37 senescence-associated transcription factors (Sen-TFs) ChIP-seq or DAP-seq data
| ANAC042 Targets | Description |
| AT1G01050 | Encodes a soluble protein with inorganic pyrophosphatase activity that is highly specific for Mg-inorganic pyrophosphate. |
| AT1G01070 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
| AT1G01110 | Member of IQ67 (CaM binding) domain containing family. |
| AT1G01120 | Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis. |
| AT1G01183 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUCCCC. Accumulation of the pri-miRNA165a transcript is increased by the activity of the miPEP165 peptide which is encoded within the pri-miRNA165a transcript. |
| AT1G01190 | cytochrome P450, family 78, subfamily A, polypeptide 8;(source:Araport11) |
| AT1G01200 | RAB GTPase homolog A3;(source:Araport11) |
| AT1G01230 | ORM1 is an ER localized orosomucoid-like protein involved in sphingolipid homeostasis. |
| AT1G01290 | COFACTOR OF NITRATE REDUCTASE AND XANTHINE DEHYDROGENASE 3. Encodes a protein involved in molybdenum cofactor biosynthesis. Homologous to E.coli MoaC. Expression is low in all tissues examined, except in roots. Appears to have targeting signals for chloroplast or mitochondria |
| AT1G01305 | hypothetical protein;(source:Araport11) |
| AT1G01320 | Encodes REDUCED CHLOROPLAST COVERAGE 1 (REC1) a protein with similarity to the FLOURY locus in maize. Located in the nucleus and cytosol. Contributes to establishing the size of the chloroplast compartment. |
| AT1G01340 | member of Cyclic nucleotide gated channel family |
| AT1G01390 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G01453 | HeLo domain-containing mixed lineage kinase domain-like protein (MLKL). A pseudokinase, mediates necroptotic cell death in animals. |
| AT1G01500 | Erythronate-4-phosphate dehydrogenase family protein;(source:Araport11) |
| AT1G01510 | Encodes a homolog of human CtBP. Mutant has longer and thicker leaves than wild type. Involved in controlling polar cell expansion in the leaf width direction. It has been shown to localize to cytosolic stress granules and is involved in their formation. |
| AT1G01520 | RVE3 is one of eleven homologous MYB-like transcription factors in Arabidopsis and a member of the RVE8 clade. Plays a minor role in clock regulation. |
| AT1G01540 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G01570 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT1G01600 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly at highest level in mature stems and flowers. |
| AT1G01650 | SIGNAL PEPTIDE PEPTIDASE-LIKE 4;(source:Araport11) |
| AT1G01695 | Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11) |
| AT1G01720 | Belongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA. The mRNA is cell-to-cell mobile. |
| AT1G01790 | Encodes a member of the cation/proton antiporters-2 antiporter superfamily, the K efflux antiporter KEA1 that is localized to the chloroplast envelope. |
| AT1G01810 | hypothetical protein;(source:Araport11) |
| AT1G01820 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
| AT1G01900 | Encodes AtSBT1.1, a subtilisin-like serine protease. Cleaves the phytosulfokine AtPSK4, a growth promoting peptide. |
| AT1G01980 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
| AT1G02000 | UDP-D-glucuronate 4-epimerase The mRNA is cell-to-cell mobile. |
| AT1G02010 | member of KEULE Gene Family |
| AT1G02040 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT1G02050 | Chalcone and stilbene synthase family protein;(source:Araport11) |
| AT1G02060 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G02065 | Encodes an SBP-box gene, a member of the SPL gene family. Mutants are affected in micro- and megasporogenesis, trichome formation on sepals, and stamen filament elongation. |
| AT1G02070 | zinc ion-binding protein;(source:Araport11) |
| AT1G02120 | Encodes VAD1 (Vascular Associated Death1), a regulator of cell death and defense responses in vascular tissues. VAD1 is a putative membrane associated protein and contains a GRAM domain. vad1 is a lesion mimic mutant that exhibits light conditional appearance of propagative HR (hypersensitive response)-like lesions along the vascular system. The mRNA is cell-to-cell mobile. |
| AT1G02150 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G02205 | Expression of the CER1 gene associated with production of stem epicuticular wax and pollen fertility. Biochemical studies showed that cer1 mutants are blocked in the conversion of stem wax C30 aldehydes to C29 alkanes, and they also lack the secondary alcohols and ketones. These suggested the CER1 protein is an aldehyde decarbonylase, but the exact molecular function of this protein remains to be determined. |
| AT1G02220 | NAC domain transcription factor which functions as a negative regulator of the TDIF-PXY module and fine-tunes TDIF signaling in vascular development. Controls the balance of xylem formation and cambial cell divisions. |
| AT1G02310 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT1G02360 | Chitinase family protein;(source:Araport11) |
| AT1G02390 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT1G02450 | NIMIN1 modulates PR gene expression according the following model: NPR1 forms a ternary complex with NIMIN1 and TGA factors upon SAR induction that binds to a positive regulatory cis-element of the PR-1 promoter, termed LS7. This leads to PR-1 gene induction. NIMIN1 decreases transcriptional activation, possibly through its EAR motif, which results in fine-tuning of PR-1 gene expression. |
| AT1G02460 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G02530 | P-glycoprotein 12;(source:Araport11) |
| AT1G02580 | Encodes the imprinted gene MEA that belongs to Polycomb Repressive Complex 2 (PRC2) and has a SET domain for methyltransferase activity and is involved in the stable transcriptional silencing of target genes. It negatively regulates seed development in the absence of fertilization. Mutations in this locus result in embryo lethality. MEA is imprinted in the endosperm. The maternal allele is expressed and the paternal allele is silent. MEA is controlled by DEMETER (DME), a DNA glycosylase required to activate MEA expression, and METHYLTRANSFERASE I (MET1), which maintains CG methylation at the MEA locus. MEA is involved in the negative regulation of its own imprinted gene expression; the effect is not only allele-specific but also dynamically regulated during seed development. In the ovule, the MEA transcripts are accumulated at their highest level before fertilization and gradually decrease after fertilization |
| AT1G02640 | encodes a protein similar to a beta-xylosidase located in the extracellular matrix. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
| AT1G02650 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G02730 | Encodes a gene similar to cellulose synthase. Knock-out mutant has reduced growth, reduced xylan level and reduced xylan synthase activity in stems.It's expression is cell cycle dependent and it appears to function in cell plate formation. |
| AT1G02810 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT1G02816 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
| AT1G02820 | Late embryogenesis abundant 3 (LEA3) family protein;(source:Araport11) |
| AT1G02910 | Mutants defective in this gene were shown to have a reduced PSII content (overall reduction in the levels of several PSII subunits) and a disrupted grana stack structure. The N-terminal half of the protein contains two tetratricopeptide repeat (TPR) motifs that are arranged tandemly, each consisting of a 34-residue degenerate consensus sequence. The N-terminal sequence is rich in positive and hydroxylated amino acid residues. |
| AT1G02960 | kinetochore protein;(source:Araport11) |
| AT1G02980 | encodes an Arabidopsis cullin |
| AT1G03010 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT1G03060 | Encodes a WD/BEACH domain protein involved in cell morphogenesis and ribonucleoprotein particle formation. It interacts with the P-body core component DCP2, associates to mRNA processing bodies (P-bodies), and regulates their assembly upon salt stress. It accumulates at the root hair apex via post-Golgi compartments and positively regulates tip growth by maintaining tip-focused vesicle secretion and filamentous-actin integrity. |
| AT1G03070 | Bax inhibitor-1 family protein;(source:Araport11) |
| AT1G03103 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G03106 | hypothetical protein;(source:Araport11) |
| AT1G03160 | A new plant-specific member of the dynamin superfamily; defines a new protein class within the dynamin superfamily of membrane remodeling GTPases that regulates organization of the thylakoid network in plants. Targeted to chloroplasts and associated with thylakoid and envelope membranes as punctate structures. Knockout mutants have abnormalities in chloroplast and thylakoid morphology, including disorganized grana stacks and alterations in the relative proportions of grana and stroma thylakoids. Overexpression of FZL-GFP also conferred defects in thylakoid organization. |
| AT1G03220 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G03300 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
| AT1G03320 | hypothetical protein;(source:Araport11) |
| AT1G03420 | Member of Sadhu non-coding retrotransposon family |
| AT1G03440 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G03445 | encodes a serine?threonine protein phosphatase with an N-terminal Kelch-repeat domain, which is nuclear localized and expressed preferentially in elongating cells. Genetic evidence suggest that this gene plays a redundant role (along with other members of the same gene family) in modulating growth in response to brassinosteroid. |
| AT1G03650 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT1G03800 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-10). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT1G03820 | E6-like protein;(source:Araport11) |
| AT1G03850 | Encodes glutaredoxin ATGRXS13, required to facilitate Botrytis cinerea infection of Arabidopsis thaliana plants. Sylvain La Camera et al (2011, PMID:21756272) reported a third splice variant in addition to the two annotated in TAIR10. It is a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT1G03880 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT1G03910 | Encodes the Arabidopsis homolog of a conserved eukaryotic protein without known functional domains. The protein that localizes to nuclear speckles and colocalizes with known splicing proteins. |
| AT1G03970 | encodes a basic leucine zipper G-box binding factor that can bind to G-box motifs only as heterodimers with GBF2 or GBF3. A single amino acid change can confer G-box binding as homodimers. |
| AT1G04000 | hypothetical protein;(source:Araport11) |
| AT1G04020 | Encodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein-protein interactions. Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression. |
| AT1G04120 | encodes a high-affinity inositol hexakisphosphate transporter that plays a role in guard cell signaling and phytate storage. It is a member of MRP subfamily / ABC transporter subfamily C. |
| AT1G04130 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808). Interacts with Hsp90/Hsp70 as co-chaperone. |
| AT1G04170 | protein synthesis initiation factor eIF2 gamma The mRNA is cell-to-cell mobile. |
| AT1G04180 | YUCCA 9;(source:Araport11) |
| AT1G04200 | dyggve-melchior-clausen syndrome protein;(source:Araport11) |
| AT1G04210 | Encodes a putative Raf-related kinase. |
| AT1G04270 | Encodes cytosolic ribosomal protein S15. |
| AT1G04370 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT1G04430 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G04445 | C2H2-like zinc finger protein;(source:Araport11) |
| AT1G04457 | Pseudogene of AT2G33450; 50S ribosomal protein L28, chloroplast (CL28) |
| AT1G04600 | member of Myosin-like proteins |
| AT1G04610 | Encodes a member of the YUC family that is expressed in the root apex and is ethylene inducible in the root. |
| AT1G04710 | EC2.3.1.16 thiolase. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT1G04780 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G04830 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT1G04930 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G04940 | Tic20 is believed to function as a component of the protein-conducting channel at the inner envelope membrane. Genes AT1G04940 and AT1G04945 were switched for the TAIR7 genome release to give consistency with MIPs annotation. The Arabidopsis genome encodes four Tic20 homologous proteins, AT1G04940(Tic20-I), AT2G47840(Tic20-II), AT4G03320(Tic20-IV) and AT5G55710(Tic20-V). |
| AT1G04990 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G05020 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT1G05055 | Member of transcription factor TFIIH complex. Involved in transcription and DNA repair and interacts with AtXPD. |
| AT1G05060 | coiled-coil protein;(source:Araport11) |
| AT1G05150 | Calcium-binding tetratricopeptide family protein;(source:Araport11) |
| AT1G05220 | Transmembrane protein 97, Putative;(source:Araport11) |
| AT1G05291 | GPI inositol-deacylase C, putative (DUF1218);(source:Araport11) |
| AT1G05300 | member of Fe(II) transporter isolog family |
| AT1G05340 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
| AT1G05370 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G05420 | ovate family protein 12;(source:Araport11) |
| AT1G05520 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
| AT1G05540 | hypothetical protein (DUF295);(source:Araport11) |
| AT1G05615 | B3 domain protein (DUF313);(source:Araport11) |
| AT1G05675 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G05680 | Encodes a UDP-glucosyltransferase, UGT74E2, that acts on IBA (indole-3-butyric acid) and affects auxin homeostasis. The transcript and protein levels of this enzyme are strongly induced by H2O2 and may allow integration of ROS (reactive oxygen species) and auxin signaling. This enzyme can also transfer glycosyl groups to several compounds related to the explosive TNT when this synthetic compound is taken up from the environment. |
| AT1G05690 | BTB and TAZ domain protein. Acts redunantly with BT1 and BT2 during female gametophyte development. Acts with BT2 during male gametophyte development. |
| AT1G05805 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G05810 | Rab GTPase-like A5A protein;(source:Araport11) |
| AT1G05820 | SIGNAL PEPTIDE PEPTIDASE-LIKE 5;(source:Araport11) |
| AT1G05900 | endonuclease III 2;(source:Araport11) |
| AT1G06000 | encodes a flavonol-7-O-rhamnosyltransferase involved in the formation of rhamnosylated flavonols |
| AT1G06002 | Natural antisense transcript overlaps with AT1G06000;(source:Araport11) |
| AT1G06060 | LisH and RanBPM domains containing protein;(source:Araport11) |
| AT1G06080 | Encodes a protein homologous to delta 9 acyl-lipid desaturases of cyanobacteria and acyl-CoA desaturases of yeast and mammals. expression down-regulated by cold temperature. It is involved in the desaturation of VLCFAs to make monounsaturated VLCFAs. |
| AT1G06110 | SKP1/ASK-interacting protein 16;(source:Araport11) |
| AT1G06148 | hypothetical protein;(source:Araport11) |
| AT1G06180 | member of MYB3R- and R2R3- type MYB- encoding genes |
| AT1G06265 | Natural antisense transcript overlaps with AT1G06260;(source:Araport11) |
| AT1G06290 | Encodes an acyl-CoA oxidase with specificity for medium chain fatty acids. The mRNA is cell-to-cell mobile. |
| AT1G06340 | Plant Tudor-like protein;(source:Araport11) |
| AT1G06380 | Ribosomal protein L1p/L10e family;(source:Araport11) |
| AT1G06390 | encodes a GSK3/shaggy-like protein kinase. Gene expression is induced by NaCl and ABA but not KCl, suggesting that this gene may be involved in response to osmotic stress. This protein can interact with the BZR1 protein involved in brassinosteroid-mediated signaling in a Y2H assay and promotes BZR1 phosphorylation in protoplasts. |
| AT1G06410 | Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants. |
| AT1G06530 | Encodes PEROXISOMAL AND MITOCHONDRIAL DIVISION FACTOR2. Involved in mitochondrial morphogenesis. |
| AT1G06730 | pfkB-like carbohydrate kinase family protein;(source:Araport11) |
| AT1G06750 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G06820 | Encodes carotenoid isomerase. Catalyzes the isomerization of poly-cis-carotenoids to all-trans-carotenoids. Together with PDS and ZDS, CRTiso is required to complete the synthesis of lycopene from phytoene. |
| AT1G06840 | Homomultimers interact with cytoplasmic signaling molecule PBL27, resulting in herbivory resistance, in an ethylene-dependent manner. |
| AT1G06923 | transcription repressor OFP17-like protein;(source:Araport11) |
| AT1G06970 | member of Putative Na+/H+ antiporter family |
| AT1G06990 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G07000 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT1G07030 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT1G07080 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G07170 | Similar to human splicing factor 3b, 14 kda subunit, SF3b14b. |
| AT1G07230 | non-specific phospholipase C1;(source:Araport11) |
| AT1G07250 | UDP-glucosyl transferase 71C4;(source:Araport11) |
| AT1G07270 | Cell division control, Cdc6;(source:Araport11) |
| AT1G07280 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G07360 | Encodes MAC5A, a component of the MOS4-associated complex (MAC) that contributes to snc1- mediated autoimmunity. MAC is a highly conserved nuclear protein complex associated with the spliceosome. Homologues include AT1G07360 (MAC5A), AT2G29580 (MAC5B) and AT5G07060 (MAC5C). |
| AT1G07430 | Encodes a member of the group A protein phosphatase 2C (PP2C) family that is responsible for negatively regulating seed dormancy. |
| AT1G07490 | ROTUNDIFOLIA like 3;(source:Araport11) |
| AT1G07560 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G07630 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT1G07680 | transmembrane protein;(source:Araport11) |
| AT1G07728 | Natural antisense transcript overlaps with AT1G07725;(source:Araport11) |
| AT1G07740 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G07850 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT1G07890 | Encodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. The mRNA is cell-to-cell mobile. |
| AT1G07910 | Encodes a tRNA ligase that resembles the yeast Trl1 RNA ligase in structure and function but very different in sequence. Like Trl1, AtRNL consists of two domains, an N-terminal ligase component and a C-terminal 5'-kinase/2',3'-cyclic phosphodiesterase (CPD) component that can function in tRNA splicing in vivo when expressed as separate polypeptides. Requires a 2'-PO4 end for tRNA splicing in vivo. |
| AT1G08140 | member of Putative Na+/H+ antiporter family |
| AT1G08170 | Histone superfamily protein;(source:Araport11) |
| AT1G08220 | ATPase complex subunit;(source:Araport11) |
| AT1G08250 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Although this enzyme has sequence similarity to prephenate dehydratases, it is 98 times more active with arogenate than prephenate in enzymatic assays. |
| AT1G08280 | Encodes a glycosyltransferase (GT) GALT29A, which belongs to the Carbohydrate Active Enzyme family GT29. GALT29A co-expresses with other arabinogalactan GTs, GALT31A and GLCAT14A. The recombinant GALT29A expressed in Nicotiana benthamiana demonstrated a galactosyltransferase activity, transferring galactose from UDP-galactose to a mixture of various oligosaccharides derived from arabinogalactan proteins. |
| AT1G08390 | Involved in preserving the stability of 45S rDNA repeats. |
| AT1G08410 | Encodes a large 60S subunit nuclear export GTPase 1 that is required for 40S maturation and is involved in ribosome biogenesis and affects multiple auxin-regulated development processes. |
| AT1G08420 | Protein phosphatase which promotes stomatal ACD by establishing kinase-based signalling asymmetry in the two daughter cells. |
| AT1G08470 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
| AT1G08530 | chitinase-like protein;(source:Araport11) |
| AT1G08570 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase. The mRNA is cell-to-cell mobile. |
| AT1G08592 | Natural antisense transcript overlaps with AT1G08590;(source:Araport11) |
| AT1G08630 | Encodes a threonine aldolase, involved in threonine degradation to glycine. Primarily expressed in seeds and seedlings. |
| AT1G08650 | Encodes a phosphoenolpyruvate carboxylase kinase that is expressed at highest levels in leaves. Expression is induced by light. The mRNA is cell-to-cell mobile. |
| AT1G08735 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.3e-87 P-value blast match to Q9SLM0 /314-478 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT1G08770 | prenylated RAB acceptor 1.E;(source:Araport11) |
| AT1G08890 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G08920 | Encodes ESL1, a transporter for monosaccharides. |
| AT1G08930 | encodes a putative sucrose transporter whose gene expression is induced by dehydration and cold. The mRNA is cell-to-cell mobile. |
| AT1G08980 | Encodes an enzyme with similarity to bacterial acylamidohydrolases and exhibits indole-3-acetamide amidohydrolase activity in vitro. This enzyme may be involved in the in vivo biosynthesis of indole-acetic acid from indole-3-acetamide, a native metabolite of A. thaliana. It appears to exist as a monomer. |
| AT1G09010 | glycoside hydrolase family 2 protein;(source:Araport11) |
| AT1G09070 | SRC2 specifically binds the peptide PIEPPPHH, and moves from ER to a vacuole fraction where it gets internalized. Involved in Protein Storage Vacuole targeting. The mRNA is cell-to-cell mobile. |
| AT1G09176 | transmembrane protein;(source:Araport11) |
| AT1G09180 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
| AT1G09245 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT1G09290 | hypothetical protein;(source:Araport11) |
| AT1G09350 | Predicted to encode a galactinol synthase |
| AT1G09390 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G09410 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT1G09520 | hypothetical protein;(source:Araport11) |
| AT1G09540 | Encodes putative transcription factor. Mutants lack of mucilage extrusion from the seeds during imbibition. Reduced quantities of mucilage are deposited during the development of the seed coat epidermis in myb61 mutants. Expressed in guard cells,loss of function mutations show an increase in stomatal pore opening suggesting a role in ABA independent regulation of stomatal pore size. |
| AT1G09570 | Light-labile cytoplasmic red/far-red light photoreceptor involved in the regulation of photomorphogenesis. It exists in two inter-convertible forms: Pr and Pfr (active) and functions as a dimer.The N terminus carries a single tetrapyrrole chromophore, and the C terminus is involved in dimerization. It is the sole photoreceptor mediating the FR high irradiance response (HIR). Major regulator in red-light induction of phototropic enhancement. Involved in the regulation of de-etiolation. Involved in gravitropism and phototropism. Requires FHY1 for nuclear accumulation. |
| AT1G09575 | Mitochondrial calcium channel. |
| AT1G09750 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G09760 | U2 small nuclear ribonucleoprotein A;(source:Araport11) |
| AT1G09950 | RESPONSE TO ABA AND SALT 1;(source:Araport11) |
| AT1G09960 | low affinity (10mM) sucrose transporter in sieve elements (phloem) |
| AT1G09980 | Putative serine esterase family protein;(source:Araport11) |
| AT1G10020 | formin-like protein (DUF1005);(source:Araport11) |
| AT1G10040 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G10140 | Uncharacterized conserved protein UCP031279;(source:Araport11) |
| AT1G10170 | Encodes AtNFXL1, a homologue of the putative human transcription repressor NF-X1. Functions as a negative regulator of the trichothecene phytotoxin-induced defense response. |
| AT1G10270 | glutamine-rich protein 23;(source:Araport11) |
| AT1G10380 | Putative membrane lipoprotein;(source:Araport11) |
| AT1G10390 | DRA2 is a homolog of mammalian nucleoporin 98 and a likely component of the nuclear pore complex in Arabidopsis. It positively participates in the control of the hypocotyl elongation response to plant proximity and control of shade induced gene expression. Nucleoportin which redundantly inhibits flowering together with Nup98b through multiple pathways including clock, photoperiod, and age pathways. Gates flowering in a CONSTANS (CO)-independent mode and bypasses the CO checkpoint in photoperiodic signaling and integrated signals from multiple pathways to directly target FLOWERING LOCUS T (FT) for flowering control. |
| AT1G10410 | CW14 protein (DUF1336);(source:Araport11) |
| AT1G10470 | Encodes a two-component response regulator. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
| AT1G10480 | Encodes a zinc finger protein containing only a single zinc finger that acts downstream of ZFP6 in regulating trichome development by integrating GA and cytokinin signaling. |
| AT1G10530 | PADRE protein |
| AT1G10560 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT1G10570 | Encodes a deSUMOylating enzyme. In vitro it has both peptidase activity and isopeptidase activity: it can cleave the C-terminal residues from SUMO to activate it for attachment to a target protein and it can also act on the isopeptide bond between SUMO and another protein. sYFP:OTS2 protein accumulates in nuclei in a punctate pattern. Double mutant analysis with ULP1D/OTS1 indicates that these genes are involved in salt stress responses and flowering time regulation. |
| AT1G10580 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G10590 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT1G10690 | cyclin-dependent kinase inhibitor;(source:Araport11) |
| AT1G10820 | hypothetical protein (DUF3755);(source:Araport11) |
| AT1G10850 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G10880 | Putative role in response to salt stress. Mutants grow larger than the wild type under salt stress condition (Ann Stapleton and Ashley Green, 2009, personal communication). |
| AT1G10910 | Member of the P subfamily of PRR proteins. Loss of function results in defects in abnormal plastid RNA edit and chloroplast biogenesis |
| AT1G11040 | HSP40/DnaJ peptide-binding protein;(source:Araport11) |
| AT1G11050 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G11055 | Encodes a defensin-like (DEFL) family protein. |
| AT1G11070 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G11160 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
| AT1G11170 | lysine ketoglutarate reductase trans-splicing-like protein (DUF707);(source:Araport11) |
| AT1G11210 | cotton fiber protein, putative (DUF761);(source:Araport11) |
| AT1G11260 | Encodes a H+/hexose cotransporter. The mRNA is cell-to-cell mobile. |
| AT1G11265 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.4e-253 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G11300 | The annotation for At1g11300 in TAIR10 is incorrect. This locus has been split into two At1g11300 (symbol: EGM1) and At1g11305 (symbol: EGM2) (Olivier Loudet, personal communication, 2013-04-03). See Comment field for revised annotation. |
| AT1G11340 | G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11) |
| AT1G11410 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G11520 | pliceosome associated protein-like protein;(source:Araport11) |
| AT1G11570 | NTF2-like protein;(source:Araport11) |
| AT1G11600 | member of CYP77B |
| AT1G11660 | heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
| AT1G11670 | MATE efflux family protein;(source:Araport11) |
| AT1G11680 | putative obtusifoliol 14-alpha demethylase involved in sterol biosynthesis. The mRNA is cell-to-cell mobile. |
| AT1G11730 | Galactosyltransferase family protein;(source:Araport11) |
| AT1G11740 | ankyrin repeat family protein;(source:Araport11) |
| AT1G11750 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). |
| AT1G11765 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT1G11770 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
| AT1G11840 | Encodes Ni+ dependent glyoxalase I homolog ATGLX1. |
| AT1G11850 | transmembrane protein;(source:Araport11) |
| AT1G11860 | T-protein is the aminomethyltransferase of the glycine cleavage multienzyme system GCS. |
| AT1G11920 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G12000 | Phosphofructokinase family protein;(source:Araport11) |
| AT1G12030 | phosphoenolpyruvate carboxylase, putative (DUF506);(source:Araport11) |
| AT1G12060 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT1G12064 | transmembrane protein;(source:Araport11) |
| AT1G12110 | Encodes NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is expressed in guard cells and function in stomatal opening. Mutants have less transpiration and are more tolerant to drought. Expressed in lateral roots. Involved in nitrate signaling which enables the plant root system to detect and exploit nitrate-rich soil patches. Comparing to the wild type, the mutant displays a strongly decreased lateral root proliferation phenotype in nitrate rich patches on growth medium. Affects flowering time via interaction with the FLC dependent flowering pathway to influence its target gene FT. |
| AT1G12240 | Encodes a vacuolar invertase betaFruct4. betaFruct4 is transported from the endoplasmic reticulum through the intermediate compartments as a membrane protein. The N-terminal cytoplasmic domain contains multiple sequence motifs that are involved at various stages in the trafficking of betaFruct4 from the ER to the central vacuole. The mRNA is cell-to-cell mobile. |
| AT1G12370 | encodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele |
| AT1G12380 | hypothetical protein;(source:Araport11) |
| AT1G12390 | Cornichon family protein;(source:Araport11) |
| AT1G12420 | ACT domain repeat 8;(source:Araport11) |
| AT1G12450 | SNARE associated Golgi protein family;(source:Araport11) |
| AT1G12480 | Encodes a membrane protein with 10 predicted transmembrane helices. SLAC1 is a multispanning membrane protein expressed predominantly in guard cells that plays a role in regulating cellular ion homeostasis and S-type anion currents. SLAC1 is important for normal stomatal closure in response to a variety of signals including elevated CO2, ozone, ABA, darkness, and humidity. SLAC1:GFP localizes to the plasma membrane. |
| AT1G12500 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT1G12550 | Encodes a hydroxypyruvate reductase that reduces HP to glycerate and shows even more activity with glyoxylate, a more upstream intermediate of the photorespiratory cycle. It is likely targeted to the chloroplast where it could provide a compensatory bypass for the reduction of HP and glyoxylate within this compartment. Together with HPPR2 and TAT1 involved in the biosynthesis of pHPL from tyrosine. |
| AT1G12560 | Member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Containing a conserved root hair-specific cis-element RHE. Expressed specifically in root hair cell and involved in root hair elongation. |
| AT1G12570 | Ortholog of maize IPE1 gene which is involved in pollen exine development. |
| AT1G12610 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (DDF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. Overexpression of this gene results in delayed flowering and dwarfism, reduction of gibberellic acid biosynthesis, and increased tolerance to high levels of salt. This gene is expressed in all tissues examined, but most abundantly expressed in upper stems. Overexpression of this gene is also correlated with increased expression of GA biosynthetic genes and RD29A (a cold and drought responsive gene). Under salt stress it induces the expression of GAOX7, which encodes ad C20-GA inhibitor. |
| AT1G12780 | Encodes a UDP-glucose epimerase that catalyzes the interconversion of the sugar nucleotides UDP-glucose UDP-galactose via a UDP-4-keto-hexose intermediate. Responsive to stress. |
| AT1G12810 | proline-rich family protein;(source:Araport11) |
| AT1G12845 | transmembrane protein;(source:Araport11) |
| AT1G12860 | Encodes ICE2 (Inducer of CBF Expression 2), a transcription factor of the bHLH family that participates in the response to deep freezing through the cold acclimation-dependent pathway. Overexpression of ICE2 results in increased tolerance to deep freezing stress after cold acclimation. |
| AT1G12940 | member of High affinity nitrate transporter family |
| AT1G12950 | root hair specific 2;(source:Araport11) |
| AT1G12960 | Ribosomal protein L18e/L15 superfamily protein;(source:Araport11) |
| AT1G13060 | Encodes 20S proteasome beta subunit PBE1 (PBE1). |
| AT1G13080 | cytochrome P450 monooxygenase |
| AT1G13120 | nucleoporin GLE1-like protein;(source:Araport11) |
| AT1G13130 | Cellulase (glycosyl hydrolase family 5) protein;(source:Araport11) |
| AT1G13210 | Autoinhibited Ca2+/ATPase II. ALA11 acts redundantly with ALA3, ALA4, ALA5, ALA9, ALA10 in root and shoot development as well as PIN trafficking and polarity . |
| AT1G13260 | Encodes an AP2/B3 domain transcription factor which is upregulated in response to low temperature. It contains a B3 DNA binding domain. It has circadian regulation and may function as a negative growth regulator. The mRNA is cell-to-cell mobile. |
| AT1G13300 | Encodes a nuclear localized member of the GARP family of transcription factors. Involved in nitrate/phosphate signaling in roots. It is transcriptionally regulated by nitrate and post transcriptionally by phosphate and functions to integrate these two nutrient signaling pathways in the root. HRS1 and HHO2 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance. |
| AT1G13370 | Histone superfamily protein;(source:Araport11) |
| AT1G13390 | translocase subunit seca;(source:Araport11) |
| AT1G13400 | Along with JAG, it is involved in stamen and carpel development. Expression is limited to the adaxial side of lateral organs. Activated by AGAMOUS in a cal-1, ap1-1 background. |
| AT1G13670 | hypothetical protein;(source:Araport11) |
| AT1G13810 | Restriction endonuclease, type II-like superfamily protein;(source:Araport11) |
| AT1G14030 | Encodes a lysine methyltransferase whose main soluble physiological substrates are chloroplastic fructose 1,6-bisphosphate aldolases, FBA1, FBA2, and FBA3. Lysines near the C-terminal end of the target proteins are trimethylated. |
| AT1G14040 | Encodes a PHO1 homologue that is upregulated in response to Zn deficiency and is involved in Pi homeostasis in response to Zn deficiency. The mRNA is cell-to-cell mobile. |
| AT1G14150 | Encodes a subunit of the NAD(P)H dehydrogenase complex located in the chloroplast thylakoid lumen. |
| AT1G14240 | GDA1/CD39 nucleoside phosphatase family protein;(source:Araport11) |
| AT1G14270 | CAAX amino terminal protease family protein;(source:Araport11) |
| AT1G14345 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT1G14350 | Encodes a putative MYB transcription factor involved in stomata development, loss of FLP activity results in a failure of guard mother cells (GMCs) to adopt the guard cell fate, thus they continue to divide resulting in abnormal stomata consisting of clusters of numerous guard cell-like cells. This phenotype is enhanced in double mutants with MYB88. Its transcript levels change after inducing MUTE expression in a mute background. Also regulates female reproductive development. |
| AT1G14370 | Encodes protein kinase APK2a. Protein is N-myristoylated. |
| AT1G14530 | tobamovirus multiplication-like protein (DUF1084);(source:Araport11) |
| AT1G14580 | C2H2-like zinc finger protein;(source:Araport11) |
| AT1G14600 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G14620 | decoy;(source:Araport11) |
| AT1G14710 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G14720 | member of Glycoside Hydrolase Family 16 |
| AT1G14740 | Encodes a PHD-finger protein that, with TTA1, is redundantly required for MP-dependent embryonic root meristem initiation. |
| AT1G14780 | MAC/Perforin domain-containing protein;(source:Araport11) |
| AT1G14790 | Encodes RNA-dependent RNA polymerase. While not required for virus-induced post-transcriptional gene silencing (PTGS), it can promote turnover of viral RNAs in infected plants. Nomenclature according to Xie, et al. (2004). Involved in the production of Cucumber Mosaic Virus siRNAs. |
| AT1G14850 | Encodes a protein similar to nucleoporin, a a major component of the nuclear pore complex (NPC) involved in cellular nucleo-cytoplasmic transport |
| AT1G14890 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G14920 | Similar to a putative transcription factor and transcriptional coactivators. Repressor of GA responses and involved in gibberellic acid mediated signaling. Member of the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. GAI may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. |
| AT1G14930 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G14970 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G15002 | Natural antisense transcript overlaps with AT1G15000;(source:Araport11) |
| AT1G15060 | alpha/beta hydrolase family protein;(source:Araport11) |
| AT1G15100 | Encodes a putative RING-H2 finger protein RHA2a. |
| AT1G15200 | protein-protein interaction regulator family protein;(source:Araport11) |
| AT1G15210 | pleiotropic drug resistance 7;(source:Araport11) |
| AT1G15215 | Encodes SHH1, a homeodomain protein required for DNA methylation. It is an atypical RNA-directed DNA methylation component, and functions in transcriptional silencing through both DNA methylation-dependent and -independent pathways. |
| AT1G15220 | Encodes a protein with oxidoreductase activity present in the inner membrane of mitochondria. CCMH is postulated to play a central role in mitochondrial cytochrome c maturation, probably as part of a heme lyase complex that also holds activity of reducing apocytochrome c. CCMH interacts with apocytochrome AtCYTc-a and is shown to be present in a 500 kDa-complex along with CcmFN2. |
| AT1G15230 | hypothetical protein;(source:Araport11) |
| AT1G15240 | Encodes a member of the Arabidopsis sorting nexin family. |
| AT1G15340 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT1G15360 | Encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. This gene is involved in wax biosynthesis. Over-expression of the gene results in glossy leaf phenotype and increased drought tolerance. Two closely related genes, AT5G25390 and AT5G11190 have similar phenotypes when over-expressed. Strong expression levels in flowers. Binds to the promoter of LACS2. |
| AT1G15400 | Tightly connected with MAPK signaling to fine-tune stomatal production and patterning. |
| AT1G15470 | WD40 nucleoplasmic shuttling protein that positively regulates the Abscisic acid (ABA) response by interacting with and maintaining the stability of ABI5 in the nucleus. Nuclear export of XIW1 is XPO1-dependent. Involved in regulating seed germination, primary root growth, and drought stress resistance. |
| AT1G15530 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT1G15560 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 3.8e-130 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G15670 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB1, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. |
| AT1G15800 | hypothetical protein;(source:Araport11) |
| AT1G15830 | hypothetical protein;(source:Araport11) |
| AT1G15840 | hypothetical protein;(source:Araport11) |
| AT1G15950 | Encodes a cinnamoyl CoA reductase. Involved in lignin biosynthesis. The mRNA is cell-to-cell mobile. |
| AT1G16030 | heat shock protein 70B;(source:Araport11) |
| AT1G16060 | Encodes ADAP, an AP2-domain protein that interacts with ARIA. ADAP is a positive regulator of the ABA response and is also involved in regulating seedling growth. |
| AT1G16070 | Member of TLP family |
| AT1G16110 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. It has been shown to be localized to the cell wall. |
| AT1G16280 | Encodes a putative DEAD-box RNA helicase. Essential for female gametogenesis. |
| AT1G16310 | Cation efflux family protein which affects ABA-JA crosstalk and susceptibility to Mamestra brassicae herbivory. |
| AT1G16370 | organic cation/carnitine transporter 6;(source:Araport11) |
| AT1G16380 | member of Putative Na+/H+ antiporter family |
| AT1G16410 | member of CYP79F The mRNA is cell-to-cell mobile. |
| AT1G16445 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G16500 | filamentous hemagglutinin transporter;(source:Araport11) |
| AT1G16530 | ASYMMETRIC LEAVES 2-like 9;(source:Araport11) |
| AT1G16560 | Per1-like family protein;(source:Araport11) |
| AT1G16600 | pseudogene of camelliol C synthase 1;(source:Araport11) |
| AT1G16720 | Encodes HCF173, a protein with weak similarities to the superfamily of the short-chain dehydrogenases/reductases. HCF173 is involved in the initiation of translation of the psbA mRNA and binds a specific site in the 5' UTR of psbA mRNA. Mutants shows a high chlorophyll fluorescence phenotype (hcf) and are severely affected in the accumulation of PSII subunits. The protein HCF173 is localized in the chloroplast, where it is mainly associated with the membrane system and is part of a higher molecular weight complex with psbA mRNA as a component of this complex. |
| AT1G16770 | hypothetical protein;(source:Araport11) |
| AT1G16850 | transmembrane protein;(source:Araport11) |
| AT1G16920 | small GTP-binding protein (Rab11)similar to YPT3/RAB11 proteins in yeast and mammals, respectively. YPT3/RAB11 is involved in intracellular protein trafficking. |
| AT1G16950 | transmembrane protein;(source:Araport11) |
| AT1G17040 | Encodes a protein that contains an SH2 domain. It can pull down a 120-kD tyrosine-phosphorylated protein in vitro. It is predicted to act as a transcription factor. |
| AT1G17070 | Encodes a homologue of spliceosome disassembly factor NTR1. Required for correct expression and splicing of DOG1, a regulator of seed dormancy. The mRNA is cell-to-cell mobile. |
| AT1G17130 | DUF572 domain protein involved in alternative splicing. |
| AT1G17160 | RBSK is a plastid localized ribokinase involved in nucleoside metabolism. It is the only member of this gene family in Arabidopsis. |
| AT1G17170 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). It is involved in the detoxification of the environmental pollutant 2,4,6-trinitrotoluene. Arabidopsis plants over-expressing At1g17170 were more resistant to TNT, removed more TNT from sterile and soil-based media, and had reduced levels of glutathione when grown in the presence of TNT. |
| AT1G17310 | MADS-box transcription factor family protein;(source:Araport11) |
| AT1G17380 | jasmonate-zim-domain protein 5;(source:Araport11) |
| AT1G17420 | LOX3 encode a Lipoxygenase. Lipoxygenases (LOXs) catalyze the oxygenation of fatty acids (FAs). |
| AT1G17430 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G17440 | Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. The gene product is an EIN3-interacting TFIID transcription factor required for proper ethylene response, including ERF1 induction. Loss of function mutants show enhanced response to ethylene. Located in nucleus and expressed throughout the plant. Required for ERF1 expression. Cytokinin-hypersensitive 1 (CKH1) mutants are characterized by rapidly growing calli with a green color at low levels of cytokinins, which are insufficient to induce such cytokinin responses in wild-type explants. It is hypothesized that CKH1 acts as a negative regulator of cytokinin signaling in Arabidopsis. |
| AT1G17470 | Encodes a member of the DRG (developmentally regulated G-protein) family expressed throughout the plant, with highest expression in actively growing tissues. Has GTPase activity. |
| AT1G17620 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G17745 | encodes a 3-Phosphoglycerate dehydrogenase The mRNA is cell-to-cell mobile. |
| AT1G17760 | Encodes a homolog of the mammalian protein CstF77, a polyadenylation factor subunit. RNA 3′-end?processing factor of antisense FLC transcript. Mediates silencing of the floral repressor gene FLC. Member of CstF complex. |
| AT1G17840 | Encodes a plasma membrane-localized ATP-binding cassette transporter, that is required for cutin transport to the extracellular matrix. The mRNA is cell-to-cell mobile. |
| AT1G17850 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT1G17860 | Member of Kunitz trypsin inhibitor (KTI) family involved in plant defense response against spider mites. |
| AT1G17940 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT1G17970 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G17980 | Encodes a poly(A) polymerase. Located in the nucleus. It limits founder-cell recruitment to organ primordia and suppresses the salicylic acid-independent immune response downstream of EDS1/PAD4. |
| AT1G18250 | encodes a thaumatin-like protein |
| AT1G18280 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G18300 | nudix hydrolase homolog 4;(source:Araport11) |
| AT1G18335 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT1G18350 | MAP kinase kinase7. Member of plant mitogen-activated protein kinase kinase group D. Negative regulator of polar auxin transport. Overexpression leads to activation of basal and systemic acquired resistance. |
| AT1G18382 | Natural antisense transcript overlaps with AT1G18380;(source:Araport11) |
| AT1G18400 | Encodes the brassinosteroid signaling component BEE1 (BR-ENHANCED EXPRESSION 1). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT1G18540 | Ribosomal protein L6 family protein;(source:Araport11) |
| AT1G18570 | Encodes a member of the R2R3-MYB transcription family. Involved in indole glucosinolate biosynthesis. The mRNA is cell-to-cell mobile. |
| AT1G18580 | Encodes a protein with putative galacturonosyltransferase activity.GAUT11 is required for pectin synthesis in seed coat epidermal cells and normal mucilage release. |
| AT1G18620 | Member of a small gene family in Arabidopsis. Quadruple mutants in this family display defects in cell elongation. |
| AT1G18670 | Encodes a cyclin-dependent kinase-like protein with a ser/thr protein kinase domain and an N-terminal myristoylation sequence. Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. |
| AT1G18680 | HNH endonuclease domain-containing protein;(source:Araport11) |
| AT1G18720 | Contains DUF962 domain. Localizes to ER and cam complement yeast Mpo1 dioxygenase function. Interacts with ABI1. May be involved in ER stress response. |
| AT1G18760 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
| AT1G18835 | Encodes a small zinc finger protein whose overexpression induces ectopic meristem formation on leaf margins. |
| AT1G18860 | member of WRKY Transcription Factor; Group II-b |
| AT1G18890 | encodes a calcium-dependent protein kinase whose gene expression is induced by dehydration and high salt. Kinase activity could not be detected in vitro. |
| AT1G19000 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G19010 | hypothetical protein;(source:Araport11) |
| AT1G19030 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G13655.1);(source:TAIR10) |
| AT1G19110 | inter-alpha-trypsin inhibitor heavy chain-like protein;(source:Araport11) |
| AT1G19170 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G19190 | Controls leaf stomatal aperture by regulating abscisic acid transport. |
