| AT4G39800 | myo-inositol-1-phosphate synthase isoform 1 |
| AT1G61065 | 1,3-beta-glucan synthase component (DUF1218) |
| AT1G53750 | 26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA, |
| AT1G18490 | 2-aminoethanethiol dioxygenase, putative (DUF1637) |
| AT4G21860 | 2-Cys methionine sulfoxide reductase. |
| AT5G20550 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein |
| AT4G16765 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein |
| AT2G38500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein |
| AT3G19010 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein |
| AT4G10500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein |
| AT1G76170 | 2-thiocytidine tRNA biosynthesis protein, TtcA |
| AT4G27490 | 3-5-exoribonuclease family protein |
| AT5G44710 | 37S ribosomal protein S27 |
| AT3G15290 | 3-hydroxyacyl-CoA dehydrogenase family protein |
| AT5G16010 | 3-oxo-5-alpha-steroid 4-dehydrogenase family protein |
| AT5G16200 | 50S ribosomal protein-like protein |
| AT1G66890 | 50S ribosomal-like protein |
| AT1G29630 | 5-3 exonuclease family protein |
| AT5G57060 | 60S ribosomal L18a-like protein |
| AT3G55280 | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA and functionally redundant to it. |
| AT1G59640 | A basic helix-loop-helix encoding gene (BIGPETAL, BPE) involved in the control of petal size. |
| AT3G02150 | a chloroplast trans-acting factor of the psbD light-responsive promoter.TCP gene involved in heterochronic control of leaf differentiation. |
| AT3G55880 | A gain-of-function mutant of SUE4 exhibited improved low sulphur tolerance. |
| AT1G23390 | A kelch domain-containing F-box protein. |
| AT2G17430 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. |
| AT2G39200 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. |
| AT1G11310 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. acid or salicylic acid, but requires a syntaxin, glycosyl hydrolase and ABC transporter. It is a novel virulence target of the P. syringae type III secreted effector HopZ2. |
| AT1G11000 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. |
| AT1G61560 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. |
| AT3G51780 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. |
| AT2G46240 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. |
| AT5G62390 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. |
| AT2G37550 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT4G17890 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT5G46750 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT3G49870 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
| AT1G09180 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
| AT5G25220 | A member of class II knotted1-like homeobox gene family (together with KNAT4 and KNAT5). |
| AT1G72470 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. |
| AT2G39380 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. |
| AT5G59730 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. |
| AT5G13990 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. |
| AT3G24220 | A member of gene NCED-related gene family, encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. |
| AT5G61960 | A member of mei2-like gene family |
| AT1G58200 | A member of MscS-like gene family |
| AT4G22820 | A member of the A20/AN1 zinc finger protein family involved in stress response. |
| AT5G04370 | A member of the Arabidopsis SABATH methyltransferase gene family. |
| AT5G42580 | a member of the cytochrome P450 family |
| AT4G15393 | a member of the cytochrome P450 gene family. molecular function unknown. |
| AT3G06020 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) gene |
| AT4G35100 | a member of the plasma membrane intrinsic protein PIP. functions as aquaporin. Salt-stress-inducible MIP |
| AT2G37180 | a member of the plasma membrane intrinsic protein PIP2. functions as aquaporin and is involved in desiccation. |
| AT4G00430 | a member of the plasma membrane intrinsic protein subfamily PIP1. involved redundantly with PIP1;1/2/3/5 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
| AT3G61430 | a member of the plasma membrane intrinsic protein subfamily PIP1. |
| AT2G45960 | a member of the plasma membrane intrinsic protein subfamily PIP1. |
| AT5G60660 | A member of the plasma membrane intrinsic protein subfamily PIP2.When expressed in yeast cells can conduct hydrogen peroxide into those cells. Mutants exhibit longer root hairs. |
| AT1G66600 | A member of WRKY Transcription Factor; Group III. Involved in the regulation of plant responses to ABA and drought stress. |
| AT3G12145 | A novel leucine-rich repeat protein. Interacts directly with MADS domain transcription factor. |
| AT2G39810 | A novel protein with a RING finger motif near the amino terminus. Negative regulator of cold responses. |
| AT1G77140 | A peripheral membrane protein that associates with microsomal membranes, likely to function in the transport of proteins to the vacuole. |
| AT3G17203 | a pseudogene initially named GA2ox5 and thought to be a member of the gibberellin 2-oxidase enzyme family. |
| AT3G10985 | A senescence-associated gene whose expression is induced in response to treatment with Nep1, a fungal protein that causes necrosis. |
| AT3G11220 | A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1?ELP6), that copurifies with the elongating RNAPII in yeast and humans. |
| AT1G70760 | a subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. |
| AT5G04590 | A.thaliana gene encoding sulfite reductase. |
| AT5G54810 | A.thaliana tryptophan synthase beta subunit (trpB) |
| AT3G52800 | A20/AN1-like zinc finger family protein |
| AT1G15570 | A2-type cyclin. Negatively regulates endocycles and acts as a key regulator of ploidy levels in Arabidopsis endoreduplication. |
| AT4G18820 | AAA-type ATPase family protein |
| AT4G02480 | AAA-type ATPase family protein |
| AT1G02890 | AAA-type ATPase family protein |
| AT3G27250 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G40800 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G50360 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G11970 | ABC family ABC transporter, putative (DUF3511) |
| AT5G24810 | ABC1 family protein |
| AT3G07700 | ABC1K7 is a member of an atypical protein kinase family that is induced by salt stress. |
| AT4G15233 | ABC-2 and Plant PDR ABC-type transporter family protein |
| AT4G15236 | ABC-2 and Plant PDR ABC-type transporter family protein |
| AT3G25620 | ABC-2 type transporter family protein |
| AT1G69260 | ABI five binding protein |
| AT3G29575 | ABI five binding protein 3 |
| AT1G14340 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
| AT5G32450 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
| AT5G54950 | Aconitase family protein |
| AT1G12420 | ACT domain repeat 8 |
| AT2G31810 | ACT domain-containing small subunit of acetolactate synthase protein |
| AT5G07740 | actin binding protein |
| AT3G25690 | actin binding protein required for normal chloroplast positioning |
| AT1G01750 | actin depolymerizing factor 11 |
| AT2G04400 | Acts during tryptophan biosynthesis controlled by ERF109. |
| AT5G16370 | acyl activating enzyme 5 |
| AT5G43590 | Acyl transferase/acyl hydrolase/lysophospholipase superfamily protein |
| AT4G13050 | Acyl-ACP thioesterase |
| AT3G05420 | Acyl-CoA binding protein with high affinity for oleoyl-CoA. Expressed in all plant organs. Involved in fatty acid transport. Plays a role in determining seed oil content. |
| AT2G37520 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein |
| AT4G19985 | Acyl-CoA N-acyltransferases (NAT) superfamily protein |
| AT3G51970 | acyl-CoA sterol acyl transferase 1 |
| AT1G01710 | acyl-CoA thioesterase II |
| AT5G03370 | acylphosphatase family |
| AT4G28260 | acyl-UDP-N-acetylglucosamine O-acyltransferase |
| AT5G22780 | Adaptor protein complex AP-2, alpha subunit |
| AT5G47740 | Adenine nucleotide alpha hydrolases-like superfamily protein |
| AT3G11930 | Adenine nucleotide alpha hydrolases-like superfamily protein |
| AT3G17020 | Adenine nucleotide alpha hydrolases-like superfamily protein |
| AT4G12440 | adenine phosphoribosyl transferase 4 |
| AT4G39940 | adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete |
| AT5G15950 | Adenosylmethionine decarboxylase family protein |
| AT5G50370 | Adenylate kinase family protein |
| AT2G41850 | ADPG2. |
| AT1G73340 | ADTO1 is required for the activation of systemic acquired resistance. |
| AT4G12730 | AF333971 Arabidopsis thaliana fasciclin-like arabinogalactan-protein 2 (Fla2) mRNA, complete cds. |
| AT4G30490 | AFG1-like ATPase family protein |
| AT5G26950 | AGAMOUS-like 93 |
| AT1G46408 | AGAMOUS-like 97 |
| AT2G41470 | agamous-like MADS-box protein |
| AT5G56750 | AGB1/AGG dimmer interacting protein, response to water deficit. |
| AT3G20830 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein |
| AT4G37450 | AGP18 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. |
| AT1G80100 | AHP6 lacks the conserved histidine residue (Asn83 in AHP6b), which is required for phosphotransfer, present in the other AHPs. |
| AT3G28940 | AIG2-like (avirulence induced gene) family protein |
| AT5G46720 | AIG2-like (avirulence induced gene) family protein |
| AT2G24390 | AIG2-like (avirulence induced gene) family protein |
| AT1G22920 | AJH1 encodes a protein similar to JAB1, a specific mammalian coactivator of AP-1 transcription. |
| AT4G39660 | alanine:glyoxylate aminotransferase 2 homolog (AGT2). |
| AT2G38400 | alanine:glyoxylate aminotransferase 2 homolog (AGT3) mRNA, |
| AT1G54100 | Aldehyde dehydrogenase |
| AT5G03690 | Aldolase superfamily protein |
| AT5G64250 | Aldolase-type TIM barrel family protein |
| AT2G44660 | ALG6, ALG8 glycosyltransferase family |
| AT4G29690 | Alkaline-phosphatase-like family protein |
| AT4G29700 | Alkaline-phosphatase-like family protein |
| AT4G29710 | Alkaline-phosphatase-like family protein |
| AT1G73750 | alpha/beta hydrolase family protein |
| AT3G12150 | alpha/beta hydrolase family protein |
| AT2G40095 | Alpha/beta hydrolase related protein |
| AT5G06570 | alpha/beta-Hydrolases superfamily protein |
| AT5G42930 | alpha/beta-Hydrolases superfamily protein |
| AT1G49650 | alpha/beta-Hydrolases superfamily protein |
| AT1G80280 | alpha/beta-Hydrolases superfamily protein |
| AT4G25770 | alpha/beta-Hydrolases superfamily protein |
| AT4G36530 | alpha/beta-Hydrolases superfamily protein |
| AT2G44970 | alpha/beta-Hydrolases superfamily protein |
| AT5G53050 | alpha/beta-Hydrolases superfamily protein |
| AT3G19970 | alpha/beta-Hydrolases superfamily protein |
| AT1G68620 | alpha/beta-Hydrolases superfamily protein |
| AT4G34310 | alpha/beta-Hydrolases superfamily protein |
| AT1G10040 | alpha/beta-Hydrolases superfamily protein |
| AT3G23570 | alpha/beta-Hydrolases superfamily protein |
| AT1G32190 | alpha/beta-Hydrolases superfamily protein |
| AT1G74640 | alpha/beta-Hydrolases superfamily protein |
| AT1G72620 | alpha/beta-Hydrolases superfamily protein |
| AT2G05260 | alpha/beta-Hydrolases superfamily protein |
| AT5G65400 | alpha/beta-Hydrolases superfamily protein |
| AT1G78210 | alpha/beta-Hydrolases superfamily protein |
| AT3G30380 | alpha/beta-Hydrolases superfamily protein |
| AT1G52750 | alpha/beta-Hydrolases superfamily protein |
| AT2G32520 | alpha/beta-Hydrolases superfamily protein |
| AT5G16120 | alpha/beta-Hydrolases superfamily protein |
| AT1G73480 | alpha/beta-Hydrolases superfamily protein |
| AT1G77420 | alpha/beta-Hydrolases superfamily protein |
| AT2G39420 | alpha/beta-Hydrolases superfamily protein |
| AT3G02410 | alpha/beta-Hydrolases superfamily protein |
| AT5G50840 | alpha-taxilin-like protein |
| AT3G08630 | alphavirus core family protein (DUF3411) |
| AT3G08640 | alphavirus core family protein (DUF3411) |
| AT3G51100 | altered inheritance of mitochondria protein |
| AT2G41290 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
| AT1G37140 | Amember of mei2-like gene family; |
| AT5G07360 | Amidase family protein |
| AT3G25585 | aminoalcoholphosphotransferase (AAPT2) |
| AT2G38710 | AMMECR1 family |
| AT1G20490 | AMP-dependent synthetase and ligase family protein |
| AT4G19030 | an aquaporin whose expression level is reduced by ABA, NaCl, dark, and desiccation. is expressed at relatively low levels under normal conditions. |
| AT5G53280 | An integral outer envelope membrane protein (as its homolog PDV2), component of the plastid division machinery. |
| AT1G06590 | anaphase-promoting complex subunit |
| AT2G31820 | Ankyrin repeat family protein |
| AT4G19150 | Ankyrin repeat family protein |
| AT3G52830 | ankyrin repeat protein |
| AT2G45360 | ankyrin repeat/KH domain protein (DUF1442) |
| AT2G38750 | Annexins are a family of calcium dependent membrane binding proteins though to be involved in Golgi mediated secretion. |
| AT2G38760 | Annexins are calcium binding proteins that are localized in the cytoplasm. When cytosolic Ca2+ increases, they relocate to the plasma membrane. |
| AT1G77131 | Annotated as pseudogene of PGSIP, glycogenin glucosyltransferase |
| AT1G14910 | ANTH domain-containing protein which functions as adaptor protein for clathrin-mediated endocytosis (CME) of the secretory vesicle-associated longintype R-SNARE VAMP72 group. |
| AT2G25430 | AP180 N-terminal homology domain, TPLATE complex protein involved in clathrin-mediated endocytosis. |
| AT2G28550 | AP2 family transcription factor that is involved in regulation of flowering and innate immunity.Interacts with CRY2 to regulate CO and FT. TOE1 binds to activation domain of CO and binds CORE sequences of the FT promoter.TOE1/TOE2 are also targets of MiR172b and function in regulation of innate immunity. |
| AT1G16640 | AP2/B3-like transcriptional factor family protein |
| AT5G57720 | AP2/B3-like transcriptional factor family protein |
| AT1G01840 | AP2-like ethylene-responsive transcription factor SNZ |
| AT4G34350 | Arabidopsis ISPH is involved in the plastid nonmevalonate pathway of isoprenoid biosynthesis. It was shown to complement the lethal phenotype of E. coli ispH mutant and is therefore most likely encodes a protein with 4-hydroxy-3-methylbut-2-en-1-yl diphosphate reductase activity involved in the last step of mevalonate-independent isopentenyl biosynthesis. Mutant has Albino seedling. |
| AT3G25250 | Arabidopsis protein kinase |
| AT3G24503 | Arabidopsis thaliana aldehyde dehydrogenase AtALDH1a mRNA. a sinapaldehyde dehydrogenase catalyzes both the oxidation of coniferylaldehyde and sinapaldehyde forming ferulic acid and sinapic acid, respectively |
| AT4G04210 | Arabidopsis thaliana CDC48-interacting UBX-domain protein (PUX4) |
| AT1G65730 | Arabidopsis thaliana metal-nicotianamine transporter YSL4 |
| AT1G15720 | Arabidopsis thaliana myb family transcription factor (At1g15720). MYB/SANT domain containing protein. |
| AT2G36960 | Arabidopsis thaliana myb/SANT domain protein |
| AT3G59760 | Arabidopsis thaliana O-acetylserine (thiol) lyase (OAS-TL) isoform oasC. Required for pollen tube growth and/or fertilization. |
| AT1G09850 | Arabidopsis thaliana papain-like cysteine peptidase |
| AT5G11510 | Arabidopsis thaliana putative c-myb-like transcription factor MYB3R-4. |
| AT1G24180 | Arabidopsis thaliana pyruvate dehydrogenase E1a-like subunit. |
| AT3G61640 | arabinogalactan protein 20 |
| AT5G65390 | arabinogalactan protein 7 |
| AT4G16130 | Arabinokinase. |
| AT5G02580 | argininosuccinate lyase |
| AT4G24830 | arginosuccinate synthase family |
| AT5G58680 | ARM repeat superfamily protein |
| AT3G58180 | ARM repeat superfamily protein |
| AT3G59020 | ARM repeat superfamily protein |
| AT1G01830 | ARM repeat superfamily protein |
| AT1G14300 | ARM repeat superfamily protein |
| AT4G16490 | ARM repeat superfamily protein |
| AT5G11550 | ARM repeat superfamily protein |
| AT5G05730 | ASA1 encodes the alpha subunit of anthranilate synthase, which catalyzes the rate-limiting step of tryptophan synthesis. |
| AT4G22770 | AT hook motif DNA-binding family protein |
| AT5G46640 | AT hook motif DNA-binding family protein |
| AT4G14940 | atao1 gene of Arabidopsis thaliana encodes an extracellular copper amine oxidase expressed during early stages of vascular tissue development. |
| AT4G14465 | AT-hook protein. Overexpression results in early flowering in short and long days. |
| AT2G41900 | AtOXS2 specifcally entered the nuclear under salt stress. |
| AT1G59870 | ATP binding cassette transporter. Localized to the plasma membrane in uninfected cells. |
| AT5G66310 | ATP binding microtubule motor family protein |
| AT5G02370 | ATP binding microtubule motor family protein |
| AT1G58080 | ATP phosphoribosyl transferase, catalyses first step of histidine biosynthesis |
| AT1G17500 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein. |
| AT4G30780 | ATP-dependent DNA helicase |
| AT2G24100 | ATP-dependent DNA helicase |
| AT2G25740 | ATP-dependent protease La (LON) domain protein |
| AT1G21410 | AtSKP2;1 is a homolog of human SKP2, the human F-box protein that recruits E2F1. |
| AT4G01250 | AtWRKY22 is a member of WRKY Transcription Factor; Group II-e. It is involved in regulation of dark induced leaf senescence. |
| AT5G63450 | AtWRKY33 regulates root apoplastic barrier formation by controlling AtCYP94B1 leading to increased salt tolerance of Arabidopsis plants. Regulation by WRKY33 to control apoplastic barrier formation in roots to confer salt tolerance. |
| AT1G13210 | Autoinhibited Ca2+/ATPase II. ALA11 acts redundantly with ALA3, ALA4, ALA5, ALA9, ALA10 in root and shoot development as well as PIN trafficking and polarity . |
| AT3G13970 | Autophagy protein. |
| AT5G16380 | autophagy-like protein, putative (Protein of unknown function, DUF538) |
| AT5G05150 | autophagy-related protein 18E |
| AT5G65670 | auxin (indole-3-acetic acid) induced gene |
| AT1G71090 | Auxin efflux carrier family protein |
| AT2G17500 | Auxin efflux carrier family protein |
| AT5G65980 | Auxin efflux carrier family protein |
| AT1G15580 | auxin induced protein |
| AT3G23030 | auxin inducible gene expressed in the nucleus |
| AT2G46530 | auxin response factor 11 |
| AT2G34315 | avirulence induced family protein |
| AT5G41810 | Avr9/Cf-9 rapidly elicited protein |
| AT4G25410 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein |
| AT5G57150 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein |
| AT1G05710 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein |
| AT4G37850 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein |
| AT2G22760 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein |
| AT2G34820 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein |
| AT1G62975 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein |
| AT5G51790 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein |
| AT5G62610 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein |
| AT4G29930 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein |
| AT5G43650 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein |
| AT1G05805 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein |
| AT1G09250 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein |
| AT3G07340 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein |
| AT5G11260 | Basic leucine zipper (bZIP) transcription factor. |
| AT1G06010 | basic leucine zipper/W2 domain protein |
| AT2G22850 | basic leucine-zipper 6 |
| AT1G58110 | Basic-leucine zipper (bZIP) transcription factor family protein |
| AT4G38900 | Basic-leucine zipper (bZIP) transcription factor family protein |
| AT1G06070 | Basic-leucine zipper (bZIP) transcription factor family protein |
| AT1G17450 | B-block binding subunit of TFIIIC |
| AT5G54470 | B-box type zinc finger family protein |
| AT1G28050 | B-box type zinc finger protein with CCT domain-containing protein |
| AT4G15250 | B-box type zinc finger protein with CCT domain-containing protein |
| AT1G48440 | B-cell receptor-associated 31-like protein |
| AT5G17190 | B-cell receptor-associated-like protein |
| AT3G03160 | B-cell receptor-associated-like protein |
| AT5G13300 | Belongs to 15-member small GTPase gene family, ARF-GAP domain proteins (AGD); corresponds to AGD3, and is one of four proteins belonging to class 1, together with AGD1, AGD2 and AGD4. |
| AT3G04090 | Belongs to a family of plant aquaporins. Similar to yeast and radish aquaporins. Located on ER. |
| AT1G01720 | Belongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA. |
| AT4G39950 | Belongs to cytochrome P450 and is involved in tryptophan metabolism. Converts Trp to indo-3-acetaldoxime (IAOx), a precursor to IAA and indole glucosinolates. |
| AT1G31880 | Belongs to five-member BRX gene family. |
| AT2G45160 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). |
| AT4G00150 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
| AT3G19710 | Belongs to the branched-chain amino acid aminotransferase gene family. Encodes a methionine-oxo-acid transaminase. |
| AT4G01710 | belongs to the DIS(distorted) gene family. Encodes a actin polymerization factor. Involved in cell expansion of trichome. |
| AT1G65860 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates |
| AT1G62540 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates |
| AT5G03350 | Belongs to the group of early SA-activated genes. Involved in resistance to Pst Avr-Rpm1 as a component of the SA35 mediated defense processes associated to the ETI response. |
| AT5G64870 | Belongs to the group of plant flotillins, which are plasma membrane proteins. Flot3 is found in membrane nanodomains. |
| AT4G30190 | Belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal domain. |
| AT4G36780 | BES1/BZR1 homolog 2 |
| AT4G18890 | BES1/BZR1 homolog 3 |
| AT1G78700 | BES1/BZR1 homolog 4 |
| AT3G57260 | beta 1,3-glucanase |
| AT3G60130 | beta glucosidase 16 |
| AT1G61820 | beta glucosidase 46 |
| AT1G60260 | beta glucosidase 5 |
| AT1G60270 | beta glucosidase 6 |
| AT5G46690 | beta HLH protein 71 |
| AT1G20010 | beta tubulin |
| AT3G11420 | beta-1,3-N-acetylglucosaminyltransferase lunatic protein, putative (DUF604) |
| AT1G33250 | beta-1,3-n-acetylglucosaminyltransferase radical fringe protein, putative (DUF604) |
| AT1G12990 | beta-1,4-N-acetylglucosaminyltransferase family protein |
| AT1G67880 | beta-1,4-N-acetylglucosaminyltransferase family protein |
| AT1G77410 | beta-galactosidase 16 |
| AT5G56870 | beta-galactosidase 4 |
| AT1G45130 | beta-galactosidase 5 |
| AT3G24542 | Beta-galactosidase related protein |
| AT3G13750 | beta-galactosidase, glycosyl hydrolase family 35 |
| AT1G61810 | beta-glucosidase 45 |
| AT5G23860 | beta-tubulin, preferentially expressed in endodermal and phloem cells of primary roots and in the vascular tissues of leaves, stems, and flowers. |
| AT1G66270 | BGLU21 encodes a beta-glucosidase that has a high level of activity against the naturally occuring secondary metabolite scopolin. |
| AT5G65640 | bHLH093/NFL encodes a bHLH transcription factor involved in GA mediated control of flowering time. |
| AT1G01260 | bHLH13 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH14 and bHLH17 to negatively regulate jasmonate responses. |
| AT4G18950 | BHP1 is a Raf-like protein kinase involved in mediating blue light dependent stomatal opening. |
| AT5G47950 | BIA2 is a putative HXXXD-type BAHD acyltransferase. Overexpression results in a BR deficient phenotype and is dependent on a functional HXXXD motif. |
| AT5G46900 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein |
| AT4G22610 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein |
| AT4G12545 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein |
| AT3G07450 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein |
| AT3G53980 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein |
| AT5G46890 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein |
| AT3G43720 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein |
| AT2G38110 | bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly. |
| AT3G19840 | Binds the carboxyl-terminal domain (CTD) of the largest subunit of RNA polymerase II and functions as a scaffold for RNA processing machineries. |
| AT5G16840 | Binds to ACD11 and fungal elicitor RxLR207. Regulates ROS mediated defense response. |
| AT4G10380 | Boric acid channel. Essential for efficient boron uptake and plant development under boron limitation. |
| AT3G23620 | BRIX domain containing protein, similar to RNA biogenesis factors in yeast. |
| AT1G73150 | Bromodomain and extra terminal domain family protein. Binds to acetyl-histone H3. Binding is reduced when GTE3 is SUMOylated by SIZ1. |
| AT2G26110 | bromodomain protein (DUF761) |
| AT3G27420 | bromodomain testis-specific protein |
| AT3G18080 | B-S glucosidase 44 |
| AT3G61420 | BSD domain (BTF2-like transcription factors, Synapse-associated proteins and DOS2-like proteins) |
| AT4G13110 | BSD domain-containing protein |
| AT5G67480 | BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves. |
| AT2G30600 | BTB/POZ domain-containing protein |
| AT1G06850 | bZIP protein involved in heat stress response. Under heat stress localization moves exclusively to nucleus. |
| AT4G35900 | bZIP protein required for positive regulation of flowering. Mutants are late flowering. FD interacts with FT to promote flowering. |
| AT3G51960 | bZIP transcription factor induced by salt stress and promoted salt tolerance. |
| AT5G06839 | bZIP transcription factor family protein |
| AT3G19290 | bZIP transcription factor with specificity for abscisic acid-responsive elements (ABRE). |
| AT2G40950 | bZIP17 appears to regulate transcription as part of a salt and osmotic stress response. |
| AT1G42990 | bZIP60 consists of a bZIP DNA binding domain followed by a putative transmembrane domain. |
| AT5G17980 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein |
| AT1G70790 | C2-domain ABA-related (CAR) protein, involved in the recruitment of ABA receptors to the plasma membrane to facilitate ABA signaling. |
| AT3G49930 | C2H2 and C2HC zinc fingers superfamily protein |
| AT4G17810 | C2H2 domain regulatory protein. Functions downstream of GL2 during root hair development and regulates expression of targets RDH6, RSL2 and RSL4. |
| AT1G75710 | C2H2-like zinc finger protein |
| AT1G04445 | C2H2-like zinc finger protein |
| AT1G14580 | C2H2-like zinc finger protein |
| AT5G40720 | C3H4 type zinc finger protein (DUF23) |
| AT1G20050 | C-8 sterol isomerase that also plays a role in miRNA function. |
| AT3G09710 | Ca(2+)-dependent calmodulin-binding protein. Targeted to the nucleus. Involved in glucosinolate metabolism in response to biotic challenge. |
| AT4G17840 | CAAX protease self-immunity protein |
| AT3G09960 | Calcineurin-like metallo-phosphoesterase superfamily protein |
| AT1G25230 | Calcineurin-like metallo-phosphoesterase superfamily protein |
| AT4G23000 | Calcineurin-like metallo-phosphoesterase superfamily protein |
| AT1G11960 | Calcium channel that is phosphorylated by BIK1 in the presence of PAMPS and required for stomatal immunity. |
| AT2G47010 | calcium/calcium/calmodulin-dependent Serine/Threonine-kinase |
| AT2G34020 | Calcium-binding EF-hand family protein |
| AT1G12310 | Calcium-binding EF-hand family protein |
| AT2G34030 | Calcium-binding EF-hand family protein |
| AT1G29025 | Calcium-binding EF-hand family protein |
| AT3G01830 | Calcium-binding EF-hand family protein |
| AT4G38810 | Calcium-binding EF-hand family protein |
| AT1G76640 | Calcium-binding EF-hand family protein |
| AT4G00140 | Calcium-binding EF-hand family protein |
| AT1G04540 | Calcium-dependent lipid-binding (CaLB domain) family protein |
| AT5G11100 | Calcium-dependent lipid-binding (CaLB domain) family protein |
| AT2G01540 | Calcium-dependent lipid-binding (CaLB domain) family protein |
| AT1G66360 | Calcium-dependent lipid-binding (CaLB domain) family protein |
| AT3G51450 | Calcium-dependent phosphotriesterase superfamily protein |
| AT3G51440 | Calcium-dependent phosphotriesterase superfamily protein |
| AT2G47370 | Calcium-dependent phosphotriesterase superfamily protein |
| AT5G19450 | calcium-dependent protein kinase (CDPK19) mRNA, complete |
| AT3G57530 | Calcium-dependent Protein Kinase. ABA signaling component that regulates the ABA-responsive gene expression via ABF4. |
| AT5G16720 | caldesmon-like protein (Protein of unknown function, DUF593) |
| AT5G04020 | calmodulin binding protein |
| AT5G57010 | calmodulin-binding family protein |
| AT3G13600 | calmodulin-binding family protein |
| AT2G18750 | Calmodulin-binding protein |
| AT4G25800 | Calmodulin-binding protein |
| AT1G67310 | Calmodulin-binding transcription activator protein with CG-1 and Ankyrin domain |
| AT4G16146 | cAMP-regulated phosphoprotein 19-related protein |
| AT5G64130 | cAMP-regulated phosphoprotein 19-related protein |
| AT5G64220 | CAMTA2 proteins bind to the AtALMT1 promoter at in vitro. The gene itself is Al inducible, and AtALMT1 expression is partially repressed in camta2 mutant. |
| AT5G66590 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein |
| AT3G09590 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein |
| AT1G01310 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein |
| AT4G09462 | Carbohydrate-binding X8 domain superfamily protein |
| AT5G01260 | Carbohydrate-binding-like fold |
| AT5G62180 | Carboxyesterase that binds stringolactones. |
| AT5G18460 | carboxyl-terminal peptidase (DUF239) |
| AT3G13510 | carboxyl-terminal peptidase, putative (DUF239) |
| AT5G46820 | carboxyl-terminal proteinase-like protein, putative (DUF239) |
| AT3G03940 | Casein kinase involved in phosphorylation and ubiquination of RYR/PYLs, resulting in negative regulation of ABA response. Also acts in GA response pathway along with RGA1/CCA1. |
| AT5G18190 | Casein kinase involved in phosphorylation and ubiquination of RYR/PYLs, resulting in negative regulation of ABA response.Also annotated as MUT9-LIKE kinase that functions as H3-T3 specific histone kinase. |
| AT1G20620 | Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen. |
| AT1G28680 | Catalyses trans-cis isomerization and lactonization in the biosynthesis of coumarins in roots. |
| AT3G57460 | catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding protein |
| AT1G74790 | catalytics |
| AT5G11560 | catalytics |
| AT4G13300 | Catalyzes the conversion of farnesyl diphosphate to (Z)-gamma-bisabolene and the additional minor products E-nerolidol and alpha-bisabolol. Expressed in cortex and sub-epidermal layers of roots, leaf hydathodes and flower stigmata. Induced by wounding. |
| AT1G25220 | Catalyzes the first step of tryptophan biosynthesis: Chorismate L-Glutamine = Anthranilate Pyruvate L-Glutamate. Functions as a heterocomplex with anthranilate synthase alpha subunit (ASA1 or ASA2). |
| AT1G20630 | Catalyzes the reduction of hydrogen peroxide using heme group as cofactor. Protects cells from toxicity by H2O2. |
| AT3G51860 | cation exchanger 3 |
| AT1G76480 | caveolin-1 protein |
| AT4G14580 | CBL-interacting protein kinase |
| AT5G57630 | CBL-interacting protein kinase.When mutated plants are hypersensitive to salt and osmotic stress. |
| AT5G63490 | CBS / octicosapeptide/Phox/Bemp1 (PB1) domains-containing protein |
| AT4G33700 | CBS domain protein (DUF21) |
| AT5G53750 | CBS domain-containing protein |
| AT1G45688 | CC1 is a plant specific gene that interacts with with the cellulose synthase complex and microtubules. |
| AT5G42860 | CC2 is a plant specific gene that interacts with with the cellulose synthase complex and microtubules. |
| AT3G56240 | CCH protein belongs to a family of eukaryotic proteins that participate in intracellular copper homeostasis by delivering this metal to the secretory pathway; mainly located along the vascular bundles of senescing leaves and petioles as well as in stem sieve elements; hypothesized to have a role in copper mobilization from decaying organs towards reproductive structures, as a result of metalloprotein breakdown. The plant-specific C-terminal domain of the CCH protein forms amyloid-like fibrils in vitro. |
| AT5G17850 | CCX2 is a putative cation/Ca2+ exchange protein. It is located in the endoplasmic reticulum. |
| AT1G69570 | CDF5 is a circadian regulated transcript that is antiphasic with respect to its natural antisense transcript (NAT) FLORE (AT1G69572). |
| AT5G66090 | cell wall integrity/stress response component |
| AT4G39840 | cell wall integrity/stress response component-like protein |
| AT2G46520 | cellular apoptosis susceptibility protein, putative / importin-alpha re-exporter |
| AT1G44790 | ChaC-like family protein |
| AT4G31290 | ChaC-like family protein |
| AT5G66230 | Chalcone-flavanone isomerase family protein |
| AT3G14200 | Chaperone DnaJ-domain superfamily protein |
| AT1G09260 | Chaperone DnaJ-domain superfamily protein |
| AT5G18140 | Chaperone DnaJ-domain superfamily protein |
| AT3G13310 | Chaperone DnaJ-domain superfamily protein |
| AT4G36040 | Chaperone DnaJ-domain superfamily protein |
| AT5G43260 | chaperone protein dnaJ-like protein |
| AT3G51660 | Chemokine-like MDL protein; modulate flowering time and innate immunity in plants. |
| AT1G31720 | chitin synthase, putative (DUF1218) |
| AT5G24090 | Chitinase A (class III) expressed exclusively under environmental stress conditions. Shown be a plant lysozyme involved in plant immunity. |
| AT3G47540 | Chitinase family protein |
| AT3G04000 | ChlADR is an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. |
| AT1G19670 | Chlorophyllase is the first enzyme involved in chlorophyll degradation. |
| AT5G17710 | Chloroplast GrpE protein involved in chloroplastic response to heat stress and the correct oligomerization of the photosynthesis-related LHCII complex. |
| AT1G78560 | Chloroplast inner membrane, pantothenate transporter. |
| AT3G45140 | Chloroplast lipoxygenase required for wound-induced jasmonic acid accumulation in Arabidopsis. |
| AT3G32040 | Chloroplast localized GFDP synthase. |
| AT5G66650 | Chloroplast localized mitochondrial calcium uniporter. |
| AT3G11170 | Chloroplastic enzyme responsible for the synthesis of 16:3 and 18:3 fatty acids from galactolipids, sulpholipids and phosphatidylglycerol. |
| AT3G46610 | Chloroplast-localized PPR protein required for the translation of the psbJ and psbN open reading frames. |
| AT1G29980 | choice-of-anchor C domain protein, putative (Protein of unknown function, DUF642) |
| AT4G17440 | chromogranin (DUF1639) |
| AT2G36650 | CHUP1-like protein |
| AT5G08330 | Circadian oscillator protein which interacts with bZIP63 and regulates a response of the circadian oscillator to sugar. |
| AT5G38200 | Class I glutamine amidotransferase-like superfamily protein |
| AT3G54600 | Class I glutamine amidotransferase-like superfamily protein |
| AT3G18940 | clast3-like protein |
| AT5G46630 | clathrin adaptor complexes medium subunit family protein, contains Pfam profile: PF00928 adaptor complexes medium subunit family; |
| AT2G20760 | Clathrin light chain protein |
| AT3G51890 | Clathrin light chain protein |
| AT4G36980 | CLK4-associating serine/arginine-rich protein |
| AT5G53350 | CLP protease regulatory subunit CLPX mRNA, nuclear gene |
| AT3G27960 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
| AT3G15980 | Coatomer, beta subunit |
| AT3G16860 | COBRA-like protein 8 precursor |
| AT3G51090 | coiled-coil 90B-like protein (DUF1640) |
| AT5G11500 | coiled-coil protein |
| AT3G50830 | cold acclimation protein WCOR413-like protein beta form. Transcript is not detectable. |
| AT5G58575 | Component of the deubiquitination module of the SAGA complex. |
| AT3G16620 | component of TOC complex, plastid protein import machinery. |
| AT5G01090 | Concanavalin A-like lectin family protein |
| AT5G60310 | Concanavalin A-like lectin protein kinase family protein |
| AT5G60320 | Concanavalin A-like lectin protein kinase family protein |
| AT3G45420 | Concanavalin A-like lectin protein kinase family protein |
| AT3G53810 | Concanavalin A-like lectin protein kinase family protein |
| AT3G53380 | Concanavalin A-like lectin protein kinase family protein |
| AT5G03140 | Concanavalin A-like lectin protein kinase family protein |
| AT2G20610 | Confers auxin overproduction. Mutants have an over-proliferation of lateral roots. |
| AT5G57660 | CONSTANS-like 5 |
| AT1G52410 | Contains a novel calcium-binding repeat sequence. Binds TSK in vitro. |
| AT1G18720 | Contains DUF962 domain. Localizes to ER and cam complement yeast Mpo1 dioxygenase function. Interacts with ABI1. May be involved in ER stress response. |
| AT1G53920 | Contains lipase signature motif and GDSL domain. |
| AT1G53990 | Contains lipase signature motif and GDSL domain. |
| AT3G51950 | Contains single CCCH domain. |
| AT2G45660 | Controls flowering and is required for CO to promote flowering. |
| AT4G00810 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
| AT1G31710 | Copper amine oxidase family protein |
| AT1G12520 | Copper-zinc superoxide dismutase copper chaperone (delivers copper to the Cu-Zn superoxide dismutase). |
| AT5G02470 | core cell cycle genes |
| AT4G30060 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein |
| AT3G03690 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein |
| AT5G57510 | cotton fiber protein |
| AT1G30190 | cotton fiber protein |
| AT4G23760 | Cox19-like CHCH family protein |
| AT1G76560 | CP12 domain-containing protein 3 |
| AT2G46310 | CRF5 encodes one of the six cytokinin response factors. It is transcriptionally upregulated in response to cytokinin. |
| AT3G61630 | CRF6 encodes one of the six cytokinin response factors. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. |
| AT2G39180 | CRINKLY4 related 2 |
| AT3G55950 | CRINKLY4 related 3 |
| AT2G39650 | cruciferin (DUF506) |
| AT1G79420 | C-type mannose receptor (DUF620) |
| AT1G22480 | Cupredoxin superfamily protein |
| AT3G27200 | Cupredoxin superfamily protein |
| AT2G41890 | curculin-like (mannose-binding) lectin family protein / PAN domain-containing protein |
| AT1G78860 | curculin-like (mannose-binding) lectin family protein, low similarity to Ser/Thr protein kinase |
| AT1G78850 | curculin-like (mannose-binding) lectin family protein, low similarity to ser/thr protein kinase from Zea mays (GI:2598067); |
| AT4G34490 | CYCLASE ASSOCIATED PROTEIN |
| AT5G24610 | cyclic AMP-responsive element-binding protein |
| AT2G44740 | cyclin p4 |
| AT1G10690 | cyclin-dependent kinase inhibitor |
| AT5G02220 | cyclin-dependent kinase inhibitor |
| AT5G02420 | cyclin-dependent kinase inhibitor SMR3-like protein |
| AT5G40460 | cyclin-dependent kinase inhibitor SMR3-like protein |
| AT1G74940 | cyclin-dependent kinase, putative (DUF581) |
| AT1G74070 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein |
| AT4G32420 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein |
| AT2G21130 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein |
| AT3G23480 | Cyclopropane-fatty-acyl-phospholipid synthase |
| AT3G48520 | CYP94B3 is a jasmonoyl-isoleucine-12-hydroxylase that catalyzes the formation of 12-OH-JA-Ile from JA-Ile. |
| AT5G64660 | CYS, MET, PRO, and GLY protein 2 |
| AT1G69800 | Cystathionine beta-synthase (CBS) protein |
| AT1G15330 | Cystathionine beta-synthase (CBS) protein |
| AT1G03710 | Cystatin/monellin superfamily protein |
| AT4G16500 | Cystatin/monellin superfamily protein |
| AT4G11310 | cysteine proteinase precursor-like protein |
| AT1G47128 | Cysteine proteinase precursor-like protein/ dehydration stress-responsive gene (RD21). |
| AT3G45310 | Cysteine proteinases superfamily protein |
| AT2G04680 | Cysteine/Histidine-rich C1 domain family protein |
| AT1G44020 | Cysteine/Histidine-rich C1 domain family protein |
| AT1G55700 | Cysteine/Histidine-rich C1 domain family protein |
| AT2G04500 | Cysteine/Histidine-rich C1 domain family protein |
| AT4G10370 | Cysteine/Histidine-rich C1 domain family protein |
| AT4G02540 | Cysteine/Histidine-rich C1 domain family protein |
| AT2G40050 | Cysteine/Histidine-rich C1 domain family protein |
| AT4G13992 | Cysteine/Histidine-rich C1 domain family protein |
| AT1G69150 | Cysteine/Histidine-rich C1 domain family protein |
| AT5G46670 | Cysteine/Histidine-rich C1 domain family protein |
| AT5G02350 | Cysteine/Histidine-rich C1 domain family protein |
| AT3G07000 | Cysteine/Histidine-rich C1 domain family protein |
| AT1G65180 | Cysteine/Histidine-rich C1 domain family protein |
| AT3G59130 | Cysteine/Histidine-rich C1 domain family protein |
| AT4G14980 | Cysteine/Histidine-rich C1 domain family protein |
| AT3G45530 | Cysteine/Histidine-rich C1 domain family protein |
| AT2G13950 | Cysteine/Histidine-rich C1 domain family protein |
| AT5G22355 | Cysteine/Histidine-rich C1 domain family protein |
| AT2G02630 | Cysteine/Histidine-rich C1 domain family protein |
| AT1G35610 | Cysteine/Histidine-rich C1 domain family protein |
| AT1G05340 | cysteine-rich TM module stress tolerance protein |
| AT4G02120 | Cytidine triphosphate synthase. |
| AT5G28050 | Cytidine/deoxycytidylate deaminase family protein |
| AT3G07570 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein |
| AT4G21192 | Cytochrome c oxidase biogenesis protein Cmc1-like protein |
| AT3G62400 | cytochrome C oxidase subunit |
| AT2G47380 | Cytochrome c oxidase subunit Vc family protein |
| AT1G32710 | Cytochrome c oxidase, subunit Vib family protein |
| AT5G19060 | cytochrome P450 family protein |
| AT3G15760 | cytochrome P450 family protein |
| AT1G52565 | cytochrome P450 family protein |
| AT1G13080 | cytochrome P450 monooxygenase |
| AT5G04330 | Cytochrome P450 superfamily protein |
| AT4G15396 | cytochrome P450, family 702, subfamily A, polypeptide 6 |
| AT4G15330 | cytochrome P450, family 705, subfamily A, polypeptide 1 |
| AT2G25160 | cytochrome P450, family 82, subfamily F, polypeptide 1 |
| AT5G52320 | cytochrome P450, family 96, subfamily A, polypeptide 4 |
| AT3G44326 | Cytokinin induced F-Box protein. Forms a unique F-Box family with AT2G27310 and AT2G36090. It is primarily expressed in the root. |
| AT4G15210 | cytosolic beta-amylase expressed in rosette leaves and inducible by sugar. RAM1 mutants have reduced beta amylase in leaves and stems. |
| AT5G26610 | D111/G-patch domain-containing protein |
| AT4G25020 | D111/G-patch domain-containing protein |
| AT5G66640 | DA1-related protein 3 |
| AT5G66620 | DA1-related protein 6 |
| AT5G66610 | DA1-related protein 7 |
| AT3G08840 | D-alanine-D-alanine ligase family |
| AT1G14130 | DAO1 is an IAA oxidase expressed in many different plant parts. |
| AT1G14120 | DAO2 is an IAA oxidase expressed in root caps. |
| AT4G36860 | DAR1 is a member of a small (7 member) ubiquitin binding protein family. |
| AT4G02180 | DC1 domain-containing protein |
| AT5G61910 | DCD (Development and Cell Death) domain protein |
| AT3G25400 | dCTP pyrophosphatase-like protein |
| AT1G28180 | DEAD-box ATP-dependent RNA helicase-like protein |
| AT1G61470 | Deadenylase. |
| AT1G77525 | defensin-like protein |
| AT4G18660 | delay of germination protein |
| AT3G16240 | Delta tonoplast intrinsic protein, functions as a water channel and ammonium (NH3) transporter. |
| AT1G76880 | DF1 is a putative transcription factor required for the synthesis of seed mucilage polysaccharides. |
| AT4G01730 | DHHC-type zinc finger family protein |
| AT3G56920 | DHHC-type zinc finger family protein |
| AT2G18730 | diacylglycerol kinase 3 |
| AT3G02420 | dihydroflavonol 4-reductase/flavanone protein |
| AT4G24380 | dihydrofolate reductase |
| AT1G48430 | Dihydroxyacetone kinase |
| AT1G62780 | dimethylallyl, adenosine tRNA methylthiotransferase |
| AT5G62030 | diphthamide synthesis DPH2 family protein |
| AT2G34930 | disease resistance family protein / LRR family protein |
| AT1G58410 | Disease resistance protein (CC-NBS-LRR class) family |
| AT4G11190 | Disease resistance-responsive (dirigent-like protein) family protein |
| AT3G13662 | Disease resistance-responsive (dirigent-like protein) family protein |
| AT5G03700 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein |
| AT5G12900 | DNA double-strand break repair RAD50 ATPase |
| AT1G75230 | DNA glycosylase superfamily protein |
| AT3G47830 | DNA glycosylase superfamily protein |
| AT4G25290 | DNA photolyase |
| AT2G42120 | DNA polymerase delta small subunit |
| AT1G67040 | DnaA initiator-associating protein |
| AT2G44430 | DNA-binding bromodomain-containing protein |
| AT1G20670 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
| AT5G55040 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
| AT1G76380 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
| AT3G04930 | DNA-binding storekeeper protein-related transcriptional regulator |
| AT2G36340 | DNA-binding storekeeper protein-related transcriptional regulator |
| AT1G01210 | DNA-directed RNA polymerase, subunit M, archaeal |
| AT5G49060 | DnaJ heat shock amino-terminal domain protein (DUF1977) |
| AT5G23590 | DNAJ heat shock N-terminal domain-containing protein |
| AT1G18700 | DNAJ heat shock N-terminal domain-containing protein |
| AT2G42750 | DNAJ heat shock N-terminal domain-containing protein |
| AT2G34860 | DnaJ-like zinc finger domain-containing protein which regulates the assembly of photosystem I (PSI) and seed development. |
| AT4G30900 | DNAse I-like superfamily protein |
| AT2G28510 | DOF transcription factor with a conserved zinc finger (ZF) DNA-binding domain. |
| AT4G21080 | Dof-type zinc finger domain-containing protein |
| AT5G62430 | Dof-type zinc finger domain-containing protein, similar to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). |
| AT1G30490 | Dominant PHV mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Has overlapping functions with PHABULOSA, REVOLUTA and CORONA/ATHB15 in patterning the apical portion of the embryo. |
| AT2G45830 | downstream target of AGL15 2 |
| AT5G55970 | Drought-induced gene encoding an ER-localized RING-type E3 Ub ligase. |
| AT2G36895 | D-tagatose-1,6-bisphosphate aldolase subunit |
| AT2G06255 | DUF1313 domain containing protein. |
| AT5G25840 | DUF1677 family protein (DUF1677) |
| AT1G72510 | DUF1677 family protein (DUF1677) |
| AT1G54095 | DUF1677 family protein, putative (DUF1677) |
| AT2G42760 | DUF1685 family protein |
| AT3G62640 | DUF3511 domain protein (DUF3511) |
| AT2G19460 | DUF3511 domain protein (DUF3511) |
| AT1G15350 | DUF4050 family protein |
| AT1G62420 | DUF506 family protein (DUF506) |
| AT1G77500 | DUF630 family protein, putative (DUF630 and DUF632) |
| AT3G60680 | DUF641 family protein (DUF641) |
| AT2G35200 | DUF740 family protein |
| AT1G32690 | DUF740 family protein |
| AT1G18740 | DUF793 domain containing protein. Expression is induced by cold. |
| AT4G12690 | DUF868 family protein (DUF868) |
| AT5G01200 | Duplicated homeodomain-like superfamily protein |
| AT5G08320 | E2F-associated phosphoprotein |
| AT3G47020 | E3 ubiquitin ligase involved in SGS3 degradation leading to inhibited biosynthesis of tasiRNA. The heat-induced activation of SGIP1 is inherited in the progeny. |
| AT1G15590 | E3 ubiquitin-protein ligase |
| AT1G72175 | E3 ubiquitin-protein ligase RNF170-like protein (DUF 1232) |
| AT5G04920 | EAP30/Vps36 family protein |
| AT3G04730 | early auxin-induced (IAA16) |
| AT2G30870 | Encodes glutathione transferase belonging to the phi class of GSTs. |
| AT3G21320 | EARLY FLOWERING protein |
| AT3G01070 | early nodulin-like protein 16 |
| AT5G15350 | early nodulin-like protein 17 |
| AT1G08500 | early nodulin-like protein 18 |
| AT4G32490 | early nodulin-like protein 4 |
| AT1G54720 | early-responsive to dehydration protein-related / ERD protein-like protein |
| AT1G69450 | Early-responsive to dehydration stress protein (ERD4) |
| AT1G10090 | Early-responsive to dehydration stress protein (ERD4) |
| AT1G32090 | early-responsive to dehydration stress protein (ERD4) |
| AT3G63060 | EDL3 is an F-box protein involved that mediated the regulation of abscisic acid signalling. |
| AT2G25460 | EEIG1/EHBP1 protein amino-terminal domain protein |
| AT5G54062 | egg cell-secreted-like protein |
| AT3G05640 | EGR1 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress.EGR1 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
| AT5G27930 | EGR2 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress. EGR2 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
| AT1G32730 | electron carrier/iron ion-binding protein |
| AT5G47380 | electron transporter, putative (Protein of unknown function, DUF547) |
| AT5G64890 | elicitor peptide 2 precursor |
| AT5G64905 | elicitor peptide 3 precursor |
| AT5G09980 | elicitor peptide 4 precursor |
| AT2G03470 | ELM2 domain-containing protein |
| AT5G43150 | elongation factor |
| AT1G21390 | embryo defective 2170 |
| AT5G06240 | embryo defective 2735 |
| AT2G35950 | embryo sac development arrest 12 |
| AT3G23440 | embryo sac development arrest 6 |
| AT2G41475 | Embryo-specific protein 3, (ATS3) |
| AT1G14010 | emp24/gp25L/p24 family/GOLD family protein |
| AT1G26690 | emp24/gp25L/p24 family/GOLD family protein |
| AT2G28140 | enabled-like protein (DUF1635) |
| AT3G50220 | Encode a DUF579 (domain of unknown function 579) containing protein essential for normal xylan synthesis and deposition in the secondary cell wall. |
| AT5G67210 | Encode a DUF579 (domain of unknown function 579) containing protein essential for normal xylan synthesis and deposition in the secondary cell wall. |
| AT3G50070 | Encode CYCD3;3, a CYCD3 D-type cyclin. Important for determining cell number in developing lateral organs. |
| AT3G14440 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. |
| AT4G31300 | Encodes 20S proteasome subunit PBA1 (PBA1). PBA1 acts as a plant caspase-3-like enzyme. |
| AT2G45300 | encodes 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase involved in chorismate biosynthesis |
| AT4G18350 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
| AT1G30100 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
| AT4G32400 | Encodes a plastidial nucleotide uniport carrier protein required to export newly synthesized adenylates into the cytosol. |
| AT2G06050 | Encodes a 12-oxophytodienoate reductase that is required for jasmonate biosynthesis. |
| AT3G50660 | Encodes a 22α hydroxylase whose reaction is a rate-limiting step in brassinosteroid biosynthetic pathway. |
| AT4G39980 | Encodes a 2-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase, which catalyzes the first committed step in aromatic amino acid biosynthesis. Gene expression is induced by wounding and pathogenic bacteria Pseudomonas syringae. |
| AT2G25450 | Encodes a 2-oxoacid-dependent dioxygenase involved in the production of 2-hydroxybut-3-enyl glucosinolate. |
| AT4G39403 | Encodes a 36 amino acid polypeptide that is necessary for correct responses to cytokinins and auxins, correct cell expansion in the root, and for vascular patterning in the leaf. |
| AT1G76490 | Encodes a 3-hydroxy-3-methylglutaryl coenzyme A reductase, which is involved in melavonate biosynthesis and performs the first committed step in isoprenoid biosynthesis. |
| AT5G54390 | Encodes a 3'-phosphoadenosine-5'-phosphate (PAP) phosphatase that is sensitive to physiological concentrations of Na+. |
| AT1G17745 | encodes a 3-Phosphoglycerate dehydrogenase |
| AT4G34200 | Encodes a 3-phosphoglycerate dehydrogenase that is essential for embryo and pollen development. |
| AT2G39460 | Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB. |
| AT1G23860 | Encodes a 9G8-like serine-arginine rich (SR) protein that interacts in vivo with U1-70K, a U1 small nuclear ribonucleoprotein 70-kDa protein that is involved in nuclear precursor mRNA processing. |
| AT3G49700 | encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family. Mutants produce elevated levels of ethylene as etiolated seedlings. |
| AT5G54060 | Encodes a anthocyanin 3-O-glucoside: 2"-O-xylosyl-transferase involved in anthocyanin modification that converts cyanidin 3-O-glucoside to cyanidin 3-O-xylosyl(1->2)glucoside. Its preferred sugar donor is UDP-xylose. |
| AT3G54990 | Encodes a AP2 domain transcription factor that can repress flowering. SMZ and its paralogous gene, SNARCHZAPFEN (SNZ), share a signature with partial complementarity to the miR172 microRNA, whose precursor is induced upon flowering. |
| AT2G39250 | Encodes a AP2 domain transcription factor that can repress flowering. SNZ and its paralogous gene, SCHLAFMUTZE (SMZ), share a signature with partial complementarity to the miR172 microRNA, whose precursor is induced upon flowering. |
| AT4G34710 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1. |
| AT2G18969 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
| AT3G29370 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
| AT4G34590 | Encodes a basic domain leucine zipper (bZip) transcription factor bZIP11. |
| AT5G41315 | Encodes a basic helix loop helix domain protein that interacts with GL1 in trichome development.GL3 interacts with JAZ and DELLA proteins to regulate trichome initiation. |
| AT5G08130 | Encodes a basic helix-loop-helix (bHLH) family protein BIM1 (BES1-INTERACTING MYC-LIKE 1), involved in brassinosteroid signaling. |
| AT1G26945 | Encodes a basic helix-loop-helix (bHLH) protein involved in blue/far-red light signaling. Physically interacts with HFR1 and negatively regulates its activity. |
| AT3G06120 | Encodes a basic helix-loop-helix (bHLH) protein that controls meristemoid differentiation during stomatal development. |
| AT2G24260 | Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair and sperm cell development. |
| AT4G30980 | Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair and sperm cell development. |
| AT3G24140 | Encodes a basic helix-loop-helix transcription factor whose activity is required to promote differentiation of stomatal guard cells and to halt proliferative divisions in their immediate precursors |
| AT1G75540 | Encodes a B-box zinc finger transcription factor BBX21 (also named STH2/salt tolerance homolog2 and LHUS/long hypocotyl under shade). Interacts with COP1 to control de-etiolation. Also genetically interacts with COP1 to regulate shade avoidance. |
| AT3G58170 | Encodes a Bet1/Sft1-like SNARE protein which fully suppresses the temperature-sensitive growth defect in sft1-1 yeast cells; however, it cannot support the deletion of the yeast BET1 gene. |
| AT5G64570 | Encodes a beta-d-xylosidase that belongs to family 3 of glycoside hydrolases. |
| AT5G22740 | Encodes a beta-mannan synthase based on in vitro enzyme assays from heterologously expressed protein. CSLA2 synthesizes the backbone of galactoglucomannan in seed coat epidermal cells. Both CSLA2 and MUCI10, which may be part of a protein complex, are critical for mucilage architecture. |
| AT2G29550 | Encodes a beta-tubulin that is expressed in leaves, roots and flowers. |
| AT2G31220 | Encodes a bHLH transcription factor that together with bHLH089 and bHLH091 is important for the normal transcriptome of the developing Arabidopsis anther, possibly by forming a feed-forward loop with DYT1. |
| AT5G49360 | Encodes a bifunctional {beta}-D-xylosidase/{alpha}-L-arabinofuranosidase required for pectic arabinan modification. ] |
| AT1G68560 | Encodes a bifunctional alpha-l-arabinofuranosidase/beta-d-xylosidase that belongs to family 3 of glycoside hydrolases. |
| AT4G19710 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. |
| AT3G06350 | Encodes a bi-functional dehydroquinate-shikimate dehydrogenase enzyme that catalyzes two steps in the chorismate biosynthesis pathway. |
| AT5G63980 | Encodes a bifunctional protein that has 3'(2'),5'-bisphosphate nucleotidase and inositol polyphosphate 1-phosphatase activities and rescues sulfur assimilation mutants in yeast. |
| AT2G46270 | encodes a bZIP G-box binding protein whose expression is induced by ABA. It has been shown to bind to Adh that contains the G-box and is induced by cold and water deprivation. |
