT3G02550 | LOB domain-containing protein 41;(source:Araport11) |
| AT2G19820 | LOB domain-containing protein 9;(source:Araport11) |
| AT1G10920 | Encodes LOV1, a disease susceptibility gene that, paradoxically, is a member of the NBS-LRR resistance gene family. Conditions susceptibility to the fungus Cochliobolus victoriae and victorin-dependent induction of defense-associated proteins. Saturation mutagenesis identified 59 lov mutations that all display reduced susceptibility to vitorin. Mutations in known defense response pathways do not prevent susceptibility to C. victoriae. |
| AT1G19740 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
| AT5G47040 | Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins. |
| AT2G35990 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT4G35190 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT5G06300 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT5G11950 | Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At2G37210. |
| AT1G64625 | Encodes a plant-specific basic helix-loop-helix (bHLH) protein that is required for normal meiotic entry and the establishment of meiotic synchrony. It plays a role in xylem differentiation downstream of auxin. |
| AT3G55850 | Encodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids. |
| AT1G77590 | Encodes major plastidic long chain acyl-CoA synthetase with a slight substrate preference of oleic acid over any of the other fatty acids. |
| AT5G23670 | Encodes the LCB2 subunit of serine palmitoyltransferase, an enzyme involved in sphingosine biosynthesis. The protein is localized to the endoplasmic reticulum. |
| AT1G02340 | Encodes a light-inducible, nuclear bHLH protein involved in phytochrome signaling. Mutants exhibit a long-hypocotyl phenotype only under far-red light but not under red light and are defective in other phytochrome A-related responses. Mutants also show blue light response defects. HFR1 interacts with COP1, co-localizes to the nuclear specks and is ubiquinated by COP1. |
| AT2G02450 | NAC domain containing protein 35;(source:Araport11) |
| AT1G49430 | Encodes a long chain acyl-CoA synthetase that catalyzes the synthesis of omega-hydroxy fatty acyl-CoA intermediates in the pathway to cutin synthesis. Required for repression of lateral root formation. |
| AT2G04350 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT5G23450 | Encodes a sphingosine kinase that specifically phosphorylates D-erythro-dihydrosphingosine (DHS), but not N-acetyl-DHS or D-threo-DHS. It also also phosphorylates D-erythro-sphingosine, trans-4, trans-8-sphingadienine and phytosphingosine. |
| AT2G46090 | Encodes a putative sphingosine kinase (SphK) containing the five conserved domains (C1-C5) previously identified in SphKs. |
| AT4G36480 | Encodes the LCB1 subunit of serine palmitoyltransferase. Together with the LCB2 subunit, forms a functional serine palmitoyltransferase complex, which catalyzes the first reaction of sphingolipid biosynthesis. Knockout of LCB1 was embryo lethal. Partial suppression of LCB1 expression led to smaller plants due to reduced cell expansion. |
| AT3G02170 | Encodes LONGIFOLIA2 (LNG2). Regulates leaf morphology by promoting cell expansion in the leaf-length direction. The LNG2 homologue LNG1 (At5g15580) has similar function. |
| AT5G56170 | LORELEI-LIKE-GPI-ANCHORED PROTEIN 1;(source:Araport11) |
| AT2G30575 | Encodes a protein with putative galacturonosyltransferase activity. Required for synthesis of native homogalacturonan in growing pollen tubes; critical role in pollen tube growh and male fertility. |
| AT3G09770 | Encodes a ubiquitin E3 ligase LOG2 (LOSS OF GDU2). Required for GLUTAMINE DUMPER1(GDU1)-induced amino secretion. |
| AT4G34120 | Encodes a single cystathionine beta-Synthase domain-containing protein. Modulates development by regulating the thioredoxin system. The mRNA is cell-to-cell mobile. |
| AT4G36910 | Encodes a single cystathionine beta-synthase domain-containing protein. Modulates development by regulating the thioredoxin system. |
| AT5G16500 | Encodes a receptor-like cytoplasmic kinase localized in the membrane of pollen tube tip regions that controls micropylar pollen tube guidance in Arabidopsis. |
| AT3G02810 | Encodes a receptor-like cytoplasmic kinase localized in the membrane of pollen tube tip regions that controls micropylar pollen tube guidance in Arabidopsis. |
| AT1G73060 | Low PSII Accumulation 3;(source:Araport11) |
| AT1G71040 | Encodes LPR2. Function together with LPR1 (AT1G23010) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
| AT1G05385 | Encodes a Psb27 homolog involved in photosystem II biogenesis. |
| AT1G75690 | Thylakoid Thiol/Disulfide-Modulating Protein. |
| AT3G50970 | Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. LTI29 and LTI30 double overexpressors confer freeze tolerance. Located in membranes. mRNA upregulated by water deprivation and abscisic acid. The mRNA is cell-to-cell mobile. |
| AT5G47010 | Required for nonsense-mediated mRNA decay. Involved in RNA interference. lba1 mutants has reduced sugar-induced expression of Atb- amylase, is hypersensitive to glucose and abscisic acid and resistant to mannose, and shows early flowering, short day-sensitive growth, and seed germination phenotypes. The mRNA is cell-to-cell mobile. |
| AT5G48543 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G15535 | low-molecular-weight cysteine-rich 10;(source:Araport11) |
| AT1G28335 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G28405 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G07005 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G48231 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G20208 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT1G73607 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT1G61070 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT2G02100 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. The mRNA is cell-to-cell mobile. |
| AT5G52300 | Encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and desiccation. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. Upregulation by P. polymyxa CR1 increases drought resistance. |
| AT5G52310 | cold regulated gene, the 5' region of cor78 has cis-acting regulatory elements that can impart cold-regulated gene expression The mRNA is cell-to-cell mobile. |
| AT1G32540 | Encodes a protein with 3 plant-specific zinc finger domains that acts as a positive regulator of cell death. |
| AT3G13682 | Encodes a homolog of human Lysine-Specific Demethylase1. Involved in H3K4 methylation of target genes including the flowering loci FLC and FWA. |
| AT4G35760 | Encodes a bimodular enzyme comprising an integral domain homologous to the catalytic subunit of mammalian vitamin K epoxide reductase (VKORC1, EC 1.1.4.1) that is fused to a soluble thioredoxin-like moiety. Using yeast microsomes as a recombinant system, it was shown that the VKORC1 domain of At4g35760 functions as a stringent naphthoquinone reductase, and that its reduced Trx-like partner can serve as its electron donor. Located in plastid. Required for the assembly of photosystem II. Can catalyze disulfide bond formation in vitro. |
| AT4G31080 | Encodes one of two LUNAPARK proteins in Arabidopsis. Both LNPA and LNPB are predominantly distributed throughout the ER, but not preferentially localized at the three-way junctions. Mutation of both LNPA and LNPB together caused the cortical ER to develop poor ER cisternae and a less dense tubular network. E3 ligase involved in degradation of RHD3 to maintain a tubular ER network. |
| AT1G78970 | Lupeol synthase. Converts oxidosqualene to multiple triterpene alcohols and a triterpene diols. This conversion proceeds through the formation of a 17β-dammarenyl cation. |
| AT1G78960 | Encodes a multifunctional 2-3-oxidosqualene (OS)-triterpene cyclase that can cyclize OS into lupeol, alpha- and beta-amyrin. |
| AT5G57030 | Lutein-deficient 2 (LUT2) required for lutein biosynthesis, member of the xanthophyll class of carotenoids. Encodes lycopene epsilon cyclase |
| AT2G32640 | Encodes a lycopene beta cyclase that catalyzes the addition of beta-ionone end groups to the end of lycopene molecules. |
| AT1G77630 | Encodes a lysin-motif protein mediating bacterial peptidoglycan sensing and immunity to bacterial infection. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. It contains a C-terminal GPI anchor signal and is an ortholog of OsLYP4 and OsLYP6. |
| AT3G01760 | Encodes an amino acid transporter expressed in the root that is involved in the uptake of acidic amino acids, glutamine and alanine, and probably phenylalanine. |
| AT4G33150 | This is a splice variant of the LKR/SDH locus. It encodes a bifunctional polypeptide lysine-ketoglutarate reductase and saccharopine dehydrogenase involved in lysine degradation. There is another splice variant that encodes a mono saccharopine dehydrogenase protein. Gene expression is induced by abscisic acid, jasmonate, and under sucrose starvation. |
| AT3G14840 | Encodes LRR-RLK protein that is localized to the plasma membrane and is involved in regulation of plant innate immunity to microbes. LIK1 is phosphorylated by CERK1, a kinase involved in chitin perception. The mRNA is cell-to-cell mobile. |
| AT2G17120 | Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. It contains a C-terminal GPI anchor signal and is an ortholog of OsCEBiP. |
| AT3G01840 | Encodes a putative LysM-containing receptor-like kinase. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. Based on protein sequence alignment analysis, it was determined to be a pseudo kinase since lack of the ATP-binding P-loop in the kinase domain. |
| AT1G51940 | Encodes a LysM-containing receptor-like kinase. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. Based on protein sequence alignment analysis, it has a typical RD signaling domain in its catalytic loop and possesses autophosphorylation activity.It is required for the suppression of defense responses in absence of pathogen infection or upon abscisic acid treatment. Loss-of-function mutants display enhanced resistance to Botrytis cinerea and Pectobacterium carotovorum. Its expression is repressed by pathogen infection and biological elicitors and is induced abscisic acid.Expression is strongly repressed by elicitors and fungal infection, and is induced by the hormone abscisic acid (ABA). Insertional mutants show increased expression of PHYTOALEXIN-DEFICIENT 3 (PAD3), enhanced resistance to Botrytis cinerea and Pectobacterium carotovorum infection and reduced physiological responses to ABA, suggesting that LYK3 is important for the cross-talk between signaling pathways activated by ABA and pathogens (PMID:24639336). |
| AT2G23770 | Encodes a putative LysM-containing receptor-like kinase LYK4. Shares overlapping function with LYK5 in mediating chitin-triggered immune responses. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain. |
| AT1G75020 | lysophosphatidyl acyltransferase 4;(source:Araport11) |
| AT3G18850 | lysophosphatidyl acyltransferase 5;(source:Araport11) |
| AT2G45670 | Encodes an acyl-CoA: lysophosphatidylethanolamine acyltransferase with 20:0-CoA being the best acyl donor. Mutations adversely affect the growth of plants and result in decreased lipid content in roots and seeds. |
| AT1G12640 | Encodes a lysophosphatidylcholine acyltransferase (LPCAT). Participates in the Lands cycle in developing seeds. |
| AT5G04710 | Plastid localized metalloaminopeptidase. |
| AT5G63190 | Encodes a member of the MRF (MA3 DOMAIN-CONTAINING TRANSLATION REGULATORY FACTOR) gene family under TOR control that is transcriptionally induced by dark and starvation. MRF1 can be phosphorylated in vitro by S6K1 and S6K2. |
| AT1G22730 | MA3 domain-containing protein;(source:Araport11) |
| AT3G48390 | MA3 domain-containing protein;(source:Araport11) |
| AT5G65060 | MADS domain protein - flowering regulator that is closely related to FLC |
| AT5G65070 | Encodes MADS-box containing FLC paralog. Five splice variants have been identified but not characterized with respect to expression patterns and/or differing function. Overexpression of the gene in the Landsberg ecotype leads to a delay in flowering, transcript levels of MAF4 are reduced after a 6 week vernalization. |
| AT5G65080 | Is upregulated during vernalization and regulates flowering time. Encodes MADS-domain protein. Two variants encoding proteins of 198 and 184 amino acids have been reported. |
| AT5G22830 | Transmembrane magnesium transporter that is essential for chloroplast development and photosynthesis. One of nine family members. |
| AT1G16010 | Transmembrane magnesium transporter. One of nine family members. |
| AT2G03620 | Transmembrane magnesium transporter. One of nine family members. |
| AT4G25080 | Encodes a protein with methyltransferase activity responsible for the methylation of magnesium protoporphyrin IX. Mutants defective in this gene are affected in chlorophyll biosynthesis and show a reduction in the accumulation of a number of major thylakoid-associated proteins including components of PSI (LHCI), PSII (LHCII, D1, CP43) and the cytochrome b6f complex (Cytf). By contrast, no significant changes were detected for the proteins of the stroma and the chloroplast envelope. |
| AT2G47600 | Encodes a magnesium/proton exchanger, member of putative Na+/Ca2+ antiporter gene family |
| AT4G02530 | MPH2 is a green lineage-specific thylakoid lumen protein required for photosynthetic acclimation of PSII to stressful light conditions (PMID:28874535). |
| AT5G07020 | Encodes an integral thylakoid membrane protein that interacts with PSII core complexes and contributes to the maintenance of PSII homeostasis upon exposure to photoinhibitory light conditions by participating in the protection and stabilization of PSII under photoinhibitory stress. |
| AT2G21870 | Encodes the FAd subunit of mitochondrial F1F0-ATP synthase. Essential for pollen formation. |
| AT1G68990 | MGP3 (male gametophyte-defective 3) belongs to a small family of nuclear-encoded Phage type RNA polymerases (RPOTs) involved in the transcription of mitochondrial genes in Arabidopsis thaliana. Mutation in MGP 3 significantly retarded pollen tube growth and caused defective embryo development. |
| AT4G01220 | Encodes MGP4 (MALE GAMETOPHYTE DEFECTIVE 4), a rhamnogalacturonan II xylosyltransferase important for growth of pollen tubes and roots. |
| AT1G66170 | Encodes a PHD-domain containing protein required for male meiosis. Gene is expressed in developing male meiocytes and protein is localized to nuclear euchromatin specifically during diplotene. Required to regulate microtubule organization and cell cycle transitions during male meiosis, and functions as a direct transcription activator of the meiotic gene TDM1. |
| AT1G19890 | histone 3.3, male-gamete-specific expression. Direct target promoter of the male germline-specific transcription factor DUO1. |
| AT1G72250 | Malectin domain kinesin. |
| AT3G10920 | manganese superoxide dismutase (MSD1) |
| AT4G27940 | manganese tracking factor for mitochondrial SOD2;(source:Araport11) |
| AT1G78850 | curculin-like (mannose-binding) lectin family protein, low similarity to ser/thr protein kinase from Zea mays (GI:2598067); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein. Belongs to GNA domain lectin family. Enhances PAP26 function to facilitate Pi-scavenging by Pi-starved plants. |
| AT1G01560 | Member of MAP Kinase family. Flg22-induced activation is blocked by AvrRpt2. |
| AT1G73670 | member of MAP Kinase The mRNA is cell-to-cell mobile. |
| AT2G01450 | MPK17 Map kinase family member. Mutants have increased numbers of peroxisomes a phenotype that can be suppressed by mutations in PMD1. This and other treatments, suggests a function in control of peroxisome proliferation in salt stress. |
| AT3G14720 | member of MAP Kinase The mRNA is cell-to-cell mobile. |
| AT2G42880 | member of MAP Kinase |
| AT4G11330 | MAP kinase |
| AT2G18170 | MAP kinase 7;(source:Araport11) |
| AT3G18040 | Encodes a protein with similarity to MAP kinases (MAPK9).Expressed preferentially in guard cells and appears to be involved in reactive oxygen species mediated ABA signaling. |
| AT3G21220 | Encodes a mitogen-activated kinase kinase, dual specific protein kinase that is expressed in vegetative tissues and floral buds. Involved in innate immunity. This protein activates MPK3/MPK6 and early-defense genes redundantly with MKK4. In plants with both MKK5 and MKK4 levels reduced by RNAi plants, floral organs do not abscise suggesting a role for both proteins in mediating floral organ abscission.MKK5 is part of a positive feedback loop that regulates HAE expression in floral receptacles. |
| AT5G56580 | Encodes a member of the MAP Kinase Kinase family of proteins. It can phosphorylate MPK12 in vitro and it can be dephosphorylated by MKP2 in vitro. |
| AT1G73500 | member of MAP Kinase Kinase family. Autophosphorylates and also phosphorylates MPK3 and MPK6. Independently involved in ethylene and calmalexin biosynthesis. Induces transcription of ACS2, ACS6, ERF1, ERF2, ERF5, ERF6, CYP79B2, CYP79B3, CYP71A13 and PAD3. |
| AT3G18690 | Encodes a nuclear-localized member of a plant specific gene family involved in mediating responses to pathogens. Interacts with WRKY transcriptional regulators. |
| AT1G80180 | Encodes a substrate of the MAPK kinases. Phenotypic analyses of Arabidopsis expressing phosphorylation site mutant forms of At1g80180.1 showed clustered stomata and higher stomatal index in cotyledons expressing the phosphomimetic form of At1g80180.1. Tightly connected with MAPK signaling to fine-tune stomatal production and patterning. |
| AT1G15400 | Tightly connected with MAPK signaling to fine-tune stomatal production and patterning. |
| AT5G20100 | Tightly connected with MAPK signaling to fine-tune stomatal production and patterning. |
| AT3G16000 | Encodes a DNA-binding protein that binds to plastid DNA non-specifically and is associated with nucleoids and thylakoid membranes. The expression of the gene is correlated with the development of thylakoid membranes.MFP1 is required for the normal initiation of starch granules in Arabidopsis chloroplasts. Mutants lacking MFP1 have fewer starch granules per chloroplast relative to wild-type plants. MFP1 interacts with PTST2 (At1g27070), which is also involved in starch granule initiation. MFP1 is required for proper PTST2 location within the chloroplast. |
| AT2G15890 | Encodes CBP1, a regulator of transcription initiation in central cell-mediated pollen tube guidance. |
| AT2G18650 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G35340 | helicase domain-containing protein;(source:Araport11) |
| AT3G02570 | Encodes a protein with phosphomannose isomerase activity. |
| AT4G00060 | Nucleotidyltransferase family protein;(source:Araport11) |
| AT4G01560 | Ribosomal RNA processing Brix domain protein;(source:Araport11) |
| AT4G13345 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
| AT5G45800 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G01280 | Involved in regulation of thermo tolerance. |
| AT2G02240 | F-box family protein;(source:Araport11) |
| AT3G10110 | Mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein;(source:Araport11) |
| AT3G19350 | Encodes a the C-terminal domain of poly(A) binding proteins. MPC is imprinted such that only the maternal allele is expressed in the endosperm. MPC is silenced by the action of MET1 and its expression is promoted by DEM. |
| AT4G34830 | Encodes MRL1, a conserved pentatricopeptide repeat protein, required for stabilization of rbcL mRNA. |
| AT3G59350 | Pti-like protein. Interacts with CLV1 and functions in CLE peptide signaling pathway in root development. Membrane localization is dependent on palmytolation. |
| AT5G23820 | ML3 can be modified by NEDD8 and ubiquitin. ML3 expression is regulated by NAI1. ML3 expression is regulated by MeJA, ethylene and wounding. ml3-3 is more susceptible against infections with Alternaria brassicicola and more resistant against infections with Pseudomonas syringae DC3000. |
| AT4G08850 | MIK1 encodes a receptor kinase that forms a complex with MDIS1/MIK2 and binds LURE1, the female pollen guidance chemi-attractant. MIK1 phosphorylates MDIS1 and is autophosphorylated. |
| AT1G53470 | mechanosensitive channel of small conductance-like 4;(source:Araport11) |
| AT3G14810 | mechanosensitive channel of small conductance-like 5;(source:Araport11) |
| AT1G78610 | mechanosensitive channel of small conductance-like 6;(source:Araport11) |
| AT2G15530 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G34040 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G02580 | Encodes the imprinted gene MEA that belongs to Polycomb Repressive Complex 2 (PRC2) and has a SET domain for methyltransferase activity and is involved in the stable transcriptional silencing of target genes. It negatively regulates seed development in the absence of fertilization. Mutations in this locus result in embryo lethality. MEA is imprinted in the endosperm. The maternal allele is expressed and the paternal allele is silent. MEA is controlled by DEMETER (DME), a DNA glycosylase required to activate MEA expression, and METHYLTRANSFERASE I (MET1), which maintains CG methylation at the MEA locus. MEA is involved in the negative regulation of its own imprinted gene expression; the effect is not only allele-specific but also dynamically regulated during seed development. In the ovule, the MEA transcripts are accumulated at their highest level before fertilization and gradually decrease after fertilization |
| AT1G26665 | Mediator complex, subunit Med10;(source:Araport11) |
| AT3G10820 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT5G09850 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT5G02850 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G63210 | encodes a novel zinc-finger protein with a proline-rich N-terminus, identical to senescence-associated protein SAG102 |
| AT2G03070 | Encodes a subunit of the Mediator complex. Regulates plant defense and flowering. |
| AT4G32450 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G07930 | A member of mei2-like gene family; phylogenetic analysis revealed that it belongs to the fourth clade of mei2-like proteins, with conserved C-terminal RNA recognition motif (RRM) only. |
| AT2G42890 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML2 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. AML2 is expressed during early embryo development (heart and torpedo stage) and predominantly in vegetative organs; no significant accumulation was detected in floral apices. |
| AT5G07290 | AML4 A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML4 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM14. AML4 is expressed during embryo development (heart and torpedo stage) and in vegetative and floral apices. |
| AT5G61960 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML1 is a member of two sister clades of mei2-like gene family, AML1 through AML5 and belongs to the clade named ALM14. AML1 is expressed during early embryo development, particularly along embryonic axis at torpedo stage, in shoot apex (weaker expression) and in the organogenic regions of floral apices. |
| AT1G29400 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML5 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. Among mei2-like genes, AML5 is the transcript with highest frequency of alternative splicing. Expression was detected during embryo development (heart and torpedo stage) and in vegetative and floral apices. |
| AT5G54260 | DNA repair and meiotic recombination protein, component of MRE11 complex with RAD50 and NBS1 |
| AT5G45420 | The gene encodes a MYB transcription factor belons to R2R3-MYB family of transcription factors. Knock-down mutant analysis indicates its role in root hair elongation. |
| AT5G24290 | Vacuolar iron transporter (VIT) family protein;(source:Araport11) |
| AT4G22270 | Encodes a plasma membrane protein involved in the positive regulation of organ size development. Overexpression results in organ size enlargement. |
| AT5G15460 | membrane-anchored ubiquitin-fold protein 2;(source:Araport11) |
| AT1G77870 | membrane-anchored ubiquitin-fold protein 5 precursor;(source:Araport11) |
| AT1G64080 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT5G52900 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT5G54110 | Encodes a highly polar protein with more than 60% hydrophilic amino acid residues that is associated with the plasma membrane. It has limited secondary structure similarity to VAP-33 from Aplysia, which may be involved in membrane trafficking. The mRNA is cell-to-cell mobile. |
| AT4G14965 | membrane-associated progesterone binding protein 4;(source:Araport11) |
| AT2G36900 | member of Membrin Gene Family |
| AT1G79230 | encodes a sulfurtransferase/rhodaneses, which belongs to a group of enzymes widely distributed in all three phyla that catalyze the transfer of sulfur from a donor to a thiophilic acceptor substrate. The protein and transcript levels are NOT affected by senescence or exogenous cyanide, suggesting that sulfurtransferases are involved in cyanide detoxification. |
| AT4G21750 | Encodes a homeobox protein similar to GL2. It is expressed in both the apical and basal daughter cells of the zygote as well as their progeny. Expression is detected starting the two-celled stage of embryo development and is later restricted to the outermost, epidermal cell layer from its inception. Its promoter is highly modular with each region contributing to specific aspects of the gene's spatial and temporal expression. Double mutant analysis with PDF2, another L1-specific gene, suggests that their functions are partially redundant and the absence of both of the genes result in abnormal shoot development. |
| AT3G56100 | Protein kinase expressed in meristematic cells. Phosphorylates AGL24. |
| AT2G31840 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G79340 | Encodes MCP2d, the predominant and constitutively expressed member of type II metacaspases (MCPs). MCP2d plays a positive regulatory role in biotic and abiotic stress-induced programmed cell death (PCD). Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. The mRNA is cell-to-cell mobile. |
| AT1G79310 | Encodes a putative metacaspase. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
| AT3G12100 | Cation efflux family protein;(source:Araport11) |
| AT1G07600 | metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage. |
| AT1G07610 | one of the five metallothioneins (MTs) genes identified in Arabidopsis. MTs are cysteine-rich proteins required for heavy metal tolerance. The mRNA is cell-to-cell mobile. |
| AT3G09390 | metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage |
| AT5G02380 | cysteine-rich protein with copper-binding activity |
| AT3G15353 | metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage |
| AT2G36880 | methionine adenosyltransferase 3;(source:Araport11) |
| AT1G64660 | Encodes a functional methionine gamma-lyase, a cytosolic enzyme catalyzes the degradation of methionine into methanethiol, alpha-ketobutyrate and ammonia. The catabolism of excess methionine is important to methionine homeostasis. The mRNA is cell-to-cell mobile. |
| AT4G29840 | threonine synthase |
| AT3G17390 | S-adenosylmethionine synthetase |
| AT3G01120 | encodes a cystathionine gamma-synthase, which performs the first committed step in methionine biosynthesis. A conserved motif of 13 amino acids in the first exon is required for posttranscriptional autoregulation. This enzyme shares the same substrate as threonine synthase (TS) and its absence transcriptionally affects 8 genes in the genome. |
| AT1G53670 | 1-Cys methionine sulfoxide reductase. |
| AT4G04810 | methionine sulfoxide reductase B4;(source:Araport11) |
| AT4G21850 | methionine sulfoxide reductase B9;(source:Araport11) |
| AT3G03780 | Encodes a cytosolic methionine synthase, involved in methionine regeneration via the activated methyl cycle (or SAM cycle) |
| AT5G17920 | Encodes a cytosolic cobalamin-independent methionine synthase, involved in methionine regeneration via the activated methyl cycle (SAM cycle). The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. The mRNA is cell-to-cell mobile. |
| AT2G23620 | Encodes a protein shown to have carboxylesterase activity, methyl salicylate esterase activity, methyl jasmonate esterase activity, and methyl IAA esterase activity in vitro. MES1 appears to be involved in MeSA hydrolysis in planta. Expression of MES1 can restore systemic acquired resistance in SAR-deficient tobacco plants. This protein does not act on MeGA4, or MEGA9 in vitro. |
| AT3G29770 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
| AT4G09900 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
| AT1G69240 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco but no enzymatic activity has been identified for this protein. |
| AT4G16690 | Encodes a protein shown to have carboxylesterase activity, methyl IAA esterase activity, and methyl jasmonate esterase activity in vitro. This protein does not act on MeSA, MeGA4, or MEGA9 in vitro. Although MES16 is similar to MES17, a MeIAA hydrolase, two mes16 mutant lines (SALK_151578) and (SALK_139756) do not show altered sensitivity to MeIAA in root growth assays. MES16 transcripts appear to be more than 10-fold less abundant than those of MES17 in roots. |
| AT2G23610 | Encodes a protein shown to have carboxylesterase activity, methyl IAA esterase activity, and methyl jasmonate esterase activity in vitro. This protein does not act on methyl salicylate, MeGA4, or MEGA9 in vitro. |
| AT4G22745 | Protein containing methyl-CpG-binding domain. |
| AT1G15340 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT3G15790 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT3G63030 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT5G59380 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. The mRNA is cell-to-cell mobile. |
| AT1G22310 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT3G01460 | Encodes a protein with a methyl-CpG-binding domain. Has sequence similarity to human MBD proteins. Involved in the modification of the FLC chromatin acetylation state to affect FLC expression. Mutants show an early flowering, and enhanced shoot branching phenotypes. |
| AT3G46580 | Protein containing a putative methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT3G12290 | MTHFD1 encodes a cytoplasmic bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase that is involved in one carbon metabolism and control of DNA methylation. |
| AT3G59970 | methylenetetrahydrofolate reductase MTHFR1 mRNA, complete |
| AT4G34840 | Encodes one of the 5'-methylthioadenosine nucleosidases (AT4G38800/MTN1; AT4G34840/MTN2). Double mutant, mtn1-1mtn2-1, retains approximately 14% of the MTN enzyme activity present in the wild type and displays a pleiotropic phenotype that includes altered vasculature and impaired fertility. |
| AT3G54250 | Encodes mevalonate diphosphate decarboxylase, the enzyme that catalyzes the synthesis of isopentenyl diphosphate, used in sterol and isoprenoid biosynthesis. |
| AT4G30972 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC |
| AT5G10945 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC |
| AT5G55835 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAAAGAGAGCAC |
| AT3G10745 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCCCAAAUGUAGACAAAGCA. Pri-mRNA coordinates for MIR158a (converted to TAIR10 based on PMID19304749): Chr3: 3366553-3366019 (reverse), length: 535 bp; exon coordinates: exon 1: 3366553 to 3366303, exon 2: 3366185 to 3366019; mature miRNA and miRNA* are located on exon 1. |
| AT1G73687 | Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUUGGAUUGAAGGGAGCUCUA. Functions redundantly with MIR159B. Plants that are doubly mutated for MIR159AB have curled leaves and reduced stature. Pri-mRNA coordinates for MIR159a (converted to TAIR10 based on PMID19304749): Chr1: 27713700-27712893 (reverse), length: 808 bp; exon coordinates: exon 1: 27713700 to 27712893, mature miRNA and miRNA* are located on exon 1. |
| AT5G46845 | Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA |
| AT5G23065 | Encodes a microRNA that targets DCL1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGAUAAACCUCUGCAUCCAG |
| AT1G66725 | Encodes a microRNA that targets several SAMT family members. miR163, is highly expressed in A. thaliana diploids but down-regulated in A. thaliana autotetraploids and repressed in A. arenosa and A. suecica. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGAAGAGGACUUGGAACUUCGAU |
| AT5G01747 | Encodes a microRNA that targets several genes containing NAC domains including NAC1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets ORE1 to negatively regulate the timing of leaf senescence. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCA |
| AT2G46685 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. This particular miRNA is involved in the regulation of vascular development in inflorescence stems, primarily through the regulation of mRNA cleavage of the class III homeodomain-leucine zipper transcription factor ATHB15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC. Pri-mRNA coordinates for MIR166a (converted to TAIR10 based on PMID19304749): Chr2: 19175959-19177071 (forward), length: 1113 bp; exon coordinates: exon 1: 19175959 to 19176341, exon 2: 19176820 to 19177071; mature miRNA and miRNA* are located on exon 1. |
| AT5G08717 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC |
| AT3G04765 | Encodes a microRNA that targets ARF family members ARF6 and ARF8. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UAAGCUGCCAGCAUGAUCUUG |
| AT1G31173 | Encodes a microRNA that targets ARF family members ARF6 and ARF8. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAAGCUGCCAGCAUGAUCUGG |
| AT4G19395 | Encodes a microRNA that targets AGO1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCGCUUGGUGCAGGUCGGGAA. MIR168a is highly expressed and predominantly produces a 21-nt miR168 species. By contrast, MIR168b is expressed at low levels and produces an equal amount of 21- and 22-nt miR168 species. Only the 21-nt miR168 is preferentially stabilized by AGO1, and consequently, the accumulation of the 22-nt but not the 21-nt miR168 is reduced when DCL1 activity is impaired. mir168a mutants with strongly reduced levels of 21-nt miR168 are viable but exhibit developmental defects, particularly during environmentally challenging conditions. |
| AT5G45307 | Encodes a microRNA that targets AGO1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGCUUGGUGCAGGUCGGGAA. MIR168a is highly expressed and predominantly produces a 21-nt miR168 species. By contrast, MIR168b is expressed at low levels and produces an equal amount of 21- and 22-nt miR168 species. Only the 21-nt miR168 is preferentially stabilized by AGO1, and consequently, the accumulation of the 22-nt but not the 21-nt miR168 is reduced when DCL1 activity is impaired. mir168a mutants with strongly reduced levels of 21-nt miR168 are viable but exhibit developmental defects, particularly during environmentally challenging conditions. |
| AT3G13405 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: CAGCCAAGGAUGACUUGCCGA |
| AT5G66045 | Encodes a microRNA that targets several SCL family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAUUGAGCCGUGUCAAUAUC |
| AT2G28056 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AGAAUCUUGAUGAUGCUGCAU. Pri-mRNA coordinates for MIR172a (converted to TAIR10 based on PMID19304749): Chr2: 11943611-11941515 (reverse), length: 2097 bp; exon coordinates: exon 1: 11943611 to 11942837, exon 2: 11942688 to 11942600, exon 3: 11941905 to 11941515; mature miRNA and miRNA* are located on exon 1. |
| AT2G10606 | Encodes a microRNA that targets several GRF family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCCACAGCUUUCUUGAACUG. miR396 expression increased with leaf development, antagonizing with expression of GRFs. Transcript accumulates in the distal zone of young developing seeds, restricing the expression of GRF2 to the proximal part. miR396 attenuates cell proliferation in developing leaves through the repression of GRF activity and a decrease in the expression of cell cycle genes. |
| AT5G35407 | Encodes a microRNA that targets several GRF family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCCACAGCUUUCUUGAACUU. Expression increased with leaf development, antagonizing with expression of GRFs. Transcript accumulates in the distal zone of young developing seeds, restricing the expression of GRF2 to the proximal part. miR396 attenuates cell proliferation in developing leaves through the repression of GRF activity and a decrease in the expression of cell cycle genes. |
| AT2G03445 | Encodes a microRNA that targets both CSD and CytC oxidase family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGUGUUCUCAGGUCACCCCUU. Down-regulated by biotic and abiotic stress. |
| AT5G62162 | Encodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCAAAGGAGAGUUGCCCUG |
| AT1G31358 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:ATTAACGCTGGCGGTTGCGGCAGC |
| AT2G47015 | Encodes a microRNA that targets both a Laccase and Plantacyanin-like family member. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AUGCACUGCCUCUUCCCUGGC |
| AT1G70645 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UACGCAUUGAGUUUCGUUGCU |
| AT2G22496 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUCUGCUAUGUUGCUGCUCAU |
| AT4G14811 | Encodes a microRNA that targets CHX18. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUCUUCGUGAAUAUCUGGCA |
| AT5G03552 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGCGGGAAGCAUUUGCACAUG |
| AT3G13724 | Encodes a microRNA that targets CMT3. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGGUGGUGAUCAUAUAAGAU |
| AT4G24415 | Encodes a microRNA that targets AGL16. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UAGACCAUUUGUGAGAAGGGA |
| AT2G26211 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUCUCAAGAAGGUGCAUGAAC |
| AT4G03039 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UAGUCCGGUUUUGGAUACGUG |
| AT5G08210 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGUAGCAGUAGCGGUGGUAA |
| AT3G23326 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCCCCUCUUUAGCUUGGAGAAG |
| AT5G52797 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UAAUUUGGUGUUUCUUCGAUC |
| AT5G46795 | microspore-specific promoter 2;(source:Araport11) |
| AT1G23060 | hypothetical protein;(source:Araport11) |
| AT3G47690 | Encodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis. |
| AT2G35630 | Member of the MAP215 family of microtubule-associated proteins required to establish interphase arrays of cortical microtubules.Mutants have defects in cytokinesis during pollen development. Vegetative phenotypes observed in temperature sensitive mutants include left-handed organ twisting, isotropic cell expansion and impairment of root hair polarity. The mRNA is cell-to-cell mobile. |
| AT5G44610 | Encodes a protein with seven repeated VEEKK motifs. RNAi and overexpression experiments suggest that the gene is not involved in cell division but might be consequential for cell shape of epidermal and cortical cells. The protein encoded by this gene binds to cortical microtubules and inhibits tubulin polymerization. Associates to the plasma membrane and interacts with calmodulin and phosphatidylinositol phosphates, indicating an involvement in cellular signal transduction. Expression is enhanced by abiotic and hormonal factors. Induced during senescence.Interacts with Ca2+/calmodulin complex, phosphatidylinositol phosphates, and free Ca2+. |
| AT4G26760 | microtubule-associated protein 65-2;(source:Araport11) |
| AT3G60840 | Encodes MAP65-4, a non-motor microtubule associated protein (MAP) that belongs to the evolutionarily conserved MAP65 family. MAP65-4 specifically associates with the forming mitotic spindle during prophase and with the kinetochore fibers from prometaphase to the end of anaphase. MAP65-4 cross-links microtubules and promotes microtubule bundle elongation. |
| AT5G62250 | microtubule-associated protein 65-9;(source:Araport11) |
| AT1G68060 | Encodes a microtubule associated protein (MAP70-1). Expressed in all tissues. |
| AT1G24764 | Member of the MAP70 protein family. |
| AT1G14840 | Encodes a microtubule associated protein (MAP70-4). Expressed in all tissues. |
| AT3G51660 | Chemokine-like MDL protein; modulate flowering time and innate immunity in plants. |
| AT2G39200 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in root tips and cotyledon vascular system, in floral organs (anthers and stigma), and in fruit abscission zone, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G11310 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO2 belongs to the clade IV, with AtMLO3, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in roots, in vascular system of cotyledons and young leaves,and in fruit abscission zone; it was not expressed in anthers and pollen, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). mlo resistance in A. thaliana does not involve the signaling molecules ethylene, jasmonic acid or salicylic acid, but requires a syntaxin, glycosyl hydrolase and ABC transporter. It is a novel virulence target of the P. syringae type III secreted effector HopZ2. |
| AT1G11000 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO4 belongs to the clade I, with AtMLO11 and AtMLO14. The gene is expressed during early seedling growth, in roots and lateral root primordia, in flower and fruit abscission zone, in vascular system of root, cotyledons and young leaves, it was not expressed in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT2G17430 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. Controls pollen tube reception in synergids. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO7 belongs to the clade III, with AtMLO5, AtMLO8, AtMLO9, and AtMLO10. The gene is expressed in vegetative organs (RT-PCR experiments)and in pollen grains, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G18835 | Encodes a small zinc finger protein whose overexpression induces ectopic meristem formation on leaf margins. |
| AT2G20980 | Similar to MCM10, which in other organism was shown to be involved in the initiation of DNA replication. |
| AT2G16440 | Regulates DNA replication via interaction with BICE1 and MCM7. |
| AT3G09660 | Encodes a minichromosome maintenance protein that is involved with RAD51 in a backup pathway that repairs meiotic double strand breaks without giving meiotic crossovers when the major pathway, which relies on DMC1, fails. |
| AT1G26800 | MPSR1 is cytoplasmic E3 ligase that senses misfolded proteins independently of chaperones and targets those proteins for degradation via the 26S proteasome. Involved in the regulation of the homeostasis of sensor NLR immune receptors. |
| AT4G21090 | MITOCHONDRIAL FERREDOXIN 2;(source:Araport11) |
| AT2G44620 | Encodes a mitochondrial acyl carrier protein (ACP) that forms part of the bridge domain which connects the membrane and the peripheral arm of mitochondrial complex I and contributes to the mitochondrial respiratory chain. Its acylated form is predominantly present in the mitochondrial membrane while the non-acylated form is soluble. The mRNA is cell-to-cell mobile. The designations of mtACP-1 and mtACP-2 in Klusch et al. 2021 (DOI:10.1093/plcell/koab092) are flipped with respect to the nomenclature published by Meyer et al. 2007 (DOI:10.1007/s11103-007-9156-9). |
| AT1G09575 | Mitochondrial calcium channel. |
| AT3G07480 | Forms an accessory complex I subunit that is part of the bridge domain, which connects the membrane and the peripheral arm of mitochondrial complex I. |
| AT5G19020 | Encodes a pentatricopeptide repeat protein (PPR) protein involved in mitochondrial mRNA editing. |
| AT3G18970 | Encodes a pentatricopeptide repeat protein (PPR) protein involved in mitochondrial mRNA editing. |
| AT3G02330 | Involved in cytidine to uridine editing of the mitochondrial mRNA AtMg00510. |
| AT2G46050 | E-PPR protein involved in mitochondrial RNA editing.It is involved in editing of the mitochondrial tatC transcript at site 581. |
| AT4G14050 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G09950 | Encodes a DYW-class PPR protein required for RNA editing at four sites in mitochondria of A. thaliana. |
| AT2G25580 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G37910 | mitochondrial heat shock protein 70-1;(source:Araport11) |
| AT5G09590 | heat shock protein 70 (Hsc70-5); nuclear |
| AT5G08040 | mitochondrial import receptor subunit TOM5-like protein;(source:Araport11) |
| AT3G16010 | Pentatricopeptide Repeat Protein involved in splicing of nad4, nad 5 and nad2 introns which affects biogenesis of the respiratory complex I. |
| AT4G01400 | Pentatricopeptide Repeat Protein involved in splicing of nad4, nad 5, nad 1 and nad2 introns which affects biogenesis of the respiratory complex I. |
| AT1G07030 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT3G15020 | Lactate/malate dehydrogenase family protein;(source:Araport11) |
| AT5G64710 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT5G09840 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT3G16480 | mitochondrial processing peptidase alpha subunit;(source:Araport11) |
| AT4G35490 | mitochondrial ribosomal protein L11;(source:Araport11) |
| AT5G01340 | Transports citrate, isocitrate and aconitate, succinate and fumarate. Catalyzes a fast counter-exchange transport as well as a low uniport of substrates, exhibits a higher transport affinity for tricarboxylates than dicarboxylates. Might be involved in storage oil mobilization 78 at early stages of seedling growth and in nitrogen assimilation in root tissue by 79 catalyzing citrate/isocitrate or citrate/succinate exchanges. |
| AT1G74120 | Encodes a mitochondrial transcription termination factor mTERF15. Required for mitochondrial nad2 intron 3 splicing and functional complex I activity. |
| AT5G64320 | MTL1 is a mitochondria localized PRR protein involved in mitochondrial protein translation and group II intron splicing. |
| AT4G25200 | AtHSP23.6-mito mRNA, nuclear gene encoding mitochondrial |
| AT1G10210 | Encodes ATMPK1. Kinase is activated by wounding. |
| AT2G46070 | Encodes a MAP kinase protein. MPK12 interacts with the IBR5 protein phosphatase in vitro and in vivo, and it can be dephosphorylated and inactivated by IBR5. MPK12 appears to be a negative regulator of auxin signlaing. MPK12 RNAi lines are hypersensitive to auxin in root elongation and transcriptional response assays, but they appear to have normal sensitivity to ABA. MPK12 is a nuclear protein and its kinase activity is increased following auxin treatment. MPK12 transcripts are widely expressed in seedlings, but MPK12 expression is stronger in guard cells than in other cell types in mature plants. |
| AT5G19010 | member of MAP Kinase |
| AT1G53510 | Member of MAP Kinase familly. Target of MPKKK20 phosphorylation. Mutant root growth is sensitive oryzalin and suggestive of a role in signaling during microtubule organization. |
| AT3G45640 | Encodes a mitogen-activated kinase whose mRNA levels increase in response to touch, cold, salinity stress and chitin oligomers.Also functions in ovule development. Heterozygous MPK3 mutants in a homozygous MPK6 background are female sterile due to defects in integument development. MPK3 can be dephosphorylated by MKP2 in vitro. The mRNA is cell-to-cell mobile. |
| AT1G59580 | encodes a mitogen-activated kinase involved in innate immunity The mRNA is cell-to-cell mobile. |
| AT1G07150 | Member of MEKK subfamily. Involved in wound induced signaling where it interacts with At5g40440, and activates At1g59580. |
| AT2G30040 | Member of MEKK subfamily. Induced by jasmonic acid and wounding in involved in insectivory response signaling. Iinteracts with At5g40440, and activates At1g59580. |
| AT4G26890 | Member of MEKK subfamily. Involved in wound response signaling. Interacts with At5g40440, and activates At1g59580. |
| AT2G32510 | Member of MEKK subfamily involved in wound and JA induced signaling.Interacts with At5g40440, and activates At1g59580. |
| AT1G05100 | member of MEKK subfamily. Negatively regulated by RGLG1 and RGLG2; involved in drought stress tolerance. |
| AT5G67080 | member of MEKK subfamily |
| AT3G50310 | Encodes a member of MEKK subfamily. Target promoter of the male germline-specific transcription factor DUO1. Involved in osmotic stress response via regulation of MPK6 activity. It also plays an important role in regulating cell division and cell elongation in the primary root meristematic and elongation areas. Mutants show defects in root microtubule organization.It phosphorylates MPK18 and MKK3.It is a positive regulator of ABA-induced stomatal closure that acts by phosphorylating MKK5. |
| AT1G53570 | Encodes a member of the MEKK subfamily that functions redundantly with MAPKKK3 to activate MPK3/6 downstream of multiple pattern recognition receptors and confer resistance to both bacterial and fungal pathogens. |
| AT5G11300 | mitotic-like cyclin, core cell cycle gene that is expressed only in roots (RT_PCR), portions with mitotic activity only (whole mount in situ). |
| AT2G41660 | Essential for hydrotropism in roots. Mutant roots are defective in hydrotropism, and have slightly reduced phototropism and modified wavy growth response. Has normal gravitropism and root elongation. |
| AT1G35260 | MLP-like protein 165;(source:Araport11) |
| AT2G01530 | MLP-like protein 329;(source:Araport11) |
| AT1G70890 | MLP-like protein 43;(source:Araport11) |
| AT5G45550 | Encodes a gene product involved in both sporogenesis and gametogenesis and is required for the normal progression of megasporogenesis and microsporogenesis. Additional alleles were isolated in a screen for enhancers of PID and genetic analysis indicates a role for MOB1A in auxin mediated signaling. |
| AT3G18165 | Encodes MOS4 (Modifier of snc1, 4), a nuclear protein homologous to human Breast Cancer-Amplified Sequence (BCAS2). MOS4 interacts with AtCDC5 and PRL1. All three proteins are essential for plant innate immunity. |
| AT3G52880 | Encodes a peroxisomal monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2 |
| AT3G09940 | Encodes a member of the monodehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica. |
| AT3G27820 | Encodes a peroxisome membrane-bound monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2 |
| AT2G11810 | MGD3 is the major enzyme for galactolipid metabolism during phosphate starvation. Does not contribute to galactolipid synthesis under P1-sufficient conditions. |
| AT1G19850 | Encodes a transcription factor (IAA24) mediating embryo axis formation and vascular development. Similar to AUXIN RESPONSIVE FACTOR 1 (ARF1) shown to bind to auxin responsive elements (AREs), and to the maize transcriptional activator VIVIPAROUS 1( VP1). In situ hybridization shows expression in provascular tissue of embryos, the emerging shoot primordia, then is restricted to provascular tissue, and in the root central vascular cylinder. |
| AT1G36370 | Encodes a nuclear localised protein MSA1 (MORE SULPHUR ACCUMULATION1). Epigenetically regulates sulphur homeostasis. Has sequence similarity to SHM (serine hydroxymethyltransferase) but lacks SHM activity in vitro. |
| AT1G21920 | MRF1 is related to SET7/9 proteins but contains an atypical SET domain. It is expressed in phloem and mutants have a weak late flowering phenotype. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT4G18640 | Required for root hair elongation during tip growth. The mRNA is cell-to-cell mobile. |
| AT4G02720 | Encodes an ortholog of NKAP (NF-kB activating protein), that interacts with splicing and ribosome biogenesis proteins, colocalizes with the 45S rDNA at the nucleolar organizer regions (NORs) and negatively regulates 45S rDNA expression. |
| AT1G28280 | VQ motif-containing protein;(source:Araport11) |
| AT5G53830 | VQ motif-containing protein;(source:Araport11) |
| AT4G10760 | Encodes a member of a core set of mRNA m6A writer proteins and is required for N6-adenosine methylation of mRNA. |
| AT5G10490 | A member of MscS-like gene family, structurally very similar to MSL3, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL2-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. |
| AT1G58200 | A member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity. |
| AT5G63800 | Involved in mucilage formation. Mutants form columella and outer cell wall architecture of the mucilage cells resembles wild-type. However, mum2 seeds completely lack seed coat mucilage. This mutation appears to represent a later step in the development of this cell-type. Encodes a beta-galactosidase involved in seed coat mucilage biosynthesis. Member of Glycoside Hydrolase Family 35 |
| AT1G53500 | encodes a putative NDP-L-rhamnose synthase, an enzyme required for the synthesis of the pectin rhamnogalacturonan I, the major component of Arabidopsis mucilage. Gene is involved in seed coat mucilage cell development. Mutant analyses suggest that MUM4 is required for complete mucilage synthesis, cytoplasmic rearrangement and seed coat development. |
| AT1G28240 | strawberry notch protein (DUF616);(source:Araport11) |
| AT2G22900 | Encodes MUCI10, a galactomannan-1,6-galactosyltransferase. MUCI10 likely decorates glucomannan, synthesized by CSLA2, with galactose residues in vivo. The degree of galactosylation is essential for the synthesis of the GGM backbone, the structure of cellulose, mucilage density, as well as the adherence of pectin. |