| AT1G19210 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT1G19220 | Encodes an auxin response factor that contains the conserved VP1-B3 DNA-binding domain at its N-terminus and the Aux/IAA-like domains III and IV present in most ARFs at its C-terminus. The protein interacts with IAA1 (yeast two hybrid) and other auxin response elements such as ER7 and ER9 (yeast one hybrid). ARF19 protein can complement many aspects of the arf7 mutant phenotype and , together with ARF7, is involved in the response to ethylene. In the arf7 arf19 double mutant, several auxin-responsive genes (e.g. IAA5, LBD16, LBD29 and LBD33) are no longer upregulated by auxin. |
| AT1G19230 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
| AT1G19330 | Evening-expressed key component of Sin3-HDAC complex, which bind directly to the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and PSEUDO-RESPONSE REGULATOR 9 (PRR9) promoters and catalyze histone 3 (H3) deacetylation at the cognate regions to repress expression, allowing the declining phase of their expression at dusk. |
| AT1G19480 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G19485 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G19540 | NmrA-like negative transcriptional regulator family protein;(source:Araport11) |
| AT1G19610 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT1G19620 | transmembrane protein;(source:Araport11) |
| AT1G19670 | Chlorophyllase is the first enzyme involved in chlorophyll degradation. It catalyzes the hydrolysis of the ester bond to yield chlorophyllide and phytol. AtCLH1 lacks a typical signal sequence for the chloroplast. Its expression is induced rapidly by methyljasmonate, a known promoter of senescence and chlorophyll degradation. |
| AT1G19790 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
| AT1G19850 | Encodes a transcription factor (IAA24) mediating embryo axis formation and vascular development. Similar to AUXIN RESPONSIVE FACTOR 1 (ARF1) shown to bind to auxin responsive elements (AREs), and to the maize transcriptional activator VIVIPAROUS 1( VP1). In situ hybridization shows expression in provascular tissue of embryos, the emerging shoot primordia, then is restricted to provascular tissue, and in the root central vascular cylinder. |
| AT1G19860 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G19880 | Encodes a regulator of chromatin condensation 1 (RCC1) family protein; confers plasticity of rosette diameter in response to changes in N availability. |
| AT1G19890 | histone 3.3, male-gamete-specific expression. Direct target promoter of the male germline-specific transcription factor DUO1. |
| AT1G19950 | HVA22-like protein H (ATHVA22H);(source:Araport11) |
| AT1G19970 | ER lumen protein retaining receptor family protein;(source:Araport11) |
| AT1G20030 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT1G20190 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT1G20240 | SWI-SNF-related chromatin binding protein;(source:Araport11) |
| AT1G20310 | syringolide-induced protein;(source:Araport11) |
| AT1G20330 | Encodes a sterol-C24-methyltransferases involved in sterol biosynthesis. Mutants display altered sterol composition, serrated petals and sepals and altered cotyledon vascular patterning as well as ectopic endoreduplication. This suggests that suppression of endoreduplication is important for petal morphogenesis and that normal sterol composition is required for this suppression. |
| AT1G20350 | mitochondrial inner membrane translocase |
| AT1G20380 | Putative prolyl oligopeptidase, associated with quantitive disease resistance to S. sclerotiorum. |
| AT1G20390 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.5e-251 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT1G20460 | NADH-ubiquinone oxidoreductase chain;(source:Araport11) |
| AT1G20480 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G20510 | OPC-8:0 CoA ligase1;(source:Araport11) |
| AT1G20520 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT1G20530 | girdin (DUF630 and DUF632);(source:Araport11) |
| AT1G20620 | Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen. The mRNA is cell-to-cell mobile. |
| AT1G20630 | Catalyzes the reduction of hydrogen peroxide using heme group as cofactor. Protects cells from toxicity by H2O2. |
| AT1G20650 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G20730 | Protein of unknown function (DUF833).Maternally expressed in some lineages. |
| AT1G20740 | transport/golgi organization-like protein (DUF833);(source:Araport11) |
| AT1G20750 | RAD3-like DNA-binding helicase protein;(source:Araport11) |
| AT1G20790 | F-box family protein;(source:Araport11) |
| AT1G20950 | Phosphofructokinase family protein;(source:Araport11) |
| AT1G21010 | PADRE proteinup-regulated after infection by S. sclerotiorun. |
| AT1G21050 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT1G21100 | O-methyltransferase family protein;(source:Araport11) |
| AT1G21130 | O-methyltransferase family protein;(source:Araport11) |
| AT1G21220 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-26 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G21240 | encodes a wall-associated kinase The mRNA is cell-to-cell mobile. |
| AT1G21290 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.7e-25 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G21300 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-15 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G21350 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G21370 | transmembrane protein;(source:Araport11) |
| AT1G21430 | Flavin-binding monooxygenase family protein;(source:Araport11) |
| AT1G21475 | hypothetical protein (DUF506);(source:Araport11) |
| AT1G21500 | hypothetical protein;(source:Araport11) |
| AT1G21525 | Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167. Virus-induced small peptide composed of 71 amino acids, which harbor a ubiquitin-interacting motif that mediates interaction with autophagy-related protein 8. Small peptide receptor functioning in the crosstalk between selective autophagy and RNA silencing. |
| AT1G21530 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G21620 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G21651 | zinc ion binding protein;(source:Araport11) |
| AT1G21670 | DPP6 amino-terminal domain protein;(source:Araport11) |
| AT1G21680 | DPP6 N-terminal domain-like protein;(source:Araport11) |
| AT1G21710 | Encodes 8-oxoguanine-DNA glycosylase. DNA repair enzyme. |
| AT1G21850 | SKU5 similar 8;(source:Araport11) |
| AT1G21870 | Encodes a Golgi-localized nucleotide-sugar transporter. |
| AT1G21973 | Encodes a Plant thionin family protein [pseudogene] |
| AT1G22110 | structural constituent of ribosome;(source:Araport11) |
| AT1G22140 | zinc finger CCCH domain protein;(source:Araport11) |
| AT1G22190 | The gene encodes a putative transcription factor belongings to the abiotic stress-associated DREB A-6 clade. The mRNA is cell-to-cell mobile. |
| AT1G22230 | nucleolar GTP-binding protein;(source:Araport11) |
| AT1G22350 | pseudogene of UDP-glucosyl transferase 85A5;(source:Araport11) |
| AT1G22360 | UDP-glucosyl transferase 85A2;(source:Araport11) |
| AT1G22380 | Encodes a putative UDP-glucosyl transferase. At1g22380 was initially identified as encoding the protein AAF87154, which has been classified as a bHLH protein (AtbHLH152). Subsequently it has been found that the AAF87154 protein appears to be encoded by the AT1G23970 genomic locus. |
| AT1G22460 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G22540 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G22600 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT1G22610 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT1G22640 | MYB-type transcription factor (MYB3) that represses phenylpropanoid biosynthesis gene expression |
| AT1G22650 | Plant neutral invertase family protein;(source:Araport11) |
| AT1G22680 | hypothetical protein;(source:Araport11) |
| AT1G22760 | Putative poly(A) binding protein May there fore function in posttranscriptional regulation, including mRNA turnover and translational initiation. Expression detected only in floral organs. |
| AT1G22790 | Low affinity potassium transport system protein;(source:Araport11) |
| AT1G22840 | Encodes cytochrome c. Contains two site II (TGGGCC/T) elements, which interact with a TCP-domain transcription factor, and a downstream internal telomeric repeat, and are required for expression of the Cytc-1 gene. Promoter directs preferential expression in root and shoot meristems and in anthers. Double mutants with CYTC-2 accumulate starch during the day, have delayed growth and development and reduced GA and DELLA proteins linking cellular metabolism and GA homeostasis. |
| AT1G22880 | cellulase 5;(source:Araport11) |
| AT1G22882 | Encodes a member of the mid-SUN subfamily of SUN-domain proteins that is localized to both the nuclear envelope and the ER. It is involved in early seed development and nuclear morphology. Secreted peptide which functions in plant growth and pathogen defense. |
| AT1G22900 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT1G22940 | Encodes a bifunctional enzyme required for thiamine (vitamin B1) biosynthesis. TH1 can phosphorylate HMP-P to produce HMP-PP, the pyrimidine heterocyclic subunit of thiamine. TH1 also catalyzes the condensation of HMP-PP and HET to form thiamine monophosphate (TMP). TH1 also appears capable of phosphorylating HMP based on E.coli mutant complementation assays. th1 mutants are thiamine auxotrophs that die as seedlings on unsupplemented media. |
| AT1G23000 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G23010 | Encodes a protein with multicopper oxidase activity. Located in ER. Function together with LPR2 (AT1G71040) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
| AT1G23040 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G23080 | Encodes a novel component of auxin efflux that is located apically in the basal cell and is involved during embryogenesis in setting up the apical-basal axis in the embryo. It is also involved in pattern specification during root development. In roots, it is expressed at lateral and basal membranes of provascular cells in the meristem and elongation zone, whereas in the columella cells it coincides with the PIN3 domain. Plasma membrane-localized PIN proteins mediate a saturable efflux of auxin. PINs mediate auxin efflux from mammalian and yeast cells without needing additional plant-specific factors. The action of PINs in auxin efflux is distinct from PGPs, rate-limiting, specific to auxins and sensitive to auxin transport inhibitors. PINs are directly involved of in catalyzing cellular auxin efflux. |
| AT1G23210 | glycosyl hydrolase 9B6;(source:Araport11) |
| AT1G23220 | Dynein light chain type 1 family protein;(source:Araport11) |
| AT1G23270 | hypothetical protein;(source:Araport11) |
| AT1G23290 | Encodes a ribosomal protein L27A, a constituent of the large subunit of the ribosomal complex. Regulated by TCP20. The mRNA is cell-to-cell mobile. |
| AT1G23300 | MATE efflux family protein;(source:Araport11) |
| AT1G23320 | Encodes a protein with similarity to the TAA1 trytophan aminotransferase involved in IAA biosynthesis. This gene appears to be expressed at a very low level during seedling development. Triple mutant analyses implicate this gene in embryonic development. |
| AT1G23350 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G23390 | A kelch domain-containing F-box protein. Its N terminus contains a typical F-box motif but its C-terminal domain only consists of one predicted kelch motif. Predicted to be stu Interacts with chalcone synthase CHS to mediate CHS ubiquitination and degradation. |
| AT1G23410 | cytosolic ribosomal protein gene, part of eS31 family |
| AT1G23490 | Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. A member of ARF GTPase family. Arabidopsis has 21 known members, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
| AT1G23510 | OBP32pep protein;(source:Araport11) |
| AT1G23550 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Its transcript level is up-regulated by tunicamycin (N-linked glycosylation inhibitor causing ER stress). |
| AT1G23640 | OBP32pep protein;(source:Araport11) |
| AT1G23710 | hypothetical protein (DUF1645);(source:Araport11) |
| AT1G23720 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT1G23760 | Encodes aromatic rich glycoprotein JP630. |
| AT1G23790 | dicer-like protein (DUF936);(source:Araport11) |
| AT1G23810 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT1G24010 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G24095 | Putative thiol-disulfide oxidoreductase DCC;(source:Araport11) |
| AT1G24100 | Encodes a UDP-glucose:thiohydroximate S-glucosyltransferase, involved in glucosinolate biosynthesis |
| AT1G24148 | hypothetical protein;(source:Araport11) |
| AT1G24150 | Encodes a group I formin. Localized to cell junctions. Polymerizes actin. Binds profilin. Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. FORMIN4 is a spatial feedback element in a multi-layered, temporally defined sequence of cytoskeletal response, contributing to the distribution of actin filaments at the dynamic cell wall appositions boundary and to the outcomes of pre-invasion defense. |
| AT1G24267 | bZIP transcription factor, putative (DUF1664);(source:Araport11) |
| AT1G24310 | nuclear pore complex protein;(source:Araport11) |
| AT1G24430 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G24530 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G24590 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and LEAFY PETIOLE. This gene functions in the regeneration of shoots in tissue culture, probably through transcriptional regulation of CUC1. May also be involved in activation of the cell cycle via CycD1;1. |
| AT1G24600 | hypothetical protein;(source:Araport11) |
| AT1G24764 | Member of the MAP70 protein family. |
| AT1G25275 | Thionin-like gene involved in resistance against the beet cyst nematode (Heterodera schachtii). |
| AT1G25290 | Predicted to be a plastid rhomboid protease. Mutants show defects in phosphatidic acid metabolism. |
| AT1G25300 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT1G25310 | basic helix-loop-helix (bHLH) DNA-binding family protein;(source:Araport11) |
| AT1G25370 | hypothetical protein (DUF1639);(source:Araport11) |
| AT1G25400 | transmembrane protein;(source:Araport11) |
| AT1G25410 | AB061404 Arabidopsis thaliana AtIPT6 mRNA for cytokinin synthase, complete cds |
| AT1G25440 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT1G25470 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT1G25510 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G25530 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT1G25560 | Encodes a member of the RAV transcription factor family that contains AP2 and B3 binding domains. Involved in the regulation of flowering under long days. Loss of function results in early flowering. Overexpression causes late flowering and repression of expression of FT. Novel transcriptional regulator involved in ethylene signaling. Promoter bound by EIN3. EDF1 in turn, binds to promoter elements in ethylene responsive genes. |
| AT1G26160 | Metal-dependent phosphohydrolase;(source:Araport11) |
| AT1G26200 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT1G26300 | BSD domain-containing protein;(source:Araport11) |
| AT1G26360 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco but no enzymatic activity has been identified for this protein. |
| AT1G26480 | 14-3-3 protein GF14iota (grf12) |
| AT1G26570 | UDP-glucose dehydrogenase 1;(source:Araport11) |
| AT1G26640 | Encodes a cytosolic isopentenyl phosphate kinase that plays an important role in regulating the formation of both MVA (mevalonic acid) and MEP (methylerythritol phosphate) pathway-derived terpenoid compounds by controlling the ratio of IP/DMAP to IPP/DMAPP. IPP and DMAPP are the universal C5 building blocks of all natural terpenoids. IPK enhances terpenoid formation by returning IP/DMAP to the terpenoid biosynthetic network. |
| AT1G26770 | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT1G26780 | Encodes LOF1 (LATERAL ORGAN FUSION1), a MYB-domain transcription factor expressed in organ boundaries. Functions in boundary specification, meristem initiation and maintenance, and organ patterning. Also see LOF2 (At1g69560). |
| AT1G26840 | Origin Recognition Complex subunit 6. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. It acts downstream of BRP4, and is, at least in part, involved in the BRP4-mediated mitotic cell-cycle progression. |
| AT1G26900 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G27030 | hypothetical protein;(source:Araport11) |
| AT1G27050 | Encodes a protein with a RNA recognition motif. Previously annotated as ATHB54, a homeodomain leucine zipper (HD-Zip) family protein. In the TAIR10 genome release (2010), this locus was split into two loci: AT1G27045 (containing homeodomain and leucine zipper domains) and AT1G27050 (containing a RNA recognition motif). AT1G27045 is now named ATHB54. Note that Affymetrix ATH1 Probe Set linked to symbol ATHB54 is in fact directed against the product of the AT1G27050 locus (the mRNA coding for the RNA-recognition-motif protein). |
| AT1G27080 | Encodes a protein with low-affinity nitrate transporter activity that is expressed in the vascular tissue of the funiculus and the silique. This plasma membrane-localized enzyme is predicted to have 12 transmembrane domains. Plants lacking NRT1.6 have reduced levels of nitrate in their seeds and have increased levels of early embryonic developmental defects and seed abortion. |
| AT1G27100 | Actin cross-linking protein;(source:Araport11) |
| AT1G27110 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G27120 | Encodes a Golgi-localized hydroxyproline-O-galactosyltransferase. |
| AT1G27170 | transmembrane receptors / ATP binding protein;(source:Araport11) |
| AT1G27180 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT1G27210 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G27285 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G27300 | transmembrane protein;(source:Araport11) |
| AT1G27670 | transmembrane protein;(source:Araport11) |
| AT1G27710 | Glycine-rich protein family;(source:Araport11) |
| AT1G27900 | RNA helicase family protein;(source:Araport11) |
| AT1G27930 | Arabinogalactan methylesterase,involved in arabinogalactan glucuronic acid methylation. Interacts with eIF3. |
| AT1G27990 | transmembrane protein;(source:Araport11) |
| AT1G28000 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G28010 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
| AT1G28050 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT1G28080 | RING finger protein;(source:Araport11) |
| AT1G28230 | Encodes a transporter that transports purines,cytokinins and other adenine derivatives. Expressed in the leaf hydathodes where it may be involved in re-uptake of cytokinins during guttation. |
| AT1G28240 | strawberry notch protein (DUF616);(source:Araport11) |
| AT1G28290 | Encodes an atypical arabinogalactan protein that is localized to the plasma membrange. AGP31 is highly expressed in flowers and vascular tissue and is repressed by jasmonic acid. AGP31 may play a role in vascular tissue function during defense and development. |
| AT1G28390 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G28395 | hypothetical protein;(source:Araport11) |
| AT1G28440 | HAESA-like 1;(source:Araport11) |
| AT1G28570 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT1G28685 | Natural antisense transcript overlaps with AT1G28680;(source:Araport11) |
| AT1G28760 | Encodes an orthlog of the Xenopus inner nuclear membrane (INM) protein Nemp1/TMEM194A. |
| AT1G29010 | verprolin;(source:Araport11) |
| AT1G29041 | hypothetical protein;(source:Araport11) |
| AT1G29090 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G29120 | Hydrolase-like protein family;(source:Araport11) |
| AT1G29160 | Encodes a DOF transcription factor involved in seed coat development. Regulates PRX2 and PRX25, involved in seed longevity. |
| AT1G29230 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.20), which has also been reported as a member of the CBL-interacting protein kinases (CIPK18). |
| AT1G29240 | transcription initiation factor TFIID subunit, putative (DUF688);(source:Araport11) |
| AT1G29280 | member of WRKY Transcription Factor; Group II-e The mRNA is cell-to-cell mobile. |
| AT1G29300 | intracellular protein transporter, putative (DUF641);(source:Araport11) |
| AT1G29330 | Encodes a protein similar in sequence to animal and yeast endoplasmic reticulum retention signal receptor. This protein can functionally complement the yeast homologue. Transcript is detected in flower buds, stems, root, and leaves. |
| AT1G29400 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML5 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. Among mei2-like genes, AML5 is the transcript with highest frequency of alternative splicing. Expression was detected during embryo development (heart and torpedo stage) and in vegetative and floral apices. |
| AT1G29570 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G29640 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT1G29660 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G29680 | histone acetyltransferase (DUF1264);(source:Araport11) |
| AT1G29715 | pseudogene of Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT1G29760 | Membrane protein involved in lipid droplet biogenesis primarily in pollen. The interaction motif on SEIPIN2 for VAP27-1 is restricted to the N-terminal 30 amino acids that contain an FFAT motif. |
| AT1G29790 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G29850 | Encodes a protein that by its interaction with HAM acetyltransferases plays an important role during DNA damage responses induced by UV-B radiation and participates in programmed cell death programs. |
| AT1G29965 | cytosolic ribosomal protein gene, part of eL20 family |
| AT1G30020 | SVB family gene. |
| AT1G30080 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT1G30100 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
| AT1G30180 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.5e-115 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G30250 | hypothetical protein;(source:Araport11) |
| AT1G30280 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G30282 | Natural antisense transcript overlaps with AT1G30280;(source:Araport11) |
| AT1G30320 | Remorin family protein;(source:Araport11) |
| AT1G30330 | Encodes a member of the auxin response factor family. Mediates auxin response via expression of auxin regulated genes. Acts redundantly with ARF8 to control stamen elongation and flower maturation. Expression of ARF6 is controlled by miR167. |
| AT1G30340 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G30350 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G30370 | Encodes a mitochondria-localized class III phospholipase A1 that plays a role in seed viability. |
| AT1G30410 | member of MRP subfamily |
| AT1G30510 | Encodes a root-type ferredoxin:NADP(H) oxidoreductase. |
| AT1G30530 | The At1g30530 gene encodes a UDP-rhamnose:flavonol-3-O-rhamnosyltransferase (UGT78D1) attaching a rhamnosyl residue to the 3-O-position of the flavonols kaempferol and quercetin |
| AT1G30540 | Actin-like ATPase superfamily protein;(source:Araport11) |
| AT1G30600 | Subtilase family protein;(source:Araport11) |
| AT1G30610 | Pentatricopeptide repeat protein .Mutations in this locus result in embryo lethality due to defects in chloroplast development. Embryo shape at seed maturity is globular. |
| AT1G30660 | A truncated version of Twinkle that retains only the DNA primase domain. |
| AT1G30670 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G30680 | Twinkle is a dual localized (mitochondria and chloroplast) DNA primase-helicase. It synthesizes RNA primers from a 5′ -(G/C)GGA-3′ template, where the last two 3' nucleotides are cryptic. Mitochondrial protein involved in DNA replication which binds to DNA polymerases, Pol1A and Pol1B. |
| AT1G30710 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G30740 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G30795 | Glycine-rich protein family;(source:Araport11) |
| AT1G30800 | Fasciclin-like arabinogalactan family protein;(source:Araport11) |
| AT1G30825 | Involved in trichome maturation. mutant displays enlarged trichomes |
| AT1G30840 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G30860 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G30890 | Integral membrane HRF1 family protein;(source:Araport11) |
| AT1G30900 | VACUOLAR SORTING RECEPTOR 6;(source:Araport11) |
| AT1G30930 | F-box family protein;(source:Araport11) |
| AT1G31120 | potassium transporter |
| AT1G31140 | Encodes a B-sister MADS-box protein, GORDITA which is specific to the Brassicaceae. GOA is the most closely related paralog of ABS. GOA represses fruit growth and contributes to integument development. Over-expression of GOA results in disorganized floral structure and addition of carpel-like features to sepals. |
| AT1G31170 | encodes a cysteine-sulfinic acid reductase (sulfiredoxin - EC 1.8.98.2) capable of reducing overoxidized plastidic 2-Cys-Prx involved in peroxide detoxification and response to oxidative stress |
| AT1G31230 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
| AT1G31240 | Bromodomain transcription factor;(source:Araport11) |
| AT1G31280 | Encodes Argonaute gene that binds viral siRNAs and is involved in antiviral defense response. Regulates innate immunity.Mutants have increased susceptibility to Potato virus X and tobacco rattle virus. |
| AT1G31320 | LOB domain-containing protein 4;(source:Araport11) |
| AT1G31330 | Encodes subunit F of photosystem I. |
| AT1G31350 | KAR-UP F-box 1;(source:Araport11) |
| AT1G31410 | putrescine-binding periplasmic protein-like protein;(source:Araport11) |
| AT1G31480 | encodes a novel protein that may be part of a gene family represented by bovine phosphatidic acid-preferring phospholipase A1 (PA-PLA1)containing a putative transmembrane domain. SGR2 is involved in the formation and function of the vacuole. |
| AT1G31550 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G31670 | Copper amine oxidase family protein;(source:Araport11) |
| AT1G31710 | Copper amine oxidase family protein;(source:Araport11) |
| AT1G31720 | chitin synthase, putative (DUF1218);(source:Araport11) |
| AT1G31760 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
| AT1G31780 | Encodes a component of the oligomeric Golgi (COG) complex. Found in pollen golgi apparatus. Loss of function results in defects in pollen tube growth resulting in lack of transmission through the pollen. |
| AT1G31960 | hypothetical protein;(source:Araport11) |
| AT1G32080 | Encodes a plant LrgAB/CidAB protein localized to the chloroplast envelope that is involved in chloroplast development, carbon partitioning, ABA/drought response, and leaf senescence. The gene may have evolved from gene fusion of bacterial lrgA and lrgB. |
| AT1G32150 | Encodes a G group bZIP transcription factor family member that can bind cis elements with an ACGT core, such as G-box, Hex, C-box and As-1. The protein is localized in the nucleus and can homodimerize and can heterodimerize with other G group members. |
| AT1G32180 | encodes a gene similar to cellulose synthase |
| AT1G32230 | Encodes a protein belonging to the (ADP-ribosyl)transferase domain-containing subfamily of WWE protein-protein interaction domain protein family. Superoxide radicals are necessary and sufficient to propagate cell death or lesion formation in rcd1 mutants. Without stress treatment, RCD1 is localized in the nucleus. Under high salt or oxidative stress, RCD1 is found not only in the nucleus but also in the cytoplasm. The mRNA is cell-to-cell mobile. |
| AT1G32240 | Encodes a member of the KANADI family of putative transcription factors. Together with KAN1, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN1 and KAN4 appears to regulate the proper localization of PIN1 in early embryogenesis. |
| AT1G32320 | member of MAP Kinase Kinase |
| AT1G32370 | Encodes a 122 amino acid basic protein involved in tobamovirus multiplication in planta. The mRNA is cell-to-cell mobile. |
| AT1G32470 | Single hybrid motif superfamily protein;(source:Araport11) |
| AT1G32570 | hypothetical protein;(source:Araport11) |
| AT1G32710 | Cytochrome c oxidase, subunit Vib family protein;(source:Araport11) |
| AT1G32740 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT1G32790 | RNA-binding protein, putative, similar to RNA-binding protein GB:CAB40027 GI:4539439 from (Arabidopsis thaliana).Member of a family of PAB2 binding domain proteins. |
| AT1G32860 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT1G32880 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G33080 | MATE efflux family protein;(source:Araport11) |
| AT1G33102 | hypothetical protein;(source:Araport11) |
| AT1G33160 | pseudogene of actin 7;(source:Araport11) |
| AT1G33250 | beta-1,3-n-acetylglucosaminyltransferase radical fringe protein, putative (DUF604);(source:Araport11) |
| AT1G33290 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G33420 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT1G33520 | Has single homolog in Arabidopsis, also homologs in human, mouse and C. elegans; contains one G-patch domain (known to mediate RNA-protein interactions) and two KOW domains (may bind RNA and/or protein); localized to the nucleus; mutant suppresses high SA levels and constitutive disease resistance in snc1 npr1 background; required for basal resistance against Pseudomonas syringae maculicola ES4326 and R gene-mediated resistance specified by RPM1, PPS4 and RPP4; |
| AT1G33800 | Encodes a glucuronoxylan(GX)-specific 4-O-methyltransferase responsible for methylating GlcA residues in GX. Reduced methylation of GX ingxmt1-1 plants is correlated with altered lignin composition. The mRNA is cell-to-cell mobile. |
| AT1G33840 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT1G33960 | Identified as a gene that is induced by avirulence gene avrRpt2 and RPS2 after infection with Pseudomonas syringae pv maculicola strain ES4326 carrying avrRpt2 |
| AT1G34044 | pseudogene of 50S ribosomal protein L34;(source:Araport11) |
| AT1G34100 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
| AT1G34150 | Pseudouridine synthase family protein;(source:Araport11) |
| AT1G34245 | Encodes a secretory peptide EPF2 expressed in proliferating cells of the stomatal lineage, known as meristemoids, and in guard mother cells, the progenitors of stomata. Controls asymmetric cell divisions during stomatal development. EPF2 is related to EPF1, also involved in stomatal development. Its transcript levels change after inducing MUTE expression in a mute background. EPF2 binds to the ER receptor triggering MAPK activation that in turn inhibits stomatal development. EPF2 competes with STOMAGEN for binding to receptor protein kinases ER, and TMM. |
| AT1G34370 | Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity. Cell wall of the mutant is unstable in low pH medium (pH 4.5) in low Ca solution. This would mediate Ca-alleviation of low pH stress through pectin-Ca interaction. In vitro binding and mutated-promoter-GUS assays identified that STOP1 directly activates AtALMT1 expression through the binding to the promoter by four zinc finger domains. Binding of STOP1 to promoter is an essential step of Al-inducible AtALMT1 expression. The mRNA is cell-to-cell mobile. |
| AT1G34430 | 2-oxoacid dehydrogenases acyltransferase family protein;(source:Araport11) |
| AT1G34520 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT1G34530 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 7.8e-116 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G34545 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.0e-112 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G34575 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G34650 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT1G34750 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT1G34780 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. |
| AT1G35060 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-61 P-value blast match to Q9S9L6 /322-461 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT1G35330 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G35350 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT1G35420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G35510 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G35560 | Encodes a member of the TCP-P subfamily that is involved in flowering time control and plant development. Mutants present an early flowering phenotype. |
| AT1G35830 | VQ motif-containing protein;(source:Araport11) |
| AT1G35920 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G14450.1);(source:TAIR10) |
| AT1G36050 | Endoplasmic reticulum vesicle transporter protein;(source:Araport11) |
| AT1G36160 | Encodes acetyl-CoA carboxylase. Mutant displays uncoordinated cell divisions which are enhanced by cytokinins. Mutant also has aberrant organization of the apical region in the embryo and abnormal root and shoot development and is deficient in freezing tolerance after cold acclimation. Essential for very long chain fatty acid elongation. The mRNA is cell-to-cell mobile. |
| AT1G37130 | Identified as a mutant resistant to chlorate. Encodes nitrate reductase structural gene. Involved in nitrate assimilation. Has nitrate reductase activity. Up-regulated by the fungus P. indica. Binds transcription factor At2g35940. The mRNA is cell-to-cell mobile. |
| AT1G41830 | SKU5-similar 6;(source:Araport11) |
| AT1G42540 | member of Putative ligand-gated ion channel subunit family |
| AT1G42550 | Encodes a plant-specific protein of unknown function that appears to be conserved among angiosperms. The mRNA is cell-to-cell mobile. |
| AT1G42560 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO9 belongs to the clade III, with AtMLO5, AtMLO7, AtMLO8, and AtMLO10. The gene is expressed during early seedling growth, in cotyledon vascular system, in flowers (with strong expression in anthers) in siliques and fruit abscission zone; not expressed in roots, or in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G42990 | bZIP60 consists of a bZIP DNA binding domain followed by a putative transmembrane domain. bZIP60 mRNA is upregulated by the addition of ER stress inducers, tunicamycin (inhibitor of N-linked glycosylation), DTT (inhibitor of disulfide bond formation) and azetin-2-carboxylate (proline analog perturbing protein structure). Upon ER stress, bZIP60 mRNA is spliced by IRE1A and IRE1B to produce bZIP60-S, an active transcription factor without the transmembrane domain. bZIP60-U, a product of unspliced form of bZIP60 mRNA, is localized at the ER membrane and bZIP60-S is localized in the nucleus. |
| AT1G43000 | PLATZ transcription factor family protein;(source:Araport11) |
| AT1G43245 | SET domain-containing protein;(source:Araport11) |
| AT1G43640 | Member of TLP family of tubby like proteins that also contain an F-Box. |
| AT1G43800 | Δ9 stearoyl-ACP desaturase which together with FAB2, AAD1, and AAD5 redundantly participates in oil storage during the maturation phase. |
| AT1G44000 | STAY-GREEN-like protein;(source:Araport11) |
| AT1G44020 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G44080 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT1G44318 | Aldolase superfamily protein;(source:Araport11) |
| AT1G44446 | Encodes chlorophyllide a oxygenase which converts chlorophyllide a to chlorophyllide b by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide a . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll b and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22. |
| AT1G44760 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT1G44780 | translation initiation factor;(source:Araport11) |
| AT1G44810 | GeBP transcription factor required for Cd‐induced growth inhibition. |
| AT1G44830 | Encodes a nuclear-localized member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. Overexpression in cultured cells results in an increase in pectin deposition.ERF014 differentially regulates responses to bacterial and fungal pathogens. |
| AT1G44970 | Encodes a class III peroxidase that is genetically redundant with PRX40, expressed in the tapetum, and essential for proper anther and pollen development. Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
| AT1G45000 | AAA-type ATPase family protein;(source:Araport11) |
| AT1G45063 | copper ion binding / electron carrier protein;(source:Araport11) |
| AT1G45130 | beta-galactosidase 5;(source:Araport11) |
| AT1G45160 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G45170 | outer envelope pore 24B-like protein;(source:Araport11) |
| AT1G45201 | Target of AtGRP7 regulation. |
| AT1G45238 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT1G45474 | Encodes a component of the light harvesting complex of photosystem I. |
| AT1G45688 | CC1 is a plant specific gene that interacts with with the cellulose synthase complex and microtubules. It appears to play a role in localizing CESA to the membrane, microtuble dynamics , particularly during salt stress. |
| AT1G45976 | S-ribonuclease binding protein 1;(source:Araport11) |
| AT1G46264 | Encodes SCHIZORIZA, a member of Heat Shock Transcription Factor (Hsf) family. Functions as a nuclear factor regulating asymmetry of stem cell divisions. |
| AT1G46552 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.6e-184 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G47056 | Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB2,3, and 4. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes. |
| AT1G47265 | hypothetical protein;(source:Araport11) |
| AT1G47271 | Cystathionine beta-synthase (CBS) family protein;(source:Araport11) |
| AT1G47410 | hypothetical protein;(source:Araport11) |
| AT1G47540 | Scorpion toxin-like knottin superfamily protein;(source:Araport11) |
| AT1G47560 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
| AT1G47570 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G47600 | Encodes a myrosinase. Over-expression led to a glucosinolate profile change. |
| AT1G47610 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G47655 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
| AT1G47730 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G47760 | AGAMOUS-like 102;(source:Araport11) |
| AT1G47765 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G47790 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G47860 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-40 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G47870 | Member of the E2F transcription factors, (cell cycle genes), key components of the cyclin D/retinoblastoma/E2F pathway. AtE2Fc is regulated by a balance between gene expression and ubiquitin-proteasome proteolysis. AtE2Fc might play a role in cell division and during the transition from skotomorphogenesis to photomorphogenesis. E2Fc has been shown to interact with DPB in its nonphosphorylated form; when E2Fc is phosphorylated, the formation of the E2Fc/DPB heterodimer is lost. E2Fc is required for miR396 activity on cell proliferation under UV-B. Its role is independent of E2Fe, probably modulating DNA damage responses through the regulation of SOG1 and ATR transcript levels. |
| AT1G47880 | pseudogene of receptor like protein 6;(source:Araport11) |
| AT1G47960 | Plant cell wall (CWI) and vacuolar invertases (VI) play important roles in carbohydrate metabolism, stress responses and sugar signaling. This protein may inhibit their activity. |
| AT1G48030 | Encodes a mitochondrial lipoamide dehydrogenase whose expression is induced by light. |
| AT1G48060 | F-box/associated interaction domain protein;(source:Araport11) |
| AT1G48070 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G48100 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G48140 | Encodes a subunit of the dolichol phosphate mannase synthase (DPMS) complex that may serve as membrane anchors for the catalytic core, DPMS1, or provide catalytic assistance. It is localized in the ER and mediates isoprenyl-linked glycan biogenesis. |
| AT1G48230 | Nucleotide/sugar transporter family protein |
| AT1G48300 | Cytosolic iron-sulfur protein with a [2Fe-2S] cluster which synthesizes triacylglycerol (DGAT activity). |
| AT1G48330 | SsrA-binding protein;(source:Araport11) |
| AT1G48400 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G48550 | VPS26C is a component of a retromer complex, it is involved in endosome to lysosome protein transport and root hair growth. |
| AT1G48610 | AT hook motif-containing protein;(source:Araport11) |
| AT1G48698 | Potential natural antisense gene, locus overlaps with AT1G48700 |
| AT1G48960 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT1G48970 | NagB/RpiA/CoA transferase-like superfamily protein;(source:Araport11) |
| AT1G49000 | transmembrane protein;(source:Araport11) |
| AT1G49032 | hypothetical protein;(source:Araport11) |
| AT1G49050 | Encodes a member of the aspartyl protease family. Interacts with BAGP1 and BAG6 and appears to be required for cleavage of BAG6 as BAG6 is not cleaved in APCB1 mutant backgrounds. |
| AT1G49110 | hypothetical protein;(source:Araport11) |
| AT1G49120 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT1G49130 | Regulated by heat shock. |
| AT1G49260 | mechanosensitive ion channel-like protein;(source:Araport11) |
| AT1G49270 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G49340 | Encodes a phosphatidylinositol 4-kinase that is expressed in inflorescences and shoots. |
| AT1G49390 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G49450 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G49500 | transcription initiation factor TFIID subunit 1b-like protein;(source:Araport11) |
| AT1G49520 | SWIB complex BAF60b domain-containing protein;(source:Araport11) |
| AT1G49560 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G49620 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Binds to D type cyclins and may inhibit cell cycle. |
| AT1G49750 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G49770 | Encodes a member of the basic helix loop helix family of transcription factors. Loss of RGE1 function causes shriveled seeds that contain small embryos. The cuticle in the embryos does not develop normally, possible due to the adeherence of the endosperm to the developing embryo. RGE1 is expressed in the endosperm surrounding region which directly surrounds the developing embryo, however it exerts its effect non autonomously- in the developing embryo. Mutant seedlings are extremely sensitive to desiccation due to the abnormal cuticle. Together with ICE1, ZOU determines primary seed dormancy depth independently of their joint role in endosperm development. |
| AT1G49850 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G49890 | Together with QWRF1 redundantly modulates cortical microtubule arrangement in floral organ growth and fertility. |
| AT1G49900 | C2H2 type zinc finger transcription factor family;(source:Araport11) |
| AT1G50020 | tubulin alpha-6 chain;(source:Araport11) |
| AT1G50450 | Saccharopine dehydrogenase;(source:Araport11) |
| AT1G50610 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G50720 | Stigma-specific Stig1 family protein;(source:Araport11) |
| AT1G50870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G50880 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G50990 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
| AT1G51170 | Encodes an active AGC VIII protein kinase that interacts with the putative transcription factor ATS and regulates planar growth during integument development in the ovule. Mutants exhibit ectopic growth in filaments and petals, as well as aberrant embryogenesis. |
| AT1G51210 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G51310 | tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase;(source:Araport11) |
| AT1G51350 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G51355 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
| AT1G51460 | ABCG13 encodes a member of the ATP-binding cassette (ABC) transporter family protein. Mutants show defects in petal elongation resulting in a folded petal phenotype. |
| AT1G51500 | Encodes an ABC transporter involved in cuticular wax biosynthesis. Lines carrying recessive mutations in this locus have weakly glaucous stem surface, and relative elevated secondary alcohols and ketones. |
| AT1G51680 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. In addition to 4-coumarate, it also converts ferulate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, ferulic acid, caffeic acid and 5-OH-ferulic acid. At4CL1 was unable to use sinapic acid as substrate. |
| AT1G51700 | Encodes dof zinc finger protein (adof1). The mRNA is cell-to-cell mobile. |
| AT1G51850 | Malectin-like receptor-like kinase involved in MAMP mediated stomatal immunity. Interacts with BAK1/FLS2 signaling complex and subsequently phosphorylates and activates SLAC1. |
| AT1G51880 | root hair specific 6;(source:Araport11) |
| AT1G51980 | Insulinase (Peptidase family M16) protein;(source:Araport11) |
| AT1G52000 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G52130 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G52140 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
| AT1G52210 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-186 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G52320 | kinesin-like protein;(source:Araport11) |
| AT1G52330 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G52340 | Encodes a cytosolic short-chain dehydrogenase/reductase involved in the conversion of xanthoxin to ABA-aldehyde during ABA biosynthesis. Mutants are insensitive to sucrose and glucose. |
| AT1G52347 | None;(source:Araport11) |
| AT1G52400 | encodes a member of glycosyl hydrolase family 1, located in inducible ER bodies which were formed after wounding, required in inducible ER body formation The mRNA is cell-to-cell mobile. |
| AT1G52510 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G52560 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT1G52590 | Putative thiol-disulfide oxidoreductase DCC;(source:Araport11) |
| AT1G52710 | Rubredoxin-like superfamily protein;(source:Araport11) |
| AT1G52760 | Encodes caffeoyl shikimate esterase and is involved in lignin biosynthesis. CSE converts caffeoyl shikimate to caffiate. Loss of function mutations have reduced lignin content and collapsed vessel elements. It is also reported to function as a lysophospholipase 2 (LysoPL2) involved in tolerance to cadmium-induced oxidative stress. Binds Acyl-CoA-binding protein 2 (ACBP2). |
| AT1G52820 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G52870 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
| AT1G53010 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G53140 | Encodes DRP5A, a dynamin protein involved in cytokinesis in Arabidopsis. |
| AT1G53160 | Encodes a member of the SPL (squamosa-promoter binding protein-like)gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. Contains the SBP-box, which encodes the SBP-domain, required and sufficient for interaction with DNA. It is involved in regulation of flowering and vegetative phase change. Its temporal expression is regulated by the microRNA miR156. The target site for the microRNA is in the 3'UTR. |
| AT1G53163 | membrane-associated kinase regulator;(source:Araport11) |
| AT1G53180 | hypothetical protein;(source:Araport11) |
| AT1G53230 | Encodes a member of a recently identified plant transcription factor family that includes Teosinte branched 1, Cycloidea 1, and proliferating cell nuclear antigen (PCNA) factors, PCF1 and 2. Regulated by miR319. Involved in heterochronic regulation of leaf differentiation. |
| AT1G53240 | mMDH1 encodes a mitochrondrial malate dehydrogenase. It is expressed at higher levels than the other mitochrondrial isoform mMDH2 (At3G15020) according to transcript and proteomic analyses. |