| AT2G18160 | Encodes a b-ZIP transcription factor. |
| AT5G48890 | Encodes a C(2) H(2) -type zinc-finger transcriptional regulator and is expressed in the leaf vasculature and the vegetative shoot apical meristem and controls the transition to flowering. |
| AT5G04340 | Encodes a C2H2 zinc finger transcription factor that coordinately activates phytochelatin-synthesis related gene expression and directly targets GSH1 by binding to its promoter to positively regulate Cd accumulation and tolerance. |
| AT1G35670 | Encodes a Ca(2+)-dependent, calmodulin-independent protein kinase that is rapidly induced by drought and high-salt stress but not by low-temperature stress or heat stress. Positive regulator of ABA signaling. Phosphorylates ABA responsive transcription factors ABF1 and ABF4. |
| AT2G33380 | Encodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to desiccation. |
| AT4G35580 | Encodes a calmodulin-binding NAC protein (CBNAC). Contains calmodulin-binding domain in the C-terminus of the protein. Functions as a calmodulin-regulated transcriptional repressor. |
| AT1G66400 | Encodes a calmodulin-like protein. Regulates nitric oxide levels and transition to flowering. |
| AT4G34230 | Encodes a catalytically active cinnamyl alcohol dehydrogenase which uses p-coumaryl aldehyde as a preferred substrate. It can also use sinapyl, caffeyl, coniferyl and d-hydroxyconiferyl aldehydes as substrates. |
| AT2G41480 | Encodes a cationic cell-wall-bound peroxidase homolog that is involved in the lignification of cell walls. Regulated by COG1, involved in seed longevity. |
| AT1G01140 | Encodes a CBL-interacting protein kinase with similarity to SOS2 |
| AT3G17510 | Encodes a CBL-interacting protein kinase. Specifically interacts with ECT1 and ECT2. |
| AT5G01820 | Encodes a CBL-interacting serine/threonine protein kinase. |
| AT1G62430 | Encodes a CDP-diacylglycerol synthase, involved in phospholipid biosynthesis. |
| AT5G09870 | Encodes a cellulose synthase CESA5 that produces seed mucilage cellulose.Mutants are defective in seed coat mucilage.Involved in the regulation of mucilage composition and/or mucilage synthesis. |
| AT4G32410 | Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. |
| AT5G64740 | Encodes a cellulose synthase isomer. CESA6 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA6, along with CESA1 and CESA3 are present in the same plasma membrane complex for cellulose biosynthesis. CESA2 and CESA5 are related to CESA6, having partially redundant roles. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. |
| AT3G03050 | encodes a cellulose synthase like protein. mutations initiate root hairs that rupture at their tip soon after initiation. is required for the synthesis of a noncellulosic wall polysaccharide. |
| AT5G51290 | Encodes a ceramide kinase that plays a role in modulating cell death. |
| AT3G45710 | Encodes a chloride permeable transporter. Modulates chloride efflux from roots. |
| AT1G79600 | Encodes a chloroplast ABC1-like kinase that regulates vitamin E metabolism. |
| AT5G52520 | Encodes a chloroplast and mitochondria localized prolyl-tRNA synthetase. |
| AT4G00490 | Encodes a chloroplast beta-amylase. The enzyme activity is very weak compared to BAM1 and BAM3. It forms a tetramer whose activity requires K+ and exhibits sigmoidal kinetics Mutants of BAM2 have no visible phenotype. |
| AT3G49680 | Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. |
| AT1G32200 | Encodes a chloroplast glycerol-3-phosphate acyltransferase.Involved in the biosynthesis of chloroplast phosphatidylglycerol. |
| AT2G39000 | Encodes a chloroplast localized n-acetyltransfefase involved in N-terminal protein amino acid acetylation. |
| AT5G39790 | Encodes a chloroplast localized protein that is involved in protein translocation and starch metabolism. PTST helps localize GBSS to the starch granules where GBSS functions in amylose biosynthesis. |
| AT1G30520 | Encodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal. |
| AT3G52380 | Encodes a chloroplast RNA-binding protein that stabilizes chloroplast RNAs as evidenced by analyses of transcript accumulation in null mutants. Essential for seedling development (albino, strongly retarded growth even on sucrose-containing medium). |
| AT4G04330 | Encodes a chloroplast thylakoid localized RbcX protein that acts as a chaperone in the folding of Rubisco. |
| AT1G55920 | Encodes a chloroplast/cytosol localized serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. |
| AT1G77490 | Encodes a chloroplastic thylakoid ascorbate peroxidase tAPX. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
| AT1G54150 | Encodes a chloroplast-localized putative RING-type ubiquitin E3 ligase. |
| AT1G15950 | Encodes a cinnamoyl CoA reductase. Involved in lignin biosynthesis. |
| AT5G65310 | Encodes a class I HDZip (homeodomain-leucine zipper) protein that is a positive regulator of ABA-responsiveness, mediating the inhibitory effect of ABA on growth during seedling establishment. |
| AT5G58660 | Encodes a class III gibberellin 2-oxidase that oxidizes GA12 to GA110 and GA9 to GA40. |
| AT2G40060 | Encodes a clathrin that is localized to the cortical division zone and the cell plate and colocalizes with TPLATE during cell plate anchoring. |
| AT5G61670 | Encodes a close homolog of the Cauliflower OR (Orange) protein that is located in the chloroplast of light grown organs but in the nucleus of etiolated cotyledons. The function of OR is to induce the differentiation of proplastids or other noncolored plastids into chromoplasts for carotenoid accumulation. Both proteins contain a Cysteine-rich zinc finger domain that is highly specific to DnaJ-like molecular chaperons. The AtOR protein interacts directly with the PSY (phytoene synthase) protein and acts as a positive posttranscriptional regulator of its expression, thereby affecting carotenoid biosynthesis. |
| AT5G04120 | Encodes a cofactor-dependent phosphoglycerate mutase (dPGM) - like protein with phosphoserine phosphatase activity that may be responsible for serine anabolism. |
| AT1G16670 | Encodes a cold-activated plasma membrane protein cold-responsive protein kinase that phosphorylates 14-3-3 proteins. The phosphorylated 14-3-3 proteins shuttle from the cytosol to the nucleus, where they interact with and destabilize the key cold-responsive C-repeat-binding factor (CBF) proteins, modulate CBF stability and the response to cold stress. |
| AT1G05260 | Encodes a cold-inducible cationic peroxidase that is involved in the stress response. In response to low temperature, RCI3 transcripts accumulate in the aerial part and in roots of etiolated seedlings but only in roots of light-grown seedlings. |
| AT1G80420 | Encodes a component of plant break excision repair and functions at several stages during active DNA demethylation in Arabidopsis. |
| AT2G19790 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
| AT1G01120 | Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis. |
| AT5G07300 | Encodes a copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. |
| AT3G23490 | Encodes a cyanase that catalyzes the bicarbonate-dependent breakdown of cyanate to ammonia and bicarbonate. CYN forms a hexadecamer and is believed to be a cytosolic protein. Long-term exposure to NaCl increases CYN transcript levels. It is also expressed at higher levels in flowers relative to stems, roots, and seedlings. |
| AT4G34180 | Encodes a cyclase-family protein that is a negative regulator of cell death that regulates pathogen-induced symptom development. |
| AT2G23980 | Encodes a cyclic GMP-activated non-selective cation channel in the plasma membrane of guard cells. Required for constitutive growth of root hairs as Ca2+-permeable channels. |
| AT2G23430 | Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. |
| AT1G57750 | Encodes a CYP96A15, midchain alkane hydroxylase, involved in cuticular wax biosynthesis. |
| AT3G01120 | encodes a cystathionine gamma-synthase, which performs the first committed step in methionine biosynthesis. A conserved motif of 13 amino acids in the first exon is required for posttranscriptional autoregulation. This enzyme shares the same substrate as threonine synthase (TS) and its absence transcriptionally affects 8 genes in the genome. |
| AT3G61440 | Encodes a cysteine synthase isomer CysC1. The isomer is however less effective in cysteine biosynthesis. It is involved in beta-cyanoalanine biosynthesis, an intermediate of cyanide detoxification pathway. |
| AT2G19570 | Encodes a cytidine deaminase that deaminates cytidine and deoxycytidine and is competitively inhibited by cytosine-containing compounds. |
| AT3G13730 | Encodes a cytochrome P-450 gene that is involved in brassinosteroid biosynthesis, most likely in the conversion step of teasterone (TE) to 3-dehydroteasterone (3DT), and/or 6-deoxoteasterone (6-deoxoTE) to 6-deoxo-3-dehydroteasterone (6-deoxo3DT); or the conversion of cathasterone (CT) to TE, and/or 6-deoxocathasterone (6-deoxoCT) to 6-deoxoTE. Recently, CYP90D1 was shown to catalyse the C-23 hydroxylation of several brassinosteroids (the enzyme has a broad specificity for 22-hydroxylated substrates). Member of the CYP90C CYP450 family. Similar to Cytochrome P450 90C1 (ROT3). |
| AT4G36380 | Encodes a cytochrome P-450 gene that is involved in leaf blade expansion by controlling polar cell expansion in the leaf length direction. |
| AT2G22330 | Encodes a cytochrome P450. Involved in tryptophan metabolism. Converts Trp to indole-3-acetaldoxime (IAOx), a precursor to IAA and indole glucosinolates. |
| AT4G35890 | Encodes a cytoplasmic LAM domain containing protein that is involved in leaf senescence. |
| AT2G36310 | Encodes a cytoplasmic nucleoside hydrolase. It has the highest levels of activity with uridine followed by xanthosine. |
| AT2G35930 | Encodes a cytoplasmically localized U-box domain containing E3 ubiquitin ligase that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT3G52450 | Encodes a cytoplasmically localized U-box domain E3 ubiquitin ligase protein that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT5G24420 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
| AT1G07890 | Encodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT3G11040 | Encodes a cytosolic beta-endo-N-acetyglucosaminidase (ENGase). ENGases N-glycans cleave the O-glycosidic linkage between the two GlcNAc residues of the N-glycan core structure and thus generate a protein with a single GlcNAc attached to asparagine. |
| AT3G17820 | encodes a cytosolic glutamine synthetase, the enzyme has low affinity with substrate ammonium |
| AT1G05620 | Encodes a cytosolic inosine nucleoside hydrolase. It forms a heterocomplex with NSH1 with almost two orders of magnitude higher catalytic efficiency for xanthosine hydrolysis than observed for NSH1 alone. Transcript levels for this gene are elevated in older leaves suggesting that it may play a role in purine catabolism during senescence. |
| AT3G62120 | Encodes a cytosolic prolyl-tRNA synthetase. |
| AT5G56760 | Encodes a cytosolic serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. |
| AT5G42980 | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. |
| AT1G45145 | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. |
| AT5G53970 | Encodes a cytosolic tyrosine aminotransferase which is strongly induced upon aging and coronatine treatment. |
| AT3G09970 | Encodes a cytosolic tyrosine phosphatase. |
| AT5G05598 | Encodes a Defensin-like (DEFL) family protein |
| AT3G06995 | Encodes a Defensin-like (DEFL) family protein [pseudogene] |
| AT4G22235 | Encodes a defensin-like (DEFL) family protein. |
| AT1G56233 | Encodes a defensin-like (DEFL) family protein. |
| AT1G76954 | Encodes a defensin-like (DEFL) family protein. |
| AT4G22212 | Encodes a defensin-like (DEFL) family protein. |
| AT2G43550 | Encodes a defensin-like (DEFL) family protein. |
| AT4G22230 | Encodes a defensin-like (DEFL) family protein. |
| AT2G43535 | Encodes a defensin-like (DEFL) family protein. |
| AT3G50925 | Encodes a defensin-like (DEFL) family protein. |
| AT2G22345 | Encodes a defensin-like (DEFL) family protein. |
| AT2G43530 | Encodes a defensin-like (DEFL) family protein. |
| AT1G76180 | Encodes a dehydrin protein whose expression is induced early on in response to dehydration stress. |
| AT5G17490 | Encodes a DELLA subfamily member that acts as a negative regulator of GA signaling and as a coactivator of ABI3 to promote seed storage protein biosynthesis during the seed maturation stage. |
| AT2G39800 | encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. |
| AT1G74100 | encodes a desulfoglucosinolate sulfotransferase, involved in the final step of glucosinolate core structure biosynthesis. |
| AT1G74090 | encodes a desulfoglucosinolate sulfotransferase, involved in the final step of glucosinolate core structure biosynthesis. |
| AT1G18590 | encodes a desulfoglucosinolate sulfotransferase, involved in the final step of glucosinolate core structure biosynthesis. |
| AT5G46050 | Encodes a di- and tri-peptide transporter involved in responses to wounding, virulent bacterial pathogens, and high NaCl concentrations. |
| AT4G30340 | encodes a diacylglycerol kinase. Applying a specific diacylglycerol kinase inhibitor to the growth media resulted in reduced root elongation and plant growth. Gene is expressed throughout the plant but is strongest in flowers and young seedlings. |
| AT3G05700 | Encodes a DNA binding protein with transcription activation activity. It is expressed in response to osmotic, drought and ABA stress. |
| AT5G04560 | Encodes a DNA glycosylase DEMETER (DME). Responsible for endosperm maternal-allele-specific hypomethylation at the MEDEA (MEA) gene. DME can excise 5-methylcytosine in vitro and when expressed in E. coli. DME establishes MEA imprinting by removing 5-methylcytosine to activate the maternal allele. |
| AT1G24120 | encodes a DnaJ-like protein similar to ARG1 and ARL2 that are both involved in root and hypocotyl gravitropism response. However, null mutation in this gene does not result in defects in gravitropism. Gene is expressed in all tissues examined. |
| AT5G60200 | Encodes a Dof-type transcription factor. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. |
| AT1G79690 | Encodes a dual activity enzyme which catalyses the hydrolysis of a peptide bond and of a phosphate bond, acting both as a dipeptidyl peptidase III and an atypical Nudix hydrolase. |
| AT3G03272 | Encodes a ECA1 gametogenesis related family protein |
| AT3G44860 | Encodes a farnesoic acid carboxyl-O-methyltransferase. |
| AT3G25110 | Encodes a FatA acyl-ACP thioesterase |
| AT3G23410 | Encodes a fatty alcohol oxidase. |
| AT5G45360 | Encodes a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins. |
| AT4G25630 | encodes a fibrillarin, a key nucleolar protein in eukaryotes which associates with box C/D small nucleolar RNAs (snoRNAs) directing 2'-O-ribose methylation of the rRNA. |
| AT1G06000 | encodes a flavonol-7-O-rhamnosyltransferase involved in the formation of rhamnosylated flavonols |
| AT4G36920 | Encodes a floral homeotic gene, a member of the AP2/EREBP (ethylene responsive element binding protein) class of transcription factors and is involved in the specification of floral organ identity, establishment of floral meristem identity, suppression of floral meristem indeterminancy, and development of the ovule and seed coat. |
| AT5G50950 | Encodes a fumarase enzyme initially shown to be in the mitochondria through proteomic studies but later shown to be present in the cytosol using an RFP fluorescent protein tag. |
| AT1G64660 | Encodes a functional methionine gamma-lyase, a cytosolic enzyme catalyzes the degradation of methionine into methanethiol, alpha-ketobutyrate and ammonia. The catabolism of excess methionine is important to methionine homeostasis. |
| AT5G15070 | Encodes a functional VIP1/PPIP5K-type ATP-grasp kinase that is involved in both InsP6 to InsP7 conversion and InsP7 to InsP8 conversion. |
| AT3G26430 | Encodes a functioning member of the GDS(L) lipase family with preference for long chain substrates that does not hydrolyze choline esters. |
| AT4G30530 | Encodes a gamma-glutamyl peptidase, outside the GGT family, that can hydrolyze gamma-glutamyl peptide bonds. |
| AT1G13980 | Encodes a GDP/GTP exchange factor for small G-proteins of the ADP ribosylation factor (RAF) class, and as regulator of intracellular trafficking. |
| AT5G55120 | Encodes a GDP-L-galactose phosphorylase, with similar biochemical properties as VTC2. |
| AT2G39770 | Encodes a GDP-mannose pyrophosphorylase/ mannose-1-pyrophosphatase. |
| AT4G04970 | encodes a gene similar to callose synthase |
| AT5G16190 | encodes a gene similar to cellulose synthase |
| AT3G56000 | encodes a gene similar to cellulose synthase |
| AT1G23480 | encodes a gene similar to cellulose synthase |
| AT3G28180 | encodes a gene similar to cellulose synthase |
| AT5G16910 | encodes a gene similar to cellulose synthase. Located in Golgi membranes. |
| AT5G15970 | Encodes a gene that can be induced by cold and abscisic acid and may be involved in cold acclimation and salt tolerance. |
| AT1G61120 | Encodes a geranyllinalool synthase that produces a precursor to TMTT, a volatile plant defense C16-homoterpene. |
| AT3G63010 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). |
| AT5G07200 | encodes a gibberellin 20-oxidase. |
| AT1G44090 | Encodes a gibberellin 20-oxidase. |
| AT1G30040 | Encodes a gibberellin 2-oxidase that acts on C-19 gibberellins. AtGA2OX2 expression is responsive to cytokinin and KNOX activities. |
| AT3G24090 | Encodes a glutamine-fructose-6-phosphate transaminase that likely plays a role in UDP-N-acetylglucosamine biosynthesis. |
| AT1G78380 | Encodes a glutathione transferase that is a member of Tau GST gene family. |
| AT5G43940 | Encodes a glutathione-dependent formaldehyde dehydrogenase (also known as class III type alcohol dehydrogenase) reduces S-nitrosoglutathione (GSNO), the condensation product of glutathione and NO, that is a naturally occurring NO reservoir and also a reactive nitrogen intermediate. |
| AT4G38680 | Encodes a glycine-rich protein that binds nucleic acids and promotes DNA melting. I |
| AT4G13850 | Encodes a glycine-rich RNA-binding protein. Gene expression is induced by cold. |
| AT4G18360 | Encodes a glycolate oxidase that modulates reactive oxygen species-mediated signal transduction during nonhost resistance. |
| AT2G44490 | Encodes a glycosyl hydrolase that localizes to peroxisomes and acts as a component of an inducible preinvasion resistance mechanism. Required for mlo resistance. |
| AT3G21720 | Encodes a glyoxylate cycle enzyme isocitrate lyase (ICL) involved in salt tolerance. |
| AT5G14950 | Encodes a golgi alpha-mannosidase, an enzyme responsible for the formation of major complex-type N-glycans. |
| AT5G62220 | Encodes a Golgi apparatus-localized galactosyltransferase involved in galactosyl-substitution of xyloglucan at position 2. |
| AT4G39390 | Encodes a golgi localized nucleotide sugar transporter. |
| AT2G39450 | Encodes a Golgi-localized manganese transporter that is involved in Mn tolerance. |
| AT4G20310 | Encodes a Golgi-localized protease that can cleave the transcription factors bZIP17 and bZIP28 that are translocated from the ER through the Golgi so that the transcription factors can be released to translocate into the nucleus. |
| AT4G31600 | Encodes a Golgi-localized UDP?glucose/UDP?galactose transporter that affects lateral root emergence. |
| AT1G64990 | Encodes a GPCR-type G protein receptor with nine predicted transmembrane domains. The protein binds abscisic acid (ABA) and is predicted to function as an ABA receptor. It has GTP-binding and GTPase activity and binds to ABA more effectively in the presence of GDP. GTG1 binds to GPA1, the alpha subunit of the heterotrimeric G protein. GPA1 (in its GTP-bound state) affects the GTP binding and GTPase activity of GTG1 and may act to down-regulate GTG1 binding to ABA. GTG1 is widely expressed throughout the plant and appears to be involved in the regulation of several ABA-dependent responses including seed germination, plant development, and promotion of stomatal closure. GTG1 transcript levels do not appear to change in response to ABA or abiotic stresses. |
| AT3G62420 | Encodes a group-S bZIP transcription factor. Forms heterodimers with group-C bZIP transcription factors. The heterodimers bind to the ACTCAT cis-element of proline dehydrogenase gene. |
| AT5G10572 | Encodes a H/ACA-box snoRNA (snoR77). Gb: AL353995 |
| AT1G11260 | Encodes a H+/hexose cotransporter. |
| AT4G29130 | Encodes a hexokinase (HXK1) in the plant glucose-signaling network. Functions as a glucose sensor to interrelate nutrient, light, and hormone signaling networks for controlling growth and development in response to the changing environment. |
| AT1G04120 | encodes a high-affinity inositol hexakisphosphate transporter that plays a role in guard cell signaling and phytate storage. It is a member of MRP subfamily / ABC transporter subfamily C. |
| AT3G47960 | Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds. |
| AT5G62680 | Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds. |
| AT5G54110 | Encodes a highly polar protein with more than 60% hydrophilic amino acid residues that is associated with the plasma membrane. It has limited secondary structure similarity to VAP-33 from Aplysia, which may be involved in membrane trafficking. |
| AT5G13960 | Encodes a histone 3 lysine 9 specific methyltransferase involved in the maintenance of DNA methylation. SUVH4/KYP is a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. In kyp mutants, there is a loss of CpNpG methylation. The protein was shown to bind to methylated cytosines of CG, CNG and CNN motifs via its SRA domain but has a preference for the latter two. There is also evidence that KYP/SUVH4 might be involved in the telomerase-independent process known as Alternative Lengthening of Telomeres. |
| AT2G32370 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. Together with ATML1 and PDF2, it is involved in cotyledon development. |
| AT1G05230 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. Mutants have trichomes that appear glass-like under a dissecting microscope as compared to the wild-type trichomes. The mutations do not affect trichome growth or branch number. |
| AT2G22430 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein that is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis. |
| AT4G40060 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT5G53980 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT3G01220 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Expressed during seed germination in the micropylar endosperm and in the root cap, and increases ABA sensitivity and seed dormancy when mutated. |
| AT3G61890 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Loss of function mutant has abnormally shaped leaves and stems. |
| AT1G26960 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Participates in the gene regulatory network controlling root branching by mediating the regulation of LAX3 by ARF7/19. |
| AT2G44910 | Encodes a homeodomain protein whose expression displays a dependence on phyB for both red and far-red light response. Also involved in the shade avoidance syndrome. |
| AT5G66700 | Encodes a homeodomain protein. Member of HD-ZIP 1 family, most closely related to HB5. AtHB53 is auxin-inducible and its induction is inhibited by cytokinin, especially in roots therefore may be involved in root development. |
| AT5G11270 | Encodes a homeodomain transcription factor involved in mediating resistance to infection by necrotrophic pathogens dependent on perception of jasmonic acid through COI1. Expressed in the nucleus. Downregulated upon fungal infection. Also involved in drought tolerance. |
| AT1G62990 | Encodes a homeodomain transcription factor of the Knotted family. May be involved in secondary cell wall biosynthesis. Mutants have moderately irregular xylem development. Expression of this gene is upregulated by SND1 and MYB46. |
| AT4G16780 | Encodes a homeodomain-leucine zipper protein that is rapidly and strongly induced by changes in the ratio of red to far-red light. It is also involved in cell expansion and cell proliferation and in the response to auxin. |
| AT4G23690 | Encodes a homodimeric all-beta dirigent protein in the superfamily of calycins. Dirigent proteins impart stereoselectivity on the phenoxy radical coupling reaction yielding optically active lignans from two molecules of coniferyl alcohol. |
| AT3G13682 | Encodes a homolog of human Lysine-Specific Demethylase1. Involved in H3K4 methylation of target genes including the flowering loci FLC and FWA. |
| AT3G05210 | encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10. |
| AT2G46750 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
| AT5G55920 | Encodes a homolog of the S. cerevisiae Nop2 that is involved in ribosome biogenesis and plays a role on organ size control by promoting cell proliferation and preventing compensation in normal leaf development. |
| AT4G21790 | encodes a host factor that is required for TMV virus multiplication. |
| AT4G15440 | Encodes a hydroperoxide lyase. Also a member of the CYP74B cytochrome p450 family. In the ecotype Columbia (Col) the gene contains a 10-nucleotide deletion in its first exon that causes it to code for a truncated protein that results in a non-functional hydroperoxide lyase. |
| AT5G53340 | Encodes a hydroxyproline O-galactosyltransferase. |
| AT5G16760 | Encodes a inositol 1,3,4-trisphosphate 5/6-kinase. Catalyzes the phosphorylation of phytic acid (InsP6) to the symmetric InsP7 isomer 5-InsP7. |
| AT3G16470 | Encodes a JA-responsive gene that coordinates with GRP7 in shaping plant development through the regulation of RNA processing in Arabidopsis. AtJAC1 interacts with RNA binding protein GRP7 specifically in the cytoplasm to regulate its nucleocytoplasmic distribution. |
| AT4G00630 | Encodes a K(+)/H(+) antiporter that modulates monovalent cation and pH homeostasis in plant chloroplasts or plastids. |
| AT2G47160 | Encodes a key transporter under boron (B) limitation in the soil. Protein accumulates in shoots and roots under conditions of boron deficiency and is degraded within several hours of restoring boron supply. Localized to the plasma membrane under B limitation, and to the cytoplasm after B application before degradation. Protein is transferred via the endosomes to the vacuole for degradation. Localized to the inner plasma membrane domain in the columella, lateral root cap, epidermis, and endodermis in the root tip region, and in the epidermis and endodermis in the elongation zone. Under high-boron is transported to the vacuole for degradation. Thought to be a B transceptor, directly senses the B concentration and promotes its own polyubiquitination and vacuolar sorting for quick and precise maintenance of B homeostasis. |
| AT3G25882 | encodes a kinase that physically interacts with NPR1/NIM1 |
| AT1G18370 | Encodes a kinesin HINKEL. Required for cytokinesis in pollen. Mutant has cytokinesis defects; seedling lethal. |
| AT3G48050 | Encodes a large protein with N-terminal bromo-adjacent homology (BAH) and transcription elongation factor S-II (TFS2N) domains and two C-terminal GW (glycine and tryptophan) repeats. It is nuclear and colocalizes with the processing-body component DCP1 in the cytoplasm. SOU is a component of the miRNA pathway and is involved in translational repression. |
| AT5G60300 | Encodes a legume-type lectin receptor kinase that is structurally distinct from the mammalian extracellular ATP receptors and acts as an extracellular ATP receptor in Arabidopsis. Extracellular ATP acts as a damage-associated molecular pattern in plants, and its signaling through P2K1 is important for mounting an effective defense response against various pathogenic microorganisms. It also plays a role in cell wall-plasma membrane adhesion. |
| AT1G72300 | Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of PSY1. PSY1 is an 18-aa tyrosine-sulfated glycopeptide encoded by AT5G58650 that promotes cellular proliferation and expansion. |
| AT1G73080 | Encodes a leucine-rich repeat receptor kinase. Functions as a receptor for AtPep1 to amplify innate immunity response to pathogen attacks. |
| AT5G47110 | Encodes a light-harvesting-like protein that is involved in chlorophyll and tocopherol biosynthesis anchoring geranylgeranyl reductase in the thylakoid membrane. |
| AT2G30550 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT1G06800 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT5G67420 | Encodes a LOB-domain protein involved in nitrogen metabolism and affecting leaf morphogenesis. |
| AT1G69870 | Encodes a low affinity nitrate transporter NRT1.7. Expressed in phloem. Responsible for source-to-sink remobilization of nitrate. |
| AT3G16180 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
| AT1G52190 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
| AT1G78690 | Encodes a lysoglycerophospholipid O-acyltransferase that acylates 1-acyl lyso PE and 1-acyl lyso PG but not PE or PG. |
| AT4G30160 | Encodes a major actin filament bundling protein that is involved in root hair growth through regulating actin organization in a Ca2+-dependent manner. |
| AT4G00650 | Encodes a major determinant of natural variation in Arabidopsis flowering time. Dominant alleles of FRI confer a vernalization requirement causing plants to overwinter vegetatively. Many early flowering accessions carry loss-of-function fri alleles .Twenty distinct haplotypes that contain non-functional FRI alleles have been identified and the distribution analyzed in over 190 accessions. The common lab strains- Col and Ler each carry loss of function mutations in FRI. |
| AT3G29670 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. |
| AT5G64860 | Encodes a maltotriose-metabolizing enzyme with chloroplastic α-1,4-glucanotransferase activity. Mutant has altered starch degradation. |
| AT4G16760 | Encodes a medium to long-chain acyl-CoA oxidase. Catalyzes the first step of fatty acid beta-oxidation. Involved in jasmonate biosynthesis. Gene expression is induced by wounding, drought stress, abscisic acid, and jasmonate. |
| AT1G14750 | Encodes a meiotic cyclin-like protein, distinct from all other known Arabidopsis cyclins. It is not required for meiotic DSB formation but is necessary for meiotic DSB repair via the homologous chromosome. |
| AT1G69890 | Encodes a member of a conserved DUF domain family that is induced by NO. Based on mutant phenotype may be involved in NO stress response. |
| AT2G22660 | Encodes a member of a family of DUF1399 domain containing proteins. GRDP1 is involved in germination and response to ABA. Loss of function mutants have reduced germination in the presence of osmotic stressors. |
| AT1G15670 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB1, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. |
| AT3G59940 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB50, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. |
| AT2G44130 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family. Component of SCF ubiquitin protein ligase, interacts with phenylalanine ammonia-lyase. AtKFB39 is a homolog of previously identified AtKFB50 (At3g59940) and specifically interacts with Arabidopsis PAL3 and PAL4 in vitro. In planta, together with AtKFB01, KFB20 and KFB50, it regulates PAL protein stability thus controlling phenylpropanoid biosynthesis . |
| AT3G23727 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT1G14182 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT4G30074 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G29273 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G28405 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G45350 | Encodes a member of a PCMP (plant combinatorial and modular protein) family (PCMP-E subfamily) with 11 pentatricopeptide (PPR) repeats. The protein is involved in RNA editing of the initiation codon of ndhD in the chloroplast. |
| AT1G13740 | Encodes a member of a small plant-specific gene family whose members interact with ABI5 and appear to be involved in mediating stress responses. AFP2 mutants affect a number of ABA mediated processes such as germination and response to osmotic and sugar stress. AFP2 nuclear localization is stress dependent. |
| AT4G30350 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. Regulates root and root hair development downstream of KAI2-mediated signaling. |
| AT5G59040 | encodes a member of copper transporter family and functionally complements a high affinity copper transporter mutant in yeast |
| AT5G02500 | Encodes a member of heat shock protein 70 family. Hsc70-1 negatively regulates the expression of Hsp101 through HsfA1d, HsfA1e and HsfA2. During non-HS condition, Hsc70-1 attenuates the activity of HsfAs and finally affects the expression of HsfA2 and Hsp101 genes. hsc70-1 mutant showed thermotolerance phenotype due to higher expression of Hsp101 and other HS inducible genes. |
| AT1G31650 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT3G50310 | Encodes a member of MEKK subfamily. Target promoter of the male germline-specific transcription factor DUO1. Involved in osmotic stress response via regulation of MPK6 activity. It also plays an important role in regulating cell division and cell elongation in the primary root meristematic and elongation areas. Mutants show defects in root microtubule organization.It phosphorylates MPK18 and MKK3.It is a positive regulator of ABA-induced stomatal closure that acts by phosphorylating MKK5. |
| AT2G16720 | Encodes a member of MYB3R- and R2R3- type MYB- encoding gene family that acts as a repressor of flavonol biosynthesis. AtMYB7 gene expression is induced by salt treatment. |
| AT5G63650 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. |
| AT5G66880 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. |
| AT3G09830 | Encodes a member of subfamily VIIa of the receptor-like cytoplasmic kinases (RLCKs). It contributes to pattern-triggered immunity in response to P. syringae. |
| AT3G05710 | Encodes a member of SYP4 Gene Family that is a plant ortholog of the Tlg2/syntaxin16 Qa-SNARE. Together with SYP42, it regulates the secretory and vacuolar transport pathways in the post-Golgi network and maintains the morphology of the Golgi apparatus and TGN and is required for extracellular resistance responses to a fungal pathogen. |
| AT5G42650 | Encodes a member of the cytochrome p450 CYP74 gene family that functions as an allene oxide synthase. This enzyme catalyzes dehydration of the hydroperoxide to an unstable allene oxide in the JA biosynthetic pathway. It shows a dual catalytic activity, the major one being a 13-AOS but also expressing a 9-AOS activity. CFA-Leu, CFA-Val, CFA-Met and CFA-Ala can induce the expression of AOS. |
| AT4G33300 | Encodes a member of the ADR1 family nucleotide-binding leucine-rich repeat (NB-LRR) immune receptors. |
| AT5G05610 | Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7). |
| AT1G35720 | Encodes a member of the annexin gene family, a diverse, multigene family of calcium-dependent, membrane-binding proteins. The protein was determined to have peroxidase activity. This activity is thought to be dependent on the presence of post-translational modifications (most likely phosphorylation). The protein was shown to be present as a mixture of monomer and homodimer. The homodimerization seems to be dependent on the presence of Ca2+ or H2O2. The dimerization was prevented by the addition of DTT, β-mercaptoethanol and TCEP. Annat1 mRNA is expressed in flowers, roots,leaves and stems and is most abundant in stems. mRNA levels are increased in response to oxidative stress. Developmental expression patterns suggest a role in Golgi-mediated polysaccharide secretion. It is a Ca 2+-permeable transporter providing a molecular link between reactive oxygen species and cytosolic Ca 2+ in plants. |
| AT1G35750 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G06210 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT4G32760 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT3G28860 | Encodes a member of the ATP-binding cassette (ABC) transporter family that is involved in auxin transport and is involved in postembryonic organ separation. Also known as AtMDR11 and PGP19. Possibly regulates auxin-dependent responses by influencing basipetal auxin transport in the root. Acts upstream of phyA in regulating hypocotyl elongation and gravitropic response. Exerts nonredundant, partially overlapping functions with the ABC transporter encoded by AtPGP1. |
| AT3G62100 | Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA30 lacks the conserved degron (domain II) found in many family members. IAA30 transcripts are induced by auxin treatment and accumulate preferentially in the quiescent center cells of the root meristem. Overexpression of IAA30 leads to defects in gravitropism, root development, root meristem maintenance, and cotyledon vascular development. Target of LEC2 and AGL15. Promotes somatyic embryogenesis. |
| AT1G30330 | Encodes a member of the auxin response factor family. Mediates auxin response via expression of auxin regulated genes. Acts redundantly with ARF8 to control stamen elongation and flower maturation. Expression of ARF6 is controlled by miR167. |
| AT5G67160 | Encodes a member of the BAHD acyltransferase superfamily. Mutants have enhanced susceptibility to virulent and avirulent pathogens and are defective in pathogen induced SA biosynthesis. EPS1 may act upstream of SA biosynthesis as application of SA can rescue the mutant phenotype. |
| AT1G19700 | Encodes a member of the BEL family of homeodomain proteins. Its interaction with PLP (PAS/LOV PROTEIN) is diminished by blue light. |
| AT4G36870 | Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw1/saw2 may act redundantly to repress BP in leaves. Regulates together with BLH4 demethylesterification of homogalacturonan in seed mucilage. |
| AT2G35940 | Encodes a member of the BEL-like homeodomain protein family. Ecotopic expression in the embryo sac leads to defects in nuclear migration and cellularization and embryo sacs with multiple egg cells. Loss of function alleles have no female gametophyte defects. The ecotopic expression phenotype requires KNAT3 because it can be suppressed by loss of KNAT3 function alleles. Localized to the nucleus but interaction with OFP1 relocates it to the cytoplasm. |
| AT3G58120 | Encodes a member of the BZIP family of transcription factors. Forms heterodimers with the related protein AtbZIP34. Binds to G-boxes in vitro and is localized to the nucleus in onion epidermal cells. |
| AT5G04770 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. Expressed in sink tissues. Induced during infestation of roots by the plant parasitic root-knot nematode, Meloidogyne incognita. Localized in the plasma membrane. |
| AT1G17120 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. |
| AT1G54160 | Encodes a member of the CCAAT-binding transcription factor (CBF-B/NF-YA) family. Expression is upregulated in response to ABA and drought. This regulation appears to be mediated by MIR169A which is downregulated in response to drought. NFYA5 is a target of MIR169A. Loss of function mutations are hypersensitive to drought. |
| AT4G37010 | Encodes a member of the Centrin family. Mutants are hypersensitive to UV and prone to UV induced DNA damage. Based on sequence similarity and mutant phenotype CEN2 is thought to be involved in nucelotide excision repair/DNA repair. |
| AT1G19100 | Encodes a member of the conserved Microrchidia (MORC) adenosine triphosphatase (ATPase) family, predicted to catalyze alterations in chromosome superstructure. Required for heterochromatin condensation and gene silencing. |
| AT5G48000 | Encodes a member of the CYP708A family of cytochrome P450 enzymes. THAH appears to add a hydroxyl group to the triterpene thalianol. thah1 mutants have an elevated accumulation of thalianol. thah1-1 mutants have longer roots than wild type plants. Thalian-diol and desaturated thalian-diol are lost from the root extracts of thah1-1 mutants. Overexpression of the sequence from At5g48000.1 rescues the thah1-1 mutant phenotype (Field 2008); it is unknown whether the shorter sequences associated with other gene models would provide functional complementation. |
| AT1G63710 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at highest level in mature stems and flowers. |
| AT3G28740 | Encodes a member of the cytochrome p450 family. Expression is upregulated in response to cis-jasmonate treatment. Overexpression induces synthesis of volatile compounds that affect chemical ecology and insect interactions. |
| AT1G19570 | Encodes a member of the dehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica.Encodes about 50-60% of extractable leaf GSH-dependent DHAR activity, but single knockout mutants show unaltered ascorbate and glutathione status in optimal and oxidative stress conditions (PMID:28381499). Acts redundantly with DHAR2 to oxidize glutathione in response to increased intracelullar hydrogen peroxide (catalase deficiency) . Complementation of a cat2 dhar1 dhar2 dhar3 quadruple mutant with DHAR1 fully restores cat2 phenotype and pathogenesis-related responses |
| AT1G12610 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (DDF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. Overexpression of this gene results in delayed flowering and dwarfism, reduction of gibberellic acid biosynthesis, and increased tolerance to high levels of salt. This gene is expressed in all tissues examined, but most abundantly expressed in upper stems. Overexpression of this gene is also correlated with increased expression of GA biosynthetic genes and RD29A (a cold and drought responsive gene). Under salt stress it induces the expression of GAOX7, which encodes ad C20-GA inhibitor. |
| AT1G63030 | encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (DDF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. Overexpression of this gene results in the reduction of gibberellic acid biosynthesis. This gene is expressed in all tissues examined, but most abundantly expressed in rosette leaves and stems. Overexpression of DDF1, a putative paralog of this gene, also reduces gibberellic acid biosynthesis and makes the plants more tolerant to high-salinity levels. |
| AT3G11020 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2B). The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A. |
| AT1G75490 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT5G25810 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family (TINY). The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Ectopic or overexpression of this gene in a Ds tagged line has reduced cell expansion. The expression of this gene is induced by ethylene and light and appears to stimulate cytokinin biosynthesis. |
| AT3G16280 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT1G33760 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT2G44940 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT1G71520 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. |
| AT1G77640 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. |
| AT3G50260 | Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. Involved in defense and freezing stress responses. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT1G19210 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT5G21960 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT1G74930 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT5G67190 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT1G22810 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. Overexpression leands to delayed senescence and delayed flowering. Negatively regulates plant resistance to P. parasitica by suppressing PAMP-triggered immunity. |
| AT1G78080 | Encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family (RAP2.4). The protein contains one AP2 domain. Role in mediating light and ethylene signaling. |
| AT1G64380 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. |
| AT2G22200 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. |
| AT1G03800 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-10). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT3G15210 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-4). The protein contains one AP2 domain. Acts as a negative regulator of JA-responsive defense gene expression and resistance to the necrotrophic fungal pathogen Fusarium oxysporum and antagonizes JA inhibition of root elongation. |
| AT1G53170 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT1G28360 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ERF12). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. Regulates floral development. |
| AT4G17500 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT5G47220 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-2). The protein contains one AP2 domain. Functions as activator of GCC box?dependent transcription. Positive regulator of JA-responsive defense genes and resistance to F. oxysporum and enhances JA inhibition of root elongation. |
| AT5G47230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-5). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT3G23240 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ERF1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. EREBP like protein that binds GCC box of ethylene regulated promoters such as basic chitinases. Constitutive expression of ERF1 phenocopies ethylene over production. Involved in ethylene signaling cascade,downstream of EIN2 and EIN3. |
| AT3G23220 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT1G04370 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT2G44840 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT5G43410 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Expression of ERF96 is induced by pathogens, JA and ethylene and over expression leads to increased resistance to resistance to necrotrophic pathogens. It is a nuclear localized, transcriptional activator that binds to GCC elements that is involved in positive regulation of ABA responses. |
| AT4G34410 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Regulates programmed cell death (PCD) inhibitor genes. Involved in retarding programmed cell death under salt stress due to the regulation of processes participating in ROS inhibition. ERF-regulated transcripts belong to the tryptophan biosynthesis, tryptophan metabolism, and downstream plant hormone signal transduction pathways, where ERF109 potentially acts as a 'master switch' mediator of a cascade of consecutive events across the three pathways, promoting plant growth and re-adjustment to homeostasis due the direct participation in auxin biosynthesis leading to the plants ability to tolerate salt stress. |
| AT1G43160 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family (RAP2.6). The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT5G61890 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT5G13330 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT5G07310 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Cytokinin production induced by jasmonate represses adventitious rooting. |
| AT4G11140 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT4G23750 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Monopteros target gene. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT5G67000 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. |
| AT1G68550 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT5G25190 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT1G15360 | Encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. This gene is involved in wax biosynthesis. Over-expression of the gene results in glossy leaf phenotype and increased drought tolerance. Two closely related genes, AT5G25390 and AT5G11190 have similar phenotypes when over-expressed. Strong expression levels in flowers. Binds to the promoter of LACS2. |
| AT4G02350 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
| AT3G24050 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT1G08010 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT5G25830 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT3G60530 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT4G32890 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT2G45050 | Encodes a member of the GATA factor family of zinc finger transcription factors. A positive regulator of photomorphogenesis. |
| AT5G24920 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
| AT5G41080 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
| AT3G02040 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. Has glycerophosphodiester phosphodiesterase activity. Functions in maintaining cellular phosphate homeostasis under phosphate starvation. |
| AT4G39410 | Encodes a member of the Group II-c WRKY Transcription Factor family that is involved in stem development and has been shown to directly bind to the promoter of NST2. WRKY13 binds to the promoter of DCD to upregulate its expression and hydrogen sulfide production to enhance plant cadmium tolerance. Mutants show a weak stem phenotype and show decreased expression of lignin-synthesis-related genes. |
| AT5G67230 | Encodes a member of the GT43 family glycosyltransferases involved in glucuronoxylan biosynthesis: AT2G37090 (IRX9) and AT1G27600 (IRX9-L or I9H, IRX9 homolog); AT4G36890 (IRX14) and AT5G67230 (IRX14-L or I14H, IRX14 homolog). They form two functionally non-redundant groups essential for the normal elongation of glucuronoxylan backbone. I9H functions redundantly with IRX9, I14H is redundant with IRX14. IRX9 or I9H do not complement IRX14, IRX14 or I14H do not complement IRX9. |
| AT1G32240 | Encodes a member of the KANADI family of putative transcription factors. Together with KAN1, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN1 and KAN4 appears to regulate the proper localization of PIN1 in early embryogenesis. |
| AT5G26230 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT1G64080 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT5G52870 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT1G53570 | Encodes a member of the MEKK subfamily that functions redundantly with MAPKKK3 to activate MPK3/6 downstream of multiple pattern recognition receptors and confer resistance to both bacterial and fungal pathogens. |
| AT3G09940 | Encodes a member of the monodehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica. |
| AT1G66370 | Encodes a member of the MYB family of transcription factors. Involved in regulation of anthocyanin biosynthesis. Affects the expression of enzymes involved in later steps of anthocyanin biosynthesis. |
| AT5G63790 | Encodes a member of the NAC family of transcription factors. ANAC102 appears to have a role in mediating response to low oxygen stress (hypoxia) in germinating seedlings. Its expression can be induced by beta-cyclocitral, an oxidized by-product of beta-carotene generated in the chloroplasts, mediates a protective retrograde response that lowers the levels of toxic peroxides and carbonyls, limiting damage to intracellular components. |
| AT3G45660 | Encodes a member of the NAXT NPF subfamily. |
| AT3G45690 | Encodes a member of the NAXT NPF subfamily. |
| AT1G58210 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It colocalizes with filamentous actin and is localized to the plasma membrane. |
| AT5G58320 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It colocalizes with filamentous actin and is localized to the tonoplast membrane. It is expressed in the epidermis of the root meristem and the early expansion zone. |
| AT5G59220 | Encodes a member of the PP2C family (Clade A protein phosphatases type 2C). Functions as a negative regulator of osmotic stress and ABA signaling. |
| AT1G26150 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G52290 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G68690 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT3G24550 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT5G46790 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. Negative regulation of ABA response as a result of phosphorylation of S136 and S182 sites by AEL1/3/4. |
| AT2G38310 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT4G01026 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of ABI1 and ABI2. |
| AT4G17870 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT5G05440 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT3G50060 | Encodes a member of the R2R3 transcription factor gene family. Expressed in response to potassium deprivation and auxin. Involved in lateral root development. Interacts with ARF7 and regulates the expression of some auxin responsive genes. |
| AT3G27810 | Encodes a member of the R2R3-MYB transcription factor gene family. Induced by jasmonate. Involved in jasmonate response during stamen development. MYB21 interacts with JAZ proteins, and functions redundantly with MYB24 and MYB57 to regulate stamen development. Promotes flavonol biosynthesis through regulation of FLS1 gene expression. |
| AT1G25560 | Encodes a member of the RAV transcription factor family that contains AP2 and B3 binding domains. Involved in the regulation of flowering under long days. Loss of function results in early flowering. Overexpression causes late flowering and repression of expression of FT. Novel transcriptional regulator involved in ethylene signaling. Promoter bound by EIN3. EDF1 in turn, binds to promoter elements in ethylene responsive genes. |
| AT1G51760 | encodes a member of the six Arabidopsis IAA-amino acid conjugate hydrolase subfamily and conjugates and conjugates IAA-Ala in vitro. Gene is expressed most strongly in roots, stems, and flowers. |
| AT1G51780 | encodes a member of the six Arabidopsis IAA-amino acid conjugate hydrolase subfamily and conjugates and is very similar to IAR3. |
| AT4G12110 | Encodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha-methyl oxidase. Works together with SMO1-2 to maintain correct sterol composition and balance auxin and cytokinin activities during embryogenesis. |
| AT1G29230 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.20), which has also been reported as a member of the CBL-interacting protein kinases (CIPK18). |
| AT2G46340 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA1 is a PHYA signaling intermediate, putative regulator of PHYA signaling pathway. Light responsive repressor of photomorphogenesis. Involved in regulating circadian rhythms and flowering time in plants. Under constant light, the abundance of SPA1 protein exhibited circadian regulation, whereas under constant darkness, SPA1 protein levels remained unchanged. In addition, the spa1-3 mutation slightly shortened circadian period of CCA1, TOC1/PRR1 and SPA1 transcript accumulation under constant light. |
| AT4G11110 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA2 primarily regulates seedling development in darkness and has little function in light-grown seedlings or adult plants. |
| AT1G53090 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA4 (and SPA3) predominantly regulates elongation growth in adult plants. |
| AT2G29450 | Encodes a member of the TAU glutathione S-transferase gene family. Gene expression is induced by exposure to auxin, pathogen and herbicides. Naming convention according to Wagner et al. (2002) |