| AT4G35050 | Encodes a WD-40 repeat protein similar to yeast MSI1. The predicted protein has a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT3G61300 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT1G04150 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT3G03680 | Member of a family of Multiple C2 Domain and Transmembrane Region Proteins. |
| AT5G17980 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT3G57880 | Required for maintenance of inflorescence and shoot SAMs and normal development of the derived vascular cambium, functions in the SAM to promote continuous organogenesis, affects SAM development through STM, where it affects intracellular localization of STM in SAM cells in the peripheral region and prevents STM localization toward the cell wall of SAM cells in the peripheral region. |
| AT1G51570 | Required for maintenance of inflorescence and shoot SAMs and normal development of the derived vascular cambium, functions in the SAM to promote continuous organogenesis, affects SAM development through STM, where it affects intracellular localization of STM in SAM cells in the peripheral region and prevents STM localization toward the cell wall of SAM cells in the peripheral region. |
| AT1G22610 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G00700 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT1G20830 | Encodes MCD1 (MULTIPLE CHLOROPLAST DIVISION SITE 1). Determines the site of chloroplast division in concert with MinD (AT5G24020). |
| AT3G06790 | Encodes a protein involved in RNA editing in mitochondria. Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
| AT1G11430 | Encodes a protein involved in RNA editing in chloroplasts. The mRNA is cell-to-cell mobile. |
| AT5G57880 | Encodes MULTIPOLAR SPINDLE 1 (MPS1), involved in meiotic spindle organization. |
| AT3G24500 | One of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is specifically elevated in response to pathogen infection, salinity, drought, heat, hydrogen peroxide, and application of abscisic acid or salicylic acid. Constitutive expression enhances the tolerance of transgenic plants to various biotic and abiotic stresses. |
| AT2G20370 | Encodes a xyloglucan galactosyltransferase located in the membrane of Golgi stacks that is involved in the biosynthesis of fucose. It is also involved in endomembrane organization. It is suggested that it is a dual-function protein that is responsible for actin organization and the synthesis of cell wall materials. The mRNA is cell-to-cell mobile. |
| AT1G30620 | encodes a type-II membrane protein that catalyzes 4-epimerization of UDP-D-Xylose to UDP-L-Arabinose in vitro, the nucleotide sugar used by glycosyltransferases in the arabinosylation of cell wall polysaccharides and wall-resident proteoglycans. |
| AT1G75640 | Encodes a Leucine-Rich Repeat Receptor-Like Kinase MUSTACHES (MUS). Regulates stomatal bilateral symmetry. Mutants have abnormally shaped guard cells, absent or skewed stomatal pores. |
| AT4G36180 | LRR-RLK which regulates lateral root development. |
| AT3G04605 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
| AT5G16505 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
| AT5G46020 | MUSE7 was identified in a forward genetic screen to identify snc1 enhancers using a mos4 snc1 background. muse7 mos4 snc1 plants are morphologiclly similar to snc1 plants with slightly twisted leaves. The triple mutant also shows PR gene activation and enhanced resistance to pathogens, like the snc1 single mutant. It is a single copy gene conserved in plants and metazoans.MUSE7 encodes an evolutionarily conserved putative kinase substrate of unknown function that affects the accumulation of NLR proteins. |
| AT3G06120 | Encodes a basic helix-loop-helix (bHLH) protein that controls meristemoid differentiation during stomatal development. In the absence of MUTE, meristemoids abort after excessive asymmetric divisions and fail to differentiate stomata. MUTE expression in the meristemoid is required for SLGCs differentiation as pavement cells. Epidermal cells lose their competence to respond to MUTE overexpression during cotyledon development. |
| AT3G24495 | encodes a DNA mismatch repair homolog of human MutS gene, MSH6. There are four MutS genes in Arabidopsis, MSH2, MSH3, MSH6, and MSH7, which all act as heterodimers and bind to 51-mer duplexes. MSH2*MSH7 exhibit moderate affinity for a (T/G) substrate and weak binding of (+T), suggesting MSH2*MSH7 may be specialized for lesions/base mispairs not tested or for (T/G) mispairs in special contexts. |
| AT3G06490 | Encodes a MYB transcription factor involved in regulating anther dehiscence as well as regulating cell death, and cuticle-related Botrytis immunity. |
| AT3G55730 | putative transcription factor MYB109 (MYB109) mRNA, |
| AT3G62610 | Member of the R2R3 factor gene family. Together with MYB12 and MYB111 redundantly regulates flavonol biosynthesis. |
| AT3G27785 | MYB118 encodes a myb transcription factor that represses endosperm maturation and, along with MYB115, regulates glucosinolate biosynthesis. |
| AT2G47460 | MYB12 belongs to subgroup 7 of the R2R3-MYB family. It strongly activates the promoters of chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), flavonol synthase (FLS) and - to a lesser extent - chalcone flavanone isomerase (CHI), but cannot activate the promoters of flavonoid-3'hydroxylase (F3'H) and dihydroflavonol 4-reductase (DF). The activation requires a functional MYB recognition element (MRE). Results from the myb12-1f allele indicate that an activation domain might be present in the C-terminus. Overexpression or knock-out plants do not show any obvious phenotype under greenhouse conditions. Young myb12-ko seedlings contain reduced amounts of flavonoids (quercetin and kaempferol), while seedlings as well as leaves of MYB12-OX plants displayed an increased flavonoid content. They did not show any significant difference in anthocyanin content. Expression of CHS and FLS shows a clear correlation to MYB12 expression levels. CHI and F3H show increased transcript levels in the MYB12-OX lines, but no differences in the knock-out. Even in the absence of functional MYB12, flavonol biosynthesis is not completely absent, suggesting functional redundancy. The redundant factors are MYB11 and MYB111 although MYB12 is primarily required for flavonol biosynthesis in roots. Mutations in MYB12 block both auxin and ethylene stimulation of flavonoid synthesis. |
| AT3G30210 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB121). |
| AT2G31180 | Member of the R2R3 factor gene family. |
| AT3G23250 | Member of the R2R3 factor gene family. Key regulator of lignin biosynthesis in effector-triggered immunity |
| AT3G61250 | LATE MERISTEM IDENTITY2 (LMI2) is a target of the meristem identity regulator LEAFY (LFY). Has a role in the meristem identity transition from vegetative growth to flowering. Member of the R2R3 factor gene family. |
| AT5G52260 | Member of the R2R3 factor gene family. |
| AT1G66230 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
| AT3G27810 | Encodes a member of the R2R3-MYB transcription factor gene family. Induced by jasmonate. Involved in jasmonate response during stamen development. MYB21 interacts with JAZ proteins, and functions redundantly with MYB24 and MYB57 to regulate stamen development. Promotes flavonol biosynthesis through regulation of FLS1 gene expression. |
| AT1G22640 | MYB-type transcription factor (MYB3) that represses phenylpropanoid biosynthesis gene expression |
| AT3G28910 | Encodes a MYB family transcriptional regulator.It is a a positive regulator of the pathogen-induced hypersensitive response and of brassinosteroid and abscisic acid signaling and a negative regulator of photomorphogenesis. Accumulation of MYB30 is light regulated and activity is modulated by SUMOlaytion. MYB30 can for complexes with different bHLH components to regulate expression of different pathways. |
| AT1G74650 | Member of the R2R3 factor gene family. |
| AT5G60890 | Myb-like transcription factor that modulates expression of ASA1, a key point of control in the tryptophan pathway; mutant has deregulated expression of ASA1 in dominant allele. Loss of function allele suggests ATR1 also functions at a control point for regulating indole glucosinolate homeostasis. |
| AT3G09370 | C-myb-like transcription factor (MYB3R3) mRNA. It is a target of CDK phosphorylation and blocks cell division in response to DNA damage. |
| AT4G00540 | Encodes a putative c-myb-like transcription factor. Member of a class of domain proteins containing structural features of the vertebrate c-Myb proto-oncoprotein, including the presence of three Myb motifs (R1,R2,R3). |
| AT4G38620 | Encodes a R2R3 MYB protein which is involved in the response to UV-B. It functions as a repressor of target gene expression. One of its target genes encodes cinnamate 4-hydroxylase; mutants accumulate sinapate esters in their leaves. MYB4 binds to its own promoter and represses its own expression. Nuclear localization of MYB4 depends on the action of the beta importin SAD2. The mRNA is cell-to-cell mobile. |
| AT5G14340 | Member of the R2R3 factor gene family. |
| AT5G16600 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
| AT1G18710 | Member of the R2R3 factor gene family. Promotes seed longevity (viability of seed over time.) Expressed in the chalazal seed coat. Overexpresion enhances resistance of seed to deterioration (PMID:32519347). |
| AT5G54230 | MYB49 transcription factor. Binds to and promotes expression of genes involved in cadmium accumulation. Interacts with ABI5 which acts as a repressor preventing MYB49 induced expression of target genes. |
| AT1G18570 | Encodes a member of the R2R3-MYB transcription family. Involved in indole glucosinolate biosynthesis. The mRNA is cell-to-cell mobile. |
| AT5G59780 | Encodes a putative transcription factor (MYB59). In roots it is involved in K+/NO3- transport and expression of the NPF7.3 transporter. |
| AT4G09460 | Encodes myb6 DNA-binding protein. The mRNA is cell-to-cell mobile. |
| AT1G08810 | putative transcription factor of the R2R3-MYB gene family. Transcript increases under conditions that promote stomatal opening (white and blue light, abi1-1 mutation) and decreases under conditions that trigger stomatal closure (ABA, desiccation, darkness), with the exception of elevated CO2. Expressed exclusively in guard cells of all tissues. It is required for light-induced opening of stomata. Mutant shows reduced stomatal aperture which helps to limit water loss during drought. |
| AT1G09540 | Encodes putative transcription factor. Mutants lack of mucilage extrusion from the seeds during imbibition. Reduced quantities of mucilage are deposited during the development of the seed coat epidermis in myb61 mutants. Expressed in guard cells,loss of function mutations show an increase in stomatal pore opening suggesting a role in ABA independent regulation of stomatal pore size. |
| AT1G68320 | putative transcription factor: R2R3-MYB transcription family. Involved in regulation of phosphate starvation responses and gibberellic acid biosynthesis. |
| AT3G11440 | Member of the R2R3-MYB gene family. Similar to GA-induced Barley myb gene. May be induced during germination in response to GA. Double mutants with MYB33 are male sterile, showing defects in pollen development and anther development. Contains a binding site for miRNA159 and may be spatially regulated by this micro RNA. A highly conserved RNA secondary structure abuts the miR159 binding site which facilitates its regulation by miR159. The male sterile phenotype of the MYB33/MYB65 double mutant is light and temperature sensitive. Fertility can be restored with increased light intensity and lower temperatures. |
| AT2G16720 | Encodes a member of MYB3R- and R2R3- type MYB- encoding gene family that acts as a repressor of flavonol biosynthesis. AtMYB7 gene expression is induced by salt treatment. |
| AT2G23290 | Member of the R2R3 factor gene family. |
| AT4G37260 | Member of the R2R3 factor gene family. The mRNA is cell-to-cell mobile. |
| AT4G05100 | Member of the R2R3 factor gene family. |
| AT3G50060 | Encodes a member of the R2R3 transcription factor gene family. Expressed in response to potassium deprivation and auxin. Involved in lateral root development. Interacts with ARF7 and regulates the expression of some auxin responsive genes. |
| AT5G49620 | Member of the R2R3 factor gene family. |
| AT4G22680 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
| AT5G10280 | Encodes a putative transcription factor (MYB92). |
| AT3G47600 | Encodes a putative transcription factor (MYB94). |
| AT1G74430 | Encodes a putative transcription factor (MYB95). The mRNA is cell-to-cell mobile. |
| AT5G62470 | Encodes a R2R3 type Myb transcription factor whose expression is strongly induced by abscisic acid. Mediates abscisic acid signaling during drought stress response. |
| AT5G62320 | Encodes a putative transcription factor (MYB99). |
| AT5G67300 | Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. The mRNA is cell-to-cell mobile. |
| AT5G47390 | Encodes a circadian-regulated transcription factor which specifically controls cell expansion during leaf development by controlling ROS homeostasis. The mRNA is cell-to-cell mobile. |
| AT4G21440 | Encodes a MYB transcription factor involved in wounding and osmotic stress response. Member of the R2R3 factor gene family. |
| AT1G71030 | Encodes a putative myb family transcription factor. In contrast to most other myb-like proteins its myb domain consists of a single repeat. A proline-rich region potentially involved in transactivation is found in the C-terminal part of the protein. Its transcript accumulates mainly in leaves. |
| AT5G18240 | Encodes MYR1 (MYR1). |
| AT3G61950 | MYC-type transcription factor which interacts with ICE1 and negatively regulates cold-responsive genes and cold tolerance. |
| AT2G46810 | MYC-type transcription factor which interacts with ICE1 and negatively regulates cold-responsive genes and cold tolerance. |
| AT5G58730 | pfkB-like carbohydrate kinase family protein;(source:Araport11) |
| AT4G39120 | Encodes a chloroplast-localized member of the myo-inositol monophosphatase family, IMPL2 (myo-Inositol monophosphatase like 2) that seems to have multiple enzymatic activities. It contributes to histidine biosynthesis based on it histidinol-phosphate phosphatase activity. In addition, the protein can act as an inositol monophosphatase and an L-galactose-1-phosphate phosphatase in vitro. |
| AT1G14520 | Encodes MIOX1. Belongs to myo-inositol oxygenase gene family. |
| AT2G19800 | Encodes a myo-inositol oxygenase family gene. |
| AT2G22240 | ** Referred to as MIPS1 in Mitsuhashi et al 2008. Myo-inositol-1-phosphate synthase isoform 2. Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT5G10170 | myo-inositol-1-phosphate synthase isoform 3.Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT3G19960 | member of Myosin-like proteins |
| AT1G17580 | Encodes a member of the type XI myosin protein family involved in organelle trafficking and overall plant development. |
| AT5G54280 | Type VII myosin gene |
| AT5G43900 | Encodes a member of the type XI myosin protein family that binds F-actin and co-localizes with actin filaments and peroxisomes. Homozygous mutants are reported to have pleiotropic effects in growth and fertility and may also be lethal. This protein is also involved in root hair growth and organelle trafficking. This protein interacts with RabC2a and RabD1 in a GTP-dependent manner. |
| AT1G08800 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT1G70750 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT5G16720 | caldesmon-like protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT1G04600 | member of Myosin-like proteins |
| AT2G33240 | member of Myosin-like proteins |
| AT5G04540 | Myotubularin-like phosphatases II superfamily;(source:Araport11) |
| AT5G57020 | Arabidopsis thaliana myristoyl-CoA:protein N-myristoyltransferase. |
| AT5G66910 | RPW8 -CNL gene is required for signal transduction of TNLs; functionally redundant to NRG1.1. |
| AT3G57560 | encodes a N-acetylglutamate kinase, involved in arginine biosynthesis |
| AT2G22910 | N-acetyl-l-glutamate synthase 1;(source:Araport11) |
| AT4G37670 | N-acetyl-l-glutamate synthase 2;(source:Araport11) |
| AT1G31070 | Encodes a protein that functions as an N-acetylglucosamine-1-phosphate uridylyltransferase that catalyzes the formation of UDP-N-acetylglucosamine (UDP-GlcNAc). This is an essential precursor for glycolipid and glycoprotein synthesis and is also used for regulatory protein modification in signaling pathways. The enzyme can also catalyze the reverse reaction using both UDP-GlcNAc and the less common UDP-N-acetylgalactosamine as substrates. |
| AT5G56750 | AGB1/AGG dimmer interacting protein, response to water deficit. |
| AT5G11790 | Plays a role in dehydration stress response. |
| AT2G44170 | pseudogene of myristoyl-CoA:protein N-myristoyltransferase;(source:Araport11) |
| AT1G50260 | N-terminal-transmembrane-C2 domain type 5.1;(source:Araport11) |
| AT4G04880 | Encodes an N6-mAMP deaminase (ADAL, renamed MAPDA) that catabolizes N6-mAMP derived from turnover of m6A-modified RNA to inosine monophosphate in vivo by hydrolytically removing the aminomethyl group. |
| AT1G53210 | Encodes a Na+/Ca 2+ exchanger-like protein that participates in the maintenance of Ca 2+ homeostasis. The mRNA is cell-to-cell mobile. |
| AT5G55470 | member of Sodium proton exchanger family |
| AT1G79610 | Encodes an endosomal Na(+)/H(+) antiporter: AT1G54370 (NHX5), AT1G79610 (NHX6). Double knockout nhx5 nhx6 showed reduced growth, with smaller and fewer cells and increased sensitivity to salinity. |
| AT5G27150 | Encodes a vacuolar sodium/proton antiporter involved in salt tolerance, ion homeostasis, and leaf development. The mRNA is cell-to-cell mobile. |
| AT2G46770 | NAC transcription factor NST1. NST1 and NST2 are redundant in regulating secondary wall thickening in anther walls and siliques. An NST1 promoter fusion was detected in various tissues in which lignified secondary walls develop. Both MYC2 and MYC4 bind to the NST1 promoter and appear to regulate its expression in response to blue light. |
| AT1G33060 | NAC 014;(source:Araport11) |
| AT3G15510 | Note of caution: not to be confused with another protein (AtNAC6 locus AT5G39610) which on occasion has also been referred to as AtNAC2. |
| AT5G39610 | Encodes a NAC-domain transcription factor. Positively regulates aging-induced cell death and senescence in leaves. This gene is upregulated in response to salt stress in wildtype as well as NTHK1 transgenic lines although in the latter case the induction was drastically reduced. It was also upregulated by ABA, ACC and NAA treatment, although in the latter two cases, the induction occurred relatively late when compared with NaCl or ABA treatments. Note: this protein (AtNAC6) on occasion has also been referred to as AtNAC2, not to be confused with the AtNAC2 found at locus AT3G15510. |
| AT1G56010 | Encodes a transcription factor involved auxin-mediated lateral root formation. Acts downstream of TIR1 and is regulated post-transcriptionally by miRNA164 and by SINAT5-dependent ubiquitination. |
| AT5G63790 | Encodes a member of the NAC family of transcription factors. ANAC102 appears to have a role in mediating response to low oxygen stress (hypoxia) in germinating seedlings. Its expression can be induced by beta-cyclocitral, an oxidized by-product of beta-carotene generated in the chloroplasts, mediates a protective retrograde response that lowers the levels of toxic peroxides and carbonyls, limiting damage to intracellular components. |
| AT5G64060 | NAC domain containing protein 103;(source:Araport11) |
| AT5G66300 | Encodes a NAC-domain transcription factor. Expressed in the vascular tissue. |
| AT1G52890 | encodes a NAC transcription factor whose expression is induced by drought, high salt, and abscisic acid. This gene binds to ERD1 promoter in vitro. |
| AT5G04410 | NAC family member, functions as a transcriptional activator, regulates flavonoid biosynthesis under high light. The mRNA is cell-to-cell mobile. |
| AT1G54330 | NAC domain containing protein 20;(source:Araport11) |
| AT1G02220 | NAC domain transcription factor which functions as a negative regulator of the TDIF-PXY module and fine-tunes TDIF signaling in vascular development. Controls the balance of xylem formation and cambial cell divisions. |
| AT3G29035 | Encodes a protein with transcription factor activity. Note: this protein (AT3G29035) on occasion has also been referred to as AtNAC3, not to be confused with the AtNAC3 found at locus AT3G15500. The mRNA is cell-to-cell mobile. |
| AT3G15500 | Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3. The mRNA is cell-to-cell mobile. |
| AT1G77450 | NAC domain transcriptional regulator that is induced by ROS in roots where it regulates the expression of downstream genes such as MYB30. |
| AT1G02230 | NAC domain containing protein 4;(source:Araport11) |
| AT2G33480 | NAC domain containing protein 41;(source:Araport11) |
| AT2G43000 | Encodes a NAC transcription factor induced by hydrogen peroxide (H2O2). Involved in senescence. Over expression of the gene strongly delays senescence and enhances tolerance to various abiotic stresses. |
| AT3G03200 | NAC domain containing protein 45;(source:Araport11) |
| AT3G04060 | NAC046 is a member of the NAC domain containing family of transcription factors. It was identified in a screen for regulators of chlorophyll protein gene expression. Mutants in NAC046 have delayed senescence and increased CHL content suggesting a role in regulation of senescence and chlorophyll degradation. |
| AT3G04070 | NAC domain containing protein 47;(source:Araport11) |
| AT3G04420 | NAC domain containing protein 48;(source:Araport11) |
| AT3G04430 | NAC domain containing protein 49;(source:Araport11) |
| AT1G02250 | Encodes a member of the NAC family of transcription factors. ANAC005 contains sequences specifying both nuclear and plasma membrane targeting. Overexpression results in increased xylem differentiation suggesting ANAC005 promotes xylem formation. |
| AT3G10480 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. It binds the NAC-binding site, the Mitochondrial Dysfunction Motif. |
| AT3G10490 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. |
| AT3G10500 | Encodes a transcriptional activator that is associated with the plasma membrane in a dormant form and is proteolytically cleaved to create a form that can enter the nucleus. It is thought to promote ROS production by binding directly to the promoters of genes encoding ROS biosynthetic enzymes during drought-induced leaf senescence. The mRNA is cell-to-cell mobile. |
| AT3G49530 | Transcription factor that serves as a molecular link between cold signals and pathogen resistance responses. Undergoes proteolytic processing triggered by cold-induced changes in membrane fluidity.It relocates from the plasma membrane to the nucleus in response to ER stress. NAC062 is phosphorylated by SnRK2.8 at Thr-142. |
| AT4G01550 | Encodes a plasma-membrane bound NAC transcription factor, whose controlled proteolytic activation allows it to enter the nucleus. |
| AT4G17980 | Encodes ANAC071, a transcription factor involved in cell proliferation in incised inflorescence stems. |
| AT4G28530 | Member of NAC family of transcription factors. Along with NAC2, KIR1 positively regulates programmed cell death of stigmatic tissue. |
| AT5G04400 | NAC domain protein;(source:Araport11) |
| AT5G07680 | NAC domain containing protein 80;(source:Araport11) |
| AT5G14000 | NAC domain containing protein 84;(source:Araport11) |
| AT5G22290 | Encodes ANAC089, a membrane-tethered transcription factor that negatively regulates floral initiation. Also controls ER-stress-induced programmed cell death. |
| AT5G41090 | NAC domain containing protein 95;(source:Araport11) |
| AT1G32870 | Expression in rosette leaves is activated by high concentration of boron. |
| AT4G35580 | Encodes a calmodulin-binding NAC protein (CBNAC). Contains calmodulin-binding domain in the C-terminus of the protein. Functions as a calmodulin-regulated transcriptional repressor. |
| AT4G01540 | Encodes a membrane-bound NAC (for NAM, ATAF1/2, CUC2) transcription factor, designated NTM1 (for NAC with transmembrane motif1). NTM1 regulates cell division in Arabidopsis. |
| AT1G69490 | Encodes a member of the NAC transcription factor gene family. It is expressed in floral primordia and upregulated by AP3 and PI. Its expression is associated with leaf senescence. The mRNA is cell-to-cell mobile. |
| AT3G12977 | NAC transcription regulator. Regulates endosperm cell expansion during germination. |
| AT1G21640 | Encodes a protein with NAD kinase activity. The protein was also shown to bind calmodulin. |
| AT1G04280 | Encodes a mitochondrial CaM/Ca2+-dependent NAD+ kinase. |
| AT1G78590 | Encodes a NADH kinase which can synthesize NADPH from NADH; also utilizes NAD+ as substrate although NADH is the preferred substrate. |
| AT4G05020 | Miitochondrial alternative NADH dehydrogenase. |
| AT2G47490 | Encodes a chloroplast-localized NAD+ transporter that transports NAD+ in a counter exchange mode with ADP and AMP in vitro. |
| AT1G25380 | Encodes a mitochondrial-localized NAD+ transporter that transports NAD+ in a counter exchange mode with ADP and AMP in vitro. |
| AT4G00570 | Encodes an NAD-dependent malic enzyme (NAD-ME) that does not act on oxaloacetate, indicating that it belongs to EC 1.1.1.39. It is a member of the beta family of NAD-MEs in plants. It appears to function as a homodimer or as a heterodimer with the alpha-type NAD-ME2 (At2g13560). NAD-ME2 transcript and protein levels are higher during the night than during the day. |
| AT1G74880 | Encodes subunit NDH-O of NAD(P)H:plastoquinone dehydrogenase complex (Ndh complex) present in the thylakoid membrane of chloroplasts. This subunit is thought to be required for Ndh complex assembly. |
| AT1G70760 | a subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. Located on the thylakoid membrane. Mutant has impaired NAD(P)H dehydrogenase activity. The mRNA is cell-to-cell mobile. |
| AT5G17770 | Encodes NADH:cytochrome (Cyt) b5 reductase that displayed strict specificity to NADH for the reduction of a recombinant Cyt b5 (AtB5-A), whereas no Cyt b5 reduction was observed when NADPH was used as the electron donor. |
| AT5G58330 | lactate/malate dehydrogenase family protein;(source:Araport11) |
| AT5G11670 | The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME2 is presumably a cytosolic enzyme involved in malate metabolism and possibly assisting the oxidative pentose phosphate pathway. AtNADP-ME2 counts for the major part of NADP-ME activity in mature tissues of Arabidopsis. |
| AT1G79750 | The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME4 is localized to chloroplasts. The gene is expressed throughout the whole plant and during embryogenesis and germination. A possible involvement in the fatty acid biosynthesis has been proposed. |
| AT2G17420 | NADPH-dependent thioredoxin reductase, major cytosolic isoform The mRNA is cell-to-cell mobile. |
| AT4G15545 | NAI1 interacting protein, involved in ER body formation. |
| AT1G16520 | NAI1 interacting protein, involved in ER body and vesicle formation. |
| AT1G56080 | NAI1 interacting protein, involved in ER body formation. |
| AT5G67440 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
| AT2G23050 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
| AT4G37590 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
| AT3G12700 | Encodes an aspartic protease has an important regulatory function in chloroplasts that not only influences photosynthetic carbon metabolism but also plastid and nuclear gene expression. |
| AT1G74560 | Double nrp1-1 nrp2-1 mutants show arrest of cell cycle progression at G2/M and disordered cellular organization occurred in root tips. Localize in the nucleus and can form homomeric and heteromeric protein complexes with NRP2. Bind histones Histone2A and Histone2B and associate with chromatin in vivo. Plant mutated in both NRP1 and NRP2 genes show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. NRP genes act synergistically with NAP1 genes in promoting somatic homologous recombination. |
| AT1G18800 | Double nrp1-1 nrp2-1 mutants show arrest of cell cycle progression at G2/M and disordered cellular organization occurred in root tips. Localize in the nucleus and can form homomeric and heteromeric protein complexes with NRP1. Bind histones Histone2A and Histone2B and associate with chromatin in vivo. Plant mutated in both NRP1 and NRP2 genes show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. NRP genes act synergistically with NAP1 genes in promoting somatic homologous recombination. |
| AT5G13850 | nascent polypeptide-associated complex subunit alpha-like protein 3;(source:Araport11) |
| AT5G67330 | Encodes a member of the Nramp2 metal transporter family; like its homolog Atnramp3, localized in vacuolar membrane. Seedlings of double mutant, atnramp3-1 atnramp4-1, were arrested at early germination. The mRNA is cell-to-cell mobile. |
| AT1G80830 | Thought to be involved in iron homeostasis. Induced in leaves in response to iron deficiency. Transgenic plants accumulate toxic levels of iron. Gene complements yeast iron uptake mutants. |
| AT2G23150 | Encodes a member of the Nramp2 metal transporter family; like its homolog Atnramp4, localized in vacuolar membrane. Seedlings of double mutant, atnramp3-1 atnramp4-1, were arrested at early germination. |
| AT3G17850 | Protein kinase which together with IRE3 plays an important role in controlling root skewing and maintaining the microtubule network. |
| AT5G06320 | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus, spermine and Pseudomonas syringae pv. tomato DC3000. The gene product is localized to the plasma membrane. |
| AT1G65690 | Encodes NHL6 (NDR1/HIN1-like 6). Plays an important role in the abiotic stresses-induced ABA signaling and biosynthesis, particularly during seed germination and early seedling development. |
| AT1G28380 | This gene is predicted to encode a protein involved in negatively regulating salicylic acid-related defense responses and cell death programs. nsl1 mutants develop necrotic lesions spontaneously and show other features of a defense response, such as higher levels of SA and disease resistance-related transcripts, in the absence of a biotic stimulus. The NSL1 protein is predicted to have a MACPF domain, found in proteins that form a transmembrane pore in mammalian immune responses. NSL1 transcript levels do not appear to change in response to biotic stresses, but are elevated by cycloheximide in seedlings, and by sodium chloride in roots. The mRNA is cell-to-cell mobile. |
| AT5G51720 | Encodes a protein with biochemical, structural, and biophysical characteristics of a NEET protein. It plays a key role in plant development, senescence, reactive oxygen homeostasis, and Fe metabolism. |
| AT1G53430 | Probable LRR receptor-like ser/thr-protein kinase; Commonly-enriched candidate LPS-interacting PM-associated proteins for both LPS chemotypes subsequent to the polymyxin B affinity chromatography strategy. |
| AT4G02710 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT5G10500 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT1G03470 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It colocalizes with filamentous actin and is localized to the nuclear membrane and the vacuolar membrane. |
| AT2G47920 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT5G58320 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It colocalizes with filamentous actin and is localized to the tonoplast membrane. It is expressed in the epidermis of the root meristem and the early expansion zone. |
| AT2G30500 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT2G38010 | Neutral/alkaline non-lysosomal ceramidase;(source:Araport11) |
| AT4G24690 | Encodes NBR1, a selective autophagy substrate. The mRNA is cell-to-cell mobile. |
| AT4G01940 | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU2 and 3 than to NFU4 and 5. Targeted to the chloroplast. |
| AT1G51390 | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU4 than to NFU1,2, and 3. Targeted to the mitochondrion. The mRNA is cell-to-cell mobile. |
| AT3G11580 | SOD7 encodes nuclear localized B3 DNA binding domain and a transcriptional repression motif. Belongs to the RAV gene family. Functions in regulation of seed size and binds to and represses KLU. Transcription repressor involved in regulation of inflorescence architecture. |
| AT5G04950 | Encodes a nicotianamide synthase. |
| AT1G42470 | Patched family protein;(source:Araport11) |
| AT4G38350 | Patched family protein;(source:Araport11) |
| AT5G64170 | LNK1 is a member of a small family (4 proteins) in Arabidopsis that have some overlap in function. LNK1 functions in the integration of light signaling and circadian clock. It is regulated by the clock TOC1 complex.Functions as a transcriptional coactivator. |
| AT3G54500 | Member of a small family (4 proteins) in Arabidopsis that have some overlap in function. LNK2 along with LNK1 functions in the integration of light signaling and circadian clock. It is regulated by the clock TOC1 complex. Functions as a transcriptional coactivator. |
| AT3G12320 | Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK4 in having affects on biomass accumulation and phototrophism. |
| AT5G06980 | Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK3 in having affects on biomass accumulation and phototrophism. |
| AT1G02450 | NIMIN1 modulates PR gene expression according the following model: NPR1 forms a ternary complex with NIMIN1 and TGA factors upon SAR induction that binds to a positive regulatory cis-element of the PR-1 promoter, termed LS7. This leads to PR-1 gene induction. NIMIN1 decreases transcriptional activation, possibly through its EAR motif, which results in fine-tuning of PR-1 gene expression. |
| AT3G25882 | encodes a kinase that physically interacts with NPR1/NIM1 |
| AT3G44200 | Encodes AtNek5, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.Interacts physically with plant kinesins ARK1 and ARK2. Mutants show defects in root epidermal cell morphology, trichome branching and other epidermal cell abnormalities suggesting a rol e in epidermal cell differentiation. NEK6 co-localizes with cortical microtubules. |
| AT3G04810 | Encodes AtNek2, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
| AT3G20860 | Encodes a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
| AT1G54510 | Encodes AtNEK1, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
| AT4G24020 | Encodes NIN Like Protein 7 (NLP7). Modulates nitrate sensing and metabolism. Mutants of NLP7 show features of nitrogen-starved plants and are tolerant to drought stress. Localized in the nucleus and functions as a putative transcription factor. The mRNA is cell-to-cell mobile. |
| AT2G43500 | Plant regulator RWP-RK family protein;(source:Araport11) |
| AT3G59580 | Plant regulator RWP-RK family protein;(source:Araport11) |
| AT3G14440 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane. |
| AT3G24220 | A member of gene NCED-related gene family, encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
| AT1G78390 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
| AT3G60320 | bZIP domain class transcription factor (DUF630 and DUF632);(source:Araport11) |
| AT3G16180 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
| AT5G60780 | member of High affinity nitrate transporter family |
| AT1G12940 | member of High affinity nitrate transporter family |
| AT3G44310 | Mutants are resistant to indole-3-acetonitrile (IAN). NIT1 catalyzes the terminal activation step in indole-acetic acid biosynthesis. Predominantly expressed isoform of nitrilase isoenzyme family. Aggregation of NIT1 in cells directly abutting wound sites is one of the earliest events associated with wound and herbicide-induced cell death. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. It is also involved in the conversion of IAN to IAM (indole-3-acetamide) and other non-auxin-related metabolic processes. The mRNA is cell-to-cell mobile. |
| AT3G44300 | Encodes an enzyme that catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (nitrile aminohydrolase, EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. Mutants have reduced sensitivity to IAN and are sensitive to IAA. This enzyme likely participates in other non-auxin-related metabolic pathways. The mRNA is cell-to-cell mobile. |
| AT2G27450 | Encodes N-carbamoylputrescine amidohydrolase that is involved in putrescine and polyamine biosynthesis. |
| AT3G16410 | Encodes a nitrile-specifier protein NSP4. NSP4 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. The mRNA is cell-to-cell mobile. |
| AT5G48180 | Encodes a nitrile-specifier protein NSP5. NSP5 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. |
| AT5G65720 | Encodes a cysteine desulfurase whose activity is dependent on AtSufE activation. It requires pyridoxal phosphate (PLP) for proper folding. Its catalytic efficiency is increase three-fold in the presence of AtFH (frataxin). |
| AT1G02860 | Encodes a ubiquitin E3 ligase with RING and SPX domains that is involved in mediating immune responses and mediates degradation of PHT1s at plasma membranes. Targeted by MIR827. Ubiquitinates PHT1;3, PHT1;2, PHT1;1/AtPT1 and PHT1;4/AtPT2. |
| AT3G16350 | MYB-like transcription factor involved in nitrate signaling trough regulation of CHL1. |
| AT3G54360 | Encodes a catalase chaperon that is essential for catalase activity. Required for multiple stress responses. |
| AT5G13390 | Required for normal pollen development and lipid accumulation within the tapetum |
| AT1G27460 | encodes a calmodulin-binding protein that is expressed in pollen, suspension culture cells, flowers, and fruits. The mRNA is cell-to-cell mobile. |
| AT4G18910 | Encodes an aquaporin homolog. Functions in arsenite transport and tolerance.When expressed in yeast cells can conduct hydrogen peroxide into those cells. |
| AT4G10380 | Boric acid channel. Essential for efficient boron uptake and plant development under boron limitation. Also functions in arsenite transport and tolerance. Localized preferentially in outer membrane domains of root cells. |
| AT4G19030 | an aquaporin whose expression level is reduced by ABA, NaCl, dark, and desiccation. is expressed at relatively low levels under normal conditions. Also functions in arsenite transport and tolerance. |
| AT4G03090 | AtNDX negatively regulates ABI4 expression during ABA signaling. |
| AT2G03440 | Induced at the transcriptional level by Pseudomonas syringae pv. tomato infection. |
| AT3G53180 | Encodes a protein that is the product of a fusion gene with a C-terminal GSI like sequence and an N-terminal part sharing homology with nodulins. It self-assembles into oligomers and its expression is increased in response to flagellin treatment. The protein co-localizes with microtubules and binds gamma-tubulin. RNAi lines are affected in root morphogenesis. |
| AT5G45410 | Plastid localized protein of unknown function. Mutants are more susceptible to P. syringae and produce less callose upon infection. |
| AT4G25030 | Plastid localized protein of unknown function. Mutants are more susceptible to P. syringae and produce less callose upon infection. |
| AT3G20600 | Required for non-race specific resistance to bacterial and fungal pathogens.Mediates systemic acquired resistance (SAR) response. The mRNA is cell-to-cell mobile. |
| AT1G29150 | specifically interacts with FUS6/COP11 via the C-terminal domain of FUS6/COP11 and associates with an ATPase subunit of the 19S proteasome regulatory complex, AtS6A. The mRNA is cell-to-cell mobile. |
| AT3G10670 | Plastidic SufC-like ATP-binding cassette/ATPase essential for Arabidopsis embryogenesis. Involved in the biogenesis and/or repair of oxidatively damaged Fe?S clusters. Expressed in embryos and meristems. |
| AT5G64330 | Involved in blue light response signaling pathway; interacts with the blue light photoreceptor NPH1. Null mutations abolish phototrophic responses of etiolated seedlings to low fluence blue light. Protein contains multiple protein-protein interaction domains. |
| AT3G03520 | Lysophosphatidic acid phosphatase highly expressed during phosphate starvation and abiotic stresses. Role in lipid synthesis. |
| AT3G48610 | Non-specific phospholipase C6 involved in gametophyte development. |
| AT4G13250 | Encodes a chlorophyll b reductase involved in the degradation of chlorophyll b and LHCII (light harvesting complex II). |
| AT4G22920 | Similar to the tomato senescence-inducible chloroplast stay-green protein 1. It is upregulated during maximal senescence in the Arabidopsis life cycle, especially in senescent leaves. Acts antagonistically with SGR2 to balance chlorophyll catabolism in chloroplasts with the dismantling and remobilizing of other cellular components in senescing leaf cells. |
| AT1G80460 | Encodes a protein similar to glycerol kinase, which converts glycerol to glycerol 3-phosphate and performs a rate-limiting step in glycerol metabolism. This gene is required for both general and specific resistance against bacteria and fungi. Arabidopsis thaliana glycerol kinase (GLR1) mRNA.Involved in flagellin-induced non-host resistance to Pseudomonas. Coronatine partially suppresses flagellin-induced expression of NHO1. |
| AT1G44575 | Encoding PSII-S (CP22), a ubiquitous pigment-binding protein associated with photosystem II (PSII) of higher plants. Involved in nonphotochemical quenching rather than in photosynthesis. Mutant has a normal violaxanthin cycle but has a limited capacity of quenching singlet excited chlorophylls and is tolerant to lipid peroxidation. |
| AT2G03820 | Encodes a protein involved in the nuclear export of the 60S ribosomal subunit and formation of the secondary cell wall. |
| AT5G52820 | Encodes a NOTCHLESS homolog, a non-ribosomal protein involved in the maturation and assembly of the 60S ribosomal subunit, that is required for female gametogenesis. The mRNA is cell-to-cell mobile. |
| AT1G62720 | Encodes a PPR protein gene that localizes to the mitochondrion and is required for seed germination. |
| AT4G28910 | Encodes a transcriptional repressor that functions in the jasmonic acid (JA) signalling pathway, root development, and has a key role in leaf development, likely due to the transcriptional regulation of CYCD3 expression. Transcriptional repressor that accumulates in short-day conditions. Regulates together with FRS7 and FRS12 glucosinolate biosynthesis. |
| AT1G48240 | member of NPSN Gene Family |
| AT3G17440 | member of NPSN Gene Family |
| AT3G06030 | NPK1-related protein kinase 3 |
| AT5G45110 | Encodes NPR3, a paralog of NPR1. Involved in negative regulation of defense responses against bacterial and oomycete pathogens. npr3 mutants has elevated level of PR1 expression. Interacts with TGA2, TGA3, TGA5 and TGA6 in yeast two hybrid assays. NPR3 and NPR4 are receptors for the immune signal salicylic acid. The mRNA is cell-to-cell mobile. |
| AT4G19660 | Encodes NPR4, a ankyrin repeat BTB/POZ domain-containing protein with 36% sequence identity with NPR1. Mutants are more susceptible to the bacterial pathogen Pseudomonas syringe pv. tomato DC3000 and to the fungal pathogen Erysiphe cichoracearum, but do not differ markedly from wild type in interaction with virulent and avirulent strains of the oomycete Peronospora parasitica. NPR4 is required for basal defense against pathogens, and may be implicated in the cross-talk between the SA- and JA-dependent signaling pathways. NPR3 and NPR4 are receptors for the immune signal salicylic acid. |
| AT1G15960 | member of Nramp2 family |
| AT5G67385 | Encodes a phototropin-interacting NRL protein that is an early signaling component in the phototrophic response and is essential for the phototropin-mediated chloroplast accumulation response but is not involved in the chloroplast avoidance response or stomatal opening. |
| AT3G47960 | Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds. |
| AT1G69870 | Encodes a low affinity nitrate transporter NRT1.7. Expressed in phloem. Responsible for source-to-sink remobilization of nitrate. The mRNA is cell-to-cell mobile. |
| AT3G45650 | Encodes a nitrate efflux transporter NAXT1 (for NITRATE EXCRETION TRANSPORTER1). Localized to the plasma membrane. NAXT1 belongs to a subclass of seven NAXT members from the large NITRATE TRANSPORTER1/PEPTIDE TRANSPORTER family and is mainly expressed in the cortex of mature roots. |
| AT1G59740 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G69850 | Encodes an inducible component of low-affinity nitrate uptake. mRNA found primarily in root hairs and the epidermis of roots. It also acts as an ABA importer at the site of ABA biosynthesis and is important for the regulation of stomatal aperture in inflorescence stems. |
| AT1G72125 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G46050 | Encodes a di- and tri-peptide transporter involved in responses to wounding, virulent bacterial pathogens, and high NaCl concentrations. The protein is predicted to have 12 transmembrane helicies. |
| AT2G26690 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G12110 | Encodes NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is expressed in guard cells and function in stomatal opening. Mutants have less transpiration and are more tolerant to drought. Expressed in lateral roots. Involved in nitrate signaling which enables the plant root system to detect and exploit nitrate-rich soil patches. Comparing to the wild type, the mutant displays a strongly decreased lateral root proliferation phenotype in nitrate rich patches on growth medium. Affects flowering time via interaction with the FLC dependent flowering pathway to influence its target gene FT. |
| AT1G32450 | Transmembrane nitrate transporter. Involved in xylem transport of nitrate from root to shoot. Induced in response to high and low concentrations of nitrate. Not involved in nitrate uptake. Expressed in root pericycle cells under the control of MYB59. Also functions as a proton-coupled H+/K+ antiporter for K+ loading into the xylem. |
| AT3G54140 | Encodes a di- and tri-peptide transporter that recognizes a variety of different amino acid combinations. GFP-tagged PTR1 localizes to the plasma membrane and has 8 to 11 predicted transmembrane domains. PTR1 is expressed in a number of different vascular tissues throughout the plant based on promoter:GUS expression analysis. ptr1 mutants have a lower dry weight than wild type plants when both are grown with Pro-Ala or Ala-Ala dipeptides as their nitrogen source, suggesting that PTR1 plays a role in dipeptide uptake in the roots. Furthermore N content of ptr1 mutants is lower than that of wild type plants when grown with Pro-Ala or a mixture of dipeptides as nitrogen source |
| AT1G62200 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G13350 | Encodes a GTPase that interacts with nuclear shuttle proteins (NSPs) from a number of different plant viruses. The gene is widely expressed and NIG transcript levels do not rise in response to viral infection. This cytoplasmic protein does not directly interact with a viral movement protein (MP), but, it does promote the movement of NSP from the nucleus to the cytoplasm. Overexpression of NIG in Arabidopsis plants renders them more sensitive to geminivirus infection. |
| AT5G16000 | NSP-interacting kinase (NIK1), receptor-like kinase, involved in defense response against geminivirus It acts as a virulence target of the begomovirus nuclear shuttle protein (NSP). |
| AT1G60800 | Encodes one of a group of LRR-RLKs, designated as CLAVATA3 INSENSITIVE RECEPTOR KINASES (CIKs), that act as co-receptors and have essential roles in regulating CLV3-mediated stem cell homeostasis. |
| AT2G27300 | NTL8 is a membrane-associated NAC transcription factor that binds both TRY and TCL1. Overexpression results in fewer trichomes. |
| AT1G03530 | nuclear assembly factor 1;(source:Araport11) |
| AT4G37210 | Encodes a predominantly nuclear histone chaperone that promotes [H3-H4]2 tetrasome formation and does not promote disassembly of in vitro preassembled tetrasomes. |
| AT4G14350 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT1G03920 | Protein kinase family protein;(source:Araport11) |
| AT2G19400 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT4G33080 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT1G30640 | Protein kinase family protein;(source:Araport11) |
| AT5G09890 | Protein kinase family protein;(source:Araport11) |
| AT1G06670 | nuclear DEIH-box helicase (NIH) encoding a putative RNA and/or DNA helicase homologous to a group of nucleic acid helicases from the DEAD/H family with nuclear DEIH-box helicase (NIH) distinct N- and C-terminal regions that differ from animal DEIH proteins The mRNA is cell-to-cell mobile. |
| AT1G02560 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). The mRNA is cell-to-cell mobile. |
| AT5G12840 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. |
| AT5G06510 | nuclear factor Y, subunit A10;(source:Araport11) |
| AT3G05690 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. |
| AT2G34720 | nuclear factor Y, subunit A4;(source:Araport11) |
| AT1G54160 | Encodes a member of the CCAAT-binding transcription factor (CBF-B/NF-YA) family. Expression is upregulated in response to ABA and drought. This regulation appears to be mediated by MIR169A which is downregulated in response to drought. NFYA5 is a target of MIR169A. Loss of function mutations are hypersensitive to drought. |
| AT3G14020 | nuclear factor Y, subunit A6;(source:Araport11) |
| AT1G30500 | nuclear factor Y, subunit A7;(source:Araport11) |
| AT1G17590 | Binds directly to CCAAT cis-elements in the promoters of multiple MIR156 genes and inhibits the juvenile-to adult transition by activating transcription of these MIR156s. |
| AT3G20910 | nuclear factor Y, subunit A9;(source:Araport11) |
| AT5G47640 | Involved in the regulation of response to nutrient levels. |
| AT4G14540 | nuclear factor Y, subunit B3;(source:Araport11) |
| AT2G37060 | nuclear factor Y, subunit B8;(source:Araport11) |
| AT1G07980 | nuclear factor Y, subunit C10;(source:Araport11) |
| AT3G12480 | nuclear factor Y, subunit C11;(source:Araport11) |
| AT1G56170 | Encodes a protein with similarity to a subunit of the CCAAT promoter motif binding complex of yeast.One of two members of this class (HAP5B) and expressed in vegetative and reproductive tissues. Involved in the regulation of response to nutrient levels. |
| AT1G54830 | Encodes a NUCLEAR FACTOR-Y C (NF-YC) homologue NF-YC3. NF-YC3., NF-YC4 and NF-YC9 redundantly modulate GA- and ABA-mediated seed germination. |
| AT1G08970 | Encodes a NUCLEAR FACTOR-Y C (NF-YC) homologue NF-YC9. NF-YC3., NF-YC4 and NF-YC9 redundantly modulate GA- and ABA-mediated seed germination. |
| AT5G18440 | Encodes NUFIP that directs assembly of C/D snoRNP (small nucleolar ribonucleoprotein). |
| AT1G31470 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G19520 | Ribosomal pentatricopeptide repeat protein |
| AT5G04050 | Essential maturase splicing factor required for splicing of nad1 introns 1, 3 and 4, holo‐complex I biogenesis, and embryo development. |
| AT1G79280 | Encodes a 237-kDA protein with similarity to vertebrate Tpr, a long coiled-coil proteins of nuclear pore inner basket filaments. It is localized to the inner surface of the nuclear envelope and is a component of the nuclear pore-associated steps of sumoylation and mRNA export in plants. Mutations affect flowering time regulation and other developmental processes. Probably acts in the same pathway as ESD4 in affecting flowering time, vegetative and inflorescence development. |
| AT1G06790 | Encodes a subunit of RNA polymerase III involved in maintaining global RNA homeostasis, not just that of genes transcribed by RNA pol III. |
| AT1G27310 | Encodes an ortholog of yeast NTF2, a nuclear envelop transport protein that functions as the nuclear import receptor for RanGDP, an essential player in nucleocytoplasmic transport. |
| AT1G27970 | Encodes an ortholog of yeast NTF2, a nuclear envelop transport protein that functions as the nuclear import receptor for RanGDP, an essential player in nucleocytoplasmic transport. The mRNA is cell-to-cell mobile. |
| AT1G52980 | Encodes a GTPase that belongs to the subfamily of YlqF/YawG GTPases. Functions in Pre-60S ribosomal subunit maturation. The mRNA is cell-to-cell mobile. |
| AT5G03555 | Encodes PLUTO (plastidic nucleobase transporter), a member of the Nucleobase:Cation-Symporter1 protein family, capable of transporting purine and pyrimidine nucleobases. |
| AT2G27810 | Encodes a plasma-membrane localized nucleobase transporter capable of transporting adenine, guanine, uracil and hypoxanthine. Likely to be a proton-nucleobase symporter. |
| AT1G79150 | binding protein;(source:Araport11) |