| AT1G53280 | Encodes a homolog of animal DJ-1 superfamily protein. In the A. thaliana genome, three genes encoding close homologs of human DJ-1 were identified AT3G14990 (DJ1A), AT1G53280 (DJ1B) and AT4G34020 (DJ1C). Among the three homologs, DJ1C is essential for chloroplast development and viability. It exhibits glyoxalase activity towards glyoxal and methylglyoxal. |
| AT1G53300 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. The mRNA is cell-to-cell mobile. |
| AT1G53470 | mechanosensitive channel of small conductance-like 4;(source:Araport11) |
| AT1G53560 | Ribosomal protein L18ae family;(source:Araport11) |
| AT1G53625 | hypothetical protein;(source:Araport11) |
| AT1G53700 | The WAG1 and its homolog, WAG2 each encodes a protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT1G53820 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G53840 | encodes a pectin methylesterase |
| AT1G53940 | Encodes a lipase, has in vitro lipase activity with p-nitrophenyl acetate and p-nitrophenyl butyrate, gene expression induced by hormones, negatively regulates auxin signaling, involved in disease resistance |
| AT1G54020 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G54035 | pseudogene of epithiospecifier protein |
| AT1G54070 | Dormancy/auxin associated family protein;(source:Araport11) |
| AT1G54090 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT1G54140 | putative TATA binding protein associated factor 21kDa |
| AT1G54200 | DNA mismatch repair Msh6-like protein;(source:Araport11) |
| AT1G54210 | Autophagy protein. |
| AT1G54220 | Encodes a subunit of the mitochondrial pyruvate dehydrogenase complex. |
| AT1G54290 | Translation initiation factor SUI1 family protein;(source:Araport11) |
| AT1G54360 | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. |
| AT1G54370 | Encodes an endosomal Na(+)/H(+) antiporter: AT1G54370 (NHX5), AT1G79610 (NHX6). Double knockout nhx5 nhx6 showed reduced growth, with smaller and fewer cells and increased sensitivity to salinity. |
| AT1G54460 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
| AT1G54490 | Involved in the ethylene response. XRN4 does not appear to regulate ethylene signaling via an RNA-INDUCED SILENCING COMPLEX-based RNA silencing mechanism but acts by independent means. Endogenous suppressor of posttranscriptional gene silencing. The mRNA is cell-to-cell mobile. |
| AT1G54530 | Calcium-binding EF hand family protein;(source:Araport11) |
| AT1G54550 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G54890 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
| AT1G54960 | member of MEKK subfamily |
| AT1G55140 | Encodes one of two chloroplast Mini-RNase III-like enzymes in Arabidopsis. Double mutants display imprecise maturation of 23S rRNA and other rRNAs. |
| AT1G55190 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
| AT1G55270 | SAGL1 is a member of a small family of KELCH domain containing proteins. Loss of function mutants show increased lignin and anthocyanin production suggesting a role in regulation of phenylpropanoid biosynthesis. |
| AT1G55330 | Encodes a putative arabinogalactan-protein (AGP21). |
| AT1G55350 | Similar to maize DEK1, a gene encoding a membrane protein of the calpain gene superfamily required for aleurone cell development in the endosperm of maize grains. A key component of the embryonic L1 cell-layer specification pathway. It localizes to membranes and undergoes intramolecular autolytic cleavage events that release the calpain domain into the cytoplasm. |
| AT1G55540 | Nuclear pore complex protein;(source:Araport11) |
| AT1G55570 | SKU5 similar 12;(source:Araport11) |
| AT1G55680 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G55740 | seed imbibition 1;(source:Araport11) |
| AT1G55770 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G55810 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
| AT1G55850 | encodes a protein similar to cellulose synthase The mRNA is cell-to-cell mobile. |
| AT1G55860 | encodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis. |
| AT1G55880 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
| AT1G55890 | Ribosomal pentatricopeptide repeat protein |
| AT1G55920 | Encodes a chloroplast/cytosol localized serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. The mRNA is cell-to-cell mobile. |
| AT1G55940 | cytochrome P450 family protein;(source:Araport11) |
| AT1G55970 | HAC4 is most likely to be an expressed pseudogene that lacks HAT function. there is a single nucleotide deletion in both the HAC4 genomic and cDNA sequences relative to its homologs. The resulting frameshift within the open reading frame causes a stop codon to occur within the predicted acetyltransferase catalytic domain. |
| AT1G56020 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT1G56120 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT1G56145 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT1G56160 | Encodes a member of the R2R3 transcription factor gene family that is involved in mediating induced systemic resistance. Genetic analysis of loss of function mutants and overexpressor lines indicates MYB72 is necessary but not sufficient for ISR.Interacts in vivo with EIL3. |
| AT1G56220 | Dormancy/auxin associated family protein;(source:Araport11) |
| AT1G56540 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G56600 | GolS2 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS2 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS2 have increased tolerance to salt, chilling, and high-light stress. |
| AT1G56670 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G56710 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G57600 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT1G57750 | Encodes a CYP96A15, midchain alkane hydroxylase, involved in cuticular wax biosynthesis. |
| AT1G57790 | F-box family protein;(source:Araport11) |
| AT1G57800 | predicted to encode a protein with an N-terminal PHD domain and two RING domains surrounding an SRA domain. Attempts to isolate ORTH3/VIM5 cDNA through RT-PCR were unsuccessful and only one Arabidopsis EST is associated with this locus. A paternally expressed imprinted gene. |
| AT1G57810 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 29%25 identity and 1.1e-12 P-value to GP|21952510|gb|AAM82604.1|AF525305_2|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10) |
| AT1G57943 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G58050 | RNA helicase family protein;(source:Araport11) |
| AT1G58055 | Encodes a defensin-like (DEFL) family protein. |
| AT1G58110 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT1G58260 | member of CYP79C subfamily of cytochrome p450s. Encodes a putative xylan endohydrolase. similar to some closely linked pseudogenes. |
| AT1G58270 | ZW9 mRNA, complete cds The mRNA is cell-to-cell mobile. |
| AT1G58300 | Encodes a member (HO4) of the heme oxygenase family. |
| AT1G58380 | Ribosomal protein S5 family protein;(source:Araport11) |
| AT1G58602 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
| AT1G59500 | encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. |
| AT1G59590 | ZCF37 mRNA, complete cds The mRNA is cell-to-cell mobile. |
| AT1G59650 | Encodes CW14. |
| AT1G59770 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.2e-49 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G59870 | ATP binding cassette transporter. Localized to the plasma membrane in uninfected cells. In infected leaves, the protein concentrated at infection sites. Contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration in a salicylic acid?dependent manner. Required for mlo resistance. Has Cd transporter activity (Cd2+ extrusion pump) and contributes to heavy metal resistance. The mRNA is cell-to-cell mobile. |
| AT1G59880 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
| AT1G59900 | encodes the e1 alpha subunit of the pyruvate dehydrogenase complex (PDC) The mRNA is cell-to-cell mobile. |
| AT1G59910 | Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. |
| AT1G59950 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT1G59960 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT1G60030 | nucleobase-ascorbate transporter 7;(source:Araport11) |
| AT1G60080 | 3-5-exoribonuclease family protein;(source:Araport11) |
| AT1G60120 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.3e-38 P-value blast match to GB:226407 retrotransposon del1-46 (Gypsy_Ty3-element) (Lilium henryi);(source:TAIR10) |
| AT1G60140 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. |
| AT1G60190 | Encodes PUB19, a plant U-box armadillo repeat protein. Involved in salt inhibition of germination together with PUB18. The mRNA is cell-to-cell mobile. |
| AT1G60230 | Radical SAM superfamily protein;(source:Araport11) |
| AT1G60390 | polygalacturonase 1;(source:Araport11) |
| AT1G60450 | Predicted to encode a galactinol synthase. |
| AT1G60540 | Annotated as pseudogene of the dynamin family.Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT1G60590 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G60600 | Encodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport. |
| AT1G60783 | cyclin-dependent kinase inhibitor SMR2-like protein;(source:Araport11) |
| AT1G60790 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G60960 | Encodes a plasma membrane localized zinc/iron transporter. |
| AT1G61070 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT1G61370 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G61430 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G61460 | G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11) |
| AT1G61580 | R-protein L3 B;(source:Araport11) |
| AT1G61610 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G61660 | Encodes a transcriptional activator that regulates the expression of genes by binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT1G61790 | Encodes the OST3/6 subunit of the hetero-oligomeric plant oligosaccharyltransferase complex (OST). Also identified by GWAS as having a role in interspecific pollen tube recognition. |
| AT1G61870 | Generic translation factor involved in mitochondrial translation. |
| AT1G61890 | MATE efflux family protein;(source:Araport11) |
| AT1G61920 | transmembrane protein;(source:Araport11) |
| AT1G62050 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G62170 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT1G62190 | Kua-ubiquitin conjugating enzyme hybrid localization domain-containing protein;(source:Araport11) |
| AT1G62280 | Encodes a protein with ten predicted transmembrane helices. The SLAH1 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. Although it is not expressed in guard cells, it can complement a slac1-2 mutant suggesting that it performs a similar function. SLAH1:GFP localizes to the plasma membrane. |
| AT1G62290 | Saposin-like aspartyl protease family protein;(source:Araport11) |
| AT1G62300 | Encodes a transcription factor WRKY6. Regulates Phosphate1 (Pho1) expression in response to low phosphate (Pi) stress. |
| AT1G62320 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
| AT1G62440 | encodes a paralog of LRX1 (LEUCINE-RICH REPEAT/EXTENSIN 1) which acts synergistically with LRX1 in root hair cell morphogenesis. |
| AT1G62520 | sulfated surface-like glycoprotein;(source:Araport11) |
| AT1G62560 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
| AT1G62660 | Glycosyl hydrolases family 32 protein;(source:Araport11) |
| AT1G62770 | PMEI9 pectin methyleseterase inhibitor. Expressed in many plant tissues. |
| AT1G62790 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G62810 | Encodes COPPER AMINE OXIDASE1 (CuAO1). Contributes to abscisic acid- and polyamine-induced nitric oxide biosynthesis and abscisic acid signal transduction. |
| AT1G62870 | hypothetical protein;(source:Araport11) |
| AT1G62940 | encodes an acyl-CoA synthetase, has in vitro activity towards medium- to long-chain fatty acids and their hydroxylated derivatives. Expressed in the tapetum. Involved in pollen wall exine formation. Null mutants were devoid of pollen grains at anther maturity and were completely male sterile. |
| AT1G62970 | SDJ3 functions partially redundantly with SDJ1 and SDJ2 and interacts with SUVH1 and SUVH3 to form a SUVH-SDJ complex. The complex binds promoters with DNA methylation and mediates transcriptional activation of promoter methylated genes. |
| AT1G63010 | Encodes an SPX domain protein that transports Pi into the vacuole and is essential for phosphate homeostasis. |
| AT1G63020 | Encodes one of two alternative largest subunits of a putative plant-specific RNA polymerase IV (aka RNA polymerase D). Required for posttranscriptional gene silencing. |
| AT1G63030 | encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (DDF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. Overexpression of this gene results in the reduction of gibberellic acid biosynthesis. This gene is expressed in all tissues examined, but most abundantly expressed in rosette leaves and stems. Overexpression of DDF1, a putative paralog of this gene, also reduces gibberellic acid biosynthesis and makes the plants more tolerant to high-salinity levels. |
| AT1G63120 | AtRBL2 has been identified as a rhomboid protein involved in regulated intramembrane proteolysis (RIP). The enzyme has the proteolytic activity and substrate specificity comparable to the Drosophila Rho-1 protein. |
| AT1G63170 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
| AT1G63205 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT1G63420 | O-glucosyltransferase-like protein (DUF821);(source:Araport11) |
| AT1G63590 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT1G63650 | Mutant has reduced trichomes, anthocyanin, and seed coat mucilage and abnormally patterned stomates. Mutants are defective in jasmonate-induced anthocyanin accumulation. Encodes a bHLH Transcription Factor 1. The protein is functionally redundant with GL3 and TT8 and interacts with TTG1, the myb proteins GL1, PAP1 and 2, CPC and TRY, and it will form heterodimers with GL3. Expression in N (non-hair cell forming) cell layers is negatively regulated by WER. Expression in H cells (hair cell forming) is promoted by CPC/TRY. |
| AT1G63690 | SIGNAL PEPTIDE PEPTIDASE-LIKE 2;(source:Araport11) |
| AT1G63710 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at highest level in mature stems and flowers. |
| AT1G63810 | nucleolar protein;(source:Araport11) |
| AT1G63910 | member of MYB3R- and R2R3- type MYB- encoding genes |
| AT1G63930 | EXO70 interactor and presumed negative secretion regulator. |
| AT1G63940 | monodehydroascorbate reductase 6;(source:Araport11) |
| AT1G63990 | Encodes AtSPO11-2, one of the three Arabidopsis homologues of the archaeal DNA topoisomerase VIA subunit (topo VIA). Required for meiotic recombination. Plants homozygous for atspo11-2 exhibit a severe sterility phenotype. Both male and female meiosis are severely disrupted in the atspo11-2 mutant, and this is associated with severe defects in synapsis during the first meiotic division and reduced meiotic recombination. AtSPO11-1 and AtSPO11-2 have overlapping functions (i.e. both required for meiotic recombination) whereas AtSPO11-3 functions in DNA replication. Required for double-strand break induction. |
| AT1G64020 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT1G64065 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G64070 | Encodes a TIR-NBS-LRR class of disease resistance protein effective against Leptosphaeria maculans. |
| AT1G64080 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT1G64090 | Reticulan like protein B3;(source:Araport11) |
| AT1G64140 | WRKY transcription factor;(source:Araport11) |
| AT1G64160 | Encodes a dirigent protein involved in the synthesis of (-)pinoresinol. Dirigent proteins impart stereoselectivity on the phenoxy radical coupling reaction yielding optically active lignans from two molecules of coniferyl alcohol. |
| AT1G64170 | member of Putative Na+/H+ antiporter family |
| AT1G64270 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.0e-06 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT1G64280 | This gene is a key regulator of the salicylic acid (SA)-mediated systemic acquired resistance (SAR) pathway. It is similar to the transcription factor inhibitor I kappa B, and contains ankyrin repeats. It confers resistance to the pathogens Pseudomonas syringae and Peronospora parasitica in a dosage-dependent fashion. Although transgenic Arabidopsis plants overexpressing NPR1 acquire enhanced sensitivity to SA and (benzothiadiazole) BTH, they display no obvious detrimental morphological changes and do not have elevated pathogenesis-related gene expression until activated by inducers or pathogens. |
| AT1G64350 | seh1-like protein |
| AT1G64380 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT1G64390 | glycosyl hydrolase 9C2;(source:Araport11) |
| AT1G64450 | Glycine-rich protein family;(source:Araport11) |
| AT1G64500 | A member of a protein family found in plants and animals that contain conserved C-terminal glutaredoxin-like and putative zinc-binding cysteine-rich domains. It is involved in light stimulated actin bundling and chloroplast movement. The mRNA is cell-to-cell mobile. |
| AT1G64540 | F-box/FBD-like domains containing protein;(source:Araport11) |
| AT1G64572 | other_RNA;(source:Araport11) |
| AT1G64590 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G64610 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G64625 | Encodes a plant-specific basic helix-loop-helix (bHLH) protein that is required for normal meiotic entry and the establishment of meiotic synchrony. It plays a role in xylem differentiation downstream of auxin. |
| AT1G64660 | Encodes a functional methionine gamma-lyase, a cytosolic enzyme catalyzes the degradation of methionine into methanethiol, alpha-ketobutyrate and ammonia. The catabolism of excess methionine is important to methionine homeostasis. The mRNA is cell-to-cell mobile. |
| AT1G64780 | encodes an ammonium transporter protein believed to act as a high affinity transporter. It is expressed in the root, primarily in endodermal and cortical cells, and contributes to ammonium uptake in the root. |
| AT1G64900 | Encodes cytochrome P450 (CYP89A2). The mRNA is cell-to-cell mobile. |
| AT1G64960 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G65000 | F-box only protein;(source:Araport11) |
| AT1G65020 | plasma protein;(source:Araport11) |
| AT1G65060 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. mRNA levels are not induced in response to wounding or to fungal infection by P. parasitica. mRNA is expressed in flowers, to a lesser degree in mature leaves and siliques and marginally in seedling roots and bolting stems of mature plants. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, ferulic acid, cinnamic acid and 5-OH-ferulic acid. At4CL3 was unable to use sinapic acid as substrate. |
| AT1G65070 | DNA mismatch repair protein MutS, type 2;(source:Araport11) |
| AT1G65130 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT1G65330 | Type I MADS-box protein, regulated by MEA and FIE, expressed transiently after fertilization in embryo and endosperm. |
| AT1G65340 | member of CYP96A |
| AT1G65365 | pseudogene of WALL ASSOCIATED KINASE (WAK)-LIKE 10;(source:Araport11) |
| AT1G65385 | pseudogene of serpin 3;(source:Araport11) |
| AT1G65390 | Phloem Protein2 family gene encoding a two-domain protein containing predicted lectin and Toll/Interleukin-1 receptor domains, which is induced upon spider mite attack and improves the ability to defend against T. urticae by participating in the tight regulation of hormonal cross talk upon mite feeding. |
| AT1G65470 | Chromatin Assembly Factor-1 (CAF-1) p150 subunit. Mutants have reduced heterochromatin content. In Arabidopsis, the three CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1, respectively. Mutations in FAS1 or FAS2 lead to increased frequency of homologous recombination and T-DNA integration in Arabidopsis. |
| AT1G65510 | Secreted peptide which functions in plant growth and pathogen defense. |
| AT1G65590 | Encodes a protein with beta-hexosaminidase activity. Located on the plasma membrane. |
| AT1G65610 | Six-hairpin glycosidases superfamily protein;(source:Araport11) |
| AT1G65630 | Encodes a putative DegP protease. |
| AT1G65680 | member of BETA-EXPANSINS. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT1G65690 | Encodes NHL6 (NDR1/HIN1-like 6). Plays an important role in the abiotic stresses-induced ABA signaling and biosynthesis, particularly during seed germination and early seedling development. |
| AT1G65700 | Defines and confers the functional specificity of the LSM2-8 spliceosome core complex, which is involved in splicing through the stabilization of the U6 snRNA. Client of Hsp90, mediated by PFD4. |
| AT1G65710 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT1G65720 | transmembrane protein;(source:Araport11) |
| AT1G65730 | Arabidopsis thaliana metal-nicotianamine transporter YSL4 |
| AT1G65740 | ascorbic acid mannose pathway regulator (DUF295);(source:Araport11) |
| AT1G65760 | ascorbic acid mannose pathway regulator (DUF295);(source:Araport11) |
| AT1G65790 | An alternatively spliced gene that encodes a functional transmembrane receptor serine/threonine kinase, alternate form may not have transmembrane domain. |
| AT1G65800 | Encodes a putative receptor-like serine/threonine protein kinases that is similar to brassica self-incompatibility (S) locus. expressed in specifically in cotyledons, leaves, and sepals, in correlation with the maturation of these structures. Together with AtPUB9, it is required for auxin-mediated lateral root development under phosphate-starved conditions. The mRNA is cell-to-cell mobile. |
| AT1G65860 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates |
| AT1G65875 | pseudogene of AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G65910 | NAC domain containing protein 28;(source:Araport11) |
| AT1G66130 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G66160 | CYS, MET, PRO, and GLY protein 1;(source:Araport11) |
| AT1G66220 | Subtilase family protein;(source:Araport11) |
| AT1G66340 | Similar to prokaryote sensory transduction proteins. Contains a histidine kinase and a response regulator domain. Homodimer. Membrane component. Binds ethylene. Mutations affect ethylene binding and metabolism of other plant hormones such as auxin, cytokinins, ABA and gibberellic acid. Ethylene receptor. Has histidine kinase activity. Is regulated by RTE1. Mutations in ETR1 block ethylene stimulation of flavonol synthesis. |
| AT1G66345 | Pentatricopeptide Repeat Protein involved in splicing of nad4 intron which affects biogenesis of the respiratory complex I. |
| AT1G66350 | Negative regulator of GA responses, member of GRAS family of transcription factors. Also belongs to the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. RGL1 may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Rapidly degraded in response to GA. Involved in flower and fruit development. |
| AT1G66370 | Encodes a member of the MYB family of transcription factors. Involved in regulation of anthocyanin biosynthesis. Affects the expression of enzymes involved in later steps of anthocyanin biosynthesis. |
| AT1G66390 | Production of anthocyanin pigment 2 protein (PAP2). |
| AT1G66420 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT1G66450 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G66530 | Arginyl-tRNA synthetase, class Ic;(source:Araport11) |
| AT1G66700 | A member of the Arabidopsis SABATH methyltransferase gene family. Encodes PXMT1, a methyltransferase that methylates 1,7-paraxanthine. |
| AT1G66710 | pseudogene of S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G66725 | Encodes a microRNA that targets several SAMT family members. miR163, is highly expressed in A. thaliana diploids but down-regulated in A. thaliana autotetraploids and repressed in A. arenosa and A. suecica. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGAAGAGGACUUGGAACUUCGAU |
| AT1G66795 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGACAGAAGAUAGAGAGCAC |
| AT1G66810 | Encodes a tandem CCCH zinc finger (TZF) protein that can bind DNA and RNA, function as a transcriptional activator, and is involved in secondary wall biosynthesis. |
| AT1G66820 | glycine-rich protein;(source:Araport11) |
| AT1G66870 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT1G66960 | Terpenoid cyclases family protein;(source:Araport11) |
| AT1G67000 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G67020 | transmembrane protein;(source:Araport11) |
| AT1G67035 | homeobox Hox-B3-like protein;(source:Araport11) |
| AT1G67050 | membrane-associated kinase regulator;(source:Araport11) |
| AT1G67110 | cytochrome P450, family 735, subfamily A, polypeptide 2;(source:Araport11) |
| AT1G67120 | Represents a homolog of the yeast MDN gene, which encodes a non-ribosomal protein involved in the maturation and assembly of the 60S ribosomal subunit. In Arabidopsis, it is essential for female gametogenesis progression. |
| AT1G67160 | Member of a family of proteins containing an F-box domain at the N-terminal region and three kelch repeats at the C-terminal region. Involved in BR signaling. Co-suppressed KIB1,2,3,4 lines have a dwarf phenotype and resemble BR receptor mutants. |
| AT1G67328 | Natural antisense transcript overlaps with AT1G67330;(source:Araport11) |
| AT1G67340 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
| AT1G67400 | ELMO/CED-12 family protein;(source:Araport11) |
| AT1G67455 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G67500 | Encodes the catalytic subunit of DNA polymerase zeta.Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS). |
| AT1G67510 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G67560 | PLAT/LH2 domain-containing lipoxygenase family protein;(source:Araport11) |
| AT1G67570 | zinc finger CONSTANS-like protein (DUF3537);(source:Araport11) |
| AT1G67700 | multidrug resistance protein;(source:Araport11) |
| AT1G67770 | Similar to terminal ear1 in Zea mays. A member of mei2-like gene family; phylogenetic analysis revealed that TEL2 belongs to the third clade of mei2-like proteins (TEL clade), with conserved two N-terminal RNA recognition motifs (RRM), in addition to the C-terminal RRM, shared among all mei2-like proteins. Expression patterns were similar to TEL1, with lower expression levels in most tissues examined. |
| AT1G67775 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. It positively regulates expression of the transcription factor gene WUSCHEL-LIKE HOMEOBOX8 (WOX8), and together CLE8 and WOX8 form a signaling module that promotes seed growth and overall seed size. |
| AT1G67840 | Encodes a chloroplast sensor kinase (CSK) that shares common ancestors with cyanobacterial histidine sensor kinases. CSK is synthesised in the cytosol and imported into the chloroplast as a protein precusor. CSK is autophosphorylated and required for control of transcription of chloroplast genes by the redox state of an electron carrier connecting photosystems I and II. |
| AT1G67855 | hypothetical protein;(source:Araport11) |
| AT1G67865 | hypothetical protein;(source:Araport11) |
| AT1G67880 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G67920 | hypothetical protein;(source:Araport11) |
| AT1G67960 | POD1 is involved in pollen tube guidence and early embryo patterning. |
| AT1G68090 | Encodes a calcium-binding protein annexin (AnnAt5). Plays a vital role in pollen development via Ca2+ dependent membrane trafficking. |
| AT1G68100 | member of IAA-alanine resistance protein 1 |
| AT1G68200 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G68220 | aerobic coproporphyrinogen-III oxidase (DUF1218);(source:Araport11) |
| AT1G68370 | DnaJ-like protein with homology to coiled coils found in cytoskeleton-interacting proteins. |
| AT1G68400 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
| AT1G68440 | Transmembrane protein;(source:Araport11). Expression induced by abiotic stressors such as ABA, drought, heat, light, NaCl, osmotic stress and wounding. |
| AT1G68460 | Encodes a putative adenylate isopentenyltransferase. It catalyzes the formation of isopentenyladenosine 5'-monophosphate (iPMP) from AMP and dimethylallylpyrophosphate (DMAPP), but it has a lower Km for ADP and likely works using ADP or ATP in plants. It is involved in cytokinin biosynthesis. |
| AT1G68480 | Encodes a putative zinc finger transcription factor that is necessary for proper lateral organ shape and is sufficient to induce the proliferation of lateral organ tissue. Together with NUB, it is involved in stamen and carpel development. |
| AT1G68520 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT1G68530 | Encodes KCS6, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G68550 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT1G68560 | Encodes a bifunctional alpha-l-arabinofuranosidase/beta-d-xylosidase that belongs to family 3 of glycoside hydrolases. |
| AT1G68670 | HHO2 is a HRS1 homolog. Nitrate-inducible expression. Also induced in roots by low Pi and is likely involved in maintaining phosphate homeostasis. It is target of PHR1.Both HHO2 and HRS1 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
| AT1G68680 | SH3/FCH domain protein;(source:Araport11) |
| AT1G68740 | Encodes PHO1;H1, a member of the PHO1 family. Involved in inorganic phosphate (Pi) transport and homeostasis. Complements pho1 mutation. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
| AT1G68765 | Encodes a small protein of 77 amino acids. Loss of function mutations are defective in the process of ethylene independent floral organ abscission. Although the mutants have a normal appearing abscission zone, the floral organs do not abscisce. The peptide appears to be secreted and may function as a ligand. Arabidopsis 35S:IDA lines constitutively overexpressing IDA exhibit earlier abscission of floral organs, showing that the abscission zones are responsive to IDA soon after the opening of the flowers. In addition, ectopic abscission was observed at the bases of the pedicel, branches of the inflorescence, and cauline leaves. The silique valves also dehisced prematurely. |
| AT1G68795 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT1G68825 | ROTUNDIFOLIA like 15;(source:Araport11) |
| AT1G68840 | Rav2 is part of a complex that has been named `regulator of the (H+)-ATPase of the vacuolar and endosomal membranes' (RAVE) The mRNA is cell-to-cell mobile. |
| AT1G68845 | hypothetical protein;(source:Araport11) |
| AT1G68910 | Encodes one of the WPP domain-interacting proteins (WIT1/AT5G11390, WIT2/AT1G68910) required for RanGAP nuclear envelope association in root tip cells. Ran GTPase plays essential roles in multiple cellular processes, including nucleocytoplasmic transport, spindle formation, and postmitotic nuclear envelope reassembly. The cytoplasmic Ran GTPase activating protein RanGAP is critical to establish a functional RanGTP/RanGDP gradient across the nuclear envelope and is associated with the outer surface of the nuclear envelope in metazoan and higher plant cells. Arabidopsis thaliana RanGAP association with the root tip nuclear envelope requires a family of likely plant-specific nucleoporins combining coiled-coil and transmembrane domains (CC-TMD) and WPP domain-interacting proteins (WIPs). WIT1 and WIT2 have been identified as a second family of CC-TMD proteins, structurally similar, yet clearly distinct from the WIP family, that is required for RanGAP nuclear envelop association in root tip cells. |
| AT1G68980 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G68990 | MGP3 (male gametophyte-defective 3) belongs to a small family of nuclear-encoded Phage type RNA polymerases (RPOTs) involved in the transcription of mitochondrial genes in Arabidopsis thaliana. Mutation in MGP 3 significantly retarded pollen tube growth and caused defective embryo development. |
| AT1G69100 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G69160 | suppressor;(source:Araport11) |
| AT1G69180 | Putative transcription factor with zinc finger and helix-loop-helix domains, the later similar to HMG boxes. Involved in specifying abaxial cell fate in the carpel. Four putative LFY binding sites (CCANTG) and two potential binding sites for MADS box proteins known as CArG boxes (CC(A/T)6GG) were found in the region spanning 3.8 Kb upstream of the CRC coding region. CRC targets YABBY genes such as YUC4 in gynoecium development. |
| AT1G69252 | other_RNA;(source:Araport11) |
| AT1G69260 | ABI five binding protein;(source:Araport11) |
| AT1G69295 | Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and is predicted to bind callose. |
| AT1G69510 | cAMP-regulated phosphoprotein 19-related protein;(source:Araport11) |
| AT1G69520 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G69600 | Encodes ZFHD1, a member of the zinc finger homeodomain transcriptional factor family. Binds to the 62 bp promoter region of ERD1 (early responsive to dehydration stress 1). Expression of ZFHD1 is induced by drought, high salinity and abscisic acid. |
| AT1G69640 | Encodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth. |
| AT1G69720 | Encodes a member (HO3) of the heme oxygenase family. |
| AT1G69730 | Wall-associated kinase family protein;(source:Araport11) |
| AT1G69780 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein which is expressed during the seed-to-seedling transition, regulates some of the network nodes, and affects late seedling establishment. Knock-out mutants for athb13 showed increased primary root length as compared with wild type (Col-0) seedlings, suggesting that this transcription factor is a negative regulator of early root growth, possibly repressing cell division and/or cell elongation or the length of time cells elongate. |
| AT1G69790 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G69820 | Note that conflicting nomenclature exists in the literature: At1g69820 is named as GGT4 in Plant J. 2007 Mar 49(5):878-88; and as GGT3 in Plant Physiol. 2007 Aug 144(4):1715-32. |
| AT1G69860 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G69880 | thioredoxin H-type 8;(source:Araport11) |
| AT1G69890 | Encodes a member of a conserved DUF domain family that is induced by NO. Based on mutant phenotype may be involved in NO stress response. |
| AT1G69900 | Actin cross-linking protein;(source:Araport11) |
| AT1G69920 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G70080 | Terpene synthase. Expressed in roots and has low enzyme activity in vitro. Products include dolabellane type diterpenes. Sesterterpene synthase which produces various sesterpne backbones via type-B cyclization mechanism. |
| AT1G70140 | Encodes a group I formin. Binds to F-actin barbed ends. Has severing actin filaments activity. Binds profilin. Involved in the initiation and tip growth of root hairs through regulation of actin cytoskeleton. |
| AT1G70210 | Encodes a D-type cyclin that physically interacts with CDC2A. Its expression is upregulated early during germination. |
| AT1G70260 | Encodes an endoplasmic reticulum (ER)-localized nodulin MtN21-like transporter family protein that negatively regulates resistance against biotrophic pathogens but not the necrotrophic pathogen, B. cinerea, possibly by regulating ROS production, cell death and PR1 expression. |
| AT1G70310 | Spermidine synthase. |
| AT1G70330 | encodes an adenosine transporter that catalyze a proton-dependent adenosine transport. The mRNA is cell-to-cell mobile. |
| AT1G70340 | Member of a novel, plant specific family of microtubule associated proteins. |
| AT1G70370 | Polygalacturonase involved in cell wall modification. |
| AT1G70460 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G70530 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT1G70550 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT1G70560 | TAA1 is involved in the shade-induced production of indole-3-pyruvate (IPA), a precursor to IAA, a biologically active auxin. It is also involved in regulating many aspects of plant growth and development from embryogenesis to flower formation and plays a role in ethylene-mediated signaling. This enzyme can catalyze the formation of IPA from L-tryptophan. Though L-Trp is expected to be the preferred substrate in vivo, TAA1 also acts as an aminotransferase using L-Phe, L-Tyr, L-Leu, L-Ala, L-Met, and L-Gln. Lines carrying mutations in this gene are unaffected by auxin transporter inhibitor NPA. Double mutant analysis and exogenous auxin treatment suggest that this gene is required for auxin signaling during lateral root and root meristem development. The activity of TAA1 can be controlled by phosphorylation of residue T101, which, when phosphorylated results in loss of activity. TAA1 is a target of TMK4. |
| AT1G70610 | member of TAP subfamily |
| AT1G70620 | cyclin-like protein;(source:Araport11) |
| AT1G70640 | octicosapeptide/Phox/Bem1p (PB1) domain-containing protein;(source:Araport11) |
| AT1G70690 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT1G70780 | hypothetical protein;(source:Araport11) |
| AT1G70820 | phosphoglucomutase, putative / glucose phosphomutase;(source:Araport11) |
| AT1G70880 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G70920 | homeobox-leucine zipper protein 18;(source:Araport11) |
| AT1G70940 | A regulator of auxin efflux and involved in differential growth. PIN3 is expressed in gravity-sensing tissues, with PIN3 protein accumulating predominantly at the lateral cell surface. PIN3 localizes to the plasma membrane and to vesicles. In roots, PIN3 is expressed without pronounced polarity in tiers two and three of the columella cells, at the basal side of vascular cells, and to the lateral side of pericycle cells of the elongation zone. PIN3 overexpression inhibits root cell growth. Protein phosphorylation plays a role in regulating PIN3 trafficking to the plasma membrane. The mRNA is cell-to-cell mobile. |
| AT1G70944 | transmembrane protein;(source:Araport11) |
| AT1G70960 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G70985 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G71020 | Encodes a nuclear localized plant U-Box protein that interacts with MYC2 and regulates its stability by acting as an E3 ubiquitin ligase and polyubiquitinating MYC2. By this mechanism, it targets MYC2 for destruction thereby affecting JA signaling. |
| AT1G71040 | Encodes LPR2. Function together with LPR1 (AT1G23010) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
| AT1G71050 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G71340 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
| AT1G71380 | cellulase 3;(source:Araport11) |
| AT1G71390 | receptor like protein 11;(source:Araport11) |
| AT1G71400 | Encodes a CLAVATA2 (CLV2)-related gene. Complements the clv2 mutant when expressed under the control of the CLV2 promoter. The mRNA is cell-to-cell mobile. |
| AT1G71460 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT1G71690 | glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11) |
| AT1G71691 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G71697 | Encodes choline kinase. mRNA levels are increased in response to wounding. The mRNA is cell-to-cell mobile. |
| AT1G71865 | PyrD;(source:Araport11) |
| AT1G71870 | Metabolite transporter involved in the anthocyanin response to anthocyanin induction conditions. Affects ABA signaling and localization. |
| AT1G71880 | Sucrose transporter gene induced in response to nematodes; member of Sucrose-proton symporter family. The mRNA is cell-to-cell mobile. |
| AT1G71890 | Encodes a sucrose transporter that is expressed in the endosperm. Mutants have delayed accumulation of fatty acids and embryo maturation. |
| AT1G71950 | SPI-1 is a member of the I9 inhibitor family. It is an inhibitor of SBT4.13 subtilase. |
| AT1G71960 | Encodes a plasma membrane localized ABC transporter involved in abscisic acid transport and responses. |
| AT1G72000 | Plant neutral invertase family protein;(source:Araport11) |
| AT1G72010 | Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
| AT1G72020 | TonB-dependent heme receptor A;(source:Araport11) |
| AT1G72090 | Methylthiotransferase;(source:Araport11) |
| AT1G72100 | late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11) |
| AT1G72120 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G72140 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
| AT1G72150 | novel cell-plate-associated protein that is related in sequence to proteins involved in membrane trafficking in other eukaryotes The mRNA is cell-to-cell mobile. |
| AT1G72260 | Encodes a thionin which is a cysteine rich protein having antimicrobial properties. Thi2.1 is expressed in response to a variety of pathogens and induced by ethylene and jasmonic acid. Belongs to the plant thionin (PR-13) family with the following members: At1g66100, At5g36910, At1g72260, At2g15010, At1g12663, At1g12660. |
| AT1G72270 | Encodes IDAP1. Acts together with IDAP2 and IDM1 to regulate active DNA demethylation. |
| AT1G72290 | Encodes a Kunitz-protease inhibitor, a water-soluble chlorophyll protein involved in herbivore resistance activation. |
| AT1G72350 | MADS-box transcription factor family protein;(source:Araport11) |
| AT1G72460 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G72480 | Lung seven transmembrane receptor family protein;(source:Araport11) |
| AT1G72500 | inter alpha-trypsin inhibitor, heavy chain-like protein;(source:Araport11) |
| AT1G72520 | PLAT/LH2 domain-containing lipoxygenase family protein;(source:Araport11) |
| AT1G72530 | Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
| AT1G72580 | hypothetical protein;(source:Araport11) |
| AT1G72590 | Encodes a polyphenol reductase. |
| AT1G72650 | Arabidopsis thaliana myb family transcription factor (At1g72650) |
| AT1G72740 | Single Myb Histone (SMH) gene family member. Contains terminal acidic SANT domain. |
| AT1G72790 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G72800 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G72810 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
| AT1G72900 | Toll-Interleukin-Resistance (TIR) domain-containing protein;(source:Araport11) |
| AT1G73000 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT1G73170 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G73240 | nucleoporin protein Ndc1-Nup protein;(source:Araport11) |
| AT1G73340 | ADTO1 is required for the activation of systemic acquired resistance. |
| AT1G73350 | ankyrin repeat protein;(source:Araport11) |
| AT1G73380 | hypothetical protein;(source:Araport11) |
| AT1G73480 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G73530 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G73540 | nudix hydrolase homolog 21;(source:Araport11) |
| AT1G73560 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G73590 | Encodes an auxin efflux carrier involved in shoot and root development. It is involved in the maintenance of embryonic auxin gradients. Loss of function severely affects organ initiation, pin1 mutants are characterised by an inflorescence meristem that does not initiate any flowers, resulting in the formation of a naked inflorescence stem. PIN1 is involved in the determination of leaf shape by actively promoting development of leaf margin serrations. In roots, the protein mainly resides at the basal end of the vascular cells, but weak signals can be detected in the epidermis and the cortex. Expression levels and polarity of this auxin efflux carrier change during primordium development suggesting that cycles of auxin build-up and depletion accompany, and may direct, different stages of primordium development. PIN1 action on plant development does not strictly require function of PGP1 and PGP19 proteins. |
| AT1G73620 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT1G73640 | RAB GTPase homolog A6A;(source:Araport11) |
| AT1G73655 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT1G73680 | Encodes an alpha dioxygenase. Recombinant protein catalyzes the conversion of a wide range of fatty acids into 2(R)-hydroperoxy derivatives. |
| AT1G73750 | alpha/beta hydrolase family protein;(source:Araport11) |
| AT1G73805 | Encodes SAR Deficient 1 (SARD1), a key regulator for ICS1 (Isochorismate Synthase 1) induction and salicylic acid (SA) synthesis. |
| AT1G73810 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G73850 | DNA ligase (DUF1666);(source:Araport11) |
| AT1G73880 | UDP-glucosyl transferase 89B1;(source:Araport11) |
| AT1G73885 | AT-rich interactive domain protein;(source:Araport11) |
| AT1G73970 | obscurin-like protein;(source:Araport11) |
| AT1G73990 | Encodes a putative protease SppA (SppA). |
| AT1G74040 | Encodes an active Arabidopsis isopropylmalate synthase IPMS2. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS2 can be compensated by a second isopropylmalate synthase gene IPMS1 (At1g18500). |
| AT1G74070 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT1G74080 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB122). |
| AT1G74160 | Member of a small gene family in Arabidopsis. Quadruple mutants in this family display defects in cell elongation. |
| AT1G74190 | receptor like protein 15;(source:Araport11) |
| AT1G74220 | homeobox-like protein;(source:Araport11) |
| AT1G74250 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT1G74280 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G74290 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G74300 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G74330 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G74350 | Encodes nMAT4, a maturase factor required for nad1 pre-mRNA processing and maturation. Essential for holocomplex I biogenesis in Arabidopsis mitochondria. |
| AT1G74360 | NILR1 encodes a serine/threonine kinase involved in defense response to nematodes. |
| AT1G74380 | xyloglucan xylosyltransferase 5;(source:Araport11) |
| AT1G74430 | Encodes a putative transcription factor (MYB95). The mRNA is cell-to-cell mobile. |
| AT1G74458 | transmembrane protein;(source:Araport11) |
| AT1G74660 | Encodes MINI ZINC FINGER 1 (MIF1) which has a zinc finger domain but lacks other protein motifs normally present in transcription factors. MIF1 physically interact with a group of zinc finger-homeodomain (ZHD) transcription factors, such as ZHD5 (AT1G75240), that regulate floral architecture and leaf development. Gel mobility shift assays revealed that MIF1 blocks the DNA binding activity of ZHD5 homodimers by competitively forming MIF1-ZHD5 heterodimers. Constitutive overexpression of MIF1 caused dramatic developmental defects, seedlings were non-responsive to gibberellin (GA) for cell elongation, hypersensitive to the GA synthesis inhibitor paclobutrazol (PAC) and abscisic acid (ABA), and hyposensitive to auxin, brassinosteroid and cytokinin, but normally responsive to ethylene. |
| AT1G74670 | Gibberellin-regulated family protein;(source:Araport11) |
| AT1G74680 | Exostosin family protein;(source:Araport11) |
| AT1G74850 | Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression. PEP complex component. |
| AT1G74970 | Ribosomal protein S9, nuclear encoded component of the chloroplast ribosome |
| AT1G75030 | encodes a PR5-like protein |
| AT1G75040 | Thaumatin-like protein involved in response to pathogens. mRNA level of the PR-5 gene (At1g75040)is significantly changed after cutting the inflorescence stem indicating the existence of a network of signal transducing pathways as other stress-regulated genes (At5g01410, At3g17800, At1g29930)do not response to the treatment. The mRNA is cell-to-cell mobile. |