| AT5G06700 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). A tbr mutant is impaired in its ability to deposit secondary wall cellulose in specific cell types, most notably in trichomes. |
| AT1G01430 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers.Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT4G01080 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G11030 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).The chemical evidence for function comes from xylan NMR analysis. Secondary wall thickening phenotype can be observed only in double or triple mutant combinations with esk1. |
| AT2G38320 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).TBL34 are required only for xylan 3-O-monoacetylation and 2,3-di-O-acetylation. This biochemical phenotype can be observed in tbl34 esk1, double mutant and tbl34 tbl35 esk1 triple mutants. |
| AT2G34070 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TBL37 expression is regulated by MYC2 and activated in response to JA. |
| AT1G29050 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G62390 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G11570 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G35560 | Encodes a member of the TCP-P subfamily that is involved in flowering time control and plant development. Mutants present an early flowering phenotype. |
| AT1G17580 | Encodes a member of the type XI myosin protein family involved in organelle trafficking and overall plant development. |
| AT5G40890 | Encodes a member of the voltage-dependent chloride channel. Also functions as a NO3-/H+ exchanger that serves to accumulate nitrate nutrient in vacuoles. Mutants homozygous for the T-DNA insertion mutation have reduced nitrate uptake capacity in high nitrate environment and exhibit hypersensitivity to chlorate. Role in cytosolic pH homeostasis. |
| AT5G58350 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
| AT2G37430 | Encodes a member of the zinc finger family of transcriptional regulators. It is expressed in many root tips, primary roots, cotyledons and hypocotyl. The protein is localized to the nucleus. Overexpression of ZAT11 causes increased root growth and increased sensitivity to nickel ions. |
| AT2G46800 | Encodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis. |
| AT2G47260 | Encodes a member of WRKY Transcription Factor; Group I. Involved in nematode feeding site establishment and auxin mediated PIN polar localization in roots. Expression is induced by auxin. |
| AT2G47770 | Encodes a membrane-bound protein designated AtTSPO (Arabidopsis thaliana TSPO-related). AtTSPO is related to the bacterial outer membrane tryptophan-rich sensory protein (TspO) and the mammalian mitochondrial 18 kDa Translocator Protein (18 kDa TSPO), members of the TspO/MBR domain-containing membrane proteins. Mainly detected in dry seeds, but can be induced in vegetative tissues by osmotic or salt stress or abscisic acid treatment. Located in endoplasmic reticulum and the Golgi stacks. It is degraded through the autophagy pathway. |
| AT1G13270 | Encodes a methionine aminopeptidase formerly called MAP1B, renamed to MAP1C. |
| AT4G13430 | Encodes a methylthioalkylmalate isomerase involved in glucosinolate biosynthesis. |
| AT5G23010 | Encodes a methylthioalkylmalate synthase, catalyzes the condensation reactions of the first two rounds of methionine chain elongation in the biosynthesis of methionine-derived glucosinolates. |
| AT5G09660 | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
| AT1G70645 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UACGCAUUGAGUUUCGUUGCU |
| AT2G22496 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUCUGCUAUGUUGCUGCUCAU |
| AT3G48201 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: GAUGGAUAUGUCUUCAAGGAC |
| AT5G40384 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: ACAAAAUCCGUCUUUGAAGA |
| AT5G52797 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UAAUUUGGUGUUUCUUCGAUC |
| AT4G24415 | Encodes a microRNA that targets AGL16. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UAGACCAUUUGUGAGAAGGGA |
| AT4G19395 | Encodes a microRNA that targets AGO1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCGCUUGGUGCAGGUCGGGAA. MIR168a is highly expressed and predominantly produces a 21-nt miR168 species. By contrast, MIR168b is expressed at low levels and produces an equal amount of 21- and 22-nt miR168 species. Only the 21-nt miR168 is preferentially stabilized by AGO1, and consequently, the accumulation of the 22-nt but not the 21-nt miR168 is reduced when DCL1 activity is impaired. mir168a mutants with strongly reduced levels of 21-nt miR168 are viable but exhibit developmental defects, particularly during environmentally challenging conditions. |
| AT1G31173 | Encodes a microRNA that targets ARF family members ARF6 and ARF8. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAAGCUGCCAGCAUGAUCUGG |
| AT2G47015 | Encodes a microRNA that targets both a Laccase and Plantacyanin-like family member. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AUGCACUGCCUCUUCCCUGGC |
| AT2G39175 | Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). Hypomorphic mutants exhibit defects in embryo, vegetative and floral development.MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA. Pri-mRNA coordinates for MIR160a (converted to TAIR10 based on PMID19304749): Chr2: 16339853-16341886 (forward), length: 2034 bp; exon coordinates: exon 1: 16339853 to 16340469, exon 2: 16341621 to 16341886; mature miRNA and miRNA* are located on exon 1. |
| AT5G59505 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: GAAUCUUGAUGAUGCUGCAU. Pri-mRNA coordinates for MIR172e (converted to TAIR10 based on PMID19304749): Chr5: 23988070-23988886 (forward), length: 817 bp; exon coordinates: exon 1: 23988070 to 23988886; mature miRNA and miRNA* are located on exon 1. |
| AT2G10606 | Encodes a microRNA that targets several GRF family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCCACAGCUUUCUUGAACUG. miR396 expression increased with leaf development, antagonizing with expression of GRFs. Transcript accumulates in the distal zone of young developing seeds, restricing the expression of GRF2 to the proximal part. miR396 attenuates cell proliferation in developing leaves through the repression of GRF activity and a decrease in the expression of cell cycle genes. |
| AT5G35407 | Encodes a microRNA that targets several GRF family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCCACAGCUUUCUUGAACUU. Expression increased with leaf development, antagonizing with expression of GRFs. Transcript accumulates in the distal zone of young developing seeds, restricing the expression of GRF2 to the proximal part. miR396 attenuates cell proliferation in developing leaves through the repression of GRF activity and a decrease in the expression of cell cycle genes. |
| AT4G30972 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC |
| AT3G55734 | Encodes a microRNA that targets several TIR1/AFB family members and one bHLH family member. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCCAAAGGGAUCGCAUUGAUCC. Targets are: F-box proteins and bHLH transcription factor. Specifically cleaves AFB3 transcripts, controlling AFB3 mRNA accumulation in roots in response to nitrate exposure. |
| AT1G31358 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:ATTAACGCTGGCGGTTGCGGCAGC |
| AT2G22668 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:ATGAGTTGGGTCTAACCCATAACT |
| AT5G16730 | Encodes a microtubule-associated protein. |
| AT1G74690 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
| AT3G09660 | Encodes a minichromosome maintenance protein that is involved with RAD51 in a backup pathway that repairs meiotic double strand breaks without giving meiotic crossovers when the major pathway, which relies on DMC1, fails. |
| AT4G12130 | Encodes a mitochondrial COG0354 protein that requires folate for its function in Fe/S cluster biogenesis. |
| AT2G31350 | Encodes a mitochondrial glyoxalase 2 that can accommodate a number of different metal centers and with the predominant metal center being Fe(III)Zn(II). |
| AT1G79900 | encodes a mitochondrial ornithine transporter that exports ornithine from the mitochondria to the cytosol |
| AT3G13110 | Encodes a mitochondrial serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. |
| AT1G53000 | Encodes a mitochondrial-localized CMP-KDO (3-deoxy-D-manno-octulosonate) synthetase. This is the enzyme activating KDO as a nucleotide sugar prior to its incorporation into rhamnogalacturonan-II. Heterozygous mutants are defective in pollen development and in pollen tube elongation. |
| AT3G21220 | Encodes a mitogen-activated kinase kinase, dual specific protein kinase that is expressed in vegetative tissues and floral buds. Involved in innate immunity. This protein activates MPK3/MPK6 and early-defense genes redundantly with MKK4. In plants with both MKK5 and MKK4 levels reduced by RNAi plants, floral organs do not abscise suggesting a role for both proteins in mediating floral organ abscission.MKK5 is part of a positive feedback loop that regulates HAE expression in floral receptacles. |
| AT3G45640 | Encodes a mitogen-activated kinase whose mRNA levels increase in response to touch, cold, salinity stress and chitin oligomers.Also functions in ovule development. Heterozygous MPK3 mutants in a homozygous MPK6 background are female sterile due to defects in integument development. MPK3 can be dephosphorylated by MKP2 in vitro. |
| AT1G72040 | Encodes a multisubstrate deoxyribonucleoside kinase that salvages DNA precursors. |
| AT5G37260 | Encodes a MYB family transcription factor Circadian 1 (CIR1). Involved in circadian regulation in Arabidopsis. |
| AT3G28910 | Encodes a MYB family transcriptional regulator.It is a a positive regulator of the pathogen-induced hypersensitive response and of brassinosteroid and abscisic acid signaling and a negative regulator of photomorphogenesis. Accumulation of MYB30 is light regulated and activity is modulated by SUMOlaytion. MYB30 can for complexes with different bHLH components to regulate expression of different pathways. |
| AT3G06490 | Encodes a MYB transcription factor involved in regulating anther dehiscence as well as regulating cell death, and cuticle-related Botrytis immunity. |
| AT1G70000 | Encodes a MYB-like Domain transcription factor that plays a positive role in anthocyanin accumulation in response to light and cytokinin via repression of MYBL2.MYBD expression increased in response to light or cytokinin, and MYBD enhanced anthocyanin biosynthesis via the repression of MYBL2 encoding for a transcription factor that had a negative effect on this process. In addition, MYBD can bind in vivo to the MYBL2 promoter and a lower level of histone H3K9 acetylation (H3K9ac) at upstream region of MYBL2 in MYBD-OX in comparison to wild-type plants, implies that MYBD represses MYBL2 expression via an epigenetic mechanism. |
| AT3G09600 | Encodes a MYB-like transcription factor similar to CIRCADIAN CLOCK-ASSOCIATED1 (CCA1) and ELONGATED HYPOCOTYL (LHY). Involved in the regulation of circadian clock by modulating the pattern of histone 3 (H3) acetylation. Functions as a transcriptional activator of evening element containing clock genes. Involved in heat shock response. |
| AT1G32640 | Encodes a MYC-related transcriptional activator with a typical DNA binding domain of a basic helix-loop-helix leucine zipper motif. Binds to an extended G-Box promoter motif and interacts with Jasmonate ZIM-domain proteins. MYC2 interacts with EIN3 and EIL1 to repress hook curvature and resistance to Botrytis cinera.Its transcription is induced by dehydration stress, ABA treatment and blue light via CRY1. Negative regulator of blue light-mediated photomorphogenic growth and blue and far-red-light-regulated gene expression. Positive regulator of lateral root formation. Regulates diverse JA-dependent functions. Negatively regulates Trp metabolism and biosynthesis of Trp-derived secondary metabolites. Positively regulates flavonoid biosynthesis, resistance to insects, and response to oxidative stress. Regulates other transcription factors, and negatively regulates its own expression. For example it binds to and regulates the expression of NST1. Its stability is modulated by PUB10 through polyubiquitination. |
| AT5G10570 | Encodes a myo-inositol hexakisphosphate kinase. |
| AT5G13180 | Encodes a NAC domain transcription factor that interacts with VND7 and negatively regulates xylem vessel formation. |
| AT2G43000 | Encodes a NAC transcription factor induced by hydrogen peroxide (H2O2). Involved in senescence. Over expression of the gene strongly delays senescence and enhances tolerance to various abiotic stresses. |
| AT4G27410 | Encodes a NAC transcription factor induced in response to desiccation. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response. |
| AT1G52890 | encodes a NAC transcription factor whose expression is induced by drought, high salt, and abscisic acid. This gene binds to ERD1 promoter in vitro. |
| AT4G36160 | Encodes a NAC-domain transcription factor that is expressed in developing xylem. Over expression of this protein causes ectopic secondary cell wall growth. Complements some of the cell wall defects seen in SND1/NST1 double mutants. |
| AT5G39610 | Encodes a NAC-domain transcription factor. Positively regulates aging-induced cell death and senescence in leaves. This gene is upregulated in response to salt stress in wildtype as well as NTHK1 transgenic lines although in the latter case the induction was drastically reduced. It was also upregulated by ABA, ACC and NAA treatment, although in the latter two cases, the induction occurred relatively late when compared with NaCl or ABA treatments. Note: this protein (AtNAC6) on occasion has also been referred to as AtNAC2, not to be confused with the AtNAC2 found at locus AT3G15510. |
| AT5G14780 | Encodes a NAD-dependent formate dehydrogenase. |
| AT1G78590 | Encodes a NADH kinase which can synthesize NADPH from NADH; also utilizes NAD+ as substrate although NADH is the preferred substrate. |
| AT3G51770 | Encodes a negative regulator of 1-aminocyclopropane-1-carboxylic acid synthase5(ACS5), which catalyze the rate-limiting step in ethylene biosynthesis. ETO1 directly interacts with ACS5 and inhibits its enzyme activity and targets it for degradation via proteasome-dependent pathway. It also interacts with CUL3 (a component of ubiquitin ligase complexes). eto1 (and eto3) mutations elevate ethylene biosynthesis by affecting the posttranscriptional regulation of ACS |
| AT3G45650 | Encodes a nitrate efflux transporter NAXT1 (for NITRATE EXCRETION TRANSPORTER1). Localized to the plasma membrane. NAXT1 belongs to a subclass of seven NAXT members from the large NITRATE TRANSPORTER1/PEPTIDE TRANSPORTER family and is mainly expressed in the cortex of mature roots. |
| AT4G21680 | Encodes a nitrate transporter (NRT1.8). Functions in nitrate removal from the xylem sap. Mediates cadmium tolerance. |
| AT3G16400 | Encodes a nitrile-specifier protein NSP1 responsible for constitutive and herbivore-induced simple nitrile formation in rosette leaves. NSP1 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. |
| AT2G18440 | Encodes a noncoding RNA, a member of an emerging class of transcripts that lack significant open reading frames and encode RNA as their final product. Has been identified as a translated small open reading frame by ribosome profiling. |
| AT3G22275 | Encodes a non-TIFY JAsmonate ZIM-domain (JAZ) protein with a Ser-rich C-terminal tail that is a site for phosphorylation that interacts with the bHLH transcription factor MYC2 and the co-repressor TOPLESS and acts as a repressor of JA signaling. JAZ13 is the 13th member of the JAZ family in Arabidopsis, and the only member not classified as a TIFY protein. |
| AT3G19720 | Encodes a novel chloroplast division protein. Mutants of exhibit defects in chloroplast constriction, have enlarged, dumbbell-shaped chloroplasts. The ARC5 gene product shares similarity with the dynamin family of GTPases, which mediate endocytosis, mitochondrial division, and other organellar fission and fusion events in eukaryotes. Phylogenetic analysis showed that ARC5 is related to a group of dynamin-like proteins unique to plants. A GFP-ARC5 fusion protein localizes to a ring at the chloroplast division site. Chloroplast import and protease protection assays indicate that the ARC5 ring is positioned on the outer surface of the chloroplast. Facilitates separation of the two daughter chloroplasts. |
| AT1G23080 | Encodes a novel component of auxin efflux that is located apically in the basal cell and is involved during embryogenesis in setting up the apical-basal axis in the embryo. It is also involved in pattern specification during root development. In roots, it is expressed at lateral and basal membranes of provascular cells in the meristem and elongation zone, whereas in the columella cells it coincides with the PIN3 domain. Plasma membrane-localized PIN proteins mediate a saturable efflux of auxin. PINs mediate auxin efflux from mammalian and yeast cells without needing additional plant-specific factors. The action of PINs in auxin efflux is distinct from PGPs, rate-limiting, specific to auxins and sensitive to auxin transport inhibitors. PINs are directly involved of in catalyzing cellular auxin efflux. |
| AT3G12930 | Encodes a novel conserved chloroplast protein that interacts with components of the PEP complex. Mutants show delayed greening and reduced photosynthetic capcity. |
| AT2G23460 | encodes a novel G-alpha protein that shares similarity to plant, yeast, and animal G-alpha proteins at the C-terminus. It contains an N-terminus that is as large as the C-terminus, is a member of a small family, and is expressed in all tissues examined, including roots, leaves, stems, flowers, and fruits. |
| AT2G20180 | Encodes a novel Myc-related bHLH transcription factor that has transcriptional activation activity in the dark. It is a key negative regulator of phytochrome-mediated seed germination and acts by inhibiting chlorophyll biosynthesis, light-mediated suppression of hypocotyl elongation and far-red light-mediated suppression of seed germination, and promoting negative gravitropism in hypocotyls. Light reduces this activity in a phy-dependent manner. The protein preferentially interacts with the Pfr forms of Phytochrome A (PhyA) and Phytochrome B (PhyB), is physically associated with APRR1/TOC1 and is degraded in red (R) and far-red (FR) light through the ubiquitin (ub)-26S proteasome pathway to optimize photomorphogenic development in Arabidopsis. It also negatively regulates GA3 oxidase expression. |
| AT2G46970 | encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. |
| AT3G62090 | encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. |
| AT3G59060 | Encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. Involved in shade avoidance. Functions as negative regulator of PhyB. Protein levels are modulated by phytochrome B. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
| AT5G04470 | Encodes a novel nuclear 14-kD protein containing a cyclin binding motif and a motif found in ICK/KRP cell cycle inhibitor proteins. It is required for coordinating cell division and cell differentiation during the development of Arabidopsis trichomes, playing a key role in the mitosis-to-endoreduplication transition. It interacts with D-type cyclins in vivo. |
| AT3G18485 | Encodes a novel protein with no predicted membrane-spanning domains that is polymorphic among Arabidopsis accessions. The protein may modulate a metal transporter. Mutants are resistant to IAA-Leu, IAA-Phe, and the divalent metals cobalt and manganese but remain sensitive to free IAA; they are defective in lateral root formation and primary root elongation. |
| AT5G28646 | Encodes a novel protein. The wvd2 gain-of-function mutant has impaired cell expansion and root waving, and changed root skewing. |
| AT3G61460 | Encodes a novel ring finger protein and forms an N-terminal hydrophobic domain and a C-terminal RING-H2 signature. Expression is down regulated by brassinolide. |
| AT4G24972 | Encodes a novel small protein which is similar to proteins of unknown function from other plant species. TPD1 is involved in cell specification during anther and pollen development. Identified in a screen for male steriles. Mutants lack tapetal cells and have an increased number of microsporocytes. Expressed in flower buds, leaves and young seedlings. In anthers, TPD1 is expressed throughout pollen development in parietal cells and sporocytes. Physically interacts with the LRR kinase EMS1 and that interaction results in phosphorylation of TPD1. |
| AT3G63210 | encodes a novel zinc-finger protein with a proline-rich N-terminus, identical to senescence-associated protein SAG102 |
| AT1G67230 | Encodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
| AT1G13220 | Encodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
| AT5G27920 | Encodes a nuclear F-box protein that can directly interact with the C2H2‐type zinc finger transcription factor STOP1 and promote its ubiquitination and degradation. STOP1 is crucial for aluminum (Al) resistance. |
| AT2G32940 | Encodes a nuclear localized 879-amino-acid protein that contains conserved PAZ and PIWI domains that is important for the accumulation of specific heterochromatin-related siRNAs, and for DNA methylation and transcriptional gene silencing. |
| AT2G46510 | Encodes a nuclear localized BLH domain containing transcriptional activator involved in response to ABA. Overexpression confers enhanced ABA responsiveness while loss of function mutants are ABA sensitive.bHLH17 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH13 and bHLH14 to negatively regulate jasmonate responses. |
| AT3G25790 | Encodes a nuclear localized member of the GARP family of transcription factors. Along with AtNIGT1/HRS1 it is involved in nitrate and phosphate signaling in the root. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
| AT5G61420 | Encodes a nuclear localized member of the MYB transcription factor family. Involved in positive regulation of aliphatic glucosinolate biosynthesis.Expression is induced by touch, wounding and glucose. |
| AT5G57790 | Encodes a nuclear localized protein of unknown function that is involved in pollen and embryo sac development. |
| AT1G69935 | Encodes a nuclear localized serine-arginine-aspartate-rich protein that acts as a negative regulator of photomorphogenesis. |
| AT5G51300 | Encodes a nuclear localized splicing factor homolog that is involved in alternative splicing of some mRNAs. |
| AT4G35080 | Encodes a nuclear-encoded chloroplast protein that plays an important role in vegetative growth, female gametogenesis, and embryogenesis likely by mediating chloroplast integrity and development. |
| AT3G18690 | Encodes a nuclear-localized member of a plant specific gene family involved in mediating responses to pathogens. Interacts with WRKY transcriptional regulators. |
| AT2G39050 | Encodes a nucleocytoplasmic lectin that is capable of binding carbohydrates. It is involved in ABA mediated stomatal movement and increased expression is correlated with increased resistance to Pseudomonas syringae. |
| AT5G16750 | Encodes a nucleolar localized WD-40 repeat protein that is preferentially expressed in dividing cells and is required for regulated division planes and embryo development. |
| AT3G22380 | Encodes a nucleus-acting plant-specific clock regulator working close to the central oscillator and affecting the circadian gating of light responses. Circadian gating is the alteration of circadian phase according to the photoperiod of the entraining day/light cycle and the rhythmic antagonism of light responses in the early subjective night. TIC differentially regulates CCA1 and PRR9 from LHY, with LHY expression as a dominant genetic target of TIC action. Also shown to be invoved in the maintenance of Arabidopsis thaliana metabolic homeostasis. |
| AT1G62440 | encodes a paralog of LRX1 (LEUCINE-RICH REPEAT/EXTENSIN 1) which acts synergistically with LRX1 in root hair cell morphogenesis. |
| AT2G46930 | Encodes a pectin acetylesterase that removes cell wall acetate associated with pectin formation in Arabidopsis leaves. |
| AT5G23870 | Encodes a pectin acetylesterase that removes cell wall acetate associated with pectin formation in Arabidopsis leaves. |
| AT1G53840 | encodes a pectin methylesterase |
| AT1G53830 | encodes a pectin methylesterase |
| AT3G14310 | encodes a pectin methylesterase, targeted by a cellulose binding protein (CBP) from the parasitic nematode Heterodera schachtii during parasitism. |
| AT4G18750 | Encodes a pentatricopeptide (PPR) protein involved in leaf and root development. dot4 mutants have an aberrant midgap venation pattern in juvenile leaves and cotyledons. |
| AT3G13880 | Encodes a pentatricopeptide repeat (PPR) protein involved in RNA editing in mitochondria. |
| AT3G14330 | Encodes a pentatricopeptide repeat protein involved in chloroplast mRNA editing. Mutants display defects in C-U editing of psbE. |
| AT5G27520 | encodes a peroxisomal adenine nucleotide transporter, involved in fatty acid beta-oxidation during early stage of postgerminative growth. |
| AT4G35090 | Encodes a peroxisomal catalase, highly expressed in bolts and leaves. mRNA expression patterns show circadian regulation with mRNA levels being high in the subjective early morning. Loss of function mutations have increased H2O2 levels and increased H2O2 sensitivity. Mutants accumulate more toxic ions yet show decreased sensitivity to Li+. This decreased sensitivity is most likely due to an insensitivity to ethylene. Note that in Queval et al. (2007) Plant Journal, 52(4):640, SALK_057998 is named as cat2-1, SALK_076998 is named as cat2-2; in Bueso et al. (2007) Plant Journal, 52(6):1052, SALK_076998 is named as cat2-1. TAIR has adopted the nomenclature consistent with that in Bueso et al. (2007) after consultation with the authors: SALK_076998 (cat2-1), SALK_057998 (cat2-2). |
| AT2G42790 | Encodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development. |
| AT4G12735 | Encodes a peroxisomal protein. |
| AT3G27820 | Encodes a peroxisome membrane-bound monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2 |
| AT1G14740 | Encodes a PHD-finger protein that, with TTA1, is redundantly required for MP-dependent embryonic root meristem initiation. |
| AT3G44880 | Encodes a pheide a oxygenase (PAO). Accelerated cell death (acd1) mutants show rapid, spreading necrotic responses to both virulent and avirulent Pseudomonas syringae pv. maculicola or pv. tomato pathogens and to ethylene. |
| AT2G35680 | Encodes a phosphatidylglycerophosphate (PGP) phosphatase involved in the synthesis of plastidial Phosphatidylglycerol (PG) in conjunction with PGPP1 and PTPMT2 in root. PTPMT1 levels were higher in node, cauline leaf, and flower than in root, leaf, and stem. |
| AT1G49340 | Encodes a phosphatidylinositol 4-kinase that is expressed in inflorescences and shoots. |
| AT2G26420 | Encodes a phosphatidylinositol-4-phosphate 5-kinase. Exclusively expressed in roots. Essential for root hair growth. |
| AT4G37870 | Encodes a phosphoenolpyruvate carboxykinase that localizes to the cytosol. |
| AT1G08650 | Encodes a phosphoenolpyruvate carboxylase kinase that is expressed at highest levels in leaves. Expression is induced by light. |
| AT1G48600 | Encodes a phosphoethanolamine N-methyltransferase that catalyses the last two methylation steps of the three sequential methylations of phosphoethanolamine (PEA) that are required for the synthesis of phosphocholine (PCho) in plants. |
| AT2G30520 | Encodes a phototropin-interacting NRL protein that is an early signaling component in the phototrophic response and is essential for the phototropin-mediated chloroplast accumulation response but is not involved in the chloroplast avoidance response or stomatal opening. |
| AT1G22280 | Encodes a phytochrome-associated protein, PAPP2C (phytochrome-associated protein phosphatase type 2C). PAPP2C interacts in the nucleus with phyA (phytochrome A) and phyB. Functions as a regulator of phytochrome-interacting factor PIF3 by dephosphorylating phytochromes in the nucleus. |
| AT3G47420 | Encodes a Pi starvation-responsive protein AtPS3. A member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT1G10700 | Encodes a P-independent phosphoribosyl pyrophosphate (PRPP) synthase. |
| AT5G54490 | Encodes a PINOID (PID)-binding protein containing putative EF-hand calcium-binding motifs. The interaction is dependent on the presence of calcium. mRNA expression is up-regulated by auxin. Not a phosphorylation target of PID, likely acts upstream of PID to regulate the activity of this protein in response to changes in calcium levels. |
| AT1G32100 | Encodes a pinoresinol reductase involved in lignan biosynthesis. Expressed strongly in roots and less strongly in stems. Shows specificity for pinoresinol and not lariciresinol. |
| AT4G19020 | Encodes a plant DNA methyltransferase that methylates mainly cytosines in CHH (H = any base but G) contexts. It is involved in heat tolerance. |
| AT5G57380 | Encodes a plant homeodomain protein VERNALIZATION INSENSITIVE 3 (VIN3). In planta VIN3 and VRN2, VERNALIZATION 2, are part of a large protein complex that can include the polycomb group (PcG) proteins FERTILIZATION INDEPENDENT ENDOSPERM (FIE), CURLY LEAF (CLF), and SWINGER (SWN or EZA1). The complex has a role in establishing FLC (FLOWERING LOCUS C) repression during vernalization. |
| AT4G30380 | Encodes a Plant Natriuretic Peptide (PNP). |
| AT3G13050 | Encodes a plant nicotinate transporter than can also transport trigonelline (N-methylnicotinate). |
| AT1G11572 | Encodes a Plant thionin family protein |
| AT1G33240 | Encodes a plant transcriptional activator that contains two separate, but similar, trihelix DNA-binding domains, similar to GT-2. Gene is expressed in all aerial parts of the plant, with higher level of expression in siliques. At-GTL2 was thought to be a duplicated copy of this gene but is likely to be a cloning artefact, the result of a chimeric clone. Regulates ploidy-dependent cell growth in trichome. |
| AT2G36080 | Encodes a plant-specific B3 DNA-binding domain transcription factor. Has transcription repressor activity. |
| AT4G39100 | Encodes a plant-specific histone reader capable of recognizing both H3K27me3 and H3K4me3 via its bromo-adjacent homology (BAH) and plant homeodomain (PHD) domains, respectively. Detailed biochemical and structural studies suggest a binding mechanism that is mutually exclusive for either H3K4me3 or H3K27me3. SHL plays a role in the repression of flowering. |
| AT4G39400 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction. BRI1 ligand is brassinolide which binds at the extracellular domain. Binding results in phosphorylation of the kinase domain which activates the BRI1 protein leading to BR responses. Residue T-1049 and either S-1044 or T-1045 were essential for kinase function in vitro and normal BRI1 signaling in planta. The structure of BRI1 ligand-binding domain has been determined at 2.5A resolution. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. BRI1 appears to be involved in the autonomous pathway that regulates the transition to flowering, primarily through its effects on FLC expression levels, as uncovered by double mutant analyses. This most likely occurs as a result of BRI1-dependent effects on histone acetylation, but not histone triMeH3K4 methylation, at the FLC locus. |
| AT5G13190 | Encodes a plasma membrane localized LITAF domain protein that interacts with LSD1 and acts as a negative regulation of hypersensitive cell death. |
| AT2G18960 | Encodes a plasma membrane proton ATPase. Mutants have a reduced ability to close their stomata in response to drought and are affected in stomatal but not seed responsiveness to ABA. |
| AT5G61900 | Encodes a plasma-membrane localized, copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Mutants exhibit temperature-sensitive growth defects and increased hypersensitive response where permissive conditions are low temperature (22 degrees Celsius) and low humidity. Gene is expressed at 22 but not at 28 (restrictive condition) degrees. Lethality of double mutants with BON3 can be partially suppressed by SNC1. Double mutants show defects in development that are genetically separable from hypersensitive/cell death response. |
| AT2G33330 | Encodes a plasmodesmal protein that affects the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT1G70690 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT2G26670 | Encodes a plastid heme oxygenase necessary for phytochrome chromophore biosynthesis and for coupling the expression of some nuclear genes to the functional state of the chloroplast. |
| AT3G20390 | Encodes a plastidial RidA (Reactive Intermediate Deaminase A) homolog that hydrolyzes the enamines/imines formed by Thr dehydratase from Ser or Thr. RidA accelerates the deamination of reactive enamine/imine intermediates produced by threonine dehydratase (At3g10050) with threonine or serine as substrates. In the absence of RidA, the serine-derived imine inactivates BCAT3 (At3g49680). RidA thus pre-empts damage to BCAT3 by hydrolyzing the reactive imine before it does damage. |
| AT3G44720 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT5G22630 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT5G53540 | Encodes a P-loop NTPase APP1. The disruption of APP1 is accompanied by a reduction in ROS level, a rise in the rate of cell division in the quiescent center (QC) and the promotion of root distal stem cell (DSC) differentiation. |
| AT4G16110 | Encodes a pollen-specific transcription factor involved in the expression of nuclear genes for components of mitochondrial complex I in Arabidopsis. Acts in concert with other type-B ARRs in the cytokinin signaling pathway. AHK3 mediates cytokinin-induced phosphorylation of ARR2 on the Asp-80 residue. This phosphorylation plays a positive role of ARR2 in cytokinin-mediated control of leaf longevity. Also involved in cytokinin-dependent inhibition of hypocotyl elongation. |
| AT2G43020 | Encodes a polyamine oxidase. |
| AT3G59050 | Encodes a polyamine oxidase. |
| AT5G06860 | Encodes a polygalacturonase inhibiting protein involved in defense response. PGIPs inhibit the function of cell wall pectin degrading enzymes such as those produced by fungal pathogens. PGIP1 is induced by fungal infection. Suppressed in the proton sensitive stop1-mutant, but the transcription level was recovered by transformation of STOP2. Knockout mutant showed severe damage in the root tip in low Ca and low pH medium. |
| AT5G06870 | Encodes a polygalacturonase inhibiting protein involved in plant defense response. PGIPs inhibit the activity of pectin degrading enzymes such as those produced by fungal pathogens. PGIP2 is induced by fungal infection and methyl jasmonate.Suppressed in the proton sensitive stop1-mutant, but the transcription level was recovered by transformation of STOP2. Knockout mutant showed severe damage in the root tip in low Ca and low pH medium. |
| AT4G20050 | Encodes a polygalacturonase that plays a direct role in degrading the pollen mother cell wall during microspore development. |
| AT4G04850 | Encodes a potassium efflux antiporter; has three splice forms KEA3.1, KEA3.2, and KEA3.3, KEA3.2 is the most abundant splice form in all plant organs (silique, flower, leaf and root). KEA3.1 and KEA3.3 are minor variants that can be found in flowers and in leaves. KEA3 is localized to the thylakoid membrane and enriched in the stromal lamellae. It allows proton efflux from the thylakoid lumen by proton/potassium antiport. |
| AT5G17070 | Encodes a PP4R2 domain protein that likely functions as a regulatory subunit of PP4, a highly conserved ser/thr protein phosphatase. |
| AT1G28960 | Encodes a ppGpp pyrophosphohydrolase. |
| AT1G17630 | Encodes a PPR protein involved in mitochondrial functioning. Mutants suppress cell wall defects caused by C17 chemical inhibitor. Mutants are defective in cytochrome c maturation and activation of mitochondrial retrograde signalling. |
| AT4G37210 | Encodes a predominantly nuclear histone chaperone that promotes [H3-H4]2 tetrasome formation and does not promote disassembly of in vitro preassembled tetrasomes. |
| AT1G62310 | Encodes a probable H3K9me2 demethylase. Functions in trichome morphogenesis via regulation of GL3. |
| AT3G30775 | Encodes a proline oxidase that is predicted to localize to the inner mitochondrial membrane, its mRNA expression induced by high levels of Al and by osmotic stress. The promoter contains an L-proline-inducible element. |
| AT1G73550 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT1G01550 | Encodes a protein with no functionally characterized domains that to prevent the synthesis of a novel substance that moves from the root to the shoot, where it modifies shoot growth by interfering with auxin signaling. Synthesis and delivery of this substance requires neither phloem nor endodermis. |
| AT3G48360 | Encodes a protein (BT2) that is an essential component of the TAC1-mediated telomerase activation pathway. Acts redundantly with BT3 and BT1 during female gametophyte development and with BT3 during male gametophyte development. BT2 also mediates multiple responses to nutrients, stresses, and hormones. |
| AT1G32230 | Encodes a protein belonging to the (ADP-ribosyl)transferase domain-containing subfamily of WWE protein-protein interaction domain protein family. Superoxide radicals are necessary and sufficient to propagate cell death or lesion formation in rcd1 mutants. Without stress treatment, RCD1 is localized in the nucleus. Under high salt or oxidative stress, RCD1 is found not only in the nucleus but also in the cytoplasm. |
| AT3G51880 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated. |
| AT1G20693 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. |
| AT1G20696 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. |
| AT3G18710 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT3G07360 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT1G10560 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT1G29340 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity. It is required for cell death and full resistance specified by Arabidopsis RPM1 and RPS4 resistance proteins against Pseudomonas syringae pv tomato. |
| AT2G29700 | Encodes a protein containing one PH (pleckstrin homology) domain with a short N-terminal extension |
| AT1G34780 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. |
| AT3G03860 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. |
| AT4G04610 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. |
| AT4G22600 | Encodes a protein involved in involved in the formation of the pollen surface apertures. It acts late in aperture formation by excluding specific membrane domains from exine deposition. |
| AT1G11430 | Encodes a protein involved in RNA editing in chloroplasts. |
| AT1G67080 | Encodes a protein involved in the photoprotection of PSII. An aba4-1 mutant completely lacks neoxanthin,a component of the chromophore of the peripheral antenna system in PSII. ABA4 is required for neoxanthin biosynthesis, an intermediary step in abscisic acid biosynthesis, but no catalytic activity has been detected for the ABA4 protein. |
| AT5G39210 | Encodes a protein of the chloroplastic NAD(P)H dehydrogenase complex (NDH Complex) involved in respiration, photosystem I (PSI) cyclic electron transport and CO2 uptake. The product of this gene appears to be essential for the stable formation of the NDH Complex. |
| AT4G12420 | Encodes a protein of unknown function involved in directed root tip growth. It is a member of 19-member gene family and is distantly related structurally to the multiple-copper oxidases ascorbate oxidase and laccase, though it lacks the copper-binding domains. The protein is glycosylated and GPI-anchored. It is localized to the plasma membrane and the cell wall. The gene is expressed most strongly in expanding tissues. |
| AT3G55000 | Encodes a protein of unknown function that is involved in cortical microtubule organization. Mutants exhibit abnormal cell growth and patterns of division. TON1A can functionally complement TON1B and their roles appear to be redundant in plants. Encodes a novel protein that is similar to human FOP and OFD1 centrosomal proteins. Localizes to the preprophase band, cytoplasm and cell cortex where it is probably associated with the cortical cytoskeleton. TON1A associates with plant centrins CEN1 and CEN2. |
| AT2G37210 | Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At5g11950. |
| AT5G11950 | Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At2G37210. |
| AT5G66680 | Encodes a protein ortholog of human SOT48 or yeast WBP1, an essential protein subunit of the oligosaccharyltransferase (OST) complex, which is responsible for the transfer in the ER of the N-linked glycan precursor onto Asn residues of candidate proteins. |
| AT1G07630 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT2G22010 | Encodes a protein predicted to act as a RING E3 ubiquitin ligase. It appears to regulate the stability of the KRP1/ICK1 cyclin dependent kinase inhibitor. Induced by beet severe curly virus (BSCTV) C4 protein. |
| AT3G17810 | Encodes a protein predicted to have dihydropyrimidine dehydrogenase activity. Its activity has not been demonstrated in vivo, but, it is required for efficient uracil catabolism in Arabidopsis. It localizes to the plastid. |
| AT2G23610 | Encodes a protein shown to have carboxylesterase activity, methyl IAA esterase activity, and methyl jasmonate esterase activity in vitro. This protein does not act on methyl salicylate, MeGA4, or MEGA9 in vitro. |
| AT2G23620 | Encodes a protein shown to have carboxylesterase activity, methyl salicylate esterase activity, methyl jasmonate esterase activity, and methyl IAA esterase activity in vitro. MES1 appears to be involved in MeSA hydrolysis in planta. Expression of MES1 can restore systemic acquired resistance in SAR-deficient tobacco plants. This protein does not act on MeGA4, or MEGA9 in vitro. |
| AT1G29330 | Encodes a protein similar in sequence to animal and yeast endoplasmic reticulum retention signal receptor. This protein can functionally complement the yeast homologue. Transcript is detected in flower buds, stems, root, and leaves. |
| AT3G49620 | encodes a protein similar to 2-oxoacid-dependent dioxygenase. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT4G24010 | encodes a protein similar to cellulose synthase |
| AT4G30270 | encodes a protein similar to endo xyloglucan transferase in sequence. It is also very similar to BRU1 in soybean, which is involved in brassinosteroid response. |
| AT1G44350 | encodes a protein similar to IAA amino acid conjugate hydrolase. |
| AT2G14960 | encodes a protein similar to IAA-amido synthases. Lines carrying an insertion in this gene are hypersensitive to auxin. |
| AT2G45280 | Encodes a protein similar to RAD51C involved in double stranded break repair via homologous recombination. Sensitive to DSB induced by Mitomycin C and gamma irradiation, interacts with Atxrcc3 in yeast two-hybrid assay. Required for female meiosis but not critical for mitosis under normal conditions. |
| AT2G27550 | encodes a protein similar to TFL1. overexpression leads to similar phenotype as TFL1 overexpression. expressed specifically in the hypocotyl and null mutation does not result in phenotypes exhibited by TFL1 null mutations. It acts non-cell autonomously to inhibit floral initiation. |
| AT3G04720 | Encodes a protein similar to the antifungal chitin-binding protein hevein from rubber tree latex. mRNA levels increase in response to ethylene and turnip crinkle virus infection. |
| AT2G37260 | Encodes a protein similar to WRKY transcription factors that is expressed in the seed integument and endosperm. Mutants are defective in proanthocyanidin synthesis and seed mucilate deposition. Seeds are yellow colored. Seed size is also affected; seeds are reduced in size but only when the mutant allele is transmitted through the female parent.Loss of function alleles are associated with a reduction in interploidy lethality. |
| AT3G02140 | Encodes a protein that acts in the nucleus and is an important negative regulator of ABA and salt stress responses, and could play a critical role in controlling root elongation, floral initiation and starch degradation. |
| AT3G05500 | Encodes a protein that associates with lipid droplet surfaces and shares sequence homology with family of small rubber particle proteins. |
| AT5G02100 | Encodes a protein that binds to beta-sitosterol and localizes to the ER. The WFDE motif in ORP3a appears to be important for a direct interaction with PVA12 [Plant VAMP-Associated protein 12]. Mutation of this motif causes ORP3a to relocalize to the Golgi and cytosol. The interaction between PVA12 and ORP3a does not appear to be sterol-dependent. |
| AT2G37570 | encodes a protein that can complement the salt-sensitive phenotype of a calcineurin (CaN)-deficient yeast mutant. This gene occurs in a single-copy and is 75% identical to tobacco SLT1 gene. |
| AT4G15340 | Encodes a protein that catalyzes the production of the tricyclic triterpene arabidiol when expressed in yeast. |
| AT1G10030 | Encodes a protein that functions as a scaffolding platform for coassembling the sterol C4 demethylation enzyme complex. It also plays an essential role in the maintenance of polar auxin transport (PAT) by restricting the release and accumulation of 4-carboxy-4-methyl-24-methylenecycloartanol (CMMC), a PAT inhibitor. |
| AT1G31070 | Encodes a protein that functions as an N-acetylglucosamine-1-phosphate uridylyltransferase that catalyzes the formation of UDP-N-acetylglucosamine (UDP-GlcNAc). This is an essential precursor for glycolipid and glycoprotein synthesis and is also used for regulatory protein modification in signaling pathways. The enzyme can also catalyze the reverse reaction using both UDP-GlcNAc and the less common UDP-N-acetylgalactosamine as substrates. |
| AT3G23980 | Encodes a protein that interacts with the Polycomb-group (Pc-G) histone methyltransferase CLF (CURLY LEAF). It colocalizes with CLF to the nucleus and represses a subset of Pc-G target genes. The pleiotropic developmental mutant phenotype suggests that BLI prevents premature differentiation. |
| AT3G14270 | Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant. |
| AT1G71010 | Encodes a protein that is predicted to act as a phosphatidylinositol-3P 5-kinase, but, because it lacks a FYVE domain, it is unlikely to be efficiently targeted to membranes containing the proposed phosphatidylinositol-3P substrate. Therefore, its molecular function remains unknown. |
| AT3G50930 | Encodes a protein that is present in a homo-multimeric protein complex on the outer mitochondrial membrane and plays a role in cell death and amplifying salicylic acid signalling. |
| AT5G50920 | Encodes a protein that is similar to ATP-dependent Clp protease ATP-binding subunit / ClpC. Involved in protein import into the chloroplast. May provide ATP source that drives the TIC (Translocon at the Inner envelope membrane of Chloroplasts) translocation machinery. Association of Hsp93 with the inner envelope membrane through its N domain is important for the functions of Hsp93 in vivo. |
| AT3G53180 | Encodes a protein that is the product of a fusion gene with a C-terminal GSI like sequence and an N-terminal part sharing homology with nodulins. It self-assembles into oligomers and its expression is increased in response to flagellin treatment. The protein co-localizes with microtubules and binds gamma-tubulin. RNAi lines are affected in root morphogenesis. |
| AT2G45440 | Encodes a protein that likely has dihydropicolinate synthase activity based on its mutant phenotype of decreased lysine levels and increased aspartate levels. The mutant also has increased levels of threonine. The enzyme is predicted to localize to the chloroplast. |
| AT3G19590 | Encodes a protein that may have a role in the spindle assembly checkpoint. |
| AT4G15480 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
| AT4G15490 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
| AT4G15500 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
| AT5G41790 | encodes a protein that physically interacts specifically with the putative coiled-coil region of COP1 in vitro. In hypocotyl and cotyledon protoplasts, it is associated to the cytoskeleton, but not in the root. expression is not regulated by light. |
| AT3G03630 | Encodes a protein that possesses S-sulfocysteine synthase activity and lacks O-acetylserien(thiol)lyase activity. |
| AT5G13820 | Encodes a protein that specifically binds plant telomeric DNA repeats. It has a single Myb telomeric DNA-binding (SANT) domain in C-terminus that prefers the sequence TTTAGGG. Single Myb Histone (SMH) gene family member. |
| AT5G40390 | Encodes a protein which might be involved in the formation of verbascose. A T-DNA insertion mutant was shown to have a decreased amount of verbascose (as well as mannitol) whereas the levels of raffinose and stachyose remained unchanged. Enhances drought tolerance through raffinose synthesis or galactinol hydrolysis. |
| AT2G01340 | Encodes a protein whose expression is responsive to nematode infection; PADRE protein up-regulated after infection by S. sclerotiorun. |
| AT2G30840 | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
| AT1G06640 | encodes a protein whose sequence is similar to a 2-oxoglutarate-dependent dioxygenase |
| AT1G06620 | encodes a protein whose sequence is similar to a 2-oxoglutarate-dependent dioxygenase |
| AT5G56180 | encodes a protein whose sequence is similar to actin-related proteins (ARPs) in other organisms. Member of nuclear ARP family of genes. |
| AT5G38020 | encodes a protein whose sequence is similar to SAM:salicylic acid carboxyl methyltransferase (SAMT) |
| AT2G35960 | Encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression is not altered in response to cucumber mosaic virus or spermine. |
| AT3G49810 | Encodes a protein with E3 ubiquitin ligase activity that is involved in negative regulation of salt stress tolerance during germination. |
| AT1G24170 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT3G58790 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT4G38270 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT3G28340 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT1G13250 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT1G18580 | Encodes a protein with putative galacturonosyltransferase activity.GAUT11 is required for pectin synthesis in seed coat epidermal cells and normal mucilage release. |
| AT4G28300 | Encodes a protein with 13.6% proline amino acids that is predicted to localize to the cell wall. |
| AT3G44870 | Encodes a protein with 93% identity to a farnesoic acid methyl transferase. SABATH family methyltransferase. |
| AT3G61190 | Encodes a protein with a C2 domain that binds to BON1 in yeast two hybrid analyses. Its ability to bind to phospholipids is enhanced by calcium ions. Involved in maintaining cell homeostasis. |
| AT1G80490 | Encodes a protein with a Lissen-cephaly type-1-like homology (LisH) domain at the N terminus,a C-terminal to LisH (CTLH) domain, and 12 WD (tryptophan-aspartic acid)-40 repeats at the C terminus. It is closely related to Topless (TPL), which mediates auxin-dependent transcriptional repression during embryogenesis. |
| AT3G01460 | Encodes a protein with a methyl-CpG-binding domain. Has sequence similarity to human MBD proteins. Involved in the modification of the FLC chromatin acetylation state to affect FLC expression. Mutants show an early flowering, and enhanced shoot branching phenotypes. |
| AT4G19230 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. CYP707A1 appears to play an important role in determining the ABA levels in dry seeds. Gene involved in postgermination growth. Overexpression of CYP707A1 leads to a decrease in ABA levels and a reduction in after-ripening period to break dormancy. |
| AT5G45340 | Encodes a protein with ABA 8'-hydroxylase activity; involved in ABA catabolism. Mutant analyses show that disruption in the gene results in more drought tolerance whereas overexpression results in increased transpiration rate and reduced drought tolerance. Gene involved in postgermination growth. Plant P450 CYP707A3, ABA 8'-hydroxylase, binds enantioselectively (+)-ABA but not (-)-ABA, whereas the enzyme binds both enantiomers of AHI1 (a structural ABA analogue used as ABA 8'-hydroxylase competitive inhibitor). |
| AT3G12360 | Encodes a protein with an ankyrin motif and transmembrane domains that is involved in salt tolerance. Expressed throughout the plant and localized to the plasma membrane. Loss of function mutations show an increased tolerance to salt based on assaying seedling growth in the presence of salt. In the mutants, induction of genes required for production of reactive oxygen species is reduced suggesting that itn1 promotes ROS production. It interacts with RCN1 in vivo and may regulate its subcellular localization. |
| AT2G34490 | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze the conversion of both 24-epi-campesterol and β-sitosterol to brassicasterol and stigmasterol, respectively, in the presence of NADPH. |
| AT1G49660 | Encodes a protein with carboxylesterase whose activity was tested using pNA. |
| AT5G47770 | Encodes a protein with farnesyl diphosphate synthase activity. |
| AT4G21200 | Encodes a protein with gibberellin 2-oxidase activity which acts specifically on C-20 gibberellins. |
| AT1G50960 | Encodes a protein with gibberellin 2-oxidase activity which acts specifically on C-20 gibberellins. DDF1 binds to GA2OX7 and regulates its expression in response to salt stress. |
| AT1G58290 | Encodes a protein with glutamyl-tRNA reductase (GluTR) activity, catalyzing the NADPH-dependent reduction of Glu-tRNA(Glu) to glutamate 1-semialdehyde (GSA) with the release of free tRNA(Glu). It is involved in the early steps of chlorophyll biosynthesis. |
| AT5G06580 | Encodes a protein with glycolate dehydrogenase activity, which was shown to complement various subunits of the E. coli glycolate oxidase complex. It has not been ruled out that the enzyme might be involved in other catalytic activities in vivo. |
| AT4G11820 | Encodes a protein with hydroxymethylglutaryl-CoA synthase activity which was characterized by phenotypical complementation of the S. cerevisiae mutant. Involved in glucosinolate biosynthesis. |
| AT5G09650 | Encodes a protein with inorganic pyrophosphatase activity. |
| AT3G13790 | Encodes a protein with invertase activity. |
| AT1G18870 | Encodes a protein with isochorismate synthase activity involved in phylloquinone biosynthesis. Mutant studies of this gene's function suggest that its function is redundant with that of ICS1 (AT1G7410). |
| AT3G21070 | Encodes a protein with NAD(H) kinase activity. |
| AT4G35790 | Encodes a protein with phospholipase D activity. Involved in phospolipase metabolism. Mutants are affected in hydrogen peroxide mediated cell death. |
| AT1G67070 | Encodes a protein with phosphomannose isomerase activity that is involved in synthesis of ascorbic acid. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT3G02570 | Encodes a protein with phosphomannose isomerase activity. |
| AT3G26840 | Encodes a protein with phytyl ester synthesis and diacylglycerol acyltransferase activities that is involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. |
| AT5G13700 | Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants). |