| AT1G48920 | Encodes ATNUC-L1 (NUCLEOLIN LIKE 1), the predominant form of the two nucleolin proteins found in Arabidopsis. This protein is involved in rRNA processing, ribosome biosynthesis, and vascular pattern formation. PARL1 localizes to the nucleolus and parl1 mutants accumulate elevated levels of the unspliced 35S pre-rRNA. parl1 mutants also have defects in cotyledon, leaf, sepal, and petal vein patterning and have reduced stature, reduced fertility, increased bushiness, and reduced root length. The sugar-induced expression of ribosome proteins is also reduced in parl1 mutants. The mRNA is cell-to-cell mobile. |
| AT3G18610 | Encodes ATNUC-L2 (NUCLEOLIN LIKE 2). |
| AT1G14850 | Encodes a protein similar to nucleoporin, a a major component of the nuclear pore complex (NPC) involved in cellular nucleo-cytoplasmic transport |
| AT5G20200 | Atypical nuceloporin-like protein. |
| AT4G31240 | protein kinase C-like zinc finger protein;(source:Araport11) |
| AT4G11010 | nucleoside diphosphate kinase 3 (ndpk3), located to the inter-membrane space in mitochondria |
| AT5G18860 | Encodes a purine nucleoside hydrolase active in the apoplast. It might play a role in salvaging extracellular ATP. NSH3 transcript levels rise in response to jasmonic acid and wounding. |
| AT5G56950 | Encodes a member of a small gene family of proteins with similarity to nucleosome assembly proteins.May function in nucleotide excision repair. Loss of function mutations have no obvious visible phenotypes but do seem to affect transcription of NER related genes. Plants mutated in three ubiquitously expressed NAP1 genes (NAP1;1~NAP1;3) and organ-specifically expressed NAP1;4 gene show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. The NAP1 genes act synergistically with NRP genes in promoting somatic homologous recombination. |
| AT4G29730 | cell cycle-related repressor genes encoding WD-repeat proteins. |
| AT3G07050 | Arabidopsis NSN1 encodes a nucleolar GTP- binding protein and is required for maintenance of inflorescence meristem identity and floral organ development. |
| AT4G39390 | Encodes a golgi localized nucleotide sugar transporter. |
| AT1G63000 | nucleotide-rhamnose synthase/epimerase-reductase;(source:Araport11) |
| AT1G68760 | Encodes a cytosol-localized nudix hydrolase that hydrolyzes 8-oxo-(d)GTP to its monophosphate form. This protective mechanism prevents the misincorporation of these oxidized nucleotides into DNA and RNA. NUDX1 also has a low level of dihydroneopterin triphosphate pyrophosphatase activity in vitro and may participate in the folate synthesis pathway. |
| AT3G26690 | Encodes AtNUDT13, a mitochondrial Nudix hydrolase specific for long-chain diadenosine polyphosphates. |
| AT4G11980 | nudix hydrolase homolog 14;(source:Araport11) |
| AT1G28960 | Encodes a ppGpp pyrophosphohydrolase. |
| AT3G12600 | nudix hydrolase homolog 16;(source:Araport11) |
| AT2G01670 | nudix hydrolase homolog 17;(source:Araport11) |
| AT1G14860 | nudix hydrolase homolog 18;(source:Araport11) |
| AT5G20070 | nudix hydrolase homolog 19;(source:Araport11) |
| AT5G47650 | Encodes an ADP-ribose pyrophosphatase that confers enhanced tolerance to oxidative stress. |
| AT5G19460 | nudix hydrolase homolog 20;(source:Araport11) |
| AT1G73540 | nudix hydrolase homolog 21;(source:Araport11) |
| AT1G30110 | Encodes a ppGpp pyrophosphohydrolase. |
| AT3G10620 | Encodes a ppGpp pyrophosphohydrolase. |
| AT1G18300 | nudix hydrolase homolog 4;(source:Araport11) |
| AT5G47240 | nudix hydrolase homolog 8;(source:Araport11) |
| AT2G34160 | Alba DNA/RNA-binding protein;(source:Araport11) |
| AT5G04900 | Encodes a chlorophyll b reducatase involved in the degradation of chlorophyll b and LHCII (light harvesting complex II). |
| AT4G14880 | Encodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis and for the fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA. Lines carrying semi-dominant mutations exhibit early senescence. Required for pollen tube growth and/or fertilization. |
| AT3G05320 | Golgi localized protein with similarity to protein O-fucosyltransferases. Mutants show lower seed set/reduced fertility. Mutant pollen fails to compete with wild type due to the inability to penetrate the stigma-style boundary. |
| AT5G54160 | A caffeic acid/5-hydroxyferulic acid O-methyltransferase. Interacts with 14-4-3 proteins in yeast 2 hybrid assay. AtOMT1 (At5g54160) encodes a flavonol 3?-O-methyltransferase that is highly active towards quercetin and myricetin. The substrate specificity identifies the enzyme as flavonol 3?-methyltransferase which replaces the former annotation of the gene to encode a caffeic acid/5-hydroxyferulic acid O-methyltransferase The mRNA is cell-to-cell mobile. |
| AT3G61990 | Encodes a protein methyltransferase. Involved in the methylation of plant transmembrane proteins. |
| AT3G07780 | Encodes a nuclear PHD finger protein that is functionally redundant with OBE2 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems. The mRNA is cell-to-cell mobile. |
| AT5G60850 | Encodes a zinc finger protein. |
| AT5G53450 | OBP3-responsive protein 1;(source:Araport11) |
| AT1G06160 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT4G31050 | Redundant octanoyltransferase. |
| AT4G25140 | Encodes oleosin1, a protein found in oil bodies, involved in seed lipid accumulation. Suppression of OLEO1 (and OLEO2) resulted in an aberrant phenotype of embryo cells that contain unusually large oilbodies that are not normally observed in seeds. Changes in the size of oilbodies caused disruption of storage organelles, altering accumulation of lipids and proteins and causing delay in germination. Functions in freezing tolerance of seeds. |
| AT5G51210 | Encodes oleosin3, a protein found in oil bodies, involved in seed lipid accumulation. |
| AT5G55920 | Encodes a homolog of the S. cerevisiae Nop2 that is involved in ribosome biogenesis and plays a role on organ size control by promoting cell proliferation and preventing compensation in normal leaf development. |
| AT4G16370 | Encodes a phloem-specific iron transporter that is essential for systemic iron signaling and redistribution of iron and cadmium. It loads iron into the phloem, facilitates iron recirculation from the xylem to the phloem, and regulates both shoot-to-root iron signaling and iron redistribution from mature to developing tissues. |
| AT4G27730 | oligopeptide transporter |
| AT5G64410 | oligopeptide transporter |
| AT4G10770 | oligopeptide transporter |
| AT2G01720 | Ribophorin I;(source:Araport11) |
| AT1G76400 | Ribophorin I;(source:Araport11) |
| AT1G61790 | Encodes the OST3/6 subunit of the hetero-oligomeric plant oligosaccharyltransferase complex (OST). Also identified by GWAS as having a role in interspecific pollen tube recognition. |
| AT1G17370 | Encodes an RNA?binding protein involved in stress granule formation. Regulated by a transposable element small RNA. |
| AT5G02120 | Encodes a one helix protein homologous to cyanobacterial high-light inducible proteins. The protein is localized to the thylakoid membrane and its transcript is transiently induced by exposure to high light conditions. The mRNA is cell-to-cell mobile. |
| AT1G34000 | Encodes a novel member of the Lhc family from Arabidopsis with one predicted transmembrane alpha-helix closely related to helix I of Lhc protein from PSI (Lhca4). Gene expression is triggered by light stress and both transcript and protein accumulate in a light intensity-dependent manner. Ohp2 is associated with PSI under low- or high-light conditions. Together with OHP1, OHP2 is essential for the formation of photosystem II reaction center, even though neither is a part of the final PSII RC. It forms a complex with OHP1 and HCF244, D1, D2, PsbI, and cytochrome b559 at an early stage of PSII de novo assembly and of PSII repair under high-light conditions. |
| AT3G21140 | Pyridoxamine 5-phosphate oxidase family protein;(source:Araport11) |
| AT1G20510 | OPC-8:0 CoA ligase1;(source:Araport11) |
| AT4G33950 | Encodes calcium-independent ABA-activated protein kinase, a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Mutations disrupted ABA induction of stomatal closure as well as ABA inhibition of light-induced stomatal opening. However, regulation of stomatal opening/closing by light or CO(2) is not affected in these mutants. May act in the interval between ABA perception and reactive oxygen species production in the ABA signalling network. |
| AT5G65620 | Zincin-like metalloproteases family protein;(source:Araport11) |
| AT3G48810 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G25270 | Encodes OTP70, a pentatricopeptide repeat protein of the E subgroup involved in splicing of the plastid transcript rpoC1. |
| AT3G13880 | Encodes a pentatricopeptide repeat (PPR) protein involved in RNA editing in mitochondria. |
| AT2G29760 | Encodes a chloroplast RNA editing factor. |
| AT3G57430 | Encodes a chloroplast RNA editing factor. |
| AT3G63370 | Encodes a chloroplast RNA editing factor. |
| AT1G79360 | organic cation/carnitine transporter 2;(source:Araport11) |
| AT1G16370 | organic cation/carnitine transporter 6;(source:Araport11) |
| AT3G20660 | organic cation/carnitine transporter4;(source:Araport11) |
| AT1G79410 | organic cation/carnitine transporter5;(source:Araport11) |
| AT5G16690 | Origin Recognition Complex subunit 3. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with all ORC subunits except ORC1b. |
| AT5G46180 | Encodes an ornithine delta-aminotransferase that is transcriptionally up-regulated in young seedlings and in response to salt stress. It is unlikely to play a role in salt-stress-induced proline accumulation, however, it appears to participate in arginine and ornithine catabolism. |
| AT2G40000 | ortholog of sugar beet HS1 PRO-1 2;(source:Araport11) |
| AT5G35080 | Encodes a protein involved in the endoplasmic reticulum-associated degradation of glycoproteins. |
| AT2G31020 | OSBP(oxysterol binding protein)-related protein 1A;(source:Araport11) |
| AT4G08180 | OSBP(oxysterol binding protein)-related protein 1C;(source:Araport11) |
| AT4G22540 | OSBP(oxysterol binding protein)-related protein 2A;(source:Araport11) |
| AT4G12460 | OSBP(oxysterol binding protein)-related protein 2B;(source:Araport11) |
| AT2G27350 | Encodes an otubain-like histone deubiquitinase involved in chromatin modification and regulation of plant gene expression. |
| AT3G63160 | Member of the Arabidopsis 7-kDa OEP family. Tail-anchored (TA) membrane protein which possesses a single C-terminal transmembrane domain targeting post-translationally to plastids. |
| AT2G28120 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G38025 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT3G62940 | Induces cross-talks among epigenomes that altogether impact the regulation of approximately 7060 genes of which 186 genes associated with root development. |
| AT2G30395 | Member of the plant specific ovate protein family of unknown function. |
| AT3G52540 | ovate family protein 18;(source:Araport11) |
| AT4G18830 | Member of the ovate protein family.Interacts with BLH1 and KNAT3. Regulates the subcellular localization of BLH1.I May also directly affect microtubule organization via interactions with TON2. |
| AT3G52525 | ovate family protein 6;(source:Araport11) |
| AT5G11270 | Encodes a homeodomain transcription factor involved in mediating resistance to infection by necrotrophic pathogens dependent on perception of jasmonic acid through COI1. Expressed in the nucleus. Downregulated upon fungal infection. Also involved in drought tolerance. |
| AT3G55400 | methionyl-tRNA synthetase / methionine-tRNA ligase / MetRS (cpMetRS);(source:Araport11) |
| AT1G25350 | glutamine-tRNA ligase, putative / glutaminyl-tRNA synthetase, putative / GlnRS;(source:Araport11) |
| AT5G39590 | TLD-domain containing nucleolar protein;(source:Araport11) |
| AT2G19810 | Encodes Oxidation-related Zinc Finger 1 (OZF1), a plasma membrane protein involved in oxidative stress. |
| AT4G29190 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT2G41900 | AtOXS2 specifcally entered the nuclear under salt stress. Te specifc nuclear localization of AtOXS2 could play a role in salt tolerance at the molecular level. Tese results implied that AtOXS2 might target some downstream cis-elements which are required for salt stress responses |
| AT5G56550 | Encodes OXIDATIVE STRESS 3 (OXS3)， involved in tolerance to heavy metals and oxidative stress. |
| AT2G06050 | Encodes a 12-oxophytodienoate reductase that is required for jasmonate biosynthesis. Mutants are male sterile and defective in pollen dehiscence. Shows activity towards 2,4,6-trinitrotoluene. CFA-Ile, CFA-Leu, CFA-Val, CFA-Met and CFA-Ala can restore the fertility of opr3 plants by inducing filament elongation and anther dehiscence. |
| AT4G33520 | Encodes a putative metal-transporting P-type ATPase PAA1. An alternative-splicing event of the PAA1 pre-mRNA produces a copper chaperon named PCH1. The mRNA is cell-to-cell mobile. |
| AT5G21930 | P-Type ATPase, mediates copper transport to chloroplast thylakoid lumen. Required for accumulation of copper-containing plastocyanin in the thylakoid lumen and for effective photosynthetic electron transport |
| AT5G57780 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
| AT3G29370 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
| AT3G07680 | Encodes an Golgi-localized p24 protein. Interacts with p24delta5 at ER export sites for ER exit and coupled transport to the Golgi apparatus. The mRNA is cell-to-cell mobile. |
| AT1G21900 | Encodes an ER-localized p24 protein. Interacts with p24beta2 at ER export sites for ER exit and coupled transport to the Golgi apparatus. Once in the Golgi, p24delta5 interacts very efficiently with the COPI machinery for retrograde transport back to the ER. |
| AT4G24520 | Encodes a cyp450 reductase likely to be involved in phenylpropanoid metabolism. |
| AT5G39860 | Encodes PRE1 (PACLOBUTRAZOL RESISTANCE1). PRE1 and IBH1 form a pair of antagonistic HLH/bHLH transcription factors that function downstream of BZR1 to mediate brassinosteroid regulation of cell elongation. BNQ1 is directly and negatively regulated by AP3 and PI in petals.Required for appropriate regulation of flowering time. |
| AT2G32240 | PAMP induced protein involved in defense response. Interaction with UBAC2 proteins in the ER, is necessary for PAMP mediated accumulation of the callose synthase PMR4. |
| AT1G60440 | The gene AT1G60440 encodes pantothenate kinase 1. Its molecular function was shown to phosphorylate pantothenate to form 4?-phosphopantothenate. |
| AT3G19180 | Encodes a chloroplast division factor located in the plastid inner envelope with its N-terminus exposed to the stroma. PARC6 influences FtsZ assembly and is required for recruitment of PDV1 during chloroplast division. |
| AT4G17410 | PQT3 is a nuclear localized E3 ligase involved in negative regulation of stress tolerance.PRMT4b is a substrate of PQT3. |
| AT1G11400 | The PYM gene encodes a protein capable of interacting with MAGO, and Y14, whose orthologs form part of the exon junction complex in animal cells. In vitro binding assays indicate that PYM can bind to MAGO and Y14 either individually, or when they are together. But, MAGO-Y14-PYM ternary complexes are difficult to detect in vivo in Arabidopsis based on pull-down experiments. However there is some evidence for a weak association in Arabidopsis flowers. PYM appears primarily cytoplasmic, but it also seems to into the nucleus at times. Its nuclear localization signal has not been rigorously defined, but there is evidence for a nuclear export signal between amino acids 171-205 in the C-terminus. |
| AT1G19300 | The PARVUS/GLZ1 gene encodes a putative family 8 glycosyl transferase that contributes to xylan biosynthesis. Its gene expression shows good co-variance with the IRX3 gene involved in secondary cell wall synthesis. PARVUS/GLZ1 is predicted to have galacturonosyltransferase activity and may be involved in the formation of the complex oligosaccharide sequence present at the reducing end of xylan. PARVUS is expressed in cells undergoing secondary wall thickening, and parvus mutants have thinner cell walls. |
| AT2G02710 | Encodes a putative blue light receptor protein. |
| AT5G10480 | Protein tyrosine phosphatase-like involved in cell division and differentiation. Interacts with CDKA;1 only in its phosphorylated form, preventing dephosphorylation. Overexpression slowed down cell division in suspension cell cultures at the G2-to-M transition and early mitosis and inhibited Arabidopsis seedling growth. Localized in the cytoplasm of dividing cells but moved into the nucleus upon cell differentiation. Based on complementation of yeast mutant PAS2 has acyl-CoA dehydratase activity. It interacts with CER10, a component of the microsomal fatty acid elongase complex, suggesting a role in synthesis of VLCFAs (very long chain fatty acids). |
| AT3G22270 | Topoisomerase II-associated protein PAT1;(source:Araport11) |
| AT4G14990 | Topoisomerase II-associated protein PAT1;(source:Araport11) |
| AT3G63200 | PATATIN-like protein 9;(source:Araport11) |
| AT3G54950 | Encodes pPLAIIIbeta, a member of the Group 3 patatin-related phospholipases. pPLAIIIbeta hydrolyzes phospholipids and galactolipids and additionally has acyl-CoA thioesterase activity. Alterations of pPLAIIIβ result in changes in lipid levels and composition. |
| AT1G72150 | novel cell-plate-associated protein that is related in sequence to proteins involved in membrane trafficking in other eukaryotes The mRNA is cell-to-cell mobile. |
| AT1G22530 | PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells. |
| AT5G06370 | PSE1 is a single copy gene that is induced in response to lead and confers increased tolerance to lead when overexpressed. It is localized to the cytoplasm. The protein has an NC domain. PSE1 appears to regulate tolerance via a GSH dependent phytochelatin synthesis pathway. |
| AT3G55450 | PBS1-like 1;(source:Araport11) |
| AT3G01300 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G28690 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G28940 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G21750 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily; isoform contains non-consensus GA donor splice site at intron 9. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response. The mRNA is cell-to-cell mobile. |
| AT1G77510 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. This protein has been shown to be an attenuator of D1 synthesis, modulating photoinhibition in a light-regulated manner. |
| AT3G54960 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response. |
| AT5G60640 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). However, the level of transcripts for this gene is slightly elevated in atbzip60 mutants. |
| AT1G52260 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). |
| AT3G16110 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). |
| AT1G04980 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. |
| AT2G32920 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. |
| AT4G14720 | PPD2 (and its paralog, PPD1) encode plant-specific putative DNA-binding proteins. Deletion of the PPD locus increases leaf lamina size and results in dome-shaped rather than flat leaves. Siliques are also altered in shape because of extra lamina growth. |
| AT5G04310 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G05910 | Pectinacetylesterase family protein;(source:Araport11) |
| AT3G09410 | Pectinacetylesterase family protein;(source:Araport11) |
| AT2G46930 | Encodes a pectin acetylesterase that removes cell wall acetate associated with pectin formation in Arabidopsis leaves. |
| AT4G19420 | Pectinacetylesterase family protein;(source:Araport11) |
| AT5G23870 | Encodes a pectin acetylesterase that removes cell wall acetate associated with pectin formation in Arabidopsis leaves. |
| AT5G62360 | Pectin methylesterase inhibitor expressed throughout the plant. |
| AT1G53840 | encodes a pectin methylesterase |
| AT2G26440 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT1G53830 | encodes a pectin methylesterase |
| AT3G14310 | encodes a pectin methylesterase, targeted by a cellulose binding protein (CBP) from the parasitic nematode Heterodera schachtii during parasitism. |
| AT3G49220 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G47500 | predicted to encode a pectin methylesterase |
| AT5G49180 | Encodes a putative pectin methylesterase. The gene is preferentially expressed in floral buds and more specifically in mucilage secretory cells of seeds. Mutants have smaller mucilage cells and abnormal mucilage profiles. |
| AT4G25260 | Pectin methylesterase inhibitor. Forms pH dependent complex with PME3. |
| AT5G53370 | pectin methylesterase PCR fragment F;(source:Araport11) |
| AT1G59870 | ATP binding cassette transporter. Localized to the plasma membrane in uninfected cells. In infected leaves, the protein concentrated at infection sites. Contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration in a salicylic acid?dependent manner. Required for mlo resistance. Has Cd transporter activity (Cd2+ extrusion pump) and contributes to heavy metal resistance. The mRNA is cell-to-cell mobile. |
| AT4G15340 | Encodes a protein that catalyzes the production of the tricyclic triterpene arabidiol when expressed in yeast. |
| AT1G62590 | Encodes a functional adenylate cyclase. |
| AT3G23020 | Encodes a chloroplast nucleoid-localized protein whose absence leads to broadly impaired plastid gene expression and chloroplast development. |
| AT1G06580 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G06430 | Encodes PPR2, a pentatricopeptide repeat protein. Binds to plastid 23S rRNA and plays an important role in the first mitotic division during gametogenesis and in cell proliferation during embryogenesis. |
| AT1G11630 | Ribosomal pentatricopeptide repeat protein |
| AT2G03380 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G48470 | hypothetical protein;(source:Araport11) |
| AT1G73080 | Encodes a leucine-rich repeat receptor kinase. Functions as a receptor for AtPep1 to amplify innate immunity response to pathogen attacks. The mRNA is cell-to-cell mobile. |
| AT4G26000 | Encodes a novel Arabidopsis gene encoding a polypeptide with K-homology (KH) RNA-binding modules, which acts on vegetative growth and pistil development. Genetic studies suggest that PEP interacts with element(s) of the CLAVATA signaling pathway. |
| AT1G15390 | encodes a peptide deformylase-like protein. Removes N-formyl groups, a prerequisite for the action of methionine aminopeptidase during protein synthesis. Targeted to mitochondria. Requires Zn for catalysis. |
| AT4G25130 | Encodes a chloroplast-localized methionine sulfoxide reductase that is a member of the MSRA family. Involved in protection of chloroplasts from oxidative stress. |
| AT5G49570 | Encodes a protein that has peptide:N-glycanase activity in enzymatic assay in heterologous systems (although the activity was not detected in wild-type plants). |
| AT3G20640 | Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT1G15440 | Encodes a nucleolar protein that is a ribosome biogenesis co-factor. Mutants display aberrant RNA processing and female gametophyte development. |
| AT5G23940 | Encodes PERMEABLE LEAVES3 (PEL3), a putative acyl-transferase. Mutation in this locus results in altered trichome phenotype (trcichomes become tangled during leaf expansion). Additional phenotype includes altered cuticle layer. |
| AT2G41480 | Encodes a cationic cell-wall-bound peroxidase homolog that is involved in the lignification of cell walls. Regulated by COG1, involved in seed longevity. |
| AT3G32980 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G14540 | Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
| AT5G05340 | Encodes a protein with sequence similarity to peroxidases that is involved in lignin biosynthesis. Loss of function mutations show abnormal development of xylem fibers and reduced levels of lignin biosynthetic enxymes. |
| AT5G15180 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G42180 | Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
| AT5G64120 | Encodes a cell wall bound peroxidase that is induced by hypo-osmolarity and is involved in the lignification of cell walls. Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
| AT2G26350 | Zinc-binding peroxisomal integral membrane protein (PEX10). Inserted directly from the cytosol into peroxisomes and is involved in importing proteins into the peroxisome. Required for embryogenesis. |
| AT1G01820 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
| AT2G45740 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. The mRNA is cell-to-cell mobile. |
| AT3G61070 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
| AT3G21865 | Interacts with PEX4 in a yeast two-hybrid. The PEX4 and PEX22 pair may be important during the remodeling of peroxisome matrix contents as glyoxysomes transition to leaf peroxisomes. |
| AT3G04460 | RING finger protein involved in peroxisome biogenesis. Also involved in peroxisomal import of nitric oxide synthase. Has been demonstrated to have E3 ubiquitin ligase activity. |
| AT3G52960 | Thioredoxin superfamily protein;(source:Araport11) |
| AT2G33150 | Encodes an organellar (peroxisome, glyoxysome) 3-ketoacyl-CoA thiolase, involved in fatty acid b-oxidation during germination and subsequent seedling growth. Mutants have defects in glyoxysomal fatty acid beta-oxidation. EC2.3.1.16 thiolase. |
| AT3G58840 | Encodes PEROXISOMAL AND MITOCHONDRIAL DIVISION FACTOR1. Involved in the morphogenesis and proliferation of peroxisomes and mitochondria. |
| AT2G22780 | encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
| AT5G09660 | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
| AT5G03680 | Recessive mutations are defective in organ initiation and orientation in the second whorl. This gene encodes a trihelix transcription factor whose expression is limited to margins of floral and vegetative organs. Overexpression and double mutant analyses suggest that this gene is involved in limiting lateral growth of organs. |
| AT4G11960 | Encodes PGRL1B, a transmembrane protein present in thylakoids. PGRL1B has a highly homologous isoform PGRL1A encoded by At4g22890. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I). |
| AT2G34710 | Dominant PHB mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. Has overlapping functions with PHAVOLUTA, REVOLUTA and CORONA. |
| AT2G37040 | Encodes PAL1, a phenylalanine ammonia-lyase. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
| AT3G53260 | Encodes phenylalanine lyase. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
| AT3G10340 | Encodes PAL4, a putative a phenylalanine ammonia-lyase. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
| AT4G39230 | encodes a protein whose sequence is similar to phenylcoumaran benzylic ether reductase (PCBER), which catalyzes NADPH-dependent reduction of 8-5' linked lignans such as dehydrodiconiferyl alcohol to give isodihydrodehydrodiconiferyl alcohol. |
| AT1G64370 | filaggrin-like protein;(source:Araport11) |
| AT1G12710 | This gene is predicted to encode a protein with a PP2 domain. This domain in present in lectins found in squash and cucumber, suggesting that this protein could potentially have carbohydrate binding capabilities. |
| AT3G61060 | phloem protein 2-A13;(source:Araport11) |
| AT5G52120 | phloem protein 2-A14;(source:Araport11) |
| AT3G53000 | phloem protein 2-A15;(source:Araport11) |
| AT2G02230 | phloem protein 2-B1;(source:Araport11) |
| AT2G02360 | Encodes an F-box protein containing a Nictaba-related lectin domain that can act as a carbohydrate-binding protein.Expression is induced by SA and pathogenic bacteria. |
| AT1G80110 | phloem protein 2-B11;(source:Araport11) |
| AT5G66410 | Encodes a protein that functions in microtubule assembly. Plants with reduced levels of both PLP3a (At3g50960) and PLP3b show defects in cytokinesis, cortical microtubule array formation, oriented cell growth, and maintenance of proper ploidy. |
| AT2G33770 | Encodes a ubiquitin-conjugating E2 enzyme. UBC24 mRNA accumulation is suppressed by miR399f, miR399b and miR399c. Involved in phosphate starvation response and mediates degradation of PHO1 and PHT1s at endomembrane. Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
| AT5G23630 | A member of the eukaryotic type V subfamily (P5) of P-type ATPase cation pumps; MIA is most similar to the human P5 ATPase ATY2(44% identity) and to Spf1p from S. cerevisiae (41% identity). Highly abundant in the endoplasmic reticulum and small vesicles of developing pollen grains and tapetum cells. T-DNA insertional mutants of MIA suffer from imbalances in cation homeostasis and exhibit a severe reduction in fertility. Mutant microspores fail to separate from tetrads and pollen grains are fragile with an abnormal morphology and altered cell wall structure. MIA is also named PDR2 and was shown to be required for proper expression of SCARECROW (SCR), a key regulator of root patterning, and for stem-cell maintenance in Pi-deprived roots. |
| AT4G28610 | Similar to phosphate starvation response gene from Chlamydomonas. Weakly responsive to phosphate starvation. Acts upstream of PHO2 in phosphate signaling and PHT1;1 in arsenate accumulation. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
| AT2G38940 | Encodes Pht1;4, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
| AT3G26570 | low affinity phosphate transporter |
| AT5G14040 | Encodes a mitochondrial phosphate transporter. Modulates plant responses to salt stress. |
| AT2G29650 | Encodes an inorganic phosphate transporter (PHT4;1) that is localized to the thylakoid membrane. |
| AT2G38060 | Encodes an inorganic phosphate transporter (PHT4;2). |
| AT3G52190 | Encodes a plant specific protein structurally related to the SEC12 proteins of the early secretory pathway. Mutation of PHF1 impairs Pi transport. Expression was detected in all tissues, and was induced by Pi starvation. Localized in endoplasmic reticulum (ER), and mutation of PHF1 resulted in ER retention and reduced accumulation of the plasma membrane PHT1;1 transporter. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
| AT1G35140 | EXL1 is involved in the C-starvation response. Phenotypic changes of an exl1 loss of function mutant became evident only under corresponding experimental conditions. For example, the mutant showed diminished biomass production in a short-day/low light growth regime, impaired survival during extended night, and impaired survival of anoxia stress. |
| AT2G01180 | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves. |
| AT3G09560 | The PAH1 gene encodes a phosphatidate phosphohydrolase. Mutant analysis revealed its involvement in galactolipid synthesis pathway, and the membrane lipid remodeling. The pah1pah2 double-mutant showed enhanced Al-susceptibility under low-P conditions, but there was no significant differences in Al tolerance between pah1pah2 and wild type when they were grown in a solution containing 35 μM Pi. |
| AT3G09920 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) family member. Family members are key enzymes in the process of phosphatidylinositol signaling pathway and have essential functions in growth, development, and biotic and abiotic stresses responses in plants |
| AT2G39290 | Encodes a phosphatidylglycerolphosphate synthase 2C which is dual-targeted into chloroplasts and mitochondria. Mutant plants have mutant chloroplasts but normal mitochondria. |
| AT5G64070 | Encodes a phosphatidylinositol 4-OH kinase, PI-4Kbeta1. Arabidopsis contains 12 PI-4Ks in three separate families: PI-4Kalphs, PI-4kbeta, and PI-4Kgamma. PI-4Kbeta1 is 83% identical to PI-4kbeta2 encoded by At5g09350. Interacts with the RabA4b GTPase. Important for polarized root hair growth as the loss of this gene and its close relative PI-4kbeta2, leads to the formation of abnormal root hairs. |
| AT1G03050 | Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane. |
| AT4G01190 | Type I phosphatidylinositol-4-phosphate 5-kinase, subfamily A. Preferentially phosphorylates PtdIns4P. Expressed in flowers and inflorescence stems. |
| AT1G68000 | phosphatidylinositol synthase 1 |
| AT2G41210 | Encodes a protein with phosphatidylinositol-4-phosphate 5-kinase activity that plays a role in pollen tip growth. The enzyme localizes to the apical plasma membrane and adjacent cytosolic region of pollen tubes. Overexpression of this gene leads to increased deposition of pectin in the cell wall at the tip of the pollen tube and causes altered pollen tube morphology. |
| AT1G21980 | Type I phosphatidylinositol-4-phosphate 5-kinase. Preferentially phosphorylates PtdIns4P. Induced by water stress and abscisic acid in Arabidopsis thaliana. Expressed in procambial cells of leaves, flowers and roots. A N-terminal Membrane Occupation and Recognition Nexus (MORN)affects enzyme activity and distribution. |
| AT5G58700 | phosphatidylinositol-speciwc phospholipase C4;(source:Araport11) |
| AT3G47220 | Encodes a plasma membrane-localized phosphoinositide-specific phospholipase C with a role in thermotolerance. |
| AT3G47290 | phosphatidylinositol-speciwc phospholipase C8;(source:Araport11) |
| AT1G15110 | PSS1 encodes a base-exchange-type Phosphatidylserine (PS) synthase. Mutant analysis revealed its role in pollen maturation. |
| AT3G01550 | phosphoenolpyruvate (pep)/phosphate translocator 2;(source:Araport11) |
| AT4G37870 | Encodes a phosphoenolpyruvate carboxykinase that localizes to the cytosol. |
| AT1G53310 | Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins.Plays an important role in carbon and nitrogen metabolism. |
| AT2G42600 | Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins.PPC1 and PPC2 are crucial for balancing carbon and nitrogen metabolism. |
| AT1G68750 | Encodes one of four Arabidopsis phosphoenolpyruvate (PEP) carboxylase proteins. But, it is more similar to bacterial PEP carboxylase than plant PEP carboxylase. Efforts to express this enzyme and to demonstrate its enzymatic activity in E.coli failed. |
| AT3G04530 | Encodes a second Arabidopsis phosphoenolpyruvate carboxylase kinase gene product with a different expression pattern from PPCK1. Expression of the gene is upregulated by exposure of the plant to light and is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
| AT1G12580 | phosphoenolpyruvate carboxylase-related kinase 1;(source:Araport11) |
| AT4G29220 | phosphofructokinase 1;(source:Araport11) |
| AT5G47810 | phosphofructokinase 2;(source:Araport11) |
| AT4G32840 | phosphofructokinase 6;(source:Araport11) |
| AT5G56630 | phosphofructokinase 7;(source:Araport11) |
| AT5G51820 | Encodes a plastid isoform of the enzyme phosphoglucomutase involved in controlling photosynthetic carbon flow. Effective petiole movement against the direction of the gravity requires functional PGM activity that is required for full development of amyloplasts. |
| AT1G70730 | Encodes a cytosolic phosphoglucomutase (PGM). Two Arabidopsis PGM proteins (AT1G70730/PGM2 and AT1G23190/PGM3) have high sequence similarities and redundant functions. Mature plants possessing a single cPGM allele had a major reduction in cPGM activity. Whereas pgm2 and pgm3 single mutants are undistinguishable from the wild type, loss of both PGM2 and PGM3 severely impairs male and female gametophyte development. |
| AT1G23190 | Encodes a cytosolic phosphoglucomutase (PGM). Two Arabidopsis PGM proteins (AT1G70730/PGM2 and AT1G23190/PGM3) have high sequence similarities and redundant functions. Mature plants possessing a single cPGM allele had a major reduction in cPGM activity. Whereas pgm2 and pgm3 single mutants are undistinguishable from the wild type, loss of both PGM2 and PGM3 severely impairs male and female gametophyte development. The mRNA is cell-to-cell mobile. |
| AT1G78050 | phosphoglycerate/bisphosphoglycerate mutase;(source:Araport11) |
| AT2G46500 | Phosphoinositide kinase which undergo autophosphorylation and phosphorylate serine/threonine residues of protein substrates. Contains phosphoinositide 3/4-kinase and ubiquitin-like domains. Phosphorylates PUFD1 and RPN10 in vitro. |
| AT2G03890 | Phosphoinositide kinase which undergo autophosphorylation and phosphorylate serine/threonine residues of protein substrates. Contains phosphoinositide 3/4-kinase and ubiquitin-like domains. The mRNA is cell-to-cell mobile. |
| AT2G26560 | Encodes a lipid acyl hydrolase with wide substrate specificity that accumulates upon infection by fungal and bacterial pathogens. Protein is localized in the cytoplasm in healthy leaves, and in membranes in infected cells. Plays a role in cell death and differentially affects the accumulation of oxylipins. Contributes to resistance to virus. |
| AT4G16820 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT1G06800 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT3G55940 | Phospholipase C family member. Double mutants with PLC5 show defects in seed coat mucilage, leaf serration and over-expression improves drought tolerance. |
| AT3G15730 | Encodes phospholipase D alpha 1 (PLD alpha 1). Positive regulator of abscisic acid (ABA) mediated stomatal movements. PLD alpha 1 plays an important role in seed deterioration and aging in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT1G55180 | member of C2-PLD. subfamily Represents a phospholipase D (PLD) gene with four exons, hence it is a member of the alpha class. Its amino acid sequence is quite different from other PLDs, therefore it might possess unique structural and/or catalytic properties. |
| AT2G42010 | phospholipase D (PLDbeta) |
| AT4G35790 | Encodes a protein with phospholipase D activity. Involved in phospolipase metabolism. Mutants are affected in hydrogen peroxide mediated cell death. |
| AT4G11850 | Encodes a phospholipase D (gamma) that is involved in aluminum tolerance and plays a role in membrane lipid modulation under Al stress. |
| AT4G11830 | Encodes one of three phospholipase D enzymes of the gamma class. |
| AT4G11840 | member of C2-PLD subfamily |
| AT3G16785 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Does not appear to be involved in root hair patterning. Not induced upon Pi starvation. |
| AT3G05630 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. Regulates vesicle trafficking. Required for auxin transport and distribution and hence auxin responses. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Plays a major role in phosphatidic acid production during phosphate deprivation. Induced upon Pi starvation in both shoots and roots. Involved in hydrolyzing phosphatidylcholine and phosphatidylethanolamine to produce diacylglycerol for digalactosyldiacylglycerol synthesis and free Pi to sustain other Pi-requiring processes. Does not appear to be involved in root hair patterning. Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT4G39670 | Member of the glycolipid transfer protein (GLTP) superfamily, shuttles ceramide-1-phosphate (C1P) between membranes. |
| AT4G35110 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT1G80860 | Encodes a single-copy phospholipid N-methyltransferase, involved in phosphatidylcholine biosynthesis. Has specific activity towards phosphatidylmonomethylethanolamine and phosphatidyldimethylethanolamine, but not phosphatidylethanolamine. |
| AT1G04010 | phospholipid sterol acyl transferase 1;(source:Araport11) |
| AT5G13640 | arabidopsis phospholipid:diacylglycerol acyltransferase (PDAT) |
| AT2G45790 | Encodes a cytoplasmic phosphomannomutase, involved in ascorbate biosynthesis |
| AT2G42910 | Phosphoribosyltransferase family protein;(source:Araport11) |
| AT1G10700 | Encodes a P-independent phosphoribosyl pyrophosphate (PRPP) synthase. |
| AT1G32060 | phosphoribulokinase;(source:Araport11) |
| AT4G15130 | phosphorylcholine cytidylyltransferase2;(source:Araport11) |
| AT1G12370 | encodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele |
| AT2G16365 | PCH1 binds and stabilizes the active (Pfr) form of phytochrome B and is involved in the formation of photobodies in the nucleus. PCH1 is expressed in evenings and is associated to the evening complex through binding to phyB, and represses hypocotyl elongation and growth. Using mass spec, the existence of the At2g16365.2 isoform has been verified, however here is no evidence that any of the other three variants are present. Atg2G16365.2 will be assigned PCH1; exon 4 and 5 in the other variants are actually another gene of the F-box/DUF295 family with gene name FDA10. |
| AT3G13670 | MUT9-like protein kinase. Contributes to phosphorylation of photoexcited CRY2. Interaction with CRY2 occurs via the non catalytic PPKC domain.MLK4 phosphorylates the conserved H2A serine 95 residue. Synthetic mutants that cannot phosphorylate H2AS95 fail to complement the late flowering phenotype suggesting that MLK4 promotes long day flowering via phosphorylation.MLK4 is required for H2A295 phosphorylation of GI. |
| AT5G18190 | Casein kinase involved in phosphorylation and ubiquination of RYR/PYLs, resulting in negative regulation of ABA response.Also annotated as MUT9-LIKE kinase that functions as H3-T3 specific histone kinase. |
| AT1G25520 | Member of the UPF0016 family of membrane proteins, belongs to the conserved group of Mn/Ca transporters. Might act to fine tune Mn allocation into the endoplasmic reticulum of specific cell types. |
| AT1G68650 | Member of the UPF0016 family of membrane proteins, belongs to the conserved group of Mn/Ca transporters. Might act to fine tune Mn allocation into the endoplasmic reticulum of specific cell types. |
| AT1G15980 | encodes a novel subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in cyclic electron flow around photosystem I to produce ATP. |
| AT5G43750 | NAD(P)H dehydrogenase 18;(source:Araport11) |
| AT1G71500 | Encodes PSB33, a protein conserved in the plastid lineage. PSB33 is associated with the chloroplast thylakoid membrane and provides stability to Photosystem II. The mRNA is cell-to-cell mobile. |
| AT3G54890 | Encodes a component of the light harvesting complex associated with photosystem I. |
| AT1G61520 | PSI type III chlorophyll a/b-binding protein (Lhca3*1) The mRNA is cell-to-cell mobile. |
| AT1G45474 | Encodes a component of the light harvesting complex of photosystem I. |
| AT1G19150 | PSI type II chlorophyll a/b-binding protein (Lhca2*1) mRNA, The mRNA is cell-to-cell mobile. |
| AT2G46820 | Encodes the P subunit of Photosystem I. About 25% of the TMP14 pool appeared to be phosphorylated, and this ratio is not affected by light. Contains seven phosphorylation sites on threonine residue and chloroplast targeting signal. Located in the proximity of PSI-L, -H and -O subunits. Forms oligomers with other members of CURT1 family to modulate grana structure. |
| AT1G03130 | Encodes a protein predicted by sequence similarity with spinach PsaD to be photosystem I reaction center subunit II (PsaD2) |
| AT2G20260 | Encodes subunit E of photosystem I. The mRNA is cell-to-cell mobile. |
| AT1G31330 | Encodes subunit F of photosystem I. |
| AT1G55670 | Encodes subunit G of photosystem I, an 11-kDa membrane protein that plays an important role in electron transport between plastocyanin and PSI and is involved in the stability of the PSI complex. PSI-G subunit is bound to PSI-B and is in contact with Lhca1. The protein inserts into thylakoids by a direct or "spontaneous" pathway that does not involve the activities of any known chloroplast protein-targeting machinery. PSI-G appears to be directly or indirectly involved in the interaction between Photosystem I and plastocyanin. |
| AT3G16140 | Encodes subunit H of photosystem I reaction center subunit VI. |
| AT1G52230 | Phosphorylation of this protein is dependent on calcium. The mRNA is cell-to-cell mobile. |
| AT1G30380 | Encodes subunit K of photosystem I reaction center. The mRNA is cell-to-cell mobile. |
| AT4G12800 | Encodes subunit L of photosystem I reaction center. |
| AT1G08380 | Encodes subunit O of photosystem I. |
| AT2G05100 | Lhcb2.1 protein encoding a subunit of the light harvesting complex II. Member of a gene family with high degree of sequence similarity. Initially LHCB2.3 was considered as a separate gene but appears to be an allele of LHCB2.1. |
| AT2G05070 | Encodes Lhcb2.2. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus. |
| AT3G27690 | Encodes Lhcb2.4. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus. The mRNA is cell-to-cell mobile. |
| AT2G34420 | Photosystem II type I chlorophyll a/b-binding protein |
| AT4G28660 | Similar to PsbW subunit of photosystem II. |
| AT2G20890 | Chloroplast-localized Thylakoid formation1 gene product involved in vesicle-mediated formation of thylakoid membranes. Thf1 antisense lines contain abnormal chloroplasts early in leaf development (chloroplasts have loosely stacked thylakoid membranes). Expression was induced in the light and decreased under dark conditions. G-alpha interaction partner that functions downstream of the plasma membrane?delimited heterotrimeric G-protein (GPA1) in a D-glucose signaling pathway. Localized to both the outer plastid membrane and the stroma. Probably involved in the metabolic pathway that controls the assembly of the PS II complex. The mRNA is cell-to-cell mobile. |
| AT2G30570 | Encodes PsbW, a protein similar to photosystem II reaction center subunit W. Loss of PsbW destabilizes the supramolecular organization of PSII. |
| AT3G50820 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO2 is the minor isoform in the wild-type. Mutants defective in this gene have been shown to be affected in the dephosphorylation of the D1 protein of PSII. |
| AT1G06680 | Encodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution. Phosphorylation of this protein is dependent on calcium. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the stroma. The mRNA is cell-to-cell mobile. |
| AT2G30790 | Encodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution. |
| AT4G05180 | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II. |
| AT4G21280 | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II. |
| AT1G79040 | Encodes for the 10 kDa PsbR subunit of photosystem II (PSII). This subunit appears to be involved in the stable assembly of PSII, particularly that of the oxygen-evolving complex subunit PsbP. Mutants defective in this gene have reduced amounts of subunits PsbP and PsbQ in PSII. In turn, assembly of PsbR is dependent on the presence of PsbJ. |
| AT3G21055 | Encodes photosystem II 5 kD protein subunit PSII-T. This is a nuclear-encoded gene (PsbTn) which also has a plastid-encoded paralog (PsbTc). |
| AT2G06520 | Encodes a protein with sequence similarity to the spinach photosystem II subunit PsbX. |
| AT3G45780 | Blue-light photoreceptor. Contains a light activated serine-threonine kinase domain and LOV1 and LOV2 repeats. Mutants are defective in blue-light response. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT1 undergoes blue-light-dependent autophosphorylation. At least eight phosphorylation sites have been identified in PHOT1. Phosphorylation of serine851 in the activation loop of PHOT1 appears to be required for stomatal opening, chloroplast accumulation, leaf flattening, and phototropism, and phosphorylation of serine849 may also contribute to the regulation of these responses. Phosphorylation-dependent binding of 14-3-3 proteins to the Hinge1 region of PHOT1 appears to require serine350 and serine376. |
| AT5G58140 | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light. The mRNA is cell-to-cell mobile. |
| AT5G20360 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT4G32070 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G29000 | MYB-CC family member. PHL1 acts redundantly with PHR1 to regulate responses to Pi starvation. |
| AT3G24120 | MYB-CC protein involved in regulation of response to phosphate starvation. |
| AT2G20400 | MYB-CC transcription factor. PHL4 is related to PHR1 (which regulates plant Pi starvation response) but it does not seem to have a significant role in Pi starvation. |
| AT4G14150 | Microtubule motor kinesin PAKRP1/Kinesin-12A. Together with PAKRP1L/Kinesin-12B, serve as linkers of the plus ends of antiparallel microtubules in the phragmoplast. |
| AT3G58850 | Encodes PHYTOCHROME RAPIDLY REGULATED2 (PAR2), an atypical basic helix-loop-helix (bHLP) protein. Closely related to PAR1 (At2g42870). Up regulated after simulated shade perception. Acts in the nucleus to control plant development and as a negative regulator of shade avoidance response. Functions as transcriptional repressor of auxin-responsive genes SAUR15 (AT4G38850) and SAUR68 (AT1G29510). |
| AT2G26710 | Encodes a member of the cytochrome p450 family that serves as a control point between multiple photoreceptor systems and brassinosteroid signal transduction. Involved in brassinolide metabolism. Mediates response to a variety of light signals including hypocotyl elongation and cotyledon expansion. |
| AT2G01490 | Encodes a phytanoyl-CoA 2-hydroxylase (PAHX). The mRNA is cell-to-cell mobile. |
| AT3G52430 | Encodes a lipase-like gene that is important for salicylic acid signaling and function in resistance (R) gene-mediated and basal plant disease resistance. PAD4 can interact directly with EDS1, another disease resistance signaling protein. Expressed at elevated level in response to green peach aphid (GPA) feeding, and modulates the GPA feeding-induced leaf senescence through a mechanism that doesn't require camalexin synthesis and salicylic acid (SA) signaling. Required for the ssi2-dependent heightened resistance to GPA. The mRNA is cell-to-cell mobile. |
| AT1G09570 | Light-labile cytoplasmic red/far-red light photoreceptor involved in the regulation of photomorphogenesis. It exists in two inter-convertible forms: Pr and Pfr (active) and functions as a dimer.The N terminus carries a single tetrapyrrole chromophore, and the C terminus is involved in dimerization. It is the sole photoreceptor mediating the FR high irradiance response (HIR). Major regulator in red-light induction of phototropic enhancement. Involved in the regulation of de-etiolation. Involved in gravitropism and phototropism. Requires FHY1 for nuclear accumulation. |
| AT5G48150 | Member of GRAS gene family. Semi-dominant mutant has a reduced response to far-red light and appears to act early in the phytochrome A signaling pathway. |
| AT2G18790 | Red/far-red photoreceptor involved in the regulation of de-etiolation. Exists in two inter-convertible forms: Pr and Pfr (active). Involved in the light-promotion of seed germination and in the shade avoidance response. Promotes seedling etiolation in both the presence and absence of phytochrome A. Overexpression results in etiolation under far-red light. Accumulates in the nucleus after exposure to far red light. The phosphorylation state of the Ser-86 residue of the phytochrome B molecule alters dark reversion of the molecule. The mRNA is cell-to-cell mobile. |
| AT5G07840 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G09530 | Transcription factor interacting with photoreceptors phyA and phyB. Forms a ternary complex in vitro with G-box element of the promoters of LHY, CCA1. Acts as a negative regulator of phyB signalling. It degrades rapidly after irradiation of dark grown seedlings in a process controlled by phytochromes. Does not play a significant role in controlling light input and function of the circadian clockwork. Binds to G- and E-boxes, but not to other ACEs. Binds to anthocyanin biosynthetic genes in a light- and HY5-independent fashion. PIF3 function as a transcriptional activator can be functionally and mechanistically separated from its role in repression of PhyB mediated processes. |
| AT3G62090 | encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. |
| AT3G59060 | Encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. Involved in shade avoidance. Functions as negative regulator of PhyB. Protein levels are modulated by phytochrome B. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
| AT2G43010 | Isolated as a semidominant mutation defective in red -light responses. Encodes a nuclear localized bHLH protein that interacts with active PhyB protein. Negatively regulates phyB mediated red light responses. Involved in shade avoidance response. Protein abundance is negatively regulated by PhyB.Involved in the regulation of response to nutrient levels. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
| AT2G02950 | Encodes a basic soluble protein which can independently bind to either PHYA or PHYB, regardless of whether the phytochromes are in the Pr or Pfr state. PKS1 can be phosphorylated by oat phyA in vitro in a light regulated manner. It is postulated to be a negative regulator of phyB signalling. |
| AT1G14280 | Encodes phytochrome kinase substrate 2. PKS proteins are critical for hypocotyl phototropism. Forms a complex with Phot1, Phot2 and NPH3. |
| AT5G04190 | Encodes phytochrome kinase substrate 4, a phytochrome signaling component involved in phototropism. It is phosphorylated in a phot1-dependent manner in vitro. Phosphorylation is transient and regulated by a type 2- protein phosphatase. |
| AT3G16500 | phytochrome-associated protein 1 (PAP1) |
| AT1G22280 | Encodes a phytochrome-associated protein, PAPP2C (phytochrome-associated protein phosphatase type 2C). PAPP2C interacts in the nucleus with phyA (phytochrome A) and phyB. Functions as a regulator of phytochrome-interacting factor PIF3 by dephosphorylating phytochromes in the nucleus. |