| AT1G75050 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT1G75090 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G75100 | Contains a J-domain at the C-terminus which is similar to the J-domain of auxilin, a clathrin-uncoating factor in cow, yeast and worm. Arabidopsis contains 6 other proteins similar to auxilin. Expressed in leaves and stems, but not in roots. Localized in the cytoplasm. Required for the chloroplast accumulation response, but not for the avoidance response. No molecular function known. Influences the composition of photosynthetic pigments, the efficiency of photosynthesis, and the CO2 uptake rate. Positive effect on water use efficiency (WUE) by reducing stomatal aperture and water vapor conductance; involved in the fine-tuning of H2O2 foliar levels, antioxidant enzymes activities and cell death after UV-C photooxidative stress. |
| AT1G75160 | DUF620 family protein (DUF620);(source:Araport11) |
| AT1G75163 | snoRNA;(source:Araport11) |
| AT1G75170 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G75210 | HAD-superfamily hydrolase, subfamily IG, 5-nucleotidase;(source:Araport11) |
| AT1G75240 | Encodes a zinc finger-homeodomain transcription factor ZHD5. Nuclear import and DNA binding of the ZHD5 transcription factor is modulated by a competitive peptide inhibitor MIF1 (AT1G74660). |
| AT1G75400 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G75410 | BEL1-like homeodomain 3 (BLH3) |
| AT1G75450 | This gene used to be called AtCKX6. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT1G75460 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
| AT1G75500 | An Arabidopsis thaliana homolog of Medicago truncatula NODULIN21 (MtN21). The gene encodes a plant-specific, predicted integral membrane protein and is a member of the Plant-Drug/Metabolite Exporter (P-DME) family (Transporter Classification number: TC 2.A.7.3) and the nodulin MtN21-like transporter family. |
| AT1G75580 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G75590 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G75600 | Histone superfamily protein;(source:Araport11) |
| AT1G75610 | pseudogene of Histone superfamily protein;(source:Araport11) |
| AT1G75620 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT1G75630 | vacuolar H+-pumping ATPase 16 kD proteolipid (ava-p) mRNA, The mRNA is cell-to-cell mobile. |
| AT1G75640 | Encodes a Leucine-Rich Repeat Receptor-Like Kinase MUSTACHES (MUS). Regulates stomatal bilateral symmetry. |
| AT1G75660 | Encodes a protein with similarity to yeast 5'-3'exonucleases and can functionally complement the yeast mutations. In Arabidopsis XRN3 acts as a suppressor of posttranscriptional gene silencing. Mutants accumulate excised miRNA products suggesting that XRN3 is involved in degradation of these products. |
| AT1G75710 | C2H2-like zinc finger protein;(source:Araport11) |
| AT1G75750 | GA-responsive GAST1 protein homolog regulated by BR and GA antagonistically. Possibly involved in cell elongation based on expression data The mRNA is cell-to-cell mobile. |
| AT1G75790 | SKU5 similar 18;(source:Araport11) |
| AT1G75810 | transmembrane protein;(source:Araport11) |
| AT1G75820 | Putative receptor kinase with an extracellular leucine-rich domain. Controls shoot and floral meristem size, and contributes to establish and maintain floral meristem identity. Negatively regulated by KAPP (kinase-associated protein phosphatase). CLV3 peptide binds directly CLV1 ectodomain. |
| AT1G75840 | Belongs to the plant-specific ROP group of Rho GTPases; localized to the plasma membrane of tips of root hairs; involved in polar growth control. The mRNA is cell-to-cell mobile. |
| AT1G75870 | hypothetical protein;(source:Araport11) |
| AT1G75970 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
| AT1G75990 | PAM domain (PCI/PINT associated module) protein;(source:Araport11) |
| AT1G76020 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G76070 | hypothetical protein;(source:Araport11) |
| AT1G76100 | One of two Arabidopsis plastocyanin genes. Expressed at 1/10th level of PETE2. Does not respond to increased copper levels and is thought to be the isoform that participates in electron transport under copper-limiting conditions. Mutation of this gene does not have obvious effect on photosynthesis. |
| AT1G76120 | Pseudouridine synthase family protein;(source:Araport11) |
| AT1G76140 | Putative prolyl oligopeptidase. |
| AT1G76160 | SKU5 similar 5;(source:Araport11) |
| AT1G76240 | DUF241 domain protein (DUF241);(source:Araport11) |
| AT1G76250 | transmembrane protein;(source:Araport11) |
| AT1G76290 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G76300 | snRNP core protein SMD3;(source:Araport11) |
| AT1G76340 | Encodes a nucleotide-sugar transporter. It is is likely the primary Golgi GDP-L-galactose transporter, and provides GDP-L-galactose for RG-II biosynthesis. Knockout lines are lethal. RNAi suppressor lines were used for analysis. GDP-L-Galactose transport was affected. This process was required for pectic RG-II biosynthesis. |
| AT1G76360 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G76380 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
| AT1G76430 | Encodes Pht1;9, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT1G76490 | Encodes a 3-hydroxy-3-methylglutaryl coenzyme A reductase, which is involved in melavonate biosynthesis and performs the first committed step in isoprenoid biosynthesis. Expression is activated in dark in leaf tissue but not controlled by light in the root (confine The mRNA is cell-to-cell mobile. |
| AT1G76500 | Encodes an AT hook domain containing protein. Identified in a screen of activation tagged lines that suppress the long-hypocotyl phenotype of a weak phyB allele. Affects cell elongation in the hypocotyl and leaves.Acts redundantly with ESC to modulate hypocotyl growth inhibition in response to light |
| AT1G76560 | CP12 domain-containing protein 3;(source:Araport11) |
| AT1G76690 | Encodes one of the closely related 12-oxophytodienoic acid reductases. This enzyme is not expected to participate in jasmonic acid biosynthesis because during in vitro assays, it shows very little activity with the naturally occurring OPDA isomer. Shows activity towards 2,4,6-trinitrotoluene. Expressed predominately in root. Predicted to be a cytosolic protein. |
| AT1G76720 | eukaryotic translation initiation factor 2 (eIF-2) family protein;(source:Araport11) |
| AT1G76880 | DF1 is a putative transcription factor required for the synthesis of seed mucilage polysaccharides. The df1 seeds produce almost 50% less mucilage than wild-type, but show less severe defects than the myb5 and ttg2 mutants. |
| AT1G76920 | F-box family protein;(source:Araport11) |
| AT1G76955 | Expressed protein;(source:Araport11) |
| AT1G77080 | MADS domain protein - flowering regulator that is closely related to FLC. Deletion of this locus in Nd ecotype is correlated with earlier flowering in short days suggesting function as a negative regulator of flowering. |
| AT1G77090 | thylakoid lumenal protein (Mog1/PsbP/DUF1795-like photosystem II reaction center PsbP family protein);(source:Araport11) |
| AT1G77110 | Rate-limiting factor in saturable efflux of auxins. PINs are directly involved of in catalyzing cellular auxin efflux. |
| AT1G77120 | Catalyzes the reduction of acetaldehyde using NADH as reductant. Requires zinc for activity. Dimer. Anaerobic response polypeptide (ANP). Fermentation. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. The mRNA is cell-to-cell mobile. |
| AT1G77200 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT1G77260 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G77280 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT1G77300 | Encodes a protein with histone lysine N-methyltransferase activity required specifically for the trimethylation of H3-K4 in FLC chromatin (and not in H3-K36 dimethylation). Acts as an inhibitor of flowering specifically involved in the autonomous promotion pathway. EFS also regulates the expression of genes involved in carotenoid biosynthesis and nitrogen assimilation.Modification of histone methylation at the CRTISO locus reduces transcript levels 90%. The increased shoot branching seen in some EFS mutants is likely due to the carotenoid biosynthesis defect having an effect on stringolactones.Required for ovule, embryo sac, anther and pollen development. |
| AT1G77370 | Glutaredoxin family protein;(source:Araport11) |
| AT1G77380 | Amino acid permease which transports basic amino acids. |
| AT1G77405 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G77410 | beta-galactosidase 16;(source:Araport11) |
| AT1G77450 | NAC domain transcriptional regulator that is induced by ROS in roots where it regulates the expression of downstream genes such as MYB30. |
| AT1G77490 | Encodes a chloroplastic thylakoid ascorbate peroxidase tAPX. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
| AT1G77520 | O-methyltransferase family protein;(source:Araport11) |
| AT1G77640 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT1G77710 | ubiquitin-fold modifier;(source:Araport11) |
| AT1G77720 | Encodes a predicted protein kinase based on sequence similarity. |
| AT1G77740 | Encodes PIP5K2, a phosphatidylinositol-4-phosphate 5-kinase (PtdIns(4)P 5-kinase 2; or PIP5K2 that is involved in regulating lateral root formation and root gravity response. The mRNA is cell-to-cell mobile. |
| AT1G77760 | Encodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. Similar to molybdopterin oxidoreductases at the N-terminus, and to FAD/NAD-binding cytochrome reductases at the C-terminus. Cofactors: FAD, heme iron (cytochrome B-557), and molybdenum-pterin. |
| AT1G77770 | forkhead box protein, putative (DUF1644);(source:Araport11) |
| AT1G77780 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT1G77790 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT1G77820 | transposable_element_gene;(source:Araport11);pseudogene, endonuclease/exonuclease/phosphatase family protein, contains similarity to reverse transcriptase GI:976278 from (Arabidopsis thaliana);(source:TAIR10) |
| AT1G77890 | One of a pair of paralogs (the other is AT4G08540)that is a subunit of the lass III phosphatidylinositol 3-kinase (PI3K) complex but is not essential for PI3P biosynthesis. |
| AT1G78030 | hypothetical protein;(source:Araport11) |
| AT1G78040 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT1G78100 | F-box family protein;(source:Araport11) |
| AT1G78120 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT1G78140 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G78240 | Encodes TSD2 (TUMOROUS SHOOT DEVELOPMENT2), a putative methyltransferase with an essential role in cell adhesion, anthocyanin accumulation, and coordinated plant development. |
| AT1G78280 | transferases, transferring glycosyl groups;(source:Araport11) |
| AT1G78310 | VQ motif-containing protein;(source:Araport11) |
| AT1G78390 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
| AT1G78400 | PGX2 is a cell wall protein that codes for a polygalacturonase. |
| AT1G78420 | Activates the latent peptidases DA1, DAR1 and DAR2 by mono-ubiquitination at multiple sites. Subsequently, these activated peptidases destabilize various positive regulators of growth. |
| AT1G78440 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins. |
| AT1G78450 | SOUL heme-binding family protein;(source:Araport11) |
| AT1G78520 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT1G78620 | integral membrane protein (Protein of unknown function DUF92, transmembrane);(source:Araport11) |
| AT1G78650 | Similar to DNA polymerase delta (POLD3), which in other organism was shown to be involved in the elongation of DNA replication. |
| AT1G78700 | BES1/BZR1 homolog 4;(source:Araport11) |
| AT1G78770 | anaphase promoting complex 6;(source:Araport11) |
| AT1G78790 | Encodes a protein with high similarity to mammalian MHF2 that acts in the same pathway as FANCM to restrain class II meiotic crossing over. |
| AT1G78820 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11) |
| AT1G78850 | curculin-like (mannose-binding) lectin family protein, low similarity to ser/thr protein kinase from Zea mays (GI:2598067); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein. Belongs to GNA domain lectin family. Enhances PAP26 function to facilitate Pi-scavenging by Pi-starved plants. |
| AT1G78860 | curculin-like (mannose-binding) lectin family protein, low similarity to Ser/Thr protein kinase (Zea mays) GI:2598067; contains Pfam profile PF01453: Lectin (probable mannose binding) but not the protein kinase domain of the Z. mays protein |
| AT1G78910 | Pseudouridine synthase family protein;(source:Araport11) |
| AT1G78915 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G78940 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT1G78950 | Terpenoid cyclases family protein;(source:Araport11) |
| AT1G78970 | Lupeol synthase. Converts oxidosqualene to multiple triterpene alcohols and a triterpene diols. This conversion proceeds through the formation of a 17β-dammarenyl cation. |
| AT1G78990 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G78995 | hypothetical protein;(source:Araport11) |
| AT1G79080 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G79245 | pseudogene of Winged helix-turn-helix transcription repressor DNA-binding protein;(source:Araport11) |
| AT1G79400 | member of Putative Na+/H+ antiporter family |
| AT1G79410 | organic cation/carnitine transporter5;(source:Araport11) |
| AT1G79420 | C-type mannose receptor (DUF620);(source:Araport11) |
| AT1G79590 | Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. |
| AT1G79610 | Encodes an endosomal Na(+)/H(+) antiporter: AT1G54370 (NHX5), AT1G79610 (NHX6). Double knockout nhx5 nhx6 showed reduced growth, with smaller and fewer cells and increased sensitivity to salinity. |
| AT1G79640 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G79680 | Encodes a twin-domain, kinase-GC signaling molecule that may function in biotic stress responses that is critically dependent on the second messenger cGMP. |
| AT1G79690 | Encodes a dual activity enzyme which catalyses the hydrolysis of a peptide bond and of a phosphate bond, acting both as a dipeptidyl peptidase III and an atypical Nudix hydrolase. |
| AT1G79700 | WRI4 encodes an AP2/ERF-type transcriptional activator that specifically controls cuticular wax biosynthesis in Arabidopsis stems. It also functions to activate transcription of genes involved fatty acid biosynthesis during seed and flower development as well as stem wax biosynthesis. Targets identified by ChIP-seq include: LACS1, KCR1, PAS2, ECR, and WSD1. |
| AT1G79730 | Encodes a PAF1 homolog that is involved in the control of flowering time by elevating FLC expression to a level that creates the vernalization-responsive, winter-annual habit. Yeast PAF1 is a component of a five-member complex that associates with RNA pol II and is thought to regulate gene expression by recruiting SET1 (a histone 3 Lys 4 [H3-K4] methyl transferase) to the initially transcribed [5'] regions of target chromatin. Mutants display reduced H3-K4 methylation in both FLC and FLM chromatin. Member of PAF-C complex. |
| AT1G79790 | Encodes a chloroplast-localized FMN hydrolase that whose phosphatase activity is FMN-specific. |
| AT1G79820 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G79830 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC5 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (139 aa) portion of the protein. The C-terminal portion of the protein can also specifically interact with two members of the Rab family of GTPases (RabH1b and RabH1c). |
| AT1G79960 | ovate family protein 14;(source:Araport11) |
| AT1G80060 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT1G80080 | Encodes a transmembrane leucine-repeat containing receptor-like protein that is expressed in proliferative postprotodermal cells. Recessive mutation leads to disruption of asymmetric cell division during stomata development. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT1G80120 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT1G80150 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G80180 | Encodes a substrate of the MAPK kinases. Phenotypic analyses of Arabidopsis expressing phosphorylation site mutant forms of At1g80180.1 showed clustered stomata and higher stomatal index in cotyledons expressing the phosphomimetic form of At1g80180.1. Tightly connected with MAPK signaling to fine-tune stomatal production and patterning. |
| AT1G80210 | Mov34/MPN/PAD-1 family protein;(source:Araport11) |
| AT1G80240 | DUF642 gene |
| AT1G80300 | Encodes an ATP/ADP transporter. The mRNA is cell-to-cell mobile. |
| AT1G80310 | MOT2 encodes a molybdate transporter which locates to the vacuolar membrane. Loss-of-function (knock out) mutants show elevated molydate levels in rosette leaves and in fully senescent leaves, but decreased MoO4 levels in seeds. Under conditions of molybdate deficiency leaves from mot2::tDNA mutants show strongly reduced nitrate reductase activity. The mot2 gene is slightly expressed in young and mature leaves, but strongly in senescing leaves. This observation points to a function of MOT2 in molybdate transfer from leaves to seeds during plant senescence. |
| AT1G80330 | Encodes a protein with gibberellin 3-oxidase activity. The enzyme, expressed and purified in E.coli, was shown to catalyze the 3β-hydroxylation of GA20 into GA29. |
| AT1G80370 | Encodes a A2-type cyclin. Contributes to the fine-tuning of local proliferation during plant development. |
| AT1G80420 | Encodes a component of plant break excision repair and functions at several stages during active DNA demethylation in Arabidopsis. |
| AT1G80450 | VQ motif-containing protein;(source:Araport11) |
| AT1G80480 | plastid transcriptionally active 17;(source:Araport11) |
| AT1G80530 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G80540 | envelope glycoprotein B;(source:Araport11) |
| AT1G80620 | S15/NS1, RNA-binding protein;(source:Araport11) |
| AT1G80660 | H[+]-ATPase 9;(source:Araport11) |
| AT1G80710 | Encodes a WD-40 repeat family protein containing a DWD (DDB1 binding WD-40) motif. Mutant analysis demonstrates that DRS1 promotes tolerance to drought stress, possibly mediated by ABA, and suggests involvement of DDB1- Cul4?mediated protein degradation in drought response. |
| AT1G80760 | Encodes a protein with boron transporter activity. It helps to preferentially direct boron to young developing tissues in the shoot, such as immature leaves, under low boron conditions. This boron channel appears to be impermeable to water, unlike the closely related NIP5;1 boron transporter. This protein also allows the transport of glycerol, urea, and formimide but not larger uncharged solutes such as arabitol and sucrose when it is expressed heterologously. |
| AT1G80890 | GAG1At protein;(source:Araport11) |
| AT1G80960 | F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT1G80980 | stress response NST1-like protein;(source:Araport11) |
| AT2G01023 | hypothetical protein;(source:Araport11) |
| AT2G01110 | mutant is Albino and pale green; Chloroplast Protein Translocation (tatC). Core subunit of the chloroplast Tat translocase. Integral chloroplast thylakoid membrane protein. |
| AT2G01300 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
| AT2G01372 | Pseudogene of AT3G13062 |
| AT2G01410 | NHL domain-containing protein;(source:Araport11) |
| AT2G01450 | MPK17 Map kinase family member. Mutants have increased numbers of peroxisomes a phenotype that can be suppressed by mutations in PMD1. This and other treatments, suggests a function in control of peroxisome proliferation in salt stress. |
| AT2G01480 | ESMD1 is a golgi localized putative O-fucosyltransferase. |
| AT2G01530 | MLP-like protein 329;(source:Araport11) |
| AT2G01570 | Member of the VHIID/DELLA regulatory family. Contains homopolymeric serine and threonine residues, a putative nuclear localization signal, leucine heptad repeats, and an LXXLL motif. Putative transcriptional regulator repressing the gibberellin response and integration of phytohormone signalling. DELLAs repress cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. RGA1 binds to PIF3 and inhibits its DNA binding activity and thus affects the expression of PIF3 regulated genes. RGA may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. Involved in fruit and flower development. |
| AT2G01610 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G01680 | Ankyrin repeat family protein;(source:Araport11) |
| AT2G01710 | SDJ2 functions partially redundantly with SDJ1 and SDJ3 and interacts with SUVH1 and SUVH3 to form a SUVH-SDJ complex. The complex binds promoters with DNA methylation and mediates transcriptional activation of promoter methylated genes. |
| AT2G01735 | encodes a RING-H2 zinc finger protein essential for seed development. |
| AT2G01770 | Encodes an iron transporter required for iron sequestration into vacuoles. Expressed in developing embryo and seed. Localized in the vacuolar membrane. |
| AT2G01820 | Transmembrane kinase (TMK), member of the plant receptor-like kinase (RLK) family. TMKs are characterized by an extracellular leucine-rich-repeat (LRR) domain, a single transmembrane region and a cytoplasmic kinase domain. TMKs have been shown to act as critical modulators of cell expansion and cell proliferation. |
| AT2G01850 | EXGT-A3 has homology to xyloglucan endotransglucosylases/hydrolases (XTHs). Mutants in this gene show a lesion mimic phenotype associated with leaf maturation and a reduction in the number of tertiary veins. Individual tracheary elements in the mutants are shorter, but phloem transport activity is not severely affected. EXGT-A3 plays a role in xyloglucan degradation in the differentiating tracheary elements of rosette leaves. The mRNA is cell-to-cell mobile. |
| AT2G01880 | PEP complex component. |
| AT2G01920 | ENTH/VHS/GAT family protein;(source:Araport11) |
| AT2G01930 | BASIC PENTACYSTEINE1 (BPC1) is a regulator of the homeotic Arabidopsis thaliana gene SEEDSTICK (STK), which controls ovule identity. BPC1 induces conformational changes by cooperative binding to purine-rich elements present in the STK regulatory sequence. STK is upregulated in bpc1 mutant.Along with BPC2, BPC1 binds to the promoter of and represses GALS1 thereby reducing beta 1,4- galactan accumulation. |
| AT2G01940 | Encodes a transcription factor that, together with IDD14 and IDD16, regulates auxin biosynthesis and transport and thus aerial organ morphogenesis and gravitropic responses. May be involved in an early event in shoot gravitropism such as gravity perception and/or a signaling process subsequent to amyloplast sedimentation as a putative transcription factor in gravity-perceptive cells. |
| AT2G01950 | Encodes a leucine rich repeat receptor kinase and associated with provascular/procambial cells. Similar to BRI, brassinosteroid receptor protein. |
| AT2G01960 | Member of TETRASPANIN family |
| AT2G01970 | Endomembrane protein 70 protein family;(source:Araport11) |
| AT2G02000 | glutamate decarboxylase 3;(source:Araport11) |
| AT2G02023 | hypothetical protein;(source:Araport11) |
| AT2G02060 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT2G02070 | RAVEN is part of the network regulated by BLJUEJAY, JACKDAW, SACRECROW and SHORT-ROOT to regulate root tissue patterning through cell lineage specification and asymmetric cell division. RAVEN is directly activated by SHORT-ROOT and directly repressed by JACKDAW. |
| AT2G02080 | C2H2 BIRD transcription factor family. |
| AT2G02148 | PPR containing protein;(source:Araport11) |
| AT2G02270 | pseudogene of phloem protein 2-B2;(source:Araport11) |
| AT2G02370 | SNARE associated Golgi protein family;(source:Araport11) |
| AT2G02400 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G02410 | yacP-like NYN domain protein;(source:Araport11) |
| AT2G02550 | PIN domain-like family protein;(source:Araport11) |
| AT2G02700 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G02795 | transmembrane protein;(source:Araport11) |
| AT2G02860 | encodes a sucrose transporter in sieve elements and a number of sink tissues and cell types. Gene expression is induced by wounding. |
| AT2G03000 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G03090 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G03110 | putative RNA-binding protein;(source:Araport11) |
| AT2G03250 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT2G03360 | Glycosyltransferase family 61 protein;(source:Araport11) |
| AT2G03380 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G03500 | Encodes a nuclear localized member of the MYB family of transcriptional regulators that is involved in negative regulation of flowering. It is expressed in vascular tissues and at low levels in the shoot apex during the transition to flowering. Loss of function mutations are early flowering.EFM is involved in the autonomous, thermosensory and GA pathways and expression is directly regulated by SVP. EFM interacts with JMJD5 to repress FT expression. |
| AT2G03550 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G03740 | Late embryogenesis abundant protein. Associates with and stabilizes membranes as part of cryoprotective response. |
| AT2G03800 | encodes a D-aminoacyl-tRNA deacylase. Involved in detoxification of D-aminoacyl-tRNA. Mutants also show ethanol-hypersensitive phenotype. |
| AT2G03870 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT2G03910 | pseudogene of Polynucleotidyl transferase;(source:Araport11) |
| AT2G03955 | Encodes a defensin-like (DEFL) family protein. |
| AT2G04110 | pseudogene of expressed protein;(source:Araport11) |
| AT2G04115 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT2G04235 | hypothetical protein;(source:Araport11) |
| AT2G04360 | transmembrane protein;(source:Araport11) |
| AT2G04420 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT2G04495 | transmembrane protein;(source:Araport11) |
| AT2G04580 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10) |
| AT2G04590 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-28 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT2G04625 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to reverse transcriptase;(source:TAIR10) |
| AT2G04680 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G04740 | ankyrin repeat family protein;(source:Araport11) |
| AT2G04795 | hypothetical protein;(source:Araport11) |
| AT2G04820 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.8e-214 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G05060 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G05133 | Pseudogene of AT2G37680 |
| AT2G05294 | transmembrane protein;(source:Araport11) |
| AT2G05330 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT2G05440 | GLYCINE RICH PROTEIN 9;(source:Araport11) |
| AT2G05600 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT2G05720 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G05790 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT2G05800 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.1e-19 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT2G05850 | serine carboxypeptidase-like 38;(source:Araport11) |
| AT2G06050 | Encodes a 12-oxophytodienoate reductase that is required for jasmonate biosynthesis. Mutants are male sterile and defective in pollen dehiscence. Shows activity towards 2,4,6-trinitrotoluene. CFA-Ile, CFA-Leu, CFA-Val, CFA-Met and CFA-Ala can restore the fertility of opr3 plants by inducing filament elongation and anther dehiscence. |
| AT2G06060 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.7e-05 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G06510 | Encodes a homolog of Replication Protein A that is involved in meiosis I in pollen mother cells. rpa1a mutants have a reduced number of class I crossovers. The protein is located in chromatin-associated foci in early leptotene and can be detected in these foci until late pachytene of meiosis I. |
| AT2G06860 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10) |
| AT2G06983 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT2G07560 | H[+]-ATPase 6;(source:Araport11) |
| AT2G07687 | Cytochrome c oxidase, subunit III;(source:Araport11) |
| AT2G07704 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.8e-50 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT2G07806 | hypothetical protein;(source:Araport11) |
| AT2G07811 | pseudogene of mitochondrial protein |
| AT2G08986 | hypothetical protein;(source:Araport11) |
| AT2G10450 | 14-3-3 family protein;(source:Araport11) |
| AT2G10530 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.9e-42 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT2G11890 | Encodes a tripolyphosphatase that is involved in root development. |
| AT2G12462 | sterile alpha motif (SAM) domain protein;(source:Araport11) |
| AT2G12475 | Encodes a defensin-like (DEFL) family protein. |
| AT2G13360 | Encodes a peroxisomal photorespiratory enzyme that catalyzes transamination reactions with multiple substrates. It is involved in photorespiration. |
| AT2G13420 | Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT2G13422 | hypothetical protein;(source:Araport11) |
| AT2G13560 | Encodes an NAD-dependent malic enzyme (NAD-ME) that does not act on oxaloacetate, indicating that it belongs to EC 1.1.1.39. It is a member of the alpha family of NAD-MEs in plants. It appears to function as a homodimer or as a heterodimer with the beta-type NAD-ME2 (At4g00570). NAD-ME1 transcript and protein levels are higher during the night than during the day. The mRNA is cell-to-cell mobile. |
| AT2G13610 | ABC-2 type transporter family protein;(source:Araport11) |
| AT2G13690 | PRLI-interacting factor;(source:Araport11) |
| AT2G14050 | minichromosome maintenance 9;(source:Araport11) |
| AT2G14290 | LL-diaminopimelate protein (DUF295);(source:Araport11) |
| AT2G14460 | hypothetical protein;(source:Araport11) |
| AT2G14610 | PR1 gene expression is induced in response to a variety of pathogens. It is a useful molecular marker for the SAR response. Though the Genbank record for the cDNA associated to this gene is called 'PR-1-like', the sequence actually corresponds to PR1. Expression of this gene is salicylic-acid responsive. |
| AT2G14692 | hypothetical protein;(source:Araport11) |
| AT2G14878 | other_RNA;(source:Araport11) |
| AT2G14880 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
| AT2G14900 | Gibberellin-regulated family protein;(source:Araport11) |
| AT2G14960 | encodes a protein similar to IAA-amido synthases. Lines carrying an insertion in this gene are hypersensitive to auxin. |
| AT2G14980 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.2e-247 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
| AT2G15020 | hypothetical protein;(source:Araport11) |
| AT2G15060 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 1.8e-63 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
| AT2G15260 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G15327 | hypothetical protein;(source:Araport11) |
| AT2G15345 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G15580 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G15630 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G15660 | AGAMOUS-like 95;(source:Araport11) |
| AT2G15880 | Pollen expressed protein required for pollen tube growth.Along with other members of the LRX family, itnteracts with RALF4 to control pollen tube growth and integrity. Loss of function results in premature pollen tube rupture and reduced fertility. |
| AT2G15890 | Encodes CBP1, a regulator of transcription initiation in central cell-mediated pollen tube guidance. |
| AT2G15980 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G16130 | polyol/monosaccharide transporter 2;(source:Araport11) |
| AT2G16280 | Encodes KCS9, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT2G16660 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G16670 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-190 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
| AT2G16690 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G41570.1);(source:TAIR10) |
| AT2G16700 | Encodes actin depolymerizing factor 5 (ADF5). |
| AT2G16710 | Iron-sulfur cluster biosynthesis family protein;(source:Araport11) |
| AT2G16730 | putative beta-galactosidase (BGAL13 gene) |
| AT2G16780 | Encodes a WD-40 repeat protein similar to yeast MSI1. |
| AT2G16895 | pseudogene of UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G16950 | TRN1 is an importin beta protein that functions as a nuclear import receptor for AtGRP7 and in interacts with AGO1 to affect miRNA loading. |
| AT2G17030 | Encodes a SKP1/ASK-interacting protein. |
| AT2G17200 | Encodes a ubiquitin receptor protein that specifically associates with PEX2 and PEX12. |
| AT2G17230 | EXORDIUM like 5;(source:Araport11) |
| AT2G17265 | Encodes a homoserine kinase (HSK) which produces O-phospho-L-homoserine (HserP), a compound at the branching point of methionine and threonine biosynthesis. HSK is found in the stromal fraction of chloroplasts. Mutation of this gene results in higher level of the amino acid homoserine and resistance to downy mildew pathogen Hyaloperonospora arabidopsidis. |
| AT2G17320 | pantothenate kinase;(source:Araport11) |
| AT2G17350 | beta-mannosyltransferase-like protein;(source:Araport11) |
| AT2G17450 | Encodes a putative RING-H2 finger protein RHA3a. |
| AT2G17477 | Pseudogene of AT3G22350; F-box family protein |
| AT2G17520 | Encodes a endoribonuclease/protein kinase IRE1-like protein that is predicted to form a type I transmembrane protein structure and contain kinase/endoribonuclease domains at their C-terminal halves. The transcript levels for several ER-stress responsive genes, including six protein disulfide isomerases (PDIs), BiP2, and AtbZIP60 are not affected in ire1-2 null mutants. The mRNA is cell-to-cell mobile. |
| AT2G17700 | ACT-like protein tyrosine kinase family protein;(source:Araport11) |
| AT2G17810 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT2G17860 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT2G17880 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT2G18230 | Encodes a protein that might have inorganic pyrophosphatase activity. |
| AT2G18245 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G18280 | Member of TLP family The mRNA is cell-to-cell mobile. |
| AT2G18330 | AAA-type ATPase family protein;(source:Araport11) |
| AT2G18340 | late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11) |
| AT2G18360 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G18500 | ovate family protein 7;(source:Araport11) |
| AT2G18510 | Essential gene (embryo lethal) that is similar to component of splicosome. Regulates embryonic pattern formation through Pol II-Mediated transcription of WOX2 an PIN7 (DOI:10.1016/j.isci.2019.09.004). JANUS positively regulates PLT1 expression in the root meristem by recruiting RNA polymerase II (Pol II) to PLT1 and by interacting with PLT1. Nuclear accumulation of JANUS in root meristem depends on IMB4. (DOI:10.1105/tpc.20.00108 ) |
| AT2G18520 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G18570 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G18620 | Terpenoid synthases superfamily protein;(source:Araport11) |
| AT2G18660 | Encodes PNP-A (Plant Natriuretic Peptide A). PNPs are a class of systemically mobile molecules distantly related to expansins; their biological role has remained elusive. PNP-A contains a signal peptide domain and is secreted into the extracellular space. Co-expression analyses using microarray data suggest that PNP-A may function as a component of plant defence response and SAR in particular, and could be classified as a newly identified PR protein. It is stress responsive and can enhance its own expression. |
| AT2G18735 | other_RNA;(source:Araport11) |
| AT2G18840 | Encodes one of the two YPT/RAB GTPase Interacting Protein 4a (YIP4a) and YIP4b (formerly YIP2), which form a TGN-localized complex with ECHIDNA (ECH). This complex is required for the secretion of cell wall polysaccharides. |
| AT2G18876 | Encodes a microtubule-associated protein. |
| AT2G18917 | Natural antisense transcript overlaps with AT2G18920 and AT2G18915;(source:Araport11) |
| AT2G18920 | hypothetical protein;(source:Araport11) |
| AT2G18938 | transmembrane protein;(source:Araport11) |
| AT2G18940 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G18980 | Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
| AT2G19060 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT2G19070 | encodes a protein whose sequence is similar to anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (gi:2239091). BAHD acyltransferase. Uses hydroxycinnamoyl CoAs, including caffeoyl/feruoyl/p-coumaroyl/sinapoyl-CoA as acyl donors to fully substitute the N1, N5, and N10 positions of spermidine. |
| AT2G19130 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT2G19150 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G19390 | SAGA complex subunit. Regulates gene expression by affecting histone H3 acetylation. |
| AT2G19430 | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. |
| AT2G19500 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT2G19620 | Plays a role in dehydration stress response. |
| AT2G19640 | ASH1-related protein 2;(source:Araport11) |
| AT2G19700 | hypothetical protein;(source:Araport11) |
| AT2G19710 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT2G19750 | Ribosomal protein S30 family protein;(source:Araport11) |
| AT2G19800 | Encodes a myo-inositol oxygenase family gene. |
| AT2G19860 | Encodes a protein with hexokinase activity (AtHXK2) and acts as a sensor for plant sugar responses. |
| AT2G19880 | Encodes Glucosylceramide synthase (GCS) which catalyzes the final step in glucosylceramide (GlcCer) synthesis by transferring a glucosyl residue from UDP-Glc to the ceramide backbone. |
| AT2G19930 | RNA-dependent RNA polymerase family protein;(source:Araport11) |
| AT2G20010 | Gls protein (DUF810);(source:Araport11) |
| AT2G20030 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G20250 | hypothetical protein;(source:Araport11) |
| AT2G20300 | Encodes ABNORMAL LEAF SHAPE 2 (ALE2), a receptor-like protein kinase (RLK) with a cluster of basic amino acid residues followed by a cysteine-containing sequence in the putative extracellular domain. Function together with ACR4 (Arabidopsis homolog of the Crinkly4) and ALE1 in positively regulating protoderm-specific gene expression and for the formation of leafy organs. ale2 mutants have various epidermal defects, including disorganization of epidermis-related tissues, defects in the leaf cuticle and the fusion of organs. |
| AT2G20370 | Encodes a xyloglucan galactosyltransferase located in the membrane of Golgi stacks that is involved in the biosynthesis of fucose. It is also involved in endomembrane organization. It is suggested that it is a dual-function protein that is responsible for actin organization and the synthesis of cell wall materials. The mRNA is cell-to-cell mobile. |
| AT2G20490 | nucleolar RNA-binding Nop10p family protein;(source:Araport11) |
| AT2G20510 | One of two loci encoding the TIM44 subunit of the mitochondrial inner membrane translocase complex. TIM44 subunit is the part of the complex that hydrolyzes ATP to provide energy for protein translocation to the inner membrane. |
| AT2G20570 | Encodes GLK1, Golden2-like 1, one of a pair of partially redundant nuclear transcription factors that regulate chloroplast development in a cell-autonomous manner. GLK2, Golden2-like 2, is encoded by At5g44190. GLK1 and GLK2 regulate the expression of the photosynthetic apparatus. GLK1 is also a member of the GARP transcription factor family. |
| AT2G20610 | Confers auxin overproduction. Mutants have an over-proliferation of lateral roots. Encodes a C-S lyase involved in converting S-alkylthiohydroximate to thiohydroximate in glucosinolate biosynthesis. Induced in epidermal cells attacked by powdery mildew. The RTY enzyme is expected to function as a dimer (or a higher order multimeric complex), as all RTY-related enzymes with a defined crystal structure are known to form dimers or tetramers. |
| AT2G20670 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
| AT2G20721 | snoRNA;(source:Araport11) |
| AT2G20725 | CAAX amino terminal protease family protein;(source:Araport11) |
| AT2G20750 | member of BETA-EXPANSINS. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT2G20780 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G20800 | NAD(P)H dehydrogenase B4;(source:Araport11) |
| AT2G20820 | hypothetical protein;(source:Araport11) |
| AT2G20825 | Developmental regulator, ULTRAPETALA;(source:Araport11) |
| AT2G20870 | cell wall protein precursor;(source:Araport11) |
| AT2G20890 | Chloroplast-localized Thylakoid formation1 gene product involved in vesicle-mediated formation of thylakoid membranes. Thf1 antisense lines contain abnormal chloroplasts early in leaf development (chloroplasts have loosely stacked thylakoid membranes). Expression was induced in the light and decreased under dark conditions. G-alpha interaction partner that functions downstream of the plasma membrane?delimited heterotrimeric G-protein (GPA1) in a D-glucose signaling pathway. Localized to both the outer plastid membrane and the stroma. Probably involved in the metabolic pathway that controls the assembly of the PS II complex. The mRNA is cell-to-cell mobile. |
| AT2G21060 | Glycine-rich protein (AtGRP2b). Also named as CSP4 (cold shock domain protein 4) containing a well conserved cold shock domain (CSD) and glycine-rich motifs interspersed by two retroviral-like CCHC zinc fingers. AtCSP4 is expressed in all tissues but accumulates in reproductive tissues and those undergoing cell divisions. Overexpression of AtCSP4 reduces silique length and induces embryo lethality. |
| AT2G21080 | Ras guanine nucleotide exchange factor K;(source:Araport11) |
| AT2G21100 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT2G21150 | Encodes a nuclear localized XAP5 family protein involved in light regulation of the circadian clock and photomorphogenesis. XCT loss of function mutations also show decreased levels of DCL1, 3 and 4 and correspondingly lower levels of certain small RNAs suggesting a role in sRNA biogenesis. |
| AT2G21180 | transmembrane protein;(source:Araport11) |
| AT2G21230 | bZIP30 is a transcriptional activator that is involved in regulation of growth and development of reproductive organs. It interacts with a number of developmental regulators including WUS, HEC1, KNAT1/BP, KNAT2, JAB, BEL1, and NGA1. |
| AT2G21280 | A nuclear-encoded, plastid-targeted protein (AtSulA) whose overexpression causes severe yet stochastic plastid (shown in chloroplasts and leucoplasts) division defects. The protein does not appear to interact with either AtFtsZ proteins when studied in a yeast two-hybrid system. |
| AT2G21330 | fructose-bisphosphate aldolase 1;(source:Araport11) |
| AT2G21440 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G21500 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G21710 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT2G21790 | encodes large subunit of ribonucleotide reductase involved in the production of deoxyribonucleoside triphosphates (dNTPs) for DNA replication and repair |
| AT2G21990 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT2G22120 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT2G22150 | pseudogene of TRAF-like family protein;(source:Araport11) |
| AT2G22170 | Lipase/lipooxygenase, PLAT/LH2 family protein;(source:Araport11) |
| AT2G22180 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT2G22330 | Encodes a cytochrome P450. Involved in tryptophan metabolism. Converts Trp to indole-3-acetaldoxime (IAOx), a precursor to IAA and indole glucosinolates. The mRNA is cell-to-cell mobile. |
| AT2G22400 | TRM4B is a cytosine-5--methyltransferase. Mutants have decreased methyl cytosine and defects in root development. |
| AT2G22425 | Microsomal signal peptidase 12 kDa subunit (SPC12);(source:Araport11) |
| AT2G22430 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein that is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis. |
| AT2G22480 | Phosphofructokinase isoform; target of plastidic thioredoxin-f-dependent redox regulation. |
| AT2G22590 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G22600 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT2G22620 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
| AT2G22680 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT2G22780 | encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
| AT2G22795 | hypothetical protein;(source:Araport11) |
| AT2G22830 | squalene epoxidase 2;(source:Araport11) |
| AT2G22890 | Kua-ubiquitin conjugating enzyme hybrid localization domain-containing protein;(source:Araport11) |
| AT2G22920 | serine carboxypeptidase-like 12;(source:Araport11) |
| AT2G22950 | Encodes a putative auto-regulated Ca2+-ATPase located in the plasma membrane involved in transporting Ca2+ outside developing pollen grains. This activity is important to support normal pollen development, particularly the progression to uninucleated microspores to bicellular pollen grains. |
| AT2G23060 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT2G23093 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G23150 | Encodes a member of the Nramp2 metal transporter family; like its homolog Atnramp4, localized in vacuolar membrane. Seedlings of double mutant, atnramp3-1 atnramp4-1, were arrested at early germination. |
| AT2G23320 | Encodes WRKY DNA-binding protein 15 (WRKY15). |
| AT2G23350 | polyadenylate-binding protein, putative / PABP, putative.Member of the Class II family of PABP proteins. Highly and ubiquitously expressed. The mRNA is cell-to-cell mobile. |
| AT2G23370 | cyclin delta-3;(source:Araport11) |
| AT2G23410 | Encodes cis-prenyltransferase involved in dolichol biosynthesis. |
| AT2G23430 | Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. |
| AT2G23440 | transmembrane protein;(source:Araport11) |
| AT2G23450 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G23510 | BAHD acyltransferase which transfers acyl-groups from different acyl-donors specifically to amines. Catalyzes the multisite acylation of spermidine. Uses caffeoyl/feruoyl/sinapoyl-CoA with the N1 and N10 positions of spermidine. |
| AT2G23600 | Encodes a protein shown to have carboxylesterase activity, methyl salicylate esterase activity, methyl jasmonate esterase activity, and methyl IAA esterase activity in vitro. MES2 appears to be involved in MeSA hydrolysis in planta. This protein does not act on MeGA4, or MEGA9 in vitro and has been show to be capable of hydrolyzing methyl ester nicotinate back to nicotinate. |
| AT2G23755 | transmembrane family 220 helix protein;(source:Araport11) |
| AT2G23800 | encodes an endoplasmic reticulum-targeted geranylgeranyl pyrophosphate synthase |
| AT2G23870 | pseudogene of Terpenoid cyclases family protein;(source:Araport11) |
| AT2G24020 | STIC2 was identifided in a screen for suppressors of chloroplast protein import defect in tic40. |
| AT2G24060 | SUPPRESSOR OF VARIEGATION9 (SVR9),encodes a chloroplast-localized prokaryotic type translation initiation factor 3. Mutant plants shows both chloroplast development defect, and a series of leaf developmental abnormalities including more serrated leaf margin, disorganized mesophyll cells, and altered cotyledon venation patterns. |
| AT2G24070 | QWRF motif protein (DUF566);(source:Araport11) |
| AT2G24240 | BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11) |
| AT2G24255 | LOW protein: F-box/kelch-repeat protein;(source:Araport11) |
| AT2G24260 | Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair and sperm cell development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3). |