| AT3G16050 | Encodes a protein with pyridoxal phosphate synthase activity whose transcripts were detected mostly in roots and accumulate during senescence. The protein was found in very low abundance, which prevented a specific localisation. |
| AT5G65280 | Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor. Loss of function mutations in GCL1 show no ABA response defects based on assays of seed germination and seedling development.GCL1 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase. |
| AT1G74700 | Encodes a protein with RNAse Z activity suggesting a role in tRNA processing. |
| AT5G10300 | Encodes a protein with R-selective hydroxynitrile lyase activity. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
| AT1G15750 | Encodes a protein with several WD40 repeats at the C-terminus and predicted protein-protein interaction domains at the N-terminus. Together with the TOPLESS-RELATED PROTEINS (TPRs), it is thought to be involved in transcriptional repression of root-promoting genes in the top half of the embryo during the transition stage of embryogenesis. It can also interact with IAA12 through the EAR domain of IAA12 and the CTLH domain of TPL. The ability of IAA12 to repress transcription is diminished in a tpl-1 mutant background. |
| AT5G05600 | Encodes a protein with similarity to flavonol synthases that is involved in the detoxifcation polycyclic aromatic hydrocarbons.One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT5G27380 | Encodes a protein with similarity to glutathione synthetases, which catalyzes one of the early steps in glutathione biosynthesis. Two transcripts have been detected; the longer transcript is less abundant and the protein is localized to the chloroplast. The smaller transcript, in which the transit peptide is truncated, is localized to the cytosol. Increased glutathione accumulation in response to cesium stress. |
| AT1G27760 | Encodes a protein with similarity to human interferon-related developmental regulator (IFRD)that is involved in salt tolerance. Loss of function mutations are hypersensitive to salt stress and have reduced fertility. SAT32 is found in the cytoplasm but appears to translocate to the nucleus when plants are subject to salt stress. |
| AT3G18040 | Encodes a protein with similarity to MAP kinases (MAPK9).Expressed preferentially in guard cells and appears to be involved in reactive oxygen species mediated ABA signaling. |
| AT1G14000 | Encodes a protein with similarity to members of the C1 subgroup of MAP kinase kinase kinases. Interacts physically with the receptor kinase BRL2/VH1 and appears to be involved in auxin and brassinosteriod signaling. |
| AT1G76790 | Encodes a protein with similarity to N-acetylserotonin O-methyltransferase (ASMT) but it does not have ASMT activity in vitro. |
| AT1G17060 | Encodes a protein with similarity to other cytochrome P450's and is a homolog of BAS1. Over expression causes a dwarf phenotype resembling brassinolide resistant mutants. Double mutant analysis of sob7/bas1 loss of function mutants suggests these genes have redundant functions in light responsiveness. SOB7 may function in metabolizing brassinolides. Expressed in leaf, root, stem and silique but expression highest in flower and cauline leaves. Dominant overexpressing plants have dwarf phenotype, short siliques/seeds, rounded dark green leaves and short hypocotyls in light and dark. Loss of function alleles result in plants with long hypocotyls. |
| AT5G62520 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Up-regulated by NaCl. SRO5 and P5CDH (an overlapping gene in the antisense orientation) generate 24-nt and 21-nt siRNAs, which together are components of a regulatory loop controlling reactive oxygen species (ROS) production and stress response. |
| AT1G05460 | Encodes a protein with similarity to RNA helicases. Mutants are defective in post-transcriptional gene silencing. |
| AT3G14067 | Encodes a protein with similarity to serine protease, subtilisin, that is upregulated during senescence and expressed in the arial portions of the plant.Loss of function mutations have increased branch number but normal silique length and seed set and therefore have increased fertility. |
| AT5G24140 | Encodes a protein with similarity to squalene monoxygenases. |
| AT4G36650 | Encodes a protein with similarity to the general transcription factor TFIIB. pBRP binds rDNA sequences in vitro. pBRP has been localized to the outer face of the plastid membrane with GFP fusion however, under conditions of proteosome inhibition it is found in the nucleus. |
| AT4G30200 | Encodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus. |
| AT2G19110 | Encodes a protein with similarity to Zn ATPase. Can rescue Zn deficiency in yeast and Cd resistance, suggesting a role in Zn and Cd transport. |
| AT2G25900 | Encodes a protein with two tandem-arrayed CCCH-type zinc fingers that binds RNA and is involved in RNA turnover. |
| AT4G01770 | Encodes a protein with UDP-xylose-dependent xylosyltransferase activity, which transfers Xyl onto L-fucose and (albeit less efficiently) L-arabinose. The linkage to L-fucose was shown to be preferentially to the O-4 position. Analysis of mutant containing T-DNA insertion in this gene indicate that the RGXT1 protein might be involved in the synthesis of the α-D-Xyl-(1,3)-α-L-Fuc-(1,4)-L-Rha structure in pectic rhamnogalacturonan II. |
| AT5G13200 | Encodes a protein with unknown function that is involved in hormone mediated regulation of seed germination/dormancy. |
| AT3G62720 | Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides. |
| AT2G16650 | Encodes a proteinaceous RNase P that supports RNase P activity in vivo in both organelles and the nucleus. It is also involved in the maturation of small nucleolar RNA (snoRNA) and mRNA. |
| AT4G21900 | Encodes a proteinaceous RNase P that supports RNase P activity in vivo in both organelles and the nucleus. It is also involved in the maturation of small nucleolar RNA (snoRNA) and mRNA. |
| AT3G08730 | Encodes a protein-serine kinase that phosphorylates ribosomal protein in vitro. Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Involved in translational up-regulation of ribosomal proteins. Phosphorylated by PDK1. Interacts with RAPTOR1, which in turn interacts with TOR. SPK6 activity is affected by osmotic stress, and plants overexpressing S6k1 are hypersensitive to osmotic stress. The gene is expressed in all tissues examined, with highest expression level detected in metabolically active tissues. |
| AT5G24470 | Encodes a pseudo-response regulator whose mutation affects various circadian-associated biological events such as flowering time in the long-day photoperiod conditions, red light sensitivity of seedlings during early photomorphogenesis, and the period of free-running rhythms of certain clock-controlled genes including CCA1 and APRR1/TOC1 in constant white light. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR7 and PRR9 to regulate hypocotyl growth under photoperiodic conditions. |
| AT5G18860 | Encodes a purine nucleoside hydrolase active in the apoplast. It might play a role in salvaging extracellular ATP. NSH3 transcript levels rise in response to jasmonic acid and wounding. |
| AT2G01890 | Encodes a purple acid phosphatase (PAP) belonging to the low molecular weight plant PAP group. |
| AT3G48000 | Encodes a putative (NAD+) aldehyde dehydrogenase. |
| AT5G22620 | encodes a putative 2-carboxy-D-arabinitol 1-phosphate phosphatase |
| AT5G64900 | Encodes a putative 92-aa protein that is the precursor of AtPep1, a 23-aa peptide which activates transcription of the defensive gene defensin (PDF1.2) and activates the synthesis of H2O2, both being components of the innate immune response. |
| AT3G56200 | Encodes a putative amino acid transporter. |
| AT5G04930 | Encodes a putative aminophospholipid translocase (p-type ATPase) involved in chilling response. It is targeted to the plasma membrane following association in the endoplasmic reticulum with an ALIS protein beta-subunit. |
| AT2G01420 | Encodes a putative auxin efflux carrier that is localized in developing and mature root meristems. It is involved in the maintenance of embryonic auxin gradients. A role for AtPIN4 in generating a sink for auxin below the quiescent center of the root meristem that is essential for auxin distribution and patterning is proposed. In the root, PIN4 is detected around the quiescent center and cells surrounding it, and localizes basally in provascular cells. PIN4 expression is upregulated in brassinosteroid-insensitive mutant (PMID 16141452). |
| AT1G70410 | Encodes a putative beta-carbonic anhydrase betaCA4. Together with betaCA1 (At3g01500) regulates CO2-controlled stomatal movements in guard cells, as well as attenuates immunity. Differential CA gene expression in response to changing atmospheric CO2 conditions contribute to altered disease resistance levels. |
| AT2G22300 | Encodes a putative CAM binding transcription factor. Loss of function mutations show enhanced resistance to fungal and bacterial pathogens suggesting that CAMTA functions to suppress defense responses.It acts in the cold response pathway, it can bind to and activate the expression of DREB1 genes. |
| AT5G07920 | Encodes a putative diacylglycerol kinase that is mainly expressed in roots, shoots and leaves, but its enzyme product was not active in vitro. |
| AT3G45040 | Encodes a putative dolichol kinase that is localized to the endoplasmic reticulum and involved in pollen tube reception in the female gametophyte. |
| AT1G05200 | Encodes a putative glutamate receptor GLR3 with dual localization in plastid and plasma membrane. |
| AT1G10050 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
| AT2G30140 | Encodes a putative glycosyltransferase. Regulates flowering time via FLOWERING LOCUS C. |
| AT4G37840 | Encodes a putative hexokinase. |
| AT2G21120 | Encodes a putative magnesium transporter that was identified through a forward genetic screen, directly isolating antiviral RNAi-defective (avi) mutant using a Cucumber Mosaic Virus (CMV) mutant. Compared to Wildtype Col-0, avi2 mutant showed severe disease symptom after viral infection and viral accumulation was significantly increased while viral siRNAs and virus-activated endogenous siRNAs (vasiRNAs) were reduced in avi2 mutant. Detailed genetic study indicated that AVI2 modulated RNAi-mediated antiviral immunity by regulating the biogenesis of secondary viral siRNAs and vasiRNAs in Arabidopsis. |
| AT1G79310 | Encodes a putative metacaspase. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
| AT1G53500 | encodes a putative NDP-L-rhamnose synthase, an enzyme required for the synthesis of the pectin rhamnogalacturonan I, the major component of Arabidopsis mucilage. Gene is involved in seed coat mucilage cell development. Mutant analyses suggest that MUM4 is required for complete mucilage synthesis, cytoplasmic rearrangement and seed coat development. |
| AT1G34370 | Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity. Cell wall of the mutant is unstable in low pH medium (pH 4.5) in low Ca solution. This would mediate Ca-alleviation of low pH stress through pectin-Ca interaction. In vitro binding and mutated-promoter-GUS assays identified that STOP1 directly activates AtALMT1 expression through the binding to the promoter by four zinc finger domains. Binding of STOP1 to promoter is an essential step of Al-inducible AtALMT1 expression. |
| AT1G64980 | Encodes a putative nucleotide-diphospho-sugar transferase required for pollen germination and tube growth. |
| AT5G65690 | Encodes a putative phosphoenolpyruvate carboxykinase (ATP-dependent). |
| AT2G29560 | Encodes a putative phosphoenolpyruvate enolase that is localized both to the nucleus and the cytoplasm. |
| AT2G47430 | Encodes a putative plasma membrane-bound hybrid histidine kinase and cytokinin sensor that is expressed within the female gametophyte. |
| AT1G30120 | Encodes a putative plastid pyruvate dehydrogenase E1 beta subunit that is distinct from the mitochondrial pyruvate dehydrogenase E1 beta subunit. |
| AT5G16150 | Encodes a putative plastidic glucose transporter. |
| AT3G05820 | Encodes a putative plastid-targeted alkaline/neutral invertase.Expression is induced by salt, osmotic and ABA treatments. Loss of function affects mitochondrial functioning and ROS production. |
| AT1G58440 | Encodes a putative protein that has been speculated, based on sequence similarities, to have squalene monooxygenase activity. |
| AT1G15100 | Encodes a putative RING-H2 finger protein RHA2a. |
| AT3G60220 | Encodes a putative RING-H2 zinc finger protein ATL4 (ATL4). |
| AT3G54770 | Encodes a putative RNA binding protein that is localized in the nucleus and affects ABA-regulated seed germination of Arabidopsis. |
| AT2G17220 | Encodes a putative serine/threonine-specific protein kinase kin3. Protein is N-myristoylated. |
| AT2G46090 | Encodes a putative sphingosine kinase (SphK) containing the five conserved domains (C1-C5) previously identified in SphKs. |
| AT4G34280 | Encodes a putative substrate receptor for the cullin4-RING ubiquitin E3 ligase complex that is involved in negative regulation of plant UV-B response. |
| AT1G48000 | Encodes a putative transcription factor (MYB112). |
| AT4G01680 | Encodes a putative transcription factor (MYB55). |
| AT1G74430 | Encodes a putative transcription factor (MYB95). |
| AT5G64750 | Encodes a putative transcription factor containing an AP2 domain. Is a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. Expressed in response to ABA, osmotic stress, sugar stress and drought. Mutants are hypersensitive to these stresses. May be involved in regulation of ABA mediated stress response. |
| AT1G08200 | Encodes a putative UDP-D-apiose/UPD-D-xylose synthetase. |
| AT5G37850 | Encodes a pyridoxal kinase required for root hair development. Mutants are hypersensitive to Na+, K+ and Li+. |
| AT4G38620 | Encodes a R2R3 MYB protein which is involved in the response to UV-B. It functions as a repressor of target gene expression. One of its target genes encodes cinnamate 4-hydroxylase; mutants accumulate sinapate esters in their leaves. MYB4 binds to its own promoter and represses its own expression. Nuclear localization of MYB4 depends on the action of the beta importin SAD2. |
| AT5G62470 | Encodes a R2R3 type Myb transcription factor whose expression is strongly induced by abscisic acid. Mediates abscisic acid signaling during drought stress response. |
| AT5G66160 | Encodes a receptor homology region transmembrane domain, ring H2 motif protein involved in transport of storage proteins to protein storage vacuoles. Localized to endoplasmic reticulum and co-localizes with DIP positive vesicles and to the trans-golgi network when complexed with RMR2. |
| AT5G18610 | Encodes a receptor-like cytoplasmic kinase that is an immediate downstream component of the chitin receptor CERK1 and contributes to the regulation of chitin-induced immunity. |
| AT2G05940 | Encodes a receptor-like cytoplasmic kinase that phosphorylates the host target RIN4, leading to the activation of a plant innate immune receptor RPM1. |
| AT5G60900 | Encodes a receptor-like protein kinase. |
| AT1G71100 | Encodes a ribose 5-phosphate isomerase involved in the formation of uridine used for the synthesis of UDP-sugars. Mutants of this gene are affected in cellulose biosynthesis. |
| AT3G08720 | Encodes a ribosomal-protein S6 kinase. Gene expression is induced by cold and salt (NaCl). Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Phosphorylates specifically mammalian and plant S6 at 25 degrees C but not at 37 degrees C. Involved in translational up-regulation of ribosomal proteins. |
| AT2G01150 | Encodes a RING-H2 finger protein that is expressed in vascular tissue, root tips, embryos and pistils. |
| AT3G15070 | Encodes a RING-type E3 ligase that positively regulates CIN-like TCP activity to promote leaf development by mediating the degradation of the TCP repressor TIE1. |
| AT5G22000 | encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. Double mutant analyses with RHF1a suggests that RHF2a may be involved in targetting ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF2a is expressed in all four floral whorls and is present at ~8-fold higher levels than RHF1a in inflorescences by RT-PCR analyses. |
| AT5G18650 | Encodes a RING-type E3 ubiquitin ligase that interacts with and ubiquitinates MYB30, leads to MYB30 proteasomal degradation and downregulation of its transcriptional activity. Since MYB30 is a positive regulator of Arabidopsis HR and defence responses, MIEL1 is involved in the negative regulation of these processes. |
| AT4G31770 | Encodes a RNA lariat debranching enzyme required for embryogenesis. |
| AT1G30510 | Encodes a root-type ferredoxin:NADP(H) oxidoreductase. |
| AT1G73600 | Encodes a S-adenosyl-L-methionine-dependent phosphoethanolamine N-methyltransferase whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in roots. It catalyzes the three sequential P-base methylation of phosphoethanolamine to phosphocholine. Homologous biochemical function to NMT1 (At3g18000). Double mutants of NMT1 and NMT3 are defective in leaf, root, flower, seed, and pollen development. |
| AT4G17230 | Encodes a scarecrow-like protein (SCL13). Member of GRAS gene family. Regulated by heat shock. |
| AT5G46410 | Encodes a SCP1-like small phosphatase (SSP). Three SSPs form a unique group with long N-terminal extensions: AT5G46410 (SSP4), AT5G11860 (SSP5), AT4G18140 (SSP4b). SSP4 and SSP4b were localized exclusively in the nuclei, whereas SSP5 accumulated in both nuclei and cytoplasm. All three SSPs encodes active CTD phosphatases like animal SCP1 family proteins, with distinct substrate specificities: SSP4 and SSP4b could dephosphorylate both Ser2-PO(4) and Ser5-PO(4) of CTD, whereas SSP5 dephosphorylated only Ser5-PO(4). |
| AT4G18140 | Encodes a SCP1-like small phosphatase (SSP). Three SSPs form a unique group with long N-terminal extensions: AT5G46410 (SSP4), AT5G11860 (SSP5), AT4G18140 (SSP4b). SSP4 and SSP4b were localized exclusively in the nuclei, whereas SSP5 accumulated in both nuclei and cytoplasm. All three SSPs encodes active CTD phosphatases like animal SCP1 family proteins, with distinct substrate specificities: SSP4 and SSP4b could dephosphorylate both Ser2-PO(4) and Ser5-PO(4) of CTD, whereas SSP5 dephosphorylated only Ser5-PO(4). |
| AT3G04530 | Encodes a second Arabidopsis phosphoenolpyruvate carboxylase kinase gene product with a different expression pattern from PPCK1. Expression of the gene is upregulated by exposure of the plant to light and is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
| AT4G13930 | Encodes a serine hydroxymethyltransferase maximally expressed in root |
| AT1G08660 | Encodes a sialyltransferase-like protein that is localized to the Golgi apparatus and is involved in pollen tube growth and pollen germination. |
| AT5G63440 | Encodes a single copy protein in Arabidopsis containing a DUF167 domain that is conserved in eukaryotes. Genetically CSU suppresses mutations in COP1. In vitro, it interacts with CACTIN and in vivo with CCA1. CSU4 promotes photomorphogenesis via negative regulation of CCA1 and PIF4 expression. |
| AT5G01075 | Encodes a small ER-localized protein that is strongly expressed in seeds and regulates both embryo development and accumulation of storage compounds. At the cellular level, TWS1 is responsible for cuticle deposition on epidermal cells and organization of the endomembrane system. |
| AT5G03210 | Encodes a small polypeptide contributing to resistance to potyvirus. |
| AT1G67360 | Encodes a small rubber particle protein homolog. Plays dual roles as positive factors for tissue growth and development and in drought stress responses. |
| AT2G47780 | Encodes a small rubber particle protein homolog. Plays dual roles as positive factors for tissue growth and development and in drought stress responses. |
| AT1G18835 | Encodes a small zinc finger protein whose overexpression induces ectopic meristem formation on leaf margins. |
| AT2G30360 | Encodes a SOS2-like protein kinase that is a member of the CBL-interacting protein kinase family.Loss of function mutants show a decrease in sensitivity to high pH.Phosphorylates AHA2, a plasma membrane H+ ATPase.This phosphorylation appears to regulate the activity of the proton transporter. |
| AT5G23450 | Encodes a sphingosine kinase that specifically phosphorylates D-erythro-dihydrosphingosine (DHS), but not N-acetyl-DHS or D-threo-DHS. It also also phosphorylates D-erythro-sphingosine, trans-4, trans-8-sphingadienine and phytosphingosine. |
| AT1G11720 | Encodes a starch synthase that in addition to its role in starch biosynthesis also has a negative regulatory function in the biosynthesis of transient starch. The protein apparently contains a starch-binding domain (SBD). |
| AT2G29390 | Encodes a sterol 4-alpha-methyl-oxidase, specifically a 4-alpha-methyl-delta-7-sterol-4alpha-methyl-oxidase. |
| AT1G20330 | Encodes a sterol-C24-methyltransferases involved in sterol biosynthesis. Mutants display altered sterol composition, serrated petals and sepals and altered cotyledon vascular patterning as well as ectopic endoreduplication. This suggests that suppression of endoreduplication is important for petal morphogenesis and that normal sterol composition is required for this suppression. |
| AT2G22740 | Encodes a SU(VAR)3-9 homolog, a methyltransferase involved in histone methylation. The protein was shown to bind to methylated cytosines of CG, CNG and CNN motifs but has a preference for the latter two. This is a member of a subfamily of SET proteins that shares a conserved SRA domain. |
| AT5G67360 | Encodes a subtilisin-like serine protease essential for mucilage release from seed coats. |
| AT3G05690 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. |
| AT1G72830 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. Expression is upregulated in the shoot of cax1/cax3 mutant. |
| AT2G46225 | Encodes a subunit of the WAVE complex. The WAVE complex is required for activation of ARP2/3 complex which functions in actin microfilament nucleation and branching. One of four ABI-like proteins. |
| AT2G02860 | encodes a sucrose transporter in sieve elements and a number of sink tissues and cell types. Gene expression is induced by wounding. |
| AT5G27350 | Encodes a sugar-porter family protein that is induced during leaf senescence. The increase in its gene expression during leaf senescence is paralleled by an accumulation of monosaccharides. |
| AT5G27360 | Encodes a sugar-porter family protein that unlike the closely related gene, SFP1, is not induced during leaf senescence. |
| AT1G78000 | Encodes a sulfate transporter that can restore sulfate uptake capacity of a yeast mutant lacking sulfate transporter genes. |
| AT5G13550 | Encodes a sulfate transporter. |
| AT5G07010 | Encodes a sulfotransferase that acts specifically on 11- and 12-hydroxyjasmonic acid. Transcript levels for this enzyme are increased by treatments with jasmonic acid (JA), 12-hydroxyJA, JA-isoleucine, and 12-oxyphytodienoic acid (a JA precursor). |
| AT1G13420 | Encodes a sulfotransferase. Unlike the related ST4A protein (At2g14920), in vitro experiments show that this enzyme does not act brassinosteroids. ST4B is expressed in the roots and transcript levels rise in response to cytokinin treatment. |
| AT3G57870 | Encodes a SUMO ligase that directs the attachment of the small protein SUMO to target proteins via an isopeptide bond. This enzyme is localized to the nucleus and plants with reduced levels of this protein show higher sensitivity to ABA in root growth inhibition assays. It has high similarity to the yeast UBC9 SUMO ligase and is sometimes referred to by that name. |
| AT3G51550 | Encodes a synergid-expressed, plasma-membrane localized receptor-like kinase that accumulates asymetrically in the synergid membrnane at the filiform apparatus and mediates male-female gametophyte interactions during pollen tube reception. Also involved in powdery mildew infection. Mutants show faster root elongation under dim light, the protein is required for intracellular accumulation of AHA2 under dim-light growth conditions. Positively regulates flowering by modulating the transcript accumulation and mRNA alternative splicing of certain flowering-related genes, including FLOWERING LOCUS C (FLC) and its homolog MADS AFFECTING FLOWERING (MAF). However, the RALF1 ligand negatively regulates flowering compared with FER. |
| AT5G44260 | Encodes a Tandem CCCH Zinc Finger protein. Interacts and co-localizes with MARD1 and RD21A in processing bodies (PBs) and stress granules (SGs). |
| AT3G12560 | Encodes a telomeric DNA-binding protein. |
| AT5G59430 | Encodes a telomeric repeat binding protein with a DNA binding domain at its C terminus. The DNA binding domain has a preference for GGTTTAG sequences and at least five of these repeats are required for recognition by a nearly full-length TRP1 protein. |
| AT5G58070 | Encodes a temperature-induced lipocalin TIL1. Involved in thermotolerance. Peripherally associated with plasma membrane. |
| AT1G02880 | Encodes a thiamine pyrophosphokinase capable of producing thiamine pyrophosphate from free thiamine. |
| AT1G76080 | Encodes a thioredoxin like protein. Localizes to the chloroplast and is redistributed to the chloroplast envelope under heat stress. It is involved in non host resistance and thermotolerance. |
| AT5G66170 | Encodes a thiosulfate sulfurtransferase/rhodanese. |
| AT2G36830 | Encodes a tonoplast intrinsic protein, which functions as water channel. It has also been shown to be able to facilitate the transport of urea and hydrogen peroxide. Highly expressed in vascular tissues of the root, stem, cauline leaves and flowers but not in the apical meristems. |
| AT5G47560 | Encodes a tonoplast malate/fumarate transporter. |
| AT2G43330 | Encodes a tonoplast-localized myo-inositol exporter, involved in efflux of myo-inositol from the vacuole to the cytosol. The gene is ubiquitously expressed. Reduced root growth in knock-out mutants grown on low inositol agar medium. |
| AT3G25795 | Encodes a trans-acting siRNA that is phosphate starvation-upregulated and activated by PAP1 (MYB75). Has been identified as a translated small open reading frame by ribosome profiling. |
| AT5G49450 | Encodes a transcription activator is a positive regulator of plant tolerance to salt, osmotic and drought stresses. |
| AT1G19850 | Encodes a transcription factor (IAA24) mediating embryo axis formation and vascular development. Similar to AUXIN RESPONSIVE FACTOR 1 (ARF1) shown to bind to auxin responsive elements (AREs), and to the maize transcriptional activator VIVIPAROUS 1( VP1). In situ hybridization shows expression in provascular tissue of embryos, the emerging shoot primordia, then is restricted to provascular tissue, and in the root central vascular cylinder. |
| AT1G56010 | Encodes a transcription factor involved auxin-mediated lateral root formation. Acts downstream of TIR1 and is regulated post-transcriptionally by miRNA164 and by SINAT5-dependent ubiquitination. |
| AT5G05410 | Encodes a transcription factor that specifically binds to DRE/CRT cis elements (responsive to drought and low-temperature stress). Belongs to the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2A). There are eight members in this subfamily including DREB2B. The protein contains one AP2 domain. Overexpression of transcriptional activation domain of DREB2A resulted in significant drought stress tolerance but only slight freezing tolerance in transgenic Arabidopsis plants. Microarray and RNA gel blot analyses revealed that DREB2A regulates expression of many water stress?inducible genes. |
| AT2G41630 | Encodes a transcription factor, TFIIB1, that plays important roles in pollen tube growth, guidance, and reception as well as endosperm development and is partially functionally different from AtTFIIB2 and AtTFIIB3/AtpBRP2. |
| AT2G46040 | Encodes a transcriptional activator that is involved in pollen development. ARID1 is expressed in nuclear bodies of microspore, vegetative and generative cells, and binds to and activates DUO during microgametogenesis. |
| AT1G61660 | Encodes a transcriptional activator that regulates the expression of genes by binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT1G72050 | Encodes a transcriptional factor TFIIIA required for transcription of 5S rRNA gene. 5S rRNA is the smallest constituent of the ribosome. Work on one of the gene models AT1G72050.2 showed that it encodes a protein with nine Cys(2)-His(2)-type zinc fingers, a characteristic feature of TFIIIA proteins. AT1G72050.2 also contains a 23 amino acid spacer between fingers 1 and 2, a 66 amino acid spacer between fingers 4 and 5, and a 50 amino acid non-finger C-terminal tail. in vitro assay demonstrated that AT1g72050.2 binds to 5S rDNA and efficiently stimulates the transcription of 5S rRNA. AT1g72050.2 also binds to 5S rRNA in vitro. AT1g72050.2 is located at several nuclear foci including the nucleolus and is absent from the cytoplasm. |
| AT5G16600 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
| AT4G28910 | Encodes a transcriptional repressor that functions in the jasmonic acid (JA) signalling pathway, root development, and has a key role in leaf development, likely due to the transcriptional regulation of CYCD3 expression. Transcriptional repressor that accumulates in short-day conditions. Regulates together with FRS7 and FRS12 glucosinolate biosynthesis. |
| AT5G52250 | Encodes a transducin protein whose gene expression is induced by UV-B. This induction is reduced in hy5 mutant and may be a target of HY5 during UV-B response. Functions as a repressor of UV-B signaling. |
| AT5G46700 | Encodes a transmembrane protein of the tetraspanin (TET) family, one of 17 members found in Arabidopsis. Double mutant analysis showed that TRN1 and TRN2 act in the same pathway. Required for the maintenance of both the radial pattern of tissue differentiation in the root and for the subsequent circumferential pattern within the epidermis. |
| AT5G04040 | Encodes a triacylglycerol lipase that is involved in storage lipid breakdown during seed germination. The mutant plant exhibits a much slower rate of postgerminative growth than the wild type. |
| AT3G16260 | Encodes a tRNase Z. |
| AT3G10220 | Encodes a tubulin-binding cofactor. Homozygous mutant plants are embryo lethal. Heterozygous mutant plants showed increased ploidy and higher numbers of spindles and phragmoplasts, suggesting a role in cell division. |
| AT2G24850 | Encodes a tyrosine aminotransferase that is responsive to treatment with jasmonic acid. |
| AT1G08030 | Encodes a tyrosylprotein sulfotransferase (TPST). This protein is a 500-aa type I transmembrane protein that shows no sequence similarity to animal TPSTs. Activity confirmed by protein expression in yeast. TPST is expressed throughout the plant body, and the highest levels of expression are in the root apical meristem. TPST acts in the auxin pathway to maintain postembryonic root stem cell niche by defining the expression of the PLETHORA stem cell transcription factor genes. A loss-of-function mutant TPST displayed a marked dwarf phenotype accompanied by stunted roots, pale green leaves, reduction in higher order veins, early senescence, and a reduced number of flowers and siliques. TPST suppresses ethylene production through the action of PSK (phytosulfokine). |
| AT5G63970 | Encodes a ubiquitin ligase that is an essential upstream modulator of JA signaling in response to various stimuli. |
| AT1G19270 | Encodes a ubiquitin-activated peptidase that is a member of a small (7 member) ubiquitin binding protein family. It appears to play a role in regulation of endoreduplication in leaf epidermal tissue. Together with CUC2/CUC3-UBP15 part of a regulatory module which controls the initiation of axillary meristems, thereby determining plant architecture. |
| AT4G17895 | Encodes a ubiquitin-specific protease. |
| AT4G30890 | Encodes a ubiquitin-specific protease. |
| AT3G11840 | Encodes a U-box-domain-containing E3 ubiquitin ligase that acts as a negative regulator of PAMP-triggered immunity. |
| AT2G44790 | Encodes a uclacyanin, a protein precursor that is closely related to precursors of stellacyanins and a blue copper protein from pea pods. |
| AT5G14345 | Encodes a Uclacyanin/Basic blue family protein |
| AT4G30440 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. |
| AT3G23820 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. |
| AT1G24100 | Encodes a UDP-glucose:thiohydroximate S-glucosyltransferase, involved in glucosinolate biosynthesis |
| AT3G11340 | Encodes a uridine diphosphate-dependent glucosyltransferase that conjugates isoleucic acid and modulates plant defense via glucosylation of N-hydroxypipecolic acid. |
| AT5G40850 | Encodes a urophorphyrin III methylase that catalyzes S-adenosyl-L-methionine-dependent transmethylation in a multistep process involving the formation of a covalently linked complex with S-adenosyl-L-methionine. |
| AT2G26540 | Encodes a uroporphyrinogen-III synthase involved in tetrapyrrole biosynthesis. The protein localizes to the chloroplast. Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
| AT4G15920 | Encodes a vacuolar fructose transporter expressed in parenchyma and xylem that controls leaf fructose content. When its expression is reduced, fructose accumulates in leaves. |
| AT1G12240 | Encodes a vacuolar invertase betaFruct4. betaFruct4 is transported from the endoplasmic reticulum through the intermediate compartments as a membrane protein. The N-terminal cytoplasmic domain contains multiple sequence motifs that are involved at various stages in the trafficking of betaFruct4 from the ER to the central vacuole. |
| AT3G05030 | Encodes a vacuolar K+/H+ exchanger essential for active K+ uptake at the tonoplast and involved in regulating stomatal closure. |
| AT3G03090 | Encodes a vacuolar membrane-localized glucose transporter that can also transport fructose. Mutations in these gene have effects on seed germination and time to flowering. |
| AT4G32940 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteinases that is expressed in vegetative organs and is upregulated in association with various types of cell death and under stressed conditions. They are essential in processing seed storage proteins and for mediating the susceptible response of toxin-induced cell death. |
| AT2G14740 | Encodes a vacuolar sorting receptor that participates in vacuolar sorting in vegetative tissues and in seeds. |
| AT3G01280 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. |
| AT5G67500 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. |
| AT1G16120 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
| AT4G29860 | Encodes a WD repeat protein with seven WD repeat motifs, predicted to function in protein-protein interaction. Mutations caused defects in both embryo and seedling development. |
| AT4G30280 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. |
| AT1G24625 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT5G59820 | Encodes a zinc finger protein involved in high light and cold acclimation. Overexpression of this putative transcription factor increases the expression level of 9 cold-responsive genes and represses the expression level of 15 cold-responsive genes, including CBF genes. Also, lines overexpressing this gene exhibits a small but reproducible increase in freeze tolerance. Because of the repression of the CBF genes by the overexpression of this gene, the authors speculate that this gene may be involved in negative regulatory circuit of the CBF pathway. |
| AT5G60850 | Encodes a zinc finger protein. |
| AT2G32930 | Encodes a zinc finger protein. |
| AT5G06530 | Encodes ABCG22, an ABC transporter gene. Mutation results in increased water transpiration and drought susceptibility. |
| AT2G19450 | Encodes Acyl-CoA:diacylglycerol acyltransferase (DGAT) catalyzes the final step of the triacylglycerol synthesis pathway. An insertion mutation in the TAG1 gene results in altered lipid phenotype. Role in senescence and seed development. Its preferred substrate is linolenoyl-CoA (C18:3-CoA). |
| AT2G14750 | Encodes adenosine-5'-phosphosulfate kinase. Provides activated sulfate for sulfation of secondary metabolites, including the glucosinolates. Essential for pollen viability. |
| AT5G51760 | Encodes AHG1 (ABA-hypersensitive germination 1), a putative protein phosphatase 2C (PP2C). Expressed in seeds. AHG1 functions in seed development and germination. |
| AT3G25780 | Encodes allene oxide cyclase, one of the enzymes involved in jasmonic acid biosynthesis. One of four genes in Arabidopsis that encode this enzyme. mRNA expression is upregulated in senescing leaves. Note: Nomenclature for Arabidopsis allene oxide cyclase 3 (AOC3, AT3G25780) gene is based on Stenzel et al. 2003 Plant Molecular Biology 51:895-911. AOC3 (AT3G25780) is also referred to as AOC2 in He et al. 2002 Plant Physiology, 128:876-884. |
| AT3G25760 | encodes allene oxide cyclase. One of four genes in Arabidopsis that encode this enzyme, which catalyzes an essential step in jasmonic acid biosynthesis. Gene expression is induced during senescence, a process that involves jasmonic acid signalling pathway. |
| AT3G25770 | Encodes allene oxide cyclase. One of four genes in Arabidopsis that encode this enzyme, which catalyzes an essential step in jasmonic acid biosynthesis. Gene expression is induced during senescence, a process that involves jasmonic acid signalling pathway. Note: Nomenclature for Arabidopsis allene oxide cyclase 2 (AOC2, AT3G25770) gene is based on Stenzel et al. 2003 Plant Molecular Biology 51:895-911. AOC2 (AT3G25770) is also referred to as AOC3 in He et al. 2002 Plant Physiology, 128:876-884. |
| AT1G13280 | Encodes allene oxide cyclase. One of four genes in Arabidopsis that encode this enzyme, which catalyzes an essential step in jasmonic acid biosynthesis. Gene expression is reduced during senescence, a process that involves jasmonic acid signalling pathway. |
| AT3G05830 | Encodes alpha-helical IF (intermediate filament)-like protein.NEAP1 is a member of a small family containing coiled-coil domains, a nuclear localization signal and a C-terminal predicted transmembrane domain. It localizes to the nuclear periphery. Mutants have altered nuclear morphology and chromatin structure. |
| AT3G25610 | Encodes aminophospholipid ATPase10 (ALA10), a P4-type ATPase flippase that internalizes exogenous phospholipids across the plasma membrane. |
| AT4G16144 | Encodes AMSH3, a deubiquitinating enzyme that hydrolyzes K48- and K63-linked ubiquitin chains in vitro. Required for intracellular trafficking and vacuole biogenesis. |
| AT2G47760 | Encodes an α-1,3-mannosyltransferase. Plants with mutations in the ALG3 protein have abnormal gylcoslation profiles. They also exhibit abnormal responses to MAMPs possibly because the glycan properties of FL22 are affected. |
| AT2G41310 | Encodes an A- type response Regulator that is primarily expressed in the root and is involved in cytokinin-mediated signalling. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT5G59550 | Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants. |
| AT4G34000 | Encodes an ABA-responsive element-binding protein with similarity to transcription factors that is expressed in response to stress and abscisic acid. |
| AT5G24780 | encodes an acid phosphatase similar to soybean vegetative storage proteins. Gene expression is induced by wounding and jasmonic acid. |
| AT3G18780 | Encodes an actin that is constitutively expressed in vegetative structures but not pollen. ACT2 is involved in tip growth of root hairs. |
| AT1G51170 | Encodes an active AGC VIII protein kinase that interacts with the putative transcription factor ATS and regulates planar growth during integument development in the ovule. Mutants exhibit ectopic growth in filaments and petals, as well as aberrant embryogenesis. |
| AT1G18500 | Encodes an active Arabidopsis isopropylmalate synthase IPMS1. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS1 can be compensated by a second isopropylmalate synthase gene IPMS2 (At1g74040). |
| AT3G05020 | encodes an acyl carrier protein expressed in leaves, roots, and dry seeds. Protein is not regulated by light. |
| AT1G08510 | Encodes an acyl-acyl carrier protein thioesterase. Hydrolyzes primarily saturated acyl-ACPs with chain lengths that vary between 8 and 18 carbons. Involved in saturated fatty acid synthesis. Nuclear-encoded, plastid-targeted globular protein that is functional as dimer. |
| AT2G35690 | Encodes an acyl-CoA oxidase. Involved in jasmonate biosynthesis. Expressed uniformly in seedlings and throughout development. |
| AT2G45670 | Encodes an acyl-CoA: lysophosphatidylethanolamine acyltransferase with 20:0-CoA being the best acyl donor. Mutations adversely affect the growth of plants and result in decreased lipid content in roots and seeds. |
| AT1G70330 | encodes an adenosine transporter that catalyze a proton-dependent adenosine transport. |
| AT5G18200 | encodes an adenylyltransferase |
| AT1G44170 | Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. It is also able to oxidize beta-unsaturated aldehydes, but not aromatic aldehydes. Activity of ALDH3H1 is NAD +-dependent. |
| AT4G34240 | Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. It is also able to oxidize beta-unsaturated aldehydes, but not aromatic aldehydes. ALDH3I1 was able to use both NAD+ and NADP+ as cofactors. |
| AT3G06500 | Encodes an alkaline/neutral invertase which localizes in mitochondria. It may be modulating hormone balance in relation to the radicle emergence. Mutants display severely reduced shoot growth and reduced oxygen consumption. Mutant root development is not affected as reported for A/N-InvA mutant (inva) plants. |
| AT2G15390 | Encodes an alpha-(1,2)-fucosyltransferase. |
| AT3G03990 | Encodes an alpha/beta hydrolase essential for strigolactone signaling. Degradation of the protein is promoted by strigolactone. |
| AT3G11900 | encodes an amino acid transporter that transports aromatic and neutral amino acids, IAA, and 2,4-D. Expressed in all tissues with highest abundance in flowers and cauline leaves. a member of a small gene family in Arabidopsis and represents a new class of amino acid transporters. |
| AT2G26430 | Encodes an ania-6a type arginine-rich cyclin which confers tolerance to LiCl and NaCl when expressed in yeast. |
| AT1G13260 | Encodes an AP2/B3 domain transcription factor which is upregulated in response to low temperature. It contains a B3 DNA binding domain. It has circadian regulation and may function as a negative growth regulator. |
| AT5G61590 | Encodes an AP2/ERF-type transcription factor that is preferentially expressed in the epidermis and induced by darkness and negatively regulates cuticular wax biosynthesis. |
| AT5G51050 | Encodes an APC isoform in Arabidopsis, a calcium-dependent mitochondrial ATP-Mg/Pi transporter. |
| AT5G07320 | Encodes an APC isoform in Arabidopsis, a calcium-dependent mitochondrial ATP-Mg/Pi transporter. |
| AT1G03000 | Encodes an apparent ATPase similar to yeast and human protein required for peroxisomal biogenesis. May facilitate recycling of PEX5, the peroxisomal matrix protein receptor, and thereby promote peroxisomal matrix protein import. |
| AT3G16857 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
| AT3G12700 | Encodes an aspartic protease has an important regulatory function in chloroplasts that not only influences photosynthetic carbon metabolism but also plastid and nuclear gene expression. |
| AT5G02190 | encodes an aspartic protease, has an important role in determining cell fate during embryonic development and in reproduction processes. The loss-of-function mutation of PCS1 causes degeneration of both male and female gametophytes and excessive cell death of developing embryos during torpedo stage. |
| AT1G76500 | Encodes an AT hook domain containing protein. Identified in a screen of activation tagged lines that suppress the long-hypocotyl phenotype of a weak phyB allele. Affects cell elongation in the hypocotyl and leaves.Acts redundantly with ESC to modulate hypocotyl growth inhibition in response to light |
| AT3G15500 | Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3. |
| AT5G01500 | encodes an ATP/ADP carrier that is located to the thylakoid membrane involved in providing ATP during thylakoid biogenesis and turnover |
| AT1G80300 | Encodes an ATP/ADP transporter. |
| AT2G37280 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
| AT4G27310 | Encodes an atypical B-box domain protein that negatively regulates photomorphogenic development by interfering with the binding of the transcription factor HY5 to target gene promoters. Degradation of BBX28 in darkness is dependent on COP1 and occurs via the 26S proteasome pathway. BBX28 acts as a key factor in the COP1-HY5 regulatory hub by maintaining proper HY5 activity to ensure normal photomorphogenic development in plants. Interacts with CO via B-box domain resulting in decreased FT expression and delayed flowering. |
| AT2G47000 | Encodes an auxin efflux transmembrane transporter that is a member of the multidrug resistance P-glycoprotein (MDR/PGP) subfamily of ABC transporters. Functions in the basipetal redirection of auxin from the root tip. Exhibits apolar plasma membrane localization in the root cap and polar localization in tissues above and is involved in root hair elongation. |
| AT4G37770 | Encodes an auxin inducible ACC synthase. |
| AT2G38120 | Encodes an auxin influx transporter. AUX1 resides at the apical plasma membrane of protophloem cells and at highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning. Shoot supplied ammonium targets AUX1 and inhibits lateral root emergence. |
| AT3G62980 | Encodes an auxin receptor that mediates auxin-regulated transcription. It contains leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation. Mutations in TIR1 block auxin stimulation of flavonoid synthesis. |
| AT1G19220 | Encodes an auxin response factor that contains the conserved VP1-B3 DNA-binding domain at its N-terminus and the Aux/IAA-like domains III and IV present in most ARFs at its C-terminus. The protein interacts with IAA1 (yeast two hybrid) and other auxin response elements such as ER7 and ER9 (yeast one hybrid). ARF19 protein can complement many aspects of the arf7 mutant phenotype and , together with ARF7, is involved in the response to ethylene. In the arf7 arf19 double mutant, several auxin-responsive genes (e.g. IAA5, LBD16, LBD29 and LBD33) are no longer upregulated by auxin. |
| AT2G40830 | Encodes an E3 ubiquitin ligase for the GA-receptor GID1 that functions as a negative regulator of GA signaling in seedlings and seeds by inducing ubiquitin-dependent proteolysis of GID1s. Tyr321 phosphorylation of GARU by TAGK2 inactivates GARU. |
| AT3G59440 | Encodes an endomembrane localized member of the CML subfamily VII. Contains a canonical CaM domain and unique N-terminal extension that distinguishes it from other members of the subfamily. |
| AT5G47990 | Encodes an endomembrane system-expressed member of the CYP705A family of cytochrome P450 enzymes. It appears to catalyze the addition of a double bond to thalian-diol at carbon 15. Reduced levels of THAD expression lead to a build up of thalian-diol in root extracts. thad1-1 mutants also have longer roots than wild type seedlings and show altered gravitropic responses. |
| AT1G79610 | Encodes an endosomal Na(+)/H(+) antiporter: AT1G54370 (NHX5), AT1G79610 (NHX6). Double knockout nhx5 nhx6 showed reduced growth, with smaller and fewer cells and increased sensitivity to salinity. |
| AT2G18700 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. |
| AT1G68020 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain and a trehalose phosphatase (TPP)-like domain. It can complement a yeast mutant lacking both of these activities suggesting that this is a bifunctional enzyme. |
| AT1G23870 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. |
| AT1G70290 | Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants. |
| AT1G06410 | Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants. |
| AT3G44300 | Encodes an enzyme that catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (nitrile aminohydrolase, EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. Mutants have reduced sensitivity to IAN and are sensitive to IAA. This enzyme likely participates in other non-auxin-related metabolic pathways. |
| AT3G62130 | Encodes an enzyme that decomposes L-cysteine into pyruvate, H2S, and NH3. |
| AT5G13690 | Encodes an enzyme that is predicted to act as an alpha-N-acetylglucosaminidase (NAGLU). An naglu mutant arrests early in seed development but does not appear to have male or female gametophytic defects. Transcript levels for this gene are increased during reproductive development. |
| AT5G04360 | Encodes an enzyme thought to be involved in the hydrolysis of the α-1,6 linkages during starch degradation in seed endosperm. However, a knockout mutant of Arabidopsis lacking limit dextrinase has normal rates of starch degradation in the leaf at night, indicating that more than one isoamylases might be involved in this process. |
| AT2G26260 | Encodes an enzyme with 3β-hydroxysteroid dehydrogenase/C4-decarboxylase activity in vitro. The activity of the enzyme was determined using microsomal extracts of yeast overexpressing the Arabidopsis gene. Cytosolic fractions failed to be associated to the activity, leading to the speculation that the enzyme is membrane-bound. |
| AT5G05290 | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT2G25490 | Encodes an F-box protein involved in the ubiquitin/proteasome-dependent proteolysis of EIN3. |
| AT1G07510 | encodes an FtsH protease that is localized to the mitochondrion |
| AT2G26140 | Encodes an FtsH protease that is localized to the mitochondrion. Loss of function results in increased determinacy of the meristem that is exacerbated when plants are grown at higher temperatures. |
| AT5G54510 | Encodes an IAA-amido synthase that conjugates Ala, Asp, Phe, and Trp to auxin. Lines overexpressing this gene accumulate IAA-ASP and are hypersensitive to several auxins. Identified as a dominant mutation that displays shorter hypocotyls in light grown plants when compared to wild type siblings. Protein is similar to auxin inducible gene from pea (GH3). |
| AT4G27260 | encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. It is involved in camalexin biosynthesis via conjugating indole-3-carboxylic acid (ICA) and cysteine (Cys). |
| AT2G38060 | Encodes an inorganic phosphate transporter (PHT4;2). |
| AT4G18010 | Encodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not appear to be active against phosphatidylinositol 4,5 bisphosphate. Overexpression of this gene renders plants insensitive to ABA in germination and growth assays. |
| AT1G05630 | Encodes an inositol polyphosphate 5-phosphatase with phosphatase activity toward only Ins(1,4,5)P3. Induced in response to ABA and wounding treatments. Expressed in young seedlings and flowers, while no transcripts were detectable in maturated roots, stems, and rosette leaves Modulates the development of cotyledon veins through its regulation of auxin homeostasis. Involved in blue light light?stimulated increase in cytosolic calcium ion. |
| AT5G42810 | Encodes an inositol tetra-/pentaphosphate 2-kinase, involved in the biosynthesis of phytic acid, a regulator of intracellular signaling, a highly abundant animal antinutrient, and a phosphate and mineral storage compound in plant seeds. Is also required for growth and modulates phosphate homeostasis at the transcriptional level. |
| AT2G20120 | Encodes an integral membrane protein of unknown function, highly conserved between plants and bacteria; is likely to be involved in a mechanism that negatively regulates the differentiation of vascular tissue in the stem. Mutants display a dramatic increase in vascular tissue development in the stem in place of the interfascicular region that normally separates the vascular bundles. |
| AT1G64150 | Encodes an integral thylakoid membrane protein that is required for normal operation of oxygen-evolving complex (as evidenced by oxygen evolution rates) and for manganese incorporation. PAM71 belongs to a small gene family in Arabidopsis comprising five members. PAM71 is well conserved in the green lineage and shares homology with putative Ca2+/H+ exchangers from yeast (Saccharomyces cerevisiae) (GDT1) and human (Homo sapiens) (TMEM165). |
| AT5G18480 | Encodes an IPC (inositol phosphorylceramide) glucuronosyltransferase. Defects in transmission via the pollen are evident but the defect in transmission through the male gametophyte is not due to improper pollen development or inability of pollen tubes to germinate and grow. Using a pollen specific complementation strategy to obtain homozygotes, loss of function results in constitutive hypersensitive response and severe growth defects. |
| AT2G39930 | Encodes an isoamylase-type debranching enzyme. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. Mutants have reduced starch content and abnormally structured amylopectins and phytoglycogens. It has been postulated that AtISA1 interacts with AtISA2 to form the Iso1 complex. |
| AT3G21240 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, ferulic acid, 5-OH-ferulic acid and cinnamic acid. At4CL2 was unable to use sinapic acid as substrate. |
| AT5G64210 | encodes an isoform of alternative oxidase, which is expressed in rosettes, stems, and roots. Transcript accumulates in dry seeds and decreased upon germination and is not affected by actinomycin A. Protein is localized to mitochondria. |
| AT5G46180 | Encodes an ornithine delta-aminotransferase that is transcriptionally up-regulated in young seedlings and in response to salt stress. It is unlikely to play a role in salt-stress-induced proline accumulation, however, it appears to participate in arginine and ornithine catabolism. |
| AT4G39030 | Encodes an orphan multidrug and toxin extrusion transporter. Essential component of salicylic acid-dependent signaling for disease resistance. Member of the MATE-transporter family. Expression induced by salicylic acid. Mutants are salicylic acid-deficient. |
| AT4G26455 | Encodes an outer nuclear membrane protein that anchors RanGAP1 to the nuclear envelope. It interacts with SUN proteins and is required for maintaining the elongated nuclear shape of epidermal cells. |
| AT3G48990 | Encodes an oxalyl-CoA synthetase and is required for oxalate degradation, for normal seed development, and for defense against an oxalate-producing fungal pathogen. |
| AT1G72280 | Encodes an oxidoreductin required for oxidative protein folding in the ER and exists in two distinct oxidized isoforms (Ox1 and Ox2), which are determined by the formation or breakage of the putative regulatory disulfide. AtERO1 is mainly present in the Ox1 redox state. |
| AT5G48010 | Encodes an oxidosqualene cyclase involved in the biosynthesis of thalianol, a tricyclic triterpenoid of unknown function. Overexpression of THAS leads to dwarfing in the aerial tissues of Arabidopsis plants, but increases their root length. THAS is part of a small operon-like cluster of genes (with At5g48000 (THAH) and At5g47990 (THAD)) involved in thalianol metabolism. |
| AT4G31500 | Encodes an oxime-metabolizing enzyme in the biosynthetic pathway of glucosinolates. Is required for phytochrome signal transduction in red light. Mutation confers auxin overproduction. |