| AT3G46640 | Encodes a myb family transcription factor with a single Myb DNA-binding domain (type SHAQKYF) that is unique to plants and is essential for circadian rhythms, specifically for transcriptional regulation within the circadian clock. LUX is required for normal rhythmic expression of multiple clock outputs in both constant light and darkness. It is coregulated with TOC1 and seems to be repressed by CCA1 and LHY by direct binding of these proteins to the evening element in the LUX promoter. The mRNA is cell-to-cell mobile. |
| AT2G31980 | PHYTOCYSTATIN 2;(source:Araport11) |
| AT4G16500 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT1G06570 | Mutation of the PDS1 locus disrupts the activity of p-hydroxyphenylpyruvate dioxygenase (HPPDase), the first committed step in the synthesis of both plastoquinone and tocopherols in plants. |
| AT2G02220 | Encodes a protein interacting with phytosulfokine, a five amino acid sulfated peptide (YIYTQ). Contains dual guanylate cyclase and kinase catalytic activities that operate in vivo. |
| AT2G22860 | Phytosulfokine 2 precursor, coding for a unique plant peptide growth factor. The mRNA is cell-to-cell mobile. |
| AT3G44735 | Phytosulfokine 3 precursor, coding for a unique plant peptide growth factor. |
| AT3G49780 | Phytosulfokine 3 precursor, coding for a unique plant peptide growth factor. Plants overexpressing this gene (under a 35S promoter), develop normal cotyledons and hypocotyls but their growth, in particular that of their roots, was faster than that of wildtype. |
| AT2G39210 | Major facilitator superfamily transmembrane transporter responsible for the uptake of picolinate herbicides. |
| AT2G48060 | Similar to mechanically sensitive ion channel identified in mouse. Mutants display root helical growth phenotype in agar media suggesting a role in mechanoperception at the root cap. |
| AT5G12130 | integral membrane TerC family protein;(source:Araport11) |
| AT4G38160 | Encodes a member of the mitochondrial transcription termination factor family. MTERF6 is localized to both the mitochondria and chloroplast. It is required for ILE tRNA maturation during chloroplast development. Loss of function of MTERF6 results in plants with defective chloroplasts or reduced rate of photosynthesis when MTERF6 expression is low. |
| AT2G26510 | Encodes a plasma-membrane localized nucleobase transporter capable of transporting adenine, guanine, uracil and hypoxanthine. Likely to be a proton-nucleobase symporter. |
| AT1G76620 | Serine/Threonine-kinase, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT1G70940 | A regulator of auxin efflux and involved in differential growth. PIN3 is expressed in gravity-sensing tissues, with PIN3 protein accumulating predominantly at the lateral cell surface. PIN3 localizes to the plasma membrane and to vesicles. In roots, PIN3 is expressed without pronounced polarity in tiers two and three of the columella cells, at the basal side of vascular cells, and to the lateral side of pericycle cells of the elongation zone. PIN3 overexpression inhibits root cell growth. Protein phosphorylation plays a role in regulating PIN3 trafficking to the plasma membrane. The mRNA is cell-to-cell mobile. |
| AT2G01420 | Encodes a putative auxin efflux carrier that is localized in developing and mature root meristems. It is involved in the maintenance of embryonic auxin gradients. A role for AtPIN4 in generating a sink for auxin below the quiescent center of the root meristem that is essential for auxin distribution and patterning is proposed. In the root, PIN4 is detected around the quiescent center and cells surrounding it, and localizes basally in provascular cells. PIN4 expression is upregulated in brassinosteroid-insensitive mutant (PMID 16141452). |
| AT1G77110 | Rate-limiting factor in saturable efflux of auxins. PINs are directly involved of in catalyzing cellular auxin efflux. |
| AT1G23080 | Encodes a novel component of auxin efflux that is located apically in the basal cell and is involved during embryogenesis in setting up the apical-basal axis in the embryo. It is also involved in pattern specification during root development. In roots, it is expressed at lateral and basal membranes of provascular cells in the meristem and elongation zone, whereas in the columella cells it coincides with the PIN3 domain. Plasma membrane-localized PIN proteins mediate a saturable efflux of auxin. PINs mediate auxin efflux from mammalian and yeast cells without needing additional plant-specific factors. The action of PINs in auxin efflux is distinct from PGPs, rate-limiting, specific to auxins and sensitive to auxin transport inhibitors. PINs are directly involved of in catalyzing cellular auxin efflux. |
| AT5G15100 | Encodes an auxin transporter with a strong expression in a male gametophyte. Mutant studies reveal a role for auxin transport in regulating pollen development and function. It acts together with PIN5. |
| AT1G71090 | Auxin efflux carrier family protein;(source:Araport11) |
| AT5G01990 | Auxin efflux carrier family protein;(source:Araport11) |
| AT5G65980 | Auxin efflux carrier family protein;(source:Araport11) |
| AT2G34650 | Encodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID. |
| AT5G54490 | Encodes a PINOID (PID)-binding protein containing putative EF-hand calcium-binding motifs. The interaction is dependent on the presence of calcium. mRNA expression is up-regulated by auxin. Not a phosphorylation target of PID, likely acts upstream of PID to regulate the activity of this protein in response to changes in calcium levels. |
| AT1G32100 | Encodes a pinoresinol reductase involved in lignan biosynthesis. Expressed strongly in roots and less strongly in stems. Shows specificity for pinoresinol and not lariciresinol. |
| AT4G13660 | Encodes a pinoresinol reductase involved in lignan biosynthesis. Expressed strongly in roots and less strongly in stems. Shows preference for pinoresinol and not lariciresinol. The mRNA is cell-to-cell mobile. |
| AT3G59220 | encodes a cupin-domain containing protein that is similar to pirins which interact with a CCAAT box binding transcription factor. The protein interacts with GPA1 (G protein alpha-subunit) in vitro. Mutants in the gene are affected in germination and early seedling development. |
| AT2G43120 | Encodes a member of the functionally diverse cupin protein superfamily that is involved in susceptibility to the bacterial plant pathogen Ralstonia solanacearum. It stabilizes the papain-like cysteine protease XCP2. The mRNA is cell-to-cell mobile. |
| AT5G20240 | Floral homeotic gene encoding a MADS domain transcription factor. Required for the specification of petal and stamen identities. |
| AT4G02075 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT1G05000 | Encodes an atypical dual-specificity phosphatase. |
| AT3G02800 | Encodes an atypical dual-specificity phosphatase. |
| AT4G03960 | Encodes an atypical dual-specificity phosphatase involved in the negative regulation of defense response to a bacterial pathogen, P. syringae pv. tomato. |
| AT5G16480 | Encodes an atypical dual-specificity phosphatase. |
| AT5G15120 | 2-aminoethanethiol dioxygenase, putative (DUF1637);(source:Araport11) |
| AT5G39890 | Plant Cysteine Oxidase (PCO). Involved in controlling the stability of Group VII ethylene response factors (ERF-VIIs) via N-Arg/degron pathway through catalyzing the oxidation of their N-Cys for subsequent Arginyl-tRNA--protein transferase 1 (ATE1) mediated arginine installation. |
| AT1G08990 | plant glycogenin-like starch initiation protein 5;(source:Araport11) |
| AT2G35710 | Nucleotide-diphospho-sugar transferases superfamily protein;(source:Araport11) |
| AT4G16600 | Nucleotide-diphospho-sugar transferases superfamily protein;(source:Araport11) |
| AT5G05850 | Encodes PIRL1, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen. |
| AT4G35470 | Encodes PIRL4, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
| AT2G17440 | Encodes PIRL5, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. The mRNA is cell-to-cell mobile. |
| AT4G29880 | Encodes PIRL7, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
| AT3G11330 | Encodes PIRL9, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen. |
| AT5G58650 | Encodes PSY1, an18-aa tyrosine-sulfated glycopeptide that promotes cellular proliferation and expansion. PSY1 is widely expressed in various tissues, including shoot apical meristem, and is highly up-regulated by wounding. Perception of PSY1 depends on At1g72300, a leucine-rich repeat receptor kinase (LRR-RK). |
| AT1G29340 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity. It is required for cell death and full resistance specified by Arabidopsis RPM1 and RPS4 resistance proteins against Pseudomonas syringae pv tomato. The mRNA is cell-to-cell mobile. |
| AT1G10560 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT1G60190 | Encodes PUB19, a plant U-box armadillo repeat protein. Involved in salt inhibition of germination together with PUB18. The mRNA is cell-to-cell mobile. |
| AT3G52450 | Encodes a cytoplasmically localized U-box domain E3 ubiquitin ligase protein that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT2G35930 | Encodes a cytoplasmically localized U-box domain containing E3 ubiquitin ligase that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT3G11840 | Encodes a U-box-domain-containing E3 ubiquitin ligase that acts as a negative regulator of PAMP-triggered immunity. |
| AT3G19380 | PUB25 and PUB26 are closely related paralogs that encode functional E3 ligases. They function in immune response pathway by targeting BIK1 for degradation. |
| AT3G18710 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT3G47820 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G40140 | Encodes a ubiquitin E3 ligase of the U-box type that mediates the proteasomal degradation of BZR1 in a root-specific manner. |
| AT1G76390 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G18320 | One of three tandemly located, paralogous plant U-box proteins. Mutants show increased sensitivity to water stress.Expression in roots is enhanced by auxin and to a lesser extent ABA and cytokinin treatment. |
| AT5G18340 | One of three tandemly located, paralogous plant U-box proteins. Mutants show increased sensitivity to water stress. E3 ligase which acts as a regulator in the heat response signaling pathway. Over-expressing AtPUB48 could induce the expression of the heat-related genes (HSP101, HSP70, HSP25.3, HSFA2, and ZAT12). Enhances plant resistance to heat stress during seed germination and seedling growth. |
| AT1G01680 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G23030 | Encodes a plant U-Box protein that is capable of binding and ubiquitinating a variety of targets including MYC2,LRR1,KIN and acting as an E3 ligase. Regulates a number of physiological hormonal and environment al responses via selective degradation of targets.Unlike PUB10, its closest homolog in Arabidopsis, it does not appear to play a major role in the MeJA-mediated response. |
| AT1G71020 | Encodes a nuclear localized plant U-Box protein that interacts with MYC2 and regulates its stability by acting as an E3 ubiquitin ligase and polyubiquitinating MYC2. By this mechanism, it targets MYC2 for destruction thereby affecting JA signaling. |
| AT4G04210 | Arabidopsis thaliana CDC48-interacting UBX-domain protein (PUX4) |
| AT1G14570 | Encodes a nuclear UBX-containing protein that can bridge ubiquitin to AtCDC48A. |
| AT2G40120 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G67690 | Zincin-like metalloproteases family protein;(source:Araport11) |
| AT4G36650 | Encodes a protein with similarity to the general transcription factor TFIIB. pBRP binds rDNA sequences in vitro. pBRP has been localized to the outer face of the plastid membrane with GFP fusion however, under conditions of proteosome inhibition it is found in the nucleus. |
| AT5G19930 | PGR is putative plasma membrane glucose- responsive regulator that is expressed in response to glucose stimulation.RNAi knockdown mutant seeds have enhanced sensitivity to glucose and 2-deoxyglucose. |
| AT4G00430 | a member of the plasma membrane intrinsic protein subfamily PIP1. involved redundantly with PIP1;1/2/3/5 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
| AT3G61430 | a member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development. The mRNA is cell-to-cell mobile. |
| AT3G54820 | plasma membrane intrinsic protein 2;(source:Araport11) |
| AT2G16850 | plasma membrane intrinsic protein 2;(source:Araport11) |
| AT2G39010 | plasma membrane intrinsic protein 2E;(source:Araport11) |
| AT4G35100 | a member of the plasma membrane intrinsic protein PIP. functions as aquaporin. Salt-stress-inducible MIP |
| AT4G20260 | Encodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels. The mRNA is cell-to-cell mobile. |
| AT1G18650 | Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and is predicted to bind callose. |
| AT1G69295 | Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and is predicted to bind callose. |
| AT3G58100 | Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and is predicted to bind callose. |
| AT2G33330 | Encodes a plasmodesmal protein that affects the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT3G04370 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT1G19880 | Encodes a regulator of chromatin condensation 1 (RCC1) family protein; confers plasticity of rosette diameter in response to changes in N availability. |
| AT3G18680 | Encodes a functional UMP Kinase located in the plastid that binds to group II intron plastid transcription products. Mutants show decreased accumulation of target transcripts/proteins. |
| AT5G53280 | An integral outer envelope membrane protein (as its homolog PDV2), component of the plastid division machinery. Similar to ARC5, PDV1 localized to a discontinuous ring at the division site in wild-type plants. PDV1 and PDV2 are required for localization of ARC5 at the chloroplast division site. Topological analysis showed that the large N-terminal region of PDV1 upstream of the transmembrane helix bearing a putative coiled-coil domain is exposed to the cytosol. Mutation of the conserved PDV1 C-terminal Gly residue did not block PDV1 insertion into the outer envelope membrane but did abolish its localization to the division site. The mRNA is cell-to-cell mobile. |
| AT3G62590 | PLIP3 is a glycerolipid A1 lipase with substrate specificity for phosphatidylglycerol. Expression is induced by ABA. |
| AT3G61680 | PLIP1 encodes a plastid localized phospholipase A1 involved in seed oil biosynthesis. |
| AT1G02660 | PLIP2 is a glycerolipid A1 lipase with substrate preference for monogalactosyldiacylglycerol. Expression is induced by ABA. |
| AT1G42550 | Encodes a plant-specific protein of unknown function that appears to be conserved among angiosperms. The mRNA is cell-to-cell mobile. |
| AT1G10522 | Encodes PRIN2 (plastid redox insensitive 2). PRIN2 mutants are impaired in PEP (plastid-encoded RNA polymerase) activity and high light-dependent plastid redox signalling to the nucleus. |
| AT2G24090 | Ribosomal protein L35;(source:Araport11) |
| AT3G13120 | Ribosomal protein S10p/S20e family protein;(source:Araport11) |
| AT3G54210 | Ribosomal protein L17 family protein;(source:Araport11) |
| AT5G47190 | Ribosomal protein L19 family protein;(source:Araport11) |
| AT5G65220 | Ribosomal L29 family protein;(source:Araport11) |
| AT1G29070 | Ribosomal protein L34;(source:Araport11) |
| AT3G02150 | a chloroplast trans-acting factor of the psbD light-responsive promoter.TCP gene involved in heterochronic control of leaf differentiation. |
| AT3G46780 | plastid transcriptionally active 16;(source:Araport11) |
| AT1G80480 | plastid transcriptionally active 17;(source:Araport11) |
| AT1G74850 | Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression. PEP complex component. |
| AT1G21600 | Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression. essential subunit of the plastid-encoded RNA polymerase (PEP). Mediates phytochrome signaling. |
| AT4G20010 | Organellar Single-stranded DNA Binding protein. Decreases MMEJ on long ssDNA templates. |
| AT3G56910 | Encodes PSRP5 (PLASTID-SPECIFIC 50S RIBOSOMAL PROTEIN 5). Functions in plastid translation. |
| AT5G17870 | plastid-specific ribosomal protein 6 precursor (Psrp-6) - like |
| AT5G16150 | Encodes a putative plastidic glucose transporter. |
| AT1G76100 | One of two Arabidopsis plastocyanin genes. Expressed at 1/10th level of PETE2. Does not respond to increased copper levels and is thought to be the isoform that participates in electron transport under copper-limiting conditions. Mutation of this gene does not have obvious effect on photosynthesis. |
| AT4G39730 | PLAT1 domain stress protein family member. Involved in mediating response to stresses such as pathogen infection. It is found in endoplasmic reticulum bodies. PLAT1 is induced by pathogenic fungi and induces the production of scopolin. |
| AT2G22170 | Lipase/lipooxygenase, PLAT/LH2 family protein;(source:Araport11) |
| AT5G39570 | Protein of unknown function. Binds phosphatidic acid and acts downstream of PLDalpha. |
| AT2G45800 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. |
| AT1G01780 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. The mRNA is cell-to-cell mobile. |
| AT3G09400 | Similar to POLTERGEIST (POL) protein phosphatase 2C. No phenotype observed in plants homozygous for a null allele. Ubiquitously expressed. |
| AT1G07630 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT4G39403 | Encodes a 36 amino acid polypeptide that is necessary for correct responses to cytokinins and auxins, correct cell expansion in the root, and for vascular patterning in the leaf. Mutation of PLS results in an enhanced ethylene-response phenotype, defective auxin transport and homeostasis, and altered microtubule sensitivity to inhibitors. |
| AT1G67960 | POD1 is involved in pollen tube guidence and early embryo patterning. |
| AT5G20690 | PRK6 is pollen specific receptor kinase that functions as a receptor for the pollen attractant LURE1 in pollen tube guidance. It is localized to the tip the pollen tube and becomes asymmetrically distributed towards the source of the LURE1 signal prior to pollen tube growth reorientation. |
| AT3G22200 | Genetically redundant with POP3;mediates pollen tube guidance. Double mutants are self sterile; gamma-aminobutyrate transaminase subunit precursor; nuclear gene for mitochondrial product. Encodes gamma-aminobutyrate transaminase that uses pyruvate instead of alpha-ketoglutarate as cosubstrate. Mutations in POP2/HER1 render roots resistant to the inhibitory growth effects of the volatile organic compound E-2-hexenal implicated in plant defense. |
| AT2G46920 | Pol mutations are recessive, partial suppressors of meristem defects in strong clv1 and clv3 mutants, and nearly complete suppressors of weak clv1 mutants. Single mutants appear normal. Acts downstream of the CLV signaling pathway in meristem development and is required together with PLL1 for stem-cell maintenance through the regulation of WUS. |
| AT2G28890 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT4G34110 | Putative poly-A binding protein. Member of a gene family .Expressed in stele and root meristem and post-fertilization ovules.Member of the class II family of PABP proteins. The mRNA is cell-to-cell mobile. |
| AT1G22760 | Putative poly(A) binding protein May there fore function in posttranscriptional regulation, including mRNA turnover and translational initiation. Expression detected only in floral organs. |
| AT3G16380 | polyadenylate-binding protein, putative / PABP, putative, similar to polyadenylate-binding protein (poly(A)-binding protein) from {Arabidopsis thaliana} SP:P42731, (Cucumis sativus) GI:7528270, {Homo sapiens} SP:Q13310, {Arabidopsis thaliana} SP:Q05196; contains InterPro entry IPR000504: RNA-binding region RNP-1 (RNA recognition motif) (RRM). Member of the class III family of PABP proteins. |
| AT1G71770 | Encodes a Class I polyA-binding protein. Expressed in floral organs. Binds polyA sepharose in vitro. |
| AT5G51120 | Encodes a homolog of the protein PABN1, a polyadenylation factor subunit. |
| AT5G13700 | Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants). |
| AT2G43020 | Encodes a polyamine oxidase. |
| AT3G59050 | Encodes a polyamine oxidase. |
| AT1G65840 | encodes a peroxisomal polyamine oxidase, involved in the back-conversion polyamine degradation pathway. Among the five polyamine oxidases in the Arabidopsis genome, PAO4 is the major isoform in root peroxisomes. The mRNA is cell-to-cell mobile. |
| AT1G31820 | Encodes POLYAMINE UPTAKE TRANSPORTER 1, an amino acid permease family protein. |
| AT1G31830 | Encodes POLYAMINE UPTAKE TRANSPORTER 2, an amino acid permease family protein. |
| AT3G19553 | Encodes POLYAMINE UPTAKE TRANSPORTER 5, an amino acid permease family protein. |
| AT1G60390 | polygalacturonase 1;(source:Araport11) |
| AT1G70370 | Polygalacturonase involved in cell wall modification. |
| AT5G06860 | Encodes a polygalacturonase inhibiting protein involved in defense response. PGIPs inhibit the function of cell wall pectin degrading enzymes such as those produced by fungal pathogens. PGIP1 is induced by fungal infection. Suppressed in the proton sensitive stop1-mutant, but the transcription level was recovered by transformation of STOP2. Knockout mutant showed severe damage in the root tip in low Ca and low pH medium. |
| AT1G78400 | PGX2 is a cell wall protein that codes for a polygalacturonase. |
| AT1G48100 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G18830 | This gene encodes a plasma membrane-localized polyol/cyclitol/monosaccharide-H+-symporter. The symporter is able to catalyze the energy-dependent membrane passage of a wide range of linear polyols (three to six carbon backbone), of cyclic polyols (myo-inositol), and of numerous monosaccharides, including pyranose ring-forming and furanose ring-forming hexoses and pentoses. This gene belongs to a monosaccharide transporter-like (MST-like) superfamily. |
| AT4G36670 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G72590 | Encodes a polyphenol reductase. |
| AT4G23660 | Encodes para-hydroxy benzoate polyprenyl diphosphate transferase. The enzyme was shown to be able to use a wide range of prenyl substrates : from GPP (C10) to decaprenyl diphosphate (C50). |
| AT3G01150 | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination. |
| AT4G05320 | One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. The mRNA is cell-to-cell mobile. |
| AT5G03240 | encodes ubiquitin that is attached to proteins destined for degradation. UBQ3 is most homologous with UBQ4, and is expressed in higher levels in vegetative tissue but lower levels in flowers than UBQ4. UBQ3 encodes different number of ubiquitins in different ecotypes. UBQ3 transcript level is modulated by UV-B and light/dark treatments. |
| AT1G05850 | Encodes an endo chitinase-like protein AtCTL1. Essential for tolerance to heat, salt and drought stresses. Also involved in root hair development, cell expansion and response to cytokinin. Allelic to erh2. 11 alleles described in Hauser (1995). Mutant is defective in acquired thermotolerance, appears semidwarf throughout its life cycle and has extra lateral branches. There are two EMS alleles. Expression of AtHSP101 is not affected in the mutants. |
| AT4G07410 | Encodes a WD-40 protein expressed both during embryo development and postembryonically in the SAM and RAM that functions in the auxin pathway, integrating auxin signaling in the organization and maintenance of the SAM and RAM. |
| AT3G47640 | Encodes POPEYE (PYE), a bHLH transcription factor regulating response to iron deficiency in Arabidopsis roots. |
| AT2G18740 | Putative temperature-specific splice regulator of development. Only the first splice form (PCP-alpha) has this function as result of C-terminal addition. |
| AT4G24370 | hypothetical protein;(source:Araport11) |
| AT3G15840 | Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport. |
| AT4G02460 | Encodes a protein similar to PMS1 in yeast, a member of the family of eukaryotic MutL homologs. The protein appears to play a role in DNA mismatch repair and in the suppression of somatic homeologous recombination. |
| AT1G04690 | potassium channel beta subunit 1;(source:Araport11) |
| AT4G22200 | Encodes AKT2, a photosynthate- and light-dependent inward rectifying potassium channel with unique gating properties that are regulated by phosphorylation. Expressed in guard cell protoplasts and in the phloem and xylem of aerial portions of the plant. The channel can coassemble with another K+ channel, KAT1, in vitro. In guard cells, AKT2/3 is responsible for the Ca2+ sensitivity of the K+ uptake channel. In the phloem, it regulates the sucrose/H+ symporters via the phloem potential. AKT2 belongs to the Shaker family K+ channels which include the following groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT2G40540 | putative potassium transporter AtKT2p (AtKT2) mRNA, |
| AT5G58600 | Belongs to a large family of plant-specific genes of unknown function. Involved in resistance to the powdery mildew species Erysiphe cichoracearum and Erysiphe orontii, but not to the unrelated pathogens Pseudomonas syringae or Peronospora parasitica. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G54920 | Powdery mildew resistant mutant encodes a pectate lyase-like protein The mRNA is cell-to-cell mobile. |
| AT3G61600 | POZ/BTB containing-protein AtPOB1. Involvement in protein ubiquitylation is predicted based on physical interaction with CULLIN 3 proteins. The mRNA is cell-to-cell mobile. |
| AT2G20630 | PP2C induced by AVRRPM1;(source:Araport11) |
| AT5G17070 | Encodes a PP4R2 domain protein that likely functions as a regulatory subunit of PP4, a highly conserved ser/thr protein phosphatase. |
| AT5G51700 | Encodes a resistance signalling protein with two zinc binding (CHORD) domains that are highly conserved across eukaryotic phyla. Mutant has reduced RPS5 and RPM1 mediated resistance. Potentially involved in transduction of R gene mediated disease resistance. Required for R protein accumulation. |
| AT1G03140 | PRP18a is one of two paralogs (the other being PRP18b) which are highly similar to the step II splicing factors in yeast. Loss of function mutations show defects in alternative splicing, mostly intron retention events. |
| AT3G19840 | Binds the carboxyl-terminal domain (CTD) of the largest subunit of RNA polymerase II and functions as a scaffold for RNA processing machineries. |
| AT5G23290 | prefoldin 5;(source:Araport11) |
| AT3G11397 | prenylated RAB acceptor 1.A3;(source:Araport11) |
| AT5G05380 | prenylated RAB acceptor 1.B3;(source:Araport11) |
| AT5G01640 | prenylated RAB acceptor 1.B5;(source:Araport11) |
| AT3G13710 | prenylated RAB acceptor 1.F4;(source:Araport11) |
| AT5G56230 | prenylated RAB acceptor 1.G2;(source:Araport11) |
| AT4G27540 | prenylated RAB acceptor 1.H;(source:Araport11) |
| AT5G15860 | Encodes a protein with prenylcysteine methylesterase activity. |
| AT2G27820 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT3G19170 | Zinc metalloprotease pitrilysin subfamily A. Signal peptide degrading enzyme targeted to mitochondria and chloroplasts. Expressed only in siliques and flowers |
| AT2G28610 | Encodes a homeodomain containing protein that regulates lateral axis-dependent development of Arabidopsis flowers and is required for cell proliferation. It is expressed in a restricted number of L1 cells at the lateral regions of flower primordia, floral organ primordia, and young leaf primordia. |
| AT5G56360 | Encodes PSL4, beta-subunit of endoplasmic reticulum-resident glucosidase II, which is essential for stable accumulation and quality control of the elf18 receptor EFR but not the flg22 receptor FLS2. The mRNA is cell-to-cell mobile. |
| AT5G09520 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G38570 | Putative CDP-diacylglycerol-inositol 3-phosphatidyltransferase 2;(source:Araport11) |
| AT2G19760 | first member of the Arabidopsis profilin multigene family, expressed in all organs of Arabidopsis. Binds poly-L-proline. The first intron of PRF1 enhances gene expression in vegetative tissues. |
| AT5G56600 | Encodes profilin3, a low-molecular weight, actin monomer-binding protein that regulates the organization of actin cytoskeleton. Originally known as profilin5, and later named profilin3. Expressed in vegetative organs. Mutants have slightly elongated petioles. |
| AT2G19770 | Encodes profilin 5, originally named profilin 4 (PRO4/PFN4). Low-molecular weight, actin monomer-binding protein that regulates the organization of actin cytoskeleton. Pollen-specific plant profilin present predominantly in mature pollen and growing pollen tubes. |
| AT1G03860 | prohibitin 2 |
| AT2G14260 | encodes proline iminopeptidase |
| AT2G39890 | Encodes a proline transporter with affinity for gly betaine, proline and GABA. Protein is expressed in the vascular tissue, specifically the phloem. |
| AT3G24550 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). The mRNA is cell-to-cell mobile. |
| AT1G26150 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G23540 | Encodes a member of the PERK family of putative receptor kinases. Overexpression leads to morphological defects and reduced fertility and increased expression of MAX genes. |
| AT1G70460 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G52290 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT3G18810 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT3G23170 | PRP is a proline/serine rich protein of unknown function. It interacts with defense related MAP kinase MPK6 and others. It's expression is induced by PAMP elicitors. May play a role in response to pathogens. |
| AT3G62120 | Encodes a cytosolic prolyl-tRNA synthetase. |
| AT5G02190 | encodes an aspartic protease, has an important role in determining cell fate during embryonic development and in reproduction processes. The loss-of-function mutation of PCS1 causes degeneration of both male and female gametophytes and excessive cell death of developing embryos during torpedo stage. |
| AT3G13330 | Encodes a protein that interacts with the 26S proteasome. Mutants are phenotypically indistinguishable from wild type plants under a variety of growth conditions. Protein levels increase upon exposure of seedlings to MG132, a specific, potent, reversible, and cell-permeable proteasome inhibitor. |
| AT5G35590 | Encodes 20S proteasome subunit PAA1 (PAA1). |
| AT1G16470 | Encodes 20S proteasome subunit PAB1 (PAB1). |
| AT5G06310 | Encodes AtPOT1b. Note on nomenclature: different names have been given to Arabidopsis POT-like genes (Kuchar and Fajkus, 2004; Shakirov et al, 2005; Tani and Murata, 2005). According to a unifying nomenclature (Surovtseva et al, 2007), At2g05210 (previously named AtPOT1) is designated AtPOT1a, while At5g06310 (previously named AtPOT2) is designated AtPOT1b. |
| AT5G04270 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT4G22750 | Encodes a protein S-acyltransferase that, together with PAT14, cooperatively regulates leaf senescence. |
| AT5G49020 | Encodes a type I protein arginine methyltransferase. PRMT4a can catalyze the asymmetric dimethylation of arginines 2,17, and 26 on histone 3 and can also methylate myelin basic protein in vitro. Double mutants lacking PRMT4a and 4b have reduced levels of histone 3 methylated at R17. These double mutants flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts. |
| AT4G17420 | PAWH1 along with PAWH2 is part of endoplasmic reticulum ubiquitin ligase complex with Arabidopsis HRD1 via interaction with EBS7. As such it plays a role in promoting protein degradation via the ERAD pathway. |
| AT5G47420 | PAWH2 along with PAWH1 is part of endoplasmic reticulum ubiquitin ligase complex with Arabidopsis HRD1 via interaction with EBS7. As such it plays a role in promoting protein degradation via the ERAD pathway. |
| AT1G55480 | Encodes a member of a novel plant protein family containing a PDZ, a K-box, and a TPR motif. mRNA but not protein levels decrease after wounding. ZKT is phosphorylated at Thr and Ser residues after wounding. The mRNA is cell-to-cell mobile. |
| AT4G34090 | cyclin delta-3;(source:Araport11) |
| AT1G08910 | Encodes an SP-RING domain containing protein that functions in sumolaytion and is involved in positive regulation of sulfur metabolism and stress response. |
| AT2G28930 | protein kinase 1B;(source:Araport11) |
| AT5G19680 | PP1 Regulatory Subunit3. Interacts with members of the Type One Protein Phosphatases (TOPP) family.Facilitates the nuclear localization of TOPP4 which is required for its activity in mediating ABA responses. |
| AT3G25800 | one of three genes encoding the protein phosphatase 2A regulatory subunit |
| AT1G10430 | Encodes one of the isoforms of the catalytic subunit of protein phosphatase 2A: AT1G59830/PP2A-1, AT1G10430/PP2A-2, At2g42500/PP2A-3, At3g58500/PP2A-4 [Plant Molecular Biology (1993) 21:475-485 and (1994) 26:523-528; Note that in more recent publications, there is mixed use of gene names for PP2A-3 and PP2A-4 - some refer to At2g42500 as PP2A-3 and some as PP2A-4]. It regulates the activation of ADF/cofilin, which, in turn, regulates actin cytoskeleton remodeling and is involved in phot2-mediated chloroplast avoidance movements. |
| AT2G33700 | Encodes a putative protein phosphatase 2C that positively regulates salt tolerance in abscisic acid-dependent manner. |
| AT3G11410 | Encodes protein phosphatase 2C. Negative regulator of ABA signalling. Expressed in seeds during germination. mRNA up-regulated by drought and ABA. |
| AT4G10050 | esterase/lipase/thioesterase family protein;(source:Araport11) |
| AT2G33640 | DHHC-type zinc finger family protein that encodes a functional s-acyl transferase. |
| AT3G56930 | Protein S-acyl transferase 4 (PAT4). Mutants display defects in root hair elongation. Along with SCN1 , it may be involved in targeting of ROP2 to the plasma membrane. |
| AT2G35680 | Encodes a phosphatidylglycerophosphate (PGP) phosphatase involved in the synthesis of plastidial Phosphatidylglycerol (PG) in conjunction with PGPP1 and PTPMT2 in root. PTPMT1 levels were higher in node, cauline leaf, and flower than in root, leaf, and stem. |
| AT1G18470 | Putative C3HC4 zinc-finger ubiquitin E3 ligase that is induced by ABA and plays a positive role in ABA signaling. |
| AT3G48330 | Encodes protein-L-isoaspartate methyltransferase. Important for maintaining viability as the seed ages. Involved in germination. |
| AT5G50240 | L-isoaspartyl methyltransferase 2 (PIMT2)gene, alternatively spliced. |
| AT3G08730 | Encodes a protein-serine kinase that phosphorylates ribosomal protein in vitro. Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Involved in translational up-regulation of ribosomal proteins. Phosphorylated by PDK1. Interacts with RAPTOR1, which in turn interacts with TOR. SPK6 activity is affected by osmotic stress, and plants overexpressing S6k1 are hypersensitive to osmotic stress. The gene is expressed in all tissues examined, with highest expression level detected in metabolically active tissues. |
| AT4G27440 | light-dependent NADPH:protochlorophyllide oxidoreductase B The mRNA is cell-to-cell mobile. |
| AT1G03630 | Encodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent. |
| AT2G42840 | Encodes a putative extracellular proline-rich protein is exclusively expressed in the L1 layer of vegetative, inflorescence and floral meristems and the protoderm of organ primordia. |
| AT5G06970 | PATROL1 is a Munc13-like protein involved in mediating H[+]-ATPase translocation. It interacts with AHA1and is responsible for its translocation during stomatal movement. |
| AT2G05620 | Involved in electron flow in Photosystem I. Essential for photoprotection. |
| AT4G27500 | interacts with H+-ATPase, and regulates its activity The mRNA is cell-to-cell mobile. |
| AT3G25840 | Spliceosome-associated kinase involved in alternative splicing. May influence alternative splicing patterns by phosphorylating a subset of splicing regulators. |
| AT5G66570 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO1 is the major isoform in the wild-type. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the membrane. The mRNA is cell-to-cell mobile. |
| AT4G28750 | mutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Subunit E of Photosystem I |
| AT2G01918 | Encode a protein homologous to each PQL protein. Mutational analysis indicates that PQL3 is also required for NDH activity. |
| AT5G60100 | Encodes pseudo-response regulator 3 (APRR3/PRR3). PRR3 transcript levels vary in a circadian pattern with peak expression at dusk under long and short day conditions. PRR3 affects the period of the circadian clock and seedlings with reduced levels of PRR3 have shorter periods, based on transcriptional assays of clock-regulated genes. PRR3 is expressed in the vasculature of cotyledons and leaves where it may help stabilize the TOC1 protein by preventing interactions between TOC1 and the F-box protein ZTL. |
| AT5G02810 | PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR7 expression levels. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR5 and PRR9 to regulate hypocotyl growth under photoperiodic conditions. |
| AT2G46790 | Pseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR5 and PRR7 to regulate hypocotyl growth under photoperiodic conditions. |
| AT3G13175 | transmembrane protein;(source:Araport11) |
| AT5G52420 | transmembrane protein;(source:Araport11) |
| AT3G50110 | Encodes a phosphatase with low in vitro tyrosine phosphatase activity that is NOT capable of dephosphorylating in vitro the 3'phosphate group of PI3P, PI(3,4)P2. |
| AT2G47060 | Encodes Pto-interacting 1-4 (PTI1-4), a member of the PTI1-like serine/threonine protein kinases that share strong sequence identity to the tomato PTI1 kinase. |
| AT5G56510 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G43090 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G60110 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G09610 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G72320 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT3G20250 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. APUM5 is involved in susceptibility to CMV and is not required for bacterial or fungal pathogen resistance although its expression is induced upon bacterial and fungal infection. It is involved in the osmotic, salt, and drought stress responses. |
| AT1G78160 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT2G32080 | similar to the conserved animal nuclear protein PUR alpha which was implicated in the control of gene transcription and DNA replication |
| AT1G28230 | Encodes a transporter that transports purines,cytokinins and other adenine derivatives. Expressed in the leaf hydathodes where it may be involved in re-uptake of cytokinins during guttation. |
| AT1G44750 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G19770 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. The mRNA is cell-to-cell mobile. |
| AT1G09860 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G57990 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G30840 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G18220 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT2G16430 | Encodes an acid phosphatase involved plant acclimation to Pi deprivation. |
| AT2G27190 | Encodes a root-secreted purple acid phosphatase involved in extracellular phosphate-scavenging. PEP complex component. |
| AT3G07130 | Encodes PAP15, a purple acid phosphatase with phytase activity. Expression of PAP15 is developmentally and temporally regulated, with strong expression at the early stages of seedling growth and pollen germination. The expression is also organ/tissue-specific, with strongest expression in the vasculature, pollen grains, and roots. Recombinant PAP protein exhibits broad substrate specificity with moderate phytase activity. PAP15 likely mobilizes phosphorus reserves in plants, particularly during seed and pollen germination. |
| AT3G17790 | Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT3G20500 | purple acid phosphatase 18;(source:Araport11) |
| AT3G52810 | purple acid phosphatase 21;(source:Araport11) |
| AT5G34850 | Encodes a root-secreted purple acid phosphatase precursor involved in extracellular phosphate-scavenging. |
| AT5G63140 | purple acid phosphatase 29;(source:Araport11) |
| AT1G14700 | purple acid phosphatase 3;(source:Araport11) |
| AT2G01890 | Encodes a purple acid phosphatase (PAP) belonging to the low molecular weight plant PAP group. |
| AT2G03450 | purple acid phosphatase 9;(source:Araport11) |
| AT1G62290 | Saposin-like aspartyl protease family protein;(source:Araport11) |
| AT3G09670 | PWWP domain protein involved in regulation of FLC and flowering time. |
| AT5G40340 | PWWP domain protein involved in regulation of FLC and flowering time. |
| AT3G05430 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
| AT5G02950 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
| AT3G27860 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
| AT3G03140 | Encodes a chromatin-associated protein that interacts with plant nuclear lamin-like components to regulate nuclear size. |
| AT1G08590 | Encodes one of the two putative eLRR kinase closely related to PXY (At1g08590/PXL1 and At4g28650/PXL2). Insertion mutants in either pxl1 or pxl2 do not exhibit an obvious phenotype in the stem; double-mutant combinations of a Col allele, of pxy (pxy-3) with pxl1 and pxl2, generate a more severe vascular phenotype than pxy-3 alone, suggesting that these genes act synergistically with PXY in regulating vascular-tissue development in the stem. |
| AT2G36570 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G16420 | The PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests. The mRNA is cell-to-cell mobile. |
| AT4G18620 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT2G38310 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. The mRNA is cell-to-cell mobile. |
| AT2G40330 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT4G01026 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of ABI1 and ABI2. |
| AT4G17870 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT5G05440 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT5G49970 | encodes the bifunctional pyridoxine (pyridoxamine) 5?-phosphate oxidase (PPOX)(EC 1.4.3.5) that is involved in the formation of pyridoxal 5'-phosphate (member of the vitamin B6 group). NAD(P)HX epimerase (AT5G49970) interconverts the two epimers of NAD(P)HX. |
| AT3G16050 | Encodes a protein with pyridoxal phosphate synthase activity whose transcripts were detected mostly in roots and accumulate during senescence. The protein was found in very low abundance, which prevented a specific localisation. |
| AT4G22930 | Encodes dihydroorotase (PYR4). |
| AT3G17810 | Encodes a protein predicted to have dihydropyrimidine dehydrogenase activity. Its activity has not been demonstrated in vivo, but, it is required for efficient uracil catabolism in Arabidopsis. It localizes to the plastid. |
| AT3G20330 | encodes aspartate carbamoyltransferase catalyzing the second step in the de novo pyrimidine ribonucleotide biosynthesis |
| AT4G20960 | encodes diaminohydroxyphosphoribosylaminopyrimidine deaminase catalyzing the second step in the riboflavin biosynthesis |
| AT2G18230 | Encodes a protein that might have inorganic pyrophosphatase activity. |
| AT2G46860 | Encodes a protein that might have inorganic pyrophosphatase activity. |
| AT3G53620 | Encodes a soluble protein with inorganic pyrophosphatase activity that is highly specific for Mg-inorganic pyrophosphate. The mRNA is cell-to-cell mobile. |
| AT5G09650 | Encodes a protein with inorganic pyrophosphatase activity. |
| AT5G54960 | pyruvate decarboxylase-2 |
| AT1G59900 | encodes the e1 alpha subunit of the pyruvate dehydrogenase complex (PDC) The mRNA is cell-to-cell mobile. |
| AT1G30120 | Encodes a putative plastid pyruvate dehydrogenase E1 beta subunit that is distinct from the mitochondrial pyruvate dehydrogenase E1 beta subunit. |
| AT3G06483 | Pyruvate dehydrogenase kinase (PDK) specifically phosphorylates the E1α subunit of the pyruvate dehydrogenase complex (PDC) on a Ser residue using ATP as a phosphate donor. PDK is a unique type of protein kinase having a His-kinase-like sequence but Ser-kinase activity. Site-directed mutagenesis and structural analysis indicate that PDK belongs to the GHKL superfamily. |
| AT4G15530 | Encodes a dual-targeted protein believed to act as a pyruvate, orthophosphate dikinase. These enzymes are normally associated with C4 photosynthesis which does not occur in Arabidopsis. However, PPDK may play a role in remobilizing nitrogen during leaf senescence in Arabidopsis. The product of the long transcript (.1 gene model) was shown to be targeted to the chloroplast, whereas the shorter transcript (no targeting sequence) accumulates in the cytosol. The two proteins were also found to be expressed in slightly different tissues. |
| AT1G13860 | Encodes QUASIMODO2 LIKE1 (QUL1), a paralog of QUASIMODO2 (QUA2). AT1G78240 (QUA2), AT1G13860 (QUL1) and AT2G03480 (QUL2) form a clade with a possible role in plant vasculature development. |
| AT1G74720 | Encodes a putative transmembrane protein carrying four C(2) domains, suggesting that QKY may function in membrane trafficking in a Ca(2+)-dependent fashion. Mutant analysis shows that this gene is involved in organ development. |
| AT4G25190 | QWRF motif protein (DUF566);(source:Araport11) |
| AT4G30710 | QWRF motif protein (DUF566);(source:Araport11) |
| AT3G06540 | Encodes a cytoplasmic Rab escort protein that preferentially binds the GDP-bound form of Rab and stimulates geranylgeranylation of various Rab GTPases in Arabidopsis extracts in vitro. |
| AT3G59920 | RAB GDP DISSOCIATION INHIBITOR 2 The mRNA is cell-to-cell mobile. |
| AT5G41820 | RAB geranylgeranyl transferase alpha subunit 2;(source:Araport11) |
| AT1G22740 | GTP-binding protein Rab7 |
| AT5G47200 | AtRabD2b encodes a Rab GTPase, which plays important roles in pollen development, germination and tube elongation. The mRNA is cell-to-cell mobile. |
| AT4G17530 | AtRabD2c encodes a Rab GTPase, which plays important roles in pollen development, germination and tube elongation. |
| AT2G21880 | RAB GTPase homolog 7A;(source:Araport11) |
| AT5G03520 | GTPase that colocalizes with golgi and plasma membranes. |
| AT1G16920 | small GTP-binding protein (Rab11)similar to YPT3/RAB11 proteins in yeast and mammals, respectively. YPT3/RAB11 is involved in intracellular protein trafficking. |
| AT5G45750 | RAB GTPase homolog A1C;(source:Araport11) |
| AT4G18800 | Encodes RabA1d, a member of the RabA subfamily of small Rab GTPases. |
| AT3G15060 | RAB GTPase homolog A1G;(source:Araport11) |
| AT2G33870 | RAB GTPase homolog A1H;(source:Araport11) |
| AT1G07410 | RAB GTPase homolog A2B;(source:Araport11) |
| AT3G46830 | RAB GTPase homolog A2C;(source:Araport11) |
| AT5G59150 | RAB GTPase homolog A2D;(source:Araport11) |
| AT5G65270 | RAB GTPase homolog A4A;(source:Araport11) |
| AT4G39990 | Rab GTPase that selectively marks cell wall-containing TGN compartments. Involved in protein trafficking to membranes during tip growth. |
| AT3G12160 | Encodes RABA4D, a member of the Arabidopsis RabA4 subfamily of Rab GTPase proteins. It is transported in exocytic vesicles to the apical tip of pollen tubes where it appears to promote tip growth. Proper localization of RabA4d depends on ROP1, RIC3, and RIC4 activity. |
| AT2G22390 | Encodes an unusual RabA family member as it has a Lysine the position of the highly conserved Glu of the WDTAGQE motif and has the sequence CVAA! at its C-ter rather than the conventional CCXX(X) or CXC motifs that promote geranylgeranylation and membrane anchoring. |
| AT5G47520 | RAB GTPase homolog A5A;(source:Araport11) |
| AT2G31680 | RAB GTPase homolog A5D;(source:Araport11) |
| AT4G17170 | member of RAB gene family |
| AT5G03530 | Encodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. CFP:RabC2a appears to co-localize with peroxisomes. |
| AT3G09910 | RAB GTPase homolog C2B;(source:Araport11) |
| AT4G20360 | Nuclear transcribed, plastid localized EF-Tu translation elongation factor. Referred to as AtRabE1b in DOI:10.1104/pp.013052. However, wider community usage and more publications assign the symbol RabE1b to At5g59840. |
| AT5G39620 | RAB GTPase homolog G1;(source:Araport11) |
| AT1G52280 | RAB GTPase homolog G3D;(source:Araport11) |
| AT3G18820 | RAB7 homolog, forms retromer complex with VPS35; ES17 prevents the retromer complex to endosome anchoring, resulting in retention of RABG3f. The interaction of RABG3f?VPS35 functinons as a checkpoint in the control of traffic toward the vacuole. |
| AT2G22290 | RAB GTPase homolog H1D;(source:Araport11) |
| AT5G53570 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT5G45130 | small GTP binding protein The mRNA is cell-to-cell mobile. |
| AT5G62880 | ROP (Rho of plant GTPases) family member involved in cell wall patterning. Locally activated to form plasma membrane domains, which direct formation of cell wall pits in metaxylem vessel cells through interaction with cortical microtubules. Pattern formation of cell wall pits is governed by ROP activation via a reaction-difusion mechanism. Patterning involves active ROP1 recruiting BDR1 to the plasma membrane in pit regions. BRD1 in turn recruits the actin binding protein WAL. |
| AT1G71100 | Encodes a ribose 5-phosphate isomerase involved in the formation of uridine used for the synthesis of UDP-sugars. Mutants of this gene are affected in cellulose biosynthesis. |
| AT5G66130 | Encodes a homolog to yeast RAD17. Involved in the regulation of DNA damage repair and homologous recombination. Mutant has increased sensitivity to MMS and increased telomere lengths. |
| AT1G79650 | Encodes a member of the RADIATION SENSITIVE23 (RAD23) family: AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome. |
| AT3G02540 | Encodes a member of the RADIATION SENSITIVE23 (RAD23) family: AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome. |
| AT1G32230 | Encodes a protein belonging to the (ADP-ribosyl)transferase domain-containing subfamily of WWE protein-protein interaction domain protein family. Superoxide radicals are necessary and sufficient to propagate cell death or lesion formation in rcd1 mutants. Without stress treatment, RCD1 is localized in the nucleus. Under high salt or oxidative stress, RCD1 is found not only in the nucleus but also in the cytoplasm. The mRNA is cell-to-cell mobile. |
| AT5G27920 | Encodes a nuclear F-box protein that can directly interact with the C2H2‐type zinc finger transcription factor STOP1 and promote its ubiquitination and degradation. STOP1 is crucial for aluminum (Al) resistance. |
| AT2G33130 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT3G05490 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT3G25170 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT4G15800 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. The mRNA is cell-to-cell mobile. |
| AT5G55190 | A member of RAN GTPase gene family. Encodes a small soluble GTP-binding protein. Likely to be involved in nuclear translocation of proteins. May also be involved in cell cycle progression. Role in seed and endosperm development. |
| AT3G63130 | Encodes a RAN GTPase activating protein involved in nuclear import, cell plate formation and mitotic spindle formation. Associates with nuclear envelope membranes. |
| AT1G02900 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. Mediates Ca2+-dependent signaling. Regulates the splicing of flowering genes and exerts an opposite effect on the flowering time compared with FER. |
| AT3G16570 | Encodes RALF23, a member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. RALF23 is significantly downregulated by brassinolide treatment of seedlings. Overexpression of AtRALF23 impairs brassinolide-induced hypocotyls elongation, and mature overexpressing plants are shorter and bushier. RALF23 overexpression produces slower growing seedlings with roots that have reduced capacity to acidify the rhizosphere. |
| AT3G05880 | Induced by low temperatures, dehydration and salt stress and ABA. Encodes a small (54 amino acids), highly hydrophobic protein that bears two potential transmembrane domains. |
| AT3G05890 | Low temperature and salt responsive protein family;(source:Araport11) |
| AT2G45280 | Encodes a protein similar to RAD51C involved in double stranded break repair via homologous recombination. Sensitive to DSB induced by Mitomycin C and gamma irradiation, interacts with Atxrcc3 in yeast two-hybrid assay. Required for female meiosis but not critical for mitosis under normal conditions. |
| AT5G20010 | A member of RAN GTPase gene family. Encodes a small soluble GTP-binding protein. Likely to be involved in nuclear translocation of proteins. May also be involved in cell cycle progression. The mRNA is cell-to-cell mobile. |
| AT3G21060 | Encodes a structural core component of a COMPASS-like H3K4 histone methylation complex that is also involved in the timing of the floral transition. |
| AT4G34730 | ribosome-binding factor A family protein;(source:Araport11) |
| AT3G26000 | RIPF1 is an F-Box E3 ligase that interacts with the ABA receptor RCAR3 and appears to be responsible for facilitating its turnover. |