| AT2G24270 | Encodes a protein with non-phosphorylating NADP-dependent glyceraldehyde-3-phosphate dehydrogenase activity. The activity of the enzyme was determined from leaf extracts; the enzyme has not been purified to confirm activity. |
| AT2G24420 | DNA repair ATPase-like protein;(source:Araport11) |
| AT2G24550 | major centromere autoantigen B-like protein;(source:Araport11) |
| AT2G24570 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
| AT2G24580 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT2G24600 | Ankyrin repeat family protein;(source:Araport11) |
| AT2G24610 | member of Cyclic nucleotide gated channel family |
| AT2G24660 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-166 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT2G24762 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
| AT2G24990 | Serine/threonine-protein kinase Rio1;(source:Araport11) |
| AT2G25090 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.18), which has also been reported as a member of the CBL-interacting protein kinases (CIPK16) and is involved in salinity tolerance. |
| AT2G25110 | Encodes an endoplasmic reticulum protein SDF2 (stromal-derived factor-2). Forms a complex SDF2-ERdj3B-BiP that is required for the proper accumulation of the surface-exposed leucine-rich repeat receptor kinases EFR. EFR is involved in PAMP (pathogen associated molecular patterns) triggered immunity. |
| AT2G25130 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G25160 | cytochrome P450, family 82, subfamily F, polypeptide 1;(source:Araport11) |
| AT2G25180 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical.The retention of leaf water content, maintenance of cell membrane stability, and enhancement of anthocyanin biosynthesis were found to contribute to the enhanced drought tolerance of the arr1,10,12 triple mutant. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
| AT2G25210 | Ribosomal protein L39 family protein;(source:Araport11) |
| AT2G25260 | Hyp O-arabinosyltransferase-like protein;(source:Araport11) |
| AT2G25380 | pseudogene of zinc finger protein-related |
| AT2G25440 | receptor like protein 20;(source:Araport11) |
| AT2G25540 | cellulose synthase |
| AT2G25570 | SEL1-like repeat protein involved in plasmodesmata-mediated intercellular transport. |
| AT2G25620 | Encodes DBP1, a member of the DBP factors (DNA-binding protein phosphatases) featuring sequence-specific DNA-binding and protein phosphatase activity. DBP1 is involved in plant-potyvirus interactions. Loss-of-function of DBP1 renders resistance to potyviruses. Negatively regulates drought and salt tolerance through altering leaf surface permeability. |
| AT2G25660 | Translocon at the inner-envelope membrane of chloroplasts which binds to the outer-membrane channel TOC75. |
| AT2G25680 | Encodes a high-affinity molybdate transporter. Mutant has reduced concentrations of molybdate in roots and shoots, and reduced shoot and root length when growing on Mo-limited medium. |
| AT2G25690 | DUF581 family protein, putative (DUF581);(source:Araport11) |
| AT2G25740 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
| AT2G25790 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT2G25800 | elongation factor Ts (DUF810);(source:Araport11) |
| AT2G25810 | tonoplast intrinsic protein 4;(source:Araport11) |
| AT2G25820 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT2G25890 | Oleosin family protein;(source:Araport11) |
| AT2G26030 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT2G26040 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT2G26250 | epidermis-specific, encodes KCS10, a putative 3-ketoacyl-CoA synthase. probably involved in the synthesis of long-chain lipids found in the cuticle. |
| AT2G26310 | Encodes a plastid stroma localized fatty acid binding protein. |
| AT2G26355 | Natural antisense transcript overlaps with AT2G26360. The RNA is cell-to-cell mobile. |
| AT2G26420 | Encodes a phosphatidylinositol-4-phosphate 5-kinase. Exclusively expressed in roots. Essential for root hair growth. |
| AT2G26450 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G26500 | cytochrome b6f complex subunit (petM);(source:Araport11) |
| AT2G26510 | Encodes a plasma-membrane localized nucleobase transporter capable of transporting adenine, guanine, uracil and hypoxanthine. Likely to be a proton-nucleobase symporter. |
| AT2G26530 | Pheromone receptor-like protein involved in the early elicitor signaling events which occur within minutes and include ion fluxes across the plasma membrane, activation of MPKs and the formation of ROS related to PGPS1 and WRKY33. |
| AT2G26560 | Encodes a lipid acyl hydrolase with wide substrate specificity that accumulates upon infection by fungal and bacterial pathogens. Protein is localized in the cytoplasm in healthy leaves, and in membranes in infected cells. Plays a role in cell death and differentially affects the accumulation of oxylipins. Contributes to resistance to virus. |
| AT2G26610 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT2G26695 | Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11) |
| AT2G26700 | Member of AGC VIIIa Kinase gene family. Encodes PID2, a homolog of PID. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT2G26710 | Encodes a member of the cytochrome p450 family that serves as a control point between multiple photoreceptor systems and brassinosteroid signal transduction. Involved in brassinolide metabolism. Mediates response to a variety of light signals including hypocotyl elongation and cotyledon expansion. |
| AT2G26740 | Encodes a soluble epoxide hydrolase whose expression is induced by auxin and water stress. |
| AT2G26750 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G26800 | Mutant has increased seed ile, leu and val as well as his and arg. |
| AT2G26880 | AGAMOUS-like 41;(source:Araport11) |
| AT2G26890 | GRV2 has sequence similarity to the C. elegans protein RME-8 which is involved in endocytosis. grv2 mutants result in a reduction in gravitropic response in hypocotyls and shoots but do not affect root gravitropism. The mutants are defective in amyloplast sedimentation. |
| AT2G26980 | encodes a serine-threonine protein kinase whose expression increases in response to abscisic acid, cold, drought, high salt, and wounding conditions. The gene is expressed in developing seeds and seedlings. Lines carrying a T-DNA insertions have reduced germination efficiency and expression of cold, high-salt, and abscisic acid marker genes are altered, but not drought-response markers. |
| AT2G27040 | AGO4 is a member of a class of PAZ/PIWI domain containing proteins involved in siRNA mediated gene silencing.Loss of function mutations have reduced site specific CpNpG and CpHpH methylation, abnormal ovule/megagametophyte develoment and increased susceptibility to bacterial pathogens including Tobacco rattle virus. |
| AT2G27080 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT2G27110 | FAR1-related sequence 3;(source:Araport11) |
| AT2G27130 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT2G27250 | One of the three CLAVATA genes controlling the size of the shoot apical meristem (SAM) in Arabidopsis. Belongs to a large gene family called CLE for CLAVATA3/ESR-related. Encodes a stem cell-specific protein CLV3 presumed to be a precursor of a secreted peptide hormone. The deduced ORF encodes a 96-amino acid protein with an 18-amino acid N-terminal signal peptide. The functional form of CLV3 (MCLV3) was first reported to be a posttranscriptionally modified 12-amino acid peptide, in which two of the three prolines were modified to hydroxyproline (Ito et al., Science 2006, 313:842; Kondo et al., Science 2006, 313:845). Ohyama et al. (2009) later reported that the active mature CLV3 is a 13-amino-acid arabinosylated glycopeptide (Nature Chemical Biology, 5:578). CLV3 binds the ectodomain of the CLAVATA1 (CLV1) receptor-kinase. Regulates shoot and floral meristem development. Required for CLAVATA1 receptor-like kinase assembly into a signaling complex that includes KAPP and a Rho-related protein. It restricts its own domain of expression, the central zone (CZ) of the shoot apical meristem (SAM), by preventing differentiation of peripheral zone cells, which surround the CZ, into CZ cells and restricts overall SAM size by a separate, long-range effect on cell division rate. CLE domain of CLV3 is sufficient for function. Results obtained from whole seedlings challenge the concept that the immune receptor FLS2 perceives the meristematic regulatory peptide CLV3p in mesophyll, seedlings, and SAM cells and that CLV3p contributes to SAM immunity against bacterial infection (PMID:22923673). |
| AT2G27420 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT2G27440 | pseudogene of rac GTPase activating protein |
| AT2G27500 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT2G27560 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
| AT2G27580 | Regulated by heat shock. |
| AT2G27720 | 60S acidic ribosomal protein family;(source:Araport11) |
| AT2G27820 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT2G27830 | hypothetical protein;(source:Araport11) |
| AT2G27880 | AGO5.Required for antiviral RNA silencing.Confers resistance to Potato virus X. |
| AT2G27940 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G28080 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G28085 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G28120 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G28160 | Encodes a putative transcription factor that regulates iron uptake responses. mRNA is detected in the outer cell layers of the root and accumulates in response to iron deficiency. The expression of many iron-regulated genes is dependent on FIT1. It specifically regulates FRO2 at the level of mRNA accumulation and IRT1 at the level of protein accumulation.Similar to FER in tomato and is a regulator of iron uptake. It is post-transcriptionally controlled. |
| AT2G28355 | low-molecular-weight cysteine-rich 5;(source:Araport11) |
| AT2G28400 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT2G28420 | Vicinal oxygen chelate (VOC) superfamily member. |
| AT2G28460 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G28550 | AP2 family transcription factor that is involved in regulation of flowering and innate immunity.Interacts with CRY2 to regulate CO and FT. TOE1 binds to activation domain of CO and binds CORE sequences of the FT promoter.TOE1/TOE2 are also targets of MiR172b and function in regulation of innate immunity. |
| AT2G28610 | Encodes a homeodomain containing protein that regulates lateral axis-dependent development of Arabidopsis flowers and is required for cell proliferation. It is expressed in a restricted number of L1 cells at the lateral regions of flower primordia, floral organ primordia, and young leaf primordia. |
| AT2G28620 | Mutants have radially swollen roots but do not exhibit defects in abundance or orientation of cortical microtubules, nor are microfibrils reduced. Cellulose synthesis is also unchanged with respect to wild type. There is a disruption in the normal pattern of cell wall placement. |
| AT2G28660 | Chloroplast-targeted copper chaperone protein;(source:Araport11) |
| AT2G28710 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT2G28770 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT2G28780 | P-hydroxybenzoic acid efflux pump subunit;(source:Araport11) |
| AT2G28790 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT2G28890 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT2G28910 | Encodes a CAX-interacting protein (CXIP4). The gene product is located in the nucleus of GFP-CXIP4-expressing yeast cells. When transiently expressed in the tobacco leaves, GFP-CXIP4 locates to the nucleus as well as in discrete areas of the cytoplasm (which do not overlap with mitochondria). |
| AT2G28920 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G28960 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G29065 | GRAS family transcription factor;(source:Araport11) |
| AT2G29070 | Ubiquitin fusion degradation UFD1 family protein;(source:Araport11) |
| AT2G29180 | transmembrane protein;(source:Araport11) |
| AT2G29360 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G29380 | highly ABA-induced PP2C protein 3;(source:Araport11) |
| AT2G29430 | coiled-coil protein (DUF572);(source:Araport11) |
| AT2G29670 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G29720 | Encodes CTF2B. |
| AT2G29780 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G29820 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G29830 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G29860 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G29910 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT2G29930 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT2G29940 | pleiotropic drug resistance 3;(source:Araport11) |
| AT2G29970 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. The mRNA is cell-to-cell mobile. |
| AT2G30000 | PHF5-like protein;(source:Araport11) |
| AT2G30070 | Encodes a high affinity potassium transporter. |
| AT2G30090 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT2G30110 | Encodes a ubiquitin-activating enzyme (E1), involved in the first step in conjugating multiple ubiquitins to proteins targeted for degradation. Gene is expressed in most tissues examined. Mutant is able to revert the constitutive defense responses phenotype of snc1, which indicates the gene is involved in defense response. It also indicates that ubiquitination plays a role in plant defense signalling. |
| AT2G30140 | Encodes a putative glycosyltransferase. Regulates flowering time via FLOWERING LOCUS C. |
| AT2G30210 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT2G30240 | Encodes a plasma membrane localized potassium transporter. |
| AT2G30300 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G30330 | Putative homolog of mammalian BLOC-1 Subunit 1. Protein - protein interaction with BLOS2 and also with SNX1.Located in endomembrane system and hypothesized to be involved in endomembrane transport. |
| AT2G30395 | Member of the plant specific ovate protein family of unknown function. |
| AT2G30520 | Encodes a phototropin-interacting NRL protein that is an early signaling component in the phototrophic response and is essential for the phototropin-mediated chloroplast accumulation response but is not involved in the chloroplast avoidance response or stomatal opening. |
| AT2G30530 | zinc finger CCCH domain protein;(source:Araport11) |
| AT2G30550 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT2G30630 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G30690 | lateral signaling target-like protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT2G30710 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT2G30750 | Putative cytochrome P450; together with CYP71A13 produces dihydrocamalexic acid (DHCA), the precursor to the defense-related compound camalexin, which accumulates in the intercellular space and contributes to the resistance of mature Arabidopsis to P. syringae without directly inhibiting bacterial growth. |
| AT2G30770 | Putative cytochrome P450; together with CYP71A12 produces dihydrocamalexic acid (DHCA), the precursor to the defense-related compound camalexin, which accumulates in the intercellular space and contributes to the resistance of mature Arabidopsis to P. syringae without directly inhibiting bacterial growth. |
| AT2G30860 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT2G31080 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.3e-49 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G31141 | hypothetical protein;(source:Araport11) |
| AT2G31160 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT2G31210 | Encodes a bHLH transcription factor that together with bHLH089 and bHLH010 is important for the normal transcriptome of the developing Arabidopsis anther, possibly by forming a feed-forward loop with DYT1. |
| AT2G31230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT2G31345 | transmembrane protein;(source:Araport11) |
| AT2G31500 | member of Calcium Dependent Protein Kinase |
| AT2G31570 | glutathione peroxidase GPx |
| AT2G31670 | Stress responsive alpha-beta barrel domain protein;(source:Araport11) |
| AT2G31680 | RAB GTPase homolog A5D;(source:Araport11) |
| AT2G31730 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT2G31750 | Encodes an auxin glycosyltransferase that is likely to be involved in regulation of auxin by glycosylation. |
| AT2G31810 | ACT domain-containing small subunit of acetolactate synthase protein;(source:Araport11) |
| AT2G31920 | Member of a novel, plant specific family of microtubule associated proteins. |
| AT2G31990 | Exostosin family protein;(source:Araport11) |
| AT2G32050 | cell cycle control-like protein (DUF572);(source:Araport11) |
| AT2G32100 | ovate family protein 16;(source:Araport11) |
| AT2G32110 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
| AT2G32170 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G32235 | hypothetical protein;(source:Araport11) |
| AT2G32260 | phosphorylcholine cytidylyltransferase;(source:Araport11) |
| AT2G32275 | Expressed protein;(source:Araport11) |
| AT2G32290 | beta-amylase 6;(source:Araport11) |
| AT2G32350 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT2G32400 | Glr5 |
| AT2G32415 | Polynucleotidyl transferase, ribonuclease H fold protein with HRDC domain-containing protein;(source:Araport11) |
| AT2G32430 | Galactosyltransferase family protein;(source:Araport11) |
| AT2G32460 | Member of the R2R3 factor gene family. |
| AT2G32487 | hypothetical protein;(source:Araport11) |
| AT2G32520 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G32560 | F-box family protein;(source:Araport11) |
| AT2G32620 | encodes a gene similar to cellulose synthase |
| AT2G32680 | NLP20 LRR receptor protein involved in PAMP mediated immunity. |
| AT2G32750 | Exostosin family protein;(source:Araport11) |
| AT2G32800 | protein kinase family protein;(source:Araport11) |
| AT2G32810 | putative beta-galactosidase |
| AT2G32830 | Encodes Pht1;5, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT2G32870 | TRAF-like family protein;(source:Araport11) |
| AT2G32890 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. This gene is contained within a highly AT-rich repetitive sequence region. |
| AT2G32930 | Encodes a zinc finger protein. |
| AT2G32960 | Encodes an atypical dual-specificity phosphatase. |
| AT2G32970 | G1/S-specific cyclin-E protein;(source:Araport11) |
| AT2G33010 | Ubiquitin-associated (UBA) protein;(source:Araport11) |
| AT2G33070 | Encodes a nitrile-specifier protein NSP2. NSP2 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. |
| AT2G33140 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT2G33160 | Gene structure annotation for AT2G33160.1 is inaccurate in TAIR10, see PMID:23709666 and Comments field on the locus page for updated annotation. |
| AT2G33170 | Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11) |
| AT2G33180 | hypothetical protein;(source:Araport11) |
| AT2G33230 | Encodes a flavin monooxygenase gene which belongs to the tryptophan-dependent auxin biosynthetic pathway and enhances drought resistance. |
| AT2G33320 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT2G33330 | Encodes a plasmodesmal protein that affects the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT2G33340 | Encodes MAC3B, a U-box proteins with homology to the yeast and human E3 ubiquitin ligase Prp19. Associated with the MOS4-Associated Complex (MAC). Involved in plant innate immunity. Regulator of flowering time. |
| AT2G33360 | cadherin EGF LAG seven-pass G-type receptor, putative (DUF3527);(source:Araport11) |
| AT2G33400 | FK506-binding nuclear-like protein;(source:Araport11) |
| AT2G33480 | NAC domain containing protein 41;(source:Araport11) |
| AT2G33500 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT2G33550 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT2G33570 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT2G33580 | Encodes a putative LysM-containing receptor-like kinase. LYK5 is a major chitin receptor and forms a chitin-induced complex with related kinase CERK1. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain. |
| AT2G33670 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO5 belongs to the clade III, with AtMLO7, AtMLO8, AtMLO9, and AtMLO10. The gene is expressed during seedling growth, in cotyledon vascular system, and in stigma, anther and pollen grains; it was not expressed in rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT2G33680 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G33700 | Encodes a putative protein phosphatase 2C that positively regulates salt tolerance in abscisic acid-dependent manner. |
| AT2G33730 | Homolog of the DEADbox pre-mRNA splicing factor Prp28 which regulates abundance of miRNA. It plays essential roles in miRNA biogenesis and interacts with the DCL1 complex and positively influences pri-miRNA processing. SMA1 binds the promoter region of genes encoding pri-miRNAs (MIRs) and is required for MIR transcription. It enhances the abundance of the DCL1 protein levels through promoting the splicing of the DCL1 pre-mRNAs. |
| AT2G33770 | Encodes a ubiquitin-conjugating E2 enzyme. UBC24 mRNA accumulation is suppressed by miR399f, miR399b and miR399c. Involved in phosphate starvation response and mediates degradation of PHO1 and PHT1s at endomembrane. Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
| AT2G33775 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT2G33830 | Negative regulator of local and systemic acquired resistance; target of FLD for activation of SAR. |
| AT2G33870 | RAB GTPase homolog A1H;(source:Araport11) |
| AT2G34000 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G34010 | verprolin;(source:Araport11) |
| AT2G34140 | CDF4 is member of the group II DOF transcription factor family is involved in regulation of differentiation root columella cells. It is a direct target of the transcriptional repressor WOX5. CDF4 itself is a transcriptional repressor that appears to repress root columella stem cell identity. Ectopic expression of CDF leads to premature differentiation of root columella cells. |
| AT2G34170 | hypothetical protein (DUF688);(source:Araport11) |
| AT2G34180 | Encodes CBL-interacting protein kinase 13 (CIPK13). |
| AT2G34280 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G34360 | MATE efflux family protein;(source:Araport11) |
| AT2G34470 | Encodes a urease accessory protein which is essential for the activation of plant urease. |
| AT2G34490 | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze the conversion of both 24-epi-campesterol and β-sitosterol to brassicasterol and stigmasterol, respectively, in the presence of NADPH. |
| AT2G34500 | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze in the presence of NADPH the conversion of β-sitosterol to stigmasterol, but not that of 24-epi-campesterol to brassicasterol (unlike CYP710A2). |
| AT2G34510 | Protein of unknown function, DUF642. Found in cellulose enriched cell wall fractions. |
| AT2G34650 | Encodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID. |
| AT2G34655 | hypothetical protein;(source:Araport11) |
| AT2G34660 | encodes a multidrug resistance-associated protein that is MgATP-energized glutathione S-conjugate pump. An ABCC-type arsenite-phytochelatin transporter. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. The mRNA is cell-to-cell mobile. |
| AT2G34740 | protein phosphatase 2C family protein;(source:Araport11) |
| AT2G34770 | encodes a fatty acid hydroxylase, required for the AtBI-1-mediated suppression of programmed cell death. |
| AT2G34790 | Encodes a BBE-like enzyme that acts in monolignol metabolism by catalyzing the oxidation of aromatic allylic alcohols, such as coumaryl-, sinapyl-, and coniferyl alcohol, to the corresponding aldehydes. |
| AT2G34810 | FAD-binding Berberine family protein;(source:Araport11) |
| AT2G34870 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT2G34880 | JMJ15 is a novel H3K4 demethylase that regulates genes involved in flowering and response to stress. It is also a maternally expressed, imprinted gene. |
| AT2G34910 | root hair specific protein;(source:Araport11) |
| AT2G34920 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G34960 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Mediates efficient uptake of Lys, Arg and Glu in a yeast system. Localized to the plasma membrane. |
| AT2G34990 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G35000 | ATL9 is an E3 ligase-like protein that is induced by chitin oligomers and contributes to fungal resistance.It differs from other members of the ATL family in that it has a PEST domain. It is a short lived protein that is subject to proteosome mediated degradation. It is expressed in many aerial tissues in a pattern that varies with developmental stage. |
| AT2G35075 | hypothetical protein;(source:Araport11) |
| AT2G35240 | Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
| AT2G35260 | CAAX protease self-immunity protein;(source:Araport11) |
| AT2G35270 | Direct target of AGAMOUS. Regulates patterning and differentiation of reproductive organs. |
| AT2G35360 | ubiquitin family protein;(source:Araport11) |
| AT2G35430 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT2G35450 | catalytic/ hydrolase;(source:Araport11) |
| AT2G35570 | pseudogene of Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT2G35585 | cystic fibrosis transmembrane conductance regulator;(source:Araport11) |
| AT2G35615 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G35640 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT2G35660 | Encodes a member of a novel gene family with homology to known proteins involved in hydroxylation and oxidation of an aromatic ring. |
| AT2G35700 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Thought to be involved in secondary cell wall metabolism. |
| AT2G35840 | Sucrose-6F-phosphate phosphohydrolase family protein;(source:Araport11) |
| AT2G35850 | transmembrane protein;(source:Araport11) |
| AT2G35859 | Natural antisense transcript overlaps with AT2G35860;(source:Araport11) |
| AT2G35900 | Mal d 1-associated protein;(source:Araport11) |
| AT2G35910 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G35940 | Encodes a member of the BEL-like homeodomain protein family. Ecotopic expression in the embryo sac leads to defects in nuclear migration and cellularization and embryo sacs with multiple egg cells. Loss of function alleles have no female gametophyte defects. The ecotopic expression phenotype requires KNAT3 because it can be suppressed by loss of KNAT3 function alleles. Localized to the nucleus but interaction with OFP1 relocates it to the cytoplasm. |
| AT2G35945 | Natural antisense transcript overlaps with AT2G35940;(source:Araport11) |
| AT2G35950 | embryo sac development arrest 12;(source:Araport11) |
| AT2G36020 | HVA22-like protein J;(source:Araport11) |
| AT2G36030 | hypothetical protein;(source:Araport11) |
| AT2G36080 | Encodes a plant-specific B3 DNA-binding domain transcription factor. Has transcription repressor activity. |
| AT2G36110 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT2G36240 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT2G36295 | hypothetical protein;(source:Araport11) |
| AT2G36380 | pleiotropic drug resistance 6;(source:Araport11) |
| AT2G36420 | nucleolin-like protein;(source:Araport11) |
| AT2G36430 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT2G36470 | DUF868 family protein, putative (DUF868);(source:Araport11) |
| AT2G36500 | CBS / octicosapeptide/Phox/Bemp1 (PB1) domains-containing protein;(source:Araport11) |
| AT2G36570 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G36580 | Pyruvate kinase family protein;(source:Araport11) |
| AT2G36600 | pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10) |
| AT2G36620 | RPL24A encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B (AT3G53020). |
| AT2G36695 | hypothetical protein;(source:Araport11) |
| AT2G36760 | UDP-glucosyl transferase 73C2;(source:Araport11) |
| AT2G36880 | methionine adenosyltransferase 3;(source:Araport11) |
| AT2G36950 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT2G37025 | TRF-like 8;(source:Araport11) |
| AT2G37080 | Encodes RIP2 (ROP interactive partner 2), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants). |
| AT2G37150 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G37200 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT2G37300 | transmembrane protein;(source:Araport11) |
| AT2G37390 | Chloroplast-targeted copper chaperone protein;(source:Araport11) |
| AT2G37430 | Encodes a member of the zinc finger family of transcriptional regulators. It is expressed in many root tips, primary roots, cotyledons and hypocotyl. The protein is localized to the nucleus. Overexpression of ZAT11 causes increased root growth and increased sensitivity to nickel ions. The mRNA is cell-to-cell mobile. |
| AT2G37510 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G37530 | forkhead box protein G1;(source:Araport11) |
| AT2G37610 | hypothetical protein;(source:Araport11) |
| AT2G37630 | Encodes a MYB-domain protein involved in specification of the leaf proximodistal axis. Mutation results in lobed and dissected leaves with a characteristic asymmetry. Homologous to the Antirrhinum PHANTASTICA (PHAN) and maize ROUGH SHEATH2 (RS2) genes Asymmetric placement of auxin response at the distal leaf tip precedes visible asymmetric leaf growth. Acts alongside AXR1 to exclude BP expression in leaves and with PIN1 to repress BP and promote lateral organ growth. Interacts physically with AS2 to form a complex that binds to the BP promoter and silences BP. Also functions as a regulator of the plant immune response. |
| AT2G37640 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G37650 | GRAS family transcription factor;(source:Araport11) |
| AT2G37660 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G37820 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G37890 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT2G37940 | Inositol phosphorylceramide synthase 2;(source:Araport11) |
| AT2G38010 | Neutral/alkaline non-lysosomal ceramidase;(source:Araport11) |
| AT2G38080 | LAC4 appears to have laccase activity based on enzyme assays performed using lac4 mutants. These mutants also have reduced levels of lignin. LAC4 is expressed in vascular bundles and fibers and likely contributes to lignin biosynthesis, and hence cell wall biosynthesis, there. lac4/irx12 mutants have a mild irregular xylem phenotype. |
| AT2G38120 | Encodes an auxin influx transporter. AUX1 resides at the apical plasma membrane of protophloem cells and at highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning. Shoot supplied ammonium targets AUX1 and inhibits lateral root emergence. The mRNA is cell-to-cell mobile. |
| AT2G38140 | plastid-specific ribosomal protein 4 (PSRP4) mRNA, complete The mRNA is cell-to-cell mobile. |
| AT2G38230 | Encodes a protein predicted to function in tandem with PDX2 to form glutamine amidotransferase complex with involved in vitamin B6 biosynthesis. The mRNA is cell-to-cell mobile. |
| AT2G38310 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. The mRNA is cell-to-cell mobile. |
| AT2G38320 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).TBL34 are required only for xylan 3-O-monoacetylation and 2,3-di-O-acetylation. This biochemical phenotype can be observed in tbl34 esk1, double mutant and tbl34 tbl35 esk1 triple mutants. |
| AT2G38330 | MATE efflux family protein;(source:Araport11) |
| AT2G38340 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT2G38520 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.4e-60 P-value blast match to dbj|BAA78427.1| polyprotein (AtRE2-2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT2G38640 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT2G38695 | Gag-Pol polyprotein/retrotransposon;(source:Araport11) |
| AT2G38750 | Annexins are a family of calcium dependent membrane binding proteins though to be involved in Golgi mediated secretion. This is one of four annexins identified in Arabidopsis. |
| AT2G38820 | DNA-directed RNA polymerase subunit beta-beta protein, putative (DUF506);(source:Araport11) |
| AT2G38860 | Encodes protease I (pfpI)-like protein YLS5. |
| AT2G38880 | Encodes a transcription factor from the nuclear factor Y (NF-Y) family, AtNF-YB1. Confers drought tolerance. |
| AT2G38905 | Low temperature and salt responsive protein family;(source:Araport11) |
| AT2G38920 | SPX (SYG1/Pho81/XPR1) domain-containing protein / zinc finger (C3HC4-type RING finger) protein-like protein;(source:Araport11) |
| AT2G38940 | Encodes Pht1;4, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
| AT2G38950 | Transcription factor jumonji (jmj) family protein / zinc finger (C5HC2 type) family protein;(source:Araport11) |
| AT2G39020 | Although this locus shares considerable sequence similarity with the adjacent NATA1 gene (At2g39030), they appear to encode genes with different functions. NATA1 is involved in the production of N-delta-acetylornithine, but, overexpression of At2g39020 in tobacco does not lead to the formation of this defense compound. The mRNA is cell-to-cell mobile. |
| AT2G39120 | Encodes a mitochondrial protein essential for the splicing of group II introns in two mitochondrial genes for which splicing factors had not previously been identified: rpl2 and ccmFc. |
| AT2G39140 | Suppressor of var2 variegation phenotype. Chloroplast localized. Loss of function mutant has defects in chloroplast protein translation and rRNA processing. Similar in sequence to pseudouridine synthase proteins. |
| AT2G39200 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in root tips and cotyledon vascular system, in floral organs (anthers and stigma), and in fruit abscission zone, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT2G39220 | Phospholipase pPLAIIIa involved in seed germination and resistance to Turnip Crinkle Virus. |
| AT2G39260 | Nonsense mediated decay (NMD)factor. |
| AT2G39270 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G39330 | jacalin-related lectin 23;(source:Araport11) |
| AT2G39350 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT2G39360 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G39450 | Encodes a Golgi-localized manganese transporter that is involved in Mn tolerance. When expressed into yeast cells, this gene confer Mn2+ and Cu2+ tolerance. |
| AT2G39510 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
| AT2G39700 | putative expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G39770 | Encodes a GDP-mannose pyrophosphorylase/ mannose-1-pyrophosphatase. This enzyme provides GDP-mannose, which is used for cell wall carbohydrate biosynthesis and protein glycosylation as well as for ascorbate (vitamin C) biosynthesis. Mutations in this gene confer hypersensitivity to NH4+. |
| AT2G39805 | Integral membrane Yip1 family protein;(source:Araport11) |
| AT2G39851 | Proteinase inhibitor, propeptide;(source:Araport11) |
| AT2G39975 | hypothetical protein;(source:Araport11) |
| AT2G39980 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT2G39990 | translation initiation factor eIF2 p47 subunit homolog |
| AT2G40030 | Encodes the unique largest subunit of nuclear DNA-dependent RNA polymerase V; homologous to budding yeast RPB1 and the E. coli RNA polymerase beta prime subunit. Required for normal RNA-directed DNA methylation at non-CG methylation sites and transgene silencing. The nrpe1 mutant is more resistant to biotrophic pathogens and is primed to activate salicylic acid-dependent defence genes. |
| AT2G40130 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. |
| AT2G40205 | Ribosomal protein L41 family;(source:Araport11) |
| AT2G40330 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT2G40420 | Encodes a putative amino acid transporter. |
| AT2G40435 | transcription factor SCREAM-like protein;(source:Araport11) |
| AT2G40450 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT2G40490 | Uroporphyrinogen decarboxylase;(source:Araport11) |
| AT2G40530 | transmembrane protein;(source:Araport11) |
| AT2G40550 | Encodes a nuclear localized target of E2Fa-DPa, transcription factors controlling cell cycle progression. Required for sister chromatid cohesion and DNA repair. |
| AT2G40610 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G40640 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT2G40650 | PRP38 family protein;(source:Araport11) |
| AT2G40711 | hypothetical protein;(source:Araport11) |
| AT2G40740 | member of WRKY Transcription Factor; Group III |
| AT2G40750 | member of WRKY Transcription Factor; Group III. Together with WRKY70 positively regulates SARD1 and CBP60g expression in plant immunity. |
| AT2G40840 | Encodes a cytosolic protein with transglucosidase and amylomaltase activity. It is an essential component of the pathway from starch to sucrose and cellular metabolism in leaves at night. The protein binds to heteroglycans and utilizes glucose, mannose and xylose as acceptors. Fucose and galactose can also act as acceptors but less efficiently than the previous three. It was also was also recently reported to act on maltodextrins. On the other hand, arabinose and fructose were not efficiently used. Its role probably includes metabolizing maltose exported from the chloroplast. Studies using maltose extracted from the double mutant be2-1 be3-2 showed that this enzyme is preferentially active of β-maltose. The mRNA is cell-to-cell mobile. |
| AT2G40910 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G40920 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G41060 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G41160 | ATI3A interacting protein containing a large N-terminal rhomboid-like transmembrane domain and a UBA domain at their C terminus, localized in the ER with a role in plant heat tolerance. UBAC2 proteins may act as both cargo receptors and inducers of an ATI3-mediated selective autophagy pathway, where ATI3 and UBAC2 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
| AT2G41240 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT2G41250 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT2G41340 | NRPE5-like protein of unknown function; homologous to budding yeast RPB5 |
| AT2G41360 | galactose oxidase/kelch repeat protein;(source:Araport11) |
| AT2G41410 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT2G41430 | Encodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2. |
| AT2G41480 | Encodes a cationic cell-wall-bound peroxidase homolog that is involved in the lignification of cell walls. Regulated by COG1, involved in seed longevity. |
| AT2G41640 | Glycosyltransferase family 61 protein;(source:Araport11) |
| AT2G41660 | Essential for hydrotropism in roots. Mutant roots are defective in hydrotropism, and have slightly reduced phototropism and modified wavy growth response. Has normal gravitropism and root elongation. |
| AT2G41705 | Encodes a fluoride export protein. |
| AT2G41750 | Involved in posttranscriptional modification of tRNA. Can form acp3U20b on a tRNA expressed in yeast cells. The aspartate and tryptophan residues in the DXTW motif of this protein are required for modification activity. Required for the acp3U20a modification of cytosolic tRNA. |
| AT2G41870 | Remorin family protein;(source:Araport11) |
| AT2G41900 | AtOXS2 specifcally entered the nuclear under salt stress. Te specifc nuclear localization of AtOXS2 could play a role in salt tolerance at the molecular level. Tese results implied that AtOXS2 might target some downstream cis-elements which are required for salt stress responses |
| AT2G41905 | transmembrane protein;(source:Araport11) |
| AT2G41990 | late embryogenesis abundant protein;(source:Araport11) |
| AT2G42100 | Actin-like ATPase superfamily protein;(source:Araport11) |
| AT2G42110 | hypothetical protein;(source:Araport11) |
| AT2G42270 | Similar to yeast Brr2p DEAD/DExH box ATP-dependent RNA helicase. |
| AT2G42280 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT2G42290 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G42300 | Together with bHLH60 associates with phytochrome interacting factor 7 to regulate hypocotyl elongation. |
| AT2G42330 | Transmembrane kinase involved in auxin signaling. Phosphorylates T101 of TAA1 to inactive the transaminase and block auxin biosynthesis. |
| AT2G42350 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G42360 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G42400 | VOZ transcription factor which acts as positive regulator of several salt-responsive genes. Functionally redundant in salt stress with VOZ1. |
| AT2G42560 | Late embryogenesis protein. Based on in vitro studies, likely plays a role in stablizing membranes in response to freezing stress. |
| AT2G42580 | Encodes a member of the TTL family and contains a thioredoxin like domain and three tandom TPRs. Interacts physically with BRL2/VH1 and appears to play a role in brassiosteroid and auxin signaling. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. The mRNA is cell-to-cell mobile. |
| AT2G42600 | Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins.PPC1 and PPC2 are crucial for balancing carbon and nitrogen metabolism. |
| AT2G42610 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT2G42680 | One of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is developmentally regulated. The mRNA is cell-to-cell mobile. |
| AT2G42770 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
| AT2G42780 | transcription elongation factor B polypeptide;(source:Araport11) |
| AT2G42835 | Natural antisense transcript overlaps with AT2G42830;(source:Araport11) |
| AT2G42860 | hypothetical protein;(source:Araport11) |
| AT2G43050 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G43060 | ILI1 binding bHLH 1;(source:Araport11) |
| AT2G43140 | bHLH129 is a nuclear localized basic helix loop helix protein. It has been shown to function as a transcriptional repressor. Overexpression of bHLH129 regulates root elongation and ABA response. |
| AT2G43210 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT2G43220 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G43310 | Member of the uL18 RNA-binding protein family. uL18 proteins share a short structurally conserved domain that binds the 5S rRNA and allow its incorporation into ribosomes. |
| AT2G43370 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G43410 | FPA is a gene that regulates flowering time in Arabidopsis via a pathway that is independent of daylength (the autonomous pathway). Mutations in FPA result in extremely delayed flowering. Double mutants with FCA have reduced fertility and single/double mutants have defects in siRNA mediated chromatin silencing. |
| AT2G43510 | Member of the defensin-like (DEFL) family. Encodes putative trypsin inhibitor protein which may function in defense against herbivory. |
| AT2G43520 | Encodes putative trypsin inhibitor protein which may function in defense against herbivory. Member of the defensin-like (DEFL) family. |
| AT2G43610 | Chitinase family protein;(source:Araport11) |
| AT2G43620 | Chitinase family protein;(source:Araport11) |
| AT2G43630 | nucleusenvelope protein;(source:Araport11) |
| AT2G43700 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G43710 | Encodes a stearoyl-ACP desaturase, involved in fatty acid desaturation. The ssi2 mutants have increased 18:0 and reduced 18:1 fatty acids. Exogenous application of glycerol to wild type plants mimics the ssi2 mutant phenotype. The altered 18:1 fatty acid content in the ssi2 mutants has an impact on SA- and JA-mediated defense signaling. ssi2 mutants resulted in hyper-resistance to green peach aphid and antibiosis activity in petiole exudates. Redundant Δ9 stearoyl-ACP desaturase gene which together with AAD1 and AAD5 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with AAD1, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase. |
| AT2G43770 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G43800 | Localizes to plasmodesmata (PD) through its transmembrane domain and is required for normal intercellular trafficking. Functions in a partially redundant manner with its closest homolog AtFH1. Regulates PD's permeability by anchoring actin filaments to PD. Caps the barbed end of actin filaments and stabilizes them in vitro. |
| AT2G43860 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G43870 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G43940 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G44010 | hypothetical protein;(source:Araport11) |
| AT2G44110 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO15 belongs to the clade II, with ATMLO13 and ATMLO15. The gene is expressed during early seedling growth, in root tips and flower (papillae, anthers and pollen grains), as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT2G44130 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family. Component of SCF ubiquitin protein ligase, interacts with phenylalanine ammonia-lyase. AtKFB39 is a homolog of previously identified AtKFB50 (At3g59940) and specifically interacts with Arabidopsis PAL3 and PAL4 in vitro. In planta, together with AtKFB01, KFB20 and KFB50, it regulates PAL protein stability thus controlling phenylpropanoid biosynthesis . |
| AT2G44210 | carboxyl-terminal peptidase (DUF239);(source:Araport11) |
| AT2G44270 | Encodes ROL5, a repressor of lrx1 mutants that develop aberrant root hairs. ROL5 is a homolog of yeast Ncs6p that affects TOR signaling. The target of rapamycin (TOR) pathway is a major regulator of cell growth in eukaryotes, and inhibition of this pathway by rapamycin reduces cell growth. ROL5 might function as a mitochondrial component of the TOR pathway that influences the plant's response to ROS (reactive oxygen species). |
| AT2G44340 | VQ18 is an ABA responsive gene and interacts with the ABI5 transcription factor. Along with its paralog VQ26, it is involved in negative regulation of ABA responses during early seedling development. |
| AT2G44400 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G44450 | beta glucosidase 15;(source:Araport11) |
| AT2G44480 | beta glucosidase 17;(source:Araport11) |
| AT2G44510 | CDK inhibitor P21 binding protein;(source:Araport11) |
| AT2G44530 | Phosphoribosyltransferase family protein;(source:Araport11) |
| AT2G44600 | hypothetical protein;(source:Araport11) |
| AT2G44670 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT2G44735 | transmembrane protein;(source:Araport11) |
| AT2G44810 | Mutant has defects in anther dehiscence, pollen maturation, and flower opening. The DAD1 protein is a chloroplastic phospholipase A1 that catalyzes the initial step of jasmonic acid biosynthesis. |
| AT2G44920 | Encodes a pentapeptide-repeat protein (PRP) composed of 25 repeats capped by N- and C-terminal a-helices. Unlike other PRPs, At2g44920 consists exclusively of type II b-turns |
| AT2G44950 | The gene encodes one of two orthologous E3 ubiquitin ligases in Arabidopsis that are involved in monoubiquitination of histone H2B. Regulates expression of disease resistance genes. |
| AT2G44970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G44980 | SNF2 domain-containing protein / helicase domain-containing protein;(source:Araport11) |
| AT2G45000 | Encodes a nucleoporin, a component of the nuclear pore complex, that appears to be a major negative regulator of auxin signalling. Loss of function mutants are embryo lethal. |
| AT2G45040 | Matrixin family protein;(source:Araport11) |
| AT2G45050 | Encodes a member of the GATA factor family of zinc finger transcription factors. A positive regulator of photomorphogenesis. |
| AT2G45150 | cytidinediphosphate diacylglycerol synthase 4;(source:Araport11) |
| AT2G45160 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