| AT5G67250 | Encodes an SKP1 interacting partner (SKIP2).Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,2, and 3. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes. |
| AT3G61350 | Encodes an SKP1 interacting partner (SKIP4). |
| AT1G08910 | Encodes an SP-RING domain containing protein that functions in sumolaytion and is involved in positive regulation of sulfur metabolism and stress response. |
| AT1G63010 | Encodes an SPX domain protein that transports Pi into the vacuole and is essential for phosphate homeostasis. |
| AT3G22370 | Encodes AOX1a, an isoform of alternative oxidase that is expressed in rosettes, flowers, and root. The alternative oxidase of plant mitochondria transfers electrons from the ubiquinone pool to oxygen without energy conservations. It is regulated through transcriptional control and by pyruvate. Plays a role in shoot acclimation to low temperature. Also is capable of ameliorating reactive oxygen species production when the cytochrome pathway is inhibited. AOX1a also functions as a marker for mitochondrial retrograde response. |
| AT2G30020 | Encodes AP2C1. Belongs to the clade B of the PP2C-superfamily. Acts as a MAPK phosphatase that negatively regulates MPK4 and MPK6. |
| AT4G09030 | Encodes arabinogalactan protein (AGP10). |
| AT5G11740 | Encodes arabinogalactan protein (AGP15). |
| AT2G46330 | Encodes arabinogalactan protein (AGP16). |
| AT5G10430 | Encodes arabinogalactan-protein (AGP4) that is expressed in female reproductive tissues. It is involved in promoting degeneration of the persistent synergid after fertilization. In mutant ovules, the persistent synergid does not degrade resulting in polytuby. |
| AT1G69440 | Encodes ARGONAUTE7, a member of the ARGONAUTE family, characterised by the presence of PAZ and PIWI domains. Involved in the regulation of developmental timing. Required for the accumulation of TAS3 ta-siRNAs but not for accumulation of miR171, miR173, miR390 or mi391. Localized in mature rosette leaves and floral buds. |
| AT5G65010 | Encodes asparagine synthetase (ASN2). |
| AT1G62800 | Encodes aspartate aminotransferase (Asp4). |
| AT2G46980 | Encodes ASY3, a coiled-coil domain protein that is required for normal meiosis. |
| AT3G44200 | Encodes AtNek5, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.Interacts physically with plant kinesins ARK1 and ARK2. Mutants show defects in root epidermal cell morphology, trichome branching and other epidermal cell abnormalities suggesting a rol e in epidermal cell differentiation. NEK6 co-localizes with cortical microtubules. |
| AT3G26690 | Encodes AtNUDT13, a mitochondrial Nudix hydrolase specific for long-chain diadenosine polyphosphates. |
| AT3G22890 | encodes ATP sulfurylase, the first enzyme in the sulfate assimilation pathway of Arabidopsis. It may also participate in selenium metabolism. |
| AT3G13170 | Encodes AtSPO11-1, one of the three Arabidopsis homologues of the archaeal DNA topoisomerase VIA subunit (topo VIA). Required for meiotic recombination. AtSPO11-1 and AtSPO11-2 have overlapping functions (i.e. both required for meiotic recombination) whereas AtSPO11-3 functions in DNA replication. AtSPO11-1 accumulates in foci in early G2. At 1 h post-S phase, no foci are observed, but by 3 h a majority (80%) of meiocytes at this time point contain >50 foci. However, by 5 h, AtSPO11-1 foci are no longer detectable. This suggests that the protein undergoes a rapid cycle of accumulation and disappearance in meiocytes over a period of between 1 and 5 h post-S phase. |
| AT1G74020 | Encodes AtSS-2 strictosidine synthase. |
| AT4G01470 | Encodes AtTIP1;3, functions as water and urea channels in pollen. |
| AT4G18160 | Encodes AtTPK3 (KCO6), a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK3 is found in the thylakoid stromal lamellae. May form homomeric ion channels in vivo. It modulates the partitioning of the proton motive force (pmf) between the delta psi and delta pH in chloroplasts in vivo at physiological light intensities. Vacuolar K+-conducting TPC1 and TPK1/TPK3 channels act in concert to provide for Ca2+- and voltageinduced electrical excitability to the central organelle of plant cells. |
| AT5G03470 | Encodes B' regulatory subunit of PP2A (AtB'alpha), putative size of 57 kDa.Functions redundantly with the beta subunit do maintain sister chromatid cohesion during meiosis. |
| AT5G60880 | Encodes BASL (BREAKING OF ASYMMETRY IN THE STOMATAL LINEAGE), a regulator of asymmetric divisions. In asymmetrically dividing stomatal-lineage cells, BASL accumulates in a polarized crescent at the cell periphery before division, and then localizes differentially to the nucleus and a peripheral crescent in self-renewing cells and their sisters after division. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT1G69010 | Encodes BES1-INTERACTING MYC-LIKE 2 (BIM2), a PAR1 (PHYTOCHROME RAPIDLY REGULATED 1)-interacting protein that positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT3G09260 | Encodes beta-glucosidase.The major constituent of ER bodies. One of the most abundant proteins in Arabidopsis seedlings. Exist in an soluble (inactive) and non-soluble (active) form, most probably formed in a polymerization process. Involved in the mutualistic interaction between Arabidopsis and the endophytic fungus Piriformospora indica. |
| AT5G47120 | Encodes BI-1, a homolog of mammalian Bax inhibitor 1. Functions as an attenuator of biotic and abiotic types of cell death. Bax-induced cell death can be downregulated by ectopically expressing AtBI in planta. |
| AT4G18710 | Encodes BIN2, a member of the ATSK (shaggy-like kinase) family. BIN2 functions in the cross-talk between auxin and brassinosteroid signaling pathways. BIN2 regulates root epidermal cell fate specification by phosphorylating EGL3 and TTG1. BIN2-mediated phosphorylation appears to promote BZR1 export from the nucleus. KIB1 interacts with BIN2 blocking its interaction with substrates and promotes BIN2 degradation. |
| AT4G19700 | Encodes BOI (Botrytis Susceptible 1 Interactor). Has E3 ubiquitin ligase activity. Interacts with and ubiquitinates BOS1 (Botrytis Susceptible 1). It prevents caspase activation and attenuates cell death. |
| AT3G15120 | Encodes BRP1, an ATPase domain-containing protein that interacts with BRAT1 to negatively regulate transcriptional silencing at methylated genomic regions. |
| AT3G18290 | Encodes BRUTUS (BTS), a putative E3 ligase protein with metal ion binding and DNA binding domains, which negatively regulates the response to iron deficiency. |
| AT1G78900 | Encodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology. |
| AT4G18700 | Encodes CBL-interacting protein kinase 12 (CIPK12). |
| AT4G30960 | Encodes CBL-interacting protein kinase 6 (CIPK6). Required for development and salt tolerance. |
| AT1G31580 | Encodes cell wall protein. ECS1 is not a Xcc750 resistance gene, but the genetic data indicate that ECS1 is linked to a locus influencing resistance to Xcc750. |
| AT1G71697 | Encodes choline kinase. mRNA levels are increased in response to wounding. |
| AT1G69370 | Encodes chorismate mutase 3 (CM3). |
| AT2G17870 | Encodes COLD SHOCK DOMAIN PROTEIN 3 (CSP3), involved in the acquisition of freezing tolerance. |
| AT1G62810 | Encodes COPPER AMINE OXIDASE1 (CuAO1). Contributes to abscisic acid- and polyamine-induced nitric oxide biosynthesis and abscisic acid signal transduction. |
| AT5G58710 | Encodes cyclophilin ROC7. |
| AT3G04940 | Encodes cysteine synthase CysD1. |
| AT4G38740 | Encodes cytosolic cyclophilin ROC1. |
| AT4G18370 | Encodes DEG5. Forms a hexamer with DEG8 in the thylakoid lumen. Involved in the cleavage of photodamaged D2 protein of photosystem II (PSII). |
| AT3G21270 | Encodes Dof zinc finger protein adof2. |
| AT5G55390 | Encodes EDM2 (enhanced downy mildew 2). The predicted protein bears typical features of transcriptional regulators. EDM2 contains two putative bipartite nuclear localization signals (NLS) two zinc-finger-like motifs, a Proline-rich region and a large aspartic acid-rich region. Both zinc-finger-like stretches resemble the PHD (plant homeodomain) finger motif. Mutations in EDM2 comprise RPP7 mediated resistance against Hyaloperonospora parasitica isolate Hiks1 (HpHiks1). EDM2 may function as a direct or indirect regulator of RPP7 expression. |
| AT1G69410 | Encodes eIF5A-2, a putative eukaryotic translation initiation factor. There are three eIF5A coding genes in Arabidopsis: eIF5A-1/At1g13950, eIF5A-2/At1g26630 and eIF5A-3/At1g69410. |
| AT5G07280 | Encodes EMS1 (EXCESS MICROSPOROCYTES1), a putative leucine-rich repeat receptor protein kinase that controls somatic and reproductive cell fates in Arabidopsis anther. |
| AT1G08920 | Encodes ESL1, a transporter for monosaccharides. |
| AT1G21310 | Encodes extensin 3. |
| AT5G55730 | Encodes fasciclin-like arabinogalactan-protein 1 (Fla1). fla1 mutants show defects in shoot regeneration. Possibly involved in embryogenesis and seed development. |
| AT1G32550 | Encodes FdC2, a ferredoxin protein capable of alternative electron partitioning. FdC1 level increases in conditions of acceptor limitation at PSI. |
| AT4G36220 | encodes ferulate 5-hydroxylase (F5H). Involved in lignin biosynthesis. |
| AT3G51240 | Encodes flavanone 3-hydroxylase that is coordinately expressed with chalcone synthase and chalcone isomerases and is involved in flavonoid biosynthesis. Not responsive to auxin or ethylene stimulus (qRT-PCR). |
| AT1G17290 | Encodes for alanine aminotransferase (ALAAT1), involved in alanine catabolism during plants recovery from hypoxia |
| AT5G16020 | Encodes GEX3, a plasma membrane localized protein expressed in the male gametophyte. Required for micropylar pollen tube guidance. Also plays a role during early embryogenesis. |
| AT4G25420 | Encodes gibberellin 20-oxidase that is involved in the later steps of the gibberellin biosynthetic pathway. Regulated by a circadian clock. Weak expression response to far red light. |
| AT5G15230 | Encodes gibberellin-regulated protein GASA4. Promotes GA responses and exhibits redox activity. |
| AT2G19880 | Encodes Glucosylceramide synthase (GCS) which catalyzes the final step in glucosylceramide (GlcCer) synthesis by transferring a glucosyl residue from UDP-Glc to the ceramide backbone. |
| AT1G09940 | Encodes glutamyl-tRNA reductase. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins |
| AT1G03850 | Encodes glutaredoxin ATGRXS13, required to facilitate Botrytis cinerea infection of Arabidopsis thaliana plants. Sylvain La Camera et al (2011, PMID:21756272) reported a third splice variant in addition to the two annotated in TAIR10. It is a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT3G54660 | Encodes glutathione reductase that is most likely localized in the chloroplast. Flavoenzyme-encoding gene. |
| AT3G03190 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G10360 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT2G29480 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G17190 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT2G29470 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT2G29440 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT5G62480 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G28480 | Encodes GRX480, a member of the glutaredoxin family that regulates protein redox state. GRX480 interacts with TGA factors and suppresses JA-responsive PDF1.2 transcription. GRX480 transcription is SA-inducible and requires NPR1. Maybe involved in SA/JA cross-talk. It has also been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT1G10370 | Encodes GSTU17 (Glutathione S-Transferase U17). Functions as a negative component of stress-mediated signal transduction pathways in drought and salt stress responses. |
| AT4G31560 | Encodes HCF153, a 15-KDa protein involved in the biogenesis of the cytochrome b(6)f complex. Associated with the thylakoid membrane. |
| AT3G15095 | Encodes HCF243 (high chlorophyll fluorescence), a chloroplast-localized protein involved in the D1 protein stability of the photosystem II complex1. |
| AT4G33470 | Encodes HDA14, a member of the histone deacetylase family proteins that can deacetylate a-tubulin, associates with a/b-tubulin and is retained on GTP/taxol-stabilized microtubules, at least in part, by direct association with the PP2A-A2 subunit. The association of a histone deacetylase with PP2A suggests a direct link between protein phosphorylation and acetylation. Class II RPD3-like family HDAC member which controls negative responses to salinity stress. |
| AT3G46290 | Encodes HERCULES1 (HERK1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
| AT4G37790 | Encodes homeobox protein HAT22, member of the HD-Zip II family. |
| AT2G18950 | Encodes homogentisate phytyltransferase involved in tocopherol biosynthesis. Has impact on seed longevity and plays a role in the adaptation to low temperature stress, notably phloem loading. |
| AT1G17560 | Encodes HUELLENLOS (HLL), a mitochondrial ribosome protein, similar to L14 ribosomal protein of eubacteria. HLL is essential for normal ovule development. |
| AT2G41430 | Encodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2. |
| AT5G43760 | Encodes KCS20, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G25450 | Encodes KCS5, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT5G13530 | Encodes KEEP ON GOING (KEG), a RING E3 ligase involved in abscisic acid signaling. KEG is essential for Arabidopsis growth and development. ABA promotes KEG degradation via the ubiquitin dependent 26S proteasome pathway. Associates with and ubiquitinates MKK4 and MKK5 to regulate plant immunity. |
| AT1G32560 | Encodes LEA4-1, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. |
| AT5G06760 | Encodes LEA4-5, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. Most of the diverse set of LEA proteins can be grouped according to properties such as high hydrophilicity and high content of glycine or other small amino acids in what has been termed hydrophilins. LEA4-5 protects enzyme activities from the adverse effects induced by freeze-thaw cycles in vitro. |
| AT4G22880 | encodes leucoanthocyanidin dioxygenase, which is involved in proanthocyanin biosynthesis. Mutant analysis suggests that this gene is also involved in vacuole formation. |
| AT3G22400 | Encodes lipoxygenase5 (LOX5). LOX5 activity in roots facilitates green peach aphid colonization of Arabidopsis foliage by promoting green peach aphid feeding from sieve element and water consumption from xylem. |
| AT5G15580 | Encodes LONGIFOLIA1 (LNG1). Regulates leaf morphology by promoting cell expansion in the leaf-length direction. The LNG1 homologue LNG2 (At3g02170) has similar function. |
| AT3G02170 | Encodes LONGIFOLIA2 (LNG2). Regulates leaf morphology by promoting cell expansion in the leaf-length direction. The LNG2 homologue LNG1 (At5g15580) has similar function. |
| AT3G14840 | Encodes LRR-RLK protein that is localized to the plasma membrane and is involved in regulation of plant innate immunity to microbes. LIK1 is phosphorylated by CERK1, a kinase involved in chitin perception. |
| AT2G33340 | Encodes MAC3B, a U-box proteins with homology to the yeast and human E3 ubiquitin ligase Prp19. Associated with the MOS4-Associated Complex (MAC). Involved in plant innate immunity. Regulator of flowering time. |
| AT1G79340 | Encodes MCP2d, the predominant and constitutively expressed member of type II metacaspases (MCPs). MCP2d plays a positive regulatory role in biotic and abiotic stress-induced programmed cell death (PCD). Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
| AT2G38700 | Encodes mevalonate diphosphate decarboxylase, the enzyme that catalyzes the synthesis of isopentenyl diphosphate, used in sterol and isoprenoid biosynthesis. The protein appears to form a homodimeric complex. Incidentally, it was shown that the Arabidopsis MVD protein could also interact with its yeast homolog to form a heterodimer. |
| AT4G01220 | Encodes MGP4 (MALE GAMETOPHYTE DEFECTIVE 4), a rhamnogalacturonan II xylosyltransferase important for growth of pollen tubes and roots. |
| AT1G14520 | Encodes MIOX1. Belongs to myo-inositol oxygenase gene family. |
| AT1G19580 | Encodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex. |
| AT3G18165 | Encodes MOS4 (Modifier of snc1, 4), a nuclear protein homologous to human Breast Cancer-Amplified Sequence (BCAS2). MOS4 interacts with AtCDC5 and PRL1. All three proteins are essential for plant innate immunity. |
| AT2G22900 | Encodes MUCI10, a galactomannan-1,6-galactosyltransferase. MUCI10 likely decorates glucomannan, synthesized by CSLA2, with galactose residues in vivo. The degree of galactosylation is essential for the synthesis of the GGM backbone, the structure of cellulose, mucilage density, as well as the adherence of pectin. |
| AT4G09460 | Encodes myb6 DNA-binding protein. |
| AT1G11840 | Encodes Ni+ dependent glyoxalase I homolog ATGLX1. |
| AT5G23810 | Encodes nonfunctional amino acid transporter. AAP7 is the most distantly related member of the AAP family, a group of well characterized amino acid transporters within the ATF1 superfamily. Expression of this gene has not been detected with RNA gel blots or promoter GUS studies. |
| AT5G51330 | Encodes novel protein involved in sister chromatid cohesion and meiotic chromosome organization during both male and female meiosis. Gene has two alternate transcripts which produce two similar proteins, one 57 aa shorter than the other. |
| AT5G45110 | Encodes NPR3, a paralog of NPR1. Involved in negative regulation of defense responses against bacterial and oomycete pathogens. npr3 mutants has elevated level of PR1 expression. Interacts with TGA2, TGA3, TGA5 and TGA6 in yeast two hybrid assays. NPR3 and NPR4 are receptors for the immune signal salicylic acid. |
| AT1G12110 | Encodes NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is expressed in guard cells and function in stomatal opening. Mutants have less transpiration and are more tolerant to drought. Expressed in lateral roots. Involved in nitrate signaling which enables the plant root system to detect and exploit nitrate-rich soil patches. Comparing to the wild type, the mutant displays a strongly decreased lateral root proliferation phenotype in nitrate rich patches on growth medium. Affects flowering time via interaction with the FLC dependent flowering pathway to influence its target gene FT. |
| AT3G23580 | Encodes one of the 3 ribonucleotide reductase (RNR) small subunit genes (RNR2A). Functionally redundant with the ribonucleotide reductase TSO2. mRNA was shown to specifically accumulate during the S-phase of the cell cycle in synchronized tobacco BY2 cells. Critical for cell cycle progression, DNA damage repair and plant development. |
| AT1G04530 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT3G58620 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. |
| AT5G21990 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808). Functions as a chaperone receptor at the chloroplast outer envelope, mediating Hsp70-dependent protein targeting to chloroplasts. It has been localized to the ER membrane, interacts with the Sec translocon, and has a potential function in post-translational protein transport into the ER. |
| AT3G09350 | Encodes one of the Arabidopsis orthologs of the human Hsp70-binding protein 1 (HspBP-1) and yeast Fes1p: Fes1A (AT3G09350), Fes1B (AT3G53800), Fes1C (AT5G02150). Fes1A is cytosolic and associates with cytosolic Hsp70. Mutants showed increased heat-sensitive phenotype suggestion the involvement of Fes1A in acquired thermotolerance. Does not have nucleotide exchange factor activity in vitro. |
| AT5G45100 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT1G79110 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT3G12920 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT1G16300 | Encodes one of the chloroplast/plastid localized GAPDH isoforms (GAPCp1/At1g79530 and GAPCp2/At1g16300). gapcp double mutants display a drastic phenotype of arrested root development, dwarfism and sterility. GAPCps are important for the synthesis of serine in roots. |
| AT5G19380 | Encodes one of the CRT-Like transporters (CLT1/AT5G19380, CLT2/AT4G24460, CLT3/AT5G12170). Required for glutathione homeostasis and stress responses. Mutants lacking these transporters are heavy metal-sensitive, glutathione(GSH)-deficient, and hypersensitive to Phytophthora infection. |
| AT3G44260 | Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses. |
| AT5G22250 | Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses. |
| AT3G55630 | Encodes one of the three folylpolyglutamate synthetase isoforms (FPGSs): FPGS1 (At5g05980, plastidic), FPGS2 (At3g10160, mitochondrial) and FPGS3 (At3g55630, cytosolic). |
| AT3G48780 | Encodes one of the two LCB2 subunits (LCB2a and LCB2b) of serine palmitoyltransferase, an enzyme involved in sphingolipid biosynthesis. LCB2a and LCB2b are functional redundant. Double mutants are gametophytic lethal. |
| AT1G14290 | Encodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth. |
| AT2G21470 | Encodes one of the two subunits of the SUMO activation enzyme required during sumolation. Sumolation is a post-translational protein modification process similar to ubiquitination during which a polypeptide (SUMO) is covalently attached to a target protein. |
| AT4G30260 | Encodes one of the two YPT/RAB GTPase Interacting Protein 4a (YIP4a) and YIP4b (formerly YIP2), which form a TGN-localized complex with ECHIDNA (ECH). This complex is required for the secretion of cell wall polysaccharides. |
| AT4G14680 | Encodes one of three A. thaliana ATP-sulfurylases. APS is the first enzyme of sulfate assimilation that catalyzes the formation of adenosine-5'-phosphosulfate from ATP and sulfate. |
| AT1G09210 | Encodes one of three Arabidopsis calreticulins.Post-transcriptionally regulates together with CRT1 VAMP721/722 levels under ER stress. |
| AT5G65510 | Encodes one of three PLETHORA transcription factors required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions. |
| AT1G48510 | Encodes one of two Arabidopsis mitochondrial proteins similar to human SURF1 which is known to be involved in cytochrome c oxidase assembly. Mutations result in defects in hypocotyl elongation and changes in GA homeostasis. |
| AT1G17440 | Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. The gene product is an EIN3-interacting TFIID transcription factor required for proper ethylene response, including ERF1 induction. Loss of function mutants show enhanced response to ethylene. Located in nucleus and expressed throughout the plant. Required for ERF1 expression. Cytokinin-hypersensitive 1 (CKH1) mutants are characterized by rapidly growing calli with a green color at low levels of cytokinins, which are insufficient to induce such cytokinin responses in wild-type explants. It is hypothesized that CKH1 acts as a negative regulator of cytokinin signaling in Arabidopsis. |
| AT3G08850 | Encodes one of two Arabidopsis RAPTOR/KOG1 homologs. RAPTOR proteins are binding partners of the target of rapamycin kinase that is present in all eukaryotes and play a central role in the stimulation of cell growth and metabolism in response to nutrients. Mutants show embryo lethal phenotype which occurs at pre-globular stage. May interact with TOR kinase in a rapamycin like signaling pathway. Interacts with TOR and S6K1 in vivo. Overexpression of RAPTOR1 rendered the S6K1 osmotic stress insensitive. |
| AT5G09900 | Encodes one of two isoforms for the 26S proteasome regulatory protein (RN) subunit RPN5. For many functions it acts redundantly with the paralogous gene RPN5b but also appears to exert independent effects. |
| AT5G17330 | Encodes one of two isoforms of glutamate decarboxylase. |
| AT4G25270 | Encodes OTP70, a pentatricopeptide repeat protein of the E subgroup involved in splicing of the plastid transcript rpoC1. |
| AT5G56550 | Encodes OXIDATIVE STRESS 3 (OXS3), involved in tolerance to heavy metals and oxidative stress. |
| AT1G17750 | Encodes PEPR2, a plasma membrane leucine-rich repeat receptor kinase functioning as a receptor for the Pep1 and Pep2 peptides. Pep1 and Pep2 are amino acids that induce the transcription of defense-related genes. |
| AT3G58840 | Encodes PEROXISOMAL AND MITOCHONDRIAL DIVISION FACTOR1. Involved in the morphogenesis and proliferation of peroxisomes and mitochondria. |
| AT4G22890 | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I). |
| AT5G05590 | Encodes phosphoribosylanthranilate isomerase which catalyzes the third step in the tryptophan biosynthetic pathway. |
| AT3G58850 | Encodes PHYTOCHROME RAPIDLY REGULATED2 (PAR2), an atypical basic helix-loop-helix (bHLP) protein. Closely related to PAR1 (At2g42870). Up regulated after simulated shade perception. Acts in the nucleus to control plant development and as a negative regulator of shade avoidance response. Functions as transcriptional repressor of auxin-responsive genes SAUR15 (AT4G38850) and SAUR68 (AT1G29510). |
| AT4G35470 | Encodes PIRL4, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
| AT2G17440 | Encodes PIRL5, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
| AT3G11330 | Encodes PIRL9, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen. |
| AT4G11570 | Encodes plastid localized protein involved in riboflavin biosynthesis. It dephosphorylates 5-amino-6-ribitylamino- 2,4(1H,3H) pyrimidinedione 5′-phosphate (ARPP) . |
| AT1G31830 | Encodes POLYAMINE UPTAKE TRANSPORTER 2, an amino acid permease family protein. |
| AT3G13620 | Encodes POLYAMINE UPTAKE TRANSPORTER 4, an amino acid permease family protein. |
| AT3G19553 | Encodes POLYAMINE UPTAKE TRANSPORTER 5, an amino acid permease family protein. |
| AT5G07110 | Encodes PRA1.B6, an isoform of the PRA1 (Prenylated Rab acceptors) family. PRAs bind to prenylated Rab proteins and possibly aids in targeting Rabs to their respective compartments. PRA1.B6 localizes to the Golgi apparatus and its ER-to-Golgi trafficking and localization to the Golgi apparatus are regulated by multiple sequence motifs in both the C- and N-terminal cytoplasmic domains. |
| AT3G11410 | Encodes protein phosphatase 2C. Negative regulator of ABA signalling. Expressed in seeds during germination. mRNA up-regulated by drought and ABA. |
| AT1G04260 | Encodes protein that interacts with CaMV movement protein. Colocalizes in the cytoplasm with the movement protein. Has similarity to mammalian proteins (such as the rat PRA1) which have been described as rab acceptors. |
| AT3G48330 | Encodes protein-L-isoaspartate methyltransferase. Important for maintaining viability as the seed ages. Involved in germination. |
| AT4G01690 | Encodes protoporphyrinogen oxidase (PPOX). |
| AT1G71500 | Encodes PSB33, a protein conserved in the plastid lineage. PSB33 is associated with the chloroplast thylakoid membrane and provides stability to Photosystem II. |
| AT5G56360 | Encodes PSL4, beta-subunit of endoplasmic reticulum-resident glucosidase II, which is essential for stable accumulation and quality control of the elf18 receptor EFR but not the flg22 receptor FLS2. |
| AT1G60190 | Encodes PUB19, a plant U-box armadillo repeat protein. Involved in salt inhibition of germination together with PUB18. |
| AT3G16570 | Encodes RALF23, a member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. RALF23 is significantly downregulated by brassinolide treatment of seedlings. Overexpression of AtRALF23 impairs brassinolide-induced hypocotyls elongation, and mature overexpressing plants are shorter and bushier. RALF23 overexpression produces slower growing seedlings with roots that have reduced capacity to acidify the rhizosphere. |
| AT5G53160 | Encodes RCAR3, a regulatory component of ABA receptor. Interacts with protein phosphatase 2Cs ABI1 and ABI2. Stimulates ABA signaling. |
| AT1G01320 | Encodes REDUCED CHLOROPLAST COVERAGE 1 (REC1) a protein with similarity to the FLOURY locus in maize. Located in the nucleus and cytosol. Contributes to establishing the size of the chloroplast compartment. |
| AT5G60210 | Encodes RIP5 (ROP interactive partner 5), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants). |
| AT5G40260 | Encodes RPG1 (RUPTURED POLLEN GRAIN1), a member of the MtN3/saliva gene family. Crucial for exine pattern formation and cell integrity of microspores. |
| AT1G76090 | Encodes S-adenosyl-methionine-sterol-C-methyltransferase, an enzyme in the sterol biosynthetic pathway. |
| AT3G19570 | Encodes SCO3 (snowy cotyledon3), a member of a largely uncharacterized protein family unique to the plant kingdom. The sco3-1 mutation alters chloroplast morphology and development, reduces chlorophyll accumulation, impairs thylakoid formation and photosynthesis in seedlings, and results in photoinhibition under extreme CO(2) concentrations in mature leaves. SCO3 is targeted to the periphery of peroxisomes. Together with QWRF2 redundantly modulates cortical microtubule arrangement in floral organ growth and fertility. |
| AT1G15215 | Encodes SHH1, a homeodomain protein required for DNA methylation. It is an atypical RNA-directed DNA methylation component, and functions in transcriptional silencing through both DNA methylation-dependent and -independent pathways. |
| AT1G44800 | Encodes Siliques Are Red 1 (SIAR1). Functions as a bidirectional amino acid transporter that is crucial for the amino acid homeostasis of siliques. Member of nodulin MtN21-like transporter family. |
| AT5G07660 | Encodes SMC6A (STRUCTURAL MAINTENANCE OF CHROMOSOMES 6A), a component of the SMC5/6 complex. SMC5/6 complex promotes sister chromatid alignment and homologous recombination after DNA damage. |
| AT1G28490 | Encodes SYP61, one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. SYP61 and SYP121 coordinate the trafficking of plasma membrane aquaporin PIP2;7 to modulate the cell membrane water permeability. |
| AT2G46640 | Encodes TAC1 (Tiller Angle Control 1). Influences axillary branch growth angle. Inflorescence stems of TAC1 mutants are vertically oriented and have axillary shoots with narrow branch angles. |
| AT4G28840 | Encodes TCP INTERACTOR-CONTAINING EAR MOTIF PROTEIN 1 (TIE1), an important repressor of CINCINNATA (CIN)-like TEOSINTE BRANCHED1/CYCLOIDEA/PCF (TCP) transcription factors, which are key for leaf development. |
| AT1G58100 | Encodes TCP8, belongs to the TCP transcription factor family known to bind site II elements in promoter regions. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
| AT2G38130 | Encodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes. |
| AT5G57160 | Encodes the Arabidopsis orthologue of the yeast and mammalian DNA ligase IV. Involved in the repair of DNA damage but, unlike in yeast, not required for T-DNA integration. Interacts with the Arabidopsis homologue of XRCC4. |
| AT5G07440 | Encodes the beta-subunit of the glutamate dehydrogenase. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells. |
| AT1G18400 | Encodes the brassinosteroid signaling component BEE1 (BR-ENHANCED EXPRESSION 1). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT2G38040 | encodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis |
| AT1G64040 | Encodes the catalytic subunit of a Type 1 phosphoprotein Ser/Thr phosphatase, expressed in roots, shoots and flowers. |
| AT2G31170 | Encodes the cysteinyl t-RNA synthetase SYCO ARATH (SYCO), which is expressed and required in the central cell but not in the antipodals. SYCO, localized to the mitochondria, is necessary for mitochondrial cristae integrity. Mutation of this gene affects the lifespan of adjacent accessory cells. |
| AT1G77760 | Encodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. Similar to molybdopterin oxidoreductases at the N-terminus, and to FAD/NAD-binding cytochrome reductases at the C-terminus. Cofactors: FAD, heme iron (cytochrome B-557), and molybdenum-pterin. |
| AT3G19800 | Encodes the DUF177B version of the two DUF177 proteins in Arabidopsis. This version differs from DUF177A in containing a 23 aa insertion compared to the DUF177A sequence. |
| AT3G55410 | Encodes the E1 subunit of the 2-oxoglutarate dehydrogenase. |
| AT5G55070 | Encodes the E2 subunit of the 2-oxoglutarate dehydrogenase. |
| AT1G01580 | Encodes the low-iron-inducible ferric chelate reductase responsible for reduction of iron at the root surface. It is likely to be the major Fe(III) chelate reductase in Arabidopsis iron metabolism. Coordinately regulated with IRT1, the major transporter responsible for high-affinity iron uptake from the soil, at both transcriptional and posttranscriptional levels. Steady state mRNA levels are regulated by several metals. Its transcription is regulated by FIT1. |
| AT5G61810 | Encodes the predominant of three APC isoforms in Arabidopsis, a calcium-dependent mitochondrial ATP-Mg/Pi transporter. |
| AT4G05180 | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II. |
| AT4G21280 | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II. |
| AT4G03280 | Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. |
| AT5G17990 | Encodes the tryptophan biosynthetic enzyme phosphoribosylanthranilate transferase (PAT1, called trpD in bacteria). Converts anthranilate and phosphoribosylpyrophosphate into phosphoribosylanthranilate and inorganic pyrophosphate. |
| AT4G35800 | Encodes the unique largest subunit of nuclear DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB1 and a homolog of the E. coli RNA polymerase beta prime subunit. |
| AT3G52850 | Encodes the Vacuolar Sorting Receptor-1 (VSR-1)/Epidermal Growth Factor Receptor-like protein1(VSR-1/ATELP1). Binds vacuolar targeting signals. Involved in sorting seed storage proteins into vacuoles. |
| AT5G54380 | Encodes THESEUS1 (THE1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
| AT4G37200 | Encodes thioredoxin-like protein with disulfide reductase activity that is involved in the biogenesis of the plastid cytochrome b6f complex. Protein is located in the thylakoid membrane with the C-terminal hydrophilic portion, containing the thioredoxin like domain, extending into the thylakoid lumen. |
| AT5G03220 | Encodes together with its paralog MED7B a subunit of the middle module of the transcriptional co-regulator Mediator complex. Regulates genes required for normal development of etiolated seedlings. |
| AT1G78240 | Encodes TSD2 (TUMOROUS SHOOT DEVELOPMENT2), a putative methyltransferase with an essential role in cell adhesion, anthocyanin accumulation, and coordinated plant development. |
| AT5G62690 | encodes tubulin beta-2/beta-3 chain |
| AT5G62700 | encodes tubulin beta-2/beta-3 chain |
| AT3G50670 | Encodes U1 snRNP 70K |
| AT3G53990 | Encodes universal stress protein (USP). Functions as a molecular chaperone under heat shock and oxidative stress conditions. Chaperone activity and assembly into complexes is redox regulated. |
| AT2G47270 | Encodes UPBEAT1 (UPB1), a transcription factor with a bHLH domain. Regulates the expression of a set of peroxidases that modulate the balance of reactive oxygen species (ROS) between the zones of cell proliferation and the zone of cell elongation where differentiation begins. Disruption of UPB1 activity alters this ROS balance, leading to a delay in the onset of differentiation. Regulates growth by mediating cell cycle progression. |
| AT2G23320 | Encodes WRKY DNA-binding protein 15 (WRKY15). |
| AT5G07100 | Encodes WRKY DNA-binding protein 26 (WRKY26). |
| AT2G03340 | Encodes WRKY DNA-binding protein 3 (WRKY3). |
| AT2G04880 | Encodes WRKY1, a member of the WRKY transcription factors in plants involved in disease resistance, abiotic stress, senescence as well as in some developmental processes. WRKY1 is involved in the salicylic acid signaling pathway. The crystal structure of the WRKY1 C-terminal domain revealed a zinc-binding site and identified the DNA-binding residues of WRKY1. |
| AT1G69310 | Encodes WRKY57, a member of the WRKY Transcription Factor. Activation of WRKY57 confers drought tolerance. |
| AT5G13740 | Encodes ZIF1 (ZINC-INDUCED FACILITATOR1), a member of the Major Facilitator Superfamily (MFS) of membrane proteins which are found in all organisms and transport a wide range of small, organic molecules. Involved in a mechanism of Zn sequestration, possibly by transport of a Zn ligand or Zn-ligand complex into vacuoles. |
| AT5G43170 | Encodes zinc finger protein. mRNA levels are elevated in response to high salinity and low temperature. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT3G19580 | Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild desiccation. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT1G70710 | endo-1,4-beta-glucanase. Involved in cell elongation. |
| AT1G06810 | endonuclease/glycosyl hydrolase |
| AT2G29980 | Endoplasmic reticulum enzyme responsible for the synthesis of 18:3 fatty acids from phospholipids. Uses cytochrome b5 as electron donor. |
| AT3G22290 | Endoplasmic reticulum vesicle transporter protein |
| AT1G73390 | Endosomal targeting BRO1-like domain-containing protein |
| AT1G13310 | Endosomal targeting BRO1-like domain-containing protein |
| AT1G17940 | Endosomal targeting BRO1-like domain-containing protein |
| AT5G24990 | enhanced disease resistance-like protein (DUF1336) |
| AT5G10750 | enhanced disease resistance-like protein (DUF1336) |
| AT1G60550 | enoyl-CoA hydratase/isomerase D |
| AT1G08670 | ENTH/VHS family protein |
| AT5G11700 | ephrin type-B receptor |
| AT1G54040 | Epithiospecifier protein, interacts with WRKY53. Involved in pathogen resistance and leaf senescence. |
| AT5G52980 | ER-based factor for assembly of V-ATPase |
| AT5G41120 | Esterase/lipase/thioesterase family protein |
| AT5G41130 | Esterase/lipase/thioesterase family protein |
| AT1G01380 | ETC1 is involved in trichome and root hair patterning in Arabidopsis. |
| AT2G40940 | Ethylene receptor, subfamily 1. Has histidine kinase activity. |
| AT2G27050 | ethylene-insensitive3-like1 (EIL1) |
| AT5G44350 | ethylene-responsive nuclear protein-like protein |
| AT5G19100 | Eukaryotic aspartyl protease family protein |
| AT3G52500 | Eukaryotic aspartyl protease family protein |
| AT5G19120 | Eukaryotic aspartyl protease family protein |
| AT5G24820 | Eukaryotic aspartyl protease family protein |
| AT2G17760 | Eukaryotic aspartyl protease family protein |
| AT1G08210 | Eukaryotic aspartyl protease family protein |
| AT5G19110 | Eukaryotic aspartyl protease family protein |
| AT3G54400 | Eukaryotic aspartyl protease family protein |
| AT1G01300 | Eukaryotic aspartyl protease family protein |
| AT3G25700 | Eukaryotic aspartyl protease family protein |
| AT2G27700 | eukaryotic translation initiation factor 2 family protein / eIF-2 family protein |
| AT1G79270 | evolutionarily conserved C-terminal region 8 |
| AT2G01850 | EXGT-A3 has homology to xyloglucan endotransglucosylases/hydrolases (XTHs). Mutants in this gene show a lesion mimic phenotype associated with leaf maturation and a reduction in the number of tertiary veins. Individual tracheary elements in the mutants are shorter, but phloem transport activity is not severely affected. EXGT-A3 plays a role in xyloglucan degradation in the differentiating tracheary elements of rosette leaves. |
| AT3G61620 | exonuclease RRP41 (RRP41) |
| AT4G19140 | exopolysaccharide production negative regulator |
| AT5G64260 | EXORDIUM like 2 |
| AT5G09440 | EXORDIUM like 4 |
| AT2G22905 | Expressed protein |
| AT1G45165 | Expressed protein |
| AT1G07985 | Expressed protein |
| AT4G29780 | Expression of the gene is affected by multiple stresses. Knockout and overexpression lines show no obvious phenotypes. |
| AT3G20340 | Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT1G26730 | EXS (ERD1/XPR1/SYG1) family protein |
| AT2G03240 | EXS (ERD1/XPR1/SYG1) family protein |
| AT3G45430 | Extracellular ATP transmembrane receptor involved in innate immunity. |
| AT4G15765 | FAD/NAD(P)-binding oxidoreductase family protein |
| AT5G44390 | FAD-binding Berberine family protein |
| AT5G44380 | FAD-binding Berberine family protein |
| AT2G24580 | FAD-dependent oxidoreductase family protein |
| AT5G67290 | FAD-dependent oxidoreductase family protein |
| AT5G44010 | fanconi anemia group F protein (FANCF) |
| AT4G19990 | FAR1-related sequence 1 |
| AT1G80010 | FAR1-related sequence 8 |
| AT5G63530 | Farnesylated protein that binds metals. |
| AT1G15190 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT3G52370 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT2G35860 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT3G11700 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT2G45470 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT1G03870 | fasciclin-like arabinogalactan-protein 9 (Fla9). Possibly involved in embryogenesis and seed development. |
| AT3G44560 | fatty acid reductase 8 |
| AT3G61580 | Fatty acid/sphingolipid desaturase |
| AT3G52670 | FBD |
| AT2G27505 | FBD-like domain family protein |
| AT4G15075 | FBD-like domain family protein |
| AT1G12190 | F-box and associated interaction domains-containing protein |
| AT5G65850 | F-box and associated interaction domains-containing protein |
| AT1G53790 | F-box and associated interaction domains-containing protein |
| AT3G23880 | F-box and associated interaction domains-containing protein |
| AT3G61340 | F-box and associated interaction domains-containing protein |
| AT1G53370 | F-box and associated interaction domains-containing protein |
| AT2G18780 | F-box and associated interaction domains-containing protein |
| AT4G04690 | F-box and associated interaction domains-containing protein |
| AT2G41473 | F-box family protein |
| AT3G19560 | F-box family protein |
| AT2G27310 | F-box family protein |
| AT5G46170 | F-box family protein |
| AT3G16210 | F-box family protein |
| AT4G18380 | F-box family protein |
| AT1G78100 | F-box family protein |
| AT4G05010 | F-box family protein |
| AT3G61590 | F-box protein that is involved in some aspect of regulation of gene silencing by miRNA. Loss of function mutations have increased levels of some miRNAs. Its activity depends on the presence of functional F-box. |
| AT5G57900 | F-box protein, interacts with SKP1/ASK1 subunit of SCF ubiquitin ligase in a glucose-dependent manner |
| AT5G53780 | F-box protein, putative (DUF295) |
| AT2G16290 | F-box SKIP23-like protein (DUF295) |
| AT2G42955 | F-box/LRR protein |
| AT3G59150 | F-box/RNI superfamily protein |
| AT3G03040 | F-box/RNI-like superfamily protein. Idenfitied in GWAS as locus involved in response to the defense molecule, allyl glucosinolate. |
| AT5G23440 | ferredoxin/thioredoxin reductase subunit A (variable subunit) 1 |
| AT3G15480 | fiber (DUF1218) |
| AT1G64370 | filaggrin-like protein |
| AT4G36120 | filament-like protein (DUF869) |
| AT1G16500 | filamentous hemagglutinin transporter |
| AT1G79160 | filamentous hemagglutinin transporter |
| AT3G66652 | fip1 motif-containing protein |
| AT4G22910 | FIZZY-related 2 |
| AT1G75200 | flavodoxin family protein / radical SAM domain-containing protein |
| AT5G63590 | flavonol synthase 3 |
| AT5G63595 | flavonol synthase 4 |
| AT5G43935 | flavonol synthase 6 |
| AT2G39950 | flocculation protein |
| AT5G10625 | flowering-promoting factor-like protein |
| AT5G67220 | FMN-linked oxidoreductases superfamily protein |
| AT1G19250 | FMO1 is required for full expression of TIR-NB-LRR conditioned resistance to avirulent pathogens and for basal resistance to invasive virulent pathogens. Functions in an EDS1-regulated but SA-independent mechanism that promotes resistance and cell death at pathogen infection sites. FMO1 functions as a pipecolate N-hydroxylase and catalyzes the biochemical conversion of pipecolic acid to N-hydroxypipecolic acid (NHP). NHP systemically accumulates in the plant foliage and induces systemic acquired resistance to pathogen infection. |
| AT2G46940 | fold protein |
| AT1G23110 | fold protein |
| AT5G58560 | FOLK is a farnesol kinase that can phosphorylate farnesol using an NTP donor. It can also phosphorylate geraniol, or geranylgeraniol, but it prefers farnesol in experiments performed using yeast membranes. folk loss-of-function mutants show ABA hypersensitivity in a seed germination assay and the mutants also exhibit abnormal flower development, including extra carpel formation, when subjected to water stress. |
| AT4G16670 | FORKED-LIKE family member, part of Group 3 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT2G37530 | forkhead box protein G1 |
| AT1G75530 | Forkhead-associated (FHA) domain-containing protein |
| AT5G67470 | formin homolog 6 |
| AT3G16700 | Fumarylacetoacetate hydrolase homolog. |
| AT2G30766 | Functions in iron homeostasis, activates iron deficiency response genes such as bHLH38, bHLH39, IRT1, and FRO2. |
| AT5G39760 | Functions together with TZP in co-regulation of the expression of blue-light dependent transcriptional regulators. Coassociates with and regulates the expression of light-regulated loci as well as transcriptional regulators to shape plant development in response to environmental stimuli with targets in RNA processing factors as well as proteins involved in salt stress and ABA signaling, in addition to embryo development. Acts downstream of TZP action with regard to blue-light-regulated hypocotyl elongation. |
| AT2G32970 | G1/S-specific cyclin-E protein |
| AT3G47800 | Galactose mutarotase-like superfamily protein |
| AT4G23730 | Galactose mutarotase-like superfamily protein |
| AT3G61610 | Galactose mutarotase-like superfamily protein |
| AT5G15140 | Galactose mutarotase-like superfamily protein |
| AT4G39550 | Galactose oxidase/kelch repeat superfamily protein |
| AT1G74510 | Galactose oxidase/kelch repeat superfamily protein |
| AT1G14330 | Galactose oxidase/kelch repeat superfamily protein |
| AT5G26960 | Galactose oxidase/kelch repeat superfamily protein |
| AT2G02870 | Galactose oxidase/kelch repeat superfamily protein |
| AT4G39560 | Galactose oxidase/kelch repeat superfamily protein |
| AT1G19460 | Galactose oxidase/kelch repeat superfamily protein |
| AT1G05170 | Galactosyltransferase family protein |
| AT2G32430 | Galactosyltransferase family protein |
| AT1G53290 | Galactosyltransferase family protein |
| AT1G74088 | galacturonosyltransferase |
| AT2G33040 | gamma subunit of Mt ATP synthase |
| AT1G78670 | gamma-glutamyl hydrolase 3 |
| AT5G13100 | Gap junction beta-4 protein |
| AT1G75750 | GA-responsive GAST1 protein homolog regulated by BR and GA antagonistically. Possibly involved in cell elongation based on expression data |
| AT5G45580 | GARP-G2-like transcription factor involved in low temperature regulation of flavonoid biosynthesis. |
| AT1G14230 | GDA1/CD39 nucleoside phosphatase family protein |
| AT1G14240 | GDA1/CD39 nucleoside phosphatase family protein |
| AT1G11320 | GDSL esterase/lipase |
| AT1G58520 | GDSL-like lipase/acylhydrolase superfamily protein |
| AT3G14220 | GDSL-motif esterase/acyltransferase/lipase. |
| AT2G24560 | GDSL-motif esterase/acyltransferase/lipase. |
| AT2G03980 | GDSL-motif esterase/acyltransferase/lipase. |
| AT5G45960 | GDSL-motif esterase/acyltransferase/lipase. |
| AT1G28580 | GDSL-motif esterase/acyltransferase/lipase. |
| AT1G54020 | GDSL-motif esterase/acyltransferase/lipase. |
| AT1G28660 | GDSL-motif esterase/acyltransferase/lipase. |
| AT1G28650 | GDSL-motif esterase/acyltransferase/lipase. |
| AT5G03610 | GDSL-motif esterase/acyltransferase/lipase. |
| AT1G54000 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G10950 | GDSL-type esterase/lipase. Required for pollen development. |
| Locus | Gene Description |
| AT1G10460 | germin-like protein (GLP7) |
| AT4G16444 | GET1 membrane receptor homolog . ER localized protein that Interacts with GET3a and GET2 orthologs. Disruption of both genes results in a decreased membrane localization of the SNARE proteinSYP123 and defects in root hair elongation. |
| AT2G14900 | Gibberellin-regulated family protein |
| AT5G13240 | Global repressor of RNA polymerase III (Pol III). Maf1 repressor activity is critical for plant survival during environmental stresses, and is regulated by its phosphorylation/dephosphorylation through the activity of TOR and PP4/PP2A phosphatases. |
| AT2G32400 | Glr5 |
| AT2G20010 | Gls protein (DUF810) |
| AT3G56060 | Glucose-methanol-choline (GMC) oxidoreductase family protein |
| AT1G14185 | Glucose-methanol-choline (GMC) oxidoreductase family protein |
| AT5G17460 | glutamyl-tRNA (Gln) amidotransferase subunit C |
| AT5G13810 | Glutaredoxin family protein |
| AT3G57070 | Glutaredoxin family protein |
| AT1G77370 | Glutaredoxin family protein |
| AT5G58530 | Glutaredoxin family protein |
| AT2G31570 | glutathione peroxidase GPx |
| AT1G30400 | glutathione S-conjugate transporting ATPase (AtMRP1) mRNA. An ABCC-type arsenite-phytochelatin transporter. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
| AT5G42150 | Glutathione S-transferase family protein |
| AT4G26690 | Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development. |
| AT5G17650 | glycine/proline-rich protein |
| AT3G06780 | glycine-rich protein |
| AT1G07135 | glycine-rich protein |
| AT2G26120 | glycine-rich protein |
| AT4G27850 | Glycine-rich protein family |
| AT1G27710 | Glycine-rich protein family |
| AT3G06035 | Glycoprotein membrane precursor GPI-anchored |
| AT5G19230 | Glycoprotein membrane precursor GPI-anchored |
| AT1G64390 | glycosyl hydrolase 9C2 |
| AT4G33840 | Glycosyl hydrolase family 10 protein |
| AT3G61810 | Glycosyl hydrolase family 17 protein |
| AT3G47010 | Glycosyl hydrolase family protein |
| AT3G62710 | Glycosyl hydrolase family protein |
| AT5G17500 | Glycosyl hydrolase superfamily protein |
| AT2G27500 | Glycosyl hydrolase superfamily protein |
| AT1G66280 | Glycosyl hydrolase superfamily protein |
| AT1G62660 | Glycosyl hydrolases family 32 protein |
| AT4G01210 | glycosyl transferase family 1 protein |
| AT3G57220 | Glycosyl transferase family 4 protein |
| AT3G18170 | Glycosyltransferase family 61 protein |
| AT2G41640 | Glycosyltransferase family 61 protein |
| AT1G27200 | glycosyltransferase family protein (DUF23) |
| AT5G44670 | glycosyltransferase family protein (DUF23) |
| AT4G20170 | glycosyltransferase family protein (DUF23) |
| AT4G09500 | Glycosyltransferase which negatively regulates hypoxia stress response. |
| AT5G67390 | glycosyltransferase-like protein |
| AT1G06130 | glyoxalase 2-4 |
| AT4G32272 | Golgi-localized nucleotide sugar (UDP-GlcNAc) transporter that delivers an essential substrate for the maturation of N-glycans and the GIPC class of sphingolipids. |
| AT3G50430 | golgin |
| AT3G11590 | golgin family A protein |
| AT2G47180 | GolS1 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS1 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS1 have increased tolerance to salt, chilling, and high-light stress. |
| AT1G56600 | GolS2 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS2 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS2 have increased tolerance to salt, chilling, and high-light stress. |
| AT1G05785 | Got1/Sft2-like vescicle transport protein family |
| AT3G03180 | Got1/Sft2-like vescicle transport protein family |
| AT4G12790 | GPN GTPase involved in selective nuclear import of RNA polymerase II. |
| AT3G19390 | Granulin repeat cysteine protease family protein |
| AT2G37650 | GRAS family transcription factor |
| AT5G67411 | GRAS family transcription factor |
| AT2G29065 | GRAS family transcription factor |
| AT5G19970 | GRAS family transcription factor family protein |
| AT1G64710 | GroES-like zinc-binding alcohol dehydrogenase family protein |
| AT5G24760 | GroES-like zinc-binding dehydrogenase family protein |
| AT1G22430 | GroES-like zinc-binding dehydrogenase family protein |
| AT1G29290 | Group II CEP family member; binds to vascular tissue independently of CEPR1 or CRA2. |
| AT2G45480 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development. |
| AT1G07930 | GTP binding Elongation factor Tu family protein |
| AT4G02930 | GTP binding Elongation factor Tu family protein |
| AT1G07920 | GTP binding Elongation factor Tu family protein |
| AT2G24765 | GTPase required for Golgi targeting of GRIP domain proteins. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner |
| AT1G61460 | G-type lectin S-receptor-like Serine/Threonine-kinase |
| AT5G62670 | H[+]-ATPase 11 |
| AT5G51260 | HAD superfamily, subfamily IIIB acid phosphatase |
| AT4G29270 | HAD superfamily, subfamily IIIB acid phosphatase |
| AT5G44020 | HAD superfamily, subfamily IIIB acid phosphatase |
| AT5G48960 | HAD-superfamily hydrolase, subfamily IG, 5-nucleotidase |
| AT5G59490 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein |
| AT5G02230 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein |
| AT5G59480 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein |
| AT4G39970 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein |
| AT2G32150 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein |
| AT4G12430 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein |
| AT4G22590 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein |
| AT5G24770 | Has acid phosphatase activity dependent on the presence of divalent cations (Mg2+, Co2+, Zn2+, Mn2+) and anti-insect activity. Insects fed with the protein show a retarded development. Induced in response to abscisic acid, jasmonic acid, salt, water deficiency and wounding. |
| AT2G41312 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT1G11185 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT3G04240 | Has O-linked N-acetyl glucosamine transferase activity. Similar to Arabidopsis SPY gene. |
| AT2G32980 | HAUS augmin-like complex subunit |
| AT5G03740 | HD2-type histone deacetylase HDAC. Involved in the ABA and stress responses. Mediates transcriptional repression via histone modification. |
| AT5G16210 | HEAT repeat-containing protein |
| AT4G02100 | Heat shock protein DnaJ with tetratricopeptide repeat-containing protein |
| AT1G56210 | Heavy metal transport/detoxification superfamily protein |
| AT3G05220 | Heavy metal transport/detoxification superfamily protein |
| AT3G06130 | Heavy metal transport/detoxification superfamily protein |
| AT5G03380 | Heavy metal transport/detoxification superfamily protein |
| AT5G19090 | Heavy metal transport/detoxification superfamily protein |
| AT1G01490 | Heavy metal transport/detoxification superfamily protein |
| AT2G46420 | helicase with zinc finger protein |
| AT5G47900 | heparan-alpha-glucosaminide N-acetyltransferase-like protein (DUF1624) |
| AT5G59020 | hepatocyte growth factor activator, putative (DUF3527) |
| AT4G12740 | HhH-GPD base excision DNA repair family protein |
| AT1G68670 | HHO2 is a HRS1 homolog. Nitrate-inducible expression. Also induced in roots by low Pi and is likely involved in maintaining phosphate homeostasis. It is target of PHR1.Both HHO2 and HRS1 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
| AT2G01830 | Histidine kinase: cytokinin-binding receptor that transduces cytokinin signals across the plasma membrane |
| AT2G25625 | Histone deacetylase-like protein. Induced by senescence and abiotic stresses. |
| AT5G59910 | Histone superfamily protein |
| AT1G13370 | Histone superfamily protein |
| AT4G40040 | Histone superfamily protein |
| AT3G59960 | histone-lysine N-methyltransferase ASHH4 |
| AT5G03670 | histone-lysine N-methyltransferase SETD1B-like protein |
| AT2G47350 | HIT zinc finger and PAPA-1-like domain-containing protein |
| AT2G18350 | homeobox protein 24 |
| AT3G50890 | homeobox protein 28 |
| AT5G46880 | homeobox-7 |
| AT5G15150 | homeobox-containing gene with an unusual feature: a leucine zipper motif adjacent to the carboxyl-terminal of the homeodomain structure. This gene is expressed primarily in the cortex of the root and the stem. |