| AT3G20390 | Encodes a plastidial RidA (Reactive Intermediate Deaminase A) homolog that hydrolyzes the enamines/imines formed by Thr dehydratase from Ser or Thr. RidA accelerates the deamination of reactive enamine/imine intermediates produced by threonine dehydratase (At3g10050) with threonine or serine as substrates. In the absence of RidA, the serine-derived imine inactivates BCAT3 (At3g49680). RidA thus pre-empts damage to BCAT3 by hydrolyzing the reactive imine before it does damage. |
| AT4G34220 | Encodes a receptor like kinase involved in ABA-mediated seedling development and drought tolerance.RDK1 is an atypical or pseudokinase and has no phosphorylation activity. Its expression is upregulated in response to ABA.interacts with ABI1 and other PP2C phosphatases. |
| AT5G66160 | Encodes a receptor homology region transmembrane domain, ring H2 motif protein involved in transport of storage proteins to protein storage vacuoles. Localized to endoplasmic reticulum and co-localizes with DIP positive vesicles and to the trans-golgi network when complexed with RMR2. |
| AT1G07390 | receptor like protein 1;(source:Araport11) |
| AT2G25440 | receptor like protein 20;(source:Araport11) |
| AT2G32660 | receptor like protein 22;(source:Araport11) |
| AT2G33050 | receptor like protein 26;(source:Araport11) |
| AT2G42800 | receptor like protein 29;(source:Araport11) |
| AT3G05360 | receptor like protein 30;(source:Araport11) |
| AT3G05370 | receptor like protein 31;(source:Araport11) |
| AT3G23010 | receptor like protein 36;(source:Araport11) |
| AT3G23110 | receptor like protein 37;(source:Araport11) |
| AT4G18760 | receptor like protein 51;(source:Araport11) |
| AT5G49290 | receptor like protein 56;(source:Araport11) |
| AT5G65830 | receptor like protein 57;(source:Araport11) |
| AT1G58190 | receptor like protein 9;(source:Araport11) |
| AT2G18890 | RLCK VI_A class kinase which activity is regulated by Rho-of-plants (ROP) GTPases. Controls seedling and plant growth in parallel with gibberrellin. |
| AT5G67280 | receptor-like kinase;(source:Araport11) |
| AT2G48010 | receptor-like serine/threonine kinase (RKF3) The mRNA is cell-to-cell mobile. |
| AT1G69270 | RPK1 is a leucine-rich receptor-like kinase located in the plasma membrane which is upregulated by abscisic acid, dehydration, high salt, low temperature, but not by other plant hormones. RPK1 knock-out and antisense plants show an ABA-insensitive phenotype. RPK1 plays a role in ABA-controlled cell proliferation and is a regulator of the ABA signal transduction pathway. Overexpression of the LRR domain has a dominant negative effect on RPK1. Mutations in RPK1 uncouple cotyledon anlagen and primordia by modulating epidermal cell shape and polarity. |
| AT3G02130 | Encodes a receptor-like kinase RPK2 (also known as TOADSTOOL 2/TOAD2). Functions as a regulator of meristem maintenance. Mutants are insensitive to synthetic CLV3 peptide. Mutations in the RPK2 also result in stem cell expansion and increased number of floral organs, as seen in the other clv mutants. Forms homo-oligomers. |
| AT4G00340 | Encodes a receptor-like protein kinase that is expressed in roots. |
| AT1G58602 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
| AT1G67500 | Encodes the catalytic subunit of DNA polymerase zeta.Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS). |
| AT1G60930 | AtRECQ4B mutant showed no sensitivity to DNA damaging agents.Involved in homologous recombination. |
| AT5G27680 | RECQ helicase SIM;(source:Araport11) |
| AT2G47700 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G34410 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Regulates programmed cell death (PCD) inhibitor genes. Involved in retarding programmed cell death under salt stress due to the regulation of processes participating in ROS inhibition. ERF-regulated transcripts belong to the tryptophan biosynthesis, tryptophan metabolism, and downstream plant hormone signal transduction pathways, where ERF109 potentially acts as a 'master switch' mediator of a cascade of consecutive events across the three pathways, promoting plant growth and re-adjustment to homeostasis due the direct participation in auxin biosynthesis leading to the plants ability to tolerate salt stress. |
| AT1G01320 | Encodes REDUCED CHLOROPLAST COVERAGE 1 (REC1) a protein with similarity to the FLOURY locus in maize. Located in the nucleus and cytosol. Contributes to establishing the size of the chloroplast compartment. |
| AT4G28080 | Encodes REDUCED CHLOROPLAST COVERAGE 2 (REC2). Along with REC1 and REC3 it contributes to establishing the size of the chloroplast compartment. |
| AT1G15290 | Encodes REDUCED CHLOROPLAST COVERAGE 3 (REC3). Contributes to establishing the size of the chloroplast compartment. |
| AT5G09680 | Encodes RLF (Reduced Lateral root Formation). Involved in lateral root formation. Contains a cytochrome b5-like heme/steroid binding domain. Localized in the cytosol. |
| AT3G15820 | Functions as phosphatidylcholine:diacylglycerol cholinephosphotransferase, a major reaction for the transfer of 18:1 into phosphatidylcholine for desaturation and also for the reverse transfer of 18:2 and 18:3 into the triacylglycerols synthesis pathway |
| AT1G75110 | Encodes an arabinosyltransferase that modifies extensin proteins in root hair cells. |
| AT1G19360 | Encodes an arabinosyltransferase that modifies extensin proteins in root hair cells. |
| AT3G18990 | Required for vernalization. Essential for the complete repression of FLC in vernalized plants. Required for the methylation of histone H3 |
| AT4G16845 | The VERNALIZATION2 (VRN2) gene mediates vernalization and encodes a nuclear-localized zinc finger protein with similarity to Polycomb group (PcG) proteins of plants and animals. In wild-type Arabidopsis, vernalization results in the stable reduction of the levels of the floral repressor FLC. In vrn2 mutants, FLC expression is downregulated normally in response to vernalization, but instead of remaining low, FLC mRNA levels increase when plants are returned to normal temperatures. VRN2 maintains FLC repression after a cold treatment, serving as a mechanism for the cellular memory of vernalization. Required for complete repression of FLC. Required for the methylation of histone H3 |
| AT5G46340 | Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Has high similarity to RWA2 whose mutant displays reduced acetylation. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. |
| AT1G29890 | Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Has high similarity to RWA2 whose mutant displays reduced acetylation. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. |
| AT3G23590 | Encodes a protein shown to physically associate with the conserved transcriptional coregulatory complex, Mediator, and is involved in the regulation of phenylpropanoid homeostasis. Acts redundantly with REF4/MED5b (At2g48110). Required for expression of some dark-upregulated genes. RFR1 is the MED5a subunit of the mediator complex. |
| AT5G01720 | RAE1 is an F-box protein component of a SCF-type E3 ligase complex. It is part of an alumium induced regulatory loop: its activity is induced by STOP1 and it in turn ubiquitinates STOP1 which is then targeted for degradation. |
| AT5G40450 | Encodes a member of a plant gene family, APK_ORTHOMCL5144,of unknown function. RBB1 is localized to the cytosol and involved in vacuolar biogenesis and organization. RBB1 mutants have increased number of vacuolar bulbs and fewer trans-vacuolar strands. |
| AT1G79950 | Encodes a homologue of human Regulator of Telomere Elongation Helicase1 (RTEL1). Plays a central role in the preservation of genome stability. |
| AT1G01360 | Encodes RCAR1 (regulatory components of ABA receptor). Interacts with and regulates the type 2C protein phosphatases (PP2Cs) ABI1 and ABI2. Functions as abscisic acid sensor. The mRNA is cell-to-cell mobile. |
| AT2G20140 | Encodes one of the two RPT2 (26S proteasome subunit RPT2) paralogs: RPT2a (At4g29040) and RPT2b (At2g20140). RPT2b can not complement the rpt2a mutant phenotype. rpt2a rpt2b double mutants are embryo lethal. |
| AT4G38630 | Regulatory particle non-ATPase subunit of the 26S proteasome with multiubiquitin-chain-binding capabilities |
| AT5G42040 | regulatory particle non-ATPase 12B;(source:Araport11) |
| AT5G64760 | Encodes one of two isoforms for the 26S proteasome regulatory protein (RN) subunit RPN5. For many functions it acts redundantly with the paralogous genes RPN5a. |
| AT1G53750 | 26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA, |
| AT5G19990 | 26S proteasome AAA-ATPase subunit The mRNA is cell-to-cell mobile. |
| AT1G54130 | This gene appears to be at least partially redundant with RSH2 (At3g14050). Guanosine tetraphosphate synthesized by RSH2/RSH3 (and CRSH At3g17470) to an unknown extent can repress chloroplast gene expression, and also reduce chloroplast size. Involved in the maintenance of the (p)ppGp level to accustom plastidial gene expression to darkness. |
| AT1G68840 | Rav2 is part of a complex that has been named `regulator of the (H+)-ATPase of the vacuolar and endosomal membranes' (RAVE) The mRNA is cell-to-cell mobile. |
| AT1G46768 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.1). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.9 and RAP2.10. |
| AT4G36900 | Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.10). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.9 and RAP2.1. |
| AT1G43160 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family (RAP2.6). The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT5G13330 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT2G28550 | AP2 family transcription factor that is involved in regulation of flowering and innate immunity.Interacts with CRY2 to regulate CO and FT. TOE1 binds to activation domain of CO and binds CORE sequences of the FT promoter.TOE1/TOE2 are also targets of MiR172b and function in regulation of innate immunity. |
| AT2G22010 | Encodes a protein predicted to act as a RING E3 ubiquitin ligase. It appears to regulate the stability of the KRP1/ICK1 cyclin dependent kinase inhibitor. Induced by beet severe curly virus (BSCTV) C4 protein. |
| AT1G49480 | Encodes a nuclear-localized DNA-binding protein that interacts with ITN1 at the PM and nuclei in vivo and may regulate ITN's subcellular localization. |
| AT3G48430 | Relative of Early Flowering 6 (REF6) encodes a Jumonji N/C and zinc finger domain-containing protein that acts as a positive regulator of flowering in an FLC-dependent pathway. REF6 mutants have hyperacetylation of histone H4 at the FLC locus. REF6 interacts with BES1 in a Y2H assay and in vitro. REF6 may play a role in brassinoteroid signaling by affecting histone methylation in the promoters of BR-responsive genes. It is most closely related to the JHDM3 subfamily of JmjN/C proteins. The mRNA is cell-to-cell mobile. |
| AT3G61260 | Lipid raft regulatory protein, crucial for plasma membrane nanodomain assembly to control plasmodesmata aperture and functionality. Negatively regulates the cell-to-cell movement of TuMV via competition with PCaP1 for binding actin filaments. |
| AT3G57540 | Remorin family protein;(source:Araport11) |
| AT2G41870 | Remorin family protein;(source:Araport11) |
| AT2G06510 | Encodes a homolog of Replication Protein A that is involved in meiosis I in pollen mother cells. rpa1a mutants have a reduced number of class I crossovers. The protein is located in chromatin-associated foci in early leptotene and can be detected in these foci until late pachytene of meiosis I. |
| AT4G19130 | Replication factor-A protein 1-like protein;(source:Araport11) |
| AT5G52250 | Encodes a transducin protein whose gene expression is induced by UV-B. This induction is reduced in hy5 mutant and may be a target of HY5 during UV-B response. Functions as a repressor of UV-B signaling. |
| AT5G67630 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G62270 | BOR2 is involved in efficient borate crosslinking of rhamnogalacturonan II in cell walls under boron limitation. |
| AT1G15460 | Encodes a efflux-type boron transporter. Over-expression improved plant growth under B toxic conditions. |
| AT4G11170 | Encodes RMG1 (Resistance Methylated Gene 1), a NB-LRR disease resistance protein with a Toll/interleukin-1 receptor (TIR) domain at its N terminus. RMG1 is expressed at high levels in response to flg22 and in naive met1/nrpd2 relative to wild-type plants. Expression of this gene is controlled by DNA methylation in its promoter region. The RMG1 promoter region is constitutively demethylated by active DNA demethylation mediated by the DNA glycosylase ROS1. |
| AT1G11330 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G22790 | Encodes a plasma membrane localized MATE type transporter that is involved in CO2 signaling during stomatal aperture regulation. RHC1 regulates HT1 which phosphorylates OST1, a kinase that regulates the SLAC1 anion channel and thus stomatal closing. |
| AT4G26090 | Encodes a plasma membrane protein with leucine-rich repeat, leucine zipper, and P loop domains that confers resistance to Pseudomonas syringae infection by interacting with the avirulence gene avrRpt2. RPS2 protein interacts directly with plasma membrane associated protein RIN4 and this interaction is disrupted by avrRpt2. The mRNA is cell-to-cell mobile. |
| AT1G09090 | NADPH-oxidase AtrbohB plays a role in seed after-ripening. Major producer of superoxide in germinating seeds. AtrbohB pre-mRNA is alternatively spliced in seeds in a hormonally and developmentally regulated manner. ABA caused accumulation of AtrbohB-? mRNA and prevented prevented AtrbohB-a mRNA expression in fresh seeds. |
| AT5G60010 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
| AT5G47910 | NADPH/respiratory burst oxidase protein D (RbohD).Interacts with AtrbohF gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. The mRNA is cell-to-cell mobile. |
| AT1G64060 | Interacts with AtrbohD gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. |
| AT3G16857 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
| AT4G31920 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
| AT1G74890 | Encodes a nuclear response regulator that acts as a negative regulator in cytokinin-mediated signal transduction. Transcript accumulates in leaves and roots in response to cytokinin treatment. |
| AT5G58080 | member of Response Regulator: B- Type |
| AT3G62670 | member of Response Regulator: B- Type |
| AT2G41310 | Encodes an A- type response Regulator that is primarily expressed in the root and is involved in cytokinin-mediated signalling. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G10470 | Encodes a two-component response regulator. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
| AT3G48100 | Encodes a transcription repressor that mediates a negative feedback loop in cytokinin signalling. ARR5 expression is upregulated by Class I KNOX genes. Arr5 protein is stabilized by cytokinin in a two-component phosphorelay. |
| AT5G62920 | Encodes a Type-A response regulator that is responsive to cytokinin treatment. Its C-ter domain is very short in comparison to other Arabidopsis ARRs (17 total). Arr6 protein is stabilized by cytokinin. |
| AT1G19050 | Encodes a member of the Arabidopsis response regulator (ARR) family, most closely related to ARR15. A two-component response regulator protein containing a phosphate accepting domain in the receiver domain but lacking a DNA binding domain in the output domain. Involved in response to cytokinin and meristem stem cell maintenance. Arr7 protein is stabilized by cytokinin. |
| AT3G57040 | response regulator ARR9, A two-component response regulator-like protein with a receiver domain with a conserved aspartate residue and a possible phosphorylation site and at the N-terminal half. Appears to interact with histidine kinase like genes ATHP3 and ATHP2 |
| AT1G09950 | RESPONSE TO ABA AND SALT 1;(source:Araport11) |
| AT3G49570 | response to low sulfur 3;(source:Araport11) |
| AT5G65950 | TRAPPIII complex protein which regulates TGN integrity, by altered TGN/EE association of several residents, including SYNTAXIN OF PLANTS 61 (SYP61), and altered vesicle morphology. Involved in regulation of endosomal function and salt stress response. |
| AT5G66400 | Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. ABA- and drought-induced glycine-rice dehydrin protein. The ABA-induced expression of RAB18 was reduced following ACC application, indicating that ethylene inhibits the ABA signaling pathway. RAB18 is also expressed in response to the formation of the phospholipid diacylglycerol pyrophosphate. COR47 and RAB18 double overexpressor plants are cold tolerant. Expressed in guard cells. |
| AT1G03120 | responsive to abscisic acid 28;(source:Araport11) |
| AT4G39090 | Similar to cysteine proteinases, induced by desiccation but not abscisic acid. Required for RRS1-R mediated resistance against Ralstonia solanacearum. Interacts with the R. solanacearum type III effector PopP2. RD19 associates with PopP2 to form a nuclear complex that is required for activation of the RRS1-R?mediated resistance response. |
| AT2G21620 | Encodes gene that is induced in response to desiccation; mRNA expression is seen 10 and 24 hrs after start of desiccation treatment. |
| AT2G33380 | Encodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to desiccation. mRNA expression under drought conditions is apparent particularly in leaves and flowers. Isoform of caleosin with a role as a peroxygenase involved in oxylipin metabolism during biotic and abiotic stress. Involved in the production of 2-hydroxy-octadecatrienoic acid. The peroxygenase has a narrow substrate specificity thus acting as a fatty acid hydroperoxide reductase in vivo. |
| AT5G25610 | responsive to dehydration 22 (RD22) mediated by ABA |
| AT4G27410 | Encodes a NAC transcription factor induced in response to desiccation. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response. |
| AT1G12300 | RFL2 is a pentatricopeptide repeat protein involved in mitochondrial RNA processing. |
| AT1G77570 | Winged helix-turn-helix transcription repressor DNA-binding. Expressed in pollen and mutants show enlarged pollen grain nucleoli. |
| AT2G41945 | Encodes a novel protein found only in plants. RED1 has two isoforms RED1.1 and RED1.2. It is localized to the nucleus. Loss of function mutants are embryo lethal but can be rescued before desiccation by embryo culture. |
| AT1G64090 | Reticulan like protein B3;(source:Araport11) |
| AT5G22790 | reticulata-related 1;(source:Araport11) |
| AT3G08630 | alphavirus core family protein (DUF3411);(source:Araport11) |
| AT3G08640 | alphavirus core family protein (DUF3411);(source:Araport11) |
| AT3G56140 | DUF399 family protein, putative (DUF399 and DUF3411);(source:Araport11) |
| AT4G28430 | Reticulon family protein;(source:Araport11) |
| AT2G46170 | Reticulon family protein;(source:Araport11) |
| AT3G10260 | Reticulon family protein;(source:Araport11) |
| AT3G61560 | Reticulon family protein;(source:Araport11) |
| AT3G12280 | Encodes a retinoblastoma homologue RETINOBLASTOMA-RELATED protein (RBR or RBR1). RBR controls nuclear proliferation in the female gametophyte. Also required for correct differentiation of male gametophytic cell types. Regulates stem cell maintenance in Arabidopsis roots. Involved in the determination of cell cycle arrest in G1 phase after sucrose starvation. RBR1 is also involved in regulation of imprinted genes. Together with MSI1 it represses the expression of MET1. This in turn activates expression of the imprinted genes FIS2 and FWA. Functions as a positive regulator of the developmental switch from embryonic heterotrophic growth to autotrophic growth.ChIP studies indicate that one class of targets of RBR1 are transposable elements. |
| AT5G37260 | Encodes a MYB family transcription factor Circadian 1 (CIR1). Involved in circadian regulation in Arabidopsis. |
| AT4G01280 | RVE5 is one of eleven homologous MYB-like transcription factors in Arabidopsis and a member of the RVE8 clade. Plays a minor role in clock regulation. |
| AT5G52660 | Encodes RVE6, a homolog of the circadian rhythm regulator RVE8. rve4 rve6 rve8 triple mutants display an extremely long circadian period, with delayed and reduced expression of evening-phased clock genes. |
| AT3G09600 | Encodes a MYB-like transcription factor similar to CIRCADIAN CLOCK-ASSOCIATED1 (CCA1) and ELONGATED HYPOCOTYL (LHY). Involved in the regulation of circadian clock by modulating the pattern of histone 3 (H3) acetylation. Functions as a transcriptional activator of evening element containing clock genes. Involved in heat shock response. |
| AT1G80360 | Encodes a methionine-specific aminotransferase that uses the ethylene biosynthetic intermediate methionine as an amino donor and the auxin biosynthetic intermediate indole-3-pyruvic acid as an amino acceptor to produce L-tryptophan and 2-oxo-4-methylthiobutyric acid. These actions allow VAS1 to coordinate both auxin and ethylene biosynthesis. It functions downstream of TAA1/SAV3 but upstream of YUCs to negatively modulate IAA biosynthesis directly by altering the 3-IPA pool. |
| AT3G02230 | RGP1 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1/rgp2 (at5g15650) double mutants have a male gametophyte lethal phenotype. RGP1 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. The mRNA is cell-to-cell mobile. |
| AT5G15650 | RGP2 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1(at3g02230)/rgp2 double mutants have a male gametophyte lethal phenotype. RGP2 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. RGP2 was originally identified as Reversibly Glycosylated Polypeptide-2. Constitutive expression in tobacco impairs plant development and virus spread. |
| AT5G50750 | RGP4 is a reversibly glycosylated polypeptide. Analyses using tagged RGP4 suggest that it is present in the cytosol and in association with the Golgi apparatus. Recombinant RGP4 does not have UDP-arabinose mutase activity based on an in vitro assay even though the related RGP1, RGP2, and RGP3 proteins do have activity in the same assay. RGP4 can form complexes with RGP1 and RGP2. RGP4 is expressed during seed development. |
| AT5G60690 | REVOLUTA regulates meristem initiation at lateral positions. a member of a small homeodomain-leucine zipper family. Has overlapping functions with PHAVOLUTA and PHABULOSA. The mRNA is cell-to-cell mobile. |
| AT5G15740 | RRT1 is a member of a novel glycosyltransferase famly in plants. It functions as a rhamnosyltransferase, elongating the RG-1 backbone. It functions during seed coat mucilage development. |
| AT1G14020 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G19530 | Direct target of RGA, plays an essential role in GA-mediated tapetum and pollen development. |
| AT5G17490 | Encodes a DELLA subfamily member that acts as a negative regulator of GA signaling and as a coactivator of ABI3 to promote seed storage protein biosynthesis during the seed maturation stage. |
| AT1G34110 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT1G56550 | Encodes a rhamnogalacturonan II specific xylosyltransferase. |
| AT1G78570 | Encodes a UDP-L-Rhamnose synthase involved in the biosynthesis of rhamnose, a major monosaccharide component of pectin. Catalyzes the conversion of UDP-D-Glc to UDP-L-Rha. The dehydrogenase domain of RHM1 was shown to catalyze the conversion of UDP-D-Glc to the reaction intermediate UDP-4-keto-6-deoxy-D-Glc using recombinant protein assay but the activity of the full-length protein was not determined as it could not be expressed in E. coli. |
| AT3G09970 | Encodes a cytosolic tyrosine phosphatase. |
| AT1G16460 | encodes a cytoplasmic thiosulfate:cyanide sulfurtransferase, activity of which increased the rhodanese activity of transgenic yeast. Can also act as a mercaptopyruvate sulfurtransferase. |
| AT5G07250 | RHOMBOID-like protein 3;(source:Araport11) |
| AT1G12750 | RHOMBOID-like protein 6;(source:Araport11) |
| AT4G21470 | Bifunctional enzyme that catalyzes hydrolysis of FMN to riboflavin, and phosphorylation of riboflavin to FMN. The mRNA is cell-to-cell mobile. |
| AT2G02990 | Encodes a member of the ribonuclease T2 family that responds to inorganic phosphate starvation, and inhibits production of anthocyanin. Also involved in wound-induced signaling independent of jasmonic acid. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in roots. |
| AT2G01290 | Cytosolic ribose-5-phosphate isomerase. Knockout mutation causes chloroplast dysfunction, late flowering and premature cell death. |
| AT2G37230 | Ribosomal pentatricopeptide repeat protein |
| AT5G15980 | Ribosomal pentatricopeptide repeat protein |
| AT1G26910 | Ribosomal protein L16p/L10e family protein;(source:Araport11) |
| AT3G27830 | 50S ribosomal protein L12-A The mRNA is cell-to-cell mobile. |
| AT3G27840 | 50S ribosomal protein L12-B |
| AT3G27850 | 50S ribosomal protein L12-C The mRNA is cell-to-cell mobile. |
| AT3G05590 | Encodes cytoplasmic ribosomal protein L18. |
| AT2G39460 | Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB. |
| AT3G55280 | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA and functionally redundant to it. |
| AT1G07320 | encodes a plastid ribosomal protein L4 |
| AT3G25520 | Encodes ribosomal protein L5 that binds to 5S ribosomal RNA and in involved in its export from the nucleus to the cytoplasm. Identified in a screen for enhancers of as1. as1/pgy double mutants show defects in leaf vascular patterning and adaxial cell fate. Double mutant analysis indicates pgy genes function in the same pathway as REV, KAN1 and KAN2. |
| AT2G42740 | encodes a cytosolic ribosomal protein L16, which is a constituent of 60S large ribosomal complex. Gene is expressed in root stele and anthers and expression is induced by auxin treatment. |
| AT5G40950 | ribosomal protein large subunit 27;(source:Araport11) |
| AT3G46040 | Regulated by TCP20. The mRNA is cell-to-cell mobile. |
| AT1G74970 | Ribosomal protein S9, nuclear encoded component of the chloroplast ribosome |
| AT3G49080 | Mitochondrial ribosomal protein, similar to RPS9 from E.coli. Loss of function results in gametophyte lethality, particularly the megagametophyte. |
| AT3G63190 | The gene encodes a chloroplast ribosome recycling factor homologue. Analysis of mutants revealed its role in the chloroplast development and eary stages of embryo development. |
| AT1G67090 | Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Functions to yield sufficient Rubisco content for leaf photosynthetic capacity. |
| AT5G44280 | Encodes a nuclear localized protein with similarity to animal polycomb repressive core complex1 (PRC1) core component RING.Appears to function redundantly with ATRING1b, a close paralog. Both interact physically with CLF and LHP1 and appear to function together to repress class I KNOX gene expression. |
| AT3G46620 | Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants. |
| AT5G59550 | Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants. |
| AT5G63970 | Encodes a ubiquitin ligase that is an essential upstream modulator of JA signaling in response to various stimuli. |
| AT1G79380 | Encodes a ubiquitin ligase that is an essential upstream modulator of JA signaling in response to various stimuli. |
| AT3G01650 | Encodes RGLG1 (RING domain ligase 1), a RING domain ubiquitin E3 ligase that negatively regulates the drought stress response by mediating ERF53 transcriptional activity. ABA inhibits myristoylation and induces shuttling of the RGLG1 to promote nuclear degradation of PP2CA. |
| AT4G03510 | RMA1 encodes a novel 28 kDa protein with a RING finger motif and a C-terminal membrane-anchoring domain that is involved in the secretory pathway. Has E3 ubiquitin ligase activity. |
| AT4G28270 | Encodes a RING finger E3 ubiquitin ligase. Binds and ubiquitinates ABP1 in vivo and in vitro. |
| AT4G27470 | Encodes a RING finger E3 ubiquitin ligase. |
| AT3G56580 | Encodes a functional E3 ubiquitin ligase involved in the dehydration stress response and regulation of proline biosynthesis. |
| AT5G22920 | Encodes a protein with sequence similarity to RING, zinc finger proteins. Loss of function mutations show reduced (15%) stomatal aperture under non stress conditions. |
| AT4G11370 | Encodes a putative RING-H2 finger protein RHA1a. |
| AT4G11360 | Encodes a putative RING-H2 finger protein RHA1b. The mRNA is cell-to-cell mobile. |
| AT2G17450 | Encodes a putative RING-H2 finger protein RHA3a. |
| AT4G00335 | RING-H2 finger B1A;(source:Araport11) |
| AT2G40830 | Encodes an E3 ubiquitin ligase for the GA-receptor GID1 that functions as a negative regulator of GA signaling in seedlings and seeds by inducing ubiquitin-dependent proteolysis of GID1s. Tyr321 phosphorylation of GARU by TAGK2 inactivates GARU. |
| AT2G01150 | Encodes a RING-H2 finger protein that is expressed in vascular tissue, root tips, embryos and pistils. |
| AT5G22000 | encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. Double mutant analyses with RHF1a suggests that RHF2a may be involved in targetting ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF2a is expressed in all four floral whorls and is present at ~8-fold higher levels than RHF1a in inflorescences by RT-PCR analyses. |
| AT5G44180 | Interacts with CHR11, CHR17, and ARID5, several known subunits of ISWI. JA biosynthesisis is positively regulated by this chromatin remodeling complex, thereby promoting stamen filament elongation. |
| AT3G11770 | RICE1 is a 23kDa protein with 3?- 5? exoribonuclease activity. It is expressed ubiquitously and localized to the cytoplasm. When RICE1 and its paralog RICE2 are knocked down, miRNA levels are decreased. RICE1 interacts with AGO1 and AGO10. It may affect miRNA accumulation by clearing RISC by degrading 5? products of AGO cleavage. |
| AT5G65900 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G80670 | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT3G61240 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT5G05450 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G55150 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT5G63120 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G06480 | DEAD box RNA helicase family protein;(source:Araport11) |
| AT5G14610 | DEAD box RNA helicase family protein;(source:Araport11) |
| AT3G09720 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G45810 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G60620 | RNA polymerase I subunit 43;(source:Araport11) |
| AT2G41340 | NRPE5-like protein of unknown function; homologous to budding yeast RPB5 |
| AT4G35800 | Encodes the unique largest subunit of nuclear DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB1 and a homolog of the E. coli RNA polymerase beta prime subunit. |
| AT1G12700 | Encodes RNA PROCESSING FACTOR 1 (RPF1), a pentatricopeptide repeat (PPR) protein of the P-class containing canonical PPR-repeats. RPF1 is required for the 5?-end processing of the nad4 mRNA in mitochondria. Ler and other accessions impaired in processing of the nad4 mRNA 5′-end, contain a single nucleotide polymorphism (SNP) 807 nucleotides downstream of the predicted translation start codon (G807A). The resulting premature translation termination codon abolishes the function of the RPF1 gene in Ler. Required for the formation of nad4L-atp4 transcripts with -318 5′ termini. |
| AT1G63130 | Transacting siRNA generating locus. Its derived siR9as targets AT1G62930 for cleavage. Itself is targeted by TAS2-derived ta-siR2140 for cleavage. |
| AT3G54760 | RRM1 interacts with SUVH9 and FVE and has an auxiliary role in RNA-directed DNA methylation. |
| AT4G13850 | Encodes a glycine-rich RNA-binding protein. Gene expression is induced by cold. |
| AT4G39260 | Encodes a glycine-rich protein with RNA binding domain at the N-terminus. Protein is structurally similar to proteins induced by stress in other plants. Gene expression is induced by cold. Transcript undergoes circadian oscillations that is depressed by overexpression of AtGRP7. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). |
| AT5G61030 | Encodes a glycine-rich RNA binding protein that is involved in C-> U RNA editing in mitochondria. Gene expression is induced by cold. The mRNA is cell-to-cell mobile. |
| AT3G26420 | Zinc finger-containing glycine-rich RNA-binding protein. Cold-inducible. Contributes to the enhancement of freezing tolerance. Members of this protein family include AT3G26420 (ATRZ-1A), AT1G60650 (AtRZ-1b) and AT5G04280 (AtRZ-1c). |
| AT3G13224 | Belongs to a member of the RNA-binding glycine-rich (RBG) gene superfamily. |
| AT4G14300 | Belongs to a member of the RNA-binding glycine-rich (RBG) gene superfamily. |
| AT1G58470 | Encodes an mRNA-binding protein that contains two RNA recognition motifs (RRMs) and is expressed in proliferating tissues. Preferentially binds UUAGG, GUAGG and/or UUAGU. Loss of function of RBP1 causes decreased root length. |
| AT1G60200 | RBM25 is an alternative splicing factor involved in mediation of abiotic stress response and ABA response. Its expression is modulated by a variety of stressors and it in turn appears to affect the ratio of splice variants of stress responsive genes such as HAB1.2/HAB1.1. |
| AT4G03110 | Encodes a putative RNA-binding protein that is located in the cytoplasm and is involved in the hypersensitive response and positively regulates salicylic acid-mediated immunity. |
| AT1G14790 | Encodes RNA-dependent RNA polymerase. While not required for virus-induced post-transcriptional gene silencing (PTGS), it can promote turnover of viral RNAs in infected plants. Nomenclature according to Xie, et al. (2004). Involved in the production of Cucumber Mosaic Virus siRNAs. |
| AT3G22680 | Encodes RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex with DMS3 (AT3G49250) and DRD1 (AT2G16390). This complex is termed DDR. The DDR complex is required for polymerase V transcripts and RNA-directed DNA methylation. |
| AT3G15000 | Encodes RIP1 (RNA-editing factor interacting protein 1). Involved in chloroplast and mitochondrial RNA editing. The mRNA is cell-to-cell mobile. |
| AT1G07910 | Encodes a tRNA ligase that resembles the yeast Trl1 RNA ligase in structure and function but very different in sequence. Like Trl1, AtRNL consists of two domains, an N-terminal ligase component and a C-terminal 5'-kinase/2',3'-cyclic phosphodiesterase (CPD) component that can function in tRNA splicing in vivo when expressed as separate polypeptides. Requires a 2'-PO4 end for tRNA splicing in vivo. |
| AT2G29540 | RNA polymerase I(A) and III(C) 14 kDa subunit |
| AT3G53920 | Encodes a sigma-like transcription factor, Sigma 3 (SIG3 or SIGC). As a subunit of chloroplast RNA polymerase, SIG3 confers the ability to recognize promoter sequences on the core enzyme. SIG3 transcribes specifically the psbN gene in plastids. |
| AT1G30510 | Encodes a root-type ferredoxin:NADP(H) oxidoreductase. |
| AT1G64440 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Mutants in RHD1 have abnormally shaped root hairs with a bulbous region at the base. Allelic to REB1 encoding a UDP-D-glucose 4-epimerase involved in cell wall biosynthesis.Involved in growth and cell wall carbohydrate biosynthesis. |
| AT5G51060 | RHD2 (along with RHD3 and RHD4) is required for normal root hair elongation. Has NADPH oxidase activity. Gene is expressed in the elongation and differention zone in trichoblasts and elongating root hairs. RDH2 is localized to the growing tips of root hair cells. It is required for the production of reactive oxygen species in response to extracellular ATP stimulus. The increase in ROS production stimulates Ca2+ influx. |
| AT3G13870 | required for regulated cell expansion and normal root hair development. Encodes an evolutionarily conserved protein with putative GTP-binding motifs that is implicated in the control of vesicle trafficking between the endoplasmic reticulum and the Golgi compartments. Degraded by LNP1 and 2 to maintain a tubular ER network. |
| AT1G66470 | ROOT HAIR DEFECTIVE6;(source:Araport11) |
| AT1G12950 | root hair specific 2;(source:Araport11) |
| AT5G02820 | Involved in the patterning and shape of leaf trichomes. Encodes the DNA topoisomerase VI SPO11-3, involved in endoreduplication |
| AT4G16515 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
| AT5G64770 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
| AT4G33495 | A member of the RPD gene family - there are13 annotated genes and one EST encoding RPD1-like proteins in Arabidopsis. Shows no homology to any protein of known function. Abundant expression found in the shoot apex and the root. rpd1 mutant is a temperature-sensitive mutant isolated on the basis of the impairment in adventitious roots formation in hypocotyl region. Also, disruption of the RPD1 gene by a T-DNA insertion caused embryogenesis arrest at the globular to transition stages. This phenotype is consistent with the hypothesized function of RPD1 in the maintenance of active cell proliferation. |
| AT5G01510 | root UVB sensitive protein (Protein of unknown function, DUF647);(source:Araport11) |
| AT4G38430 | Member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily, also known as DUF315). Interacts with ROP1 but the whole protein lacks Rho guanyl-nucleotide exchange factor activity in vitro. The DUF315/PRONE domain is sufficient to confer RopGEF catalytic activity. ropgef1 mutants have defects in auxin transport that result in abnormal development of embryos and growth defects. |
| AT1G52240 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily . |
| AT3G16130 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT1G31650 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT2G45890 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Mutants exhibit longer root hairs under phosphate-deficient conditions. Involved in cell wall patterning. Encodes ROP activator, regulates the formation of ROP-activated domains; these in turn determine the pattern of cell wall pits. Forms a dimer that interacts with activated ROP11 in vivo, which could provide positive feedback for ROP activation. Required for periodic formation of secondary cell wall pits |
| AT3G55660 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT3G24620 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT4G13240 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT3G53350 | Encodes RIP3 (ROP interactive partner 3), a microtubule-binding protein that is anchored to the plasma membrane domains and promotes local microtubule disassembly, forming as specific pattern of secondary walls in xylem vessel cells. Localized at microtubules and interacts with the plant-specific kinesin AtKinesin-13A. |
| AT4G28560 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Most similar to RIC6 and RIC8 (subfamily group II). Gene is expressed in all tissues examined. |
| AT1G63240 | Methyl-DNA binding protein which interacts with RMB1 and ROS1 acting in the base excision repair pathway through DNA methylation. |
| AT4G34870 | belongs to cyclophilin family |
| AT4G38740 | Encodes cytosolic cyclophilin ROC1. |
| AT2G16600 | Encodes cytosolic cyclophilin ROC3. The mRNA is cell-to-cell mobile. |
| AT5G58710 | Encodes cyclophilin ROC7. The mRNA is cell-to-cell mobile. |
| AT4G36380 | Encodes a cytochrome P-450 gene that is involved in leaf blade expansion by controlling polar cell expansion in the leaf length direction. Member of the CYP90C CYP450 family. ROT3 was shown to be involved in brassinosteroid biosynthesis, most likely in the conversion step of typhasterol (TY) to castasterone (CS). As 6-deoxo-CS was unable to restore the phenotype of rot3-1, it has been postulated that ROT3 might be specifically involved in the conversion of TY to CS in the C6-oxidation pathway of brassinolide. Recently, CYP90C1 was shown to catalyse the C-23 hydroxylation of several brassinosteroids (the enzyme has a broad specificity for 22-hydroxylated substrates). |
| AT3G53232 | ROTUNDIFOLIA like 1;(source:Araport11) |
| AT1G68825 | ROTUNDIFOLIA like 15;(source:Araport11) |
| AT3G25717 | ROTUNDIFOLIA like 16;(source:Araport11) |
| AT2G29125 | ROTUNDIFOLIA like 2;(source:Araport11) |
| AT1G67265 | ROTUNDIFOLIA like 21;(source:Araport11) |
| AT1G64585 | ROTUNDIFOLIA like 22;(source:Araport11) |
| AT2G39705 | ROTUNDIFOLIA like 8;(source:Araport11) |
| AT5G26760 | Encodes RPAP2 IYO Mate (RIMA), a homologue of yeast and human proteins linked to nuclear import of selective cargo. Knockdown of RIMA causes delayed onset of cell differentiation. |
| AT3G25070 | Encodes a member of the R protein complex and may represent a virulence target of type III pili effector proteins (virulence factors) from bacterial pathogens, which is 'guarded' by R protein complex (RPM1 and RPS2 proteins). RIN4 physically interacts with RPS2 and RPM1 in vivo. Bacterial avirulence (Avr) effectors AvrB, AvrRpm1, and AvrRpt2 induce a mobility shift in RIN4 and expression of AvrRpt2 induces rapid degradation of RIN4. RIN4 contains 2 sites for AvrRpt2 autocleavage, called RCS1 and RCS2. Overexpression of RIN4 inhibits multiple phenotypes associated with AvrRpt2 function and also inhibits PAMP-induced defense signaling. Attached to the plasma membrane at its carboxyl terminus. Cleaved by AvrRpt2 at two PxFGxW motifs, one releasing a large portion of RIN4 from the plasma membrane and both exposing amino-terminal residues that destabilized the carboxyl-terminal cleavage products by targeting them for N-end ubiquitylation and proteasomal degradation. Major virulence target of the TTSE HopF2Pto. The mRNA is cell-to-cell mobile. |
| AT2G05940 | Encodes a receptor-like cytoplasmic kinase that phosphorylates the host target RIN4, leading to the activation of a plant innate immune receptor RPM1. |
| AT1G12210 | RFL1 has high sequence similarity to the adjacent disease resistance (R) gene RPS5. |
| AT4G27490 | 3-5-exoribonuclease family protein;(source:Araport11) |
| AT1G77680 | Ribonuclease II/R family protein;(source:Araport11) |
| AT2G32415 | Polynucleotidyl transferase, ribonuclease H fold protein with HRDC domain-containing protein;(source:Araport11) |
| AT1G23860 | Encodes a 9G8-like serine-arginine rich (SR) protein that interacts in vivo with U1-70K, a U1 small nuclear ribonucleoprotein 70-kDa protein that is involved in nuclear precursor mRNA processing. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT2G39730 | Rubisco activase, a nuclear-encoded chloroplast protein that consists of two isoforms arising from alternative splicing in most plants. Required for the light activation of rubisco. Involved in jasmonate-induced leaf senescence. |
| AT5G38420 | Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Activated by OXS2 under the treatment of salt. |
| AT5G38410 | Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Functions to yield sufficient Rubisco content for leaf photosynthetic capacity. |
| AT5G18700 | Encodes a microtubule-associated kinase-like protein RUNKEL (RUK). Contains a putative serine/threonine kinase domain and a microtubule-binding domain. RUK directly binds to microtubules in vitro and colocalizes with mitotic preprophase band, spindle, and phragmoplast in vivo. Required for cell plate expansion in cytokinesis. |
| AT2G35800 | Encodes a predicted calcium-dependent S-adenosyl methionine carrier. |
| AT3G02470 | Encodes a S-adenosylmethionine decarboxylase involved in polyamine biosynthesis. |
| AT5G15950 | Adenosylmethionine decarboxylase family protein;(source:Araport11) |
| AT1G61380 | Encodes a membrane localized S-domain receptor kinase that is involved in lipopolysaccharide (LPS) sensing. SD1-29 detected LPS of Pseudomonas and Xanthomonas species for which it serves as a microbe associated molecular pattern triggering innate immunity. Loses of function mutants are hyper susceptible to P.syringae. |
| AT2G41530 | Encodes a protein with S-formylglutathione hydrolase activity. |
| AT1G49820 | encodes 5-methylthioribose kinase, involved in methionine cycle The mRNA is cell-to-cell mobile. |
| AT1G12800 | SDP is a chloroplast localized RNA binding protein that is required for plastid rRNA processing. Plants harboring a mutation in SDP have numerous defects including reduced chlorophyll content, poor growth, yellow leaves and abnormal chloroplasts. |
| AT3G23700 | Encodes a chloroplast-localized S1 domain-containing protein with RNA chaperone activity that affects the splicing and processing of chloroplast transcripts and plays a role in seedling growth in the presence of ABA. Binds the chloroplast psbA RNA and some other chloroplast RNAs. Required for the stability of the chloroplast ndhC RNA. Inhibits ribosome association with psbA RNA and ycf1 RNA. Not required for the splicing of chloroplast trnL, as had been reported previously. |
| AT5G03350 | Belongs to the group of early SA-activated genes. Involved in resistance to Pst Avr-Rpm1 as a component of the SA35 mediated defense processes associated to the ETI response. Involved in resistance to P.syringae pv. tomato Avr-Rpm1 in Arabidopsis, as a component of the SA-mediated defense processes associated with the effector-triggered immunity response. |
| AT3G51830 | putative transmembrane protein G5p (AtG5) mRNA, complete. autophagy-related (ATG) gene |
| AT3G10730 | Encodes a member of the Sad1/UNC-84 (SUN)-domain proteins: AtSUN1(At5g04990), AtSUN2(AT3G10730). SUN domain proteins are part of the cytoskeletal-nucleoskeletal bridging complexes. AtSUN1 and AtSUN2 are localized to the nuclear envelope and are present as homomers and heteromers in vivo. |
| AT1G50735 | Member of Sadhu non-coding retrotransposon family |
| AT5G14260 | Suppresses singlet oxygen-induced stress responses by protecting grana margins. |
| AT3G27460 | SGF29 tudor-like domain-containing protein;(source:Araport11) |
| AT2G37050 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G02020 | Encodes a protein involved in salt tolerance, names SIS (Salt Induced Serine rich). |
| AT5G24270 | encodes a calcium sensor that is essential for K+ nutrition, K+/Na+ selectivity, and salt tolerance. The protein is similar to calcineurin B. Lines carrying recessive mutations are hypersensitive to Na+ and Li+ stresses and is unable to grow in low K+. The growth defect is rescued by extracellular calcium. |
| AT3G46550 | Isolated in a screen for salt hypersensitive mutants. Mutants have thinner cell walls, abnormal siliques and root growth is inhibited under salt stress. The gene has similarity to arabinogalactan proteins and domains associated with cell adhesion.SOS5 is required for normal mucilage adherence to seeds. |
| AT1G06040 | Encodes salt tolerance protein (STO) which confers salt tolerance to yeast cells. Fully complements calcineurin deficient yeast but does not encode a phosphoprotein phosphatase. Sequence has similarities to CONSTANS. STO co-localizes with COP1 and plays a role in light signaling.STO transcript levels are regulated by photoperiod and phtyohormones. STO competes with FLC in the regulation of floral transition genes SOC1 and FT. |
| AT3G55980 | salt-inducible zinc finger 1;(source:Araport11) |
| AT1G27760 | Encodes a protein with similarity to human interferon-related developmental regulator (IFRD)that is involved in salt tolerance. Loss of function mutations are hypersensitive to salt stress and have reduced fertility. SAT32 is found in the cytoplasm but appears to translocate to the nucleus when plants are subject to salt stress. |
| AT2G31870 | The gene encodes a poly(ADPribose) glycohydrolase (PARG1). Mutant analysis suggests that PARG1 plays a role in abiotic stress responses and DNA repair. Loss of function mutants accumulate poly(ADPribose) and have increased cell death when treated with bleomycin. |
| AT5G60410 | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation. Regulates leaf cell division and expansion through salicylic acid accumulation. signaling |
| AT1G19330 | Evening-expressed key component of Sin3-HDAC complex, which bind directly to the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and PSEUDO-RESPONSE REGULATOR 9 (PRR9) promoters and catalyze histone 3 (H3) deacetylation at the cognate regions to repress expression, allowing the declining phase of their expression at dusk. |
| AT1G73805 | Encodes SAR Deficient 1 (SARD1), a key regulator for ICS1 (Isochorismate Synthase 1) induction and salicylic acid (SA) synthesis. |
| AT5G52810 | SAR-DEFICIENT4 (SARD4) alias ORNITHINE CYCLODEAMINASE/m-CRYSTALLIN (ORNCD1) is involved in the biosynthesis of pipecolic acid. The reductase converts dehydropipecolic acid intermediates generated from L-Lysine by AGD2-LIKE DEFENSE RESPONSE PROTEIN1 (ALD1) to pipecolic acid (PMID:28330936). |
| AT2G33800 | Encodes SCABRA1 (SCA1), a nuclear gene encoding a plastid-type ribosomal protein that functions as a structural component of the 70S plastid ribosome. The sca1-rps5 allele exhibits defects in plastid 16SrRNA processing and a resulting decrease in accumulation of photosynthetic proteins. Loss-of-function mutations enhance the polarity defects of the as2 mutants. |
| AT5G01730 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
| AT3G54220 | Encodes a member of a novel family having similarity to DNA binding proteins containing basic-leucine zipper regions; scr is expressed in cortex/endodermal initial cells and in the endodermal cell lineage. Regulates the radial organization of the root. Is required cell-autonomously for distal specification of the quiescent center, which in turn regulates stem cell fate of immediately surrounding cells. SCR appears to be a direct target of SHR. SCR and SCR-LIKE 23 act redundantly in bundle sheath cell fate specification. |
| AT1G07530 | Encodes a member of the GRAS family of transcription factors. The protein interacts with the TGA2 transcription factor and affects the transcription of stress-responsive genes. The protein is found in the nucleus and is also exported to the cytoplasm. |
| AT1G50420 | Encodes a scarecrow-like protein (SCL3) Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay). |
| AT5G52510 | SCARECROW-like 8;(source:Araport11) |
| AT5G13300 | Belongs to 15-member small GTPase gene family, ARF-GAP domain proteins (AGD); corresponds to AGD3, and is one of four proteins belonging to class 1, together with AGD1, AGD2 and AGD4. The protein contains four domains: BAR domain, PH domain, an ARF-GAP domain, and two Ankyrin repeats. In sfc mutants, the secondary and tertiary veins of cotyledons, leaves, sepals and petals are largely replaced by small segments of discontinuous veins. sfc mutants have exaggerated responses to auxin. |
| AT3G54990 | Encodes a AP2 domain transcription factor that can repress flowering. SMZ and its paralogous gene, SNARCHZAPFEN (SNZ), share a signature with partial complementarity to the miR172 microRNA, whose precursor is induced upon flowering. |
| AT2G39250 | Encodes a AP2 domain transcription factor that can repress flowering. SNZ and its paralogous gene, SCHLAFMUTZE (SMZ), share a signature with partial complementarity to the miR172 microRNA, whose precursor is induced upon flowering. |
| AT5G46410 | Encodes a SCP1-like small phosphatase (SSP). Three SSPs form a unique group with long N-terminal extensions: AT5G46410 (SSP4), AT5G11860 (SSP5), AT4G18140 (SSP4b). SSP4 and SSP4b were localized exclusively in the nuclei, whereas SSP5 accumulated in both nuclei and cytoplasm. All three SSPs encodes active CTD phosphatases like animal SCP1 family proteins, with distinct substrate specificities: SSP4 and SSP4b could dephosphorylate both Ser2-PO(4) and Ser5-PO(4) of CTD, whereas SSP5 dephosphorylated only Ser5-PO(4). The mRNA is cell-to-cell mobile. |
| AT4G18140 | Encodes a SCP1-like small phosphatase (SSP). Three SSPs form a unique group with long N-terminal extensions: AT5G46410 (SSP4), AT5G11860 (SSP5), AT4G18140 (SSP4b). SSP4 and SSP4b were localized exclusively in the nuclei, whereas SSP5 accumulated in both nuclei and cytoplasm. All three SSPs encodes active CTD phosphatases like animal SCP1 family proteins, with distinct substrate specificities: SSP4 and SSP4b could dephosphorylate both Ser2-PO(4) and Ser5-PO(4) of CTD, whereas SSP5 dephosphorylated only Ser5-PO(4). |
| AT1G14182 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT5G51110 | Encodes a protein involved in Rubisco assembly that also mediates Abscisic acid-dependent stress response. It is a ubiquitination target of the intracellular E3 ligase SDIR1. It selectively regulates the expression of the downstream basic region/leucine zipper motif transcription factor gene ABA-INSENSITIVE5, rather than ABA-RESPONSIVE ELEMENTS BINDING FACTOR3 (ABF3) or ABF4, to regulate ABA-mediated seed germination and the plant salt response. |
| AT4G36490 | SEC14-like 12;(source:Araport11) |
| AT3G62440 | Encodes an F-box protein which is predominantly expressed in flower tissues and interacts with ASK19 protein. Mutations in this gene suggest it acts as a negative regulator of endothecial secondary wall thickening in anthers. |
| AT3G04240 | Protein O-GlcNAc transferase. Together with SPY functions to competitively regulate RGA1 (At2g01570). |
| AT1G03220 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G11890 | Member of SEC22 Gene Family; regulates cell morphogenesis via affecting cytoskeleton organization and stabilities. |
| AT1G56330 | Encodes a small GTP-binding protein implicated in ER to cis-Golgi transport of other proteins. A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. The protein is found associated to the ER and free in the cytosol. |
| AT1G09180 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