| AT2G45210 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G45280 | Encodes a protein similar to RAD51C involved in double stranded break repair via homologous recombination. Sensitive to DSB induced by Mitomycin C and gamma irradiation, interacts with Atxrcc3 in yeast two-hybrid assay. Required for female meiosis but not critical for mitosis under normal conditions. |
| AT2G45300 | encodes 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase involved in chorismate biosynthesis The mRNA is cell-to-cell mobile. |
| AT2G45340 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G45420 | LOB domain-containing protein 18;(source:Araport11) |
| AT2G45430 | Encodes a nuclear localized AT hook domain containing protein that can bind AT rich DNA in vitro. Overexpression of the gene results in delayed flowering. Is likely to act redundantly with AHL18, AHL27 and AHL29 in the regulation of flowering. It is also involved in both photo- and skotomorphogenesis. |
| AT2G45450 | ZPR1, a small leucine zipper-containing protein that interacts with REV HD-ZIPIII and is involved in the establishment of leaf polarity. |
| AT2G45460 | SMAD/FHA domain-containing protein;(source:Araport11) |
| AT2G45530 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G45540 | WD-40 repeat family protein / beige-like protein;(source:Araport11) |
| AT2G45550 | Member of CYP76C family of cytochrome P450 enzymes.Has geraniol 9- or 8-hydroxylase activity. |
| AT2G45570 | member of CYP76C |
| AT2G45600 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G45610 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G45620 | Nucleotidyltransferase family protein involved in transcript polyadenylation. TUTase which connects decapping activators and prevents the accumulation of excessively deadenylated mRNAs to avoid siRNA biogenesis. |
| AT2G45630 | Hydroxyphenylpyruvate reductase (HPPR) family member with low activity. |
| AT2G45685 | Natural antisense transcript overlaps with AT2G45680;(source:Araport11) |
| AT2G45720 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G45750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G45760 | encodes a protein that is similar to BONZAI1-binding protein BAP1. |
| AT2G45830 | downstream target of AGL15 2;(source:Araport11) |
| AT2G45850 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT2G45880 | Encodes a beta-amylase-like protein present in the nucleus rather than targeted to the chloroplast. Contains BRASSINAZOLE RESISTANT1 (BZR1)-type DNA binding domains. Activates gene expression in protoplast transactivation assays. |
| AT2G45970 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems.Mutant seeds have reduced seed longevity, higher tetrazolium salt uptake and reduction, and reduced lipid polyester barriers (PMID:32519347). |
| AT2G45980 | Encodes an Atg8-interacting protein that is partially associated with the ER during favorable growth conditions and becomes mainly associated with a spherical compartment that dynamically moves along the ER network. In stress induced plants, ATI1 is localized to a novel plastid associated bodies that are transported to vesicles, in what appears to be an autophagy dependent process. ATI1 interacts with number of other plastid proteins such as NPQ4 and APE1. |
| AT2G46140 | Late embryogenesis abundant protein;(source:Araport11) |
| AT2G46160 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G46170 | Reticulon family protein;(source:Araport11) |
| AT2G46210 | Fatty acid/sphingolipid desaturase;(source:Araport11) |
| AT2G46240 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Expression of BAG6 in leaves was strongly induced by heat stress. Knockout mutants exhibited enhanced susceptibility to fungal pathogen Botrytis cinerea. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. The mRNA is cell-to-cell mobile. |
| AT2G46280 | Encodes a homolog of mammalian TGF-beta receptor interacting protein. Co-immunoprecipitates with BRI1 and can be phosphorylated in vitro by BRI1 at specific sites (Thr-14, Thr-89, and either Thr-197 or Ser-198). May therefore be a cytoplasmic BRI1 substrate and involved in brassinosteroid regulated plant growth and development.The encoded protein has two DWD motifs. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT2G46308 | transmembrane protein;(source:Araport11) |
| AT2G46375 | hypothetical protein;(source:Araport11) |
| AT2G46410 | Nuclear-localized R3-type MYB transcription factor. Positive regulator of hair-cell differentiation. Preferentially transcribed in hairless cells. Moves from atrichoblasts into trichoblast via plasmodesmata in a tissue-specific mode. N-terminus and part of the Myb domain are required for this movement, with W76 playing a crucial role. Capability to increase the size-exclusion limit of plasmodesmata. Regulated by WEREWOLF. |
| AT2G46490 | hypothetical protein;(source:Araport11) |
| AT2G46520 | cellular apoptosis susceptibility protein, putative / importin-alpha re-exporter;(source:Araport11) |
| AT2G46590 | Encodes a protein containing Dof zinc finger motifs that is a positive regulator of light-mediated seed germination. Its expression is limited to vascular system of the mother plant. A recessive mutation is inherited as maternal-effect and expression is not detected in the embryo. Mutants are defective in seed germination and are more dependent on light and cold treatment and less sensitive to gibberellin during seed germination. It plays its main role downstream of PIL5 and DAG1 in the phytochrome B (phyB)-mediated pathway. |
| AT2G46600 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT2G46610 | Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT2G46620 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G46630 | serine/arginine repetitive matrix protein;(source:Araport11) |
| AT2G46660 | Encodes a member of CYP78A cytochrome P450 monooxygenase protein family that is required in the sporophytic tissue of the mother plant to promote seed growth. |
| AT2G46685 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. This particular miRNA is involved in the regulation of vascular development in inflorescence stems, primarily through the regulation of mRNA cleavage of the class III homeodomain-leucine zipper transcription factor ATHB15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC. Pri-mRNA coordinates for MIR166a (converted to TAIR10 based on PMID19304749): Chr2: 19175959-19177071 (forward), length: 1113 bp; exon coordinates: exon 1: 19175959 to 19176341, exon 2: 19176820 to 19177071; mature miRNA and miRNA* are located on exon 1. |
| AT2G46710 | ROP (Rho of plant GTPases) family member Involved in cell wall patterning. Encodes ROP inactivator, regulates the formation of ROP-activated domains; these in turn determined the pattern of cell wall pits. Positively regulates pit formation, but negatively regulates pit size, required for periodic formation of secondary cell wall pits. |
| AT2G46735 | death domain associated protein;(source:Araport11) |
| AT2G46740 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
| AT2G46770 | NAC transcription factor NST1. NST1 and NST2 are redundant in regulating secondary wall thickening in anther walls and siliques. An NST1 promoter fusion was detected in various tissues in which lignified secondary walls develop. Both MYC2 and MYC4 bind to the NST1 promoter and appear to regulate its expression in response to blue light. |
| AT2G46940 | fold protein;(source:Araport11) |
| AT2G46950 | cytochrome P450, family 709, subfamily B, polypeptide 2;(source:Araport11) |
| AT2G46960 | member of CYP709B |
| AT2G46980 | Encodes ASY3, a coiled-coil domain protein that is required for normal meiosis. |
| AT2G46990 | Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA20 lacks the conserved degron (domain II) found in many family members, and IAA20 fusion proteins are stable in Arabidopsis seedlings. IAA20 transcripts are induced by auxin treatment, and overexpression of IAA20 leads to defects in gravitropism, root development, root meristem maintenance, etiolation, and cotyledon vascular development. |
| AT2G46995 | hypothetical protein;(source:Araport11) |
| AT2G47015 | Encodes a microRNA that targets both a Laccase and Plantacyanin-like family member. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AUGCACUGCCUCUUCCCUGGC |
| AT2G47130 | Encodes a short-chain dehydrogenase/reductase that is not involved in ABA biosynthesis but plays an important role in plant defense response to bacteria. |
| AT2G47140 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G47170 | Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. Members of this family are known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. The mRNA is cell-to-cell mobile. |
| AT2G47180 | GolS1 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS1 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS1 have increased tolerance to salt, chilling, and high-light stress. |
| AT2G47190 | Encodes a MYB transcription factor that possesses an R2R3 MYB DNA binding domain and is known to regulate the expression of salt- and dehydration-responsive genes. Has been shown to bind calmodulin. |
| AT2G47460 | MYB12 belongs to subgroup 7 of the R2R3-MYB family. It strongly activates the promoters of chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), flavonol synthase (FLS) and - to a lesser extent - chalcone flavanone isomerase (CHI), but cannot activate the promoters of flavonoid-3'hydroxylase (F3'H) and dihydroflavonol 4-reductase (DF). The activation requires a functional MYB recognition element (MRE). Results from the myb12-1f allele indicate that an activation domain might be present in the C-terminus. Overexpression or knock-out plants do not show any obvious phenotype under greenhouse conditions. Young myb12-ko seedlings contain reduced amounts of flavonoids (quercetin and kaempferol), while seedlings as well as leaves of MYB12-OX plants displayed an increased flavonoid content. They did not show any significant difference in anthocyanin content. Expression of CHS and FLS shows a clear correlation to MYB12 expression levels. CHI and F3H show increased transcript levels in the MYB12-OX lines, but no differences in the knock-out. Even in the absence of functional MYB12, flavonol biosynthesis is not completely absent, suggesting functional redundancy. The redundant factors are MYB11 and MYB111 although MYB12 is primarily required for flavonol biosynthesis in roots. Mutations in MYB12 block both auxin and ethylene stimulation of flavonoid synthesis. |
| AT2G47600 | Encodes a magnesium/proton exchanger, member of putative Na+/Ca2+ antiporter gene family |
| AT2G47700 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G47740 | pre-tRNA tRNA-Gly (anticodon: CCC);(source:Araport11, TAIR10) |
| AT2G47750 | Encodes GH3.9, a member of the GH3 family auxin-responsive genes. gh3.9-1 mutants had greater primary root length, increased sensitivity to indole-3-acetic acid (IAA)-mediated root growth inhibition, but no obvious effects on apical dominance or leaf morphology. |
| AT2G47760 | Encodes an α-1,3-mannosyltransferase. Plants with mutations in the ALG3 protein have abnormal gylcoslation profiles. They also exhibit abnormal responses to MAMPs possibly because the glycan properties of FL22 are affected. |
| AT2G47800 | Encodes a plasma membrane localized ATPase transporter involved in multidrug transport. The expression of this gene is upregulated by herbicide safeners such as benoxacor, fluxofenim and fenclorim. The mRNA is cell-to-cell mobile. |
| AT2G47810 | nuclear factor Y, subunit B5;(source:Araport11) |
| AT2G47860 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT2G47890 | Acts as a positive regulator of red light signaling; overexpression causes markedly shortened hypocotyls under various light states. Binds to the HY5 promoter to activate its transcription, while both BBX21 and HY5 associate with its promoter to positively regulate its expression. T |
| AT2G47910 | Encodes a chloroplast thylakoid membrane protein. Required for the assembly/accumulation of the NAD(P)H dehydrogenase complex of the photosynthetic electron transport chain. |
| AT2G47920 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT2G47990 | Encodes a transducin family nucleolar protein with six WD40 repeats that is most likely involved in 18S rRNA biogenesis. The slow progression of the gametophytic division cycles in swa1 suggested that the SWA1 protein is required for the normal progression of mitotic division cycles through the regulation of cell metabolism. Ubiquitously expressed throughout the plant. |
| AT2G48000 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G48010 | receptor-like serine/threonine kinase (RKF3) The mRNA is cell-to-cell mobile. |
| AT2G48030 | DNAse I-like superfamily protein;(source:Araport11) |
| AT2G48080 | oxidoreductase, 2OG-Fe(II) oxygenase family protein;(source:Araport11) |
| AT3G01060 | lysine-tRNA ligase;(source:Araport11) |
| AT3G01080 | member of WRKY Transcription Factor; Group I |
| AT3G01085 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G01090 | encodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It can also interact with PRL1 DWD-containing protein. Based on in vitro degradation assays and cul4cs and prl1 mutants, there is evidence that AKIN10 is degraded in a proteasome-dependent manner, and that this depends on a CUL4-PRL1 E3 ligase |
| AT3G01150 | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination. |
| AT3G01190 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G01200 | Encodes a PPDK regulatory protein that has protein kinase activity but lacks protein phosphatase activity towards PPDK (pyruvate orthophosphate dikinase). |
| AT3G01290 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT3G01311 | actin cross-linking protein, putative (DUF569);(source:Araport11) |
| AT3G01513 | hypothetical protein;(source:Araport11) |
| AT3G01630 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G01640 | AtGlcAK is a sugar kinase able to phosphorylate D-GlcA to D-GlcA-1-phosphate in the presence of ATP. |
| AT3G01660 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G01680 | Encodes a protein localized to phloem filaments that is required for phloem filament formation. The mRNA is cell-to-cell mobile. |
| AT3G01810 | EEIG1/EHBP1 protein amino-terminal domain protein;(source:Araport11) |
| AT3G01840 | Encodes a putative LysM-containing receptor-like kinase. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. Based on protein sequence alignment analysis, it was determined to be a pseudo kinase since lack of the ATP-binding P-loop in the kinase domain. |
| AT3G01850 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT3G01870 | hypothetical protein (DUF946);(source:Araport11) |
| AT3G01900 | member of CYP94B |
| AT3G01940 | transmembrane protein, putative (DUF 3339);(source:Araport11) |
| AT3G02110 | serine carboxypeptidase-like 25;(source:Araport11) |
| AT3G02130 | Encodes a receptor-like kinase RPK2 (also known as TOADSTOOL 2/TOAD2). Functions as a regulator of meristem maintenance. Mutants are insensitive to synthetic CLV3 peptide. Mutations in the RPK2 also result in stem cell expansion and increased number of floral organs, as seen in the other clv mutants. Forms homo-oligomers. |
| AT3G02140 | Encodes a protein that acts in the nucleus and is an important negative regulator of ABA and salt stress responses, and could play a critical role in controlling root elongation, floral initiation and starch degradation. |
| AT3G02230 | RGP1 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1/rgp2 (at5g15650) double mutants have a male gametophyte lethal phenotype. RGP1 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. The mRNA is cell-to-cell mobile. |
| AT3G02280 | Flavoenzyme-encoding gene. |
| AT3G02335 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT3G02410 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G02630 | One of seven acyl acyl carrier proteins. Expressed primarily in developing seeds.Involved in fatty acid metabolism. Redundant Δ9 stearoyl-ACP desaturase gene which together with FAB2 and AAD1 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with FAB2, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase. |
| AT3G02690 | Nucleotide/sugar transporter family protein |
| AT3G02730 | Encodes a type-f thioredoxin. Has a role in the short-term activation of carbon metabolism. Loss affects growth under short-day conditions. |
| AT3G02880 | Probable inactive receptor kinase; Commonly-enriched candidate LPS-interacting PM-associated proteins from the three affinity chromatography systems with LPS chemotype Xcc 8530 as ligand. |
| AT3G02900 | Low-density receptor-like protein;(source:Araport11) |
| AT3G02910 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT3G02970 | EXORDIUM like 6;(source:Araport11) |
| AT3G03000 | Calmodulin like protein localized in the plant vacuolar compartment with a function of binding and modifying the activity of a tonoplast transporter (AtNHX1) from within the vacuole in a Ca+2- and pH-dependent manner |
| AT3G03050 | encodes a cellulose synthase like protein. mutations initiate root hairs that rupture at their tip soon after initiation. is required for the synthesis of a noncellulosic wall polysaccharide. |
| AT3G03140 | Encodes a chromatin-associated protein that interacts with plant nuclear lamin-like components to regulate nuclear size. |
| AT3G03240 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G03272 | Encodes a ECA1 gametogenesis related family protein |
| AT3G03450 | Encodes a DELLA protein, a member of the GRAS superfamily of putative transcription factors. DELLA proteins restrain the cell proliferation and expansion that drives plant growth. Negative regulator of the response to GA in controlling seed germination. GA triggers the degradation of RGL2 protein in a process blocked by both proteasome inhibitors and serine/threonine phosphatase inhibitors. The protein undergoes degradation in response to GA via the 26S proteasome. RGL2 may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Rapidly degraded in response to GA. Regulates GA-promoted seed germination. Involved in flower and fruit development. |
| AT3G03480 | acetyl CoA:(Z)-3-hexen-1-ol acetyltransferase;(source:Araport11) |
| AT3G03650 | Exostosin family protein;(source:Araport11) |
| AT3G03670 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G03680 | Member of a family of Multiple C2 Domain and Transmembrane Region Proteins. |
| AT3G03760 | LOB domain-containing protein 20;(source:Araport11) |
| AT3G03780 | Encodes a cytosolic methionine synthase, involved in methionine regeneration via the activated methyl cycle (or SAM cycle) |
| AT3G03855 | Annotated as pseudogene of disease resistance protein.Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 . |
| AT3G03890 | Dimeric β-barrel protein that is structurally related to the putative non-canonical heme oxygenase (HO) and is located in chloroplasts. May function additionally in the tetrapyrrole biosynthetic pathway. |
| AT3G03950 | Physically interacts with CIPK1. Located in the nucleus. |
| AT3G04010 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT3G04080 | Encodes an Golgi-localized integral membrane enzyme with nucleoside diphosphate activity that when mutated in combination with ATAPY2 causes a complete inhibition of pollen germination.With respect to substrate specificity, APY1 shows the following preferences UTP>IDP>GDP. |
| AT3G04090 | Belongs to a family of plant aquaporins. Similar to yeast and radish aquaporins. Located on ER. |
| AT3G04110 | putative glutamate receptor (GLR1.1). Contains a functional cation - permeable pore domain. Involved in cellular cation homeostasis. |
| AT3G04240 | Has O-linked N-acetyl glucosamine transferase activity. Similar to Arabidopsis SPY gene. |
| AT3G04330 | Kunitz family trypsin and protease inhibitor protein;(source:Araport11) |
| AT3G04420 | NAC domain containing protein 48;(source:Araport11) |
| AT3G04510 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT3G04550 | Encodes an ancillary chaperone protein that functions in Rubisco biogenesis. RAF1 dimers function in the assembly of the large subunit of Rubisco. Co-expression of RAF1 and rbcL in tobacco cells results in increased photosynthesis and plant growth. The mRNA is cell-to-cell mobile. |
| AT3G04600 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
| AT3G04620 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT3G04640 | glycine-rich protein;(source:Araport11) |
| AT3G04680 | Encodes a nuclear protein that functions in mRNA processing. Mutations in this gene cause embryo lethality and reduced transmission through the female gametophyte. Over-expression of a CLPS3:TAP protein changes the relative levels of two alternatively processed FCA transcripts. It also causes abnormal phyllotaxy and flower development, early flowering under long and short days, and increased levels of CUC1 and WUS expression. |
| AT3G04820 | Pseudouridine synthase family protein;(source:Araport11) |
| AT3G04880 | encodes a novel protein involved in DNA repair from UV damage. Isolated by functional complementation of E. coli UV-sensitive mutants (UVR genes). |
| AT3G04890 | adenine phosphoribosyltransferase-like protein, putative (DUF2358);(source:Araport11) |
| AT3G04930 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT3G05130 | paramyosin-like protein;(source:Araport11) |
| AT3G05150 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G05155 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G05165 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G05170 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT3G05200 | Encodes a putative RING-H2 zinc finger protein ATL6 (ATL6). The mRNA is cell-to-cell mobile. |
| AT3G05250 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G05345 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT3G05370 | receptor like protein 31;(source:Araport11) |
| AT3G05390 | S-adenosyl-L-methionine-dependent methyltransferase;(source:Araport11) |
| AT3G05410 | Photosystem II reaction center PsbP family protein;(source:Araport11) |
| AT3G05460 | sporozoite surface protein-like protein;(source:Araport11) |
| AT3G05470 | Actin-binding FH2 (formin homology 2) family protein;(source:Araport11) |
| AT3G05490 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT3G05600 | Encodes a cytosolic epoxide hydrolase capable of acting on 9,10-epoxystearic acid and on 12,13- epoxyoctadec-9-enoic acid that is involved in the synthesis of poly-hydroxylated cutin monomers. |
| AT3G05610 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT3G05620 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT3G05625 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G05630 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. Regulates vesicle trafficking. Required for auxin transport and distribution and hence auxin responses. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Plays a major role in phosphatidic acid production during phosphate deprivation. Induced upon Pi starvation in both shoots and roots. Involved in hydrolyzing phosphatidylcholine and phosphatidylethanolamine to produce diacylglycerol for digalactosyldiacylglycerol synthesis and free Pi to sustain other Pi-requiring processes. Does not appear to be involved in root hair patterning. Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT3G05650 | receptor like protein 32;(source:Araport11) |
| AT3G05770 | hypothetical protein;(source:Araport11) |
| AT3G05800 | AtBS1(activation-tagged BRI1 suppressor 1)-interacting factor 1;(source:Araport11) |
| AT3G05937 | hypothetical protein;(source:Araport11) |
| AT3G05960 | Encodes a hexose sugar transporter that is expressed in pollen. STP6 may play a role in providing sugars during late pollen maturation or pollen tube germination. |
| AT3G05970 | encode peroxisomal long-chain acyl-CoA synthetase (LACS) isozymes |
| AT3G05990 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G06050 | Encodes a mitochondrial matrix localized peroxiredoxin involved in redox homeostasis. Knockout mutants have reduced root growth under certain oxidative stress conditions. |
| AT3G06100 | Encodes NIP7;1, an anther-specific boric acid transporter of the aquaporin superfamily regulated by an unusual tyrosine in helix 2 of the transport pore. |
| AT3G06130 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G06145 | RING zinc finger protein;(source:Araport11) |
| AT3G06150 | cytochrome P450 family protein;(source:Araport11) |
| AT3G06280 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G06350 | Encodes a bi-functional dehydroquinate-shikimate dehydrogenase enzyme that catalyzes two steps in the chorismate biosynthesis pathway. |
| AT3G06360 | Encodes an arabinogalactan-protein (AGP27). |
| AT3G06370 | member of Sodium proton exchanger family |
| AT3G06380 | Member of plant TLP family which differs in having an F box domain. Interacts with ASK proteins.Plasma membrane tethering is mediated by PIP2 binding domain. Mutants are insensitive to ABA. May act redundantly with its paralog TPL3. |
| AT3G06400 | Encodes a SWI2/SNF2 chromatin remodeling protein belonging to the ISWI family. Involved in nuclear proliferation during megagametogenesis and cell expansion in the sporophyte. Constitutively expressed. RNAi induced loss of function in megagametogenesis results in female sterility.35S:RNAi plants have reduced stature. Double mutation in CHR17 and CHR11 results in the loss of the evenly spaced nucleosome pattern in gene bodies, but does not affect nucleosome density. |
| AT3G06420 | Autophagy protein. |
| AT3G06460 | ELO family protein containing a characteristic histidine motif which binds to AtCb5-B, interacts with AtBI-1 |
| AT3G06483 | Pyruvate dehydrogenase kinase (PDK) specifically phosphorylates the E1α subunit of the pyruvate dehydrogenase complex (PDC) on a Ser residue using ATP as a phosphate donor. PDK is a unique type of protein kinase having a His-kinase-like sequence but Ser-kinase activity. Site-directed mutagenesis and structural analysis indicate that PDK belongs to the GHKL superfamily. |
| AT3G06540 | Encodes a cytoplasmic Rab escort protein that preferentially binds the GDP-bound form of Rab and stimulates geranylgeranylation of various Rab GTPases in Arabidopsis extracts in vitro. |
| AT3G06560 | Encodes a poly(A) polymerase. Located in the cytoplasm. |
| AT3G06590 | Encodes RITF1, a bHLH transcription factor that regulates the transcription of several genes involved in the detoxification of reactive oxygen species generated by salt stress. |
| AT3G06640 | PAS domain-containing protein tyrosine kinase family protein;(source:Araport11) |
| AT3G06720 | Encodes importin alpha involved in nuclear import. Protein interacts with Agrobacterium proteins VirD2 and VirE2. Is not individually essential for Agrobacterium-mediated root transformation, but when overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT3G06740 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT3G06750 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G06770 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G06780 | glycine-rich protein;(source:Araport11) |
| AT3G06810 | Encodes a protein with similarity to acyl-CoA dehydrogenases. Mutations in IBR3 render plants resistant to indole-3-butryic acid, a putative storage form of the biologically active auxin IAA (indole-3-acetic acid). IBR3 is hypothesized to carry out the second step in a β-oxidation-like process of IBA metabolism in Arabidopsis. Though its subcellular location has not been determined, IBR3 has a peroxisomal targeting sequence and two other putative IBA metabolic enzymes (IBR1 and IBR10) can be found in this organelle. No specific enzymatic activity has been documented for IBR3, but double mutant analyses with CHY1 argue against a role for IBR3 in general fatty acid β-oxidation. The mRNA is cell-to-cell mobile. |
| AT3G06840 | hypothetical protein;(source:Araport11) |
| AT3G06910 | Encodes a deSUMOylating enzyme. In vitro it has both peptidase activity and isopeptidase activity: it can cleave the C-terminal residues from SUMO to activate it for attachment to a target protein and it can also act on the isopeptide bond between SUMO and another protein. In vitro assays suggest that this enzyme is active against SUMO1 and SUMO2. It has weak activity with SUMO3 and cannot act on SUMO5. The N-terminal regulatory region of this protein is required for full activity. Suppresses growth during salt stress. |
| AT3G07120 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G07130 | Encodes PAP15, a purple acid phosphatase with phytase activity. Expression of PAP15 is developmentally and temporally regulated, with strong expression at the early stages of seedling growth and pollen germination. The expression is also organ/tissue-specific, with strongest expression in the vasculature, pollen grains, and roots. Recombinant PAP protein exhibits broad substrate specificity with moderate phytase activity. PAP15 likely mobilizes phosphorus reserves in plants, particularly during seed and pollen germination. |
| AT3G07230 | wound-responsive protein-like protein;(source:Araport11) |
| AT3G07250 | RNA-binding (RRM-RBD-RNP motif) domain nuclear transport factor 2 family protein;(source:Araport11) |
| AT3G07300 | NagB/RpiA/CoA transferase-like superfamily protein;(source:Araport11) |
| AT3G07350 | sulfate/thiosulfate import ATP-binding protein, putative (DUF506);(source:Araport11) |
| AT3G07420 | Encodes an asparaginyl-tRNA synthetase. |
| AT3G07500 | Encodes one of four FRS (FAR1-RELATED SEQUENCE) factor-like genes in Arabidopsis. FRS factors are characterized by having an N-terminal C2H2-type chelating motif of the WRKY- Glial Cell Missing1 family, a central core transposase domain of Mutator-like element transposases, and a C-terminal SWIM domain. The four FRF-like genes in Arabidopsis share only the N-terminal motif with FRS proteins. |
| AT3G07510 | maternal effect embryo arrest protein;(source:Araport11) |
| AT3G07520 | member of Putative ligand-gated ion channel subunit family. Contains a functional cation - permeable pore domain. Involved in cellular cation homeostasis. |
| AT3G07620 | glycosyltransferase;(source:Araport11) |
| AT3G07680 | Encodes an Golgi-localized p24 protein. Interacts with p24delta5 at ER export sites for ER exit and coupled transport to the Golgi apparatus. The mRNA is cell-to-cell mobile. |
| AT3G07770 | HEAT SHOCK PROTEIN 89.1;(source:Araport11) |
| AT3G07910 | reactive oxygen species modulator-like protein;(source:Araport11) |
| AT3G07940 | Calcium-dependent ARF-type GTPase activating protein family;(source:Araport11) |
| AT3G07960 | Encodes phosphatidylinositol-4-phosphate 5-kinase 6 (PIP5K6). Regulates clathrin-dependent endocytosis in pollen tubes. |
| AT3G08020 | PHD finger family protein;(source:Araport11) |
| AT3G08030 | The mRNA of this gene is expressed in viable seeds. Its detection in a dry seed lot has potential for use as a molecular marker for germination performance as absence of expression correlates with decreased germination. Encodes DUF642 cell wall protein. |
| AT3G08505 | zinc finger (CCCH-type/C3HC4-type RING finger) family protein;(source:Araport11) |
| AT3G08580 | mitochondrial ADP/ATP carrier |
| AT3G08670 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT3G08680 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G08860 | Encodes a protein that is predicted to have beta-alanine aminotransferase activity. |
| AT3G08870 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G08920 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT3G08960 | Ran effector. |
| AT3G09000 | Encodes a microtubule-associated protein. Plays a minor role in cortical microtubule organization during leaf development. |
| AT3G09010 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G09030 | EAP3 is a cytolsolic BTB/POZ-domain protein involved in trafficking of PEN3. |
| AT3G09060 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G09200 | Ribosomal protein L10 family protein;(source:Araport11) |
| AT3G09260 | Encodes beta-glucosidase.The major constituent of ER bodies. One of the most abundant proteins in Arabidopsis seedlings. Exist in an soluble (inactive) and non-soluble (active) form, most probably formed in a polymerization process. Involved in the mutualistic interaction between Arabidopsis and the endophytic fungus Piriformospora indica. |
| AT3G09300 | OSBP(oxysterol binding protein)-related protein 3B;(source:Araport11) |
| AT3G09320 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G09350 | Encodes one of the Arabidopsis orthologs of the human Hsp70-binding protein 1 (HspBP-1) and yeast Fes1p: Fes1A (AT3G09350), Fes1B (AT3G53800), Fes1C (AT5G02150). Fes1A is cytosolic and associates with cytosolic Hsp70. Mutants showed increased heat-sensitive phenotype suggestion the involvement of Fes1A in acquired thermotolerance. Does not have nucleotide exchange factor activity in vitro. |
| AT3G09430 | peptide transporter family protein;(source:Araport11) |
| AT3G09520 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT3G09550 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G09570 | Lung seven transmembrane receptor family protein;(source:Araport11) |
| AT3G09580 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT3G09630 | Ribosomal protein L4/L1 family;(source:Araport11) |
| AT3G09650 | RNA binding protein involved in the processing of chloroplast psbB-psbT-psbH-petB-petD transcript unit. |
| AT3G09780 | CRINKLY4 related 1;(source:Araport11) |
| AT3G09830 | Encodes a member of subfamily VIIa of the receptor-like cytoplasmic kinases (RLCKs). It contributes to pattern-triggered immunity in response to P. syringae. |
| AT3G09890 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G09930 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G09940 | Encodes a member of the monodehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica. |
| AT3G09970 | Encodes a cytosolic tyrosine phosphatase. |
| AT3G10015 | pre-tRNA tRNA-Leu (anticodon: TAA);(source:Araport11, TAIR10) |
| AT3G10030 | aspartate/glutamate/uridylate kinase family protein;(source:Araport11) |
| AT3G10050 | first enzyme in the biosynthetic pathway of isoleucine |
| AT3G10080 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT3G10130 | Cholorplast plastoglobule localized heme binding protein. |
| AT3G10270 | Protein targeting to mitochondria is influenced by UTR sequences. |
| AT3G10300 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT3G10370 | mitochondrial FAD-dependent glycerol-3-phosphate dehydrogenase. possibly involved in storage lipid catabolism and glycerol assimilation, and in glycerol-3-phosphate shuttle which transports reducing power from cytosol to mitochondrion. |
| AT3G10470 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT3G10560 | member of CYP77A |
| AT3G10572 | APEM9 is required for both PTS1- and PTS2-dependent protein transport. APEM9 interacts with PEX6 in BiFC assay and mating-based Split ubiquitin system. BiFC data shows that APEM9 is required for peroxisomal localization of PEX1-PEX6 complex. These results indicate that APEM9 functions like mammalian PEX26 and yeast PEX15. |
| AT3G10580 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G10585 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G10600 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. |
| AT3G10680 | SLI1 is a heat shock like protein that is found in sieve elements, sieve plates and spherical bodies peripheral to the mitochondria. Mutants show increased phloem feeding by aphids and decreased heat tolerance. |
| AT3G10710 | root hair specific 12;(source:Araport11) |
| AT3G10790 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G10810 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT3G10960 | Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2). |
| AT3G10986 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT3G11030 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).The chemical evidence for function comes from xylan NMR analysis. Secondary wall thickening phenotype can be observed only in double or triple mutant combinations with esk1. |
| AT3G11070 | Outer membrane OMP85 family protein;(source:Araport11) |
| AT3G11110 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G11120 | Ribosomal protein L41 family;(source:Araport11) |
| AT3G11320 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT3G11370 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G11385 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G11397 | prenylated RAB acceptor 1.A3;(source:Araport11) |
| AT3G11405 | hypothetical protein;(source:Araport11) |
| AT3G11410 | Encodes protein phosphatase 2C. Negative regulator of ABA signalling. Expressed in seeds during germination. mRNA up-regulated by drought and ABA. |
| AT3G11440 | Member of the R2R3-MYB gene family. Similar to GA-induced Barley myb gene. May be induced during germination in response to GA. Double mutants with MYB33 are male sterile, showing defects in pollen development and anther development. Contains a binding site for miRNA159 and may be spatially regulated by this micro RNA. A highly conserved RNA secondary structure abuts the miR159 binding site which facilitates its regulation by miR159. The male sterile phenotype of the MYB33/MYB65 double mutant is light and temperature sensitive. Fertility can be restored with increased light intensity and lower temperatures. |
| AT3G11450 | Encodes a ZRF1 chromatin regulator. Functions in regulating plant growth and development. |
| AT3G11470 | Encodes one of three splice variants. Differs in having CM in positions 88 and 89. The protein is localized to the mitochondria where it phosphopantetheinylates the mature apo mtACP isoforms. It is an essential gene as homozygous mutants cannot be recovered (embryo lethal). |
| AT3G11510 | Ribosomal protein S11 family protein;(source:Araport11) |
| AT3G11570 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G11580 | SOD7 encodes nuclear localized B3 DNA binding domain and a transcriptional repression motif. Belongs to the RAV gene family. Functions in regulation of seed size and binds to and represses KLU. Transcription repressor involved in regulation of inflorescence architecture. |
| AT3G11660 | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus. Localization of the gene product is similar to that of NHL3 (plasma membrane) but it is yet inconclusive. |
| AT3G11690 | hypothetical protein;(source:Araport11) |
| AT3G11700 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT3G11740 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT3G11760 | structural maintenance of chromosomes flexible hinge domain protein;(source:Araport11) |
| AT3G11920 | glutaredoxin-like protein;(source:Araport11) |
| AT3G12030 | transmembrane/coiled-coil protein (Protein of unknown function DUF106, transmembrane);(source:Araport11) |
| AT3G12060 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G12120 | Major enzyme responsible for the synthesis of 18:2 fatty acids in the endoplasmic reticulum. Contains His-rich motifs, which contribute to the interaction with the electron donor cytochrome b5. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
| AT3G12145 | A novel leucine-rich repeat protein. Interacts directly with MADS domain transcription factor. |
| AT3G12180 | Cornichon family protein |
| AT3G12345 | FKBP-type peptidyl-prolyl cis-trans isomerase;(source:Araport11) |
| AT3G12420 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT3G12440 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT3G12502 | Natural antisense transcript overlaps with AT3G12500;(source:Araport11) |
| AT3G12545 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G12560 | Encodes a telomeric DNA-binding protein. |
| AT3G12610 | Plays role in DNA-damage repair/toleration. Partially complements RecA- phenotypes. |
| AT3G12690 | Encodes a putative serine/threonine kinase It is expressed specifically in pollen and appears to function redundantly with AGC1.7 to regulate polarized growth of pollen tubes. |
| AT3G12700 | Encodes an aspartic protease has an important regulatory function in chloroplasts that not only influences photosynthetic carbon metabolism but also plastid and nuclear gene expression. |
| AT3G12750 | A member of Zrt- and Irt-related protein (ZIP) family. transcript is induced in response to zinc deficiency in the root. |
| AT3G12810 | Encodes a protein similar to ATP-dependent, chromatin-remodeling proteins of the ISWI and SWI2/SNF2 family. Genetic analyses suggest that this gene is involved in multiple flowering pathways. Mutations in PIE1 results in suppression of FLC-mediated delay of flowering and causes early flowering in noninductive photoperiods independently of FLC. PIE1 is required for expression of FLC in the shoot apex but not in the root.Along with ARP6 forms a complex to deposit modified histone H2A.Z at several loci within the genome. This modification alters the expression of the target genes (i.e. FLC, MAF4, MAF6). The mRNA is cell-to-cell mobile. |
| AT3G12880 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G12890 | Encodes a protein belonging to a class of CCT (CONSTANS, CONSTANS-like, TOC1) domain proteins. The protein contains a 43 amino acid-long sequence with high homology to the CCT domain but does not have any B-box or GATA-type zinc finger domains. Functions as a transcriptional activator and regulates the expression of at least a subset of sugar-inducible genes. |
| AT3G12900 | S8H hydroxylates scopoletin to generate fraxetin (8-hydroxyscopoletin). Fraxetin and its oxidized analog sideretin (5-hydroxyfraxetin) are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil.S8H hydroxylates scopoletin to generate fraxetin (8-hydroxyscopoletin). Fraxetin and its oxidized analog sideretin (5-hydroxyfraxetin) are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil. |
| AT3G12920 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT3G13210 | crooked neck protein, putative / cell cycle protein;(source:Araport11) |
| AT3G13220 | Encodes a ATP-binding cassette transporter G26 (ABCG26) involved in tapetal cell and pollen development. Required for male fertility and pollen exine formation. |
| AT3G13290 | varicose-like protein;(source:Araport11) |
| AT3G13310 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT3G13380 | Similar to BRI, brassinosteroid receptor protein. |
| AT3G13390 | SKU5 similar 11;(source:Araport11) |
| AT3G13420 | transmembrane protein;(source:Araport11) |
| AT3G13510 | carboxyl-terminal peptidase, putative (DUF239);(source:Araport11) |
| AT3G13525 | snoRNA;(source:Araport11) |
| AT3G13550 | Encodes a protein similar to ubiquitin-conjugating enzyme (E2) variant proteins (UEV); lacks catalytic cysteine residue found in ubiquitin-conjugating enzyme E2. Represses photomorphogenesis and induces skotomorphogenesis in the dark. |
| AT3G13590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G13650 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT3G13672 | SINAT homolog with truncated RING finger and zinc finger domains. |
| AT3G13700 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G13720 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
| AT3G13740 | Encodes one of two chloroplast Mini-RNase III-like enzymes in Arabidopsis. Double mutants display imprecise maturation of 23S rRNA and other rRNAs. |
| AT3G13770 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G13784 | cell wall invertase 5;(source:Araport11) |
| AT3G13840 | GRAS family transcription factor;(source:Araport11) |
| AT3G13845 | transmembrane protein;(source:Araport11) |
| AT3G13980 | SKI/DACH domain protein;(source:Araport11) |
| AT3G14000 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
| AT3G14050 | Involved in the maintenance of the (p)ppGp level to accustom plastidial gene expression to darkness. |
| AT3G14067 | Encodes a protein with similarity to serine protease, subtilisin, that is upregulated during senescence and expressed in the arial portions of the plant.Loss of function mutations have increased branch number but normal silique length and seed set and therefore have increased fertility. |
| AT3G14090 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT3G14100 | Triple RNA Recognition Motif protein involved in the dynamic and reversible aggregation of translationally repressed mRNAs during hypoxia.During hypoxia, UBP1C association with non? uracil-rich mRNAs is enhanced concomitant with its aggregation into microscopically visible cytoplasmic foci, referred to as UBP1 stress granules (SGs). This mRNA association occurs as global levels of protein synthesis decline during hypoxia. Upon reoxygenation, rapid UBP1 SG disaggregation coincides with the return of the stabilized mRNAs to polysomes. |
| AT3G14110 | Encodes a novel coiled-coil, TPR domain containing protein that is localized to the chloroplast membrane and is involved in chlorophyll biosynthesis. Mutants accumulate protochlorophyllide, an intermediate in the chlorophyll biosynthesis pathway, in dark and release singlet oxygen in plastids in a controlled and non-invasive manner upon a dark/light shift. |
| AT3G14180 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT3G14210 | A semidominant QTL which has an epistatic effect on the Epithiospecifier gene. Represses nitrile formation and favors isothiocyanate production during glucosinolate hydrolysis. The functional allele deters the insect herbivory T. ni. |
| AT3G14225 | Contains lipase signature motif and GDSL domain. |
| AT3G14240 | Subtilase family protein;(source:Araport11) |
| AT3G14250 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G14300 | pectinesterase family protein;(source:Araport11) |
| AT3G14310 | encodes a pectin methylesterase, targeted by a cellulose binding protein (CBP) from the parasitic nematode Heterodera schachtii during parasitism. |
| AT3G14350 | STRUBBELIG-receptor family 7;(source:Araport11) |
| AT3G14370 | The WAG2 and its homolog, WAG1 each encodes protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT3G14395 | Protein Involved in the Regulation of Herbivore-Associated Signaling Pathways, affecting the expression of genes involved in biosynthesis and signaling of the jasmonic acid and salicylic acid hormones. |
| AT3G14420 | Encodes a glycolate oxidase that modulates reactive oxygen species-mediated signal transduction during nonhost resistance. The mRNA is cell-to-cell mobile. |
| AT3G14440 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane. |
| AT3G14450 | RNA-binding protein, putative, contains Pfam profile: PF00076 RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (2 copies). Contains PAM PABC binding domain. |
| AT3G14480 | glycine/proline-rich protein;(source:Araport11) |
| AT3G14600 | Ribosomal protein L18ae/LX family protein;(source:Araport11) |
| AT3G14710 | RNI-like superfamily protein;(source:Araport11) |
| AT3G14730 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G14760 | transmembrane protein;(source:Araport11) |
| AT3G14770 | Nodulin MtN3 family protein;(source:Araport11) |
| AT3G14840 | Encodes LRR-RLK protein that is localized to the plasma membrane and is involved in regulation of plant innate immunity to microbes. LIK1 is phosphorylated by CERK1, a kinase involved in chitin perception. The mRNA is cell-to-cell mobile. |
| AT3G14855 | pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10) |
| AT3G14910 | Rab3 GTPase-activating protein non-catalytic subunit;(source:Araport11) |
| AT3G15020 | Lactate/malate dehydrogenase family protein;(source:Araport11) |
| AT3G15095 | Encodes HCF243 (high chlorophyll fluorescence), a chloroplast-localized protein involved in the D1 protein stability of the photosystem II complex1. |