| AT5G47370 | homeobox-leucine zipper genes induced by auxin, but not by other phytohormones. Plays opposite roles in the shoot and root tissues in regulating auxin-mediated morphogenesis. |
| AT4G29940 | Homeodomain protein (PRHA). Expression of the gene differs in various vegetative and floral plant tissues and is positively influenced by the phytohormone auxin. It is often associated with regions of developing vascular tissue. The prha promoter is highly responsive to the synthetic auxin, naphthalene acetic acid, in transient assays using tobacco protoplasts. The PRHA protein has the capacity to bind to TAATTG core sequence elements but requires additional adjacent bases for high-affinity binding. |
| AT1G14600 | Homeodomain-like superfamily protein |
| AT2G38250 | Homeodomain-like superfamily protein |
| AT5G01380 | Homeodomain-like superfamily protein |
| AT2G02060 | Homeodomain-like superfamily protein |
| AT2G40260 | Homeodomain-like superfamily protein |
| AT3G10760 | Homeodomain-like superfamily protein |
| AT2G13960 | Homeodomain-like superfamily protein |
| AT2G40970 | Homeodomain-like superfamily protein |
| AT3G10000 | Homeodomain-like superfamily protein |
| AT4G17695 | Homeodomain-like superfamily protein |
| AT3G22740 | homocysteine S-methyltransferase (HMT3) |
| AT1G66240 | homolog of anti-oxidant 1 |
| AT3G50450 | Homolog of RPW8 |
| AT1G03780 | Homolog of vertebrate TPX2. Protein has three domains involved in nuclear targeting, one in nuclear export and two in microtubule binding. Involved in mitotic spindle assembly during late prophase and early prometaphase. |
| AT2G28110 | Homolog to AT5G22940, a member of glycosyltransferase family 47 that is involved in secondary cell wall biosynthesis. It exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. Protein has a domain that shares significant similarity with the pfam03016 domain. It is expressed specifically in developing vessels and fiber cells, and FRA8 is targeted to Golgi. Mutants have irregular xylem formation, reduced cellulose levels and plants are smaller than normal siblings. |
| AT4G24960 | Homologous to a eukaryote specific ABA- and stress-inducible gene first isolated from barley. Groups in one subfamily with ATHVA22E. Along with other members of the ATHVA22 family, it may be involved in regulation of autophagy during development. |
| AT5G48850 | Homologous to the wheat sulphate deficiency-induced gene sdi1. Expression in root and leaf is induced by sulfur starvation. Knockout mutants retained higher root and leaf sulfate concentrations, indicating a role in regulation of stored sulfate pools. |
| AT2G30470 | HSI2 is a member of the ABI3 family of B3 domain proteins and functions as an active repressor of the Spo minimal promoter through the EAR motif. It contains a plant-specific B3 DNA-binding domain. It is expressed at similar levels in all organs. Treatment with 6% sucrose showed a slight increase in transcript levels after 24 h. No changes were observed after treatment with 50?M ABA. It is localized in the nucleus via a nuclear localization sequence located in the fourth conserved region of the C-terminal B3 domain. HSI2 is also an epigenetic repressor as it also contains functional plant homeodomain-like (PHD-L) and zinc-finger Cys- and Trp-containing (CW) domains associated with epigenetic regulation. The PHD-L domain of HSI2 is connected to promoting trimethylation of Lys-27 on histone 3 (H3K27me3), while the CW domain can bind directly to H3K4me3. Through these domains, HSI2 represses the seed maturation program during seed germination by repressing transcription of the core LAFL (LEC1, ABI3, FUS3, and LEC2) seed developmental transcriptional regulators. In developing A. thaliana embryos, HSI2 suppresses expression of a large number of genes, many identified as targets of FUS3. However, the absence of HSI2 had no effect on transcript levels of the LAFL regulators and the levels of measured metabolites and phytohormones (ABA, auxin, and JA derivatives) in developing Arabidopsis embryos. HSI2 likely fine-tunes seed maturation by repressing genes involved in early embryogenesis that are not required later for seed maturation and desiccation. |
| AT2G29500 | HSP20-like chaperones superfamily protein |
| AT3G63070 | HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. |
| AT3G50280 | HXXXD-type acyl-transferase family protein |
| AT5G16410 | HXXXD-type acyl-transferase family protein |
| AT3G50270 | HXXXD-type acyl-transferase family protein |
| AT3G50290 | HXXXD-type acyl-transferase family protein |
| AT5G38130 | HXXXD-type acyl-transferase family protein |
| AT5G47980 | HXXXD-type acyl-transferase family protein |
| AT5G67150 | HXXXD-type acyl-transferase family protein |
| AT2G39980 | HXXXD-type acyl-transferase family protein |
| AT5G21940 | hybrid signal transduction histidine kinase M-like protein |
| AT3G02875 | Hydrolyzes amino acid conjugates of the plant growth regulator indole-3-acetic acid (IAA), including IAA-Leu and IAA-Phe. Uses Mg and Co ions as cofactors. |
| AT5G65940 | hydrolyzes beta-hydroxyisobutyryl-CoA |
| AT5G52430 | hydroxyproline-rich glycoprotein family protein |
| AT4G25620 | hydroxyproline-rich glycoprotein family protein |
| AT2G22510 | hydroxyproline-rich glycoprotein family protein |
| AT1G23040 | hydroxyproline-rich glycoprotein family protein |
| AT5G65660 | hydroxyproline-rich glycoprotein family protein |
| AT3G06750 | hydroxyproline-rich glycoprotein family protein |
| AT1G63720 | hydroxyproline-rich glycoprotein family protein |
| AT1G72600 | hydroxyproline-rich glycoprotein family protein |
| AT3G13500 | hypothetical protein |
| AT4G32930 | hypothetical protein |
| AT1G78476 | hypothetical protein |
| AT1G74929 | hypothetical protein |
| AT3G11405 | hypothetical protein |
| AT4G27657 | hypothetical protein |
| AT2G30760 | hypothetical protein |
| AT1G12411 | hypothetical protein |
| AT3G52230 | hypothetical protein |
| AT1G52720 | hypothetical protein |
| AT1G61900 | hypothetical protein |
| AT1G73470 | hypothetical protein |
| AT2G29452 | hypothetical protein |
| AT3G03150 | hypothetical protein |
| AT2G25964 | hypothetical protein |
| AT3G08636 | hypothetical protein |
| AT2G42110 | hypothetical protein |
| AT2G34110 | hypothetical protein |
| AT1G07885 | hypothetical protein |
| AT1G64050 | hypothetical protein |
| AT1G01990 | hypothetical protein |
| AT3G27210 | hypothetical protein |
| AT1G52855 | hypothetical protein |
| AT5G06755 | hypothetical protein |
| AT3G01513 | hypothetical protein |
| AT1G09520 | hypothetical protein |
| AT5G17180 | hypothetical protein |
| AT1G52905 | hypothetical protein |
| AT3G19200 | hypothetical protein |
| AT5G50361 | hypothetical protein |
| AT4G11020 | hypothetical protein |
| AT1G76994 | hypothetical protein |
| AT4G21902 | hypothetical protein |
| AT1G49032 | hypothetical protein |
| AT4G21920 | hypothetical protein |
| AT2G27830 | hypothetical protein |
| AT2G26340 | hypothetical protein |
| AT5G10946 | hypothetical protein |
| AT2G18970 | hypothetical protein |
| AT5G50335 | hypothetical protein |
| AT3G62650 | hypothetical protein |
| AT5G23460 | hypothetical protein |
| AT5G36900 | hypothetical protein |
| AT4G40011 | hypothetical protein |
| AT4G36170 | hypothetical protein |
| AT1G80610 | hypothetical protein |
| AT4G30970 | hypothetical protein |
| AT1G61170 | hypothetical protein |
| AT4G20190 | hypothetical protein |
| AT1G70900 | hypothetical protein |
| AT4G27415 | hypothetical protein |
| AT5G54585 | hypothetical protein |
| AT5G48200 | hypothetical protein |
| AT3G49550 | hypothetical protein |
| AT4G33310 | hypothetical protein |
| AT2G16340 | hypothetical protein |
| AT4G21926 | hypothetical protein |
| AT5G05250 | hypothetical protein |
| AT3G15359 | hypothetical protein |
| AT5G46770 | hypothetical protein |
| AT5G15420 | hypothetical protein |
| AT3G60200 | hypothetical protein |
| AT1G76070 | hypothetical protein |
| AT2G20480 | hypothetical protein |
| AT4G20250 | hypothetical protein |
| AT5G43000 | hypothetical protein |
| AT2G25735 | hypothetical protein |
| AT3G05936 | hypothetical protein |
| AT3G57450 | hypothetical protein |
| AT2G34310 | hypothetical protein |
| AT2G38790 | hypothetical protein |
| AT4G26450 | hypothetical protein |
| AT5G65207 | hypothetical protein |
| AT3G27809 | hypothetical protein |
| AT1G68500 | hypothetical protein |
| AT5G15190 | hypothetical protein |
| AT3G14340 | hypothetical protein |
| AT5G56880 | hypothetical protein |
| AT2G22790 | hypothetical protein |
| AT4G30180 | hypothetical protein |
| AT2G44198 | hypothetical protein |
| AT3G56360 | hypothetical protein |
| AT2G22795 | hypothetical protein |
| AT4G39930 | hypothetical protein |
| AT2G22426 | hypothetical protein |
| AT5G49440 | hypothetical protein |
| AT1G67910 | hypothetical protein |
| AT3G15280 | hypothetical protein |
| AT5G54970 | hypothetical protein |
| AT3G63050 | hypothetical protein |
| AT3G05770 | hypothetical protein |
| AT1G58235 | hypothetical protein |
| AT3G27415 | hypothetical protein |
| AT1G11440 | hypothetical protein |
| AT5G61412 | hypothetical protein |
| AT4G32030 | hypothetical protein |
| AT1G26921 | hypothetical protein |
| AT1G15800 | hypothetical protein |
| AT4G36370 | hypothetical protein |
| AT2G19180 | hypothetical protein |
| AT3G03170 | hypothetical protein |
| AT3G12835 | hypothetical protein |
| AT3G14060 | hypothetical protein |
| AT3G15534 | hypothetical protein |
| AT2G31130 | hypothetical protein |
| AT3G05425 | hypothetical protein |
| AT1G32920 | hypothetical protein |
| AT5G60290 | hypothetical protein |
| AT1G13360 | hypothetical protein |
| AT5G14105 | hypothetical protein |
| AT3G06840 | hypothetical protein |
| AT4G36500 | hypothetical protein |
| AT3G07710 | hypothetical protein |
| AT3G50900 | hypothetical protein |
| AT5G67350 | hypothetical protein |
| AT5G02550 | hypothetical protein |
| AT2G30480 | hypothetical protein |
| AT1G77270 | hypothetical protein |
| AT1G64405 | hypothetical protein |
| AT3G22415 | hypothetical protein |
| AT1G51402 | hypothetical protein |
| AT3G19790 | hypothetical protein |
| AT1G01305 | hypothetical protein |
| AT1G20430 | hypothetical protein |
| AT1G32460 | hypothetical protein |
| AT3G21680 | hypothetical protein |
| AT1G71970 | hypothetical protein |
| AT2G23985 | hypothetical protein |
| AT1G03200 | hypothetical protein |
| AT4G31280 | hypothetical protein |
| AT3G19530 | hypothetical protein |
| AT1G25422 | hypothetical protein |
| AT3G60760 | hypothetical protein |
| AT2G21780 | hypothetical protein |
| AT1G69050 | hypothetical protein |
| AT2G33180 | hypothetical protein |
| AT2G18210 | hypothetical protein |
| AT3G50340 | hypothetical protein |
| AT1G53180 | hypothetical protein |
| AT4G01245 | hypothetical protein |
| AT1G06148 | hypothetical protein |
| AT2G46535 | hypothetical protein |
| AT1G02990 | hypothetical protein |
| AT5G53220 | hypothetical protein |
| AT1G78030 | hypothetical protein |
| AT1G75190 | hypothetical protein |
| AT3G25870 | hypothetical protein |
| AT4G33467 | hypothetical protein |
| AT1G32650 | hypothetical protein |
| AT5G65925 | hypothetical protein |
| AT3G11165 | hypothetical protein |
| AT2G37610 | hypothetical protein |
| AT2G40475 | hypothetical protein |
| AT5G36925 | hypothetical protein |
| AT4G24370 | hypothetical protein |
| AT5G22270 | hypothetical protein |
| AT2G20080 | hypothetical protein |
| AT3G19680 | hypothetical protein (DUF1005) |
| AT1G25370 | hypothetical protein (DUF1639) |
| AT3G27880 | hypothetical protein (DUF1645) |
| AT1G23710 | hypothetical protein (DUF1645) |
| AT1G05870 | hypothetical protein (DUF1685) |
| AT2G43340 | hypothetical protein (DUF1685) |
| AT2G15610 | hypothetical protein (DUF1685) |
| AT5G03390 | hypothetical protein (DUF295) |
| AT5G54450 | hypothetical protein (DUF295) |
| AT3G56410 | hypothetical protein (DUF3133) |
| AT1G01440 | hypothetical protein (DUF3133) |
| AT2G29510 | hypothetical protein (DUF3527) |
| AT3G22970 | hypothetical protein (DUF506) |
| AT1G53380 | hypothetical protein (DUF641) |
| AT3G14870 | hypothetical protein (DUF641) |
| AT3G09110 | hypothetical protein (DUF674) |
| AT4G03420 | hypothetical protein (DUF789) |
| AT1G73210 | hypothetical protein (DUF789) |
| AT1G17830 | hypothetical protein (DUF789) |
| AT2G25200 | hypothetical protein (DUF868) |
| AT5G37070 | hypothetical protein (Protein of unknown function, DUF538) |
| AT4G01090 | Hypothetical protein; participates in wound-induced lateral root development. |
| AT1G65430 | IBR domain-containing protein |
| AT5G05300 | IDL6 peptide is induced in response to Pathogen-Associated Molecular Patterns (PAMPs). Overexpression of IDL6 results in increased susceptibility to pathogens. |
| AT2G43060 | ILI1 binding bHLH 1 |
| AT5G06480 | Immunoglobulin E-set superfamily protein |
| AT5G12930 | inactive rhomboid protein |
| AT5G08790 | induced by wounding, belongs to a large family of putative transcriptional activators with NAC domain. |
| AT3G52115 | Induced in response to ionizing radiation, shows basal expression in mitotically active cells and high expression in endoreduplicating cells. May be involved in DNA damage-induced growth arrest. Protein sequence contains a PEST destruction box. |
| AT4G08170 | Inositol 1,3,4-trisphosphate 5/6-kinase family protein |
| AT3G54020 | Inositol phosphorylceramide synthase |
| AT3G47980 | Integral membrane HPP family protein. Putative nitrate transporter. |
| AT1G78620 | integral membrane protein (Protein of unknown function DUF92, transmembrane) |
| AT2G39805 | Integral membrane Yip1 family protein |
| AT3G59830 | Integrin-linked protein kinase family |
| AT1G72500 | inter alpha-trypsin inhibitor, heavy chain-like protein |
| AT1G64060 | Interacts with AtrbohD gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. |
| AT4G35610 | Interacts with EIN3 to regulate transcriptional repression that leads to an inhibition of shoot growth in response to ethylene. |
| AT4G27500 | interacts with H+-ATPase, and regulates its activity |
| AT5G42000 | Interacts with serine palmitoyltransferase (SPT) to negatively regulate sphingolipid biosynthesis. |
| AT1G19110 | inter-alpha-trypsin inhibitor heavy chain-like protein |
| AT3G52110 | interferon-activable protein |
| AT1G07180 | Internal NAD(P)H dehydrogenase in mitochondria. The predicted protein sequence has high homology with other designated NAD(P)H DHs from microorganisms; the capacity for matrix NAD(P)H oxidation via the rotenone-insensitive pathway is significantly reduced in the Atndi1 mutant plant line; the in vitro translation product of AtNDI1 is imported into isolated mitochondria and located on the inside of the inner membrane. |
| AT1G29300 | intracellular protein transporter, putative (DUF641) |
| AT3G26680 | involved in a SNM-dependent recombinational repair process of oxidatively induced DNA damage. |
| AT4G26080 | Involved in abscisic acid (ABA) signal transduction. Negative regulator of ABA promotion of stomatal closure. |
| AT3G14070 | Involved in cation (K, Na and Mn) homeostasis and transport |
| AT1G54115 | Involved in cation (Na and K) homeostasis. |
| AT2G32410 | Involved in chiasma distribution, affects expression of key DNA repair and meiotic genes, signifcant role in DNA repair. |
| AT1G66480 | Involved in chloroplast avoidance movement under intermediate and high light intensities; PADRE protein up-regulated after infection by S. sclerotiorun. |
| AT5G58620 | Involved in control of defence gene expression post-transcriptionally through release from translation arrest within TZF9-PAB2-containing RNA granules. TZF9 shows phospho-mobility shift after flg22 treatment, inferred to be caused by phosphorylation through MPK3 and/or MPK6. The major MPK3/6-targeted phospho-sites are S181, S323, S343, S352, S356, S362 and S377. |
| AT1G25260 | Involved in male gamete development. Trans-acting factor in the assembly of the pre-60S particle. |
| AT5G63800 | Involved in mucilage formation. Mutants form columella and outer cell wall architecture of the mucilage cells resembles wild-type. However, mum2 seeds completely lack seed coat mucilage. This mutation appears to represent a later step in the development of this cell-type. Encodes a beta-galactosidase involved in seed coat mucilage biosynthesis. Member of Glycoside Hydrolase Family 35 |
| AT2G41750 | Involved in posttranscriptional modification of tRNA. Can form acp3U20b on a tRNA expressed in yeast cells. The aspartate and tryptophan residues in the DXTW motif of this protein are required for modification activity. Required for the acp3U20a modification of cytosolic tRNA. |
| AT5G11530 | Involved in regulating reproductive development |
| AT3G48350 | Involved in starvation-related responses that curtail primary root growth under severe nutrient limitation. |
| AT3G14050 | Involved in the maintenance of the (p)ppGp level to accustom plastidial gene expression to darkness. |
| AT3G16270 | Involved in the plant trans-Golgi network (TGN), where it is part of an adaptor protein (AP) complex to promote vesicle generation with different cargo specificity and destination. Interacts with AP-4, whose function is required for MTV1 recruitment. |
| AT5G61780 | Involved in the regulation of AtGA20ox3 expression, as well as seed germination. |
| AT5G47640 | Involved in the regulation of response to nutrient levels. |
| AT2G15620 | Involved in the second step of nitrate assimilation. Its expression is induced by nitrate. |
| AT2G46260 | Involvement in protein ubiquitylation is predicted based on physical interaction with CULLIN 3 proteins. LRBs physically interact with photoexcited and phosphorylated CRY2, at the CCE domain of CRY2, to facilitate polyubiquitination and degradation of CRY2 in response to blue light. |
| AT5G43745 | ion channel POLLUX-like protein, putative (DUF1012) |
| AT5G02940 | ion channel POLLUX-like protein, putative (DUF1012) |
| AT3G52870 | IQ calmodulin-binding motif family protein |
| AT3G56350 | Iron/manganese superoxide dismutase family protein |
| AT4G36890 | IRX14 was identified as MUCI64 in a reverse genetic screen for MUCILAGE-RELATED genes. IRX14/MUCI64 is a GT43 protein essential for xylan elongation in seed coat mucilage. The xylan backbone maintains the attachment of mucilage to the seed surface and the distribution of cellulose. It was identified based on its gene expression co-variance with the IRX3 gene involved in secondary cell wall synthesis. A biochemical assay using the irx14 mutant indicates that IRX14 might function in xylose chain elongation. |
| AT5G06070 | Isolated as a mutation defective in petal development with specific effects on adaxial petals which are filamentous or absent. Encodes a Superman (SUP) like protein with zinc finger motifs. Transcript is detected in petal primordia and protein is localized to the nucleus. |
| AT2G43010 | Isolated as a semidominant mutation defective in red -light responses. Encodes a nuclear localized bHLH protein that interacts with active PhyB protein. Negatively regulates phyB mediated red light responses. Involved in shade avoidance response. Protein abundance is negatively regulated by PhyB.Involved in the regulation of response to nutrient levels. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
| AT2G04160 | isolated from differential screening of a cDNA library from auxin-treated root culture. encodes a protein similar to subtilisin-like serine protease which is believed to be active outside the plant cell. |
| AT4G12550 | isolated from differential screening of a cDNA library from auxin-treated root culture. encodes a protein that is related to a large family of proteins that consist of a proline-rich or glycine-rich N-terminus and a hydrophobic, possibly membrane spanning C-terminus. |
| AT3G07390 | isolated from differential screening of a cDNA library from auxin-treated root culture. sequence does not show homology to any known proteins and is predicted to be extracellular. |
| AT5G59920 | Isolated in a screen for UV-B insensitive mutants using a hypocotyl growth inhibition assay. Mutants are defective in a number of UV-B responses. |
| AT5G03160 | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast. |
| AT1G48500 | Jasmonate zim domain transcription factor family protein.Involved in freezing tolerance and JA iduceed leaf senesence. |
| AT5G20900 | jasmonate-zim-domain protein 12 |
| AT1G17380 | jasmonate-zim-domain protein 5 |
| AT1G30135 | jasmonate-zim-domain protein 8 |
| AT1G19180 | JAZ1 is a nuclear-localized protein involved in jasmonate signaling. JAZ1 transcript levels rise in response to a jasmonate stimulus. JAZ1 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ1:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. The Jas domain appears to be important for JAZ1-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. |
| AT1G72450 | JAZ6 transcript levels rise in response to a jasmonate stimulus and a GFP:JAZ6 fusion protein localizes to the nucleus. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ6:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. |
| AT1G70700 | JAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. |
| AT3G17860 | JAZs are direct targets of the SCFCOI1 E3 ubiquitin-ligase and JA treatment induces their proteasome-mediated degradation. Furthermore, JAI3 negatively regulates the key transcriptional activator of JA responses, AtMYC2. The C-terminal portion of JAZ3, including the Jas domain, appears to be important for JAZ3-COI1 binding in the presence of coronatine. |
| AT1G53760 | K+-H+ exchange-like protein |
| AT1G74950 | Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators. |
| AT2G34600 | Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators. |
| AT3G12130 | KHZ1 is a CCCH zinc-finger and KH domain protein belonging to the VII subfamily. It is expressed throughout the plant. Highly similar to KHZ2. khz1 mutants are late flowering and double mutants with khz2 are even more late flowering. Overexpression leads to increased rates of leaf senescence. |
| AT5G06770 | KHZ2 is a CCCH zinc-finger and KH domain protein belonging to the VII subfamily. It is expressed throughout the plant. Highly similar to KHZ1.Double mutants with khz1 are late flowering. Overexpression leads to increased rates of leaf senescence. |
| AT1G35710 | kinase family with leucine-rich repeat domain-containing protein |
| AT5G25930 | kinase family with leucine-rich repeat domain-containing protein |
| AT3G17680 | Kinase interacting (KIP1-like) family protein |
| AT1G03080 | kinase interacting (KIP1-like) family protein |
| AT2G22560 | Kinase interacting (KIP1-like) family protein |
| AT2G30500 | Kinase interacting (KIP1-like) family protein |
| AT3G44610 | Kinase involved in the first positive phototropism and gravitropism. Phosphorylates serine residues in the cytoplasmic loop of PIN1 and shares phosphosite preferences with D6PK. Critical component for both hypocotyl phototropism and gravitropism, control tropic responses mainly through regulation of PIN-mediated auxin transport by protein phosphorylation. |
| AT1G21590 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein |
| AT5G63940 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein |
| AT2G24370 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein |
| AT1G77280 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein |
| AT5G59010 | kinase with tetratricopeptide repeat domain-containing protein |
| AT3G54030 | kinase with tetratricopeptide repeat domain-containing protein |
| AT1G66940 | kinase-like protein |
| AT3G16630 | Kinesin-13A localized to entire Golgi stacks. Involved in trichome development. |
| AT4G18440 | L-Aspartase-like family protein |
| AT1G17620 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family |
| AT3G52470 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family |
| AT2G35970 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family |
| AT4G01410 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family |
| AT2G46150 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family |
| AT2G30505 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family |
| AT3G54200 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family |
| AT2G46140 | Late embryogenesis abundant protein |
| AT3G62580 | Late embryogenesis abundant protein (LEA) family protein |
| AT2G23120 | Late embryogenesis abundant protein, group 6 |
| AT2G23110 | Late embryogenesis abundant protein, group 6 |
| AT2G42440 | Lateral organ boundaries (LOB) domain family protein |
| AT2G46000 | LDL receptor wingless signaling/trafficking chaperone |
| AT3G15356 | Legume lectin family protein |
| AT1G53080 | Legume lectin family protein |
| AT3G57330 | Lesion mimic phenotype when mutation in the gene is combined with a mutation in ACA4. Lesion mimic phenotype of double knockout can be suppressed by nutritional supplements that increase anion levels (e.g. 15 mM Nitrate, Chloride, or Phosphate) |
| AT3G59820 | LETM1-like protein |
| AT4G18670 | Leucine rich extensin protein involved in cell wall biogenesis and organization. Interacts with several members of the RALF family of ligand peptides. |
| AT4G13340 | Leucine rich extensin protein involved in cell wall biogenesis and organization. Interacts with several members of the RALF family of ligand peptides. |
| AT2G23780 | Leucine rich extensin protein involved in cell wall biogenesis and organization. ligand peptides. |
| AT5G49760 | Leucine rich receptor kinase. Encodes a receptor of extracellular reactive oxygen species. |
| AT5G56040 | Leucine-rich receptor-like protein kinase family protein |
| AT3G22800 | Leucine-rich repeat (LRR) family protein |
| AT5G21090 | Leucine-rich repeat (LRR) family protein |
| AT1G33590 | Leucine-rich repeat (LRR) family protein |
| AT4G06744 | Leucine-rich repeat (LRR) family protein |
| AT2G19780 | Leucine-rich repeat (LRR) family protein |
| AT1G33610 | Leucine-rich repeat (LRR) family protein |
| AT5G66330 | Leucine-rich repeat (LRR) family protein |
| AT3G20820 | Leucine-rich repeat (LRR) family protein |
| AT4G29240 | Leucine-rich repeat (LRR) family protein |
| AT5G45510 | Leucine-rich repeat (LRR) family protein |
| AT3G05990 | Leucine-rich repeat (LRR) family protein |
| AT3G24480 | Leucine-rich repeat (LRR) family protein |
| AT1G73066 | Leucine-rich repeat family protein |
| AT4G37250 | Leucine-rich repeat protein kinase family protein |
| AT1G10850 | Leucine-rich repeat protein kinase family protein |
| AT1G14390 | Leucine-rich repeat protein kinase family protein |
| AT5G16900 | Leucine-rich repeat protein kinase family protein |
| AT2G27060 | Leucine-rich repeat protein kinase family protein |
| AT2G37050 | Leucine-rich repeat protein kinase family protein |
| AT1G12460 | Leucine-rich repeat protein kinase family protein |
| AT2G26730 | Leucine-rich repeat protein kinase family protein |
| AT1G72460 | Leucine-rich repeat protein kinase family protein |
| AT3G23750 | Leucine-rich repeat protein kinase family protein |
| AT4G26540 | Leucine-rich repeat receptor-like protein kinase family protein |
| AT1G34420 | leucine-rich repeat transmembrane protein kinase family protein |
| AT5G10290 | leucine-rich repeat transmembrane protein kinase family protein |
| AT1G05700 | Leucine-rich repeat transmembrane protein kinase protein |
| AT3G52220 | leukocyte immunoglobulin-like receptor family A protein |
| AT4G33430 | Leu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. Contributes to postinvasive immunity against Alternaria brassicola. |
| AT2G42610 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640) |
| AT1G78600 | light-regulated zinc finger protein 1 |
| AT2G20130 | like COV 1 |
| AT2G18460 | like COV 3 |
| AT1G18730 | likely a subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. Located on the thylakoid membrane. Mutant has impaired NAD(P)H dehydrogenase activity. |
| AT3G14360 | Lipid droplet-associated triacylglycerol lipase (TAG) involved in pollen tube growth. TAG is possibly a direct precursor for the synthesis of membrane lipids in pollen tubes. |
| AT2G45820 | Lipid raft regulatory protein, crucial for plasma membrane nanodomain assembly to control plasmodesmata aperture and functionality. |
| AT4G37880 | LisH/CRA/RING-U-box domains-containing protein |
| AT2G14290 | LL-diaminopimelate protein (DUF295) |
| AT5G65290 | LMBR1-like membrane protein |
| AT3G49940 | LOB domain-containing protein 38 |
| AT4G37540 | LOB domain-containing protein 39 |
| AT2G43800 | Localizes to plasmodesmata (PD) through its transmembrane domain and is required for normal intercellular trafficking. Functions in a partially redundant manner with its closest homolog AtFH1. Regulates PD's permeability by anchoring actin filaments to PD. Caps the barbed end of actin filaments and stabilizes them in vitro. |
| AT1G03990 | Long-chain fatty alcohol dehydrogenase family protein |
| AT5G50150 | LOTR1 protein has an unknown function. It contains both DUF4409 and DUF239 domains. Loss of function mutations show defects in formation of the Casparian band- which is correlated with mis localization of CASP1. |
| AT1G09960 | low affinity (10mM) sucrose transporter in sieve elements (phloem) |
| AT3G53170 | LOW protein: PPR containing protein |
| AT1G17360 | LOW protein: protein phosphatase 1 regulatory subunit-like protein |
| AT1G57550 | Low temperature and salt responsive protein family |
| AT4G28088 | Low temperature and salt responsive protein family |
| AT4G30660 | Low temperature and salt responsive protein family |
| AT4G30650 | Low temperature and salt responsive protein family |
| AT3G05890 | Low temperature and salt responsive protein family |
| AT2G28355 | low-molecular-weight cysteine-rich 5 |
| AT1G17420 | LOX3 encode a Lipoxygenase. Lipoxygenases (LOXs) catalyze the oxygenation of fatty acids (FAs). |
| AT2G30105 | LRR/ubiquitin-like domain protein |
| AT4G36180 | LRR-RLK which regulates lateral root development. |
| AT3G56370 | LRR-RLK with distinct polar localization within the plasma membrane in different cell types of the root. Mutants show defects in cell divisions within the root ground tissue. |
| AT5G65600 | L-type lectin receptor kinase which modulates metabolites and abiotic stress responses. Phosphorylates AvrPtoB which in turn reduces its virulence. |
| AT1G61670 | Lung seven transmembrane receptor family protein |
| AT3G09570 | Lung seven transmembrane receptor family protein |
| AT1G63410 | LURP-one-like protein (DUF567) |
| AT3G10986 | LURP-one-like protein (DUF567) |
| AT1G80120 | LURP-one-like protein (DUF567) |
| AT3G14260 | LURP-one-like protein (DUF567) |
| AT3G15810 | LURP-one-like protein (DUF567) |
| AT5G03270 | lysine decarboxylase family protein |
| AT3G03520 | Lysophosphatidic acid phosphatase highly expressed during phosphate starvation and abiotic stresses. Role in lipid synthesis. |
| AT3G11710 | lysyl-tRNA synthetase 1 |
| AT3G48390 | MA3 domain-containing protein |
| AT3G57230 | MADS-box transcription factor. Expressed in leaf, root and stem, with higher RNA accumulation in guard cells and trichomes. AGL16 can directly interact with SVP and indirectly interact with FLC. Furthermore, the accumulation of AGL16 transcripts is modulated by miR824 (AT4G24415). The flowering time effect for the miR824/AGL16 module is more obvious in the Col-FRI background than in the Col-0 background. AGL16 controls flowering via a allelic dosage effect in long-day non-vernalized conditions. |
| AT3G26670 | magnesium transporter, putative (DUF803) |
| AT4G38730 | magnesium transporter, putative (DUF803) |
| AT2G24550 | major centromere autoantigen B-like protein |
| AT3G12120 | Major enzyme responsible for the synthesis of 18:2 fatty acids in the endoplasmic reticulum. Contains His-rich motifs, which contribute to the interaction with the electron donor cytochrome b5. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
| AT4G36790 | Major facilitator superfamily protein |
| AT3G05165 | Major facilitator superfamily protein |
| AT1G67300 | Major facilitator superfamily protein |
| AT1G22570 | Major facilitator superfamily protein |
| AT3G05160 | Major facilitator superfamily protein |
| AT3G05155 | Major facilitator superfamily protein |
| AT5G10820 | Major facilitator superfamily protein |
| AT2G40460 | Major facilitator superfamily protein |
| AT5G46040 | Major facilitator superfamily protein |
| AT1G59740 | Major facilitator superfamily protein |
| AT1G72120 | Major facilitator superfamily protein |
| AT2G26690 | Major facilitator superfamily protein |
| AT2G28120 | Major facilitator superfamily protein |
| AT4G36670 | Major facilitator superfamily protein |
| AT2G39210 | Major facilitator superfamily transmembrane transporter responsible for the uptake of picolinate herbicides. |
| AT3G10920 | manganese superoxide dismutase (MSD1) |
| AT1G52000 | Mannose-binding lectin superfamily protein |
| AT5G35940 | Mannose-binding lectin superfamily protein |
| AT1G52120 | Mannose-binding lectin superfamily protein |
| AT3G16450 | Mannose-binding lectin superfamily protein |
| AT3G16460 | Mannose-binding protein |
| AT2G18170 | MAP kinase 7 |
| AT2G14910 | MAR-binding filament-like protein |
| AT2G04080 | MATE efflux family protein |
| AT5G65380 | MATE efflux family protein |
| AT4G21910 | MATE efflux family protein |
| AT1G61890 | MATE efflux family protein |
| AT2G38330 | MATE efflux family protein |
| AT1G11670 | MATE efflux family protein |
| AT1G66760 | MATE efflux family protein |
| AT5G44050 | MATE efflux family protein |
| AT3G23550 | MATE efflux family protein |
| AT1G70170 | Matrix metalloprotease. Expression induced by fungal and bacterial pathogens. Mutants are late flowering with early senescence. |
| AT1G57600 | MBOAT (membrane bound O-acyl transferase) family protein |
| AT1G03090 | MCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion. |
| AT5G23830 | MD-2-related lipid recognition domain-containing protein |
| AT3G44100 | MD-2-related lipid recognition domain-containing protein |
| AT1G53470 | mechanosensitive channel of small conductance-like 4 |
| AT1G78610 | mechanosensitive channel of small conductance-like 6 |
| AT1G15010 | mediator of RNA polymerase II transcription subunit |
| AT2G01300 | mediator of RNA polymerase II transcription subunit |
| AT4G15800 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT5G67070 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT1G28270 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. RALF4 and RALF19 act redundantly in the pollen tube to regulate pollen tube growth. |
| AT1G02900 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. Mediates Ca2+-dependent signaling. Regulates the splicing of flowering genes and exerts an opposite effect on the flowering time compared with FER. |
| AT4G22780 | Member of a family of ACT domain containing proteins . ACT domains are involved in amino acid binding . |
| AT2G24220 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT3G23637 | Member of a family of small polypeptides found only in angiosperm lineages.Contains a conserved 29 amino acid domain (RTF or DVL domain). |
| AT4G36730 | member of a gene family encoding basic leucine zipper proteins (GBFs) which bind the G-box |
| AT2G31083 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT2G03730 | Member of a small family of ACT domain containing proteins. ACT domains are thought to be involved in amino acid binding. |
| AT3G12320 | Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK4 in having affects on biomass accumulation and phototrophism. |
| AT5G23580 | Member of a unique family of enzymes containing a single polypeptide chain with a kinase domain at the amino terminus and a putative calcium-binding EF hands structure at the carboxyl terminus; recombinant protein is fully active and induced by Ca2+ |
| AT5G65890 | Member of ACT domain containing protein family. ACT domains are amino acid binding domains. Shows strongest expression in flowers and siliques. |
| AT5G09810 | Member of Actin gene family.Mutants are defective in germination and root growth. |
| AT2G36350 | Member of AGC VIIIa Kinase gene family. |
| AT2G37640 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT1G69530 | Member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT5G49890 | member of Anion channel protein family |
| AT3G27170 | member of Anion channel protein family |
| AT5G53420 | Member of ASML2 family of CCT domain proteins.There is a preferential accumulation of RNA isoforms CCT101.1 and CCT101.2 in response to N-treatment, each isoform has different targets. |
| AT4G17615 | Member of AtCBL (Calcineurin B-like Calcium Sensor Proteins) family. Protein level is increased upon high salt, mannitol, and cold stresses. CBL1 interacts with CIPK23 and recruits the kinase to the plasma membrane where the substrate(s) of CIPK23 may reside. CBL1 localization is regulated by protein modification including myristolation and acylation. |
| AT3G47750 | member of ATH subfamily |
| AT2G20750 | member of BETA-EXPANSINS. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT1G55180 | member of C2-PLD. subfamily Represents a phospholipase D (PLD) gene with four exons, hence it is a member of the alpha class. Its amino acid sequence is quite different from other PLDs, therefore it might possess unique structural and/or catalytic properties. |
| AT3G51850 | member of Calcium Dependent Protein Kinase |
| AT1G04440 | Member of CKL gene family (CKL-C group). |
| AT5G57015 | Member of CKL gene family (member of CKL-B group). |
| AT3G17690 | member of Cyclic nucleotide gated channel family |
| AT1G50560 | member of CYP705A |
| AT1G78490 | member of CYP708A family. |
| AT5G24910 | Member of CYP714A. Encodes one of the two tandemly duplicated gene pair ELA1 (CYP714A1) and ELA2 (CYP714A2), homologs of the rice cytochrome P450 monooxygenase gene EUI1. Double mutation of ELA1 and ELA2 results in increased biomass and enlarged organs. |
| AT5G52400 | member of CYP715A |
| AT1G13110 | member of CYP71B |
| AT3G52970 | member of CYP76G |
| AT4G37360 | member of CYP81D |
| AT4G37340 | member of CYP81D |
| AT4G37330 | member of CYP81D |
| AT4G37320 | member of CYP81D |
| AT4G37400 | member of CYP81F |
| AT4G37410 | member of CYP81F |
| AT1G64950 | member of CYP89A |
| AT3G01900 | member of CYP94B |
| AT2G23180 | member of CYP96A |
| AT4G32170 | member of CYP96A |
| AT2G46650 | member of Cytochromes b5 |
| AT3G26400 | member of eIF4B - eukaryotic initiation factor 4B |
| AT1G59910 | Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. |
| AT1G05300 | member of Fe(II) transporter isolog family |
| AT5G48150 | Member of GRAS gene family. Semi-dominant mutant has a reduced response to far-red light and appears to act early in the phytochrome A signaling pathway. |
| AT3G22830 | member of Heat Stress Transcription Factor (Hsf) family |
| AT3G24520 | member of Heat Stress Transcription Factor (Hsf) family |
| AT5G62020 | member of Heat Stress Transcription Factor (Hsf) family |
| AT3G02990 | member of Heat Stress Transcription Factor (Hsf) family |
| AT2G26150 | member of Heat Stress Transcription Factor (Hsf) family. Involved in response to misfolded protein accumulation in the cytosol. Regulated by alternative splicing and non-sense-mediated decay. |
| AT1G25550 | Member of HHO/HRS GARP type transcriptional repressor family. Involved in Pi uptake and Pi starvation signaling. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
| AT5G10720 | member of Histidine Kinase |
| AT5G13460 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G59690 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G49380 | Member of IQ67 (CaM binding) domain containing family. |
| AT1G01110 | Member of IQ67 (CaM binding) domain containing family. |
| AT5G03040 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G23060 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G29150 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G52290 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G22190 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G12120 | member of KEULE Gene Family |
| AT1G73670 | member of MAP Kinase |
| AT3G14720 | member of MAP Kinase |
| AT1G53510 | Member of MAP Kinase familly. Target of MPKKK20 phosphorylation. Mutant root growth is sensitive oryzalin and suggestive of a role in signaling during microtubule organization. |
| AT1G73500 | member of MAP Kinase Kinase family. Autophosphorylates and also phosphorylates MPK3 and MPK6. Independently involved in ethylene and calmalexin biosynthesis. Induces transcription of ACS2, ACS6, ERF1, ERF2, ERF5, ERF6, CYP79B2, CYP79B3, CYP71A13 and PAD3. |
| AT5G55090 | member of MEKK subfamily |
| AT5G67080 | member of MEKK subfamily |
| AT4G36950 | member of MEKK subfamily |
| AT2G32510 | Member of MEKK subfamily involved in wound and JA induced signaling.Interacts with At5g40440, and activates At1g59580. |
| AT2G30040 | Member of MEKK subfamily. Induced by jasmonic acid and wounding in involved in insectivory response signaling. Iinteracts with At5g40440, and activates At1g59580. |
| AT1G05100 | member of MEKK subfamily. Negatively regulated by RGLG1 and RGLG2; involved in drought stress tolerance. |
| AT3G59140 | member of MRP subfamily |
| AT3G62700 | member of MRP subfamily |
| AT3G09230 | member of MYB3R- and R2R3- type MYB- encoding genes |
| AT3G19960 | member of Myosin-like proteins |
| AT2G37010 | member of NAP subfamily |
| AT1G53320 | Member of plant TLP family. TLP7 is tethered to the PM but detaches upon stimulus and translocates to the nucleus. Has DNA binding activity but lacks conservation of the transcription activation domain. |
| AT4G23700 | member of Putative Na+/H+ antiporter family |
| AT5G22900 | member of Putative Na+/H+ antiporter family |
| AT5G11800 | member of Putative potassium proton antiporter family |
| AT5G58080 | member of Response Regulator: B- Type |
| AT3G13640 | member of RLI subfamily |
| AT5G28913 | Member of Sadhu non-coding retrotransposon family |
| AT3G02515 | Member of Sadhu non-coding retrotransposon family |
| AT2G47070 | member of SPL gene family, encodes DNA binding proteins and putative transcription factors. All have the SBP-box, which encodes the SBP-domain, required for and sufficient for interaction with DNA. |
| AT5G08080 | member of SYP13 Gene Family |
| AT5G16830 | member of SYP2 Gene Family. Over-expression of the gene in tobacco protoplasts leads to a disruption of vacuolar transport from the prevacuolar compartment (PVC) to the vacuole, but not from the Golgi apparatus to the plasma membrane. |
| AT4G17730 | member of SYP2 Gene Family. Together with SYP23 interacts with Tobacco mosaic virus 126 kDa protein; required for normal local virus accumulation and spread. |
| AT1G70610 | member of TAP subfamily |
| AT2G19580 | Member of TETRASPANIN family |
| AT2G37620 | Member of the actin gene family. Expressed in mature pollen. |
| AT3G46230 | Member of the class I small heat-shock protein (sHSP) family, which accounts for the majority of sHSPs in maturing seeds.Induced by heat, cold, salt, drought and high-light. |
| AT2G35630 | Member of the MAP215 family of microtubule-associated proteins required to establish interphase arrays of cortical microtubules.Mutants have defects in cytokinesis during pollen development. Vegetative phenotypes observed in temperature sensitive mutants include left-handed organ twisting, isotropic cell expansion and impairment of root hair polarity. |
| AT3G23090 | Member of the microtubule regulatory protein WVD2/WDL family WDL3 stabilizes cortical microtubules and is involved in light induced hypocotyl elongation. WDL3 is ubiquinated by COP1, leading to its degadation in the dark, |
| AT4G02060 | Member of the minichromosome maintenance complex, involved in DNA replication initiation. Abundant in proliferating and endocycling tissues. Localized in the nucleus during G1, S and G2 phases of the cell cycle, and are released into the cytoplasmic compartment during mitosis. Binds chromatin. |
| AT3G53200 | Member of the R2R3 factor gene family. |
| AT1G74650 | Member of the R2R3 factor gene family. |
| AT5G14340 | Member of the R2R3 factor gene family. |
| AT1G57560 | Member of the R2R3 factor gene family. |
| AT2G23290 | Member of the R2R3 factor gene family. |
| AT4G05100 | Member of the R2R3 factor gene family. |
| AT4G37260 | Member of the R2R3 factor gene family. |
| AT3G23250 | Member of the R2R3 factor gene family. Key regulator of lignin biosynthesis in effector-triggered immunity |
| AT1G18710 | Member of the R2R3 factor gene family. Promotes seed longevity (viability of seed over time.) Expressed in the chalazal seed coat. Overexpresion enhances resistance of seed to deterioration (PMID:32519347). |
| AT5G67300 | Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. |
| AT5G43270 | Member of the SPL (squamosa-promoter binding protein-like) gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. In conjunction with SPL10 and SPL11, SPL2 redundantly controls proper development of lateral organs in association with shoot maturation in the reproductive phase. SPL2, SPL10, and SPL11, suppress root regeneration with age by inhibiting wound-induced auxin biosynthesis. |
| AT2G01570 | Member of the VHIID/DELLA regulatory family. Contains homopolymeric serine and threonine residues, a putative nuclear localization signal, leucine heptad repeats, and an LXXLL motif. Putative transcriptional regulator repressing the gibberellin response and integration of phytohormone signalling. DELLAs repress cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. RGA1 binds to PIF3 and inhibits its DNA binding activity and thus affects the expression of PIF3 regulated genes. RGA may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. Involved in fruit and flower development. |
| AT2G18280 | Member of TLP family |
| AT3G54110 | Member of Uncoupling protein PUMP2 family. Encodes a mitochondrial uncoupling protein AtUCP1 involved in maintain the redox poise of the mitochondrial electron transport chain to facilitate photosynthetic metabolism. Disruption of UCP1 results in a photosynthetic phenotype. Specifically there is a restriction in photorespiration with a decrease in the rate of oxidation of photorespiratory glycine in the mitochondrion. This change leads to an associated reduced photosynthetic carbon assimilation rate. |
| AT3G58730 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
| AT3G01970 | member of WRKY Transcription Factor; Group I |
| AT4G01720 | member of WRKY Transcription Factor; Group II-b |
| AT4G22070 | member of WRKY Transcription Factor; Group II-b |
| AT1G18860 | member of WRKY Transcription Factor; Group II-b |
| AT4G04450 | member of WRKY Transcription Factor; Group II-b. Interacts with lncRNA APOLO to trigger root hair cell expansion in response to cold. |
| AT5G64810 | member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses. |
| AT3G04670 | member of WRKY Transcription Factor; Group II-d |
| AT4G31550 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
| AT2G24570 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
| AT3G58710 | member of WRKY Transcription Factor; Group II-e |
| AT1G29280 | member of WRKY Transcription Factor; Group II-e |
| AT5G22570 | member of WRKY Transcription Factor; Group III |
| AT5G01900 | member of WRKY Transcription Factor; Group III |
| AT1G54110 | Membrane fusion protein Use1 |
| AT5G66800 | membrane-associated kinase regulator-like protein |
| AT4G14723 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT3G02500 | mental retardation GTPase activating protein |
| AT1G71870 | Metabolite transporter involved in the anthocyanin response to anthocyanin induction conditions. Affects ABA signaling and localization. |
| AT3G62010 | metal ion-binding protein |
| AT1G26160 | Metal-dependent phosphohydrolase |
| AT4G04830 | methionine sulfoxide reductase B5 |
| AT4G04840 | methionine sulfoxide reductase B6 |
| AT4G21830 | methionine sulfoxide reductase B7 |
| AT4G21840 | methionine sulfoxide reductase B8 |
| AT4G21850 | methionine sulfoxide reductase B9 |
| AT2G17705 | methionine-S-oxide reductase |
| AT1G63240 | Methyl-DNA binding protein which interacts with RMB1 and ROS1 acting in the base excision repair pathway through DNA methylation. |
| AT5G38710 | Methylenetetrahydrofolate reductase family protein |
| AT3G59970 | methylenetetrahydrofolate reductase MTHFR1 mRNA, complete |
| AT1G11580 | methylesterase PCR A |
| AT5G01710 | methyltransferase |
| AT5G58375 | Methyltransferase-related protein |
| AT1G68990 | MGP3 (male gametophyte-defective 3) belongs to a small family of nuclear-encoded Phage type RNA polymerases (RPOTs) involved in the transcription of mitochondrial genes in Arabidopsis thaliana. Mutation in MGP 3 significantly retarded pollen tube growth and caused defective embryo development. |
| AT1G65820 | microsomal glutathione s-transferase |
| AT4G40042 | Microsomal signal peptidase 12 kDa subunit (SPC12) |
| AT4G14150 | Microtubule motor kinesin PAKRP1/Kinesin-12A. Together with PAKRP1L/Kinesin-12B, serve as linkers of the plus ends of antiparallel microtubules in the phragmoplast. |
| AT3G23670 | Microtubule motor kinesin PAKRP1L/Kinesin-12B. Together with PAKRP1/Kinesin-12A, serve as linkers of the plus ends of antiparallel microtubules in the phragmoplast. |
| AT2G35880 | Microtubule-stabilizing protein. |
| AT4G05020 | Miitochondrial alternative NADH dehydrogenase. |
| AT1G67195 | miRNA (MIR414). Has been identified as a translated small open reading frame by ribosome profiling. |
| AT3G15960 | mismatched DNA binding / ATP binding protein |
| AT5G51740 | Mitochondrial ATP-independent protease .Important for maintenance of proper function of the oxphos system. |
| AT4G21090 | MITOCHONDRIAL FERREDOXIN 2 |
| AT5G27395 | Mitochondrial inner membrane translocase complex, subunit Tim44-related protein |
| AT5G39800 | Mitochondrial ribosomal protein L27 |
| AT3G59650 | mitochondrial ribosomal protein L51/S25/CI-B8 family protein |
| AT5G15640 | Mitochondrial substrate carrier family protein |
| AT3G55640 | Mitochondrial substrate carrier family protein |
| AT2G26360 | Mitochondrial substrate carrier family protein |
| AT1G14140 | Mitochondrial substrate carrier family protein |
| AT3G60400 | Mitochondrial transcription termination factor family protein |
| AT1G76610 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617) |
| AT5G23820 | ML3 can be modified by NEDD8 and ubiquitin. ML3 expression is regulated by NAI1. ML3 expression is regulated by MeJA, ethylene and wounding. ml3-3 is more susceptible against infections with Alternaria brassicicola and more resistant against infections with Pseudomonas syringae DC3000. |
| AT1G35260 | MLP-like protein 165 |
| AT5G18940 | Mo25 family protein |
| AT3G17830 | Molecular chaperone Hsp40/DnaJ family protein |
| AT5G44720 | Molybdenum cofactor sulfurase family protein |
| AT4G22980 | molybdenum cofactor sulfurase-like protein |
| AT3G21700 | Monomeric G protein. Expressed in root epidermal cells that are destined to become atrichoblasts. Also expressed during pollen development and in the pollen tube tip. |
| AT1G53580 | Mononuclear Fe(II)-containing member of the b-lactamase fold superfamily. ETHE1 is homodimeric in solution, exhibits low-level esterase activity, and specifically binds a single Fe(II) atom in the active site. |
| AT2G01450 | MPK17 Map kinase family member. Mutants have increased numbers of peroxisomes a phenotype that can be suppressed by mutations in PMD1. This and other treatments, suggests a function in control of peroxisome proliferation in salt stress. |
| AT1G21920 | MRF1 is related to SET7/9 proteins but contains an atypical SET domain. It is expressed in phloem and mutants have a weak late flowering phenotype. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT3G09100 | mRNA capping enzyme family protein |
| AT3G10320 | MUCI21 is a GT61 protein required for the production of highly branched xylan in seed coat mucilage. MUCI21 likely decorates xylan with xylose side chains that seem to be necessary for pectin attachment to the seed surface. |
| AT2G16640 | multimeric translocon complex in the outer envelope membrane 132 |
| AT1G53800 | muscle M-line assembly protein |
| AT3G13670 | MUT9-like protein kinase. Contributes to phosphorylation of photoexcited CRY2. Interaction with CRY2 occurs via the non catalytic PPKC domain.MLK4 phosphorylates the conserved H2A serine 95 residue. Synthetic mutants that cannot phosphorylate H2AS95 fail to complement the late flowering phenotype suggesting that MLK4 promotes long day flowering via phosphorylation.MLK4 is required for H2A295 phosphorylation of GI. |
| AT4G28750 | mutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Subunit E of Photosystem I |
| AT1G13180 | Mutant has defect in trichome cell expansion and actin organization resulting in a distorted trichome phenotype. |
| AT2G44810 | Mutant has defects in anther dehiscence, pollen maturation, and flower opening. The DAD1 protein is a chloroplastic phospholipase A1 that catalyzes the initial step of jasmonic acid biosynthesis. |
| AT3G44310 | Mutants are resistant to indole-3-acetonitrile (IAN). NIT1 catalyzes the terminal activation step in indole-acetic acid biosynthesis. Predominantly expressed isoform of nitrilase isoenzyme family. Aggregation of NIT1 in cells directly abutting wound sites is one of the earliest events associated with wound and herbicide-induced cell death. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. It is also involved in the conversion of IAN to IAM (indole-3-acetamide) and other non-auxin-related metabolic processes. |
| AT4G37000 | Mutants have spontaneous spreading cell death lesions and constitutive activation of defenses in the absence of pathogen infection. Its product was shown to display red chlorophyll catabolite reductase (RCCR), which catalyzes one step in the breakdown of the porphyrin component of chlorophyll. The enzyme was further assessed to be a Type-1 (pFCC-1-producing) RCCR.Upon P. syringae infection, ACD2 localization shifts from being largely in chloroplasts to partitioning to chloroplasts, mitochondria, and to a small extent, cytosol. Overexpression of ACD2 delayed cell death and the replication of P. syringae. |
| AT3G26830 | Mutations in pad3 are defective in biosynthesis of the indole derived phytoalexin camalexin. Encodes a cytochrome P450 enzyme that catalyzes the conversion of dihydrocamalexic acid to camalexin. |
| AT5G26660 | myb domain protein 86 |
| AT2G47460 | MYB12 belongs to subgroup 7 of the R2R3-MYB family. It strongly activates the promoters of chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), flavonol synthase (FLS) and - to a lesser extent - chalcone flavanone isomerase (CHI), but cannot activate the promoters of flavonoid-3'hydroxylase (F3'H) and dihydroflavonol 4-reductase (DF). The activation requires a functional MYB recognition element (MRE). Results from the myb12-1f allele indicate that an activation domain might be present in the C-terminus. Overexpression or knock-out plants do not show any obvious phenotype under greenhouse conditions. Young myb12-ko seedlings contain reduced amounts of flavonoids (quercetin and kaempferol), while seedlings as well as leaves of MYB12-OX plants displayed an increased flavonoid content. They did not show any significant difference in anthocyanin content. Expression of CHS and FLS shows a clear correlation to MYB12 expression levels. CHI and F3H show increased transcript levels in the MYB12-OX lines, but no differences in the knock-out. Even in the absence of functional MYB12, flavonol biosynthesis is not completely absent, suggesting functional redundancy. The redundant factors are MYB11 and MYB111 although MYB12 is primarily required for flavonol biosynthesis in roots. Mutations in MYB12 block both auxin and ethylene stimulation of flavonoid synthesis. |