| AT1G11180 | Secretory carrier membrane protein (SCAMP) family protein;(source:Araport11) |
| AT2G20840 | Secretory carrier membrane protein (SCAMP) family protein;(source:Araport11) |
| AT1G32050 | SCAMP family protein;(source:Araport11) |
| AT3G55800 | Encodes the chloroplast enzyme sedoheptulose-1,7-bisphosphatase (SBPase), involved in the carbon reduction of the Calvin cycle. Increase in SBPase activity in transgenic lines accumulate up to 50% more sucrose and starch than wild-type. The mRNA is cell-to-cell mobile. |
| AT5G07190 | Gene is expressed preferentially in the embryo and encodes a unique protein of unknown function. |
| AT1G55740 | seed imbibition 1;(source:Araport11) |
| AT5G40390 | Encodes a protein which might be involved in the formation of verbascose. A T-DNA insertion mutant was shown to have a decreased amount of verbascose (as well as mannitol) whereas the levels of raffinose and stachyose remained unchanged. Enhances drought tolerance through raffinose synthesis or galactinol hydrolysis. |
| AT3G57520 | SIP2 encodes a raffinose-specific alpha-galactosidase that catalyzes the breakdown of raffinose into alpha-galatose and sucrose. This enzyme may function in unloading raffinose from the phloem as part of sink metabolism. Although it was originally predicted to act as a raffinose synthase (RS), that activity was not observed for recombinant SIP2. |
| AT4G18520 | Encodes a PPR (pentatricopeptide repeat) protein PDM1/SEL1. Involved in RNA editing and splicing of plastid genes. |
| AT3G10420 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G00026 | Encodes SD3 (Segregation Distortion 3), a protein with high similarity to yeast translocase on the inner mitochondrial membrane 21 (TIM21). sd3 mutants show seedling-lethal phenotype in light-grown seedlings and shorter hypocotyls in dark-grown seedlings. SD3 overexpression plants show increase in cell number and cell size, as well as elevated ATP level. |
| AT4G14030 | selenium-binding protein 1;(source:Araport11) |
| AT4G14040 | selenium-binding protein 2;(source:Araport11) |
| AT3G47300 | SELT-like protein precursor;(source:Araport11) |
| AT4G35770 | Senescence-associated gene that is strongly induced by phosphate starvation. Transcripts are differentially regulated at the level of mRNA stability at different times of day. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. |
| AT3G10985 | A senescence-associated gene whose expression is induced in response to treatment with Nep1, a fungal protein that causes necrosis. The mRNA is cell-to-cell mobile. |
| AT1G20780 | Encodes a protein containing a U-box and an ARM domain. Homozygous mutant seedlings have a seedling lethal phenotype with widespread cell death lesions throughout the cotyledons and roots. |
| AT5G14930 | encodes an acyl hydrolase involved in senescence . |
| AT4G02380 | Encodes AtLEA5 (late embryogenesis abundant like protein). Also known as SENESCENCE-ASSOCIATED GENE 21 (SAG21). Has a role on oxidative stress tolerance. mRNA levels are elevated in response to various stresses. |
| AT3G14067 | Encodes a protein with similarity to serine protease, subtilisin, that is upregulated during senescence and expressed in the arial portions of the plant.Loss of function mutations have increased branch number but normal silique length and seed set and therefore have increased fertility. |
| AT3G02040 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. Has glycerophosphodiester phosphodiesterase activity. Functions in maintaining cellular phosphate homeostasis under phosphate starvation. The mRNA is cell-to-cell mobile. |
| AT3G06510 | Encodes a protein with beta-glucosidase and galactosyltransferase activity, mutants show increased sensitivity to freezing. Though it is classified as a family I glycosyl hydrolase, it has no hydrolase activity in vitro. |
| AT4G04920 | Encodes a nuclear targeted protein that plays a role in the CBF pathway -downstream of CBF translation. Mutants have impaired cold responses, reduced levels of cold induced RNA transcripts, are sensitive to osmotic stress. Required for expression of CBF-controlled cold-upregulated genes and some, but not all, other cold up-regulated genes. Required for recruitment of the Mediator complex and RNA polymerase II to CBF-controlled cold-responsive genes. Required for expression of some dark-upregulated genes. SFR6 was isolated as a suppressor of cell wall defects in cob6 mutant background. |
| AT5G43940 | Encodes a glutathione-dependent formaldehyde dehydrogenase (also known as class III type alcohol dehydrogenase) reduces S-nitrosoglutathione (GSNO), the condensation product of glutathione and NO, that is a naturally occurring NO reservoir and also a reactive nitrogen intermediate. Gene expression is reduced by wounding and induced by salicylic acid. Is required for the acclimation of plants to high temperature and for fertility. |
| AT1G34370 | Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity. Cell wall of the mutant is unstable in low pH medium (pH 4.5) in low Ca solution. This would mediate Ca-alleviation of low pH stress through pectin-Ca interaction. In vitro binding and mutated-promoter-GUS assays identified that STOP1 directly activates AtALMT1 expression through the binding to the promoter by four zinc finger domains. Binding of STOP1 to promoter is an essential step of Al-inducible AtALMT1 expression. The mRNA is cell-to-cell mobile. |
| AT5G22890 | An unique homologue of STOP1 (AT1G34370) in Arabidopsis genome. Transformation to the stop1-mutant activated several genes that are regulated by STOP1, and conferred proton sensitive phenotype. |
| AT4G29520 | SES1 is an ER localized chaperone involved in salt and heat stress response. |
| AT5G59560 | Encodes a novel protein conserved in higher eukaryotes. Normal function of the protein is required for normal oscillator function during circadian rhythm. Mutant analyses also suggest a role in phytochrome B (phyB)-mediated light signaling. |
| AT3G02310 | MADS-box protein, binds K domain of AG in vivo |
| AT5G15800 | Encodes a MADS box transcription factor involved flower and ovule development. Functionally redundant with SEP2 and SEP3. |
| AT1G24260 | Member of the MADs box transcription factor family. SEP3 is redundant with SEP1 and 2. Flowers of SEP1/2/3 triple mutants show a conversion of petals and stamens to sepals.SEP3 forms heterotetrameric complexes with other MADS box family members and binds to the CArG box motif. |
| AT5G36180 | serine carboxypeptidase-like 1;(source:Araport11) |
| AT2G23000 | serine carboxypeptidase-like 10;(source:Araport11) |
| AT2G22970 | serine carboxypeptidase-like 11;(source:Araport11) |
| AT2G22980 | serine carboxypeptidase-like 13;(source:Araport11) |
| AT3G12203 | serine carboxypeptidase-like 17;(source:Araport11) |
| AT4G12910 | serine carboxypeptidase-like 20;(source:Araport11) |
| AT3G02110 | serine carboxypeptidase-like 25;(source:Araport11) |
| AT4G30810 | serine carboxypeptidase-like 29;(source:Araport11) |
| AT5G23210 | serine carboxypeptidase-like 34;(source:Araport11) |
| AT3G63470 | serine carboxypeptidase-like 40;(source:Araport11) |
| AT3G10410 | SERINE CARBOXYPEPTIDASE-LIKE 49;(source:Araport11) |
| AT1G15000 | serine carboxypeptidase-like 50;(source:Araport11) |
| AT3G48780 | Encodes one of the two LCB2 subunits (LCB2a and LCB2b) of serine palmitoyltransferase, an enzyme involved in sphingolipid biosynthesis. LCB2a and LCB2b are functional redundant. Double mutants are gametophytic lethal. The mRNA is cell-to-cell mobile. |
| AT4G37930 | Encodes a protein with mitochondrial serine hydroxymethyltransferase activity, which functions in the photorespiratory pathway, catalyzes the conversion of serine and tetrahydrofolate to glycine and 5,10-methylene tetrahydrofolate. Involved in controlling cell damage caused by abiotic stress, such as high light and salt and the hypersensitive defense response of plants. |
| AT4G02430 | Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT5G63870 | Encodes a nuclear localized serine/threonine phosphatase that appears to be regulated by redox activity and is a positive regulator of cryptochrome mediated blue light signalling. |
| AT5G01820 | Encodes a CBL-interacting serine/threonine protein kinase. |
| AT3G08720 | Encodes a ribosomal-protein S6 kinase. Gene expression is induced by cold and salt (NaCl). Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Phosphorylates specifically mammalian and plant S6 at 25 degrees C but not at 37 degrees C. Involved in translational up-regulation of ribosomal proteins. |
| AT1G69960 | type 2A serine/threonine protein phosphatase (PP2A) mRNA, positive regulators of SPCH and thus stomatal production. |
| AT4G15410 | serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime gamma;(source:Araport11) |
| AT4G35780 | ACT-like protein tyrosine kinase family protein;(source:Araport11) |
| AT4G38470 | Serine/threonine kinase that phosphorylate transit peptides of chloroplast and mitochondria targeted pre-proteins. |
| AT2G17700 | ACT-like protein tyrosine kinase family protein;(source:Araport11) |
| AT2G24360 | STYK serine threonine kinase that phosphorylates several oil body proteins including OLE1 and CLO4/CAL4. |
| AT2G27100 | Identified as a leaf form mutant by Redei having serrated leaves. Further analysis of the single loss of function allele indicated pleiotropic effects extending to many aspects of shoot development such as taller meristems, alterations in phase transition, phyllotaxy and branching. Encodes a single zinc finger containing protein that is expressed in meristems and organ primordia and forms a complex with both AtCBC (cap binding complex) proteins to control alternative splicing. |
| AT1G11870 | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana. |
| AT4G30860 | Encodes a member of the trxG protein family. Contains a SET domain which is known to be involved in modification of histone tails by methylation. Interacts physically with AMS, but the implications of this interaction are unknown.Overexpression results in plieotrophic developmental defects. |
| AT3G61740 | Encodes SET domain containing protein that acts redundantly with ATX4/5 to regulate histone H3-K4 methylation. Involved in bolting/flowering time together with ATX1 and ATX4. |
| AT4G25520 | SEUSS-like 1;(source:Araport11) |
| AT5G62090 | Encodes a protein that functions with LUH to promote Al binding to the root cell wall. |
| AT1G17040 | Encodes a protein that contains an SH2 domain. It can pull down a 120-kD tyrosine-phosphorylated protein in vitro. It is predicted to act as a transcription factor. |
| AT1G31440 | SH3 domain-containing protein;(source:Araport11) |
| AT4G18060 | SH3 domain-containing protein;(source:Araport11) |
| AT5G26680 | Encodes a FEN1 homolog that has double-flap endonuclease activity, weak GEN activity towards bubble DNA structures and flap endonuclease activity towards substrates with a single-flap structure, but lacks the 5′ exonuclease activity towards DNA substrates with a nick on one strand, and GEN activity towards gapped DNA without any flap. It is expressed in rapidly dividing cells and mutants have smaller roots and hypocotyls. |
| AT5G14640 | shaggy-like kinase 13;(source:Araport11) |
| AT4G00720 | Encodes ASKtheta, a group III Arabidopsis GSK3/shaggy-like kinase. Functions in the brassinosteroid signalling pathway. |
| AT5G26751 | Encodes a SHAGGY-related kinase involved in meristem organization. It regulates the redox stress response by phosphorylating glucose-6-phosphate dehydrogenase 6.Functions as a positive regulator of salt stress tolerance. Phosphorylates and enhances G6PD6 (At5g40760) activity |
| AT2G30980 | Encodes a GSK3-like protein kinase. This protein can interact with the BZR1 protein involved in brassinosteroid-mediated signaling in a Y2H assay and promotes BZR1 phosphorylation in protoplasts. |
| AT4G26690 | Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development. |
| AT4G24190 | encodes an ortholog of GRP94, an ER-resident HSP90-like protein and is involved in regulation of meristem size and organization. Single and double mutant analyses suggest that SHD may be required for the correct folding and/or complex formation of CLV proteins. Lines carrying recessive mutations in this locus exhibits expanded shoot meristems, disorganized root meristems, and defective pollen tube elongation. Transcript is detected in all tissues examined and is not induced by heat. Endoplasmin supports the protein secretory pathway and has a role in proliferating tissues. |
| AT1G07010 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT1G75520 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis.SRS5 is a positive regulator of photomorphogenesis. |
| AT3G54430 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
| AT4G39540 | Encodes a shikimate kinase. Its transcripts appear to be expressed in vegetative tissues and developing embryos. SK2 transcript levels rise in response to Phytophthora infestans spores. SK2 is believed to be localized to the chloroplast. |
| AT3G26900 | Encodes a protein with some sequence similarity to shikimate kinases, but a truncated form of this protein (lacking a putative N-terminal chloroplast transit peptide) does not have shikimate kinase activity in vitro. skl1-3 mutants have a variegated phenotype and skl1-8 mutants have an albino phenotype consistent with the observation of chloroplast defects in these mutants. |
| AT1G31480 | encodes a novel protein that may be part of a gene family represented by bovine phosphatidic acid-preferring phospholipase A1 (PA-PLA1)containing a putative transmembrane domain. SGR2 is involved in the formation and function of the vacuole. |
| AT2G01940 | Encodes a transcription factor that, together with IDD14 and IDD16, regulates auxin biosynthesis and transport and thus aerial organ morphogenesis and gravitropic responses. May be involved in an early event in shoot gravitropism such as gravity perception and/or a signaling process subsequent to amyloplast sedimentation as a putative transcription factor in gravity-perceptive cells. |
| AT2G36810 | Specifically involved in gravity perception and/or gravity signal transduction for the shoot gravitropic response. Effects gravitropism only in inflorescence stems but normal in both hypocotyls and roots. |
| AT5G02750 | Encodes an E3 ligase, SHOOT GRAVITROPISM9. Modulates the interaction between statoliths and F-Actin in gravity sensing. |
| AT4G25350 | SHB1 encodes a nuclear and cytosolic protein that has motifs homologous with SYG1 protein family members. Acts in cryptochrome signaling. Overexpression of SHB1 enhanced the expression of PHYTOCHROME-INTERACTING FACTOR4 (PIF4) under red light and promoted proteasome-mediated degradation of phytochrome A and hypocotyl elongation under far-red light. A knockout allele suppressed LONG HYPOCOTYL IN FAR-RED LIGHT1 (HFR1) expression and showed several deetiolation phenotypes. Acts upstream of HFR1. Regulates seed development. |
| AT5G66350 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Shi mutant is dominant, has dwarf phenotype. Loss of function mutations have no observable phenotype. Putative zinc finger protein. Involved in the response to gibberellic acid. |
| AT4G39100 | Encodes a plant-specific histone reader capable of recognizing both H3K27me3 and H3K4me3 via its bromo-adjacent homology (BAH) and plant homeodomain (PHD) domains, respectively. Detailed biochemical and structural studies suggest a binding mechanism that is mutually exclusive for either H3K4me3 or H3K27me3. SHL plays a role in the repression of flowering. |
| AT1G10682 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT2G41312 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT3G06125 | Unknown gene The mRNA is cell-to-cell mobile. |
| AT3G26612 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT3G27884 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT5G24735 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT4G20362 | Natural antisense transcript overlaps with AT4G20360. Has been identified as a translated small open reading frame by ribosome profiling. |
| AT3G29250 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G47140 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G47130 | Encodes a short-chain dehydrogenase/reductase that is not involved in ABA biosynthesis but plays an important role in plant defense response to bacteria. |
| AT3G55290 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G52290 | Encodes a protein with similarity to XPF endonucleases. Loss of function mutations have defects in meiosis- specifically a reduction in the number of chiasmata. As a result both pollen and embryo sacs are abnormal and plants have severely reduced fertility. |
| AT3G03060 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G18330 | AAA-type ATPase family protein;(source:Araport11) |
| AT2G45690 | Encodes a protein with similarity to yeast Pep16p, a membrane localized protein involved in peroxisome assembly and protein-trafficking. SSE1 mutant seeds do not accumulate oils and dessicated seeds have a shrunken appearance. Involved in protein and oil body biogenesis. SSE is expressed during seed development, reaching the highest peak in mature siliques. Expression in leaves and roots is low compared to cotyledons and flowers. Located in peroxisomes and endoplasmic reticulum. Homologous to the peroxin PEX16 and complements the pex16 mutants of the yeast Yarrowia lipolytica. |
| AT3G48820 | Encodes a homolog of the animal sialyltransferases but sialyltransferase activity was not detected (Plant Biology 2009, 11:284). Located in the Golgi apparatus. |
| AT1G08180 | cyclin-dependent kinase inhibitor;(source:Araport11) |
| AT5G02220 | cyclin-dependent kinase inhibitor;(source:Araport11) |
| AT1G07500 | SMR5 is a member of the SIAMESE-RELATED Cyclin-Dependent Kinase Inhibitor family. It is induced by ROS/oxidative stress. |
| AT4G24500 | Encodes a proline-rich protein SICKLE (SIC). Required for development and abiotic stress tolerance. Involved in microRNA biogenesis. It is involved in mRNA splicing. It is a single copy gene in Arabidopsis and likely specific to higher plants. Along with RCN1, it functions in regulating auxin transport processes in part by regulating the recycling of PIN1 and PIN2 auxin transporters. It is required for circadian clock temperature responses. |
| AT3G10680 | SLI1 is a heat shock like protein that is found in sieve elements, sieve plates and spherical bodies peripheral to the mitochondria. Mutants show increased phloem feeding by aphids and decreased heat tolerance. |
| AT3G01680 | Encodes a protein localized to phloem filaments that is required for phloem filament formation. The mRNA is cell-to-cell mobile. |
| AT5G13730 | Encodes sigma 4 factor, involved in regulating the activity of the plastid-encoded RNA polymerase PEP. Regulates the overall quantity of NDH complexes and thus influences NDH activity. |
| AT2G41180 | VQ motif-containing protein;(source:Araport11) |
| AT2G03120 | homologous to Signal Peptide Peptidases (SPP), required for pollen development and pollen germination. No homozygotes could be recovered from a T-DNA insertion mutant. The mRNA is cell-to-cell mobile. |
| AT1G73990 | Encodes a putative protease SppA (SppA). |
| AT4G33410 | SIGNAL PEPTIDE PEPTIDASE-LIKE 1;(source:Araport11) |
| AT1G63690 | SIGNAL PEPTIDE PEPTIDASE-LIKE 2;(source:Araport11) |
| AT2G43070 | SIGNAL PEPTIDE PEPTIDASE-LIKE 3;(source:Araport11) |
| AT1G01650 | SIGNAL PEPTIDE PEPTIDASE-LIKE 4;(source:Araport11) |
| AT1G15310 | 54 kDa protein subunit of SRP that interacts with the signal peptide of secreted proteins |
| AT3G15390 | Encodes a novel protein that is similar to PRL1 interacting factor and is involved in virus induced silencing. |
| AT1G44800 | Encodes Siliques Are Red 1 (SIAR1). Functions as a bidirectional amino acid transporter that is crucial for the amino acid homeostasis of siliques. Member of nodulin MtN21-like transporter family. |
| AT1G23550 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Its transcript level is up-regulated by tunicamycin (N-linked glycosylation inhibitor causing ER stress). |
| AT5G62520 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Up-regulated by NaCl. SRO5 and P5CDH (an overlapping gene in the antisense orientation) generate 24-nt and 21-nt siRNAs, which together are components of a regulatory loop controlling reactive oxygen species (ROS) production and stress response. |
| AT1G59890 | SIN3-like 5;(source:Araport11) |
| AT1G10450 | Encodes SIN3-like 6, a homolog of the transcriptional repressor SIN3 (AT1G24190). |
| AT5G37890 | Encodes an E3 protein ligase (based on a self-ubiquitination in vitro assay). |
| AT2G22990 | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose. |
| AT5G09230 | Encodes SRT2, a member of the SIR2 (sirtuin) family HDAC (histone deacetylase) (SRT1/AT5g55760, SRT2/AT5G09230). |
| AT5G16270 | Encodes a SCC1/REC8 ortholog that may be involved in mitosis and may represent a mitotic cohesin. Plays a role in somatic DNA double strand break damage repair. The mRNA is cell-to-cell mobile. |
| AT4G20310 | Encodes a Golgi-localized protease that can cleave the transcription factors bZIP17 and bZIP28 that are translocated from the ER through the Golgi so that the transcription factors can be released to translocate into the nucleus. |
| AT5G57900 | F-box protein, interacts with SKP1/ASK1 subunit of SCF ubiquitin ligase in a glucose-dependent manner |
| AT2G21950 | Encodes an SKP1 interacting partner (SKIP6). |
| AT5G45360 | Encodes a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins. |
| AT1G10230 | Involved in protein degradation. One target is PHR1. |
| AT2G45950 | SKP1-like 20;(source:Araport11) |
| AT3G61415 | SKP1-like 21;(source:Araport11) |
| AT1G06110 | SKP1/ASK-interacting protein 16;(source:Araport11) |
| AT5G67250 | Encodes an SKP1 interacting partner (SKIP2).Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,2, and 3. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes. |
| AT4G28090 | SKU5 similar 10;(source:Araport11) |
| AT2G23630 | SKU5 similar 16;(source:Araport11) |
| AT4G22010 | SKU5 similar 4;(source:Araport11) |
| AT1G76160 | SKU5 similar 5;(source:Araport11) |
| AT1G41830 | SKU5-similar 6;(source:Araport11) |
| AT4G27970 | Encodes a protein with ten predicted transmembrane helices. The SLAH2 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. But, it is not expressed in guard cells and cannot complement a slac1-2 mutant suggesting that it performs a different function. SLAH2:GFP localizes to the plasma membrane. |
| AT5G24030 | Encodes a protein with ten predicted transmembrane helices. The SLAH3 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. Although it is not expressed in guard cells, it can complement an slac1-2 mutant suggesting that it performs a similar function. SLAH3:GFP localizes to the plasma membrane. |
| AT4G24210 | F-box protein that is involved in GA signaling. Regulates seed germination. Component of E3 ubiquitin complex. Interacts with DELLA proteins. |
| AT2G22410 | SLOW GROWTH 1;(source:Araport11) |
| AT3G14080 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT2G43810 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT3G04090 | Belongs to a family of plant aquaporins. Similar to yeast and radish aquaporins. Located on ER. |
| AT1G55270 | SAGL1 is a member of a small family of KELCH domain containing proteins. Loss of function mutants show increased lignin and anthocyanin production suggesting a role in regulation of phenylpropanoid biosynthesis. |
| AT5G18010 | Encodes SAUR19 (small auxin up RNA 19). Note that TAIR nomenclature is based on Plant Mol Biol. 2002, 49:373-85 (PMID:12036261). In Planta (2011) 233:1223?1235 (PMID:21327815), At5g18010 is SAUR24. |
| AT5G18020 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G18030 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G18080 | Encodes SAUR24 (small auxin up RNA 24). Note that TAIR nomenclature is based on Plant Mol Biol. 2002, 49:373-85 (PMID:12036261). In Planta (2011) 233:1223?1235 (PMID:21327815), SAUR24 is At5g18010. |
| AT3G03850 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G03840 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G03830 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G03820 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G29440 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G38850 | mRNA is rapidly induced by auxin and is very short-lived. Has been used as a reporter gene in studying auxin mutants. |
| AT2G45210 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G79130 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G16510 | Encodes a clade III SAUR gene with a distinctive expression pattern in root meristems. It is normally expressed in the quiescent center and cortex/endodermis initials and upon auxin stimulation, the expression is found in the endodermal layer. Overexpression studies suggest roles in cell expansion and auxin transport. |
| AT1G29490 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G56150 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G12830 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G34770 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G66260 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G38840 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G38860 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G34790 | Putative OXS2-binding DEGs were constitutively activated by OXS2. |
| AT2G46690 | Regulates ABA-mediated responses to drought stress. |
| AT4G12410 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G34800 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G03310 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G36210 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G34750 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G34760 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G75590 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G19840 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G21210 | Putative auxin-regulated protein whose expression is downregulated in response to chitin oligomers. |
| AT1G29420 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G29430 | SAUR762 expression is induced during pollination and expressed in pollen tubes. SAUR62 likely functions in translation of proteins required for pollen tube development/function. |
| AT1G29450 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G29460 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G29500 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G21200 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G03847 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G17345 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G72430 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G35290 | hypothetical protein;(source:Araport11) |
| AT4G36110 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G06210 | Encodes a chloroplast protein involved in the responses to salt and oxidative stresses. |
| AT2G30942 | Encodes a 56-amino acid polypeptide with low but significant similarity to human small subunit of serine palmitoyltransferase that localizes to the ER and physically interacts with and greatly stimulates the activity of LCB1/LCB2 heterodimer ser palmitoyltransferase complex. |
| AT4G34620 | Encodes ribosomal protein S16, has embryo-defective lethal mutant phenotype |
| AT1G56580 | Encodes SMALLER WITH VARIABLE BRANCHES (SVB), a protein with a conserved domain of unknown function (DUF538). The trichomes of the SVB mutants are smaller and exhibit branches of variable length and number. ABA responsive trichome formation regulator. |
| AT4G30350 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. Regulates root and root hair development downstream of KAI2-mediated signaling. |
| AT2G29970 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. The mRNA is cell-to-cell mobile. |
| AT3G58030 | Encodes a RING domain E3 ligase. Has overlapping function with MUSE2 in the negative regulation of defence responses. SIKIC2 (and possibly SIKIC1 and 3) is ubiquination target. |
| AT2G42030 | Encodes a RING domain E3 ligase. Has overlapping function with MUSE1 in the negative regulation of defence responses. SIKIC2 (and possibly SIKIC1 and 3) is ubiquination target. |
| AT3G01090 | encodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It can also interact with PRL1 DWD-containing protein. Based on in vitro degradation assays and cul4cs and prl1 mutants, there is evidence that AKIN10 is degraded in a proteasome-dependent manner, and that this depends on a CUL4-PRL1 E3 ligase |
| AT1G78290 | encodes a member of SNF1-related protein kinase (SnRK2) family whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress and dehydration. |
| AT5G08590 | Encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Similar to the calcium/calmodulin-dependent protein kinase subfamily and the SNF1 kinase subfamily. |
| AT1G60940 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. |
| AT5G63650 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. |
| AT3G48530 | SNF1-related protein kinase regulatory subunit gamma 1;(source:Araport11) |
| AT3G20010 | Encodes a member of the SNF2 family of helicase-like proteins and is involved in RNA-directed DNA methylation. It is functionally redundant with FRG2 and interacts physically with SUVR2, another component of the RdDM pathway. |
| AT1G62750 | Nuclear encoded protein consists of the five domains conserved in EF-G proteins, with two GTP-binding sites in the first domain, and an additional transit peptide at the N-terminus. Localized in chloroplasts. Point mutation results in a delay in the onset of germination. At early developmental stage embryos still contain undifferentiated proplastids. The greening of cotyledons is severely impaired in light-grown mutant sco1 seedlings, whereas the following true leaves develop normally as in wild-type plants. |
| AT3G05030 | Encodes a vacuolar K+/H+ exchanger essential for active K+ uptake at the tonoplast and involved in regulating stomatal closure. |
| AT4G32400 | Encodes a plastidial nucleotide uniport carrier protein required to export newly synthesized adenylates into the cytosol. |
| AT2G37570 | encodes a protein that can complement the salt-sensitive phenotype of a calcineurin (CaN)-deficient yeast mutant. This gene occurs in a single-copy and is 75% identical to tobacco SLT1 gene. |
| AT1G78510 | Encodes one of the two paralogous solanesyl diphosphate synthases - SPS1 (At1g78510) and SPS2 (At1g17050) - that assemble the side-chain of plastoquinone-9 in plastids. |
| AT1G17050 | Encodes one of the two paralogous solanesyl diphosphate synthases - SPS1 (At1g78510) and SPS2 (At1g17050) - that assemble the side-chain of plastoquinone-9 in plastids. |
| AT1G14750 | Encodes a meiotic cyclin-like protein, distinct from all other known Arabidopsis cyclins. It is not required for meiotic DSB formation but is necessary for meiotic DSB repair via the homologous chromosome. |
| AT1G71830 | Plasma membrane LRR receptor-like serine threonine kinase expressed during embryogenesis in locules until stage 6 anthers, with higher expression in the tapetal cell layer. SERK1 and SERK2 receptor kinases function redundantly as an important control point for sporophytic development controlling male gametophyte production. SERK1 interacts with and transphosphorylates EMS1 |
| AT1G34210 | Plasma membrane LRR receptor-like serine threonine kinase expressed during embryogenesis in locules until stage 6 anthers, with higher expression in the tapetal cell layer. SERK1 and SERK2 receptor kinases function redundantly as an important control point for sporophytic development controlling male gametophyte production. The mRNA is cell-to-cell mobile. |
| AT1G03790 | Encodes SOMNUS (SOM), a nucleus-localized CCCH-type zinc finger protein. SOM negatively regulates light-dependent seed germination downstream of PIL5 (AT2G20180). |
| AT5G58440 | sorting nexin 2A;(source:Araport11) |
| AT1G15240 | Encodes a member of the Arabidopsis sorting nexin family. |
| AT5G58380 | Encodes a CBL-interacting protein kinase with similarity to SOS protein kinase. |
| AT4G30960 | Encodes CBL-interacting protein kinase 6 (CIPK6). Required for development and salt tolerance. The mRNA is cell-to-cell mobile. |
| AT2G30360 | Encodes a SOS2-like protein kinase that is a member of the CBL-interacting protein kinase family.Loss of function mutants show a decrease in sensitivity to high pH.Phosphorylates AHA2, a plasma membrane H+ ATPase.This phosphorylation appears to regulate the activity of the proton transporter. |
| AT5G10150 | SOK2 is a DUF966 domain containing protein of unknown function. Expressed in discrete domains of the PM. In root endodermis and embryo, expression is in inner basal edges and in basal |
| AT2G28150 | DUF966 domain containing protein, expressed during embryogenesis. |
| AT5G59790 | SOK5 is a DUF966 domain containing protein expressed in early embryos. |
| AT1G53090 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA4 (and SPA3) predominantly regulates elongation growth in adult plants. |
| AT4G36930 | Encodes a transcription factor of the bHLH protein family. Mutants have abnormal, unfused carpels and reduced seed dormancy. |
| AT1G23820 | Spermidine synthase. |
| AT1G70310 | Spermidine synthase. |
| AT5G53120 | encodes a novel spermine synthase and is a paralog of previously characterized spermidine synthases, SPDS1 and SPDS2. SPDS3 forms heterodimers with SDPS2, which in turn forms heterodimers with SDPS1 in vivo. The gene does not complement speDelta3 deficiency of spermidine synthase in yeast but DOES complement speDelta4 deficiency. |
| AT1G69640 | Encodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth. |
| AT1G14290 | Encodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth. |
| AT3G61580 | Fatty acid/sphingolipid desaturase;(source:Araport11) |
| AT2G46210 | Fatty acid/sphingolipid desaturase;(source:Araport11) |
| AT3G58490 | Encodes a long-chain base 1-phosphate (LCBP) phosphatase that is expressed in the endoplasmic reticulum. |
| AT4G21540 | Encodes a sphingosine kinase, also has enzyme activity towards other plant long-chain sphingoid bases. Involved in guard cell ABA signalling and seed germination. |
| AT4G21534 | Diacylglycerol kinase family protein;(source:Araport11) |
| AT2G03680 | The SPR1 gene encodes a plant-specific 12-kD protein which has a repeated motif at both ends, separated by a predicted rod-like domain, suggesting that it may act as an intermolecular linker. Ubiquitously expressed and belongs to a six-member gene family in Arabidopsis; expressed in transgenic seedlings localized to microtubules within the cortical array, preprophase band, phragmoplast, and mitotic spindle. |
| AT1G69230 | SPIRAL1-LIKE2 belongs to a six-member gene family in Arabidopsis; all members share a high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root and organ growth as a result of defective anisotropic cell expansion. |
| AT5G15600 | SPIRAL1-LIKE4 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
| AT5G60230 | putative subunit of tRNA splicing endonuclease |
| AT3G13170 | Encodes AtSPO11-1, one of the three Arabidopsis homologues of the archaeal DNA topoisomerase VIA subunit (topo VIA). Required for meiotic recombination. AtSPO11-1 and AtSPO11-2 have overlapping functions (i.e. both required for meiotic recombination) whereas AtSPO11-3 functions in DNA replication. AtSPO11-1 accumulates in foci in early G2. At 1 h post-S phase, no foci are observed, but by 3 h a majority (80%) of meiocytes at this time point contain >50 foci. However, by 5 h, AtSPO11-1 foci are no longer detectable. This suggests that the protein undergoes a rapid cycle of accumulation and disappearance in meiocytes over a period of between 1 and 5 h post-S phase. |
| AT5G20150 | Expression is upregulated in the shoot of cax1/cax3 mutant. Additionally, its expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. The mRNA is cell-to-cell mobile. |
| AT2G26660 | SPX domain-containing protein 2 (SPX2);(source:Araport11) |
| AT4G34640 | Encodes squalene synthase, which converts two molecules of farnesyl diphosphate (FPP) into squalene via an intermediate: presqualene diphosphate (PSPP). It is generally thought to be one of the key enzymes of sterol biosynthesis, since it catalyzes the first pathway-specific reaction of the sterol branch of the isoprenoid pathway. The mRNA is cell-to-cell mobile. |
| AT4G34650 | Encodes a protein with similarity to squalene synthase which catalyzes the first committed step in sterol biosynthesis. To date no experimental evidence exists that SQS2 functions as a squalene synthase and some experiments indicate it does not have this function. |
| AT1G69170 | Encodes SPL6. Required for the resistance mediated by the TIR-NB-LRR RPS4 against Pseudomonas syringae carrying the avrRps4 effector. Transcriptome analysis indicates that SPL6 positively regulates a subset of defense genes. |
| AT5G43270 | Member of the SPL (squamosa-promoter binding protein-like) gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. In conjunction with SPL10 and SPL11, SPL2 redundantly controls proper development of lateral organs in association with shoot maturation in the reproductive phase. SPL2, SPL10, and SPL11, suppress root regeneration with age by inhibiting wound-induced auxin biosynthesis. |
| AT1G02065 | Encodes an SBP-box gene, a member of the SPL gene family. Mutants are affected in micro- and megasporogenesis, trichome formation on sepals, and stamen filament elongation. |
| AT3G60030 | squamosa promoter-binding protein-like 12;(source:Araport11) |
| AT2G15790 | SQN encodes the Arabidopsis homolog of cyclophilin 40 (CyP40). It is specifically required for the vegetative but not the reproductive maturation of the shoot. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT4G03430 | Encodes a nuclear protein similar to the human U5 small ribonucleoprotein-associated 102-kD protein and to the yeast pre-mRNA splicing factors Prp1p and Prp6p. STA1 expression is upregulated by cold stress, and the sta1-1 mutant is defective in the splicing of the cold-induced COR15A gene. Luciferase imaging was used to isolate a recessive mutant, sta1-1, with enhanced stability of the normally unstable luciferase transcript. This mutation also causes the stabilization of some endogenous gene transcripts and has a range of developmental and stress response phenotypes. |
| AT4G01970 | Encodes a a raffinose and high affinity stachyose synthase as well as a stachyose and Gol specific galactosylhydrolase enzyme activity.AtRS4 is a sequential multifunctional RafS and StaS as well as a high affinity StaS, accepting only Raf and Gol for Sta product formation. AtRS4 possesses a Sta and Gol specific galactosylhydrolase enzyme activity. |
| AT2G36390 | Encodes a starch branching enzyme (EC.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout plant tissues. The mRNA is cell-to-cell mobile. |
| AT5G03650 | Encodes starch branching enzyme (E.C.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout the plant and highest in seedlings and cauline leaves. |
| AT1G10760 | Encodes an α-glucan, water dikinase required for starch degradation. Involved in cold-induced freezing tolerance. Mutations that eliminate the GWD protein or affect the dikinase domain of the enzyme dramatically reduce both the amount of phosphate in the amylopectin and the rate of starch degradation. Mature leaves of these mutants accumulate amounts of starch up to seven times greater than those in wild-type leaves. NMR analysis of the mutants, suggests that the gene is specifically involved in the phosphorylation of the glucosyl residues of starch at the C6 position. |
| AT5G24300 | SSI is a plastidial enzyme and crucial for the synthesis of normal amylopectin in the leaves of Arabidopsis. The absence of SSI results in a deficiency in the number of shorter glucans which in turn affect the formation and connection of the amylopectin clusters in starch. |
| AT1G11720 | Encodes a starch synthase that in addition to its role in starch biosynthesis also has a negative regulatory function in the biosynthesis of transient starch. The protein apparently contains a starch-binding domain (SBD). |
| AT4G18240 | Encodes a starch synthase. In Arabidopsis leaves, the catalytic C-terminal region of STARCH SYNTHASE 4 promotes starch granule initiation while its non-catalytic N-terminal region determines starch granules morphology. |
| AT5G01920 | Chloroplast thylakoid protein kinase STN8 is specific in phosphorylation of N-terminal threonine residues in D1, D2 and CP43 proteins, and Thr-4 in PsbH protein of photosystem II. Phosphorylation of Thr-4 in the wild type required both light and prior phosphorylation at Thr-2. |
| AT5G19690 | encodes an oligosaccharyl transferase involved response to high salt. Mutants are hypersensitive to high salt conditions The mRNA is cell-to-cell mobile. |
| AT3G02850 | Encodes SKOR, a member of Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mediates the delivery of K+ from stelar cells to the xylem in the roots towards the shoot. mRNA accumulation is modulated by abscisic acid. K+ gating activity is modulated by external and internal K+. Involved in response to low potassium. |
| AT2G41770 | Regulates the assembly and trafficking of cellulose synthase complexes. |
| AT3G57420 | Regulates the assembly and trafficking of cellulose synthase complexes. |
| AT5G35770 | A recessive mutation in the Arabidopsis STERILE APETALA (SAP) causes severe aberrations in inflorescence and flower and ovule development. |
| AT5G56040 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT1G07420 | Arabidopsis thaliana sterol 4-alpha-methyl-oxidase mRNA. The sterol 4alpha-methyl oxidase2 family proteins SMO2-1 and SMO2-2 function partially through effects on auxin accumulation, auxin response and PIN1 expression to regulate embryogenesis in Arabidopsis. |
| AT2G29390 | Encodes a sterol 4-alpha-methyl-oxidase, specifically a 4-alpha-methyl-delta-7-sterol-4alpha-methyl-oxidase. |
| AT4G22756 | Encodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha-methyl oxidase. Works together with SMO1-1 to maintain correct sterol composition and balance auxin and cytokinin activities during embryogenesis. |
| AT3G07020 | encodes a 3beta-hydroxy sterol UDP-glucosyltransferase. ugt80a2 mutant plants have reduced steryl glycoside and acyl steryl glycoside levels and reduced seed size. ugt80a2/b1 double mutants have normal levels of celluose and normal cold stress tolerance. |
| AT5G13710 | SMT1 controls the level of cholesterol in plants |
| AT1G20330 | Encodes a sterol-C24-methyltransferases involved in sterol biosynthesis. Mutants display altered sterol composition, serrated petals and sepals and altered cotyledon vascular patterning as well as ectopic endoreduplication. This suggests that suppression of endoreduplication is important for petal morphogenesis and that normal sterol composition is required for this suppression. |
| AT1G76090 | Encodes S-adenosyl-methionine-sterol-C-methyltransferase, an enzyme in the sterol biosynthetic pathway. |
| AT4G12110 | Encodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha-methyl oxidase. Works together with SMO1-2 to maintain correct sterol composition and balance auxin and cytokinin activities during embryogenesis. |
| AT4G30620 | Homolog of STIC2, recent duplication. |
| AT4G18530 | lysine ketoglutarate reductase trans-splicing-like protein, putative (DUF707);(source:Araport11) |
| AT1G79200 | Encodes a nuclear localized protein involved in auxin-dependent control of cell proliferation in pistil development. Loss of function mutations have increased cell proliferation in the stigma. |
| AT2G26770 | Encodes a plant-specific actin binding protein SCAB1 (STOMATAL CLOSURE-RELATED ACTIN BINDING PROTEIN1). SCAB1 stabilizes actin filaments and regulates stomatal movement. |
| AT3G56480 | myosin heavy chain-like protein;(source:Araport11) |
| AT1G49040 | Encodes soluble protein containing N-terminal DENN domain and eight C-terminal WD-40 repeats. Involved in cytokinesis of guard mother cells and leaf epidermal cells. The overall growth and development of mutant plants is severely affected, they are smaller than wt, with defects in seedling development, leaf expansion and flower morphology which renders the mutant conditionally sterile. |
| AT3G12630 | Encodes a protein with E3 ligase activity that acts as a positive regulator of stress responses in Arabidopsis. |
| AT4G22820 | A member of the A20/AN1 zinc finger protein family involved in stress response.Expression is increased in response to water, salt , pathogen and other stressors.SAP9 can pull down both K48-linked and K63- linked tetraubiquitin chains and functions as a E3 ubiquitin ligase suggesting a role in proteasome-dependent protein degradation. |
| AT2G17975 | SRP1 is a C2C2 type zinc finger protein that binds RNA. It has a role in response to ABA.. It can bind the 3'UTR of ABI2 and appears to be involved in RNA turnover. |
| AT4G34190 | Encodes a stress enhanced protein that localizes to the thylakoid membrane and whose mRNA is upregulated in response to high light intensity. It may be involved in chlorophyll binding. |
| AT2G21970 | stress enhanced protein 2 (SEP2) chlorophyll a/b-binding protein |
| AT1G51805 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G25380 | stress-associated protein 10;(source:Araport11) |
| AT1G74020 | Encodes AtSS-2 strictosidine synthase. |
| AT2G41290 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
| AT2G25110 | Encodes an endoplasmic reticulum protein SDF2 (stromal-derived factor-2). Forms a complex SDF2-ERdj3B-BiP that is required for the proper accumulation of the surface-exposed leucine-rich repeat receptor kinases EFR. EFR is involved in PAMP (pathogen associated molecular patterns) triggered immunity. |
| AT5G06820 | STRUBBELIG-receptor family 2;(source:Araport11) |
| AT4G03390 | STRUBBELIG-receptor family 3;(source:Araport11) |
| AT3G14350 | STRUBBELIG-receptor family 7;(source:Araport11) |
| AT4G22130 | STRUBBELIG-receptor family 8;(source:Araport11) |
| AT5G07660 | Encodes SMC6A (STRUCTURAL MAINTENANCE OF CHROMOSOMES 6A), a component of the SMC5/6 complex. SMC5/6 complex promotes sister chromatid alignment and homologous recombination after DNA damage. |
| AT5G04940 | Encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. SUVH1 has been shown to have a preference for binding methylated DNA. |
| AT1G73100 | Encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. |
| AT4G13460 | Encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. A plant line expressing an RNAi construct directed against this gene has reduced agrobacterium-mediated tumor formation. |
| AT2G05920 | Subtilase family protein;(source:Araport11) |
| AT5G67090 | Encodes a subtilisin-like serine protease with in vitro protease activity. |
| AT4G34980 | Serine protease similar to subtilisin. |
| AT5G66760 | One of two genes in Arabidopsis that encode a flavoprotein subunit of the mitochondrial succinate dehydrogenase complex. The mRNA is cell-to-cell mobile. |
| AT2G18450 | Nuclear encoded mitochondrial flavoprotein subunit of succinate dehydrogenase complex . |
| AT3G27380 | One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Expressed during germination and post-germinative growth. |
| AT5G40650 | One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Expressed during germination and post-germinative growth. |
| AT5G65165 | One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Transcripts appear during seed maturation, persist through desiccation, are abundant in dry seeds, and markedly decline during germination. |
| AT5G51040 | Encodes succinate dehydrogenase assembly factor 2 (SDHAF2), a low abundance mitochondrial protein needed for assembly and activity of mitochondrial complex II and for normal root elongation.Sdhaf2 knockdown line showed lowered SDH1 protein abundance, lowered maximal SDH activity and less protein-bound FAD at the molecular mass of SDH1. |
| AT5G67490 | SDHAF4 acts on FAD-SDH1 and promotes its assembly with SDH2, thereby stabilizing SDH2 and enabling its full assembly with SDH3/SDH4 to form the SDH complex. |
| AT2G46505 | Encodes succinate dehydrogenase ,a component of mitochondrial respiratory complex II. Nuclear encoded gene which is imported into the mitochondrion. |
| AT5G66880 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. The mRNA is cell-to-cell mobile. |
| AT5G20280 | Encodes a sucrose-phosphate synthase activity. This is the major leaf isoform. |
| AT5G11110 | Encodes a sucrose-phosphate synthase involved in pollen exine formation. This is the dominant SPS isoform in leaves with respect to protein levels. |
| AT1G04920 | Encodes a sucrose-phosphate synthase whose activity is stimulated by Glc-6-P and inhibited by Pi. |
| AT4G02280 | Encodes a protein with sucrose synthase activity (SUS3). It appears to be important for sucrose metabolism in developing seeds, especially during the late maturation phase, about 18 days after flowering. |
| AT1G09960 | low affinity (10mM) sucrose transporter in sieve elements (phloem) |
| AT3G52340 | sucrose-phosphatase (SPP2) |
| AT1G71880 | Sucrose transporter gene induced in response to nematodes; member of Sucrose-proton symporter family. The mRNA is cell-to-cell mobile. |
| AT1G22710 | Encodes for a high-affinity transporter essential for phloem loading and long-distance transport. A major sucrose transporter, AtSUC2 can also transport a wide range of physiological and synthetic glucose conjugates with both α- or β-linkage. |
| AT1G73660 | Encodes a protein with similarity to MAPKKKs. May function as a negative regulator of salt tolerance. |
| AT1G77210 | AtSTP14 belongs to the family of sugar transport proteins (AtSTPs)in volved in monosaccharide transport. Heterologous expression in yeast revealed that AtSTP14 is the transporter specifc for galactose and does not transport other monosaccharides such as glucose or fructose. |
| AT1G11260 | Encodes a H+/hexose cotransporter. The mRNA is cell-to-cell mobile. |
| AT3G19930 | Encodes a sucrose hydrogen symporter that is induced by wounding. The mRNA is cell-to-cell mobile. |
| AT3G57140 | sugar-dependent 1-like protein;(source:Araport11) |
| AT5G04040 | Encodes a triacylglycerol lipase that is involved in storage lipid breakdown during seed germination. The mutant plant exhibits a much slower rate of postgerminative growth than the wild type. |
| AT1G78000 | Encodes a sulfate transporter that can restore sulfate uptake capacity of a yeast mutant lacking sulfate transporter genes. |
| AT3G51895 | Encodes a chloroplast-localized sulfate transporter. |
| AT5G13550 | Encodes a sulfate transporter. |
| AT3G12520 | Encodes a sulfate transporter that in induced under sulfate limitation. |
| AT1G31170 | encodes a cysteine-sulfinic acid reductase (sulfiredoxin - EC 1.8.98.2) capable of reducing overoxidized plastidic 2-Cys-Prx involved in peroxide detoxification and response to oxidative stress |
| AT3G01910 | Encodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite. |
| AT5G04590 | A.thaliana gene encoding sulfite reductase. |
| AT4G33030 | involved in sulfolipid biosynthesis The mRNA is cell-to-cell mobile. |
| AT5G01220 | Encodes a UDP-sulfoquinovose:DAG sulfoquinovosyltransferase that is involved in sulfolipid biosynthesis and whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. |
| AT5G07010 | Encodes a sulfotransferase that acts specifically on 11- and 12-hydroxyjasmonic acid. Transcript levels for this enzyme are increased by treatments with jasmonic acid (JA), 12-hydroxyJA, JA-isoleucine, and 12-oxyphytodienoic acid (a JA precursor). |
| AT5G07000 | Encodes a member of the sulfotransferase family of proteins. Although it has 85% amino acid identity with ST2A (At5g07010), this protein is not able to transfer a sulfate group to 11- or 12-hydroxyjasmonic acid in vitro. It may be able to act on structurally related jasmonates. |
| AT1G13420 | Encodes a sulfotransferase. Unlike the related ST4A protein (At2g14920), in vitro experiments show that this enzyme does not act brassinosteroids. ST4B is expressed in the roots and transcript levels rise in response to cytokinin treatment. |
| AT1G13430 | Encodes a sulfotransferase. Unlike the related ST4A protein (At2g14920), in vitro experiements show that this enzyme does not act brassinosteroids. ST4C is expressed in the roots and transcript levels rise in response to cytokinin treatment. |
| AT1G04770 | SDI2 is a member of a small family of TPR proteins in Arabidopsis. Like SDI1 it is induced by low sulfer and appears to play a role in negative regulation of glucosinolate biosynthesis. |
| AT1G67810 | Encodes a protein capable of stimulating the cysteine desulfurase activity of CpNifS (AT1G08490) in vitro. SufE2:GFP localizes to the chloroplasts where it is likely to play a role in iron-sulfur cluster assembly. Transcript levels for this gene are high in the pollen relative to other organs based on RT-PCR analysis. The mRNA is cell-to-cell mobile. |
| AT5G66170 | Encodes a thiosulfate sulfurtransferase/rhodanese. |
| AT5G66040 | Encodes a protein with thiosulfate sulfurtransferase/rhodanese activity in vitro, however, it is likely to use a substrate other than thiosulfate or 3-mercaptopyruvate in vivo. The mRNA is cell-to-cell mobile. |