| AT3G15170 | Encodes a transcription factor involved in shoot apical meristem formation and cotyledon separation. Functions redundantly with CUC2 and CUC3. The cuc1 cuc2 double mutant phenotype is first detectable at the heart stage, as embryos lacking two distinct bulges of cotyledonary primordia.In post embryonic development it plays a role in axillary meristem formation, boundary separation, gynoecium and ovule development.Contains a MIR164 binding site. |
| AT3G15180 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G15210 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-4). The protein contains one AP2 domain. Acts as a negative regulator of JA-responsive defense gene expression and resistance to the necrotrophic fungal pathogen Fusarium oxysporum and antagonizes JA inhibition of root elongation. The mRNA is cell-to-cell mobile. |
| AT3G15350 | G14 enzyme |
| AT3G15357 | phosphopantothenoylcysteine decarboxylase subunit;(source:Araport11) |
| AT3G15360 | encodes a prokaryotic thioredoxin The mRNA is cell-to-cell mobile. |
| AT3G15370 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT3G15460 | Encodes one of two Arabidopsis orthologs of yeast BRX1, a protein involved in maturation of the large ribosomal subunit. The proteins are mainly localized in nucleolus. Mutant plants are affected in pre-rRNA processing. |
| AT3G15500 | Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3. The mRNA is cell-to-cell mobile. |
| AT3G15510 | Note of caution: not to be confused with another protein (AtNAC6 locus AT5G39610) which on occasion has also been referred to as AtNAC2. |
| AT3G15520 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT3G15530 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G15570 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G15700 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G15720 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G15780 | transmembrane protein;(source:Araport11) |
| AT3G15820 | Functions as phosphatidylcholine:diacylglycerol cholinephosphotransferase, a major reaction for the transfer of 18:1 into phosphatidylcholine for desaturation and also for the reverse transfer of 18:2 and 18:3 into the triacylglycerols synthesis pathway |
| AT3G15860 | plant self-incompatibility protein S1 family protein;(source:Araport11) |
| AT3G15990 | Vascular cambium-localized sulfate transporter, mediates xylem-to-phloem transfer of phosphorus. 2 for its preferential distribution |
| AT3G16060 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT3G16150 | Encodes an asparaginase that catalyzes the degradation of L-asparagine to L-aspartic acid and ammonia. The mRNA is cell-to-cell mobile. |
| AT3G16180 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
| AT3G16330 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
| AT3G16350 | MYB-like transcription factor involved in nitrate signaling trough regulation of CHL1. |
| AT3G16450 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT3G16460 | Mannose-binding protein |
| AT3G16500 | phytochrome-associated protein 1 (PAP1) |
| AT3G16510 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G16520 | UDP-glucosyl transferase 88A1;(source:Araport11) |
| AT3G16560 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G16570 | Encodes RALF23, a member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. RALF23 is significantly downregulated by brassinolide treatment of seedlings. Overexpression of AtRALF23 impairs brassinolide-induced hypocotyls elongation, and mature overexpressing plants are shorter and bushier. RALF23 overexpression produces slower growing seedlings with roots that have reduced capacity to acidify the rhizosphere. |
| AT3G16640 | Encodes a protein homologous to translationally controlled tumor protein (TCTP) from Drosophila. In flies, TCTP functions guanine nucleotide exchange factor in the TOR signaling pathway. TCTP is expressed throughout the plant with highest levels seen in meristematic regions of the shoot and root. Loss of function alleles are not transmitted through the male gametophyte due to defects in pollen tube growth. Hypomorphs, generated through RNAi, are dwarf and have smaller cells. These plants also have defects in lateral and primary root growth as well as root hair growth. The phenotypes are similar to TOR mutants suggesting that TCTP functions in the is pathway in Arabidopsis as well. |
| AT3G16670 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT3G16712 | hypothetical protein;(source:Araport11) |
| AT3G16720 | RING-H2 protein induced after exposure to chitin or inactivated crude cellulase preparations. The mRNA is cell-to-cell mobile. |
| AT3G16785 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Does not appear to be involved in root hair patterning. Not induced upon Pi starvation. |
| AT3G16850 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G16860 | COBRA-like protein 8 precursor;(source:Araport11) |
| AT3G16890 | Encodes a mitochondrial pentatricopeptide repeat (PPR) domain protein, PPR40, which provides a signalling link between mitochondrial electron transport and regulation of stress and hormonal responses. Mutations in PPR40 result in enhanced sensitivity to salt, ABA and oxidative stress, as well as reduced electron transport through Complex III (cytochrome c reductase). |
| AT3G16910 | Encodes a peroxisomal protein with acetyl-CoA synthetase activity that is responsible for the activation of acetate for entry into the glyoxylate cycle. |
| AT3G17070 | Peroxidase family protein;(source:Araport11) |
| AT3G17100 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT3G17110 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT3G17152 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G17205 | ubiquitin protein ligase 6;(source:Araport11) |
| AT3G17280 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G17340 | Ran effector. |
| AT3G17350 | wall-associated receptor kinase carboxy-terminal protein;(source:Araport11) |
| AT3G17360 | PHRAGMOPLAST ORIENTING KINESIN 1 is one of the two Arabidopsis homologs isolated in yeast two-hybrid screen for interaction partners of maize gene TANGLED1 (TAN1). Based on sequence homology in their motor domains, POK1 and POK2 belong to the kinesin-12 class which also includes the well-characterized group of phragmoplast-associated kinesins AtPAKRPs. Both kinesins are composed of an N-terminal motor domain throughout the entire C terminus and putative cargo binding tail domains. The expression domains for POK1 constructs were more limited than those for POK2; both are expressed in tissues enriched for dividing cells. The phenotype of pok1/pok2 double mutants strongly resembles that of maize tan1 mutants, characterized by misoriented mitotic cytoskeletal arrays and misplaced cell walls. |
| AT3G17430 | Nucleotide/sugar transporter family protein The mRNA is cell-to-cell mobile. |
| AT3G17550 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT3G17580 | SsrA-binding protein;(source:Araport11) |
| AT3G17611 | RHOMBOID-like protein 14;(source:Araport11) |
| AT3G17670 | tetratricopeptide repeat (TPR)-containing protein;(source:Araport11) |
| AT3G17710 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G17730 | NAC domain containing protein 57;(source:Araport11) |
| AT3G17810 | Encodes a protein predicted to have dihydropyrimidine dehydrogenase activity. Its activity has not been demonstrated in vivo, but, it is required for efficient uracil catabolism in Arabidopsis. It localizes to the plastid. |
| AT3G17950 | transmembrane protein;(source:Araport11) |
| AT3G18010 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Its mRNA is expressed in the initiating vascular primordium of the cotyledons during heart and torpedo stages. |
| AT3G18020 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G18050 | GPI-anchored protein;(source:Araport11) |
| AT3G18290 | Encodes BRUTUS (BTS), a putative E3 ligase protein with metal ion binding and DNA binding domains, which negatively regulates the response to iron deficiency. The mRNA is cell-to-cell mobile. |
| AT3G18480 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component, known as a golgin in mammals and yeast. A fluorescently-tagged version of CASP co-localizes with Golgi markers, and this localization appears to require the C-terminal (565?689aa) portion of the protein. The protein is inserted into a membrane in a type II orientation. |
| AT3G18490 | Encodes ASPG1 (ASPARTIC PROTEASE IN GUARD CELL 1). Functions in drought avoidance through abscisic acid (ABA) signalling in guard cells. |
| AT3G18550 | Encodes a TCP transcription factor, closely related to teosinte branched1, arrests axillary bud development and prevents axillary bud outgrowth. Role in flowering control. |
| AT3G18560 | hypothetical protein;(source:Araport11) |
| AT3G18570 | Oleosin family protein;(source:Araport11) |
| AT3G18670 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G18690 | Encodes a nuclear-localized member of a plant specific gene family involved in mediating responses to pathogens. Interacts with WRKY transcriptional regulators. |
| AT3G18710 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT3G18715 | Similar to Inflorescance deficient in abscission (IDA). Involved in floral organ abscission. |
| AT3G18820 | RAB7 homolog, forms retromer complex with VPS35; ES17 prevents the retromer complex to endosome anchoring, resulting in retention of RABG3f. The interaction of RABG3f?VPS35 functinons as a checkpoint in the control of traffic toward the vacuole. |
| AT3G18830 | This gene encodes a plasma membrane-localized polyol/cyclitol/monosaccharide-H+-symporter. The symporter is able to catalyze the energy-dependent membrane passage of a wide range of linear polyols (three to six carbon backbone), of cyclic polyols (myo-inositol), and of numerous monosaccharides, including pyranose ring-forming and furanose ring-forming hexoses and pentoses. This gene belongs to a monosaccharide transporter-like (MST-like) superfamily. |
| AT3G18930 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G18950 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G19030 | transcription initiation factor TFIID subunit 1b-like protein;(source:Araport11) |
| AT3G19080 | SWIB complex BAF60b domain-containing protein;(source:Araport11) |
| AT3G19100 | Encodes a protein kinase that positively regulates gibberellic acid (GA) signaling by inactivating the E3 ubiquitin ligase GARU. GARU mediates ubiquitin-dependent degradation of GID1s, which are GA receptors. |
| AT3G19120 | PIF / Ping-Pong family of plant transposase;(source:Araport11) |
| AT3G19150 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type cyclins. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. KRP6 appears to be targeted for degradation by RHF1a and RHF2a to allow mitotic divisions during gametogenesis. In addition, KRP6 transcript levels rise prior to and drop following the meitotic divisions of gametogenesis. Elevated levels of KRP6 negatively affect plant development and fertility. |
| AT3G19160 | Encodes cytokinin synthase. |
| AT3G19180 | Encodes a chloroplast division factor located in the plastid inner envelope with its N-terminus exposed to the stroma. PARC6 influences FtsZ assembly and is required for recruitment of PDV1 during chloroplast division. |
| AT3G19220 | Encodes a zinc finger protein that is similar to a subgroup of DnaJ and is involved in cotyledon chloroplast biogenesis. Cyo1 is localized to the thylakoid membrane and has protein disulfide isomerase activity in vivo.Cyo1 is more highly expressed in light grown seedlings. Loss of function mutants have albino cotyledons and abnormal plastids. |
| AT3G19230 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G19260 | LAG1 homolog. Loss of function mutant is sensitive to AAL-toxin. LOH2 is presumed to function in sphingolipid metabolism. It encodes a ceramide synthase essential for production of LCFA-ceramides (mainly C16). Uses palmitoyl-CoA and dihydroxy LCB substrates. |
| AT3G19274 | hypothetical protein;(source:Araport11) |
| AT3G19320 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G19340 | aminopeptidase (DUF3754);(source:Araport11) |
| AT3G19380 | PUB25 and PUB26 are closely related paralogs that encode functional E3 ligases. They function in immune response pathway by targeting BIK1 for degradation. |
| AT3G19390 | Granulin repeat cysteine protease family protein;(source:Araport11) |
| AT3G19430 | late embryogenesis abundant protein-related / LEA protein-like protein;(source:Araport11) |
| AT3G19440 | Pseudouridine synthase family protein;(source:Araport11) |
| AT3G19480 | Encodes a stromal phosphoglycerate dehydrogenase with a high NAD(H)-specificity that is active in photosynthesizing chloroplasts and draws its substrate 3-PGA directly from the Calvin-Benson-Bassham cycle. |
| AT3G19490 | member of Na+/H+ antiporter-Putative family |
| AT3G19508 | complex 1 protein, LYR family protein;(source:Araport11) |
| AT3G19570 | Encodes SCO3 (snowy cotyledon3), a member of a largely uncharacterized protein family unique to the plant kingdom. The sco3-1 mutation alters chloroplast morphology and development, reduces chlorophyll accumulation, impairs thylakoid formation and photosynthesis in seedlings, and results in photoinhibition under extreme CO(2) concentrations in mature leaves. SCO3 is targeted to the periphery of peroxisomes. Together with QWRF2 redundantly modulates cortical microtubule arrangement in floral organ growth and fertility. |
| AT3G19580 | Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild desiccation. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT3G19615 | beta-1,4-xylosidase;(source:Araport11) |
| AT3G19830 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G19920 | BTB/POZ domain protein;(source:Araport11) |
| AT3G19990 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT3G20015 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G20083 | pseudogene of cytochrome P450;(source:Araport11) |
| AT3G20160 | Terpenoid synthases superfamily protein;(source:Araport11) |
| AT3G20200 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT3G20240 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT3G20280 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT3G20310 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-7). The protein contains one AP2 domain. Phosphorylated by PKS3 in vitro. Involved in ABA-mediated responses. Acts as a repressor of GCC box?mediated transcription together with AtSin3 and HDA19. |
| AT3G20410 | calmodulin-domain protein kinase CDPK isoform 9 (CPK9) |
| AT3G20530 | Protein kinase superfamily protein, expressed in the peroxisome. |
| AT3G20570 | early nodulin-like protein 9;(source:Araport11) |
| AT3G20580 | COBRA-like protein 10 precursor;(source:Araport11) |
| AT3G20630 | Encodes a ubiquitin-specific protease. Identical to TTN6. Loss of function mutations are embryo lethals, having development arrested at the preglobular/globular stage. Also involved in root responses to phosphate deficiency. |
| AT3G20640 | Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT3G20760 | Nse4, component of Smc5/6 DNA repair complex;(source:Araport11) |
| AT3G20820 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G20830 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT3G20975 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.6e-08 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G20980 | Gag-Pol-related retrotransposon family protein;(source:Araport11) |
| AT3G20993 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G21000 | Gag-Pol-related retrotransposon family protein;(source:Araport11) |
| AT3G21050 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.8e-18 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G21100 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G21110 | 5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole synthetase (PUR7, syn. SAICAR synthetase), catalyzes aspartate addition at the alpha-amino group to the growing purine backbone. |
| AT3G21150 | Encodes a protein with a B-box domain predicted to act as a transcription factor. Expression of the BBX32 gene is affected by monochromatic red light. Genetic analysis shows BBX32 is under circadian control; it is a morning gene under clock regulation. |
| AT3G21200 | Encodes a soluble glutamyl-tRNA reductase (GluTR) binding protein that forms a ternary complex with FLU and GluTR. |
| AT3G21230 | The gene encodes a 4-coumarate coenzyme A ligase being able to use sinapate as substrate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, 5-OH-ferulic acid, ferulic acid and sinapic acid. At4CL5 was unable to use cinnamic acid as substrate. Knockout of At4CL5 (4cl5) revealed no effect on syringyl lignin content indicating that the activity observed does probably not occur in vivo. |
| AT3G21240 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, ferulic acid, 5-OH-ferulic acid and cinnamic acid. At4CL2 was unable to use sinapic acid as substrate. |
| AT3G21270 | Encodes Dof zinc finger protein adof2. |
| AT3G21290 | Nuclear-localized intrinsically disordered protein involved in promoting miRNA activity. |
| AT3G21310 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT3G21330 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G21352 | transmembrane protein;(source:Araport11) |
| AT3G21370 | beta glucosidase 19;(source:Araport11) |
| AT3G21380 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT3G21400 | dynein beta chain, ciliary protein;(source:Araport11) |
| AT3G21660 | UBX domain-containing protein;(source:Araport11) |
| AT3G21690 | MATE efflux family protein;(source:Araport11) |
| AT3G21755 | Natural antisense transcript overlaps with AT3G21760;(source:Araport11) |
| AT3G21830 | SKP1-like 8;(source:Araport11) |
| AT3G21900 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT3G21933 | pseudogene of cysteine-rich receptor-like kinase;(source:Araport11) |
| AT3G21945 | cysteine-rich repeat secretory protein;(source:Araport11) |
| AT3G21965 | pseudogene of Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT3G22100 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G22133 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase GB:AAC33226.1 from (Arabidopsis thaliana);(source:TAIR10) |
| AT3G22150 | Involved in RNA editing of plastid atpF and mitochondrial nad5. |
| AT3G22180 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G22250 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G22290 | Endoplasmic reticulum vesicle transporter protein;(source:Araport11) |
| AT3G22340 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.2e-60 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G22370 | Encodes AOX1a, an isoform of alternative oxidase that is expressed in rosettes, flowers, and root. The alternative oxidase of plant mitochondria transfers electrons from the ubiquinone pool to oxygen without energy conservations. It is regulated through transcriptional control and by pyruvate. Plays a role in shoot acclimation to low temperature. Also is capable of ameliorating reactive oxygen species production when the cytochrome pathway is inhibited. AOX1a also functions as a marker for mitochondrial retrograde response. The mRNA is cell-to-cell mobile. |
| AT3G22380 | Encodes a nucleus-acting plant-specific clock regulator working close to the central oscillator and affecting the circadian gating of light responses. Circadian gating is the alteration of circadian phase according to the photoperiod of the entraining day/light cycle and the rhythmic antagonism of light responses in the early subjective night. TIC differentially regulates CCA1 and PRR9 from LHY, with LHY expression as a dominant genetic target of TIC action. Also shown to be invoved in the maintenance of Arabidopsis thaliana metabolic homeostasis. |
| AT3G22400 | Encodes lipoxygenase5 (LOX5). LOX5 activity in roots facilitates green peach aphid colonization of Arabidopsis foliage by promoting green peach aphid feeding from sieve element and water consumption from xylem. |
| AT3G22410 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G22560 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT3G22570 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G22670 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G22740 | homocysteine S-methyltransferase (HMT3) |
| AT3G22800 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G22845 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT3G22900 | Non-catalytic subunit specific to DNA-directed RNA polymerase IV; homologous to budding yeast RPB7 |
| AT3G22960 | encodes a chloroplast pyruvate kinase alpha subunit. Important for seed oil biosynthesis. Ubiquitously expressed, with significantly increased expression in maturing seeds. The mRNA is cell-to-cell mobile. |
| AT3G22970 | hypothetical protein (DUF506);(source:Araport11) |
| AT3G22990 | Armadillo-repeat containing protein. Involved in leaf and flower development. Located in nucleus. Broadly expressed throughout vegetative and floral tissues. LFR is functionally associated with AS2 to mediate leaf development. |
| AT3G23000 | Encodes a serine/threonine protein kinase with similarities to CBL-interacting protein kinases, SNF1 and SOS2. The mRNA is cell-to-cell mobile. |
| AT3G23090 | Member of the microtubule regulatory protein WVD2/WDL family WDL3 stabilizes cortical microtubules and is involved in light induced hypocotyl elongation. WDL3 is ubiquinated by COP1, leading to its degadation in the dark, |
| AT3G23120 | receptor like protein 38;(source:Araport11) |
| AT3G23125 | Encodes a microRNA that targets the TAS1 and TAS2 families of tasiRNA-generating transcripts. Cleavage of TAS1 and TAS2 transcripts by miR173 initiates processing of these transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCGCUUGCAGAGAGAAAUCAC |
| AT3G23380 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Interacts with Rop1 and is involved in pollen tube growth and function. Gene is expressed predominantly in inflorescence and flower tissue. |
| AT3G23400 | Encodes FIBRILLIN 4 (FIB4). The fibrillins are a large family of chloroplast proteins that have been linked with stress tolerance and disease resistance. FIBRILLIN 4 is required for plastoglobule development and stress resistance.Iinvolved in plastoquinone transport. |
| AT3G23420 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G23580 | Encodes one of the 3 ribonucleotide reductase (RNR) small subunit genes (RNR2A). Functionally redundant with the ribonucleotide reductase TSO2. mRNA was shown to specifically accumulate during the S-phase of the cell cycle in synchronized tobacco BY2 cells. Critical for cell cycle progression, DNA damage repair and plant development. |
| AT3G23590 | Encodes a protein shown to physically associate with the conserved transcriptional coregulatory complex, Mediator, and is involved in the regulation of phenylpropanoid homeostasis. Acts redundantly with REF4/MED5b (At2g48110). Required for expression of some dark-upregulated genes. RFR1 is the MED5a subunit of the mediator complex. |
| AT3G23660 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
| AT3G23750 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G23810 | S-adenosyl-l-homocysteine (SAH) hydrolase 2;(source:Araport11) |
| AT3G23820 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. The mRNA is cell-to-cell mobile. |
| AT3G23840 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G23860 | Encodes a GTP-binding related protein that acts as a negative regulator of pollen germination, pollen tube growth, and gametophyte senescence. |
| AT3G23970 | F-box family protein;(source:Araport11) |
| AT3G23980 | Encodes a protein that interacts with the Polycomb-group (Pc-G) histone methyltransferase CLF (CURLY LEAF). It colocalizes with CLF to the nucleus and represses a subset of Pc-G target genes. The pleiotropic developmental mutant phenotype suggests that BLI prevents premature differentiation. |
| AT3G24030 | hydroxyethylthiazole kinase family protein;(source:Araport11) |
| AT3G24050 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT3G24200 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT3G24220 | A member of gene NCED-related gene family, encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
| AT3G24230 | Pectate lyase family protein;(source:Araport11) |
| AT3G24290 | ammonium transporter 1;(source:Araport11) |
| AT3G24310 | snapdragon myb protein 305 homolog (myb) |
| AT3G24420 | DLK2 is a divergent member of the DWARF14 family. It's expression is dependent on D14 and KAI2 but it does not appear to play a role in stringolactone metabolism. |
| AT3G24480 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G24503 | Arabidopsis thaliana aldehyde dehydrogenase AtALDH1a mRNA. a sinapaldehyde dehydrogenase catalyzes both the oxidation of coniferylaldehyde and sinapaldehyde forming ferulic acid and sinapic acid, respectively |
| AT3G24508 | Encodes a defensin-like (DEFL) family protein. |
| AT3G24517 | hypothetical protein;(source:Araport11) |
| AT3G24600 | late embryogenesis abundant protein, group 2;(source:Araport11) |
| AT3G24670 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G24680 | transposable_element_gene;(source:Araport11);similar to zinc finger protein, putative [Arabidopsis thaliana] (TAIR:AT2G15520.1);(source:TAIR10) |
| AT3G24810 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. |
| AT3G25030 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G25180 | Encodes a cytochrome P450 monooxygenase (CYP82G1) that catalyzes the production of two volatile homoterpenes, TMTT and DMNT, although it is only likely to produce TMTT in planta. TMTT can be involved in attracting predatory insects to protect Arabidopsis plants from herbivorous pests. Homoterpene synthesis is also stimulated by fungal elicitors which increase the transcript levels of CYP82G1. |
| AT3G25182 | Pseudogene of AT5G24050; DNA binding protein |
| AT3G25210 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G25240 | sulfate/thiosulfate import ATP-binding protein, putative (DUF506);(source:Araport11) |
| AT3G25250 | Arabidopsis protein kinase The mRNA is cell-to-cell mobile. |
| AT3G25290 | Auxin-responsive family protein;(source:Araport11) |
| AT3G25410 | Sodium Bile acid symporter family;(source:Araport11) |
| AT3G25500 | Poly-L-proline-containing (PLP) protein that form part of the signal-transduction cascade that leads to rearrangement of the actin cytoskeleton. AFH1 is a nonprocessive formin that moves from the barbered end to the side of an actin filament after the nucleation event. |
| AT3G25585 | aminoalcoholphosphotransferase (AAPT2) |
| AT3G25590 | micronuclear linker histone polyprotein-like protein;(source:Araport11) |
| AT3G25600 | Calmodulin like protein. Paralog of CML15. |
| AT3G25610 | Encodes aminophospholipid ATPase10 (ALA10), a P4-type ATPase flippase that internalizes exogenous phospholipids across the plasma membrane. |
| AT3G25620 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G25700 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G25730 | ethylene response DNA binding factor 3;(source:Araport11) |
| AT3G25810 | Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
| AT3G25860 | Encodes the dihydrolipoamide S-acetyltransferase subunit of the plastid Pyruvate Dehydrogenase Complex (E2). Mutant has embryo defect. |
| AT3G25870 | hypothetical protein;(source:Araport11) |
| AT3G25905 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT3G25940 | TFIIB zinc-binding protein;(source:Araport11) |
| AT3G26080 | localized to chloroplasts |
| AT3G26125 | encodes a protein with cytochrome P450 domain |
| AT3G26130 | Cellulase (glycosyl hydrolase family 5) protein;(source:Araport11) |
| AT3G26147 | hypothetical protein;(source:Araport11) |
| AT3G26200 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT3G26240 | Cysteine/Histidine-rich C1 domain family protein. Accumulation of this protein is regulated by a cis-Natural Antisense RNA (cis-NAT). |
| AT3G26270 | putative cytochrome P450 |
| AT3G26295 | putative cytochrome P450. |
| AT3G26370 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G26490 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G26539 | hypothetical protein;(source:Araport11) |
| AT3G26540 | RGFR3 is a leucine--rich repeat receptor kinase that, together with RGFR1 and RGFR2, binds ROOT GROWTH FACTORS and is required for establishing the gradient of PLETHORA1 and PLETHORA2 essential for proper root growth and development. |
| AT3G26560 | ATP-dependent RNA helicase;(source:Araport11) |
| AT3G26580 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G26610 | Encodes an apoplast-localized polygalacturonase involved in cell elongation and flower development. |
| AT3G26612 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT3G26775 | pseudogene of Protein with RNI-like/FBD-like domains;(source:Araport11) |
| AT3G26782 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G26790 | Transcriptional factor with high similarity to the B3 region of the VP1/ABI3-like proteins. Full length FUS3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of FUS3 requires the B3 DNA-binding domain and an activation domain. FUS3 specifies cotyledon identity. Regulator of gene expression during late embryogenesis. Involved in the control foliar organ identity in Arabidopsis by regulating the synthesis of two hormones, abscisic acid and gibberellin. FUS3 together with LEC1 positively regulate the abundance of the ABI3 protein in the seed. |
| AT3G26830 | Mutations in pad3 are defective in biosynthesis of the indole derived phytoalexin camalexin. Encodes a cytochrome P450 enzyme that catalyzes the conversion of dihydrocamalexic acid to camalexin. The mRNA is cell-to-cell mobile. |
| AT3G26890 | meiosis chromosome segregation family protein;(source:Araport11) |
| AT3G26910 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G26990 | ENTH/VHS family protein;(source:Araport11) |
| AT3G27020 | Arabidopsis thaliana metal-nicotianamine transporter YSL6 |
| AT3G27090 | DCD (Development and Cell Death) domain protein;(source:Araport11) |
| AT3G27110 | PGM48 is a member of a plant specific clade of metallo-endopeptidase proteins. It is found in plastoglobules. Analysis of over-expression and loss of function phenotypes suggests PGM48 may have a role in positively regulating senescence. |
| AT3G27180 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G27200 | Cupredoxin superfamily protein;(source:Araport11) |
| AT3G27250 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT3G27270 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT3G27290 | RNI-like superfamily protein;(source:Araport11) |
| AT3G27325 | hydrolases, acting on ester bond;(source:Araport11) |
| AT3G27330 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT3G27380 | One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Expressed during germination and post-germinative growth. |
| AT3G27440 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
| AT3G27510 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G27590 | reverse transcriptase family protein;(source:Araport11) |
| AT3G27680 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G27830 | 50S ribosomal protein L12-A The mRNA is cell-to-cell mobile. |
| AT3G27850 | 50S ribosomal protein L12-C The mRNA is cell-to-cell mobile. |
| AT3G27860 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
| AT3G27960 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
| AT3G28060 | nodulin MtN21-like transporter family protein |
| AT3G28070 | nodulin MtN21-like transporter family protein |
| AT3G28080 | nodulin MtN21-like transporter family protein |
| AT3G28130 | nodulin MtN21-like transporter family protein |
| AT3G28180 | encodes a gene similar to cellulose synthase The mRNA is cell-to-cell mobile. |
| AT3G28330 | F-box family protein-like protein;(source:Araport11) |
| AT3G28380 | P-glycoprotein 17;(source:Araport11) |
| AT3G28420 | Putative membrane lipoprotein;(source:Araport11) |
| AT3G28460 | methyltransferase;(source:Araport11) |
| AT3G28590 | transmembrane protein;(source:Araport11) |
| AT3G28690 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G28780 | transmembrane protein, putative (DUF1216);(source:Araport11) |
| AT3G28900 | Ribosomal protein L34e superfamily protein;(source:Araport11) |
| AT3G28910 | Encodes a MYB family transcriptional regulator.It is a a positive regulator of the pathogen-induced hypersensitive response and of brassinosteroid and abscisic acid signaling and a negative regulator of photomorphogenesis. Accumulation of MYB30 is light regulated and activity is modulated by SUMOlaytion. MYB30 can for complexes with different bHLH components to regulate expression of different pathways. |
| AT3G28917 | mini zinc finger 2;(source:Araport11) |
| AT3G28920 | homeobox protein 34;(source:Araport11) |
| AT3G29010 | Biotin/lipoate A/B protein ligase family;(source:Araport11) |
| AT3G29090 | Encodes an atypical pectin methylesterase that does not require salt for its activity and has a blockwise mode of pectin demethylesterification. |
| AT3G29240 | PPR containing protein (DUF179);(source:Araport11) |
| AT3G29260 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G29360 | Encodes one of four UDP-glucose dehydrogenase UGD) genes. Mutation of this gene in combination with UGD3 leads to swollen plant cell walls and severe developmental defects associated with changes in pectic polysaccharides. |
| AT3G29365 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT3G29370 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
| AT3G29375 | XH domain-containing protein;(source:Araport11) |
| AT3G29590 | At3g29590 (At5MAT) encodes a malonyl-CoA:anthocyanidin 5-O-glucoside-6"-O-malonyltransferase that is coordinately expressed with a epistatic 5-O-anthocyanidin glucosyltransferase (At4g14090). The enzyme is involved in the malonylation of anthocyanins in Arabidopsis. |
| AT3G29630 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G29635 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G29670 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. The mRNA is cell-to-cell mobile. |
| AT3G29773 | pseudogene of nuclease;(source:Araport11) |
| AT3G29776 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-178 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G30340 | nodulin MtN21-like transporter family protein |
| AT3G30530 | basic leucine-zipper 42;(source:Araport11) |
| AT3G30740 | pseudogene of Ribosomal protein S25 family protein;(source:Araport11) |
| AT3G30775 | Encodes a proline oxidase that is predicted to localize to the inner mitochondrial membrane, its mRNA expression induced by high levels of Al and by osmotic stress. The promoter contains an L-proline-inducible element. |
| AT3G30839 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-11 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G32925 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.1e-13 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT3G33055 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-282 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G33058 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-112 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G33520 | Encodes ACTIN-RELATED PROTEIN6 (ARP6), a putative component of a chromatin-remodeling complex. Required for both histone acetylation and methylation of the FLC chromatin in Arabidopsis. Along with PIE1 forms a complex to deposit modified histone H2A.Z at several loci within the genome. This modification alters the expression of the target genes (i.e. FLC, MAF4, MAF6). Incorporation of this variant histone into chromatin mediates the ambient temperature response. Located at specific regions of the nuclear periphery. Expression throughout plants shown by in-situ and immunolocalization methods. Mutants show defects in fertility, leaf, flower and inflorescence development and shorter flowering times. ARP6 also is involved in globally controlling developmental responses to ambient temperature through incorporation of variant histone H2A.Z into chromatin. |
| AT3G41979 | 5.8SrRNA |
| AT3G42150 | transmembrane protein;(source:Araport11) |
| AT3G42170 | transposase-like gene with conserved domains from the family of hAT transposases that includes hobo from Drosophila melanogaster, Activator (Ac) from maize, and Tam3 from snapdragon but lacks several amino acids known to be essential for Ac transposition5. The DAYSLEEPER gene lacks 8 bp duplications and TIRs (a common feature of transcriptionally silent hAT transposases), however, DAYSLEEPER expression was detected, and several expressed sequence tags are available. The expression seems to be under the control of factors determining the circadian rhythm. DAYSLEEPER was isolated as a factor binding to a motif (Kubox1) present in the upstream region of the Arabidopsis DNA repair gene Ku70. Mutant plants lacking DAYSLEEPER or strongly overexpressing this gene do not develop in a normal manner. |
| AT3G42780 | hypothetical protein;(source:Araport11) |
| AT3G43110 | transmembrane protein;(source:Araport11) |
| AT3G43180 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G43250 | coiled-coil protein (DUF572);(source:Araport11) |
| AT3G43291 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G43580 | Beta-galactosidase related protein;(source:Araport11) |
| AT3G43710 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G43825 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.3e-106 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G43910 | MutS2;(source:Araport11) |
| AT3G43930 | BRCT domain-containing DNA repair protein;(source:Araport11) |
| AT3G44100 | MD-2-related lipid recognition domain-containing protein;(source:Araport11) |
| AT3G44200 | Encodes AtNek5, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.Interacts physically with plant kinesins ARK1 and ARK2. Mutants show defects in root epidermal cell morphology, trichome branching and other epidermal cell abnormalities suggesting a rol e in epidermal cell differentiation. NEK6 co-localizes with cortical microtubules. |
| AT3G44260 | Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses. |
| AT3G44300 | Encodes an enzyme that catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (nitrile aminohydrolase, EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. Mutants have reduced sensitivity to IAN and are sensitive to IAA. This enzyme likely participates in other non-auxin-related metabolic pathways. The mRNA is cell-to-cell mobile. |
| AT3G44430 | transmembrane protein;(source:Araport11) |
| AT3G44460 | basic leucine zipper transcription factor (BZIP67), identical to basic leucine zipper transcription factor GI:18656053 from (Arabidopsis thaliana); identical to cDNA basic leucine zipper transcription factor (atbzip67 gene) GI:18656052. Located in the nucleus and expressed during seed maturation in the cotyledons. |
| AT3G44610 | Kinase involved in the first positive phototropism and gravitropism. Phosphorylates serine residues in the cytoplasmic loop of PIN1 and shares phosphosite preferences with D6PK. Critical component for both hypocotyl phototropism and gravitropism, control tropic responses mainly through regulation of PIN-mediated auxin transport by protein phosphorylation. |
| AT3G44700 | transmembrane protein;(source:Araport11) |
| AT3G44720 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile. |
| AT3G44757 | pseudogene of transmembrane protein;(source:Araport11) |
| AT3G44770 | transmembrane protein, putative (DUF626);(source:Araport11) |
| AT3G44970 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT3G44990 | Encodes a xyloglucan endotransglycosylase/hydrolase. Protein sequence and phylogenetic analysis indicates that this enzyme resides in Group III-A of the XTH family, with high similarity to Tropaeolum majus (nasturtium) xyloglucanase 1 (TmNXG1).Enzyme kinetic analysis indicates predominant xyloglucan endo-hydrolase activity (EC 3.2.1.151) with only limited potential to act as a xyloglucan endo-transglycosylase (EC 2.4.1.207). |
| AT3G45010 | serine carboxypeptidase-like 48;(source:Araport11) |
| AT3G45120 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G17900.1);(source:TAIR10) |
| AT3G45130 | lanosterol synthase 1;(source:Araport11) |
| AT3G45230 | Encodes the arabinogalactan protein core of plant cell wall proteoglycan that contains arabinogalactan and cell wall matrix glycan pectin and/or xylan domains. |
| AT3G45310 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT3G45320 | transmembrane protein;(source:Araport11) |
| AT3G45420 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G45490 | reverse transcriptase-like protein;(source:Araport11) |
| AT3G45620 | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT3G45740 | hydrolase family protein / HAD-superfamily protein;(source:Araport11) |
| AT3G45790 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G45810 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
| AT3G45900 | Ribonuclease P protein subunit P38-like protein;(source:Araport11) |
| AT3G45940 | Glycosyl hydrolases family 31 protein;(source:Araport11) |
| AT3G45990 | Cofilin/tropomyosin-type actin-binding protein family;(source:Araport11) |
| AT3G46070 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT3G46110 | DUF966 domain containing protein, expressed during embryogenesis. |
| AT3G46220 | E3 ligase that mediates ufmylation. Part of complex with C53 and the ER-resident adaptor protein DDRGK1. Involved in the pathway that links ribosome-associated quality control with selective autophagy at the ER. |
| AT3G46450 | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein;(source:Araport11) |
| AT3G46482 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT3G46500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G46530 | Confers resistance to the biotrophic oomycete, Peronospora parasitica. Encodes an NBS-LRR type R protein with a putative amino-terminal leucine zipper. Fungal protein ATR13 induces RPP13 gene expression and disease resistance. The mRNA is cell-to-cell mobile. |
| AT3G46570 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT3G46590 | Encodes a protein that specifically binds plant telomeric DNA (TTTAGGG)n repeats. Involved in bending DNA. Expressed throughout the plant with highest levels in flowers. |
| AT3G46620 | Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants. |
| AT3G46640 | Encodes a myb family transcription factor with a single Myb DNA-binding domain (type SHAQKYF) that is unique to plants and is essential for circadian rhythms, specifically for transcriptional regulation within the circadian clock. LUX is required for normal rhythmic expression of multiple clock outputs in both constant light and darkness. It is coregulated with TOC1 and seems to be repressed by CCA1 and LHY by direct binding of these proteins to the evening element in the LUX promoter. The mRNA is cell-to-cell mobile. |
| AT3G46710 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT3G46720 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G46740 | Component of the translocon outer membrane (TOC) complex. Forms the outer envelope translocation channel (beta-barrel). Plays a role in preprotein conductance. Imported into chloroplast. Expressed in young dividing photosynthetic tissues. Knockout mutants are embryo lethal with arrested development at the two-cell stage. Knockout mutants have abnormal etioplasts. |
| AT3G46780 | plastid transcriptionally active 16;(source:Araport11) |
| AT3G46840 | Subtilase family protein;(source:Araport11) |
| AT3G46880 | hypothetical protein;(source:Araport11) |
| AT3G46890 | maternal effect embryo arrest protein;(source:Araport11) |
| AT3G46940 | DUTP-PYROPHOSPHATASE-LIKE 1;(source:Araport11) |
| AT3G47010 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT3G47050 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT3G47190 | Encodes a class III gibberellin 2-oxidase that oxidizes GA12 to GA110. |
| AT3G47340 | encodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT3G47360 | Encodes a putative hydroxysteroid dehydrogenase (HSD). Genes that encode HSD include: At5g50600 and At5g50700 (HSD1), At3g47350(HSD2), At3g47360(HSD3), At5g50590 and At5g50690(HSD4), At5g50770(HSD6) (Plant Cell Physiology 50:1463). Two copies of HSD1 and HSD4 exist due to a gene duplication event. In Plant Physiology 145:87, At5g50690 is HSD7, At4g10020 is HSD5. |
| AT3G47380 | Pectin methylesterase inhibitor that is involved in resistance to Botrytis cinerea. Affects PME activity during infection to prevent disease. |
| AT3G47520 | Encodes a protein with NAD-dependent malate dehydrogenase activity, located in chloroplasts. The mRNA is cell-to-cell mobile. |
| AT3G47530 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G47550 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT3G47620 | Encodes a transcription factor AtTCP14 that regulates seed germination. AtTCP14 shows elevated expression level just prior to germination. AtTCP14 is predominantly expressed in the vascular tissue of the embryo, and affects gene expression in radicles in a non-cell-autonomous manner. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
| AT3G47770 | ABC2 homolog 5;(source:Araport11) |
| AT3G47800 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT3G47870 | Required for normal cell division during pollen development. Mutant has extra cell in pollen of vegetative cell identity. Male gametophytic mutation. |
| AT3G47890 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT3G47930 | L-Galactono-1,4-lactone dehydrogenase, catalyzes the final step of ascorbate biosynthesis. |
| AT3G47940 | DNAJ heat shock family protein;(source:Araport11) |
| AT3G47950 | mutant has Slight reduction in root and shoot growth; Exaggerated defects in salt stress; Plasma Membrane H+ ATPase |
| AT3G47980 | Integral membrane HPP family protein. Putative nitrate transporter. |
| AT3G48110 | glycine-tRNA ligase |
| AT3G48115 | other_RNA;(source:Araport11) |
| AT3G48120 | serine/arginine-rich splicing factor;(source:Araport11) |
| AT3G48170 | ALDH10A9 encodes a protein that can function as a betaine aldehyde dehydrogenase in vitro. The C-terminal amino acids of this protein direct GFP to the peroxisome suggesting that ALDH10A9 accumulates in this organelle. ALDH10A9 transcript levels rise in response to ABA, NaCl, chilling, methyl viologen, and dehydration stress. The enzyme can catalyze the formation of glycine betaine in vitro, but there are still questions about whether Arabidopsis makes this protective compound under natural conditions. This enzyme may be involved in oxidizing aminoaldehydes formed through polyamine metabolism. |
| AT3G48195 | Encodes a member of the Arabidopsis sorting nexin family. |
| AT3G48209 | Encodes a Plant thionin family protein |
| AT3G48240 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT3G48320 | putative cytochrome P450 |
| AT3G48330 | Encodes protein-L-isoaspartate methyltransferase. Important for maintaining viability as the seed ages. Involved in germination. |
| AT3G48340 | KDEL-tailed cysteine endopeptidase. Mutants generated via RNAi show decreased lateral root growth. |
| AT3G48360 | Encodes a protein (BT2) that is an essential component of the TAC1-mediated telomerase activation pathway. Acts redundantly with BT3 and BT1 during female gametophyte development and with BT3 during male gametophyte development. BT2 also mediates multiple responses to nutrients, stresses, and hormones. |
| AT3G48450 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
| AT3G48470 | embryo defective 2423;(source:Araport11) |
| AT3G48510 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT3G48515 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT3G48520 | CYP94B3 is a jasmonoyl-isoleucine-12-hydroxylase that catalyzes the formation of 12-OH-JA-Ile from JA-Ile. By reducing the levels of this the biologically active phytohormone, CYP94B3 attenuates the jasmonic acid signaling cascade. CYP94B3 transcript levels rise in response to wounding. |