| AT3G24120 | MYB-CC protein involved in regulation of response to phosphate starvation. |
| AT5G58340 | myb-like HTH transcriptional regulator family protein |
| AT3G13040 | myb-like HTH transcriptional regulator family protein |
| AT3G16350 | MYB-like transcription factor involved in nitrate signaling trough regulation of CHL1. |
| AT5G60890 | Myb-like transcription factor that modulates expression of ASA1, a key point of control in the tryptophan pathway; mutant has deregulated expression of ASA1 in dominant allele. Loss of function allele suggests ATR1 also functions at a control point for regulating indole glucosinolate homeostasis. |
| AT5G17300 | Myb-like transcription factor that regulates hypocotyl growth by regulating free auxin levels in a time-of-day specific manner. |
| AT1G22640 | MYB-type transcription factor (MYB3) that represses phenylpropanoid biosynthesis gene expression |
| AT5G46760 | MYC3 is a JAZ-interacting transcription factor that act together with MYC2 and MYC4 to activate JA-responses. |
| AT5G01910 | myelin transcription factor |
| AT2G47950 | myelin transcription factor-like protein |
| AT2G45380 | myeloid leukemia factor |
| AT5G10170 | myo-inositol-1-phosphate synthase isoform 3.Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT1G05320 | myosin heavy chain, embryonic smooth protein |
| AT5G52280 | Myosin heavy chain-related protein |
| AT3G11850 | myosin-binding protein (Protein of unknown function, DUF593) |
| AT1G70750 | myosin-binding protein (Protein of unknown function, DUF593) |
| AT5G04540 | Myotubularin-like phosphatases II superfamily |
| AT1G02210 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein |
| AT2G02450 | NAC domain containing protein 35 |
| AT3G04070 | NAC domain containing protein 47 |
| AT3G04420 | NAC domain containing protein 48 |
| AT4G01520 | NAC domain containing protein 67 |
| AT5G14000 | NAC domain containing protein 84 |
| AT5G18270 | NAC domain containing protein 87 |
| AT5G56620 | NAC domain containing protein 99 |
| AT1G77450 | NAC domain transcriptional regulator that is induced by ROS in roots where it regulates the expression of downstream genes such as MYB30. |
| AT2G46770 | NAC transcription factor NST1. NST1 and NST2 are redundant in regulating secondary wall thickening in anther walls and siliques. An NST1 promoter fusion was detected in various tissues in which lignified secondary walls develop. Both MYC2 and MYC4 bind to the NST1 promoter and appear to regulate its expression in response to blue light. |
| AT1G61110 | NAC transcription regulator. Regulates endosperm cell expansion during germination. |
| AT3G58130 | N-acetylglucosaminylphosphatidylinositol de-N-acetylase family protein |
| AT2G22910 | N-acetyl-l-glutamate synthase 1 |
| AT3G46170 | NAD(P)-binding Rossmann-fold superfamily protein |
| AT4G23420 | NAD(P)-binding Rossmann-fold superfamily protein |
| AT3G01980 | NAD(P)-binding Rossmann-fold superfamily protein |
| AT4G30470 | NAD(P)-binding Rossmann-fold superfamily protein |
| AT3G59710 | NAD(P)-binding Rossmann-fold superfamily protein |
| AT5G02540 | NAD(P)-binding Rossmann-fold superfamily protein |
| AT1G01800 | NAD(P)-binding Rossmann-fold superfamily protein |
| AT5G15940 | NAD(P)-binding Rossmann-fold superfamily protein |
| AT4G24050 | NAD(P)-binding Rossmann-fold superfamily protein |
| AT3G03980 | NAD(P)-binding Rossmann-fold superfamily protein |
| AT3G55310 | NAD(P)-binding Rossmann-fold superfamily protein |
| AT3G29250 | NAD(P)-binding Rossmann-fold superfamily protein |
| AT3G55290 | NAD(P)-binding Rossmann-fold superfamily protein |
| AT1G68540 | NAD(P)-binding Rossmann-fold superfamily protein |
| AT1G04420 | NAD(P)-linked oxidoreductase superfamily protein |
| AT2G27680 | NAD(P)-linked oxidoreductase superfamily protein |
| AT3G03100 | NADH:ubiquinone oxidoreductase, 17.2kDa subunit |
| AT5G47910 | NADPH/respiratory burst oxidase protein D (RbohD).Interacts with AtrbohF gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. |
| AT4G24110 | NADP-specific glutamate dehydrogenase |
| AT2G44070 | NagB/RpiA/CoA transferase-like superfamily protein |
| AT1G06002 | Natural antisense transcript overlaps with AT1G06000 |
| AT1G18735 | Natural antisense transcript overlaps with AT1G18730 |
| AT1G20515 | Natural antisense transcript overlaps with AT1G20520 |
| AT1G28685 | Natural antisense transcript overlaps with AT1G28680 |
| AT1G67365 | Natural antisense transcript overlaps with AT1G67370 |
| AT1G76878 | Natural antisense transcript overlaps with AT1G76880 |
| AT1G78265 | Natural antisense transcript overlaps with AT1G78270 |
| AT2G26692 | Natural antisense transcript overlaps with AT2G26690 |
| AT2G30362 | Natural antisense transcript overlaps with AT2G30360 |
| AT2G33051 | Natural antisense transcript overlaps with AT2G33050 |
| AT2G35859 | Natural antisense transcript overlaps with AT2G35860 |
| AT2G35945 | Natural antisense transcript overlaps with AT2G35940 |
| AT2G37555 | Natural antisense transcript overlaps with AT2G37550 |
| AT2G40008 | Natural antisense transcript overlaps with AT2G40010 |
| AT2G41178 | Natural antisense transcript overlaps with AT2G41180 |
| AT2G45685 | Natural antisense transcript overlaps with AT2G45680 |
| AT3G05905 | Natural antisense transcript overlaps with AT3G05900 |
| AT3G24518 | Natural antisense transcript overlaps with AT3G24520 |
| AT3G51238 | Natural antisense transcript overlaps with AT3G51240 |
| AT3G52535 | Natural antisense transcript overlaps with AT3G52540 |
| AT3G56408 | Natural antisense transcript overlaps with AT3G56410 |
| AT3G58795 | Natural antisense transcript overlaps with AT3G58790 |
| AT4G22233 | Natural antisense transcript overlaps with AT4G22235 |
| AT4G27852 | Natural antisense transcript overlaps with AT4G27850 and AT4G27860 |
| AT5G05435 | Natural antisense transcript overlaps with AT5G05430 |
| AT5G06865 | Natural antisense transcript overlaps with AT5G06860 |
| AT5G26146 | Natural antisense transcript overlaps with AT5G26150 |
| AT5G40348 | Natural antisense transcript overlaps with AT5G40350 |
| AT5G59732 | Natural antisense transcript overlaps with AT5G59730. The RNA is cell-to-cell mobile. |
| AT5G67488 | Natural antisense transcript overlaps with AT5G67490 |
| AT1G72840 | NBS TIR LRR protein. It is induced in response to bacterial pathogens and overexpression results in cell death in leaves. |
| AT1G72890 | NBS TIR protein. |
| AT5G16360 | NC domain-containing protein-like protein |
| AT5G36970 | NDR1/HIN1-like protein, expression induced during incompatible response to a pathogen, expression is at least partly dependent on the salicylic acid signaling pathway |
| AT1G09470 | NEAP3 is a member of a small family containing coiled-coil domains, a nuclear localization signal and a C-terminal predicted transmembrane domain. It localizes to the nuclear periphery. Mutants have altered nuclear morphology and chromatin structure. |
| AT2G30560 | Needs to be reannotated and split into two genes, AtEAL2 and AtEAL3, both encoding maize Ebb apparatus 1-like proteins. |
| AT3G53480 | Negative regulator of auxin polar transport inhibitors. ABCG37 regulates auxin distribution and homeostasis in roots by excluding IBA from the root apex, but does not act directly in basipetal transport. ABCG37 and ABCG36 act redundantly at outermost root plasma membranes and, transport IBA out of the cells. Also involved in root transmembrane secretion of fluorescent phenolics involved in Fe uptake. |
| AT1G66350 | Negative regulator of GA responses, member of GRAS family of transcription factors. Also belongs to the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. RGL1 may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Rapidly degraded in response to GA. Involved in flower and fruit development. |
| AT2G33830 | Negative regulator of local and systemic acquired resistance; target of FLD for activation of SAR. |
| AT4G23390 | NEP-interacting protein, putative (DUF239) |
| AT3G50910 | netrin receptor DCC |
| AT1G72690 | neurofilament heavy protein |
| AT4G26483 | nicotianamine synthase |
| AT1G02450 | NIMIN1 modulates PR gene expression according the following model: NPR1 forms a ternary complex with NIMIN1 and TGA factors upon SAR induction that binds to a positive regulatory cis-element of the PR-1 promoter, termed LS7. This leads to PR-1 gene induction. NIMIN1 decreases transcriptional activation, possibly through its EAR motif, which results in fine-tuning of PR-1 gene expression. |
| AT1G79260 | nitrobindin heme-binding domain protein |
| AT1G78150 | N-lysine methyltransferase |
| AT5G45370 | nodulin MtN21-like transporter family protein |
| AT3G28050 | nodulin MtN21-like transporter family protein |
| AT5G40210 | nodulin MtN21-like transporter family protein |
| AT3G28130 | nodulin MtN21-like transporter family protein |
| AT3G16690 | Nodulin MtN3 family protein |
| AT1G74780 | Nodulin-like / Major Facilitator Superfamily protein |
| AT2G34350 | Nodulin-like / Major Facilitator Superfamily protein |
| AT4G30975 | None |
| AT3G59765 | None |
| AT2G39260 | Nonsense mediated decay (NMD)factor. |
| AT3G15510 | Note of caution: not to be confused with another protein (AtNAC6 locus AT5G39610) which on occasion has also been referred to as AtNAC2. |
| AT3G45700 | NPF2.4 is a member of the NAXT NPF subfamily. It encodes a plasmamembrane localized chloride transporter that is expressed in the root and is down regulated in response to ABA and salt treatment. NPF2.3 miRNA induced knockdowns have less Cl in the shoots when grown on low NaCl concentrations. |
| AT3G06030 | NPK1-related protein kinase 3 |
| AT2G28130 | NSE5 subunit of the SMC5/6 complex. |
| AT5G16000 | NSP-interacting kinase (NIK1), receptor-like kinase, involved in defense response against geminivirus It acts as a virulence target of the begomovirus nuclear shuttle protein (NSP). |
| AT2G27300 | NTL8 is a membrane-associated NAC transcription factor that binds both TRY and TCL1. Overexpression results in fewer trichomes. |
| AT3G53600 | Nuclear C2H2 zinc finger protein.Expression is induced by cold, osmotic, salt, and drought stress. Over expression confers some drought tolerance whereas mutants display some drought sensitivity. |
| AT2G18450 | Nuclear encoded mitochondrial flavoprotein subunit of succinate dehydrogenase complex . |
| AT1G30500 | nuclear factor Y, subunit A7 |
| AT1G07980 | nuclear factor Y, subunit C10 |
| AT5G38140 | nuclear factor Y, subunit C12 |
| AT5G04830 | Nuclear transport factor 2 (NTF2) family protein |
| AT2G46100 | Nuclear transport factor 2 (NTF2) family protein |
| AT2G46410 | Nuclear-localized R3-type MYB transcription factor. Positive regulator of hair-cell differentiation. Preferentially transcribed in hairless cells. Moves from atrichoblasts into trichoblast via plasmodesmata in a tissue-specific mode. N-terminus and part of the Myb domain are required for this movement, with W76 playing a crucial role. Capability to increase the size-exclusion limit of plasmodesmata. Regulated by WEREWOLF. |
| AT3G17030 | Nucleic acid-binding proteins superfamily |
| AT4G30800 | Nucleic acid-binding, OB-fold-like protein |
| AT2G20490 | nucleolar RNA-binding Nop10p family protein |
| AT1G47970 | nucleolin |
| AT2G36420 | nucleolin-like protein |
| AT4G38760 | nucleoporin (DUF3414) |
| AT1G13120 | nucleoporin GLE1-like protein |
| AT4G11010 | nucleoside diphosphate kinase 3 (ndpk3), located to the inter-membrane space in mitochondria |
| AT1G12805 | nucleotide binding protein |
| AT2G01330 | nucleotide binding protein |
| AT5G40900 | Nucleotide-diphospho-sugar transferase family protein |
| AT1G63000 | nucleotide-rhamnose synthase/epimerase-reductase |
| AT4G32390 | Nucleotide-sugar transporter family protein |
| AT5G11230 | Nucleotide-sugar transporter family protein |
| AT1G28350 | Nucleotidylyl transferase superfamily protein |
| AT3G12600 | nudix hydrolase homolog 16 |
| AT1G14860 | nudix hydrolase homolog 18 |
| AT5G19460 | nudix hydrolase homolog 20 |
| AT1G73540 | nudix hydrolase homolog 21 |
| AT1G18300 | nudix hydrolase homolog 4 |
| AT5G47240 | nudix hydrolase homolog 8 |
| AT5G53450 | OBP3-responsive protein 1 |
| AT1G70640 | octicosapeptide/Phox/Bem1p (PB1) domain-containing protein |
| AT5G16220 | Octicosapeptide/Phox/Bem1p family protein |
| AT3G54100 | O-fucosyltransferase family protein |
| AT2G44500 | O-fucosyltransferase family protein |
| AT5G65470 | O-fucosyltransferase family protein |
| AT3G48980 | O-glucosyltransferase rumi-like protein (DUF821) |
| AT5G23850 | O-glucosyltransferase rumi-like protein (DUF821) |
| AT5G55180 | O-Glycosyl hydrolases family 17 protein |
| AT2G05790 | O-Glycosyl hydrolases family 17 protein |
| AT3G07320 | O-Glycosyl hydrolases family 17 protein |
| AT3G55430 | O-Glycosyl hydrolases family 17 protein |
| AT4G24840 | oligomeric golgi complex subunit-like protein |
| AT5G64410 | oligopeptide transporter |
| AT1G51990 | O-methyltransferase family protein |
| AT1G21100 | O-methyltransferase family protein |
| AT2G38240 | One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT3G55970 | One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT4G05320 | One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. |
| AT5G24310 | One of four ABI-like proteins. |
| AT1G02560 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). |
| AT3G27190 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
| AT5G49460 | One of the two genes encoding subunit B of the cytosolic enzyme ATP Citrate Lyase (ACL) |
| AT3G06650 | One of the two genes encoding subunit B of the trimeric enzyme ATP Citrate lyase |
| AT1G20260 | One of three genes encoding the vacuolar ATP synthase subunit B1. The protein binds to and co-localizes with F-actin, bundles F-actin to form higher-order structure, and stabilizes actin filaments in vitro. |
| AT5G65165 | One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Transcripts appear during seed maturation, persist through desiccation, are abundant in dry seeds, and markedly decline during germination. |
| AT1G76100 | One of two Arabidopsis plastocyanin genes. Expressed at 1/10th level of PETE2. Does not respond to increased copper levels and is thought to be the isoform that participates in electron transport under copper-limiting conditions. Mutation of this gene does not have obvious effect on photosynthesis. |
| AT2G36070 | One of two genes in Arabidopsis that encode a putative subunit of the mitochondrial inner membrane translocase complex. TIM44 subunit is thought to provide the energy for translocation via hydrolysis of ATP. |
| AT1G22275 | One of two nearly identical proteins (ZYP1a) identified by similarity to transverse filament (TF) proteins. These proteins are involved in chromosome synapsis during meiosis I and localize to the synaptonemal complex (SC). Single mutants have reduced fertility and double mutants (induced by RNAi) have severely reduced fertility. |
| AT3G03460 | One of two paralogous GLTSCR domain containing proteins and a core component of SWI/SNF complexes. Interacts with BRM and may be responsible for ensuring proper complex assembly and association with chromatin. Function is dependent upon the GLTSCR domain. |
| AT1G20510 | OPC-8:0 CoA ligase1 |
| AT4G20010 | Organellar Single-stranded DNA Binding protein. Decreases MMEJ on long ssDNA templates. |
| AT1G16370 | organic cation/carnitine transporter 6 |
| AT4G21570 | organic solute transporter ostalpha protein (DUF300) |
| AT1G23070 | organic solute transporter ostalpha protein (DUF300) |
| AT1G01230 | ORM1 is an ER localized orosomucoid-like protein involved in sphingolipid homeostasis. |
| AT4G36648 | other_RNA |
| AT1G67238 | other_RNA |
| AT1G77138 | other_RNA |
| AT2G01422 | other_RNA |
| AT1G46554 | other_RNA |
| AT4G16748 | other_RNA |
| AT3G44798 | other_RNA |
| AT4G39404 | other_RNA |
| AT3G45638 | other_RNA |
| AT4G40065 | other_RNA |
| AT1G69252 | other_RNA |
| AT1G04425 | other_RNA |
| AT3G11415 | other_RNA |
| AT2G07042 | other_RNA |
| AT4G26255 | other_RNA |
| AT1G48540 | Outer arm dynein light chain 1 protein |
| AT1G78230 | Outer arm dynein light chain 1 protein |
| AT1G20816 | outer envelope pore-like protein |
| AT2G36050 | ovate family protein 15 |
| AT3G52540 | ovate family protein 18 |
| AT4G29200 | Over-expressed by salt stress. |
| AT2G48080 | oxidoreductase, 2OG-Fe(II) oxygenase family protein |
| AT5G52410 | oxidoreductase/transition metal ion-binding protein |
| AT3G51940 | oxidoreductase/transition metal ion-binding protein |
| AT1G10530 | PADRE protein |
| AT1G60010 | PADRE protein down-regulated after infection by S. sclerotiorun. |
| AT4G37240 | PADRE protein down-regulated after infection by S. sclerotiorun. |
| AT5G12340 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT1G28190 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT1G76600 | PADRE protein up-regulated after infection by S. sclerotiorun. |
| AT5G66580 | PADRE protein. |
| AT3G61920 | PADRE protein. |
| AT4G02090 | PADRE protein. |
| AT3G50800 | PADRE protein. |
| AT1G21010 | PADRE proteinup-regulated after infection by S. sclerotiorun. |
| AT3G24093 | Paired amphipathic helix (PAH2) superfamily protein |
| AT2G17340 | pantothenate kinase |
| AT3G06660 | PAPA-1-like family protein / zinc finger (HIT type) family protein |
| AT4G23050 | PAS domain-containing protein tyrosine kinase family protein |
| AT1G76980 | patatin-like phospholipase domain protein |
| AT4G37070 | Patatin-related phospholipase A. Expressed strongly and exclusively in roots. AtplaIVA-null mutants have reduced lateral root development. Phosphorylation by calcium-dependent protein kinases in vitro enhances its activity. |
| AT4G37060 | Patatin-related phospholipase A. Expressed weakly in roots, cotyledons, and leaves but is transcriptionally induced by auxin. Phosphorylation by calcium-dependent protein kinases in vitro enhances its activity. |
| AT1G42470 | Patched family protein |
| AT5G56980 | Pathogen-associated molecular pattern-induced gene.Responsive to jasmonic acid and wounding. |
| AT4G38670 | Pathogenesis-related thaumatin superfamily protein |
| AT1G75800 | Pathogenesis-related thaumatin superfamily protein |
| AT1G80840 | Pathogen-induced transcription factor. Binds W-box sequences in vitro. Forms protein complexes with itself and with WRKY40 and WRKY60. Coexpression with WRKY18 or WRKY60 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. |
| AT4G31800 | Pathogen-induced transcription factor. Binds W-box sequences in vitro. Forms protein complexes with itself and with WRKY40 and WRKY60. Constitutive expression of WRKY18 enhanced resistance to P. syringae, but its coexpression with WRKY40 or WRKY60 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. |
| AT3G55450 | PBS1-like 1 |
| AT2G16365 | PCH1 binds and stabilizes the active (Pfr) form of phytochrome B and is involved in the formation of photobodies in the nucleus. PCH1 is expressed in evenings and is associated to the evening complex through binding to phyB, and represses hypocotyl elongation and growth. Using mass spec, the existence of the At2g16365.2 isoform has been verified, however here is no evidence that any of the other three variants are present. Atg2G16365.2 will be assigned PCH1; exon 4 and 5 in the other variants are actually another gene of the F-box/DUF295 family with gene name FDA10. |
| AT5G02460 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT3G01270 | Pectate lyase family protein |
| AT5G45280 | Pectin acetylesterase involved in pectin remodelling. |
| AT1G30350 | Pectin lyase-like superfamily protein |
| AT3G24670 | Pectin lyase-like superfamily protein |
| AT3G16850 | Pectin lyase-like superfamily protein |
| AT5G07430 | Pectin lyase-like superfamily protein |
| AT1G80170 | Pectin lyase-like superfamily protein |
| AT1G19170 | Pectin lyase-like superfamily protein |
| AT2G43890 | Pectin lyase-like superfamily protein |
| AT4G35670 | Pectin lyase-like superfamily protein |
| AT1G10640 | Pectin lyase-like superfamily protein |
| AT5G48140 | Pectin lyase-like superfamily protein |
| AT3G53190 | Pectin lyase-like superfamily protein |
| AT4G20040 | Pectin lyase-like superfamily protein |
| AT4G25260 | Pectin methylesterase inhibitor. Forms pH dependent complex with PME3. |
| AT2G45220 | Pectin methylesterase involved in pectin remodelling. Regulated by its PRO region that triggers PME activity in the resistance to Botrytis cinerea. |
| AT3G05910 | Pectinacetylesterase family protein |
| AT4G19420 | Pectinacetylesterase family protein |
| AT1G02813 | pectinesterase (Protein of unknown function, DUF538) |
| AT1G02816 | pectinesterase (Protein of unknown function, DUF538) |
| AT2G30100 | pentatricopeptide (PPR) repeat-containing protein |
| AT3G50420 | Pentatricopeptide repeat (PPR) superfamily protein |
| AT5G61990 | Pentatricopeptide repeat (PPR) superfamily protein |
| AT5G43790 | Pentatricopeptide repeat (PPR) superfamily protein |
| AT2G48000 | Pentatricopeptide repeat (PPR) superfamily protein |
| AT4G35850 | Pentatricopeptide repeat (PPR) superfamily protein |
| AT3G49710 | Pentatricopeptide repeat (PPR) superfamily protein |
| AT5G59900 | Pentatricopeptide repeat (PPR) superfamily protein |
| AT5G14350 | Pentatricopeptide repeat (PPR) superfamily protein |
| AT1G11710 | Pentatricopeptide repeat (PPR) superfamily protein |
| AT1G20300 | Pentatricopeptide repeat (PPR) superfamily protein |
| AT1G56690 | Pentatricopeptide repeat (PPR) superfamily protein |
| AT5G08510 | Pentatricopeptide repeat (PPR) superfamily protein |
| AT5G04780 | Pentatricopeptide repeat (PPR) superfamily protein |
| AT5G16420 | Pentatricopeptide repeat (PPR-like) superfamily protein |
| AT5G46680 | Pentatricopeptide repeat (PPR-like) superfamily protein |
| AT1G66345 | Pentatricopeptide Repeat Protein involved in splicing of nad4 intron which affects biogenesis of the respiratory complex I. |
| AT4G01400 | Pentatricopeptide Repeat Protein involved in splicing of nad4, nad 5, nad 1 and nad2 introns which affects biogenesis of the respiratory complex I. |
| AT5G04810 | Pentatricopeptide which is essential during the early stages of embryo development and acts in the plastid nucleoids as the factor responsible of rps12 intron 1 trans-splicing and, indirectly, in the assembly of 70S ribosomes and plastid translation. |
| AT2G01880 | PEP complex component. |
| AT1G56700 | Peptidase C15, pyroglutamyl peptidase I-like protein |
| AT1G23440 | Peptidase C15, pyroglutamyl peptidase I-like protein |
| AT3G48380 | Peptidase C78, ubiquitin fold modifier-specific peptidase 1/ 2 |
| AT1G06200 | Peptidase S24/S26A/S26B/S26C family protein |
| AT3G08980 | Peptidase S24/S26A/S26B/S26C family protein |
| AT5G43060 | Peptidase, activity detected in extracts of root, leaf and cell culture. |
| AT2G47020 | Peptide chain release factor 1 |
| AT5G03190 | peptide upstream protein |
| AT3G52790 | peptidoglycan-binding LysM domain-containing protein |
| AT5G16140 | Peptidyl-tRNA hydrolase family protein |
| AT5G62130 | Per1-like family protein |
| AT5G14110 | peroxidase (DUF 3339) |
| AT4G30170 | Peroxidase family protein |
| AT4G17690 | Peroxidase superfamily protein |
| AT4G25980 | peroxidase superfamily protein |
| AT2G42770 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein |
| AT5G43140 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein |
| AT1G19600 | pfkB-like carbohydrate kinase family protein |
| AT5G58730 | pfkB-like carbohydrate kinase family protein |
| AT1G78400 | PGX2 is a cell wall protein that codes for a polygalacturonase. |
| AT1G77800 | PHD finger family protein |
| AT2G18090 | PHD finger family protein / SWIB complex BAF60b domain-containing protein / GYF domain-containing protein |
| AT4G35510 | PHD finger-like protein |
| AT2G26530 | Pheromone receptor-like protein involved in the early elicitor signaling events which occur within minutes and include ion fluxes across the plasma membrane, activation of MPKs and the formation of ROS related to PGPS1 and WRKY33. |
| AT1G63090 | phloem protein 2-A11 |
| AT5G52120 | phloem protein 2-A14 |
| AT1G80110 | phloem protein 2-B11 |
| AT2G02310 | phloem protein 2-B6 |
| AT2G02320 | phloem protein 2-B7 |
| AT1G77855 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G01390 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G77660 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT3G09920 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) family member. Family members are key enzymes in the process of phosphatidylinositol signaling pathway and have essential functions in growth, development, and biotic and abiotic stresses responses in plants |
| AT1G10900 | Phosphatidylinositol-4-phosphate 5-kinase family protein |
| AT5G58690 | phosphatidylinositol-speciwc phospholipase C5 |
| AT3G01550 | phosphoenolpyruvate (pep)/phosphate translocator 2 |
| AT1G77060 | Phosphoenolpyruvate carboxylase family protein |
| AT5G56630 | phosphofructokinase 7 |
| AT3G14205 | Phosphoinositide phosphatase family protein |
| AT1G17340 | Phosphoinositide phosphatase family protein |
| AT2G42910 | Phosphoribosyltransferase family protein |
| AT4G24340 | Phosphorylase superfamily protein |
| AT4G24350 | Phosphorylase superfamily protein |
| AT4G28940 | Phosphorylase superfamily protein |
| AT1G03930 | Phosphorylates serine, threonine, and tyrosine |
| AT1G51400 | Photosystem II 5 kD protein |
| AT3G08660 | Phototropic-responsive NPH3 family protein |
| AT1G67900 | Phototropic-responsive NPH3 family protein |
| AT5G48800 | Phototropic-responsive NPH3 family protein |
| AT3G50840 | Phototropic-responsive NPH3 family protein |
| AT3G22104 | Phototropic-responsive NPH3 family protein |
| AT3G08570 | Phototropic-responsive NPH3 family protein |
| AT4G32160 | Phox (PX) domain-containing protein |
| AT3G16500 | phytochrome-associated protein 1 (PAP1) |
| AT3G49780 | Phytosulfokine 3 precursor, coding for a unique plant peptide growth factor. Plants overexpressing this gene (under a 35S promoter), develop normal cotyledons and hypocotyls but their growth, in particular that of their roots, was faster than that of wildtype. |
| AT2G46230 | PIN domain-like family protein |
| AT2G25950 | PITH domain protein (DUF1000) |
| AT5G41390 | PLAC8 family protein |
| AT1G49030 | PLAC8 family protein |
| AT2G15220 | Plant basic secretory protein (BSP) family protein |
| AT2G42900 | Plant basic secretory protein (BSP) family protein |
| AT5G15430 | Plant calmodulin-binding protein-like protein |
| AT1G08990 | plant glycogenin-like starch initiation protein 5 |
| AT2G26450 | Plant invertase/pectin methylesterase inhibitor superfamily |
| AT1G02810 | Plant invertase/pectin methylesterase inhibitor superfamily |
| AT3G43270 | Plant invertase/pectin methylesterase inhibitor superfamily |
| AT3G06830 | Plant invertase/pectin methylesterase inhibitor superfamily |
| AT2G26440 | Plant invertase/pectin methylesterase inhibitor superfamily |
| AT3G49220 | Plant invertase/pectin methylesterase inhibitor superfamily |
| AT5G62350 | Plant invertase/pectin methylesterase inhibitor superfamily protein |
| AT3G17130 | Plant invertase/pectin methylesterase inhibitor superfamily protein |
| AT2G47340 | Plant invertase/pectin methylesterase inhibitor superfamily protein |
| AT1G02550 | Plant invertase/pectin methylesterase inhibitor superfamily protein |
| AT5G21105 | Plant L-ascorbate oxidase |
| AT2G01560 | Plant protein 1589 of unknown function |
| AT3G18350 | Plant protein of unknown function (DUF639) |
| AT3G24060 | Plant self-incompatibility protein S1 family |
| AT5G12060 | Plant self-incompatibility protein S1 family |
| AT5G01830 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G67340 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G65920 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G51270 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G01660 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G24330 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT3G47820 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G76390 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G47180 | Plant VAMP (vesicle-associated membrane protein) family protein |
| AT1G13990 | plant/protein |
| AT1G03610 | plant/protein (DUF789) |
| AT1G74450 | Plants overexpressing At1g74450 are stunted in height and have reduced male fertility. |
| AT5G13220 | Plants overexpressing At5g13220.3, but not At5g13220.1 showed enhanced insensitivity to MeJa. |
| AT2G12400 | plasma membrane fusion protein |
| AT4G23400 | Plasma membrane intrinsic protein, involved redundantly with PIP1;1/2/3/4 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
| AT4G37190 | plasma membrane, autoregulation-binding site, misato segment II, myosin-like, tubulin/FtsZ protein |
| AT1G16860 | Plasma membrane-localized proteins that negatively regulate cellulose synthesis by inhibiting the exocytosis of CESAs. |
| AT5G13760 | Plasma-membrane choline transporter family protein |
| AT1G25500 | Plasma-membrane choline transporter family protein |
| AT5G45410 | Plastid localized protein of unknown function. Mutants are more susceptible to P. syringae and produce less callose upon infection. |
| AT4G25030 | Plastid localized protein of unknown function. Mutants are more susceptible to P. syringae and produce less callose upon infection. |
| AT1G72520 | PLAT/LH2 domain-containing lipoxygenase family protein |
| AT1G67560 | PLAT/LH2 domain-containing lipoxygenase family protein |
| AT4G39730 | PLAT1 domain stress protein family member. Involved in mediating response to stresses such as pathogen infection. It is found in endoplasmic reticulum bodies. PLAT1 is induced by pathogenic fungi and induces the production of scopolin. |
| AT5G46710 | PLATZ transcription factor family protein |
| AT1G21000 | PLATZ transcription factor family protein |
| AT4G17900 | PLATZ transcription factor family protein |
| AT1G76590 | PLATZ transcription factor family protein |
| AT4G36945 | PLC-like phosphodiesterases superfamily protein |
| AT4G34920 | PLC-like phosphodiesterases superfamily protein |
| AT2G30060 | Pleckstrin homology (PH) domain superfamily protein |
| AT5G01570 | plectin-like protein |
| AT4G15215 | pleiotropic drug resistance 13 |
| AT4G15230 | pleiotropic drug resistance 2 |
| AT2G36380 | pleiotropic drug resistance 6 |
| AT1G15210 | pleiotropic drug resistance 7 |
| AT3G61680 | PLIP1 encodes a plastid localized phospholipase A1 involved in seed oil biosynthesis. |
| AT1G02660 | PLIP2 is a glycerolipid A1 lipase with substrate preference for monogalactosyldiacylglycerol. Expression is induced by ABA. |
| AT4G34910 | P-loop containing nucleoside triphosphate hydrolases superfamily protein |
| AT1G02670 | P-loop containing nucleoside triphosphate hydrolases superfamily protein |
| AT2G03750 | P-loop containing nucleoside triphosphate hydrolases superfamily protein |
| AT4G16680 | P-loop containing nucleoside triphosphate hydrolases superfamily protein |
| AT5G45490 | P-loop containing nucleoside triphosphate hydrolases superfamily protein |
| AT1G03030 | P-loop containing nucleoside triphosphate hydrolases superfamily protein |
| AT5G52882 | P-loop containing nucleoside triphosphate hydrolases superfamily protein |
| AT4G25280 | P-loop containing nucleoside triphosphate hydrolases superfamily protein |
| AT3G50940 | P-loop containing nucleoside triphosphate hydrolases superfamily protein |
| AT2G18193 | P-loop containing nucleoside triphosphate hydrolases superfamily protein |
| AT1G26090 | P-loop containing nucleoside triphosphate hydrolases superfamily protein |
| AT3G01820 | P-loop containing nucleoside triphosphate hydrolases superfamily protein |
| AT5G58370 | P-loop containing nucleoside triphosphate hydrolases superfamily protein |
| AT1G21730 | P-loop containing nucleoside triphosphate hydrolases superfamily protein |
| AT5G05450 | P-loop containing nucleoside triphosphate hydrolases superfamily protein |
| AT3G09720 | P-loop containing nucleoside triphosphate hydrolases superfamily protein |
| AT5G41310 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein |
| AT1G63640 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein |
| AT3G03210 | Pmr5/Cas1p GDSL/SGNH-like acyl-esterase family protein |
| AT5G17480 | pollen calcium-binding protein 1 |
| AT1G78040 | Pollen Ole e 1 allergen and extensin family protein |
| AT1G70370 | Polygalacturonase involved in cell wall modification. |
| AT5G49800 | Polyketide cyclase/dehydrase and lipid transport superfamily protein |
| AT1G23120 | Polyketide cyclase/dehydrase and lipid transport superfamily protein |
| AT1G14930 | Polyketide cyclase/dehydrase and lipid transport superfamily protein |
| AT4G23670 | Polyketide cyclase/dehydrase and lipid transport superfamily protein |
| AT3G26460 | Polyketide cyclase/dehydrase and lipid transport superfamily protein |
| AT5G54170 | Polyketide cyclase/dehydrase and lipid transport superfamily protein |
| AT4G14500 | Polyketide cyclase/dehydrase and lipid transport superfamily protein |
| AT3G26450 | Polyketide cyclase/dehydrase and lipid transport superfamily protein |
| AT4G23680 | Polyketide cyclase/dehydrase and lipid transport superfamily protein |
| AT2G32415 | Polynucleotidyl transferase, ribonuclease H fold protein with HRDC domain-containing protein |
| AT3G23320 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein |
| AT3G15080 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein |
| AT5G25800 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein |
| AT4G27430 | Positive regulator of light-regulated genes. Novel nuclear protein which requires light for its high level expression. |
| AT1G31120 | potassium transporter |
| AT1G70300 | potassium transporter |
| AT3G02050 | potassium transporter KUP3p (KUP3) |
| AT2G19572 | Potential natural antisense gene, locus overlaps with AT2G19570 |
| AT3G61600 | POZ/BTB containing-protein AtPOB1. Involvement in protein ubiquitylation is predicted based on physical interaction with CULLIN 3 proteins. |
| AT2G20630 | PP2C induced by AVRRPM1 |
| AT5G55840 | PPR superfamily protein |
| AT4G36850 | PQ-loop repeat family protein / transmembrane family protein |
| AT1G55190 | PRA1 (Prenylated rab acceptor) family protein |
| AT3G13720 | PRA1 (Prenylated rab acceptor) family protein |
| AT1G74420 | Predicted fucosyltransferase, based on similarity to FUT1, but not functionally redundantwith FUT1. |
| AT1G60470 | Predicted to encode a galactinol synthase. |
| AT5G43570 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. |
| AT5G43580 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Functions in resistance to necrotrophic fungi and insect herbivory. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860. |
| AT1G61070 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT2G44195 | pre-mRNA splicing factor domain-containing protein |
| AT2G44200 | pre-mRNA splicing factor domain-containing protein |
| AT3G56720 | pre-mRNA-splicing factor |
| AT1G78480 | Prenyltransferase family protein |
| AT1G15710 | prephenate dehydrogenase family protein |
| AT1G21600 | Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression. essential subunit of the plastid-encoded RNA polymerase (PEP). Mediates phytochrome signaling. |
| AT2G30850 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT1G06610 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT5G08075 | pre-tRNA tRNA-Ala (anticodon: CGC);(source:Araport11, TAIR10) |
| AT3G63006 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
| AT5G65015 | pre-tRNA tRNA-Arg (anticodon: ACG);(source:Araport11, TAIR10) |
| AT2G24380 | pre-tRNA tRNA-Arg (anticodon: ACG);(source:Araport11, TAIR10) |
| AT3G50895 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
| AT5G22315 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
| AT3G50665 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
| AT5G19095 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT1G04320 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT3G06665 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT4G02055 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT4G39985 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT3G05835 | pre-tRNA tRNA-Ile (anticodon: TAT);(source:Araport11, TAIR10) |
| AT1G20040 | pre-tRNA tRNA-Leu (anticodon: CAA);(source:Araport11, TAIR10) |
| AT3G10015 | pre-tRNA tRNA-Leu (anticodon: TAA);(source:Araport11, TAIR10) |
| AT1G20250 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT4G12115 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT1G79290 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
| AT1G79300 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
| AT1G11010 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT5G65305 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT1G69000 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT3G55735 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT1G20420 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT5G16375 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT1G72780 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT5G51055 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT1G65830 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT1G17570 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT4G28915 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
| AT3G09595 | pre-tRNA tRNA-Ser (anticodon: TGA);(source:Araport11, TAIR10) |
| AT3G48275 | pre-tRNA tRNA-Thr (anticodon: TGT);(source:Araport11, TAIR10) |
| AT4G17612 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT5G07315 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT2G15950 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT4G39195 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT5G09655 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT1G12510 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT5G44375 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT5G52800 | primase/polymerase protein |
| AT3G13965 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT3G17110 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT2G37830 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167. |
| AT1G03860 | prohibitin 2 |
| AT1G26250 | Proline-rich extensin-like family protein |
| AT2G43150 | Proline-rich extensin-like family protein |
| AT5G43770 | proline-rich family protein |
| AT4G16140 | proline-rich family protein |
| AT1G12810 | proline-rich family protein |
| AT5G45350 | proline-rich family protein |
| AT3G01560 | proline-rich receptor-like kinase, putative (DUF1421) |
| AT5G03110 | protamine P1 family protein |
| AT5G14710 | proteasome assembly chaperone-like protein |
| AT3G15790 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT5G02240 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT2G20635 | protein kinase and Mad3-BUB1-I domain-containing protein |
| AT5G46660 | protein kinase C-like zinc finger protein |
| AT5G41730 | Protein kinase family protein |
| AT2G40270 | Protein kinase family protein |
| AT3G56050 | Protein kinase family protein |
| AT2G32800 | protein kinase family protein |
| AT1G03920 | Protein kinase family protein |
| AT5G09890 | Protein kinase family protein |
| AT4G10390 | Protein kinase superfamily protein |
| AT1G53050 | Protein kinase superfamily protein |
| AT2G42960 | Protein kinase superfamily protein |
| AT1G67000 | Protein kinase superfamily protein |
| AT1G45160 | Protein kinase superfamily protein |
| AT5G45430 | Protein kinase superfamily protein |
| AT4G24100 | Protein kinase superfamily protein |
| AT5G01850 | Protein kinase superfamily protein |
| AT5G24080 | Protein kinase superfamily protein |
| AT1G01540 | Protein kinase superfamily protein |
| AT4G34500 | Protein kinase superfamily protein |
| AT5G37790 | Protein kinase superfamily protein |
| AT1G54820 | Protein kinase superfamily protein |
| AT2G23450 | Protein kinase superfamily protein |
| AT1G66880 | Protein kinase superfamily protein |
| AT5G58520 | Protein kinase superfamily protein |
| AT4G19110 | Protein kinase superfamily protein |
| AT4G25390 | Protein kinase superfamily protein |
| AT1G70740 | Protein kinase superfamily protein |
| AT1G03740 | Protein kinase superfamily protein |
| AT2G41930 | Protein kinase superfamily protein |
| AT1G76360 | Protein kinase superfamily protein |
| AT4G31390 | Protein kinase superfamily protein |
| AT2G39360 | Protein kinase superfamily protein |
| AT1G69790 | Protein kinase superfamily protein |
| AT1G76370 | Protein kinase superfamily protein |
| AT1G72540 | Protein kinase superfamily protein |
| AT5G15080 | Protein kinase superfamily protein |
| AT2G40120 | Protein kinase superfamily protein |
| AT1G53690 | Protein of unknown function that is homologous to At5g41010, which encodes a non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB12. |
| AT1G17550 | Protein Phosphatase 2C |
| AT2G20050 | protein phosphatase 2C and cyclic nucleotide-binding/kinase domain-containing protein |
| AT1G03590 | Protein phosphatase 2C family protein |
| AT5G10740 | Protein phosphatase 2C family protein |
| AT1G17545 | Protein phosphatase 2C family protein |
| AT3G17250 | Protein phosphatase 2C family protein |
| AT5G06750 | Protein phosphatase 2C family protein |
| AT3G51370 | Protein phosphatase 2C family protein |
| AT5G17270 | Protein prenylyltransferase superfamily protein |
| AT3G56930 | Protein S-acyl transferase 4 (PAT4). Mutants display defects in root hair elongation. Along with SCN1 , it may be involved in targeting of ROP2 to the plasma membrane. |
| AT3G10270 | Protein targeting to mitochondria is influenced by UTR sequences. |
| AT1G15200 | protein-protein interaction regulator family protein |
| AT3G54680 | proteophosphoglycan-like protein |
| AT1G02350 | protoporphyrinogen oxidase-like protein |
| AT5G67520 | Provides activated sulfate for the sulfation of secondary metabolites, including the glucosinolates. Redundant with APK3. |
| AT1G03600 | PSB27 is a chloroplast lumen localized protein that is involved in adaptation to changes in light intensity. |
| AT3G19025 | pseudogene of alpha/beta-Hydrolases superfamily protein |
| AT1G28591 | Pseudogene of AT1G28610; GDSL-motif lipase, putative |
| AT4G13996 | Pseudogene of AT2G35345; unknown protein |
| AT4G24652 | Pseudogene of AT4G20330; transcription initiation factor-related |
| AT4G19239 | Pseudogene of AT5G01080; beta-galactosidase |
| AT5G42677 | Pseudogene of AT5G19630 |
| AT5G38096 | Pseudogene of AT5G38100; methyltransferase-related protein |
| AT5G40212 | Pseudogene of AT5G40240; nodulin MtN21 family protein |
| AT5G27043 | pseudogene of cell division cycle 20.2 |
| AT5G23235 | pseudogene of DNAJ heat shock N-terminal domain-containing protein |
| AT4G04692 | pseudogene of expressed protein |
| AT2G04110 | pseudogene of expressed protein |
| AT3G24927 | pseudogene of expressed protein |
| AT3G56275 | pseudogene of expressed protein |
| AT2G15765 | pseudogene of F-box/RNI-like superfamily protein |
| AT3G09915 | pseudogene of Galactose oxidase/kelch repeat superfamily protein |
| AT1G75480 | pseudogene of gamma-glutamyl hydrolase 1 |
| AT1G23470 | pseudogene of Pectin lyase-like superfamily protein |
| AT1G62650 | pseudogene of P-loop containing nucleoside triphosphate hydrolases superfamily protein |
| AT5G36903 | pseudogene of protein related to self-incompatibility |
| AT2G04250 | pseudogene of ribonuclease H |
| AT3G18777 | pseudogene of RING/U-box superfamily protein |
| AT5G42445 | pseudogene of R-protein L3 B |
| AT1G31355 | pseudogene of Translation protein SH3-like family protein |
| AT1G78330 | pseudogene of Trimeric LpxA-like enzymes superfamily protein |
| AT2G16895 | pseudogene of UDP-Glycosyltransferase superfamily protein |
| AT1G20410 | Pseudouridine synthase family protein |
| AT1G49350 | PsiMP Glycosylase (PUMY) that hydrolyzes PsiMP to uracil and ribose-5-phosphate. Acts together with PUMY in the peroxisome to prevent toxic pseudouridine monophosphate accumulation. Acts together with the a pseudouridine kinase PUKI in the peroxisome to prevent toxic pseudouridine monophosphate accumulation. |
| AT1G49780 | PUB25 and PUB26 are closely related paralogs that encode functional E3 ligases. They function in immune response pathway by targeting BIK1 for degradation. |
| AT1G14700 | purple acid phosphatase 3 |
| AT3G52780 | Purple acid phosphatases superfamily protein |
| AT4G17800 | Putative AT-hook DNA-binding family protein |
| AT4G12050 | Putative AT-hook DNA-binding family protein |
| AT4G36360 | putative beta-galactosidase (BGAL3 gene) |
| AT1G68820 | Putative C3HC4 zinc-finger ubiquitin E3 ligase, negative regulator in ABA and drought stress response. May act as a positive role in regulating the high temperature by mediating the degradation of unknown target proteins. |
| AT5G42590 | putative cytochrome P450 |
| AT3G48290 | putative cytochrome P450 |
| AT3G26170 | putative cytochrome P450 |
| AT3G14640 | putative cytochrome P450 |
| AT3G14680 | putative cytochrome P450 |
| AT5G25120 | putative cytochrome P450 |
| AT3G14650 | putative cytochrome P450 |
| AT2G36890 | Putative homolog of the Blind gene in tomato. Together with RAX1 and RAX3 belong to the class R2R3 MYB genes; encoded by the Myb-like transcription factor MYB38, regulates axillary meristem formation. |
| AT1G18140 | putative laccase, a member of laccase family of genes (with 17 members in Arabidopsis). |
| AT5G01040 | putative laccase, knockout mutant showed early flowering |
| AT4G00310 | Putative membrane lipoprotein |
| AT3G51800 | putative nuclear DNA-binding protein G2p (AtG2) mRNA, |
| AT2G17330 | putative obtusifoliol 14-alpha demethylase. Expressed pseudogene. |
| AT4G34790 | Putative OXS2-binding DEGs were constitutively activated by OXS2. |
| AT3G29255 | Putative pentacyclic triterpene synthase 7 |
| AT2G40540 | putative potassium transporter AtKT2p (AtKT2) mRNA, |
| AT5G38280 | putative receptor serine/threonine kinase PR5K (PR5K) mRNA, PR5-like receptor kinase |
| AT5G06090 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT1G54140 | putative TATA binding protein associated factor 21kDa |
| AT2G18740 | Putative temperature-specific splice regulator of development. Only the first splice form (PCP-alpha) has this function as result of C-terminal addition. |
| AT3G61690 | Putative TNAase |
| AT3G11280 | Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay). |
| AT3G09670 | PWWP domain protein involved in regulation of FLC and flowering time. |
| AT5G40340 | PWWP domain protein involved in regulation of FLC and flowering time. |
| AT5G03630 | Pyridine nucleotide-disulfide oxidoreductase family protein |
| AT3G48790 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein |
| AT5G26600 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein |
| AT5G28237 | Pyridoxal-5-phosphate-dependent enzyme family protein |
| AT2G04690 | Pyridoxamine 5-phosphate oxidase family protein |
| AT2G46580 | Pyridoxamine 5-phosphate oxidase family protein |
| AT1G03730 | pyrroline-5-carboxylate reductase |
| AT5G01330 | pyruvate decarboxylase |
| AT5G54960 | pyruvate decarboxylase-2 |
| AT3G06483 | Pyruvate dehydrogenase kinase (PDK) specifically phosphorylates the E1α subunit of the pyruvate dehydrogenase complex (PDC) on a Ser residue using ATP as a phosphate donor. PDK is a unique type of protein kinase having a His-kinase-like sequence but Ser-kinase activity. Site-directed mutagenesis and structural analysis indicate that PDK belongs to the GHKL superfamily. |
| AT3G25960 | Pyruvate kinase family protein |
| AT3G04050 | Pyruvate kinase family protein |
| AT5G56350 | Pyruvate kinase family protein |
| AT5G43160 | QWRF motif protein (DUF566) |
| AT2G21880 | RAB GTPase homolog 7A |
| AT5G60860 | RAB GTPase homolog A1F |
| AT2G33870 | RAB GTPase homolog A1H |
| AT1G01200 | RAB GTPase homolog A3 |
| AT3G09910 | RAB GTPase homolog C2B |
| AT5G39620 | RAB GTPase homolog G1 |
| AT1G52280 | RAB GTPase homolog G3D |
| AT4G39990 | Rab GTPase that selectively marks cell wall-containing TGN compartments. Involved in protein trafficking to membranes during tip growth. |
| AT5G58510 | Rab3 GTPase-activating protein catalytic protein |
| AT5G01720 | RAE1 is an F-box protein component of a SCF-type E3 ligase complex. It is part of an alumium induced regulatory loop: its activity is induced by STOP1 and it in turn ubiquitinates STOP1 which is then targeted for degradation. |
| AT1G70650 | Ran BP2/NZF zinc finger-like superfamily protein |
| AT3G17340 | Ran effector. |
| AT3G04735 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT1G60815 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT5G57340 | ras guanine nucleotide exchange factor Q-like protein |
| AT2G02070 | RAVEN is part of the network regulated by BLJUEJAY, JACKDAW, SACRECROW and SHORT-ROOT to regulate root tissue patterning through cell lineage specification and asymmetric cell division. RAVEN is directly activated by SHORT-ROOT and directly repressed by JACKDAW. |
| AT1G60200 | RBM25 is an alternative splicing factor involved in mediation of abiotic stress response and ABA response. Its expression is modulated by a variety of stressors and it in turn appears to affect the ratio of splice variants of stress responsive genes such as HAB1.2/HAB1.1. |
| AT2G25440 | receptor like protein 20 |
| AT2G32660 | receptor like protein 22 |
| AT2G33050 | receptor like protein 26 |
| AT3G05660 | receptor like protein 33 |
| AT4G18760 | receptor like protein 51 |
| AT5G67280 | receptor-like kinase |
| AT5G48540 | receptor-like protein kinase-related family protein |
| AT2G48010 | receptor-like serine/threonine kinase (RKF3) |
| AT2G18790 | Red/far-red photoreceptor involved in the regulation of de-etiolation. Exists in two inter-convertible forms: Pr and Pfr (active). Involved in the light-promotion of seed germination and in the shade avoidance response. Promotes seedling etiolation in both the presence and absence of phytochrome A. Overexpression results in etiolation under far-red light. Accumulates in the nucleus after exposure to far red light. The phosphorylation state of the Ser-86 residue of the phytochrome B molecule alters dark reversion of the molecule. |
| AT4G14770 | Regulates fate transition and cell Divisions in the stomatal lineage. |
| AT2G22770 | Regulates the development of ER bodies. also involves in response to the endophytic fungus Piriformospora indica. |
| AT3G02510 | Regulator of chromosome condensation (RCC1) family protein |
| AT3G26100 | Regulator of chromosome condensation (RCC1) family protein |
| AT1G79910 | Regulator of Vps4 activity in the MVB pathway protein |
| AT1G27730 | Related to Cys2/His2-type zinc-finger proteins found in higher plants. Compensated for a subset of calcineurin deficiency in yeast. Salt tolerance produced by ZAT10 appeared to be partially dependent on ENA1/PMR2, a P-type ATPase required for Li+ and Na+ efflux in yeast. The protein is localized to the nucleus, acts as a transcriptional repressor and is responsive to chitin oligomers. Also involved in response to photooxidative stress. |
| AT1G65440 | Related to yeast Spt6 protein, which functions as part of a protein complex in transcription initiation and also plays a role in chromatin structure / assembly. It encodes a putative WG/GW-repeat protein involved in the regulation of apical-basal polarity of embryo |
| AT1G67590 | Remorin family protein |
| AT4G36970 | Remorin family protein |
| AT1G30320 | Remorin family protein |
| AT2G41870 | Remorin family protein |
| AT3G55720 | replication factor C subunit, putative (DUF620) |
| AT4G19130 | Replication factor-A protein 1-like protein |
| AT2G20000 | Required for cell division and cell differentiation in meristems. Encodes a homolog of the CDC27 subunit of the anaphase-promoting complex (APC). Unlike other CDC27 homologs in Arabidopsis, its transcription is cell cycle regulated. Strong hbt mutants give rise to seedlings that lack an anatomically recognizable quiescent center and differentiated columella root cap cells, the cell types derived from the wild-type hypophysis. Furthermore, they have no mitotically active root meristem and lack a differentiated lateral root cap. |
| AT3G57880 | Required for maintenance of inflorescence and shoot SAMs and normal development of the derived vascular cambium, functions in the SAM to promote continuous organogenesis, affects SAM development through STM, where it affects intracellular localization of STM in SAM cells in the peripheral region and prevents STM localization toward the cell wall of SAM cells in the peripheral region. |
| AT3G13870 | required for regulated cell expansion and normal root hair development. Encodes an evolutionarily conserved protein with putative GTP-binding motifs that is implicated in the control of vesicle trafficking between the endoplasmic reticulum and the Golgi compartments. Degraded by LNP1 and 2 to maintain a tubular ER network. |
| AT3G57040 | response regulator ARR9, A two-component response regulator-like protein with a receiver domain with a conserved aspartate residue and a possible phosphorylation site and at the N-terminal half. Appears to interact with histidine kinase like genes ATHP3 and ATHP2 |
| AT1G09950 | RESPONSE TO ABA AND SALT 1 |
| AT3G49570 | response to low sulfur 3 |
| AT3G11670 | Responsible for the final assembly of galactolipids in photosynthetic membranes. Provides stability to the PS I core complex (e.g. subunits PsaD, PsaE). |
| AT1G78895 | Reticulon family protein |
| AT3G10915 | Reticulon family protein |
| AT2G46170 | Reticulon family protein |
| AT3G10260 | Reticulon family protein |
| AT3G23910 | reverse transcriptase-like protein |
| AT3G02230 | RGP1 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1/rgp2 (at5g15650) double mutants have a male gametophyte lethal phenotype. RGP1 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. |
| AT5G15650 | RGP2 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1(at3g02230)/rgp2 double mutants have a male gametophyte lethal phenotype. RGP2 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. RGP2 was originally identified as Reversibly Glycosylated Polypeptide-2. Constitutive expression in tobacco impairs plant development and virus spread. |
| AT5G47490 | RGPR-like protein |
| AT5G47480 | RGPR-related protein; SEC16A homolog. Part of endomembrane trafficking system. |
| AT5G51060 | RHD2 (along with RHD3 and RHD4) is required for normal root hair elongation. Has NADPH oxidase activity. Gene is expressed in the elongation and differention zone in trichoblasts and elongating root hairs. RDH2 is localized to the growing tips of root hair cells. It is required for the production of reactive oxygen species in response to extracellular ATP stimulus. The increase in ROS production stimulates Ca2+ influx. |
| AT5G11810 | rhomboid family protein |
| AT1G12750 | RHOMBOID-like protein 6 |
| AT1G19230 | Riboflavin synthase-like superfamily protein |
| AT4G29090 | Ribonuclease H-like superfamily protein |
| AT4G37510 | Ribonuclease III family protein |
| AT3G09500 | Ribosomal L29 family protein |
| AT3G58700 | Ribosomal L5P family protein |
| AT5G60670 | Ribosomal protein L11 family protein |
| AT3G24830 | Ribosomal protein L13 family protein |
| AT1G53560 | Ribosomal protein L18ae family |
| AT1G70600 | Ribosomal protein L18e/L15 superfamily protein |
| AT5G47190 | Ribosomal protein L19 family protein |
| AT5G66860 | Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain-containing protein |
| AT5G15220 | Ribosomal protein L27 family protein |
| AT2G44120 | Ribosomal protein L30/L7 family protein |
| AT5G45590 | Ribosomal protein L35 |
| AT2G25210 | Ribosomal protein L39 family protein |
| AT1G74060 | Ribosomal protein L6 family protein |