| AT1G77990 | Encodes a low-affinity sulfate transporter. |
| AT3G55880 | A gain-of-function mutant of SUE4 exhibited improved low sulphur tolerance. |
| AT2G03760 | Encodes a brassinosteroid sulfotransferase. In vitro experiements show that this enzyme has a preference for 24-epibrassinosteroids, particularly 24-epicathasterone, but does not act on castasterone and brassinolide. It also shows sulfating activity toward flavonoids. It is differentially expressed during development, being more abundant in young seedlings and actively growing cell cultures. Expression is induced in response to salicylic acid and methyl jasmonate and bacterial pathogens. |
| AT3G57870 | Encodes a SUMO ligase that directs the attachment of the small protein SUMO to target proteins via an isopeptide bond. This enzyme is localized to the nucleus and plants with reduced levels of this protein show higher sensitivity to ABA in root growth inhibition assays. It has high similarity to the yeast UBC9 SUMO ligase and is sometimes referred to by that name. |
| AT4G33620 | Encodes a SUMO protease that, along with ASP1,is required for fertility as asp1/spf2 double mutants have defects in gametogenesis and embroygenesis. |
| AT1G22882 | Encodes a member of the mid-SUN subfamily of SUN-domain proteins that is localized to both the nuclear envelope and the ER. It is involved in early seed development and nuclear morphology. Secreted peptide which functions in plant growth and pathogen defense. |
| AT1G71360 | Encodes a member of the mid-SUN subfamily of SUN-domain proteins that is localized to both the nuclear envelope and the ER. It is involved in early seed development and nuclear morphology. |
| AT3G07880 | RhoGTPase GDP dissociation inhibitor (RhoGDI) that spatially restricts the sites of growth to a single point on the trichoblast. It regulates the NADPH oxidase RHD2/AtrbohC, which is required for hair growth. |
| AT5G64340 | Encodes a bHLH(basic helix-loop-helix)-type transcription factor SAC51 [suppressor of acaulis 51]. Upregulation of SAC51 reverses the dwarf phenotype caused by a loss-of-function mutation in ACL5 (Arabidopsis thaliana ACAULIS 5) gene, suggesting that activation of SAC51 may lead to the expression of a subset of genes required for stem elongation. |
| AT3G43220 | Phosphoinositide phosphatase family protein;(source:Araport11) |
| AT5G20840 | Phosphoinositide phosphatase family protein;(source:Araport11) |
| AT1G17340 | Phosphoinositide phosphatase family protein;(source:Araport11) |
| AT3G59770 | Encodes a phosphoinositide phosphatase. The sac9 null mutant accumulates elevated levels of PtdIns(4,5)P2 and Ins(1,4,5)P3. The mutant plants have characteristics of constitutive stress responses. |
| AT2G31880 | Encodes a putative leucine rich repeat transmembrane protein that is expressed in response to Pseudomonas syringae. Expression of SRRLK may be required for silencing via lsiRNAs. Regulates cell death and innate immunity. |
| AT1G02100 | Leucine carboxyl methyltransferase;(source:Araport11) |
| AT1G79820 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G25580 | Encodes suppressor of gamma response 1 (SOG1), a putative transcription factor governing multiple responses to DNA damage. |
| AT5G23570 | Required for posttranscriptional gene silencing and natural virus resistance.SGS3 is a member of an 'unknown' protein family. Members of this family have predicted coiled coiled domains suggesting oligomerization and a potential zinc finger domain. Involved in the production of trans-acting siRNAs, through direct or indirect stabilization of cleavage fragments of the primary ta-siRNA transcript. Acts before RDR6 in this pathway. The mRNA is cell-to-cell mobile. |
| AT3G60400 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT1G71696 | Encodes a Putative Zn2+ carboxypeptidase, 4 splice variants have been identified but not characterized for different functions and/or expression patterns.SOL1 isolated as a suppressor of root- specific overexpression of CLE19, a clavata3 like gene. sol1 partially suppresses the short root phenotype caused by CLE19 overexpression. |
| AT5G57710 | SMAX1 (SUPPRESSOR OF MAX2 1) is a member of an eight-gene family in Arabidopsis that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. SMAX1 is an important component of KAR/SL signaling during seed germination and seedling growth, but is not necessary for all MAX2-dependent responses. The mRNA is cell-to-cell mobile. |
| AT3G06670 | SMEK1 forms a catalytically active complex with PP4 proteins. The complex has been shown to target and dephosphorylate HYL1 which in turn promotes miRNA biogenesis. Mutants have pleiotrophic phenotypes and decreased production of miRNA. SMEK1 accumulation is responsive to ABA. |
| AT1G21580 | Encodes a zinc-finger protein that co-localizes with the exosome-associated RNA helicase HEN2 and functions as a co-factor of nuclear RNA quality control by the nucleoplasmic exosome. |
| AT2G46340 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA1 is a PHYA signaling intermediate, putative regulator of PHYA signaling pathway. Light responsive repressor of photomorphogenesis. Involved in regulating circadian rhythms and flowering time in plants. Under constant light, the abundance of SPA1 protein exhibited circadian regulation, whereas under constant darkness, SPA1 protein levels remained unchanged. In addition, the spa1-3 mutation slightly shortened circadian period of CCA1, TOC1/PRR1 and SPA1 transcript accumulation under constant light. |
| AT5G08150 | Encodes SOB5. Activation tagging lines accumulated higher level of cytokinin. |
| AT1G56500 | Encodes a thylakoid membrane protein with thioredoxin-like and beta-propeller domains located in the lumen and a haloacid-dehalogenase domain exposed to the chloroplast stroma. The protein's role may be to prevent formation of a slowly reversible form of antenna quenching, thereby maintaining the efficiency of light harvesting. The mRNA is cell-to-cell mobile. |
| AT4G37460 | Encodes a tetratricopeptide repeat domain containing protein that shows sequence similarity to those of transcriptional repressors in other organisms. Involved in mediating effector-triggered immunity. |
| AT2G43710 | Encodes a stearoyl-ACP desaturase, involved in fatty acid desaturation. The ssi2 mutants have increased 18:0 and reduced 18:1 fatty acids. Exogenous application of glycerol to wild type plants mimics the ssi2 mutant phenotype. The altered 18:1 fatty acid content in the ssi2 mutants has an impact on SA- and JA-mediated defense signaling. ssi2 mutants resulted in hyper-resistance to green peach aphid and antibiosis activity in petiole exudates. Redundant Δ9 stearoyl-ACP desaturase gene which together with AAD1 and AAD5 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with AAD1, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase. |
| AT5G11310 | The SOAR1 gene encodes a pentatricopeptide repeat (PPR) protein which localizes to both the cytosol and nucleus. Down-regulation of SOAR1 strongly enhances, but up-regulation of SOAR1 almost completely impairs, ABA responses, revealing that SOAR1 is a critical, negative, regulator of ABA signalling. Further genetic evidence supports that SOAR1 functions downstream of ABAR and probably upstream of an ABA-responsive transcription factor ABI5. Changes in the SOAR1 expression alter expression of a subset of ABA-responsive genes including ABI5. These findings provide important information to elucidate further the functional mechanism of PPR proteins and the complicated ABA signalling network. |
| AT2G24020 | STIC2 was identifided in a screen for suppressors of chloroplast protein import defect in tic40. |
| AT2G45070 | Sec61 Beta Subunit |
| AT1G62970 | SDJ3 functions partially redundantly with SDJ1 and SDJ2 and interacts with SUVH1 and SUVH3 to form a SUVH-SDJ complex. The complex binds promoters with DNA methylation and mediates transcriptional activation of promoter methylated genes. |
| AT1G03750 | switch 2;(source:Araport11) |
| AT5G51330 | Encodes novel protein involved in sister chromatid cohesion and meiotic chromosome organization during both male and female meiosis. Gene has two alternate transcripts which produce two similar proteins, one 57 aa shorter than the other. |
| AT5G05490 | Encodes a RAD21-like gene essential for meiosis. Encodes a 627 a.a. protein that is slightly longer in the N-terminus than SYN1 BP5. |
| AT2G33120 | Encodes a member of Synaptobrevin-like protein family. Also known as VESICLE-ASSOCIATED MEMBRANE PROTEIN 722 (VAMP722). Required for cell plate formation. Post-transcriptionally regulated by CRT1/2 under ER stress. |
| AT2G20990 | Encodes a protein specifically localized to the ER-PM boundary with similarity to synaptotagmins, a class of membrane trafficking proteins. SYT1 is expressed in all tissues. Loss of function mutations show hypersensitivity to NaCl and electrolyte leakage from the plasma membrane. SYT1 also affects calcium dependent freezing tolerance and mechanical stress response. Regulates endocytosis endosome recycling at the plasma membrane, but not membrane traffic along the secretory pathway. SYT1 may have a role in membrane repair such as membrane resealing after freezing induced damage. SYT1 binds to phosphatidylinositol phosphates in vitro. It is distributed to immobile tubules and likely plays an important role in the formation of the tubular ER network as well as in cellular ER-PM tethering. |
| AT1G08560 | member of SYP11 syntaxin Gene Family |
| AT5G16830 | member of SYP2 Gene Family. Over-expression of the gene in tobacco protoplasts leads to a disruption of vacuolar transport from the prevacuolar compartment (PVC) to the vacuole, but not from the Golgi apparatus to the plasma membrane. |
| AT4G17730 | member of SYP2 Gene Family. Together with SYP23 interacts with Tobacco mosaic virus 126 kDa protein; required for normal local virus accumulation and spread. |
| AT2G18260 | member of SYP11 Gene Family |
| AT3G11820 | Encodes a syntaxin localized at the plasma membrane. SYR1/PEN1 is a member of the SNARE superfamily and functions in positioning anchoring of the KAT1 K+ channel protein at the plasma membrane. Transcription is upregulated by abscisic acid, suggesting a role in ABA signaling. Also functions in non-host resistance against barley powdery mildew. It is a nonessential component of the preinvasive resistance against Colletotrichum fungus. Required for mlo resistance. The syp121 point mutation results in stomatal phenotypes that reduce CO2 assimilation, slow vegetative growth and increase water use efficiency in the whole plant, conditional upon high light intensities and low relative humidity. The R20R21 motif of SYP121 are essential for SEC11 interaction. Mutation of the R20R21 motif blocks vesicle traffic without uncoupling the effects of SYP121 on solute and K+ uptake associated with the F9xRF motif; the mutation also mimicks the effects on traffic block observed on coexpression of the dominant negative SEC11?149 fragment. |
| AT1G11250 | member of SYP12 Gene Family |
| AT3G03800 | member of SYP13 Gene Family |
| AT5G08080 | member of SYP13 Gene Family |
| AT5G26980 | member of SYP4 Gene Family |
| AT3G05710 | Encodes a member of SYP4 Gene Family that is a plant ortholog of the Tlg2/syntaxin16 Qa-SNARE. Together with SYP42, it regulates the secretory and vacuolar transport pathways in the post-Golgi network and maintains the morphology of the Golgi apparatus and TGN and is required for extracellular resistance responses to a fungal pathogen. |
| AT1G79590 | Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. |
| AT3G61450 | syntaxin of plants 73 (SYP73) |
| AT5G44260 | Encodes a Tandem CCCH Zinc Finger protein. Interacts and co-localizes with MARD1 and RD21A in processing bodies (PBs) and stress granules (SGs). |
| AT5G43630 | Encodes a zinc knuckle protein that negatively regulates morning specific growth. The role of TZP in hypocotyl elongation was established through a QTL analysis of BayXSha RIL populations. The Bay-0 allele contains a deletion causing a frameshift mutation. TZP is under circadian control and acts to regulate morning-specific hypocotyl growth. The mRNA is cell-to-cell mobile. |
| AT4G34270 | TOR signaling pathway protein. |
| AT4G24972 | Encodes a novel small protein which is similar to proteins of unknown function from other plant species. TPD1 is involved in cell specification during anther and pollen development. Identified in a screen for male steriles. Mutants lack tapetal cells and have an increased number of microsporocytes. Expressed in flower buds, leaves and young seedlings. In anthers, TPD1 is expressed throughout pollen development in parietal cells and sporocytes. Physically interacts with the LRR kinase EMS1 and that interaction results in phosphorylation of TPD1. |
| AT5G60120 | AP2 family transcription factor that is involved in regulation of flowering and innate immunity.Interacts with CRY1 and CRY2 during flowering as part of a regulatory circuit including FT and CO. TOE1/TOE2 are also targets of MiR172b repression and functions in regulation of innate immunity via repression of FLS. |
| AT5G60200 | Encodes a Dof-type transcription factor. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT1G50030 | Related to TOR proteins from yeast and mammals, regulators of cell growth in response to nutrient availability. TOR proteins belong to the family of phosphatidylinositol 3-kinase and are targets of the antiproliferative drug rapamycin. AtTOR binds the yeast FKBP12 protein in the presence of Rapamycin, is involved in embryogenesis and is expressed in embryos, endosperm and meristems. Participates in negatively modulating ethylene signals and the molecular mechanism is likely involved in the regulation of ethylene biosynthesis by affecting ACSs in transcription and protein levels |
| AT3G13445 | TBP (TATA binding protein) associates with TAF(II)s (TBP-associated factors) to form the TFIID general transcription factor complex |
| AT1G55520 | TATA-box binding protein. Required for basal transcription. Acts facilitating the recruitment of TFIID to the promoter, which together with the RNA polymerase form the preinitiation complex. |
| AT2G31090 | Encodes a signalling peptide influencing lateral organ separation. |
| AT2G20562 | Encodes a putative signalling peptide with similarity to TAX1. No known function has been demonstrated yet. |
| AT2G18000 | TBP-associated factor 14;(source:Araport11) |
| AT1G50300 | TBP-associated factor 15;(source:Araport11) |
| AT2G31070 | TCP family protein involved in heterchronic regulation of leaf differentiation. |
| AT5G51910 | TCP family transcription factor;(source:Araport11) |
| AT5G08330 | Circadian oscillator protein which interacts with bZIP63 and regulates a response of the circadian oscillator to sugar. Is not required for the sugar-induced circadian phase advance in the morning; regulates a response of CCA1 to sugars. |
| AT1G35560 | Encodes a member of the TCP-P subfamily that is involved in flowering time control and plant development. Mutants present an early flowering phenotype. |
| AT5G23280 | Transcription factor which plays an important role during leaf and hypocotyl development, redundantly, with at least six class I TCPs, and regulates the expression of CYCD1;1 to affect endoreplication. |
| AT1G58100 | Encodes TCP8, belongs to the TCP transcription factor family known to bind site II elements in promoter regions. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
| AT2G45680 | TCP family transcription factor;(source:Araport11) |
| AT3G15030 | Arabidopsis thaliana TCP family transcription factor. Regulated by miR319. Involved in heterchronic regulation of leaf differentiation. |
| AT2G20080 | hypothetical protein;(source:Araport11) |
| AT5G24590 | Member of NAc protein family. Interacts with turnip crinkle virus (TCV) capsid protein. Transcription factor involved in regulating the defense response of Arabidopsis to TCV. |
| AT2G41800 | Encodes a DUF642 cell wall protein that is highly induced during the M/G1 phases of the cell cycle and is involved in hypocotyl cell elongation. |
| AT5G13820 | Encodes a protein that specifically binds plant telomeric DNA repeats. It has a single Myb telomeric DNA-binding (SANT) domain in C-terminus that prefers the sequence TTTAGGG. Single Myb Histone (SMH) gene family member. |
| AT5G59430 | Encodes a telomeric repeat binding protein with a DNA binding domain at its C terminus. The DNA binding domain has a preference for GGTTTAG sequences and at least five of these repeats are required for recognition by a nearly full-length TRP1 protein. |
| AT5G58070 | Encodes a temperature-induced lipocalin TIL1. Involved in thermotolerance. Peripherally associated with plasma membrane. |
| AT4G18390 | TEOSINTE BRANCHED 1, cycloidea and PCF transcription factor 2;(source:Araport11) |
| AT3G27010 | Belongs to a TCP protein transcription factor family. Members of this family contain a predicted basic-helix-loop-helix domain involved in DNA binding. Related to rice PCF1 and PCF2 genes. Binds to the GCCCR element of CYCB1;1. Involved in regulation of expression of cell cycle control and ribosomal protein genes. |
| AT3G47620 | Encodes a transcription factor AtTCP14 that regulates seed germination. AtTCP14 shows elevated expression level just prior to germination. AtTCP14 is predominantly expressed in the vascular tissue of the embryo, and affects gene expression in radicles in a non-cell-autonomous manner. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
| AT1G69690 | AtTCP15 is involved in the regulation of endoreduplication. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
| AT3G26120 | Similar to terminal ear1 in Zea mays. A member of mei2-like gene family; phylogenetic analysis revealed that TEL1 belongs to the third clade of mei2-like proteins (TEL clade), with conserved two N-terminal RNA recognition motifs (RRM), in addition to the C-terminal RRM, shared among all mei2-like proteins. |
| AT5G48110 | The Col variant has no enzyme activity due to various substitution and deletion mutations. |
| AT4G14770 | Regulates fate transition and cell Divisions in the stomatal lineage. |
| AT2G01960 | Member of TETRASPANIN family |
| AT5G57810 | Member of TETRASPANIN family |
| AT2G19580 | Member of TETRASPANIN family |
| AT3G45600 | Member of TETRASPANIN family |
| AT5G60220 | Member of TETRASPANIN family |
| AT4G28050 | Member of TETRASPANIN family |
| AT2G23810 | Member of TETRASPANIN family |
| AT3G43210 | Encodes a kinesin TETRASPORE. Required for cytokinesis in pollen. In mutants, all four microspore nuclei remain within the same cytoplasm after meiosis. |
| AT1G04530 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT1G58450 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G21990 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808). Functions as a chaperone receptor at the chloroplast outer envelope, mediating Hsp70-dependent protein targeting to chloroplasts. It has been localized to the ER membrane, interacts with the Sec translocon, and has a potential function in post-translational protein transport into the ER. The mRNA is cell-to-cell mobile. |
| AT1G22070 | Encodes a transcription factor. Like other TGAla-related factors, TGA3 has a highly conserved bZIP region and exhibits similar DNA-binding properties. |
| AT5G06839 | bZIP transcription factor family protein;(source:Araport11) |
| AT1G08320 | bZIP transcription factor family protein;(source:Araport11) |
| AT5G10030 | Encodes a member of basic leucine zipper transcription gene family. Nomenclature according to Xiang, et al. (1997). |
| AT5G65210 | Encodes TGA1, a redox-controlled regulator of systemic acquired resistance. TGA1 targets the activation sequence-1 (as-1) element of the promoter region of defense proteins. TGA1 are S-nitrosylated. |
| AT1G77920 | bZIP transcription factor family protein;(source:Araport11) |
| AT2G46280 | Encodes a homolog of mammalian TGF-beta receptor interacting protein. Co-immunoprecipitates with BRI1 and can be phosphorylated in vitro by BRI1 at specific sites (Thr-14, Thr-89, and either Thr-197 or Ser-198). May therefore be a cytoplasmic BRI1 substrate and involved in brassinosteroid regulated plant growth and development.The encoded protein has two DWD motifs. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT3G59280 | Encodes the ortholog of yeast PAM16, part of the mitochondrial inner membrane protein import motor. Single mutant plants exhibit a smaller size and enhanced resistance against virulent pathogens. They also display elevated reactive oxygen species (ROS) accumulation. |
| AT5G54380 | Encodes THESEUS1 (THE1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
| AT1G02880 | Encodes a thiamine pyrophosphokinase capable of producing thiamine pyrophosphate from free thiamine. |
| AT2G29630 | Encodes a protein involved in thiamin biosynthesis. The protein is an iron-sulfur cluster protein predicted to catalyze the conversion of 5-aminoimidazole ribonucleotide (AIR) to hydroxymethylpyrimidine (HMP) or hydroxymethylpyrimidine phosphate (HMP-P). A severe reduction of THIC levels in plants decreases vitamin B1 (thiamin diphosphate (TPP)) levels and also leads to changes in the levels of numerous other metabolites since so many primary metabolic enzymes require a TPP co-factor. thiC mutants are chlorotic and arrest in their development at the cotyledon stage. A N-terminal targeting sequence directs the THIC protein to the chloroplast stroma. A conserved TPP-binding site is located in the 3' UTR of the At2g29630.2 gene model, and is predicted to function as a riboswitch. The riboswitch controls the formation of transcripts with alternative 3' UTR lengths, which affect mRNA accumulation and protein production. THIC transcripts are observed in seedlings 5 or more days after germination, and light promotes the expression of this gene. Recessive mutant isolated by Redei. Leaves but not cotyledons white, lethal; restored to normal by thiamine or 2,5-dimethyl-4-aminopyrimidine. |
| AT5G10540 | Zincin-like metalloproteases family protein;(source:Araport11) |
| AT5G42980 | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. The mRNA is cell-to-cell mobile. |
| AT5G16400 | Encodes an f-type thioredoxin (Trx-f2) localized in chloroplast stroma. |
| AT1G45145 | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. |
| AT1G69880 | thioredoxin H-type 8;(source:Araport11) |
| AT3G15360 | encodes a prokaryotic thioredoxin The mRNA is cell-to-cell mobile. |
| AT2G35010 | Localized in mitochondria; associated with redox-active functions and effects on plant growth in constant light; joint role with Trx h2 in regulating NADPH redox balance and photosynthetic performance in fluctuating light. |
| AT1G50320 | encodes a prokaryotic thioredoxin |
| AT1G65980 | thioredoxin-dependent peroxidase |
| AT1G08630 | Encodes a threonine aldolase, involved in threonine degradation to glycine. Primarily expressed in seeds and seedlings. |
| AT1G54780 | Encodes a thylakoid lumen protein regulating photosystem II repair cycle. Has acid phosphatase activity. The mRNA is cell-to-cell mobile. |
| AT5G53490 | thylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein. |
| AT2G30440 | Encodes a thylakoidal processing peptidase that removes signal sequences from proteins synthesized in the cytoplasm and transported into the thylakoid lumen. The mRNA is cell-to-cell mobile. |
| AT4G01050 | hydroxyproline-rich glycoprotein family protein, contains a rhodanese homology domain. Required for anchoring the FNR flavoenzyme to the thylakoid membranes and sustaining high efficiency photosynthetic linear electron flow. The mRNA is cell-to-cell mobile. |
| AT1G77490 | Encodes a chloroplastic thylakoid ascorbate peroxidase tAPX. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
| AT5G23070 | Encodes a thymidine kinase that salvages DNA precursors. The pyrimidine salvage pathway is crucial for chloroplast development and genome replication, as well as for the maintenance of its integrity. |
| AT3G63180 | TIC-like protein;(source:Araport11) |
| AT2G46640 | Encodes TAC1 (Tiller Angle Control 1). Influences axillary branch growth angle. Inflorescence stems of TAC1 mutants are vertically oriented and have axillary shoots with narrow branch angles. |
| AT3G22380 | Encodes a nucleus-acting plant-specific clock regulator working close to the central oscillator and affecting the circadian gating of light responses. Circadian gating is the alteration of circadian phase according to the photoperiod of the entraining day/light cycle and the rhythmic antagonism of light responses in the early subjective night. TIC differentially regulates CCA1 and PRR9 from LHY, with LHY expression as a dominant genetic target of TIC action. Also shown to be invoved in the maintenance of Arabidopsis thaliana metabolic homeostasis. |
| AT5G61380 | Pseudo response regulator involved in the generation of circadian rhythms. TOC1 appears to shorten the period of circumnutation speed. TOC1 contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. PRR3 may increase the stability of TOC1 by preventing interactions between TOC1 and the F-box protein ZTL. Expression of TOC1 is correlated with rhythmic changes in chromatin organization. The mRNA is cell-to-cell mobile. |
| AT5G25810 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family (TINY). The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Ectopic or overexpression of this gene in a Ds tagged line has reduced cell expansion. The expression of this gene is induced by ethylene and light and appears to stimulate cytokinin biosynthesis. |
| AT4G09420 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
| AT5G56220 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G60740 | Encodes tubulin-folding cofactor D. Mutants arrest during embryogenesis with embryos that are small, mushroom-shaped ('pilz') and consist of only one or few large cells each containing one or more variably enlarged nuclei and often cell wall stubs. Gene product necessary for continuous microtubule organization. |
| AT1G19080 | This gene is predicted to encode a PSF3 component of the GINS complex. This complex has been implicated in the initiation of DNA replication in Xenopus. Mutations in this gene cause defects in embryo development. |
| AT3G54670 | Encodes a member of the Arabidopsis cohesin complex that is essential for viability and sister chromatid alignment. |
| AT1G14740 | Encodes a PHD-finger protein that, with TTA1, is redundantly required for MP-dependent embryonic root meristem initiation. |
| AT3G63500 | Encodes a PHD-finger protein that, with TTA2, is redundantly required for MP-dependent embryonic root meristem initiation. |
| AT4G21790 | encodes a host factor that is required for TMV virus multiplication. The mRNA is cell-to-cell mobile. |
| AT1G32400 | TOM2A encodes a 280 amino acid putative four-pass transmembrane protein with a C-terminal farnesylation signal, essential for efficient multiplication of tobacco mosaic viruses. |
| AT2G02180 | Necessary for the efficient multiplication of tobamoviruses. The mRNA is cell-to-cell mobile. |
| AT1G14530 | tobamovirus multiplication-like protein (DUF1084);(source:Araport11) |
| AT1G06210 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT1G21380 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT1G76970 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT5G63640 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT2G38410 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT5G01760 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT3G08790 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT4G32760 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT2G45900 | Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11) |
| AT3G61380 | Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11) |
| AT4G00440 | GPI-anchored adhesin-like protein, putative (DUF3741);(source:Araport11) |
| AT2G39435 | Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11) |
| AT3G53540 | afadin;(source:Araport11) |
| AT5G43880 | methyl-coenzyme M reductase II subunit gamma, putative (DUF3741);(source:Araport11) |
| AT1G67040 | DnaA initiator-associating protein;(source:Araport11) |
| AT5G62170 | LOW protein: M-phase inducer phosphatase-like protein;(source:Araport11) |
| AT2G17550 | RB1-inducible coiled-coil protein;(source:Araport11) |
| AT2G36420 | nucleolin-like protein;(source:Araport11) |
| AT5G03670 | histone-lysine N-methyltransferase SETD1B-like protein;(source:Araport11) |
| AT1G18620 | Member of a small gene family in Arabidopsis. Quadruple mutants in this family display defects in cell elongation. |
| AT3G24630 | hypothetical protein;(source:Araport11) |
| AT3G63430 | zinc finger CCCH domain protein;(source:Araport11) |
| AT3G05750 | Encodes a member of the TRM superfamily, that plays a role in preprophase band formation during plant cell division and controls the robustness of the orientation of that cell division. |
| AT5G26910 | Encodes a member of the TRM superfamily, that plays a role in preprophase band formation during plant cell division and controls the robustness of the orientation of that cell division. |
| AT5G47560 | Encodes a tonoplast malate/fumarate transporter. |
| AT4G17340 | tonoplast intrinsic protein 2;(source:Araport11) |
| AT5G47450 | Tonoplast intrinsic protein, transports ammonium (NH3) and methylammonium across the tonoplast membrane, gene expression shows diurnal regulation and is upregulated by ammonium (NH3). |
| AT1G20840 | The protein encoded by this gene is found in the tonoplast (vacuole membrane) of Arabidopsis cells. The gene is expressed at highest levels in juvenile (sink) and adult (source) leaves, followed by flower tissues. |
| AT4G35300 | tonoplast monosaccharide transporter2;(source:Araport11) |
| AT1G80080 | Encodes a transmembrane leucine-repeat containing receptor-like protein that is expressed in proliferative postprotodermal cells. Recessive mutation leads to disruption of asymmetric cell division during stomata development. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT1G15750 | Encodes a protein with several WD40 repeats at the C-terminus and predicted protein-protein interaction domains at the N-terminus. Together with the TOPLESS-RELATED PROTEINS (TPRs), it is thought to be involved in transcriptional repression of root-promoting genes in the top half of the embryo during the transition stage of embryogenesis. It can also interact with IAA12 through the EAR domain of IAA12 and the CTLH domain of TPL. The ability of IAA12 to repress transcription is diminished in a tpl-1 mutant background. |
| AT1G80490 | Encodes a protein with a Lissen-cephaly type-1-like homology (LisH) domain at the N terminus,a C-terminal to LisH (CTLH) domain, and 12 WD (tryptophan-aspartic acid)-40 repeats at the C terminus. It is closely related to Topless (TPL), which mediates auxin-dependent transcriptional repression during embryogenesis. |
| AT3G16830 | TOPLESS family member which directly binds the N-terminal domain of SNC1 and interacts with TPR1. |
| AT5G27030 | TOPLESS family member involved in the negative regulation of SNC1-dependent phenotypes. |
| AT3G20780 | Encodes putative eukaryotic homolog of archaebacterial topoisomerase VI subunit B, TOP6B. Is essential for endoreduplication and is involved in cell expansion and cell proliferation. The hlq (harlequin) dwarf mutant has fewer root hair and leaf trichome. It has abnormal epidermal cell and accumulates callose. |
| AT5G16750 | Encodes a nucleolar localized WD-40 repeat protein that is preferentially expressed in dividing cells and is required for regulated division planes and embryo development. |
| AT5G55540 | Encodes a large plant-specific protein of unknown function, with conserved domains also found in a variety of signaling proteins, In trn mutants, the leaf venation network had a severely reduced complexity: incomplete loops, no tertiary or quaternary veins, and vascular islands. The leaf laminas were asymmetric and narrow because of a severely reduced cell number. TRN1 is required for the maintenance of both the radial pattern of tissue differentiation in the root and for the subsequent circumferential pattern within the epidermis. Double mutant analysis showed that TRN1 and TRN2 act in the same pathway. |
| AT5G46700 | Encodes a transmembrane protein of the tetraspanin (TET) family, one of 17 members found in Arabidopsis. Double mutant analysis showed that TRN1 and TRN2 act in the same pathway. Required for the maintenance of both the radial pattern of tissue differentiation in the root and for the subsequent circumferential pattern within the epidermis. |
| AT2G41100 | encodes a calmodulin-like protein, with six potential calcium binding domains. Calcium binding shown by Ca(2+)-specific shift in electrophoretic mobility. Expression induced by touch and darkness. Expression may also be developmentally controlled. Expression in growing regions of roots, vascular tissue, root/shoot junctions, trichomes, branch points of the shoot, and regions of siliques and flowers. The mRNA is cell-to-cell mobile. |
| AT5G57560 | Encodes a cell wall-modifying enzyme, rapidly upregulated in response to environmental stimuli. |
| AT5G55860 | WEB1/PMI2 related protein involved in mecahnotransduction.TREPH1 is phosphorylated at position S625 in response to touch, and this is required for mechanosensitive growth response. |
| AT3G16720 | RING-H2 protein induced after exposure to chitin or inactivated crude cellulase preparations. The mRNA is cell-to-cell mobile. |
| AT5G58580 | Encodes a functional E3 ligase that is involved in membrane trafficking and regulation of salt stress responses. It is localized to membranes including the plasma membrane, pre-vacuolar compartments and Golgi. |
| AT4G11990 | TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of aurora kinase activity. |
| AT1G73020 | anoctamin-like protein;(source:Araport11) |
| AT3G17185 | Encodes a trans-acting siRNA (tasi-RNA) that regulates the expression of auxin response factor genes (ARF2, ARF4, ETT). One of 3 genomic loci that encode the TAS3 siRNA. Has been identified as a translated small open reading frame by ribosome profiling. |
| AT2G41630 | Encodes a transcription factor, TFIIB1, that plays important roles in pollen tube growth, guidance, and reception as well as endosperm development and is partially functionally different from AtTFIIB2 and AtTFIIB3/AtpBRP2. |
| AT3G10330 | Cyclin-like family protein;(source:Araport11) |
| AT1G72050 | Encodes a transcriptional factor TFIIIA required for transcription of 5S rRNA gene. 5S rRNA is the smallest constituent of the ribosome. Work on one of the gene models AT1G72050.2 showed that it encodes a protein with nine Cys(2)-His(2)-type zinc fingers, a characteristic feature of TFIIIA proteins. AT1G72050.2 also contains a 23 amino acid spacer between fingers 1 and 2, a 66 amino acid spacer between fingers 4 and 5, and a 50 amino acid non-finger C-terminal tail. in vitro assay demonstrated that AT1g72050.2 binds to 5S rDNA and efficiently stimulates the transcription of 5S rRNA. AT1g72050.2 also binds to 5S rRNA in vitro. AT1g72050.2 is located at several nuclear foci including the nucleolus and is absent from the cytoplasm. |
| AT3G23230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT4G35610 | Interacts with EIN3 to regulate transcriptional repression that leads to an inhibition of shoot growth in response to ethylene. |
| AT5G58450 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G24710 | WD40/YVTN repeat protein which cooperates with the AP2 complex in the clathrin-mediated endocytosis of cellulose synthase to regulate cellulose biosynthesis. |
| AT3G60750 | Transketolase;(source:Araport11) |
| AT2G45290 | Transketolase;(source:Araport11) |
| AT1G10840 | Encodes eukaryotic initiation factor 3H1 subunit (TIF3H1). |
| AT1G20350 | mitochondrial inner membrane translocase |
| AT5G11690 | mitochondrial inner membrane translocase |
| AT1G72750 | translocase inner membrane subunit 23-2;(source:Araport11) |
| AT3G27080 | Component of the TOM complex involved in transport of nuclear-encoded mitochondrial proteins |
| AT1G04070 | Subunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion. |
| AT1G64220 | translocase of outer membrane 7 kDa subunit 2;(source:Araport11) |
| AT2G29530 | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. Together with AtTIM9, AtTIM10 is non-redundantly essential for maintaining mitochondrial function of early embryo proper cells and endosperm free-nuclei. |
| AT3G46560 | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. Together with AtTIM10, AtTIM9 is non-redundantly essential for maintaining mitochondrial function of early embryo proper cells and endosperm free-nuclei. |
| AT3G20000 | Encodes a component of the TOM receptor complex responsible for the recognition and translocation of cytosolically synthesized mitochondrial preproteins. With TOM22, functions as the transit peptide receptor at the surface of the mitochondrial outer membrane and facilitates the movement of preproteins into the translocation pore. The mRNA is cell-to-cell mobile. |
| AT3G23710 | Tic22-like family protein;(source:Araport11) |
| AT5G16620 | chloroplast protein import (Tic40) |
| AT5G01590 | histone-lysine N-methyltransferase ATXR3-like protein;(source:Araport11) |
| AT5G09420 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT3G16620 | component of TOC complex, plastid protein import machinery. |
| AT1G66150 | Receptor-like transmembrane kinase I (TMK1); key regulator in auxin signaling. High auxin and TMK1 play essential and positive roles in ABA signaling through regulating ABA INSENSITIVE 1 and 2 (ABI1/2). Inhibits the phosphatase activity of ABI2 by direct phosphorylation of threonine 321 (T321), a conserved phosphorylation site in ABI2 proteins, whose phosphorylation status is important for both auxin and ABA responses. |
| AT2G01820 | Transmembrane kinase (TMK), member of the plant receptor-like kinase (RLK) family. TMKs are characterized by an extracellular leucine-rich-repeat (LRR) domain, a single transmembrane region and a cytoplasmic kinase domain. TMKs have been shown to act as critical modulators of cell expansion and cell proliferation. |
| AT1G10950 | Encodes an Arabidopsis Transmembrane nine (TMN) protein. Transmembrane nine (TM9) proteins are localized in the secretory pathway of eukaryotic cells and are involved in cell adhesion and phagocytosis. Functions in the deposition of rhamnogalacturonan II and I for cell growth. |
| AT3G59030 | Encodes a proton antiporter. Involved in the transportation of proanthocyanidin precursors into the vacuole. In vitro transport experiments showed that cyanidin-3-O-glucoside (anthocyanin) was an effective substrate, whereas the proanthocyanidin precursor epicatechin was not transported. However catechin-3-O-glucoside inhibited anthocyanin transport in a dose-dependent manner suggesting that glycosylated epicatechin is the in vivo substrate. Recessive mutation has strong reduction of proanthocyanidin deposition in vacuoles and has reduced dormancy. Expressed in the endothelium of ovules and developing seeds. |
| AT5G07990 | Required for flavonoid 3' hydroxylase activity. Enzyme abundance relative to CHS determines Quercetin/Kaempferol metabolite ratio. The mRNA is cell-to-cell mobile. |
| AT4G09820 | TT8 is a regulation factor that acts in a concerted action with TT1, PAP1 and TTG1 on the regulation of flavonoid pathways, namely proanthocyanidin and anthocyanin biosynthesis. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Also important for important for marginal trichome development. It binds the promoter of both AT3G26790 and AT1G28300.TT8 interacts with JAZ proteins to regulate anthocyanin accumulation. TT8 acts maternally to affect seed FA biosynthesis and inhibits seed FA accumulation by down-regulating a group of genes either critical to embryonic development or important in the FA biosynthesis pathway. TT8 represses the activities of LEAFY COTYLEDON1, LEAFY COTYLEDON2, and FUSCA3, the critical transcriptional factors important for seed development. |
| AT3G28430 | Encodes a peripheral membrane protein localized at the Golgi apparatus that is involved in membrane trafficking, vacuole development and in flavonoid accumulation in the seed coat. Mutant seed color is pale brown. |
| AT3G62980 | Encodes an auxin receptor that mediates auxin-regulated transcription. It contains leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation. Mutations in TIR1 block auxin stimulation of flavonoid synthesis. |
| AT4G24040 | Encodes a trehalase, member of Glycoside Hydrolase Family 37. |
| AT1G60140 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. |
| AT2G22190 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G12430 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G22590 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G39770 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G65140 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G06410 | Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants. |
| AT1G23870 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. The mRNA is cell-to-cell mobile. |
| AT3G46590 | Encodes a protein that specifically binds plant telomeric DNA (TTTAGGG)n repeats. Involved in bending DNA. Expressed throughout the plant with highest levels in flowers. |
| AT1G07540 | Arabidopsis thaliana telomere-binding protein, putative (At1g07540) |
| AT1G17460 | Arabidopsis thaliana myb family transcription factor (At1g17460) |
| AT3G53790 | Arabidopsis thaliana telomere-binding protein, putative (At3g53790) |
| AT1G15720 | Arabidopsis thaliana myb family transcription factor (At1g15720). MYB/SANT domain containing protein. |
| AT1G72650 | Arabidopsis thaliana myb family transcription factor (At1g72650) |
| AT2G37025 | TRF-like 8;(source:Araport11) |
| AT3G12560 | Encodes a telomeric DNA-binding protein. |
| AT2G19450 | Encodes Acyl-CoA:diacylglycerol acyltransferase (DGAT) catalyzes the final step of the triacylglycerol synthesis pathway. An insertion mutation in the TAG1 gene results in altered lipid phenotype. Role in senescence and seed development. Its preferred substrate is linolenoyl-CoA (C18:3-CoA). |
| AT5G06700 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). A tbr mutant is impaired in its ability to deposit secondary wall cellulose in specific cell types, most notably in trichomes. |
| AT2G40160 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G06080 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G19160 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G64470 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G64020 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT2G37720 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT4G25360 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G15900 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G60790 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G28150 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. A putative xyloglucan O-acetyltransferase. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G01430 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers.Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G70230 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. A putative xyloglucan O-acetyltransferase. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT2G40150 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G11030 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).The chemical evidence for function comes from xylan NMR analysis. Secondary wall thickening phenotype can be observed only in double or triple mutant combinations with esk1. |
| AT5G01620 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).TBL35 are required only for xylan 3-O-monoacetylation and 2,3-di-O-acetylation. The biochemical phenotype can be observed in tbl35 esk1, double mutant and tbl34 tbl35 esk1 triple mutants. |
| AT3G54260 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT2G34070 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TBL37 expression is regulated by MYC2 and activated in response to JA. |
| AT1G29050 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT2G42570 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G14850 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G78710 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT2G30010 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G62390 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G55440 | Encodes triosephosphate isomerase. |
| AT1G73980 | TTM1 is a triphosphate tunnel metalloenzyme that displays pyrophosphatase activity. It contains both a uridine kinase (UK) domain,CYTH domain, a coiled-coil domain and a transmembrane domain at the C-terminal Mutants show a delay in leaf senescence. Can functionally complement TTM1 and vise versa. (PMID:28733390) |
| AT1G68720 | Encodes the chloroplastic A-to-I tRNA editing enzyme. |
| AT1G22270 | Encodes SMO2 (Small Organ 2). Modulates progression of cell division during organ growth. |
| AT4G01880 | methyltransferase;(source:Araport11) |
| AT3G02320 | Involved in posttranscriptional modification of tRNA. |
| AT5G15810 | Involved in posttranscriptional modification of tRNA. |
| AT3G56330 | Involved in posttranscriptional modification of plastid tRNA. |
| AT2G28450 | zinc finger (CCCH-type) family protein;(source:Araport11) |
| AT4G17610 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
| AT2G45730 | eukaryotic initiation factor 3 gamma subunit family protein;(source:Araport11) |
| AT1G03110 | Encodes a gene involved in the modification of nucleosides in tRNA. Mutants have no 7-methylguanosine. |
| AT2G27760 | Encodes tRNA isopentenyltransferase, similar to yeast MOD5. |
| AT4G24670 | Encodes a protein with similarity to the TAA1 trytophan aminotransferase involved in IAA biosynthesis. Double mutant analyses suggest that this protein is involved in regulating many aspects of plant growth and development from embryogenesis to flower formation and plays a role in ethylene-mediated signaling.TAR2 is required for reprogramming root architecture in response to low nitrogen conditions. |
| AT1G34040 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT5G54810 | A.thaliana tryptophan synthase beta subunit (trpB) |
| AT3G06060 | Encodes one of the Arabidopsis proteins (At3g06060/TSC10A and At5g19200/TSC10B) with significant similarity to the yeast 3-ketodihydrosphinganine (3-KDS) reductase, Tsc10p. Both TSC10A and TSC10B are bona fide 3-KDS reductase as shown by complementation experiment in yeast. |
| AT5G19200 | Encodes one of the Arabidopsis proteins (At3g06060/TSC10A and At5g19200/TSC10B) with significant similarity to the yeast 3-ketodihydrosphinganine (3-KDS) reductase, Tsc10p. Both TSC10A and TSC10B are bona fide 3-KDS reductase as shown by complementation experiment in yeast. |
| AT2G36960 | Arabidopsis thaliana myb/SANT domain protein |
| AT3G27060 | Encodes one of the 3 ribonucleotide reductase (RNR) small subunit genes. TSO2 transcription occurs predominantly at the S-phase of the cell cycle and its expression pattern is consistent with its role in dNDP biosynthesis during DNA replication in actively dividing cells. Critical for cell cycle progression, DNA damage repair and plant development. |
| AT2G47770 | Encodes a membrane-bound protein designated AtTSPO (Arabidopsis thaliana TSPO-related). AtTSPO is related to the bacterial outer membrane tryptophan-rich sensory protein (TspO) and the mammalian mitochondrial 18 kDa Translocator Protein (18 kDa TSPO), members of the TspO/MBR domain-containing membrane proteins. Mainly detected in dry seeds, but can be induced in vegetative tissues by osmotic or salt stress or abscisic acid treatment. Located in endoplasmic reticulum and the Golgi stacks. It is degraded through the autophagy pathway. |
| AT1G76900 | Member of plant TLP family. Contains terminal F-box domain, interacts with ASK proteins. Tethered to the PM. |
| AT1G25280 | Member of TLP family |
| AT1G53320 | Member of plant TLP family. TLP7 is tethered to the PM but detaches upon stimulus and translocates to the nucleus. Has DNA binding activity but lacks conservation of the transcription activation domain. |
| AT1G50010 | Encodes alpha-2,4 tubulin. TUA2 and TUA4 encode identical proteins. The mRNA is cell-to-cell mobile. |
| AT5G19770 | tubulin 3 |
| AT1G04820 | Encodes an alpha tubulin isoform that is expressed in roots, leaves and flowers. |
| AT5G19780 | Encodes an isoform of alpha tubulin. Closely related to adjacent gene TUA3 suggesting recent duplication. The mRNA is cell-to-cell mobile. |
| AT4G14960 | Encodes an alpha-tubulin isoform required for right handed helical growth. |
| AT5G23860 | beta-tubulin, preferentially expressed in endodermal and phloem cells of primary roots and in the vascular tissues of leaves, stems, and flowers. The mRNA is cell-to-cell mobile. |
| AT5G62690 | encodes tubulin beta-2/beta-3 chain The mRNA is cell-to-cell mobile. |
| AT5G62700 | encodes tubulin beta-2/beta-3 chain The mRNA is cell-to-cell mobile. |
| AT5G44340 | beta tubulin gene |
| AT1G20010 | beta tubulin |
| AT2G29550 | Encodes a beta-tubulin that is expressed in leaves, roots and flowers. |
| AT4G20890 | tubulin 9 The mRNA is cell-to-cell mobile. |
| AT5G64510 | Encodes Tunicamycin Induced 1(TIN1), a plant-speci c ER stress-inducible protein. TIN1 mutation affects pollen surface morphology. Transcriptionally induced by treatment with the N-linked glyclsylation inhibitor tunicamycin. |
| AT5G01075 | Encodes a small ER-localized protein that is strongly expressed in seeds and regulates both embryo development and accumulation of storage compounds. At the cellular level, TWS1 is responsible for cuticle deposition on epidermal cells and organization of the endomembrane system. |
| AT3G02140 | Encodes a protein that acts in the nucleus and is an important negative regulator of ABA and salt stress responses, and could play a critical role in controlling root elongation, floral initiation and starch degradation. |
| AT4G03560 | Encodes a depolarization-activated Ca(2+) channel. Anti-sense experiments with this gene as well as Sucrose-H(+) symporters and complementation of yeast sucrose uptake mutant cch1 suggest that this protein mediates a voltage-activated Ca(2+ )influx. Mutants lack detectable SV channel activity suggesting TPC1 is essential component of the SV channel. Patch clamp analysis of loss of function mutation indicates TPC1 does not affect Ca2+ signaling in response to abiotic and biotic stress. |
| AT3G62260 | Type 2C protein phosphatase (PP2C) which negatively regulates AtHKT1;1 activity and thus determines systemic Na+ allocation during salt stress. |
| AT2G29400 | Type 1 protein phosphatase, expressed in roots, rosettes and flowers |
| AT3G05580 | Encodes a Type One Protein Phosphatase that acts as a nucleocytoplasmic negative regulator of tip growth. Mutants affect pollen germination, pollen tube growth, and root hair growth. It acts genetically downstream of ANX1 (AT3G04690) and ANX2 (AT5G28680) and is functionally redundant with TOPP8 (AT5G27840). |
| AT5G59160 | Encodes the catalytic subunit of a Type 1 phosphoprotein Ser/Thr phosphatase, expressed in roots, shoots and flowers. |
| AT5G36160 | Encodes a cytosolic L-tyrosine aminotransferase. AtTAT2 exhibits much broader amino donor specificity than AtTAT1 and can use not only Tyr but also Phe, Trp, His, Met, Leu, Ala, Ser, Cys, Asp, Asn, Gln, and Arg as amino donors. |
| AT5G53970 | Encodes a cytosolic tyrosine aminotransferase which is strongly induced upon aging and coronatine treatment. AtTAT1 prefers Tyr as an amino donor but can also use Phe, Trp, His, Met, and Leu. The mRNA is cell-to-cell mobile. |
| AT5G15170 | Tyrosyl-DNA phosphodiesterase 1 involved in DNA repair. TDP1 is involved the repair of Topoisomerase 1 cleavage complexes (tdp1 mutants are camptotecin hypersensitive). tdp1/wss1A double mutants show a synergistic sensitivity after camptothecin treatment. tdp1/mus81 double mutants show an elevated number of dead cells in root meristems after camptothecin treatment (compared to the single mutants). |
| AT1G08030 | Encodes a tyrosylprotein sulfotransferase (TPST). This protein is a 500-aa type I transmembrane protein that shows no sequence similarity to animal TPSTs. Activity confirmed by protein expression in yeast. TPST is expressed throughout the plant body, and the highest levels of expression are in the root apical meristem. TPST acts in the auxin pathway to maintain postembryonic root stem cell niche by defining the expression of the PLETHORA stem cell transcription factor genes. A loss-of-function mutant TPST displayed a marked dwarf phenotype accompanied by stunted roots, pale green leaves, reduction in higher order veins, early senescence, and a reduced number of flowers and siliques. TPST suppresses ethylene production through the action of PSK (phytosulfokine). |
| AT3G50670 | Encodes U1 snRNP 70K |
| AT1G09760 | U2 small nuclear ribonucleoprotein A;(source:Araport11) |
| AT2G30260 | encodes U2B", which is a component of the U2 snRNP complex. Its precise role in pre-mRNA splicing is still unknown. It has been suggested that U2B0 may not be required for the splicing reaction itself but may have a role in U2 snRNP biogenesis. Deletion analysis of the U2B0 gene fusion has identified the N-terminal RNP-80 motif as sufficient for localization to the coiled body and the nucleus. |
| AT5G09585 | U2;(source:Araport11) |
| AT5G54075 | U3 small nucleolar RNA |
| AT3G06900 | U4;(source:Araport11) |
| AT4G10970 | UAP56-interacting factor1, binds single stranded RNA and, along with UIEF2,,appears to play a role in nuclear export of RNA. |
| AT4G23910 | UAP56-interacting factor2, binds single stranded RNA and, along with UIEF1,,appears to play a role in nuclear export of RNA. |
| AT4G05050 | polyubiquitin gene, belongs to a subtype group with UBQ10 and UBQ14. Various ecotypes of Arabidopsis have different numbers of ubiquitin repeats within this gene. |
| AT3G62250 | ubiquitin 5;(source:Araport11) |
| AT2G47110 | polyubiquitin gene The mRNA is cell-to-cell mobile. |
| AT3G09790 | encodes a ubiquitin-like protein that contains tandem repeats of the ubiquitin coding region, but at least one repeat per gene encodes a protein with amino acid substitutions. |
| AT5G41700 | One of the polypeptides that constitute the ubiquitin-conjugating enzyme E2 The mRNA is cell-to-cell mobile. |
| AT4G27960 | ubiquitin conjugating enzyme |
| AT1G77700 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT2G30110 | Encodes a ubiquitin-activating enzyme (E1), involved in the first step in conjugating multiple ubiquitins to proteins targeted for degradation. Gene is expressed in most tissues examined. Mutant is able to revert the constitutive defense responses phenotype of snc1, which indicates the gene is involved in defense response. It also indicates that ubiquitination plays a role in plant defense signalling. |
| AT5G53300 | Encodes a ubiquitin conjugating enzyme. |
| AT3G46460 | May function together with UBC7 and UBC14 in the plant READ pathway, required in plant responses to multiple stress conditions. |
| AT1G75440 | ubiquitin-conjugating enzyme 16;(source:Araport11) |
| AT5G42990 | ubiquitin-conjugating enzyme 18;(source:Araport11) |
| AT5G05080 | ubiquitin-conjugating enzyme 22;(source:Araport11) |
| AT2G16920 | ubiquitin-conjugating enzyme 23;(source:Araport11) |
| AT3G15355 | ubiquitin-conjugating enzyme 25;(source:Araport11) |
| AT1G53025 | Ubiquitin-conjugating enzyme family protein;(source:Araport11) |
| AT1G64230 | ubiquitin-conjugating enzyme 28;(source:Araport11) |
| AT5G62540 | Encodes a protein predicted to be an E2 ubiquitin conjugating enzyme. It appears homologous to the RAD6 protein in yeast implicated in histone ubiquitination, but, UBC3 has not been experimentally associated with this process. |
| AT5G56150 | ubiquitin-conjugating enzyme 30;(source:Araport11) |
| AT3G17000 | Group XIV ubiquitin-conjugating enzyme that functions negative regulation of drought stress. |
| AT1G16890 | UBC36/UBC13B encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair. It can bind to the MMZ/UEV1 proteins in vitro. |
| AT5G42300 | Ubiquitin like protein that appears to play a role in pre-mRNA splicing. |
| AT5G02880 | encodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT2G45695 | Ubiquitin related modifier 1;(source:Araport11) |
| AT5G06600 | Encodes a ubiquitin-specific protease which together with UBP13 deubiquitinates DA1, DAR1 and DAR2, hence reducing their peptidase activity. Works upstream of DA1, DAR1 and DAR2 to restrict their protease activity and hence fine-tune plant growth and development. |
| AT3G11910 | Ubiquitin-specific protease, which together with UBP12 deubiquitinates DA1, DAR1 and DAR2, hence reducing their peptidase activity. Works upstream of DA1, DAR1 and DAR2 to restrict their protease activity and hence fine-tune plant growth and development. |
| AT1G17110 | Encodes a ubiquitin-specific protease, and its activity has been confirmed in an in vitro assay. ubp15 mutants have defects in cell proliferation, and the associated processes of leaf, root, stem, flower, and silique development. UBP15 can be found in the nucleus and cytoplasm in transient assays. Though UBP15 is expressed in many tissues, UBP15 transcript levels are higher in rosette leaves and inflorescences than in other parts of the plant. Together with CUC2/CUC3-DA1 part of a regulatory module controls the initiation of axillary meristems, thereby determining plant architecture. As a direct substrate of DA1 peptidase, it represses the initiation of axillary meristems. |
| AT5G65450 | Encodes a ubiquitin-specific protease. The mRNA is cell-to-cell mobile. |
| AT4G17895 | Encodes a ubiquitin-specific protease. |
| AT5G57990 | Encodes a ubiquitin-specific protease. |
| AT4G30890 | Encodes a ubiquitin-specific protease. |
| AT1G51710 | Ubiquitin-specific protease 6 (UBP6). Deubiquinating enzyme. Interacts with calmodulin. |
| AT5G03490 | Encodes a dihydroxybenzoic acid (DHBA) glycosyltransferase. The Col-0 enzyme is responsible for biosynthesis of 2,3-DHBA xyloside and 2,5-DHBA xyloside. The Col-0 enzyme is specific for UDP-xylose and the C24 enzyme uses both UDP-glucose and UDP-xylose. This difference in sugar donor specificity was shown to be largely due to a single amino acid change between the two isoforms. |
| AT2G27860 | Encodes UDP-d-apiose/UDP-d-xylose synthase that requires NAD+ for enzymatic activity and is strongly inhibited by UDP-d-galacturonate. |
| AT1G08200 | Encodes a putative UDP-D-apiose/UPD-D-xylose synthetase. |
| AT1G12780 | Encodes a UDP-glucose epimerase that catalyzes the interconversion of the sugar nucleotides UDP-glucose UDP-galactose via a UDP-4-keto-hexose intermediate. Responsive to stress. |
| AT4G23920 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in growth and cell wall carbohydrate biosynthesis. |
| AT1G63180 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in pollen development. |
| AT4G10960 | Encodes a protein with UDP-D-glucose 4-epimerase activity. |
| AT4G30440 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. |
| AT1G02000 | UDP-D-glucuronate 4-epimerase The mRNA is cell-to-cell mobile. |
| AT2G45310 | UDP-D-glucuronate 4-epimerase |
| AT4G12250 | UDP-D-glucuronate 4-epimerase |
| AT3G23820 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. The mRNA is cell-to-cell mobile. |
| AT2G02810 | Encodes a multitransmembrane hydrophobic protein that functions as transporter of UDP-galactose and UDP-glucose into the Golgi. Localized in the ER. Involved in the unfolded protein response, a mechanism that controls proper protein folding in the ER. |
| AT4G23010 | UDP-galactose transporter 2;(source:Araport11) |
| AT1G14360 | UDP-galactose transporter 3;(source:Araport11) |
| AT3G59360 | UDP-galactose transporter 6;(source:Araport11) |
| AT4G32272 | Golgi-localized nucleotide sugar (UDP-GlcNAc) transporter that delivers an essential substrate for the maturation of N-glycans and the GIPC class of sphingolipids. |
| AT2G41490 | UDP-GlcNAc:dolichol phosphate N-acetylglucosamine-1-phosphate transferase |
| AT1G26570 | UDP-glucose dehydrogenase 1;(source:Araport11) |
| AT3G29360 | Encodes one of four UDP-glucose dehydrogenase UGD) genes. Mutation of this gene in combination with UGD3 leads to swollen plant cell walls and severe developmental defects associated with changes in pectic polysaccharides. |
| AT3G03250 | Is thought to encode a cytosolic UDP-glucose pyrophosphorylase with strong similarity to potato UTP--glucose-1-phosphate uridylyltransferase. Downregulated by flooding. |
| AT5G17310 | UDP-glucose pyrophosphorylase 2;(source:Araport11) |
| AT3G21750 | Encodes a glucosyltransferase that can attach glucose to a number of hydroxylated phenolic compounds as well as quercetins in vitro |
| AT3G21780 | Encodes a protein with UDP-glucosyl transferase activity that was shown to preferentially glucosylates abscisic acid (ABA), and not its catabolites. Moreover, UGT71B6 was shown to have a strict preference for the naturally-occurring ABA enantiomer, (+)-ABA, and not its 'unnatural' relative, (-)-ABA. This is in contrast to the other identified UGT genes catalyzing the glucosylation of ABA which were shown to accept both stereoisomers as substrates. |
| AT2G29750 | UDP-glucosyl transferase 71C1;(source:Araport11) |
| AT2G29740 | UDP-glucosyl transferase 71C2;(source:Araport11) |
| AT1G07250 | UDP-glucosyl transferase 71C4;(source:Araport11) |
| AT1G07240 | Encodes a UDP-glucosyltransferase that plays a role in abscisic acid (ABA) glucosylation from ABA to ABA-glucose ester and regulates ABA homeostasis, thereby influencing the ABA signal network. |
| AT2G29730 | UDP-glucosyl transferase 71D1;(source:Araport11) |
| AT1G01420 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT3G50740 | UGT72E1 is an UDPG:coniferyl alcohol glucosyltransferase which specifically glucosylates sinapyl- and coniferyl aldehydes. The enzyme is thought to be involved in lignin metabolism. |
| AT4G34138 | UDP-glucosyl transferase 73B1;(source:Araport11) |
| AT4G34131 | UDP-glucosyl transferase 73B3;(source:Araport11) |
| AT2G31750 | Encodes an auxin glycosyltransferase that is likely to be involved in regulation of auxin by glycosylation. |
| AT1G05530 | Encodes a protein with glucosyltransferase activity with high sequence homology to UGT1 (AT1G05560). It belongs to an UGT subfamily that binds UDP-glucose but not UDP-glucuronate, UDP-galactose, or UDP-rhamnose as the glycosyl donor. UGT2 was shown to be able to use abscisic acid as glycosylation substrate in the presence of UDP-glucose. |
| AT5G05870 | UDP-glucosyl transferase 76C1;(source:Araport11) |
| AT5G05860 | Encodes a cytokinin N-glucosyltransferase that is involved in cytokinin homeostasis and cytokinin response in planta through cytokinin N-glucosylation. Expression is induced by ABA, mannitol and drought stress. Analysis of overexpressors and loss of function mutants indicate a role in response to osmotic and drought stress. |
| AT5G05880 | Encodes a nicotinate-N-glycosyltransferase. |
| AT5G59580 | UDP-glucosyl transferase 76E1;(source:Araport11) |
| AT5G59590 | UDP-glucosyl transferase 76E2;(source:Araport11) |
| AT3G21560 | Encodes a protein with sinapic acid:UDP-glucose glucosyltransferase activity. Mutants defective in this gene are hyper-fluorescent (which accumulate in their trichomes a compound that is likely to be 3',5'-dimethoxynaringenin chalcone or sinapoyltriacetic acid lactone, potential products of the concerted action of 4-coumarate CoA ligase and chalcone synthase on sinapic acid). Also shown to be required for Arabidopsis nonhost resistance to the Asian soybean rust pathogen Phakopsora pachyrhizi. |
| AT1G22360 | UDP-glucosyl transferase 85A2;(source:Araport11) |
| AT1G22380 | Encodes a putative UDP-glucosyl transferase. At1g22380 was initially identified as encoding the protein AAF87154, which has been classified as a bHLH protein (AtbHLH152). Subsequently it has been found that the AAF87154 protein appears to be encoded by the AT1G23970 genomic locus. |
| AT1G78270 | UDP-glucosyl transferase 85A4;(source:Araport11) |
| AT1G22370 | UDP-glucosyl transferase 85A5;(source:Araport11) |
| AT2G30140 | Encodes a putative glycosyltransferase. Regulates flowering time via FLOWERING LOCUS C. |
| AT3G16520 | UDP-glucosyl transferase 88A1;(source:Araport11) |
| AT1G73880 | UDP-glucosyl transferase 89B1;(source:Araport11) |
| AT4G34135 | The At4g34135 gene encodes a flavonol 7-O-glucosyltransferase (EC 2.4.1.237) that glucosylates also with a 20 fold lower activity flavonols (kaempferol and quercetin) at the 3-O-position. |
| AT2G43820 | Encodes a nicotinate-O-glycosyltransferase. Induced by Salicylic acid, virus, fungus and bacteria. Also involved in the tryptophan synthesis pathway. Independent of NPR1 for their induction by salicylic acid. UGT74F1 transfers UDP:glucose to salicylic acid (forming a glucoside (SAG) and a glucose ester (SGE)), benzoic acid, and anthranilate in vitro. UGT74F2 shows a weak ability to catalyze the formation of the p-aminobenzoate-glucose ester in vitro. But, UGT75B1 appears to be the dominant pABA acylglucosyltransferase in vivo based on assays in leaves, flowers, and siliques. |
| AT1G05560 | A UDP-glucose transferase localized in the phragmoplast. It has been co-purified with the callose synthase complex and may transfer UDP-glucose from sucrose synthase to the callose synthase and thus help form a substrate channel for the synthesis of callose at the forming cell plate. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. UGT1 encodes a protein with glucosyltransferase activity with high sequence homology to UGT2 (AT1G05530). It belongs to an UGT subfamily that binds UDP-glucose but not UDP-glucuronate, UDP-galactose, or UDP-rhamnose as the glycosyl donor. UGT1 was shown to be able to use abscisic acid as glycosylation substrate in the presence of UDP-glucose. UGT1/UGT75B1 catalyzes the formation of the p-aminobenzoate-glucose ester in vitro and in vivo. It appears to be the enzyme predominantly responsible for pABA-Glc formation in Arabidopsis based on assays in leaves, flowers, and siliques. |
| AT3G53520 | Encodes a Golgi localized isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
| AT4G09500 | Glycosyltransferase which negatively regulates hypoxia stress response. |
| AT5G49690 | UDP-glycosyltransferase that can act upon sulcotrione herbicide. Overexpression confers resistance to herbicide. |
| AT1G76670 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT5G52560 | Encodes a protein with UTP:sugar 1-phosphate uridylyltransferase activity, which has been shown to use a wide range of substrates including glucose-1-P, galactose-1-P, xylose-1-P, arabinose-1-P and glucuronate-1-P. The enzyme was shown to require Mg2+ or Mn2+ for activity. Mutations in USP can lead to a complete loss of male fertility. |
| AT2G47650 | Encodes a Golgi localized isoform of UDP-glucuronic acid decarboxylase. UDP-glucuronic acid decarboxylase produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
| AT2G28315 | UXT1 is a member of the NST-KT subfamily of nucleotide/sugar transporters. It is localized to the golgi and ER. UXT1 functions as a UDP-Xyl transporter. The mRNA is cell-to-cell mobile. |
| AT4G02500 | Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides. The mRNA is cell-to-cell mobile. |
| AT5G11230 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT4G37180 | UIF1 is a nuclear and cytoplasmically localized myb-domain containing member of the GARP G2-like subfamily of transcription factors. Interacts with ULT1 and binds to the WUS promoter. UIF1 binding domains are also found in CUC and AG promoters suggesting they are also direct targets. This locus was also identified as a putative cytoskeletal protein in a yeast screen. |
| AT2G20825 | Developmental regulator, ULTRAPETALA;(source:Araport11) |
| AT1G03190 | UV damage and heat induce a common stress response in plants that leads to tissue death and reduced chloroplast function. The UVH6 product is suggested to be a negative regulator of this response. |
| AT1G14140 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT1G33430 | UPEX1 is arabinogalactan b-(1,3)-galactosyltransferase involved in the formation of pollen exine. Belongs to GT31 family. Mutants have reduced levels of AGPs. GALT8 has some but not complete functional overlap with KNS4/UPEX1. |
| AT1G29300 | intracellular protein transporter, putative (DUF641);(source:Araport11) |
| AT4G00050 | Encodes a phytochrome interacting factor that inhibits phytochrome A-mediated far-red light responses and binds to promoter regions of AT2G46970 and AT3G62090. |
| AT4G00080 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G13640 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G02100 | Encodes a protein that binds to beta-sitosterol and localizes to the ER. The WFDE motif in ORP3a appears to be important for a direct interaction with PVA12 [Plant VAMP-Associated protein 12]. Mutation of this motif causes ORP3a to relocalize to the Golgi and cytosol. The interaction between PVA12 and ORP3a does not appear to be sterol-dependent. |
| AT2G47470 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. The mRNA is cell-to-cell mobile. |
| AT3G03340 | LUC7 related protein;(source:Araport11) |
| AT3G03690 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G51170 | Encodes an active AGC VIII protein kinase that interacts with the putative transcription factor ATS and regulates planar growth during integument development in the ovule. Mutants exhibit ectopic growth in filaments and petals, as well as aberrant embryogenesis. |
| AT3G20830 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT3G53990 | Encodes universal stress protein (USP). Functions as a molecular chaperone under heat shock and oxidative stress conditions. Chaperone activity and assembly into complexes is redox regulated. |
| AT3G58450 | USP domain containing protein, member of the universal stress protein family, regulated by ABA and possibly regulated by the ABA-dependent transcription factor AREB/ABF. Involved in the regulation of seed germination. |
| AT1G16730 | hypothetical protein;(source:Araport11) |
| AT2G20100 | Together with PFA1 and PFA3 governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT1G29120 | Hydrolase-like protein family;(source:Araport11) |
| AT2G47270 | Encodes UPBEAT1 (UPB1), a transcription factor with a bHLH domain. Regulates the expression of a set of peroxidases that modulate the balance of reactive oxygen species (ROS) between the zones of cell proliferation and the zone of cell elongation where differentiation begins. Disruption of UPB1 activity alters this ROS balance, leading to a delay in the onset of differentiation. Regulates growth by mediating cell cycle progression. |
| AT1G67550 | Encodes a nickel-containing urea hydrolase involved in nitrogen recycling. It requires three urease accessory proteins for its activation. The mRNA is cell-to-cell mobile. |
| AT1G26440 | Encodes a ureide permease, uptake assays in yeast mutants indicated the longer splice variant is a cellular importer for allantoin, uracil and xanthine. Encodes 2 splice variants, UPS5L and UPS5S, which under nonstress conditions may function in allantoin degradation for nutrient recycling, whereas under stress, both genes may be involved in vesicular export allowing allantoin translocation from roots to shoots. |
| AT1G05680 | Encodes a UDP-glucosyltransferase, UGT74E2, that acts on IBA (indole-3-butyric acid) and affects auxin homeostasis. The transcript and protein levels of this enzyme are strongly induced by H2O2 and may allow integration of ROS (reactive oxygen species) and auxin signaling. This enzyme can also transfer glycosyl groups to several compounds related to the explosive TNT when this synthetic compound is taken up from the environment. |
| AT3G27190 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
| AT1G55810 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
| AT3G27440 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
| AT1G05620 | Encodes a cytosolic inosine nucleoside hydrolase. It forms a heterocomplex with NSH1 with almost two orders of magnitude higher catalytic efficiency for xanthosine hydrolysis than observed for NSH1 alone. Transcript levels for this gene are elevated in older leaves suggesting that it may play a role in purine catabolism during senescence. |
| AT3G56620 | nodulin MtN21-like transporter family protein |
| AT2G40900 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
| AT2G37460 | nodulin MtN21-like transporter family protein |
| AT2G37450 | nodulin MtN21-like transporter family protein |
| AT2G39510 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
| AT5G13670 | nodulin MtN21-like transporter family protein |
| AT1G43650 | nodulin MtN21-like transporter family protein |
| AT1G01070 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
| AT4G28040 | nodulin MtN21-like transporter family protein |
| AT4G15540 | nodulin MtN21-like transporter family protein The mRNA is cell-to-cell mobile. |
| AT5G40240 | nodulin MtN21-like transporter family protein |
| AT3G28130 | nodulin MtN21-like transporter family protein |
| AT3G28100 | nodulin MtN21-like transporter family protein The mRNA is cell-to-cell mobile. |
| AT2G45620 | Nucleotidyltransferase family protein involved in transcript polyadenylation. TUTase which connects decapping activators and prevents the accumulation of excessively deadenylated mRNAs to avoid siRNA biogenesis. |
| AT5G63860 | UV-B-specific signaling component that orchestrates expression of a range of genes with vital UV-protective functions. Located in the nucleus and the cytosol. Associates with chromatin via histones. UV-B light promotes URV8 protein accumulation in the nucleus. UVR8 interaction with COP1 is negatively regulated by RUP1 and RUP2. |
| AT1G76030 | One of three genes encoding the vacuolar ATP synthase subunit B1. This subunit was shown to interact with the gene product of hexokinase1 (ATHXK1). This interaction, however, is solely restricted to the nucleus. The protein binds to and co-localizes with F-actin, bundles F-actin to form higher-order structure, and stabilizes actin filaments in vitro. The mRNA is cell-to-cell mobile. |
| AT1G20260 | One of three genes encoding the vacuolar ATP synthase subunit B1. The protein binds to and co-localizes with F-actin, bundles F-actin to form higher-order structure, and stabilizes actin filaments in vitro. The mRNA is cell-to-cell mobile. |
| AT2G14740 | Encodes a vacuolar sorting receptor that participates in vacuolar sorting in vegetative tissues and in seeds. The mRNA is cell-to-cell mobile. |
| AT1G78900 | Encodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology. The mRNA is cell-to-cell mobile. |
| AT1G64200 | vacuolar H+-ATPase subunit E isoform 3;(source:Araport11) |
| AT1G75630 | vacuolar H+-pumping ATPase 16 kD proteolipid (ava-p) mRNA, The mRNA is cell-to-cell mobile. |
| AT1G78920 | Encodes a type II H+-PPases that localizes to and function as a proton pump of the Golgi apparatus in most tissues except for mature leaves. |
| AT1G62660 | Glycosyl hydrolases family 32 protein;(source:Araport11) |
| AT3G01390 | Subunit G of the vacuolar membrane ATPAse complex |
| AT1G63010 | Encodes an SPX domain protein that transports Pi into the vacuole and is essential for phosphate homeostasis. |
| AT4G29380 | The gene encodes phosphatidylinositol 3- kinase involved in the development and germination of pollen through the biosynthesis of phosphatidylinositol 3-phosphate (PI3P). The mRNA is cell-to-cell mobile. |
| AT1G22860 | Vacuolar sorting protein 39;(source:Araport11) |
| AT3G61770 | Acid phosphatase/vanadium-dependent haloperoxidase-related protein;(source:Araport11) |
| AT1G08190 | Might be involved in protein sorting to the vacuole. The mRNA is cell-to-cell mobile. |
| AT1G17730 | Encodes an ESCRT-related protein: CHMP1A/AT1G73030; CHMP1B/AT1G17730. CHMP1A and B mediate multivesicular body sorting of auxin carriers and are required for plant development. ESCRT: Endosomal Sorting Complexes Required For Transport machinery; CHMP: Charged Multivesicular Body Protein/Chromatin Modifying Protein. |
| AT2G21410 | Vacuolar proton ATPase subunit VHA-a isoform 2. Localized in the tonoplast. Required for efficient nutrient storage but not for sodium accumulation. |
| AT4G39080 | Vacuolar proton ATPase subunit VHA-a isoform 3. Localized in the tonoplast. The mRNA is cell-to-cell mobile. |
| AT2G32760 | Homolog of yeast VPS38P. Interacts with PI3K.Mutants have defects in late endosome morphology and retromer function. |
| AT2G34940 | VACUOLAR SORTING RECEPTOR 5;(source:Araport11) |
| AT4G38920 | vacuolar-type H[+]-ATPase C3;(source:Araport11) |
| AT3G13300 | Encodes VCS (VARICOSE). Involved in mRNA decapping. VCS forms a mRNA decapping complex with DCP1 (At1g08370) and DCP2 (At5g13570). Unlike DCP2, VCS itself does not have mRNA decapping activity in vitro. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. VCS is also required for leaf development. |
| AT2G30950 | Metalloprotease that functions in thylakoid membrane biogenesis. Involved in the repair of PSII following damaged incurred during photoinhibition. Forms a complex with VAR1. Mutants show a variegated phenotype, which decreases during development. Transcript and protein levels increase with light intensity. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the membrane. |
| AT1G02120 | Encodes VAD1 (Vascular Associated Death1), a regulator of cell death and defense responses in vascular tissues. VAD1 is a putative membrane associated protein and contains a GRAM domain. vad1 is a lesion mimic mutant that exhibits light conditional appearance of propagative HR (hypersensitive response)-like lesions along the vascular system. The mRNA is cell-to-cell mobile. |
| AT1G79620 | VRLK1 is a LRR kinase involved in switching between cell elongation and secondary cell wall thickening.VRLK1 is a member of a gene family that includes a small number of recently duplicated paralogs. |
| AT3G21710 | transmembrane protein;(source:Araport11) |
| AT1G50930 | Serine/Threonine-kinase;(source:Araport11) |
| AT5G62850 | Encodes a protein that is expressed in vegetative cells of pollen. A member of the SWEET sucrose efflux transporter family proteins. |
| AT5G24770 | Has acid phosphatase activity dependent on the presence of divalent cations (Mg2+, Co2+, Zn2+, Mn2+) and anti-insect activity. Insects fed with the protein show a retarded development. Induced in response to abscisic acid, jasmonic acid, salt, water deficiency and wounding. |
| AT4G24220 | encodes a progesterone-5beta-reductase-like protein. It has enone reductase activity against a wide range of substrates, including 3-oxo-Δ-4,5-steroids in vitro. The in vivo substrates and product of this enzyme have not yet been elucidated but it is likely to participate in steroid metabolism. The protein contains a mammalian death domain involved in programmed cell death. The gene is expressed in the vascular system and mutants carrying a dominant mutation in the gene have defective vascular patterning. VEP1 gene expression is induced specifically by wounding. |
| AT3G24440 | Encodes Vernalization Insensitive 3-like 1 (VIL1). VIL1 is involved in the photoperiod and vernalization of Arabidopsis by regulating expression of the related floral repressors Flowering Locus C (FLC) and Flowering Locus M (FLM). VIL1, along with VIN3 (Vernalization Insensitive 3) is necessary for the chromatin modification to FLC and FLM. |
| AT4G29830 | VIP3 protein is composed of repeats of WD motif which is involved in protein complex formation. The gene is involved in flower timing and flower development. This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. Loss of gene function leads to a redistribution of H3K4me3 and K3K36me2 modifications within genes but not a change in the overall abundance of these modifications within chromatin. Also known as SKI8, a component of the SKI complex involved in exosome mediated RNA degredation. Member of PAF-C complex. |
| AT1G61040 | Encodes a yeast Paf1C subunit homolog required for the expression of the MADS box gene FLC and other members of the FLC/MAF MADS-box gene family. Member of PAF-C complex. |
| AT5G57380 | Encodes a plant homeodomain protein VERNALIZATION INSENSITIVE 3 (VIN3). In planta VIN3 and VRN2, VERNALIZATION 2, are part of a large protein complex that can include the polycomb group (PcG) proteins FERTILIZATION INDEPENDENT ENDOSPERM (FIE), CURLY LEAF (CLF), and SWINGER (SWN or EZA1). The complex has a role in establishing FLC (FLOWERING LOCUS C) repression during vernalization. |
| AT4G30200 | Encodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus. |
| AT2G18870 | vernalization5/VIN3-like protein;(source:Araport11) |
| AT3G05270 | Encodes a protein that localizes at motile vesicle-like small compartments in differentiating xylem cells that is associated with microtubule plus-ends. VETH-positive compartments are unlikely to be elements in conventional endomembrane trafficking pathways. It can associate with COG2, and together these two proteins co-localize with the EXO70A1 exocyst subunit, tethering EXO70A1 to compartments associated with cortical microtubules. |
| AT1G77580 | filament-like protein (DUF869);(source:Araport11) |
| AT1G26670 | member of VTI1 Gene Family. Normally localizes to the transgolgi network and plasma membrane. A dominant mutation (zip1) alters the subcellular localization of VTI12 and suppresses loss of function mutation (zag1) of VTI11. Interacts with members of the SYP family. Involved in protein trafficking to protein storage vacuoles. |
| AT4G32150 | AtVAMP711 is a member of Synaptobrevin-like AtVAMP7C, v-SNARE (soluble N-ethyl-maleimide sensitive factor attachment protein receptors) protein family. SNAREs have been divided into four subgroups: Qa-, Qb-, Qc- and R-SNAREs. R-SNAREs are classified into three groups, the Sec22-, YKT6- and VAMP7-like R-SNAREs. One R-SNARE and three Q-SNAREs (one of each subgroup) form the trans-SNARE complex, which governs specific membrane fusions. VAMP7 proteins consist of three distinct domain, the N-terminal longin-domain (LD), the SNARE motif (SNM) and a transmembrane domain. In spite of the high similarities among the VAMP7 proteins, they show different subcellular localizations. VAMP7C is vacuolar-localized and its LD is essential for the correct localization. Generally, it is suggested that the complete LD is the determinant of subcellular sorting in both animal and plant R-SNAREs. |
| AT1G14000 | Encodes a protein with similarity to members of the C1 subgroup of MAP kinase kinase kinases. Interacts physically with the receptor kinase BRL2/VH1 and appears to be involved in auxin and brassinosteriod signaling. The mRNA is cell-to-cell mobile. |
| AT4G07400 | Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,2,and 4. When levels of all 4 genes are reduced plants show defects in growth and reduced levels of auxin response genes. |
| AT3G57410 | Encodes a protein with high homology to animal villin. VLN3 is a Ca2+-regulated villin involved in actin filament bundling. |
| AT4G23630 | VIRB2-interacting protein 1;(source:Araport11) |
| AT4G11220 | VIRB2-interacting protein 2;(source:Araport11) |
| AT5G41600 | VIRB2-interacting protein 3;(source:Araport11) |
| AT4G26850 | Encodes a novel protein involved in ascorbate biosynthesis, which was shown to catalyze the transfer of GMP from GDP-galactose to a variety of hexose-1-phosphate acceptors. Recessive mutation has a reduced amount of vitamin C, lower level of non-photochemical quenching, and reduced rate of conversion of violaxanthin to zeaxanthin in high light. |
| AT5G55120 | Encodes a GDP-L-galactose phosphorylase, with similar biochemical properties as VTC2. |
| AT4G32770 | Tocopherol cyclase involved in tocopherol (vitamin E)synthesis. VTE1 over-expressing plants have increased tocopherol indicating VTE1 is a major limiting factor in tocopherol synthesis. Mutants defective in this gene accumulate high amounts of zeaxanthin in conditions of high light or low temperature. Plays a role in the adaptation to low temperature stress, notably phloem loading. |
| AT1G78620 | integral membrane protein (Protein of unknown function DUF92, transmembrane);(source:Araport11) |
| AT5G04490 | Encodes a protein with phytol kinase activity involved in tocopherol biosynthesis. |
| AT3G01280 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. The mRNA is cell-to-cell mobile. |
| AT5G67500 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. The mRNA is cell-to-cell mobile. |
| AT5G15090 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. Purified VDAC3 is shown to have voltage-dependent anion channel activity. |
| AT5G57490 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. |
| AT4G21550 | VP1/ABI3-like 3;(source:Araport11) |
| AT2G17790 | Encodes a protein with similarity to yeast VPS35 which encodes a component of the retromer involved in retrograde endosomal transport. Mutants partially suppress the loss of VTI11 function in Arabidopsis and restores gravitropism in the double mutant. The mRNA is cell-to-cell mobile. |
| AT3G18360 | Member of VQ gene family. VQ proteins are named for the VQ motif (FxxxVQxxTG), a conserved amino acid region. Interacts with members of WRKY gene family, involved in pollen development. |
| AT1G78310 | VQ motif-containing protein;(source:Araport11) |
| AT3G60090 | VQ26 is an ABA responsive gene and interacts with the ABI5 transcription factor. Along with its paralog VQ18, it is involved in negative regulation of ABA responses during early seedling development. |
| AT1G16260 | Wall-associated kinase family protein;(source:Araport11) |
| AT1G16120 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
| AT1G16130 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
| AT1G16140 | Encodes a predicted WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
| AT1G16150 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. Likely involved in Arabidopsis root mineral responses to Zn2+, Cu2+, K+, Na+ and Ni+. The mRNA is cell-to-cell mobile. |
| AT1G16110 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. It has been shown to be localized to the cell wall. |
| AT1G16090 | Encodes a truncated WAK-like kinase that is predicted to be a secreted protein. |
| AT1G75500 | An Arabidopsis thaliana homolog of Medicago truncatula NODULIN21 (MtN21). The gene encodes a plant-specific, predicted integral membrane protein and is a member of the Plant-Drug/Metabolite Exporter (P-DME) family (Transporter Classification number: TC 2.A.7.3) and the nodulin MtN21-like transporter family. |
| AT1G72290 | Encodes a Kunitz-protease inhibitor, a water-soluble chlorophyll protein involved in herbivore resistance activation. |
| AT2G22680 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT5G65683 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT1G70950 | Microtubule-stabilizing protein. Module with MREL57 regulates microtubule disassembly to mediate stomatal closure in response to drought stress and ABA treatment. MREL57 interacts with, ubiquitinates and degrades WDL7, effect is enhanced by ABA. |
| AT5G28646 | Encodes a novel protein. The wvd2 gain-of-function mutant has impaired cell expansion and root waving, and changed root skewing. |
| AT3G23090 | Member of the microtubule regulatory protein WVD2/WDL family WDL3 stabilizes cortical microtubules and is involved in light induced hypocotyl elongation. WDL3 is ubiquinated by COP1, leading to its degadation in the dark, |
| AT2G35880 | Microtubule-stabilizing protein. |
| AT5G06690 | Encodes a thioredoxin (WCRKC1) localized in chloroplast stroma. Contains a WCRKC motif. Functions in redox cascade with 2CPA and 2CPB via the ferredoxin-thioredoxin reductase (FTR)/thioredoxin (Trx) pathway to mediate the light-responsive reductive control of target proteins. Oxidizes redox-regulated proteins. |
| AT2G26570 | Encodes a coiled-coil protein WEB1 (weak chloroplast movement under blue light 1). WEB1, together with another coiled-coil protein WEB2/PMI2 (At1g66840), maintains the chloroplast photorelocation movement velocity. |
| AT3G20880 | WIP4 is a paralog of NTT and along with WIP5,acts redundantly in cell fate determination during primary root development. MP binds to AuxRE motifs within the WIP4 gene and likely regulates its expression. |
| AT3G04910 | Serine/threonine protein kinase, whose transcription is regulated by circadian rhythm. |
| AT1G64630 | with no lysine (K) kinase 10;(source:Araport11) |
| AT3G48260 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. |
| AT5G58350 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
| AT3G18750 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
| AT1G10200 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. |
| AT3G55770 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. |
| AT2G01830 | Histidine kinase: cytokinin-binding receptor that transduces cytokinin signals across the plasma membrane |
| AT4G28240 | Member of the wound-induced polypeptide (WIP) family. Positively regulates plant resistance against Pst DC3000 by enhancing PTI responses. |
| AT4G05070 | Member of the wound-induced polypeptide (WIP) family. Positively regulates plant resistance against Pst DC3000 by enhancing PTI responses. |
| AT4G33560 | Member of the wound-induced polypeptide (WIP) family. |
| AT5G50200 | Wound-responsive gene 3 (WR3). Encodes a high-affinity nitrate transporter. Up-regulated by nitrate. Involved in jasmonic acid-independent wound signal transduction. |
| AT4G26455 | Encodes an outer nuclear membrane protein that anchors RanGAP1 to the nuclear envelope. It interacts with SUN proteins and is required for maintaining the elongated nuclear shape of epidermal cells. |
| AT5G56210 | Encodes an outer nuclear membrane protein that anchors RanGAP1 to the nuclear envelope. It interacts with SUN proteins and is required for maintaining the elongated nuclear shape of epidermal cells. |
| AT3G13360 | Encodes an outer nuclear membrane protein that anchors RanGAP1 to the nuclear envelope. It interacts with SUN proteins and is required for maintaining the elongated nuclear shape of epidermal cells. |
| AT3G54320 | WRINKLED1 encodes transcription factor of the AP2/ERWEBP class. Protein has two plant-specific (AP2/EREB) DNA-binding domains and is involved in the control of storage compound biosynthesis in Arabidopsis. Mutants have wrinkled seed phenotype, due to a defect in the incorporation of sucrose and glucose into triacylglycerols. Transgenic sGsL plants (21-day-old) grown on 6% sucrose for 24 hours had 2-fold increase in levels of expressions (sGsL line carries a single copy of T-DNA containing the Spomin::GUS-Spomin::LUC dual reporter genes in the upper arm of chromosome 5 of ecotype Col-0. The sporamin .minimal. promoter directs sugar-inducible expression of the LUC and GUS reporters in leaves). Regulation by LEC2 promotes fatty acid accumulation during seed maturation. Splice form 3 is the major form expressed in seedlings.Mutations in the C terminal intrinsically disordered region increase the stability of WRI1 and lead to increased oil production. |
| AT1G79700 | WRI4 encodes an AP2/ERF-type transcriptional activator that specifically controls cuticular wax biosynthesis in Arabidopsis stems. It also functions to activate transcription of genes involved fatty acid biosynthesis during seed and flower development as well as stem wax biosynthesis. Targets identified by ChIP-seq include: LACS1, KCR1, PAS2, ECR, and WSD1. |
| AT4G31550 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
| AT1G30650 | member of WRKY Transcription Factor; Group II-e |
| AT2G23320 | Encodes WRKY DNA-binding protein 15 (WRKY15). |
| AT2G24570 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
| AT4G31800 | Pathogen-induced transcription factor. Binds W-box sequences in vitro. Forms protein complexes with itself and with WRKY40 and WRKY60. Constitutive expression of WRKY18 enhanced resistance to P. syringae, but its coexpression with WRKY40 or WRKY60 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. The mRNA is cell-to-cell mobile. |
| AT5G56270 | Encodes WRKY transcription factor 2, a zinc-finger protein. In wrky2 mutants, egg cells polarize normally but zygotes fail to reestablish polar organelle positioning from a transient symmetric state, resulting in equal cell division and distorted embryo development. |
| AT2G30590 | Encodes WRKY DNA-binding protein 21 (WRKY21). |
| AT2G30250 | member of WRKY Transcription Factor; Group I. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. |
| AT5G52830 | Encodes a WRKY transcription factor WRKY27. Mutation in Arabidopsis WRKY27 results in delayed symptom development in response to the bacterial wilt pathogen Ralstonia solanacearum. |
| AT4G18170 | Member of WRKY Transcription Factor; Group II-c. Involved in the activation of salicylic acid biosynthesis genes ICS1 and PBS3. In the ovule, it is expressed in hypodermal somatic cells and appears to play a role in supression of megasporocyte cell fate. In the leaf if is upstream of FHY3 and regulates light-mediated leaf senescence. |
| AT4G30935 | member of WRKY Transcription Factor; Group I |
| AT2G38470 | Member of the plant WRKY transcription factor family. Regulates the antagonistic relationship between defense pathways mediating responses to P. syringae and necrotrophic fungal pathogens. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. Regulates cytochrome P450 gene CYP94B1 to control apoplastic barrier formation in roots to confer salt tolerance. |
| AT2G34830 | member of WRKY Transcription Factor; Group II-e |
| AT1G69810 | member of WRKY Transcription Factor; Group II-b |
| AT3G04670 | member of WRKY Transcription Factor; Group II-d |
| AT1G13960 | Encodes WRKY DNA-binding protein 4 (WRKY4). |
| AT1G80840 | Pathogen-induced transcription factor. Binds W-box sequences in vitro. Forms protein complexes with itself and with WRKY40 and WRKY60. Coexpression with WRKY18 or WRKY60 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. The mRNA is cell-to-cell mobile. |
| AT5G49520 | Encodes WRKY48, a member of the WRKY Transcription Factor. WRKY48 is a stress- and pathogen-induced transcriptional activator that represses plant basal defense. The mRNA is cell-to-cell mobile. |
| AT5G64810 | member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses. |
| AT1G69310 | Encodes WRKY57, a member of the WRKY Transcription Factor. Activation of WRKY57 confers drought tolerance. |
| AT2G21900 | member of WRKY Transcription Factor; Group II-c |
| AT2G25000 | Pathogen-induced transcription factor. Forms protein complexes with itself and with WRKY40. Coexpression with WRKY18 or WRKY40 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. |
| AT1G29280 | member of WRKY Transcription Factor; Group II-e The mRNA is cell-to-cell mobile. |
| AT3G58710 | member of WRKY Transcription Factor; Group II-e |
| AT4G24240 | Encodes a Ca-dependent calmodulin binding protein. Sequence similarity to the WRKY transcription factor gene family. |
| AT3G56400 | Member of WRKY Transcription Factor; Group III. Function as activator of SA-dependent defense genes and a repressor of JA-regulated genes. WRKY70-controlled suppression of JA-signaling is partly executed by NPR1. |
| AT5G15130 | member of WRKY Transcription Factor; Group II-b; contribute to basal immunity. The mRNA is cell-to-cell mobile. |
| AT5G46350 | member of WRKY Transcription Factor; Group II-c |
| AT5G12420 | WSD7 can function in vitro as wax ester synthase but does not appear to be essential for cuticular wax biosynthesis. |
| AT4G35550 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. WOX13 is the only family member that does not contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
| AT5G59340 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. WOX2 has a putative Zinc finger domain downstream of the homeodomain. Transcripts are expressed in the egg cell, the zygote and the apical cell lineage and are reduced in met3-1 early embryos. This gene is necessary for cell divisions that form the apical embryo domain. |
| AT3G04630 | Member of a small gene family which have a KLEEK domain which may be involved in protein- protein interactions. Over expression of WDL1 results in abnormal root development. |
| AT4G34890 | Encodes a xanthine dehydrogenase, involved in purine catabolism. Ubiquitously expressed, but the transcript level is altered during aging, senescence, salt and cold stress, ABA treatment, and dark treatment. RNAi lines that suppress both XDH1 and XDH2 produce small plants with reduced fertility and accelerated leaf senescence. Role in drought tolerance. |
| AT2G21150 | Encodes a nuclear localized XAP5 family protein involved in light regulation of the circadian clock and photomorphogenesis. XCT loss of function mutations also show decreased levels of DCL1, 3 and 4 and correspondingly lower levels of certain small RNAs suggesting a role in sRNA biogenesis. |
| AT5G57740 | Encodes a RING-type E3 ligase XBAT32. Mediates the proteasomal degradation of the ethylene biosynthetic enzyme, 1-aminocyclopropane-1-carboxylate synthase 7. |
| AT5G07270 | hypothetical protein;(source:Araport11) |
| AT4G14365 | hypothetical protein;(source:Araport11) |
| AT3G18000 | Encodes a N-methyltransferase-like protein. Double mutants of NMT1 and NMT3 are defective in leaf, root, flower, seed, and pollen development. |
| AT1G09850 | Arabidopsis thaliana papain-like cysteine peptidase |
| AT5G64080 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G25820 | Encodes a xyloglucan endotransglycosylase with a clear preference for non-fucosylated xyloglucan polymer. The mRNA is cell-to-cell mobile. |
| AT1G65310 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. |
| AT4G30280 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. |
| AT4G30290 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed throughout both the main and the lateral root, with intensive expression at the dividing and elongating regions. Is expressed in lateral root primordia but expression ceases after lateral root begins to grow. Involved in cell proliferation in incised inflorescence stems. |
| AT5G57550 | xyloglucan endotransglycosylase-related protein (XTR3) |
| AT4G28850 | xyloglucan endotransglucosylase/hydrolase 26;(source:Araport11) |
| AT1G14720 | member of Glycoside Hydrolase Family 16 |
| AT3G44990 | Encodes a xyloglucan endotransglycosylase/hydrolase. Protein sequence and phylogenetic analysis indicates that this enzyme resides in Group III-A of the XTH family, with high similarity to Tropaeolum majus (nasturtium) xyloglucanase 1 (TmNXG1).Enzyme kinetic analysis indicates predominant xyloglucan endo-hydrolase activity (EC 3.2.1.151) with only limited potential to act as a xyloglucan endo-transglycosylase (EC 2.4.1.207). |
| AT4G37800 | xyloglucan endotransglucosylase/hydrolase 7;(source:Araport11) |
| AT1G11545 | xyloglucan endotransglucosylase/hydrolase 8;(source:Araport11) |
| AT4G03210 | Encodes a member of xyloglucan endotransglucosylase/hydrolases (XTHs) that catalyze the cleavage and molecular grafting of xyloglucan chains function in loosening and rearrangement of the cell wall. Gene is expressed in shoot apex region, flower buds, flower stalks and internodes bearing flowers. |
| AT1G74380 | xyloglucan xylosyltransferase 5;(source:Araport11) |
| AT1G10550 | Encodes a membrane-localized protein that is predicted to function during cell wall modification.Overexpression of XTH33 results in abnormal cell morphology. It's expression is under epigenetic control by ATX1. |
| AT3G62720 | Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides. |
| AT5G17630 | Phosphate translocator family member which resides in the plastid inner envelope membrane. Retrieves excessive pentose phosphates from the extra-plastidial space and makes them available to the plastids. |
| AT2G21370 | Although this gene has a sequence similar to xylulose kinases, several lines of experimental evidence suggest that it does not act on xylulose or deoxy-xylulose. |
| AT5G49650 | Encodes a cytosolic protein capable of phosphorylating xylulose and deoxy-xylulose. It most likely plays a role in producing precursors for isoprenoid biosynthesis. |
| AT4G00180 | YABBY gene family member, likely has transcription factor activity, involved in specifying abaxial cell fate. Along with FIL, involved in patterning of the fruit. GUS reporter gene expression in seedlings is observed in the young leaves and as the leaf matures, expression is restricted to the abaxial tissues of leaves, expression is also observed on either side of the leaf margin in the younger tissues of leaf blades. |
| AT1G08410 | Encodes a large 60S subunit nuclear export GTPase 1 that is required for 40S maturation and is involved in ribosome biogenesis and affects multiple auxin-regulated development processes. |
| AT3G06290 | Encodes a component of the conserved TREX-2 complex that couples mRNA transcription with nucleo-cytoplasmic export, that is required for prevention of epigenetic gene silencing and has additional roles in regulating siRNAs and DNA methylation. |
| AT5G53550 | YELLOW STRIPE like 3;(source:Araport11) |
| AT3G17650 | Arabidopsis thaliana metal-nicotianamine transporter YSL5 |
| AT3G27020 | Arabidopsis thaliana metal-nicotianamine transporter YSL6 |
| AT1G65730 | Arabidopsis thaliana metal-nicotianamine transporter YSL4 |
| AT5G08290 | Encodes Dim1 homolog. |
| AT2G35980 | Encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus, spermine and during senescence. The gene product is localized to the chloroplast. The mRNA is cell-to-cell mobile. |
| AT4G28720 | Auxin biosynthetic gene regulated by RVE1. Overexpression leads to suppression of bri1 phenotype. |
| AT5G43890 | Encodes a YUCCA-like putative flavin monooxygenase, the activation tagging mutant has increased level of IAA, increased auxin response and phenotype of auxin overproduction, rescues erecta mutant phenotype |
| AT5G59440 | Encodes thymidylate kinase which exists in two isoforms in plants. The longer variant of 263 amino acids with a N-terminal extension that is required for localization to the mitochondrion. The second isoform of 224 residues is localized to the cytoplasm and nucleoplasm. Peak of expression occurs during G1/S phase transition. |
| AT3G14890 | Encodes a base excision repair protein that, together with APE2, it plays overlapping roles in the maintenance of epigenome and genome stability in plants. |
| AT1G69600 | Encodes ZFHD1, a member of the zinc finger homeodomain transcriptional factor family. Binds to the 62 bp promoter region of ERD1 (early responsive to dehydration stress 1). Expression of ZFHD1 is induced by drought, high salinity and abscisic acid. |
| AT2G32930 | Encodes a zinc finger protein. |
| AT5G16540 | Encodes a zinc finger protein. |
| AT5G04340 | Encodes a C2H2 zinc finger transcription factor that coordinately activates phytochelatin-synthesis related gene expression and directly targets GSH1 by binding to its promoter to positively regulate Cd accumulation and tolerance. |
| AT3G02830 | Encodes a zinc finger protein that binds to PORA mRNA in vivo and recruits the Pfr form of phytochrome to the 5′-UTR of PORA mRNA to regulate translation of the mRNA. |
| AT5G25160 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT1G66140 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT1G10480 | Encodes a zinc finger protein containing only a single zinc finger that acts downstream of ZFP6 in regulating trichome development by integrating GA and cytokinin signaling. |
| AT1G67030 | Encodes a novel C2H2 zinc finger protein containing only a single zinc finger which plays a key role in regulating trichome development by integrating GA and cytokinin signaling. The mRNA is cell-to-cell mobile. |
| AT2G41940 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT5G13750 | zinc induced facilitator-like 1;(source:Araport11) |
| AT3G43790 | zinc induced facilitator-like 2;(source:Araport11) |
| AT3G54826 | Zim17-type zinc finger protein;(source:Araport11) |
| AT3G20870 | ZIP metal ion transporter family;(source:Araport11) |
| AT1G10970 | A member of Zrt- and Irt-related protein (ZIP) family. transcript is induced in response to zinc deficiency in the root and shoot. Expression is regulated by copper, but response to copper deficiency is detected only after three weeks of deficiency. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G05300 | member of Fe(II) transporter isolog family |
| AT2G46800 | Encodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis. |
| AT2G04880 | Encodes WRKY1, a member of the WRKY transcription factors in plants involved in disease resistance, abiotic stress, senescence as well as in some developmental processes. WRKY1 is involved in the salicylic acid signaling pathway. The crystal structure of the WRKY1 C-terminal domain revealed a zinc-binding site and identified the DNA-binding residues of WRKY1. The mRNA is cell-to-cell mobile. |
| AT5G67450 | Encodes zinc-finger protein. mRNA levels are elevated in response to low temperature, cold temperatures and high salt. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT2G48020 | Encodes a zinc transporter ZIF2. Expression of ZIF2 is regulated by alternative splicing. |
| AT5G61350 | Encodes a membrane-localized receptor-like kinase that regulates root hair tip growth by maintaining cytoplasmic Ca2+ gradients. Knockouts of CAP1 produced more cytoplasmic NH4+ and ceased growth of root hairs on MS medium except when NH4+ was depleted; NH4+ depletion reestablished the Ca2+ gradient necessary for normal growth. The lower net NH4+ influx across the vacuolar membrane and relatively alkaline cytosolic pH of root hairs in cap1-1 relative to wild type implied that mutation of CAP1 results in more NH4+ accumulation in the cytoplasm. Furthermore, CAP1 functionally complemented npr1 kinase yeast mutant defective in high-affinity NH4+ uptake via MEP2, distinguishing CAP1 as a cytosolic modulator of NH4+ level that participates in NH4+ homeostasis-regulated root hair growth by modulating tip-focused cytoplasmic Ca2+ gradients. |
| AT2G25095 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC. Pri-mRNA coordinates for MIR156a (converted to TAIR10 based on PMID19304749): Chr2: 10677064-10673957 (reverse), length: 3108 bp; exon coordinates: exon 1: 10677064 to 10676955, exon 2: 10676613 to 10676366, exon 3: 10674380 to 10674338, exon 4: 10674245 |
| AT4G31877 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC. Pri-mRNA coordinates for MIR156c (converted to TAIR10 based on PMID19304749): Chr4: 15415873-15413295 (reverse), length: 2580 bp; exon coordinates: exon 1: 15415873 |