| AT3G04920 | Ribosomal protein S24e family protein |
| AT5G15200 | Ribosomal protein S4 |
| AT5G57910 | ribosomal RNA small subunit methyltransferase G |
| AT5G13250 | RING finger protein |
| AT1G11020 | RING/FYVE/PHD zinc finger superfamily protein |
| AT5G01070 | RING/FYVE/PHD zinc finger superfamily protein |
| AT1G77250 | RING/FYVE/PHD-type zinc finger family protein |
| AT1G56030 | RING/U-box protein |
| AT1G19680 | RING/U-box superfamily protein |
| AT4G01023 | RING/U-box superfamily protein |
| AT1G62370 | RING/U-box superfamily protein |
| AT5G08139 | RING/U-box superfamily protein |
| AT5G05530 | RING/U-box superfamily protein |
| AT1G35625 | RING/U-box superfamily protein |
| AT5G41400 | RING/U-box superfamily protein |
| AT1G13195 | RING/U-box superfamily protein |
| AT1G75400 | RING/U-box superfamily protein |
| AT1G19310 | RING/U-box superfamily protein |
| AT4G22250 | RING/U-box superfamily protein |
| AT1G73760 | RING/U-box superfamily protein |
| AT2G20030 | RING/U-box superfamily protein |
| AT5G46650 | RING/U-box superfamily protein |
| AT2G42350 | RING/U-box superfamily protein |
| AT5G40250 | RING/U-box superfamily protein |
| AT2G18670 | RING/U-box superfamily protein |
| AT4G10150 | RING/U-box superfamily protein |
| AT5G06490 | RING/U-box superfamily protein |
| AT2G28920 | RING/U-box superfamily protein |
| AT2G44578 | RING/U-box superfamily protein |
| AT2G44581 | RING/U-box superfamily protein |
| AT3G20395 | RING/U-box superfamily protein |
| AT2G31780 | RING/U-box superfamily protein |
| AT3G10815 | RING/U-box superfamily protein |
| AT3G10910 | RING/U-box superfamily protein |
| AT4G30370 | RING/U-box superfamily protein |
| AT3G14320 | RING-H2 ubiquitin ligase. Mutants are defective in ABA mediated drought response. |
| AT3G26000 | RIPF1 is an F-Box E3 ligase that interacts with the ABA receptor RCAR3 and appears to be responsible for facilitating its turnover. |
| AT1G09970 | RLK7 belongs to a leucine-rich repeat class of receptor-likekinase (LRR-RLKs). It is involved in the control of germination speed and the tolerance to oxidant stress. |
| AT4G03510 | RMA1 encodes a novel 28 kDa protein with a RING finger motif and a C-terminal membrane-anchoring domain that is involved in the secretory pathway. Has E3 ubiquitin ligase activity. |
| AT4G28703 | RmlC-like cupins superfamily protein |
| AT5G07350 | RNA binding protein with nuclease activity essential for stress response. Involved in mechanisms acting on mRNAs entering the secretory pathway. Functionally redundant with TSN2. |
| AT1G71080 | RNA polymerase II transcription elongation factor |
| AT1G22910 | RNA-binding (RRM/RBD/RNP motifs) family protein |
| AT1G13190 | RNA-binding (RRM/RBD/RNP motifs) family protein |
| AT1G78260 | RNA-binding (RRM/RBD/RNP motifs) family protein |
| AT3G52660 | RNA-binding (RRM/RBD/RNP motifs) family protein |
| AT1G22330 | RNA-binding (RRM/RBD/RNP motifs) family protein |
| AT2G46780 | RNA-binding (RRM/RBD/RNP motifs) family protein |
| AT4G13860 | RNA-binding (RRM/RBD/RNP motifs) family protein |
| AT3G21215 | RNA-binding (RRM/RBD/RNP motifs) family protein |
| AT5G02530 | RNA-binding (RRM/RBD/RNP motifs) family protein |
| AT4G17720 | RNA-binding (RRM/RBD/RNP motifs) family protein |
| AT3G07250 | RNA-binding (RRM-RBD-RNP motif) domain nuclear transport factor 2 family protein |
| AT4G39040 | RNA-binding CRS1 / YhbY (CRM) domain protein |
| AT4G26480 | RNA-binding KH domain-containing protein |
| AT4G18375 | RNA-binding KH domain-containing protein |
| AT3G14450 | RNA-binding protein, putative, contains Pfam profile: PF00076 RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (2 copies). Contains PAM PABC binding domain. |
| AT4G10610 | RNA-binding protein, putative. Member of a family of proteins having an PABC binding domain (PAM motif). |
| AT4G10613 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein |
| AT1G70220 | RNA-processing, Lsm domain-containing protein |
| AT5G40470 | RNI-like superfamily protein |
| AT5G45500 | RNI-like superfamily protein |
| AT1G66470 | ROOT HAIR DEFECTIVE6 |
| AT3G53232 | ROTUNDIFOLIA like 1 |
| AT4G13395 | ROTUNDIFOLIA like 12 |
| AT1G13245 | ROTUNDIFOLIA like 17 |
| AT1G67265 | ROTUNDIFOLIA like 21 |
| AT1G64585 | ROTUNDIFOLIA like 22 |
| AT2G39705 | ROTUNDIFOLIA like 8 |
| AT1G69270 | RPK1 is a leucine-rich receptor-like kinase located in the plasma membrane which is upregulated by abscisic acid, dehydration, high salt, low temperature, but not by other plant hormones. RPK1 knock-out and antisense plants show an ABA-insensitive phenotype. RPK1 plays a role in ABA-controlled cell proliferation and is a regulator of the ABA signal transduction pathway. Overexpression of the LRR domain has a dominant negative effect on RPK1. Mutations in RPK1 uncouple cotyledon anlagen and primordia by modulating epidermal cell shape and polarity. |
| AT4G25230 | RPM1 interacting protein 2, has a CUE domain which is sufficient for the interaction with RPM1.Positive regulator of RPM1 and PRS2 mediated hypersensitive response.Functions as ubiquitin ligase and binds to RPM1. |
| AT3G48450 | RPM1-interacting protein 4 (RIN4) family protein |
| AT5G63270 | RPM1-interacting protein 4 (RIN4) family protein |
| AT5G66910 | RPW8 -CNL gene is required for signal transduction of TNLs; functionally redundant to NRG1.1. |
| AT3G54760 | RRM1 interacts with SUVH9 and FVE and has an auxiliary role in RNA-directed DNA methylation. |
| AT5G04760 | R-R-type MYB protein which plays negative roles in salt stress and is required for ABA signaling in Arabidopsis. |
| AT2G21650 | RSM1 is a member of a small sub-family of single MYB transcription factors. Analysis of overexpressin lines indicate its involvement during early morphogenesis. |
| AT1G52710 | Rubredoxin-like superfamily protein |
| AT3G53370 | S1FA-like DNA-binding protein |
| AT5G05740 | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442?454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171?179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria. |
| AT5G38100 | SABATH family methyltransferase. |
| AT5G37990 | SABATH family methyltransferase. |
| AT5G38780 | SABATH methyltransferase. |
| AT1G50450 | Saccharopine dehydrogenase |
| AT2G41380 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein |
| AT4G33120 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein |
| AT1G77260 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein |
| AT5G10830 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein |
| AT4G28830 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein |
| AT1G69526 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein |
| AT3G62000 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein |
| AT4G34360 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein |
| AT1G16650 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein |
| AT5G14430 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein |
| AT4G33110 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein |
| AT5G44590 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein |
| AT4G18030 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein |
| AT4G13330 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein |
| AT1G78140 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein |
| AT5G54400 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein |
| AT2G26200 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein |
| AT4G01850 | S-adenosylmethionine synthetase 2 |
| AT3G55980 | salt-inducible zinc finger 1 |
| AT4G34770 | SAUR-like auxin-responsive protein family |
| AT5G53590 | SAUR-like auxin-responsive protein family |
| AT4G34800 | SAUR-like auxin-responsive protein family |
| AT2G36210 | SAUR-like auxin-responsive protein family |
| AT1G75590 | SAUR-like auxin-responsive protein family |
| AT5G50760 | SAUR-like auxin-responsive protein family |
| AT3G60690 | SAUR-like auxin-responsive protein family |
| AT4G36110 | SAUR-like auxin-responsive protein family |
| AT5G47050 | SBP (S-ribonuclease binding protein) family protein |
| AT4G35070 | SBP (S-ribonuclease binding protein) family protein |
| AT5G52510 | SCARECROW-like 8 |
| AT5G67490 | SDHAF4 acts on FAD-SDH1 and promotes its assembly with SDH2, thereby stabilizing SDH2 and enabling its full assembly with SDH3/SDH4 to form the SDH complex. |
| AT2G01470 | Sec12p-like protein (GTP exchange protein) that functionally complements yeast sec12 null mutant. Protein is localized to the ER. |
| AT3G10210 | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein |
| AT5G47730 | Sec14p-like phosphatidylinositol transfer family protein |
| AT4G36640 | Sec14p-like phosphatidylinositol transfer family protein |
| AT1G75170 | Sec14p-like phosphatidylinositol transfer family protein |
| AT5G56160 | Sec14p-like phosphatidylinositol transfer family protein |
| AT1G05370 | Sec14p-like phosphatidylinositol transfer family protein |
| AT1G55840 | Sec14p-like phosphatidylinositol transfer family protein |
| AT1G22180 | Sec14p-like phosphatidylinositol transfer family protein |
| AT1G01630 | Sec14p-like phosphatidylinositol transfer family protein |
| AT3G24840 | Sec14p-like phosphatidylinositol transfer family protein |
| AT1G30690 | Sec14p-like phosphatidylinositol transfer family protein |
| AT5G67170 | SEC-C motif-containing protein / OTU-like cysteine protease family protein |
| AT5G50460 | secE/sec61-gamma protein transport protein |
| AT5G36920 | Secreted peptide which functions in plant growth and pathogen defense. |
| AT1G11180 | Secretory carrier membrane protein (SCAMP) family protein |
| AT2G34250 | SecY protein transport family protein |
| AT1G15320 | seed dormancy control protein |
| AT4G27140 | seed storage albumin 1 |
| AT4G35660 | selection/upkeep of intraepithelial T-cells protein, putative (DUF241) |
| AT5G03230 | senescence regulator (Protein of unknown function, DUF584) |
| AT2G28400 | senescence regulator (Protein of unknown function, DUF584) |
| AT4G21930 | senescence regulator (Protein of unknown function, DUF584) |
| AT1G29640 | senescence regulator (Protein of unknown function, DUF584) |
| AT2G44670 | senescence-associated family protein (DUF581) |
| AT5G20700 | senescence-associated family protein, putative (DUF581) |
| AT2G45650 | Sequence suggests this encodes a MADS-box transcription factor. Negatively regulates the FLC/MAF clade genes and positively regulates FT in Arabidopsis. |
| AT3G17100 | sequence-specific DNA binding transcription factor |
| AT2G22970 | serine carboxypeptidase-like 11 |
| AT3G12230 | serine carboxypeptidase-like 14 |
| AT3G12220 | serine carboxypeptidase-like 16 |
| AT4G30810 | serine carboxypeptidase-like 29 |
| AT2G23010 | serine carboxypeptidase-like 9 |
| AT5G54530 | serine protease, putative (Protein of unknown function, DUF538) |
| AT3G15115 | serine/arginine repetitive matrix protein |
| AT3G12970 | serine/arginine repetitive matrix-like protein |
| AT4G32020 | serine/arginine repetitive matrix-like protein |
| AT4G22190 | serine/arginine repetitive matrix-like protein |
| AT3G08670 | serine/arginine repetitive matrix-like protein |
| AT4G38470 | Serine/threonine kinase that phosphorylate transit peptides of chloroplast and mitochondria targeted pre-proteins. |
| AT5G47760 | serine/threonine protein kinase |
| AT3G04910 | Serine/threonine protein kinase, whose transcription is regulated by circadian rhythm. |
| AT1G21060 | Serine/Threonine-kinase, putative (Protein of unknown function, DUF547) |
| AT1G76620 | Serine/Threonine-kinase, putative (Protein of unknown function, DUF547) |
| AT1G32120 | serine/threonine-protein phosphatase 7 long form-like protein |
| AT5G17240 | SET domain group 40 |
| AT4G25520 | SEUSS-like 1 |
| AT3G11210 | SGNH hydrolase-type esterase superfamily protein |
| AT5G03600 | SGNH hydrolase-type esterase superfamily protein |
| AT1G68680 | SH3/FCH domain protein |
| AT4G25350 | SHB1 encodes a nuclear and cytosolic protein that has motifs homologous with SYG1 protein family members. Acts in cryptochrome signaling. Overexpression of SHB1 enhanced the expression of PHYTOCHROME-INTERACTING FACTOR4 (PIF4) under red light and promoted proteasome-mediated degradation of phytochrome A and hypocotyl elongation under far-red light. A knockout allele suppressed LONG HYPOCOTYL IN FAR-RED LIGHT1 (HFR1) expression and showed several deetiolation phenotypes. Acts upstream of HFR1. Regulates seed development. |
| AT1G04240 | SHY2/IAA3 regulates multiple auxin responses in roots. It is induced rapidly by IAA, and has been shown to be phosphorylated by oat phytochrome A in vitro. |
| AT1G01650 | SIGNAL PEPTIDE PEPTIDASE-LIKE 4 |
| AT5G61970 | signal recognition particle-related / SRP-like protein |
| AT2G31560 | signal transducer/transcription protein, putative (DUF1685) |
| AT1G14920 | Similar to a putative transcription factor and transcriptional coactivators. Repressor of GA responses and involved in gibberellic acid mediated signaling. Member of the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. GAI may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. |
| AT3G12300 | Similar to Bug22p in Paramecium, a conserved centrosomal/ciliary protein. This protein is widespread in eukaryotes harboring centrioles/cilia at some stage of their life cycles. Among eukaryotes devoid of centrioles/cilia, plants possess BUG22 genes whereas some fungi (at least ascomycetes) do not. |
| AT4G39090 | Similar to cysteine proteinases, induced by desiccation but not abscisic acid. Required for RRS1-R mediated resistance against Ralstonia solanacearum. Interacts with the R. solanacearum type III effector PopP2. RD19 associates with PopP2 to form a nuclear complex that is required for activation of the RRS1-R?mediated resistance response. |
| AT1G78650 | Similar to DNA polymerase delta (POLD3), which in other organism was shown to be involved in the elongation of DNA replication. |
| AT3G25655 | Similar to Inflorescence Deficient in Abscission (IDA). Involved in floral organ abscission. |
| AT5G64667 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
| AT5G09805 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
| AT2G38050 | Similar to mammalian steroid-5-alpha-reductase. Involved in the brassinolide biosynthetic pathway. |
| AT4G22260 | Similar to mitochondrial alternative oxidase. im mutants have a variegated phenotype and fail to differentiate chloroplasts in the majority of their cells under high light intensity continuous illumination. The white tissues of immutans accumulate phytoene, a non-colored C40 carotenoid intermediate. This suggests that immutans controls, either directly or indirectly, the activity of phytoene desaturase (PDS), the enzyme that converts phytoene to zeta-carotene in higher plants. However, im is not the structural gene for PDS. It is located in the lumenar face of the thylakoid membrane. IM is expressed ubiquitously in plant tissues. |
| AT1G74440 | Similar to MPH1, can complement mph1-1 salt sensitivity phenotype. |
| AT4G28660 | Similar to PsbW subunit of photosystem II. |
| AT3G15950 | Similar to TSK-associating protein 1 (TSA1), contains 10 EFE repeats, a novel repeat sequence unique to plants. Expressed preferentially in the roots.Protein is localized to ER bodies- an endoplasmic reticulum derived structure. Loss of function mutations lack ER bodies. |
| AT1G30470 | SIT4 phosphatase-associated family protein |
| AT1G24320 | Six-hairpin glycosidases superfamily protein |
| AT1G75790 | SKU5 similar 18 |
| AT4G22010 | SKU5 similar 4 |
| AT1G76160 | SKU5 similar 5 |
| AT1G41830 | SKU5-similar 6 |
| AT4G27300 | S-locus lectin protein kinase family protein |
| AT2G45460 | SMAD/FHA domain-containing protein |
| AT4G14490 | SMAD/FHA domain-containing protein |
| AT4G30220 | small nuclear ribonucleoprotein F |
| AT2G43810 | Small nuclear ribonucleoprotein family protein |
| AT5G05540 | small RNA degrading nuclease 2 |
| AT3G58990 | Small subunit, which together with IPMI SSU1, IPMISSU2 and IPMI LSU1, is a member of heterodimeric isopropylmalate isomerase (IPMI). Together with IPMI SSU3 participates in the Met chain elongation pathway. |
| AT5G57710 | SMAX1 (SUPPRESSOR OF MAX2 1) is a member of an eight-gene family in Arabidopsis that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. SMAX1 is an important component of KAR/SL signaling during seed germination and seedling growth, but is not necessary for all MAX2-dependent responses. |
| AT3G06670 | SMEK1 forms a catalytically active complex with PP4 proteins. The complex has been shown to target and dephosphorylate HYL1 which in turn promotes miRNA biogenesis. Mutants have pleiotrophic phenotypes and decreased production of miRNA. SMEK1 accumulation is responsive to ABA. |
| AT5G58720 | smr (Small MutS Related) domain-containing protein |
| AT1G07500 | SMR5 is a member of the SIAMESE-RELATED Cyclin-Dependent Kinase Inhibitor family. It is induced by ROS/oxidative stress. |
| AT5G13710 | SMT1 controls the level of cholesterol in plants |
| AT5G19070 | SNARE associated Golgi protein family |
| AT1G79070 | SNARE-associated protein-like protein |
| AT5G52990 | SNARE-like superfamily protein |
| AT2G44980 | SNF2 domain-containing protein / helicase domain-containing protein |
| AT3G54460 | SNF2 domain-containing protein / helicase domain-containing protein / F-box family protein |
| AT1G19373 | snoRNA |
| AT3G21805 | snoRNA |
| AT5G13225 | snoRNA |
| AT1G20015 | snoRNA |
| AT3G11580 | SOD7 encodes nuclear localized B3 DNA binding domain and a transcriptional repression motif. Belongs to the RAV gene family. Functions in regulation of seed size and binds to and represses KLU. Transcription repressor involved in regulation of inflorescence architecture. |
| AT1G05577 | SOK1 is a DUF966 domain containing protein. It is expressed during embryogenesis in the apical-lateral plasma membrane. SOK1 can form homodimers and it's polar localization of SOK1 depends on N terminal domains within the protein. Misexpression of SOK1 or delocalization alters cell division planes. |
| AT3G59340 | solute carrier family 35 protein (DUF914) |
| AT5G58440 | sorting nexin 2A |
| AT1G23820 | Spermidine synthase. |
| AT1G70310 | Spermidine synthase. |
| AT3G23325 | Splicing factor 3B subunit 5/RDS3 complex subunit 10 |
| AT1G22060 | sporulation-specific protein |
| AT3G11890 | Sterile alpha motif (SAM) domain-containing protein |
| AT5G23680 | Sterile alpha motif (SAM) domain-containing protein |
| AT4G02050 | STP7 is a monosaccharide/H+ symporter that transports arabinose and xylose. |
| AT3G62630 | stress response NST1-like protein (DUF1645) |
| AT5G61820 | stress up-regulated Nod 19 protein |
| AT5G49910 | Stromal heat shock protein involved in protein import into chloroplast. |
| AT5G64580 | Strong interaction with TIC inner envelope protein translocon which consists of Tic20/Tic56/Tic100/Tic214(Ycf1)(DOI:10.1105/tpc.18.00357). |
| AT3G14350 | STRUBBELIG-receptor family 7 |
| AT3G11760 | structural maintenance of chromosomes flexible hinge domain protein |
| AT4G21326 | subtilase 3.12 |
| AT5G11940 | Subtilase family protein |
| AT4G21323 | Subtilase family protein |
| AT3G14240 | Subtilase family protein |
| AT2G05920 | Subtilase family protein |
| AT3G54690 | Sugar isomerase (SIS) family protein |
| AT4G32480 | sugar phosphate exchanger, putative (DUF506) |
| AT5G65650 | sugar transporter, putative (DUF1195) |
| AT5G43780 | sulfate adenylyltransferase, ATP sulfurylase |
| AT3G07350 | sulfate/thiosulfate import ATP-binding protein, putative (DUF506) |
| AT1G61740 | Sulfite exporter TauE/SafE family protein |
| AT2G25737 | Sulfite exporter TauE/SafE family protein |
| AT2G39140 | Suppressor of var2 variegation phenotype. Chloroplast localized. Loss of function mutant has defects in chloroplast protein translation and rRNA processing. Similar in sequence to pseudouridine synthase proteins. |
| AT1G69760 | suppressor SRP40-like protein |
| AT4G14930 | Survival protein SurE-like phosphatase/nucleotidase |
| AT1G30020 | SVB family gene. |
| AT1G14640 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein |
| AT1G49520 | SWIB complex BAF60b domain-containing protein |
| AT1G60560 | SWIM zinc finger family protein |
| AT1G20290 | SWI-SNF-related chromatin binding protein |
| AT4G30240 | Syntaxin/t-SNARE family protein |
| AT1G27700 | Syntaxin/t-SNARE family protein |
| AT1G20310 | syringolide-induced protein |
| AT4G01895 | systemic acquired resistance (SAR) regulator protein NIMIN-1-like protein |
| AT1G45201 | Target of AtGRP7 regulation. |
| AT5G67180 | target of early activation tagged (EAT) 3 |
| AT2G37000 | TCP family transcription factor |
| AT2G45680 | TCP family transcription factor |
| AT5G20890 | TCP-1/cpn60 chaperonin family protein |
| AT1G19835 | TCS1 encodes a coiled-coil domain protein that binds to microtubules and co-localizes with the cortical microtubules. Mutants have defects in trichome branching and hypocotyl elongation. TCS1 interacts with ZWI and appears to be involved in microtubule assembly. |
| AT4G37080 | ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547) |
| AT2G24210 | terpene synthase 10 |
| AT2G37140 | Terpenoid synthases superfamily protein |
| AT5G25790 | Tesmin/TSO1-like CXC domain-containing protein |
| AT2G20110 | Tesmin/TSO1-like CXC domain-containing protein which is a transcriptional repressor of genes required for maintenance of DNA methylation, including MET1, CMT3, DDM1, KYP and VIMs. Functions redundantly with its paralogue TCX5 in repressing the expression of these genes. |
| AT4G23410 | TET5 encodes a member of the TETRASPANIN gene family that is expressed in the embryo and vascular system and is involved in organ growth redundantly with TET6. |
| AT5G20190 | Tetratricopeptide repeat (TPR)-like superfamily protein |
| AT3G15200 | Tetratricopeptide repeat (TPR)-like superfamily protein |
| AT1G04840 | Tetratricopeptide repeat (TPR)-like superfamily protein |
| AT2G31240 | Tetratricopeptide repeat (TPR)-like superfamily protein |
| AT5G65520 | Tetratricopeptide repeat (TPR)-like superfamily protein |
| AT5G62370 | Tetratricopeptide repeat (TPR)-like superfamily protein |
| AT2G30780 | Tetratricopeptide repeat (TPR)-like superfamily protein |
| AT4G19440 | Tetratricopeptide repeat (TPR)-like superfamily protein |
| AT2G29670 | Tetratricopeptide repeat (TPR)-like superfamily protein |
| AT3G09490 | Tetratricopeptide repeat (TPR)-like superfamily protein |
| AT3G47080 | Tetratricopeptide repeat (TPR)-like superfamily protein |
| AT4G19220 | Tetratricopeptide repeat (TPR)-like superfamily protein |
| AT5G59600 | Tetratricopeptide repeat (TPR)-like superfamily protein |
| AT2G47440 | Tetratricopeptide repeat (TPR)-like superfamily protein |
| AT1G07280 | Tetratricopeptide repeat (TPR)-like superfamily protein |
| AT1G02650 | Tetratricopeptide repeat (TPR)-like superfamily protein |
| AT4G21300 | Tetratricopeptide repeat (TPR)-like superfamily protein |
| AT5G46400 | Tetratricopeptide repeat (TPR)-like superfamily protein |
| AT1G77360 | Tetratricopeptide repeat (TPR)-like superfamily protein |
| AT5G58450 | Tetratricopeptide repeat (TPR)-like superfamily protein |
| AT1G78660 | The Arabidopsis protein AtGGH1 is a gamma-glutamyl hydrolase cleaving pentaglutamates to yield di- and triglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. |
| AT1G78680 | The Arabidopsis protein AtGGH2 is a gamma-glutamyl hydrolase acting specifically on monoglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. |
| AT1G30530 | The At1g30530 gene encodes a UDP-rhamnose:flavonol-3-O-rhamnosyltransferase (UGT78D1) attaching a rhamnosyl residue to the 3-O-position of the flavonols kaempferol and quercetin |
| AT5G14200 | The AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. Encodes methylthioalkylmalate dehydrogenase. Involved in glucosinolate biosynthesis, in methionine chain elongation. |
| AT5G48110 | The Col variant has no enzyme activity due to various substitution and deletion mutations. |
| AT3G21230 | The gene encodes a 4-coumarate coenzyme A ligase being able to use sinapate as substrate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, 5-OH-ferulic acid, ferulic acid and sinapic acid. At4CL5 was unable to use cinnamic acid as substrate. Knockout of At4CL5 (4cl5) revealed no effect on syringyl lignin content indicating that the activity observed does probably not occur in vivo. |
| AT3G63190 | The gene encodes a chloroplast ribosome recycling factor homologue. Analysis of mutants revealed its role in the chloroplast development and eary stages of embryo development. |
| AT4G39640 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in vascular tissues (predominantly phloem) of leaves and is involved in the degradation of glutathione. The encoded enzyme also mitigates oxidative stress by metabolizing GSSG (oxidized form of GSH - glutathione) in the apoplast. |
| AT4G39650 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in the apoplast of young siliques (within the ovules of the carpel) and is involved in the degradation of glutathione. The encoded enzyme also acts as part of a GSH pumping gamma-glutamyl cycle in this tissue and may also be involved in gamma-glutamyl amino acid formation. |
| AT4G29210 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in the vacuole and is most active in roots. The encoded enzyme is involved in the initial degradation of glutathione conjugates in this cell compartment. It is also induced by xenobiotics and contributes to xenobiotics metabolism. Note that conflicting nomenclature exists in the literature: At4g29210 is named as GGT3 in Plant J. 2007 Mar 49(5):878-88; At4g29210 is named as GGT4 and At1g69820 as GGT3 in Plant Physiol. 2007 Aug 144(4):1715-32. |
| AT5G45420 | The gene encodes a MYB transcription factor belons to R2R3-MYB family of transcription factors. Knock-down mutant analysis indicates its role in root hair elongation. |
| AT4G19690 | The gene encodes Fe2+ transporter protein. It is a member of the Zrt/Irt-like protein (ZIP) family of transporters. AtIRT1 has broad specificity for divalent heavy metals, mediating the transport of zinc, manganese, cobalt and cadmium under Fe-deficient conditions. IRT1 is monoubiquitinated to promote endocytic trafficking. |
| AT4G01070 | the glycosyltransferase (UGT72B1) is involved in metabolizing xenobiotica (chloroaniline and chlorophenole). Comparison between wild type and knock-out mutant demonstrates the central role of this gene for metabolizing chloroaniline but significantly less for chlorophenole. The glucosyltransferase preferred UDP-xylose over UDP-glucose indicating its (additional) functioning as a xylosyltransferase in planta |
| AT3G08030 | The mRNA of this gene is expressed in viable seeds. Its detection in a dry seed lot has potential for use as a molecular marker for germination performance as absence of expression correlates with decreased germination. Encodes DUF642 cell wall protein. |
| AT2G42620 | The mutations at MAX2 cause increased hypocotyl and petiole elongation in light-grown seedlings. Positional cloning identifies MAX2 as a member of the F-box leucine-rich repeat family of proteins. MAX2 is identical to ORE9, a proposed regulator of leaf senescence. Involved in positive regulation of light responses. |
| AT3G16420 | The PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests. |
| AT5G61650 | The P-type cyclins (CYCPs) share a conserved central region of 100 amino acids ('cyclin box') displaying homology to the corresponding region of the PHO80 cyclin from Saccharomyces cerevisiae and the related G1 cyclins from Trypanosoma cruzi and T. brucei. |
| AT3G14370 | The WAG2 and its homolog, WAG1 each encodes protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT1G21400 | Thiamin diphosphate-binding fold (THDP-binding) superfamily protein |
| AT2G30720 | Thioesterase/thiol ester dehydrase-isomerase superfamily protein |
| AT1G25275 | Thionin-like gene involved in resistance against the beet cyst nematode (Heterodera schachtii). |
| AT1G52990 | thioredoxin family protein |
| AT3G25580 | Thioredoxin superfamily protein |
| AT5G65840 | Thioredoxin superfamily protein |
| AT3G56420 | Thioredoxin superfamily protein |
| AT3G52960 | Thioredoxin superfamily protein |
| AT3G44320 | This enzyme catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. It is the only one of the four Arabidopsis nitrilases whose mRNA levels are strongly induced when plants experience sulphur deprivation. This enzyme likely participates in other non-auxin-related metabolic pathways. |
| AT1G54130 | This gene appears to be at least partially redundant with RSH2 (At3g14050). Guanosine tetraphosphate synthesized by RSH2/RSH3 (and CRSH At3g17470) to an unknown extent can repress chloroplast gene expression, and also reduce chloroplast size. Involved in the maintenance of the (p)ppGp level to accustom plastidial gene expression to darkness. |
| AT5G66607 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G13181 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G03204 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G55566 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G49115 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G61997 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G63052 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G65630 | This gene is predicted to encode a bromodomain-containing protein. Plant lines expressing RNAi constructs targeted against GTE7 show some resistance to agrobacterium-mediated root transformation. |
| AT1G28380 | This gene is predicted to encode a protein involved in negatively regulating salicylic acid-related defense responses and cell death programs. nsl1 mutants develop necrotic lesions spontaneously and show other features of a defense response, such as higher levels of SA and disease resistance-related transcripts, in the absence of a biotic stimulus. The NSL1 protein is predicted to have a MACPF domain, found in proteins that form a transmembrane pore in mammalian immune responses. NSL1 transcript levels do not appear to change in response to biotic stresses, but are elevated by cycloheximide in seedlings, and by sodium chloride in roots. |
| AT5G21482 | This gene used to be called AtCKX5. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. Enzyme assays show preference for N6 -(2-isopentenyl)adenine 9-glucoside substrate. |
| AT1G75450 | This gene used to be called AtCKX6. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT4G33150 | This is a splice variant of the LKR/SDH locus. It encodes a bifunctional polypeptide lysine-ketoglutarate reductase and saccharopine dehydrogenase involved in lysine degradation. There is another splice variant that encodes a mono saccharopine dehydrogenase protein. Gene expression is induced by abscisic acid, jasmonate, and under sucrose starvation. |
| AT4G29840 | threonine synthase |
| AT3G63180 | TIC-like protein |
| AT3G54000 | TIP41-like protein |
| AT1G33230 | TMPIT-like protein |
| AT1G14530 | tobamovirus multiplication-like protein (DUF1084) |
| AT2G20100 | Together with PFA1 and PFA3 governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT3G63460 | Together with SEC31A a component of the coat protein complex II (COPII) which promotes the formation of transport vesicles from the endoplasmic reticulum (ER). |
| AT1G72130 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
| AT1G72140 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
| AT1G22550 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
| AT5G27030 | TOPLESS family member involved in the negative regulation of SNC1-dependent phenotypes. |
| AT3G16830 | TOPLESS family member which directly binds the N-terminal domain of SNC1 and interacts with TPR1. |
| AT4G14990 | Topoisomerase II-associated protein PAT1 |
| AT4G34270 | TOR signaling pathway protein. |
| AT1G07670 | TPLATE complex protein involved in clathrin-mediated endocytosis. |
| AT1G79060 | TPRXL |
| AT5G26260 | TRAF-like family protein |
| AT5G52330 | TRAF-like superfamily protein |
| AT3G25950 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein |
| AT1G45010 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein |
| AT1G31300 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein |
| AT1G35180 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein |
| AT5G42290 | transcription activator-like protein |
| AT4G02110 | transcription coactivator |
| AT5G05140 | Transcription elongation factor (TFIIS) family protein |
| AT4G24200 | Transcription elongation factor (TFIIS) family protein |
| AT3G10820 | Transcription elongation factor (TFIIS) family protein |
| AT4G38070 | transcription factor bHLH131-like protein |
| AT2G41070 | Transcription factor homologous to ABI5. Regulates AtEm1 expression by binding directly at the AtEm1 promoter. Located in the nucleus and expressed during seed maturation in the cotyledons and later in the whole embryo. |
| AT1G07480 | Transcription factor IIA, alpha/beta subunit |
| AT5G23280 | Transcription factor which plays an important role during leaf and hypocotyl development, redundantly, with at least six class I TCPs, and regulates the expression of CYCD1;1 to affect endoreplication. |
| AT5G59230 | transcription factor-like protein |
| AT5G60680 | transcription initiation factor TFIID subunit (Protein of unknown function, DUF584) |
| AT3G19030 | transcription initiation factor TFIID subunit 1b-like protein |
| AT1G49500 | transcription initiation factor TFIID subunit 1b-like protein |
| AT1G04250 | Transcription regulator acting as repressor of auxin-inducible gene expression. Auxin-inducible AUX/IAA gene. Short-lived nuclear protein with four conserved domains. Domain III has homology to beta alpha alpha dimerization and DNA binding domains. Involved in auxin signaling and is a positive modulator of natural leaf senescence. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. |
| AT3G47610 | transcription regulator/ zinc ion binding protein |
| AT5G06250 | Transcription repressor involved in regulation of inflorescence architecture. |
| AT5G56770 | transcription repressor-like protein |
| AT5G03660 | transcriptional activator (DUF662) |
| AT3G27350 | transcriptional regulator ATRX-like protein |
| AT5G40700 | transcriptional regulator ATRX-like protein |
| AT5G67410 | transcriptional regulator of RNA polII, SAGA, subunit |
| AT1G78070 | Transducin/WD40 repeat-like superfamily protein |
| AT4G14310 | Transducin/WD40 repeat-like superfamily protein |
| AT4G18900 | Transducin/WD40 repeat-like superfamily protein |
| AT1G24130 | Transducin/WD40 repeat-like superfamily protein |
| AT1G64610 | Transducin/WD40 repeat-like superfamily protein |
| AT5G42010 | Transducin/WD40 repeat-like superfamily protein |
| AT1G78280 | transferases, transferring glycosyl groups |
| AT4G11350 | transferring glycosyl group transferase (DUF604) |
| AT1G01570 | transferring glycosyl group transferase (DUF604) |
| AT2G45290 | Transketolase |
| AT2G34590 | Transketolase family protein |
| AT1G18070 | Translation elongation factor EF1A/initiation factor IF2gamma family protein |
| AT4G39630 | translation initiation factor |
| AT2G39990 | translation initiation factor eIF2 p47 subunit homolog |
| AT5G54940 | Translation initiation factor SUI1 family protein |
| AT2G37020 | Translin family protein |
| AT1G13390 | translocase subunit seca |
| AT1G68490 | translocase subunit seca |
| AT3G47630 | translocator assembly/maintenance protein |
| AT5G02180 | Transmembrane amino acid transporter family protein |
| AT5G02170 | Transmembrane amino acid transporter family protein |
| AT5G15240 | Transmembrane amino acid transporter family protein |
| AT3G09340 | Transmembrane amino acid transporter family protein |
| AT5G65990 | Transmembrane amino acid transporter family protein |
| AT2G23755 | transmembrane family 220 helix protein |
| AT1G32450 | Transmembrane nitrate transporter. Involved in xylem transport of nitrate from root to shoot. Induced in response to high and low concentrations of nitrate. Not involved in nitrate uptake. Expressed in root pericycle cells under the control of MYB59. Also functions as a proton-coupled H+/K+ antiporter for K+ loading into the xylem. |
| AT5G61340 | transmembrane protein |
| AT4G32750 | transmembrane protein |
| AT5G59350 | transmembrane protein |
| AT2G02440 | transmembrane protein |
| AT2G46308 | transmembrane protein |
| AT2G43540 | transmembrane protein |
| AT1G28375 | transmembrane protein |
| AT3G43110 | transmembrane protein |
| AT5G15581 | transmembrane protein |
| AT3G25597 | transmembrane protein |
| AT1G09176 | transmembrane protein |
| AT2G40004 | transmembrane protein |
| AT5G65880 | transmembrane protein |
| AT1G45163 | transmembrane protein |
| AT1G35181 | transmembrane protein |
| AT4G28085 | transmembrane protein |
| AT1G02575 | transmembrane protein |
| AT3G47510 | transmembrane protein |
| AT1G64385 | transmembrane protein |
| AT5G42146 | transmembrane protein |
| AT5G07730 | transmembrane protein |
| AT2G18690 | transmembrane protein |
| AT2G01580 | transmembrane protein |
| AT1G16850 | transmembrane protein |
| AT4G01671 | transmembrane protein |
| AT2G25169 | transmembrane protein |
| AT4G27654 | transmembrane protein |
| AT1G30757 | transmembrane protein |
| AT1G52155 | transmembrane protein |
| AT1G70505 | transmembrane protein |
| AT1G77765 | transmembrane protein |
| AT3G25573 | transmembrane protein |
| AT5G64880 | transmembrane protein |
| AT1G15640 | transmembrane protein |
| AT5G58570 | transmembrane protein |
| AT5G14690 | transmembrane protein |
| AT5G62400 | transmembrane protein |
| AT4G06534 | transmembrane protein |
| AT3G13432 | transmembrane protein |
| AT5G15265 | transmembrane protein |
| AT5G26270 | transmembrane protein |
| AT3G01516 | transmembrane protein |
| AT4G14315 | transmembrane protein |
| AT5G18130 | transmembrane protein |
| AT1G26762 | transmembrane protein |
| AT1G15600 | transmembrane protein |
| AT3G57400 | transmembrane protein |
| AT5G40860 | transmembrane protein |
| AT1G25400 | transmembrane protein |
| AT1G53620 | transmembrane protein |
| AT4G25225 | transmembrane protein |
| AT3G15780 | transmembrane protein |
| AT1G23850 | transmembrane protein |
| AT3G47341 | transmembrane protein |
| AT3G45050 | transmembrane protein |
| AT1G15610 | transmembrane protein |
| AT5G10745 | transmembrane protein |
| AT4G05018 | transmembrane protein |
| AT1G01240 | transmembrane protein |
| AT3G52360 | transmembrane protein |
| AT3G27416 | transmembrane protein |
| AT2G18200 | transmembrane protein |
| AT1G75810 | transmembrane protein |
| AT3G57062 | transmembrane protein |
| AT5G08240 | transmembrane protein |
| AT3G17120 | transmembrane protein |
| AT5G03460 | transmembrane protein |
| AT1G27290 | transmembrane protein |
| AT3G49230 | transmembrane protein |
| AT1G05575 | transmembrane protein |
| AT4G29850 | transmembrane protein (DUF872) |
| AT5G55960 | transmembrane protein C9orf5 protein |
| AT3G01940 | transmembrane protein, putative (DUF 3339) |
| AT4G23720 | transmembrane protein, putative (DUF1191) |
| AT3G50130 | transmembrane protein, putative (DUF247) |
| AT3G50120 | transmembrane protein, putative (DUF247) |
| AT5G45480 | transmembrane protein, putative (DUF594) |
| AT4G34320 | transmembrane protein, putative (DUF677) |
| AT5G66675 | transmembrane protein, putative (DUF677) |
| AT2G18630 | transmembrane protein, putative (DUF677) |
| AT4G24310 | transmembrane protein, putative (DUF679) |
| AT3G26440 | transmembrane protein, putative (DUF707) |
| AT3G11880 | transmembrane protein, putative (Protein of unknown function DUF2359, transmembrane) |
| AT4G02360 | transmembrane protein, putative (Protein of unknown function, DUF538) |
| AT3G07460 | transmembrane protein, putative (Protein of unknown function, DUF538) |
| AT1G68440 | Transmembrane protein. Expression induced by abiotic stressors such as ABA, drought, heat, light, NaCl, osmotic stress and wounding. |
| AT4G38260 | transport/golgi organization-like protein (DUF833) |
| AT1G52840 | transposable_element_gene |
| AT4G08871 | transposable_element_gene;CACTA-like transposase family (En/Spm), has a 1.2e-15 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota) |
| AT1G35600 | transposable_element_gene;CACTA-like transposase family (Ptta/En/Spm) |
| AT1G35590 | transposable_element_gene;CACTA-like transposase family (Tnp2/En/Spm) |
| AT5G19015 | transposable_element_gene;CACTA-like transposase family (Tnp2/En/Spm) |
| AT4G12423 | transposable_element_gene;copia-like retrotransposon family |
| AT5G35935 | transposable_element_gene;copia-like retrotransposon family |
| AT2G17490 | transposable_element_gene;copia-like retrotransposon family |
| AT5G56747 | transposable_element_gene;copia-like retrotransposon family |
| AT4G20180 | transposable_element_gene;copia-like retrotransposon family |
| AT3G27965 | transposable_element_gene;copia-like retrotransposon family |
| AT2G02830 | transposable_element_gene;copia-like retrotransposon family |
| AT5G27035 | transposable_element_gene;copia-like retrotransposon family |
| AT1G17495 | transposable_element_gene;copia-like retrotransposon family |
| AT1G63835 | transposable_element_gene;copia-like retrotransposon family |
| AT5G38975 | transposable_element_gene;copia-like retrotransposon family |
| AT5G28145 | transposable_element_gene;copia-like retrotransposon family |
| AT1G30310 | transposable_element_gene;copia-like retrotransposon family |
| AT3G29577 | transposable_element_gene;gypsy-like retrotransposon family |
| AT3G28295 | transposable_element_gene;gypsy-like retrotransposon family |
| AT3G54823 | transposable_element_gene;gypsy-like retrotransposon family |
| AT5G44255 | transposable_element_gene;gypsy-like retrotransposon family, has a 3.5e-09 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica) |
| AT3G23085 | transposable_element_gene;hAT-like transposase family (hobo/Ac/Tam3) |
| AT2G14950 | transposable_element_gene;hAT-like transposase family (hobo/Ac/Tam3) |
| AT1G80020 | transposable_element_gene;hAT-like transposase family (hobo/Ac/Tam3) |
| AT1G45760 | transposable_element_gene;hAT-like transposase family (hobo/Ac/Tam3), has a 2.6e-37 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana) |
| AT2G19806 | transposable_element_gene;Mariner-like transposase family |
| AT1G67240 | transposable_element_gene;Mutator-like transposase family |
| AT3G30170 | transposable_element_gene;Mutator-like transposase family |
| AT5G28263 | transposable_element_gene;Mutator-like transposase family |
| AT5G27345 | transposable_element_gene;Mutator-like transposase family |
| AT5G26345 | transposable_element_gene;Mutator-like transposase family, has a 1.9e-43 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays) |
| AT1G34842 | transposable_element_gene;non-LTR retroelement reverse transcriptase |
| AT4G15590 | transposable_element_gene;non-LTR retrotransposon family (LINE) |
| AT5G55896 | transposable_element_gene;non-LTR retrotransposon family (LINE) |
| AT5G01335 | transposable_element_gene;non-LTR retrotransposon family (LINE) |
| AT5G07215 | transposable_element_gene;non-LTR retrotransposon family (LINE) |
| AT5G46645 | transposable_element_gene;non-LTR retrotransposon family (LINE) |
| AT1G31030 | transposable_element_gene;non-LTR retrotransposon family (LINE) |
| AT3G62725 | transposable_element_gene;non-LTR retrotransposon family (LINE) |
| AT1G30030 | transposable_element_gene;non-LTR retrotransposon family (LINE) |
| AT1G23990 | transposable_element_gene;non-LTR retrotransposon family (LINE) |
| AT2G01550 | transposable_element_gene;non-LTR retrotransposon family (LINE) match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element) |
| AT5G38285 | transposable_element_gene;non-LTR retrotransposon family (LINE), has a 1.1e-22 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus) |
| AT1G22560 | transposable_element_gene;non-LTR retrotransposon family (LINE), has a 9.4e-20 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus) |
| AT1G60150 | transposable_element_gene;pseudogene |
| AT1G55100 | transposable_element_gene;pseudogene, putative ATP synthase beta subunit |
| AT1G22580 | transposable_element_gene;pseudogene, similar to putative AP endonuclease/reverse transcriptase |
| AT1G36936 | transposable_element_gene;pseudogene, similar to Putative copia-type polyprotein, blastp match of 43%25 identity and 2.1e-28 P-value to GP|15209144|gb|AAK91877.1|AC091665_3|AC091665 Putative copia-type polyprotein {Oryza sativa} |
| AT3G62490 | transposable_element_gene;similar to ASY2, DNA binding |
| AT1G26950 | transposable_element_gene;similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT5G33360.1) |
| AT4G37620 | transposable_element_gene;similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT4G09490.1) |
| AT1G17390 | transposable_element_gene;similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT5G36905.1) |
| AT3G26530 | transposable_element_gene;similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G08740.1) |
| AT3G47240 | transposable_element_gene;similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G54926.1) |
| AT2G23710 | transposable_element_gene;similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G09370.1) |
| AT1G35570 | transposable_element_gene;similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1) |
| AT2G04135 | transposable_element_gene;similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G33303.1) |
| AT1G51160 | TRAPP protein BET5 homolog. |
| AT2G37025 | TRF-like 8 |
| AT1G04985 | triacylglycerol lipase-like protein |
| AT3G02270 | Trimeric LpxA-like enzyme |
| AT5G17660 | tRNA (guanine-N-7) methyltransferase |
| AT1G72550 | tRNA synthetase beta subunit family protein |
| AT5G24600 | TRP-like ion channel protein (Protein of unknown function, DUF599) |
| AT4G27070 | Tryptophan synthase beta. Expressed at low levels in all tissues. |
| AT3G05430 | Tudor/PWWP/MBT superfamily protein |
| AT2G03300 | TX12 is a Toll/Interleukin-1 receptor domain containing protein. Misexpression results in ectopic activation of defense response genes. |
| AT2G29400 | Type 1 protein phosphatase, expressed in roots, rosettes and flowers |
| AT5G66080 | Type 2C protein phosphatase located in the plasma membrane. Functions in heat shock response memory mantainance. |
| AT5G04550 | type-1 restriction enzyme mjaxp r protein (DUF668) |
| AT5G21970 | Ubiquitin carboxyl-terminal hydrolase family protein |
| AT2G34240 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (Protein with domains of unknown function DUF627 and DUF632) |
| AT2G46030 | Ubiquitin conjugating enzyme E2 |
| AT5G24870 | Ubiquitin E3 ligase, works with WDL7 in module which regulates microtubule disassembly to mediate stomatal closure in response to drought stress and ABA treatment. MREL57 interacts with, ubiquitinates and degrades WDL7, effect is enhanced by ABA. |
| AT4G38930 | Ubiquitin fusion degradation UFD1 family protein |
| AT3G17205 | ubiquitin protein ligase 6 |
| AT1G27752 | Ubiquitin system component Cue protein |
| AT1G75440 | ubiquitin-conjugating enzyme 16 |
| AT5G42990 | ubiquitin-conjugating enzyme 18 |
| AT5G56150 | ubiquitin-conjugating enzyme 30 |
| AT2G18600 | Ubiquitin-conjugating enzyme family protein |
| AT5G55856 | Ubiquitin-like superfamily protein |
| AT1G11970 | Ubiquitin-like superfamily protein |
| AT5G14360 | Ubiquitin-like superfamily protein |
| AT2G36370 | ubiquitin-protein ligase |
| AT5G61640 | ubiquitous enzyme that repairs oxidatively damaged proteins |
| AT5G07470 | ubiquitous enzyme that repairs oxidatively damaged proteins |
| AT5G07460 | ubiquitous enzyme that repairs oxidatively damaged proteins. Methionine sulfoxide reductase activity. Mutant lacking reductase activity showed increased protein oxidation, nitration and glycation of specific amino acid residues during darkness. |
| AT4G30390 | UDP-arabinopyranose mutase |
| AT4G12250 | UDP-D-glucuronate 4-epimerase |
| AT1G14360 | UDP-galactose transporter 3 |
| AT3G46180 | UDP-galactose transporter 5 |
| AT3G59360 | UDP-galactose transporter 6 |
| AT5G39320 | UDP-glucose 6-dehydrogenase family protein |
| AT4G15550 | UDP-glucose:indole-3-acetate beta-D-glucosyltransferase |
| AT3G21800 | UDP-glucosyl transferase 71B8 |
| AT4G34138 | UDP-glucosyl transferase 73B1 |
| AT3G53150 | UDP-glucosyl transferase 73D1 |
| AT5G59580 | UDP-glucosyl transferase 76E1 |
| AT5G59590 | UDP-glucosyl transferase 76E2 |
| AT1G22360 | UDP-glucosyl transferase 85A2 |
| AT1G78270 | UDP-glucosyl transferase 85A4 |
| AT1G22370 | UDP-glucosyl transferase 85A5 |
| AT1G22340 | UDP-glucosyl transferase 85A7 |
| AT3G22250 | UDP-Glycosyltransferase superfamily protein |
| AT5G12890 | UDP-Glycosyltransferase superfamily protein |
| AT2G22930 | UDP-Glycosyltransferase superfamily protein |
| AT5G38010 | UDP-Glycosyltransferase superfamily protein |
| AT1G19710 | UDP-Glycosyltransferase superfamily protein |
| AT3G46700 | UDP-Glycosyltransferase superfamily protein |
| AT1G73160 | UDP-Glycosyltransferase superfamily protein |
| AT2G29710 | UDP-Glycosyltransferase superfamily protein |
| AT4G36770 | UDP-Glycosyltransferase superfamily protein |
| AT3G50740 | UGT72E1 is an UDPG:coniferyl alcohol glucosyltransferase which specifically glucosylates sinapyl- and coniferyl aldehydes. The enzyme is thought to be involved in lignin metabolism. |
| AT4G37180 | UIF1 is a nuclear and cytoplasmically localized myb-domain containing member of the GARP G2-like subfamily of transcription factors. Interacts with ULT1 and binds to the WUS promoter. UIF1 binding domains are also found in CUC and AG promoters suggesting they are also direct targets. This locus was also identified as a putative cytoskeletal protein in a yeast screen. |
| AT1G10140 | Uncharacterized conserved protein UCP031279 |
| AT1G03700 | Uncharacterized protein family (UPF0497) |
| AT4G16442 | Uncharacterized protein family (UPF0497) |
| AT4G13615 | Uncharacterized protein family SERF |
| AT3G06125 | Unknown gene |
| AT5G14730 | Unknown protein, expression induced by IDL7 and stress. |
| AT2G15960 | Unknown protein. Expression decreased in response to proline. |
| AT4G21437 | unknown pseudogene |
| AT4G37690 | Unlike its close paralog MUCI10 (At2g22900), GT6 is not required for the biosynthesis of seed coat mucilage. GT6 is preferentially expressed in sub-epidermal cell layers of the seed coat. |
| AT4G30150 | Urb2/Npa2 family protein |
| AT2G35820 | ureidoglycolate hydrolase |
| AT2G35810 | ureidoglycolate hydrolase |
| AT1G03190 | UV damage and heat induce a common stress response in plants that leads to tissue death and reduced chloroplast function. The UVH6 product is suggested to be a negative regulator of this response. |
| AT5G63860 | UV-B-specific signaling component that orchestrates expression of a range of genes with vital UV-protective functions. Located in the nucleus and the cytosol. Associates with chromatin via histones. UV-B light promotes URV8 protein accumulation in the nucleus. UVR8 interaction with COP1 is negatively regulated by RUP1 and RUP2. |
| AT1G62480 | Vacuolar calcium-binding protein-like protein |
| AT1G64200 | vacuolar H+-ATPase subunit E isoform 3 |
| AT4G27870 | Vacuolar iron transporter (VIT) family protein |
| AT4G27860 | vacuolar iron transporter (VIT) family protein |
| AT5G24290 | Vacuolar iron transporter (VIT) family protein |
| AT4G39080 | Vacuolar proton ATPase subunit VHA-a isoform 3. Localized in the tonoplast. |
| AT2G34940 | VACUOLAR SORTING RECEPTOR 5 |
| AT5G18490 | vacuolar sorting-associated protein (DUF946) |
| AT4G38920 | vacuolar-type H[+]-ATPase C3 |
| AT2G34010 | verprolin |
| AT1G80160 | Vicinal oxygen chelate (VOC) superfamily member. |
| AT4G23630 | VIRB2-interacting protein 1 |
| AT4G11220 | VIRB2-interacting protein 2 |
| AT5G41600 | VIRB2-interacting protein 3 |
| AT1G28200 | VirF-interacting protein FIP1 |
| AT1G17147 | VQ motif-containing protein |
| AT1G80450 | VQ motif-containing protein |
| AT1G28280 | VQ motif-containing protein |
| AT2G41180 | VQ motif-containing protein |
| AT4G37710 | VQ motif-containing protein |
| AT1G78310 | VQ motif-containing protein |
| AT3G22160 | VQ motif-containing protein. JAV1 is a repressor of jasmonate-mediated defense responses. |
| AT3G60090 | VQ26 is an ABA responsive gene and interacts with the ABI5 transcription factor. Along with its paralog VQ18, it is involved in negative regulation of ABA responses during early seedling development. |
| AT3G56270 | WEB family protein (DUF827) |
| AT5G55860 | WEB1/PMI2 related protein involved in mecahnotransduction.TREPH1 is phosphorylated at position S625 in response to touch, and this is required for mechanosensitive growth response. |
| AT5G66050 | Wound-responsive family protein |
| AT1G19660 | Wound-responsive family protein |
| AT1G47200 | WPP family members contains an NE targeting domain. This domain, called the WPP domain after a highly conserved Trp-Pro-Pro motif, is necessary for NE targeting of WPP1. RNAi suppression of WPP2 resulted in reduced mitotic activity. |
| AT1G79700 | WRI4 encodes an AP2/ERF-type transcriptional activator that specifically controls cuticular wax biosynthesis in Arabidopsis stems. |
| AT1G64140 | WRKY transcription factor |
| AT5G13080 | WRKY75 is one of several transcription factors induced during Pi deprivation. |
| AT2G05760 | Xanthine/uracil permease family protein |
| AT4G01780 | XH/XS domain-containing protein |
| AT3G48580 | xyloglucan endotransglucosylase/hydrolase 11 |
| AT4G28850 | xyloglucan endotransglucosylase/hydrolase 26 |
| AT4G37800 | xyloglucan endotransglucosylase/hydrolase 7 |
| AT1G32170 | xyloglucan endotransglycosylase-related protein (XTR4) |
| AT4G25810 | xyloglucan endotransglycosylase-related protein (XTR6) |
| AT4G22830 | YCF49-like protein |
| AT2G40810 | yeast autophagy-like protein |
| AT3G08990 | Yippee family putative zinc-binding protein |
| AT4G29950 | Ypt/Rab-GAP domain of gyp1p superfamily protein |
| AT1G04830 | Ypt/Rab-GAP domain of gyp1p superfamily protein |
| AT3G07890 | Ypt/Rab-GAP domain of gyp1p superfamily protein |
| AT5G53570 | Ypt/Rab-GAP domain of gyp1p superfamily protein |
| AT1G04180 | YUCCA 9 |
| AT1G10220 | ZCF37 |
| AT1G59590 | ZCF37 mRNA, complete cds |
| AT1G59600 | ZCW7 |
| AT3G54740 | zein-binding protein (Protein of unknown function, DUF593) |
| AT3G54826 | Zim17-type zinc finger protein |
| AT5G49665 | Zinc finger (C3HC4-type RING finger) family protein |
| AT5G65683 | Zinc finger (C3HC4-type RING finger) family protein |
| AT1G32360 | Zinc finger (CCCH-type) family protein |
| AT2G30530 | zinc finger CCCH domain protein |
| AT1G26920 | zinc finger CCHC domain protein |
| AT1G04990 | Zinc finger C-x8-C-x5-C-x3-H type family protein |
| AT3G06410 | Zinc finger C-x8-C-x5-C-x3-H type family protein |
| AT4G29190 | Zinc finger C-x8-C-x5-C-x3-H type family protein |
| AT1G69610 | zinc finger FYVE domain protein, putative (DUF1666) |
| AT1G70160 | zinc finger MYND domain protein |
| AT3G54880 | zinc finger protein |
| AT3G61850 | Zinc finger transcription factor of the Dof family involved in the control of seed germination. |
| AT1G63170 | Zinc finger, C3HC4 type (RING finger) family protein |
| AT1G12760 | Zinc finger, C3HC4 type (RING finger) family protein |
| AT3G26420 | Zinc finger-containing glycine-rich RNA-binding protein. Cold-inducible. |
| AT5G13750 | zinc induced facilitator-like 1 |
| AT2G44580 | zinc ion binding protein |
| AT1G22440 | Zinc-binding alcohol dehydrogenase family protein |
| AT5G38000 | Zinc-binding dehydrogenase family protein |
| AT5G02160 | Zinc-finger domain containing protein involved in abiotic stress response. |
| AT2G45450 | ZPR1, a small leucine zipper-containing protein that interacts with REV HD-ZIPIII and is involved in the establishment of leaf polarity. |
| AT1G58270 | ZW9 mRNA, complete cds |