| AT3G48530 | SNF1-related protein kinase regulatory subunit gamma 1;(source:Araport11) |
| AT3G48580 | xyloglucan endotransglucosylase/hydrolase 11;(source:Araport11) |
| AT3G48590 | Encodes a protein with similarity to a subunit of the CCAAT promoter motif binding complex of yeast.One of two members of this class (HAP5A) and expressed in vegetative and reproductive tissues. |
| AT3G48620 | Outer membrane OMP85 family protein;(source:Araport11) |
| AT3G48690 | Encodes a protein with carboxylesterase whose activity was tested using both pNA and 2,4-D-methyl. |
| AT3G48700 | carboxyesterase 13;(source:Araport11) |
| AT3G48760 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G48780 | Encodes one of the two LCB2 subunits (LCB2a and LCB2b) of serine palmitoyltransferase, an enzyme involved in sphingolipid biosynthesis. LCB2a and LCB2b are functional redundant. Double mutants are gametophytic lethal. The mRNA is cell-to-cell mobile. |
| AT3G48850 | Encodes a mitochondrial phosphate transporter. Modulates plant responses to salt stress. |
| AT3G48950 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G48980 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT3G48990 | Encodes an oxalyl-CoA synthetase and is required for oxalate degradation, for normal seed development, and for defense against an oxalate-producing fungal pathogen. |
| AT3G49055 | ATP-binding protein;(source:Araport11) |
| AT3G49070 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT3G49110 | Class III peroxidase Perx33. Expressed in roots. Located in the cell wall. Involved in cell elongation. Expression activated by light. May play a role in generating H2O2 during defense response. The mRNA is cell-to-cell mobile. |
| AT3G49120 | Class III peroxidase Perx34. Expressed in roots, leaves and stems. Located in the cell wall. Involved in cell elongation. Expression activated by light. May play a role in generating H2O2 during defense response. The mRNA is cell-to-cell mobile. |
| AT3G49210 | WSD6 can function in vitro as wax ester synthase but does not appear to be essential for cuticular wax biosynthesis. |
| AT3G49230 | transmembrane protein;(source:Araport11) |
| AT3G49320 | Metal-dependent protein hydrolase;(source:Araport11) |
| AT3G49350 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT3G49370 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
| AT3G49620 | encodes a protein similar to 2-oxoacid-dependent dioxygenase. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT3G49630 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G49668 | Natural antisense transcript overlaps with AT3G49670;(source:Araport11) |
| AT3G49680 | Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. |
| AT3G49750 | receptor like protein 44;(source:Araport11) |
| AT3G49870 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
| AT3G49890 | hypothetical protein;(source:Araport11) |
| AT3G49900 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G49930 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT3G50060 | Encodes a member of the R2R3 transcription factor gene family. Expressed in response to potassium deprivation and auxin. Involved in lateral root development. Interacts with ARF7 and regulates the expression of some auxin responsive genes. |
| AT3G50070 | Encode CYCD3;3, a CYCD3 D-type cyclin. Important for determining cell number in developing lateral organs. Mediating cytokinin effects in apical growth and development. |
| AT3G50120 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G50123 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G50150 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G50230 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G50310 | Encodes a member of MEKK subfamily. Target promoter of the male germline-specific transcription factor DUO1. Involved in osmotic stress response via regulation of MPK6 activity. It also plays an important role in regulating cell division and cell elongation in the primary root meristematic and elongation areas. Mutants show defects in root microtubule organization.It phosphorylates MPK18 and MKK3.It is a positive regulator of ABA-induced stomatal closure that acts by phosphorylating MKK5. |
| AT3G50330 | Encodes a bHLH transcription factor that is involved in transmitting tract and stigma development. Inhibits thermomorphogenesis. |
| AT3G50370 | hypothetical protein;(source:Araport11) |
| AT3G50390 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G50410 | Arabidopsis Dof protein containing a single 51-amino acid zinc finger DNA-binding domain, which may play an important roles in plant growth and development. |
| AT3G50420 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G50670 | Encodes U1 snRNP 70K |
| AT3G50685 | anti-muellerian hormone type-2 receptor;(source:Araport11) |
| AT3G50700 | zinc finger protein, similar to maize Indeterminate1 (ID1) |
| AT3G50740 | UGT72E1 is an UDPG:coniferyl alcohol glucosyltransferase which specifically glucosylates sinapyl- and coniferyl aldehydes. The enzyme is thought to be involved in lignin metabolism. |
| AT3G50750 | BES1/BZR1 homolog 1;(source:Araport11) |
| AT3G50780 | BTB/POZ domain protein;(source:Araport11) |
| AT3G50800 | PADRE protein. |
| AT3G50810 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G50825 | snoRNA;(source:Araport11) |
| AT3G50835 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT3G50870 | Encodes a GATA transcriptional regulator required to position the proembryo boundary in the early embryo. Regulates shoot apical meristem and flower development. |
| AT3G50890 | homeobox protein 28;(source:Araport11) |
| AT3G50930 | Encodes a protein that is present in a homo-multimeric protein complex on the outer mitochondrial membrane and plays a role in cell death and amplifying salicylic acid signalling. The mRNA is cell-to-cell mobile. |
| AT3G50980 | dehydrin xero 1;(source:Araport11) |
| AT3G51060 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. STY1/STY2 double mutants showed defective style, stigma as well as serrated leaves. Binds to the promoter of YUC4 and YUC8 (binding site ACTCTAC) |
| AT3G51070 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G51130 | transmembrane protein;(source:Araport11) |
| AT3G51230 | chalcone-flavanone isomerase family protein;(source:Araport11) |
| AT3G51265 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT3G51325 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G51360 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G51410 | hypothetical protein (DUF241);(source:Araport11) |
| AT3G51420 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
| AT3G51430 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
| AT3G51440 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT3G51450 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT3G51670 | PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells. |
| AT3G51680 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G51790 | Encodes a heme-binding protein located in the mitochondrial inner membrane that is involved in cytochrome c maturation. |
| AT3G51890 | Clathrin light chain protein;(source:Araport11) |
| AT3G51970 | acyl-CoA sterol acyl transferase 1;(source:Araport11) |
| AT3G52000 | serine carboxypeptidase-like 36;(source:Araport11) |
| AT3G52030 | F-box family protein with WD40/YVTN repeat doamin;(source:Araport11) |
| AT3G52370 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT3G52400 | syntaxin protein, involved in the negative regulation of defense pathways such as programmed cell death, salicylic acid signalling pathway, jasmonic acid signalling pathway |
| AT3G52430 | Encodes a lipase-like gene that is important for salicylic acid signaling and function in resistance (R) gene-mediated and basal plant disease resistance. PAD4 can interact directly with EDS1, another disease resistance signaling protein. Expressed at elevated level in response to green peach aphid (GPA) feeding, and modulates the GPA feeding-induced leaf senescence through a mechanism that doesn't require camalexin synthesis and salicylic acid (SA) signaling. Required for the ssi2-dependent heightened resistance to GPA. The mRNA is cell-to-cell mobile. |
| AT3G52460 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G52470 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT3G52500 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G52520 | hypothetical protein;(source:Araport11) |
| AT3G52605 | Natural antisense transcript overlaps with AT3G52610;(source:Araport11) |
| AT3G52710 | hypothetical protein;(source:Araport11) |
| AT3G52760 | Integral membrane Yip1 family protein;(source:Araport11) |
| AT3G52820 | purple acid phosphatase 22;(source:Araport11) |
| AT3G52860 | Encodes a mediator subunit,, important for development and senescence. |
| AT3G52880 | Encodes a peroxisomal monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2 |
| AT3G52957 | Pseudogene of AT2G33200; F-box family protein |
| AT3G52960 | Thioredoxin superfamily protein;(source:Araport11) |
| AT3G53040 | late embryogenesis abundant protein, putative / LEA protein;(source:Araport11) |
| AT3G53190 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G53270 | Small nuclear RNA activating complex (SNAPc), subunit SNAP43 protein;(source:Araport11) |
| AT3G53280 | cytochrome P450 monooxygenase The mRNA is cell-to-cell mobile. |
| AT3G53330 | plastocyanin-like domain-containing protein;(source:Araport11) |
| AT3G53480 | Negative regulator of auxin polar transport inhibitors. ABCG37 regulates auxin distribution and homeostasis in roots by excluding IBA from the root apex, but does not act directly in basipetal transport. ABCG37 and ABCG36 act redundantly at outermost root plasma membranes and, transport IBA out of the cells. Also involved in root transmembrane secretion of fluorescent phenolics involved in Fe uptake. The mRNA is cell-to-cell mobile. |
| AT3G53490 | valine-tRNA ligase;(source:Araport11) |
| AT3G53680 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
| AT3G53710 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT3G53720 | member of Putative Na+/H+ antiporter family. Involved in the osmoregulation through K(+) fluxes and possibly pH modulation of an active endomembrane system in guard cells. |
| AT3G53730 | Histone superfamily protein;(source:Araport11) |
| AT3G53750 | Member of the Actin gene family. Expressed in mature pollen. |
| AT3G53780 | RHOMBOID-like protein 4;(source:Araport11) |
| AT3G53880 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT3G53950 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT3G54000 | TIP41-like protein;(source:Araport11) |
| AT3G54050 | Encodes a chloroplastic fructose 1,6-bisphosphate phosphatase. also known as HCEF1 (High Cyclic Electron Flow 1). hcef1 mutants have constitutively elevated electron flow (CEFI) and plants with antisense suppression of this enzyme have higher levels of net leaf photosynthesis and increased sucrose biosynthesis. The mRNA is cell-to-cell mobile. |
| AT3G54100 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G54200 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT3G54270 | sucrose-6F-phosphate phosphohydrolase family protein;(source:Araport11) |
| AT3G54390 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT3G54420 | encodes an EP3 chitinase that is expressed during somatic embryogenesis in 'nursing' cells surrounding the embryos but not in embryos themselves. The gene is also expressed in mature pollen and growing pollen tubes until they enter the receptive synergid, but not in endosperm and integuments as in carrot. Post-embryonically, expression is found in hydathodes, stipules, root epidermis and emerging root hairs. |
| AT3G54450 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G54510 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT3G54520 | hypothetical protein;(source:Araport11) |
| AT3G54600 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
| AT3G54630 | kinetochore protein;(source:Araport11) |
| AT3G54650 | F- box protein involved in regulation of cell cycle genes. |
| AT3G54700 | Encodes Pht1;7, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT3G54720 | Encodes glutamate carboxypeptidase. Various alleles show-increased cotyledon number and rate of leaf initiation, show transformation of leaves to cotyledons, altered flowering time and photomorphogenesis and an increased level of cytokinin biosynthesis. Involved in ethylene enhanced hypocotyl elongation in the light. Strong genetic interaction between TGH and AMP1. |
| AT3G54770 | Encodes a putative RNA binding protein that is localized in the nucleus and affects ABA-regulated seed germination of Arabidopsis. |
| AT3G54780 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT3G54820 | plasma membrane intrinsic protein 2;(source:Araport11) |
| AT3G54940 | Papain family cysteine protease;(source:Araport11) |
| AT3G55080 | SET domain-containing protein;(source:Araport11) |
| AT3G55100 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G55110 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G55120 | Catalyzes the conversion of chalcones into flavanones. Required for the accumulation of purple anthocyanins in leaves and stems. Co-expressed with CHS. |
| AT3G55150 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT3G55240 | Overexpression leads to PEL (Pseudo-Etiolation in Light) phenotype. |
| AT3G55370 | Encodes a nuclear localized Dof domain containing transcription factor expressed primarily in roots. Responsive to salicylic acid. Transgenic overexpressors have yellow leaves and short, defective roots. |
| AT3G55410 | Encodes the E1 subunit of the 2-oxoglutarate dehydrogenase. |
| AT3G55430 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT3G55500 | expansin-like protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT3G55566 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G55605 | Mitochondrial glycoprotein family protein;(source:Araport11) |
| AT3G55610 | encodes delta 1-pyrroline-5-carboxylate synthetase B. Gene expression is induced by dehydration, high salt and ABA. Knock-out mutations in P5CS2 are embryo-lethal. P5CS2 appears to be present in different cells and/or different subcellular locations from P5CS1 in a tissue-dependent manner. Mutants are defective in pollen development. |
| AT3G55646 | TPRXL;(source:Araport11) |
| AT3G55660 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT3G55690 | hypothetical protein;(source:Araport11) |
| AT3G55720 | replication factor C subunit, putative (DUF620);(source:Araport11) |
| AT3G55730 | putative transcription factor MYB109 (MYB109) mRNA, |
| AT3G55760 | hypothetical protein;(source:Araport11) |
| AT3G55780 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT3G55840 | Hs1pro-1 protein;(source:Araport11) |
| AT3G55870 | ADC synthase superfamily protein;(source:Araport11) |
| AT3G55950 | CRINKLY4 related 3;(source:Araport11) |
| AT3G55970 | One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT3G55980 | salt-inducible zinc finger 1;(source:Araport11) |
| AT3G56030 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G56050 | Protein kinase family protein;(source:Araport11) |
| AT3G56130 | biotin/lipoyl attachment domain-containing protein;(source:Araport11) |
| AT3G56170 | Encodes a calcium-dependent nuclease with similarity to staphylococcal nuclease. |
| AT3G56275 | pseudogene of expressed protein;(source:Araport11) |
| AT3G56330 | Involved in posttranscriptional modification of plastid tRNA. |
| AT3G56360 | hypothetical protein;(source:Araport11) |
| AT3G56408 | Natural antisense transcript overlaps with AT3G56410;(source:Araport11) |
| AT3G56410 | hypothetical protein (DUF3133);(source:Araport11) |
| AT3G56510 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G56570 | SET domain-containing protein;(source:Araport11) |
| AT3G56700 | Encodes a fatty-acyl-CoA reductase that is expressed in response to wounding. |
| AT3G56710 | Sig1 binding protein; interacts with Sig1R4. As well as Sig1, SibI is imported into chloroplasts and its expression is light-dependent in mature chloroplasts. |
| AT3G56760 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G56800 | encodes a calmodulin |
| AT3G56810 | hypothetical protein;(source:Araport11) |
| AT3G56880 | VQ motif-containing protein;(source:Araport11) |
| AT3G57040 | response regulator ARR9, A two-component response regulator-like protein with a receiver domain with a conserved aspartate residue and a possible phosphorylation site and at the N-terminal half. Appears to interact with histidine kinase like genes ATHP3 and ATHP2 |
| AT3G57140 | sugar-dependent 1-like protein;(source:Araport11) |
| AT3G57150 | Encodes a putative pseudouridine synthase (NAP57). |
| AT3G57157 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT3G57240 | encodes a member of glycosyl hydrolase family 17 |
| AT3G57260 | beta 1,3-glucanase |
| AT3G57340 | DnaJ heat shock amino-terminal domain protein (DUF1977);(source:Araport11) |
| AT3G57370 | Encodes a nuclear-localized member of the TFIIB-related protein family that is involved in regulation of the mitotic cell-cycle progression during male gametogenesis. |
| AT3G57540 | Remorin family protein;(source:Araport11) |
| AT3G57560 | encodes a N-acetylglutamate kinase, involved in arginine biosynthesis |
| AT3G57590 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G57670 | Encodes a a C2H2/C2HC zinc finger transcription factor specifically expressed in the transmitting tract and involved in transmitting tract development and pollen tube growth.Acts redundantly with WIP4 and WIP5 to determine distal cell fate in the root. MP binds to regulatory elements within the NTT locus and likely regulates its expression. |
| AT3G57680 | C-terminal peptidase |
| AT3G57710 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G57790 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G57800 | Together with bHLH48 associates with phytochrome interacting factor 7 to regulate hypocotyl elongation. |
| AT3G57810 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT3G57830 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G57870 | Encodes a SUMO ligase that directs the attachment of the small protein SUMO to target proteins via an isopeptide bond. This enzyme is localized to the nucleus and plants with reduced levels of this protein show higher sensitivity to ABA in root growth inhibition assays. It has high similarity to the yeast UBC9 SUMO ligase and is sometimes referred to by that name. |
| AT3G57980 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT3G58020 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT3G58180 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G58210 | TRAF-like family protein;(source:Araport11) |
| AT3G58250 | TRAF-like family protein;(source:Araport11) |
| AT3G58260 | TRAF-like family protein;(source:Araport11) |
| AT3G58280 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT3G58310 | cysteine-rich repeat secretory protein, putative (DUF26);(source:Araport11) |
| AT3G58450 | USP domain containing protein, member of the universal stress protein family, regulated by ABA and possibly regulated by the ABA-dependent transcription factor AREB/ABF. Involved in the regulation of seed germination. |
| AT3G58620 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. |
| AT3G58630 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT3G58650 | Encodes a member of the TRM superfamily, that plays a role in preprophase band formation during plant cell division and controls the robustness of the orientation of that cell division. Its transcription is regulated by the cell cycle and peaks at the G2/M transition. |
| AT3G58660 | Ribosomal protein L1p/L10e family;(source:Araport11) |
| AT3G58710 | member of WRKY Transcription Factor; Group II-e |
| AT3G58795 | Natural antisense transcript overlaps with AT3G58790;(source:Araport11) |
| AT3G58840 | Encodes PEROXISOMAL AND MITOCHONDRIAL DIVISION FACTOR1. Involved in the morphogenesis and proliferation of peroxisomes and mitochondria. |
| AT3G58877 | hypothetical protein;(source:Araport11) |
| AT3G58900 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G58930 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G58940 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G58975 | pseudogene of F-box family protein |
| AT3G58990 | Small subunit, which together with IPMI SSU1, IPMISSU2 and IPMI LSU1, is a member of heterodimeric isopropylmalate isomerase (IPMI). Together with IPMI SSU3 participates in the Met chain elongation pathway. |
| AT3G59010 | Encodes PME35, a pectin methylesterase. PME35-mediated demethylesterification of the primary cell wall regulates the mechanical strength of the supporting tissue. |
| AT3G59030 | Encodes a proton antiporter. Involved in the transportation of proanthocyanidin precursors into the vacuole. In vitro transport experiments showed that cyanidin-3-O-glucoside (anthocyanin) was an effective substrate, whereas the proanthocyanidin precursor epicatechin was not transported. However catechin-3-O-glucoside inhibited anthocyanin transport in a dose-dependent manner suggesting that glycosylated epicatechin is the in vivo substrate. Recessive mutation has strong reduction of proanthocyanidin deposition in vacuoles and has reduced dormancy. Expressed in the endothelium of ovules and developing seeds. |
| AT3G59060 | Encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. Involved in shade avoidance. Functions as negative regulator of PhyB. Protein levels are modulated by phytochrome B. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
| AT3G59080 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G59100 | encodes a protein similar to callose synthase |
| AT3G59260 | pirin;(source:Araport11) |
| AT3G59270 | FBD-like domain family protein;(source:Araport11) |
| AT3G59290 | Involved in plant trans-Golgi network (TGN) transport. |
| AT3G59400 | GUN, genomes uncoupled, is necessary for coupling the expression of some nuclear genes to the functional state of the chloroplast. Binds to the magnesium chelatase complex and promotes formation of the substrate,a tetrapyrrole signaling molecule. Porphyrin-binding protein that enhances the activity of Mg-chelatase. Although required for chlorophyll accumulation under normal growth conditions, GUN4 is not essential for chlorophyll synthesis. |
| AT3G59580 | Plant regulator RWP-RK family protein;(source:Araport11) |
| AT3G59710 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G59765 | None;(source:Araport11) |
| AT3G59850 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G59880 | hypothetical protein;(source:Araport11) |
| AT3G59900 | Encodes ARGOS (Auxin-Regulated Gene Involved in Organ Size). Inducible by auxin. Involved in lateral organ size control. Transgenic plants expressing sense or antisense ARGOS cDNA display enlarged or reduced aerial organs, respectively. The alteration in organ size is attributable mainly to changes in cell number and the duration of organ growth. |
| AT3G60070 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G60080 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G60110 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT3G60120 | beta glucosidase 27;(source:Araport11) |
| AT3G60180 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G60200 | hypothetical protein;(source:Araport11) |
| AT3G60320 | bZIP domain class transcription factor (DUF630 and DUF632);(source:Araport11) |
| AT3G60380 | cotton fiber protein;(source:Araport11) |
| AT3G60390 | Encodes homeobox protein HAT3. |
| AT3G60410 | hypothetical protein (DUF1639);(source:Araport11) |
| AT3G60460 | Encodes an R2R3 myb transcription factor that is required for male gamete formation, specifically for entry of the generative cell into mitosis. Specifically expressed in the male germline. |
| AT3G60480 | StAR lipid transfer-like protein;(source:Araport11) |
| AT3G60490 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT3G60510 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
| AT3G60520 | zinc ion-binding protein;(source:Araport11) |
| AT3G60530 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT3G60670 | PLATZ transcription factor family protein;(source:Araport11) |
| AT3G60720 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT3G60750 | Transketolase;(source:Araport11) |
| AT3G60870 | Encodes an AT hook domain containing protein that, when overexpressed, delays flowering. Los s of function mutations have defects in primary and lateral root development. |
| AT3G60965 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.8e-146 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT3G61060 | phloem protein 2-A13;(source:Araport11) |
| AT3G61190 | Encodes a protein with a C2 domain that binds to BON1 in yeast two hybrid analyses. Its ability to bind to phospholipids is enhanced by calcium ions. Involved in maintaining cell homeostasis. |
| AT3G61200 | Thioesterase superfamily protein;(source:Araport11) |
| AT3G61230 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. |
| AT3G61250 | LATE MERISTEM IDENTITY2 (LMI2) is a target of the meristem identity regulator LEAFY (LFY). Has a role in the meristem identity transition from vegetative growth to flowering. Member of the R2R3 factor gene family. |
| AT3G61260 | Lipid raft regulatory protein, crucial for plasma membrane nanodomain assembly to control plasmodesmata aperture and functionality. Negatively regulates the cell-to-cell movement of TuMV via competition with PCaP1 for binding actin filaments. |
| AT3G61280 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT3G61290 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT3G61320 | Encodes a bestrophin-like protein (Best1). Located in the stroma thylakoid membrane. Functions as a chloride ion channel. Proposed to modulate proton motive force partitioning by mediating chloride ion influx in the thylakoid lumen. Major isoform (based on transcript analysis), redundant function with AtBest2. |
| AT3G61460 | Encodes a novel ring finger protein and forms an N-terminal hydrophobic domain and a C-terminal RING-H2 signature. Expression is down regulated by brassinolide. |
| AT3G61560 | Reticulon family protein;(source:Araport11) |
| AT3G61590 | F-box protein that is involved in some aspect of regulation of gene silencing by miRNA. Loss of function mutations have increased levels of some miRNAs. Its activity depends on the presence of functional F-box. |
| AT3G61620 | exonuclease RRP41 (RRP41) |
| AT3G61680 | PLIP1 encodes a plastid localized phospholipase A1 involved in seed oil biosynthesis. |
| AT3G61690 | Putative TNAase |
| AT3G61820 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G61860 | encodes an arginine/serine-rich splicing factor. transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT3G61880 | Encodes a cytochrome p450 monooxygenase. Overexpression of this gene allows fruit growth independently of fertilization. The gene is normally expressed only in floral organs(during the Arabidopsis stage 14 flower) and in the funiculus at anthesis. |
| AT3G61890 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Loss of function mutant has abnormally shaped leaves and stems. |
| AT3G61910 | NAC transcription factor NST2. NST1 and NST2 are redundant in regulating secondary wall thickening in anther walls. NST2 promoter was particularly strong in anther tissue. |
| AT3G61920 | PADRE protein. |
| AT3G62090 | encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. |
| AT3G62150 | Encodes a facultative transporter controlling auxin concentrations in plant cells. |
| AT3G62160 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G62170 | VANGUARD-like protein;(source:Araport11) |
| AT3G62260 | Type 2C protein phosphatase (PP2C) which negatively regulates AtHKT1;1 activity and thus determines systemic Na+ allocation during salt stress. |
| AT3G62300 | Encodes a protein with Agenet/Tudor and DUF724 domains. It can interact with ABAP1, a negative regulator of DNA replication and transcription, with the plant histone modification 'reader' LHP1, and with non-modified histones. It may act as a link between DNA replication, transcription and chromatin remodeling during flower development. Loss of function mutant has a WT phenotype. |
| AT3G62529 | pseudogene of pentatricopeptide (PPR) repeat-containing protein |
| AT3G62590 | PLIP3 is a glycerolipid A1 lipase with substrate specificity for phosphatidylglycerol. Expression is induced by ABA. |
| AT3G62610 | Member of the R2R3 factor gene family. Together with MYB12 and MYB111 redundantly regulates flavonol biosynthesis. |
| AT3G62620 | Encodes a protein of unknown function. Previously this protein has been annotated computationally as a sucrose-phosphatase-related protein. However, the source of this annotation can not be verified. This annotation (sucrose-phosphatase-related) has been removed. |
| AT3G62630 | stress response NST1-like protein (DUF1645);(source:Araport11) |
| AT3G62660 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT3G62680 | Proline-rich protein The mRNA is cell-to-cell mobile. |
| AT3G62690 | Encodes a RING-H2 zinc finger protein related to ATL2. The ATL gene family is represented by fifteen sequences that contain, in addition to the RING, a transmembrane domain which is located in most of them towards the N-terminal end. |
| AT3G62700 | member of MRP subfamily |
| AT3G62725 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-41 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G62780 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G62790 | NADH-ubiquinone oxidoreductase-like protein;(source:Araport11) |
| AT3G62820 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G62830 | Encodes a Golgi localized isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
| AT3G62890 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G63003 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
| AT3G63010 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. The mRNA is cell-to-cell mobile. |
| AT3G63200 | PATATIN-like protein 9;(source:Araport11) |
| AT3G63240 | DNAse I-like superfamily protein;(source:Araport11) |
| AT3G63250 | Encodes a homocysteine methyltransferase (HMT). Among the three HMT coding genes in the genome, HMT2 is responsible for a significant proportion of HMT activity in the flower stalks and silique hulls. However, HMT2 does not significantly contribute to the total HMT activity in seeds. |
| AT3G63290 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G63300 | Encodes a pleckstrin homology domain- and DUF828-containing protein. Mutants have defects in leaf vascular pattering, with vascular bundles that fail to meet distally in both the cotyledons and leaves. Necessary to the formation of the closed leaf vascular pattern characteristic of dicot leaves in response to auxin. Redundant with FKD2. FKD1 may influence PIN1 localization in an auxin dependent manner. proposed to be a key component of the auxin canalization pathway. FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT3G63320 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G63360 | Encodes a defensin-like (DEFL) family protein. |
| AT3G63380 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
| AT3G63470 | serine carboxypeptidase-like 40;(source:Araport11) |
| AT4G00050 | Encodes a phytochrome interacting factor that inhibits phytochrome A-mediated far-red light responses and binds to promoter regions of AT2G46970 and AT3G62090. |
| AT4G00100 | Encodes a cytoplasmic ribosomal protein S13 homologue involved in early leaf development The mRNA is cell-to-cell mobile. |
| AT4G00150 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
| AT4G00160 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT4G00180 | YABBY gene family member, likely has transcription factor activity, involved in specifying abaxial cell fate. Along with FIL, involved in patterning of the fruit. GUS reporter gene expression in seedlings is observed in the young leaves and as the leaf matures, expression is restricted to the abaxial tissues of leaves, expression is also observed on either side of the leaf margin in the younger tissues of leaf blades. |
| AT4G00230 | xylem serine peptidase 1;(source:Araport11) |
| AT4G00231 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G00300 | AT4G00300 has been split into two loci based on new cDNA evidence provided by Aleksander Riise Hansen of University of Copenhagen: AT4G00300.2 becomes AT4G00300.1; a new locus AT4G00295 is created. See comments field for AT4G00295 annotation. |
| AT4G00305 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G00310 | Putative membrane lipoprotein;(source:Araport11) |
| AT4G00340 | Encodes a receptor-like protein kinase that is expressed in roots. |
| AT4G00355 | Encodes an Atg8-interacting protein that is partially associated with the ER during favorable growth conditions and becomes mainly associated with a spherical compartment that dynamically moves along the ER network. |
| AT4G00360 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems. |
| AT4G00530 | UvrABC system protein A;(source:Araport11) |
| AT4G00550 | encodes a UDP-galactose-dependent digalactosyldiacylglycerol(DGDG) synthase. Located in chloroplast outer membrane. |
| AT4G00560 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G00585 | transmembrane protein;(source:Araport11) |
| AT4G00610 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT4G00620 | Amino acid dehydrogenase family protein;(source:Araport11) |
| AT4G00660 | RNAhelicase-like 8;(source:Araport11) |
| AT4G00710 | Encodes BR-signaling kinase 3 (BSK3), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
| AT4G00720 | Encodes ASKtheta, a group III Arabidopsis GSK3/shaggy-like kinase. Functions in the brassinosteroid signalling pathway. |
| AT4G00750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G00800 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT4G00830 | Encodes a heterogeneous nuclear ribonucleoprotein (hnRNP-Q) that is involved in the plant innate immune response and may function as a suppressor of cell-autonomous immunity. |
| AT4G00840 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT4G00890 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
| AT4G00970 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G00980 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
| AT4G01000 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G01026 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of ABI1 and ABI2. |
| AT4G01060 | Encodes a Myb-related protein similar to CPC. Involved in epidermal cell differentiation. Mutants have reduced numbers of root hairs and increased trichome branching. Involved in endoreduplication. Loss of function mutants are hypertrophic and early flowering. |
| AT4G01070 | the glycosyltransferase (UGT72B1) is involved in metabolizing xenobiotica (chloroaniline and chlorophenole). Comparison between wild type and knock-out mutant demonstrates the central role of this gene for metabolizing chloroaniline but significantly less for chlorophenole. The glucosyltransferase preferred UDP-xylose over UDP-glucose indicating its (additional) functioning as a xylosyltransferase in planta |
| AT4G01080 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT4G01110 | late embryogenesis abundant hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G01130 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G01150 | Integral thylakoid membrane protein required for proper grana stack curvature. |
| AT4G01190 | Type I phosphatidylinositol-4-phosphate 5-kinase, subfamily A. Preferentially phosphorylates PtdIns4P. Expressed in flowers and inflorescence stems. |
| AT4G01200 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT4G01230 | Reticulon family protein. Mutants are resistant to agrobacterium infection. |
| AT4G01250 | AtWRKY22 is a member of WRKY Transcription Factor; Group II-e. It is involved in regulation of dark induced leaf senescence. |
| AT4G01265 | Pseudogene of AT4G01265; raffinose synthase family protein |
| AT4G01280 | RVE5 is one of eleven homologous MYB-like transcription factors in Arabidopsis and a member of the RVE8 clade. Plays a minor role in clock regulation. |
| AT4G01330 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G01380 | plastocyanin-like domain-containing protein;(source:Araport11) |
| AT4G01410 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT4G01455 | tRNA-Glu (anticodon: TTC) |
| AT4G01570 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G01630 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT4G01660 | Encodes an ABC1-like protein, member of the ATH subfamily; putative ABC transporter; isolated by functional complementation of a yeast abc1 mutant The mRNA is cell-to-cell mobile. |
| AT4G01670 | hypothetical protein;(source:Araport11) |
| AT4G01680 | Encodes a putative transcription factor (MYB55). |
| AT4G01700 | Chitinase family protein;(source:Araport11) |
| AT4G01720 | member of WRKY Transcription Factor; Group II-b |
| AT4G01740 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G01760 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G01860 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT4G01870 | tolB protein-like protein;(source:Araport11) |
| AT4G01915 | hypothetical protein;(source:Araport11) |
| AT4G01920 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G01940 | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU2 and 3 than to NFU4 and 5. Targeted to the chloroplast. |
| AT4G01960 | transmembrane protein;(source:Araport11) |
| AT4G02005 | None;(source:Araport11) |
| AT4G02030 | Vps51/Vps67 family (components of vesicular transport) protein;(source:Araport11) |
| AT4G02130 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT4G02150 | Encodes IMPORTIN ALPHA 3. Mutant plants act as suppressors of snc1 response and salicylic acid accumulation. Located in the nucleus. Involved in protein import. Protein interacts with Agrobacterium proteins VirD2 and VirE2. Is not individually essential for Agrobacterium-mediated root transformation, but when overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT4G02160 | cotton fiber protein;(source:Araport11) |
| AT4G02170 | cotton fiber protein;(source:Araport11) |
| AT4G02235 | AGAMOUS-like 51;(source:Araport11) |
| AT4G02250 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G02317 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-25 P-value blast match to GB:BAA22288 pol polyprotein (Ty1_Copia-element) (Oryza australiensis)GB:BAA22288 polyprotein (Ty1_Copia-element) (Oryza australiensis)gi|2443320|dbj|BAA22288.1| polyprotein (RIRE1) (Oryza australiensis) (Ty1_Copia-element);(source:TAIR10) |
| AT4G02330 | Encodes a pectin methylesterase that is sensitive to chilling stress and brassinosteroid regulation. |
| AT4G02405 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G02420 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT4G02500 | Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides. The mRNA is cell-to-cell mobile. |
| AT4G02650 | Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane. |
| AT4G02700 | sulfate transporter 3;(source:Araport11) |
| AT4G02770 | Encodes a protein predicted by sequence similarity with spinach PsaD to be photosystem I reaction center subunit II (PsaD1) |
| AT4G02780 | Catalyzes the conversion of geranylgeranyl pyrophosphate (GGPP) to copalyl pyrophosphate (CPP) of gibberellin biosynthesis |
| AT4G02820 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G02830 | hypothetical protein;(source:Araport11) |
| AT4G02930 | GTP binding Elongation factor Tu family protein;(source:Araport11) |
| AT4G03000 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G03010 | RNI-like superfamily protein;(source:Araport11) |
| AT4G03364 | Pseudogene of AT4G05230; ubiquitin family protein |
| AT4G03415 | Encodes a myristoylated 2C-type protein phosphatase that interacts with AGB1 and is localized to the plasma membrane. |
| AT4G03420 | hypothetical protein (DUF789);(source:Araport11) |
| AT4G03505 | hypothetical protein;(source:Araport11) |
| AT4G03550 | Encodes a callose synthase that is required for wound and papillary callose formation in response to fungal pathogens Erysiphe and Blumeria. Mutants are resistant to P. parasitica and exhibit an exaggerated PR1 response.Contributes to PAMP-induced basal defense. The mRNA is cell-to-cell mobile. |
| AT4G03620 | myosin heavy chain-like protein;(source:Araport11) |
| AT4G03820 | transmembrane protein, putative (DUF3537);(source:Araport11) |
| AT4G03965 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G04296 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.4e-13 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT4G04320 | malonyl-CoA decarboxylase family protein;(source:Araport11) |
| AT4G04470 | 22-kD peroxisomal membrane protein, an integral membrane protein embedded in the lipid bilayer. |
| AT4G04490 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04500 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04510 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04570 | Encodes a cysteine-rich receptor-like protein kinase. The mRNA is cell-to-cell mobile. |
| AT4G04620 | Autophagy protein. |
| AT4G04640 | One of two genes (with ATPC2) encoding the gamma subunit of Arabidopsis chloroplast ATP synthase. |
| AT4G04690 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G04710 | member of Calcium Dependent Protein Kinase |
| AT4G04800 | methionine sulfoxide reductase B3;(source:Araport11) |
| AT4G04850 | Encodes a potassium efflux antiporter; has three splice forms KEA3.1, KEA3.2, and KEA3.3, KEA3.2 is the most abundant splice form in all plant organs (silique, flower, leaf and root). KEA3.1 and KEA3.3 are minor variants that can be found in flowers and in leaves. KEA3 is localized to the thylakoid membrane and enriched in the stromal lamellae. It allows proton efflux from the thylakoid lumen by proton/potassium antiport. |
| AT4G04970 | encodes a gene similar to callose synthase The mRNA is cell-to-cell mobile. |
| AT4G04972 | hypothetical protein;(source:Araport11) |
| AT4G04990 | serine/arginine repetitive matrix-like protein (DUF761);(source:Araport11) |
| AT4G05020 | Miitochondrial alternative NADH dehydrogenase. |
| AT4G05030 | Copper transport protein family;(source:Araport11) |
| AT4G05040 | ankyrin repeat family protein;(source:Araport11) |
| AT4G05091 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G05105 | Encodes a microRNA that targets several Laccase family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCAUUGAGUGCAGCGUUGAUG |
| AT4G05130 | equilibrative nucleoside transporter 4;(source:Araport11) |
| AT4G05160 | Encodes a peroxisomal protein involved in the activation of fatty acids through esterification with CoA. At4g05160 preferentially activates fatty acids with medium chain length (C6:0 and C7:0) as well as even-numbered long-chain fatty acids (C14:0, C16:0 and C18:0). At4g05160 was also able to catalyze the conversion of OPC-6:0 to its CoA ester and is therefore thought to be involved in the peroxisomal β-oxidation steps of jasmonic acid biosynthesis. |
| AT4G05310 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G05540 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G06529 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.7e-246 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT4G06549 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, temporary gene name assignment;(source:TAIR10) |
| AT4G06619 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.0e-28 P-value blast match to At5g59620.1/14-257 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G06700 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.7e-54 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
| AT4G07031 | transposable_element_gene;(source:Araport11);similar to cytochrome P-450 aromatase-related [Arabidopsis thaliana] (TAIR:AT2G05870.1);(source:TAIR10) |
| AT4G07408 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G07410 | Encodes a WD-40 protein expressed both during embryo development and postembryonically in the SAM and RAM that functions in the auxin pathway, integrating auxin signaling in the organization and maintenance of the SAM and RAM. |
| AT4G07960 | encodes a XyG glucan synthase; gene similar to cellulose synthase |
| AT4G08150 | A member of class I knotted1-like homeobox gene family (together with KNAT2). Similar to the knotted1 (kn1) homeobox gene of maize. Normally expressed in the peripheral and rib zone of shoot apical meristem but not in the leaf primordia. It is also expressed in the fourth floral whorl, in the region that would become style, particularly in the cell surrounding the transmitting tissue. No expression was detected in the first three floral whorls. Expression is repressed by auxin and AS1 which results in the promotion of leaf fate. |
| AT4G08450 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G08455 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT4G08590 | ORTHRUS-like protein;(source:Araport11) |
| AT4G08867 | hypothetical protein;(source:Araport11) |
| AT4G08868 | hypothetical protein;(source:Araport11) |
| AT4G08980 | Encodes an F-box gene that is a novel negative regulator of AGO1 protein levels and may play a role in ABA signalling and/or response. It is a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins. |
| AT4G09040 | Encodes a protein that binds to the chloroplast psbA RNA. Has little effect on chloroplast gene expression under laboratory growth conditions. |
| AT4G09100 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09130 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09300 | LisH and RanBPM domains containing protein;(source:Araport11) |
| AT4G09420 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
| AT4G09450 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT4G09460 | Encodes myb6 DNA-binding protein. The mRNA is cell-to-cell mobile. |
| AT4G09550 | Encodes a gamma-tubulin complex protein that plays a role in gamma-tubulin complex localization, spindle stability and chromosomal segregation. |
| AT4G09965 | hypothetical protein;(source:Araport11) |
| AT4G09990 | glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11) |
| AT4G10180 | Encodes a nuclear-localized protein that acts as a repressor of photomorphogenesis and may be involved in chromatin remodeling. The mRNA is cell-to-cell mobile. |
| AT4G10340 | photosystem II encoding the light-harvesting chlorophyll a/b binding protein CP26 of the antenna system of the photosynthetic apparatus The mRNA is cell-to-cell mobile. |
| AT4G10350 | NAC domain protein. SMB, BRN1, and BRN2 act to regulate root cap maturation, in a partially redundant fashion.BRN1 and BRN2, control the cell wall maturation processes that are required to detach root cap layers from the root. |
| AT4G10500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G10507 | other_RNA;(source:Araport11) |
| AT4G10540 | Proteolytic enzyme of that phytaspase family which at pH 5.5 is strictly Asp-specific. Strongly preferred cleavage motifs are YVAD and IETD. |
| AT4G10620 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G10640 | Overexpression of IQD16 in transgenic Arabidopsis Pro35:IQD16 lines alters microtubule organization, cell shape, and plant growth. Phenotypes are reminiscent of lng1-1D plants, which overexpress LNG1/TRM2. IQD16 induces elongation of aerial tissues. |
| AT4G10720 | Ankyrin repeat family protein;(source:Araport11) |
| AT4G10750 | Phosphoenolpyruvate carboxylase family protein;(source:Araport11) |
| AT4G10767 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT4G10840 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
| AT4G10850 | Nodulin MtN3 family protein;(source:Araport11) |
| AT4G10925 | Nuclear transport factor 2 (NTF2) family protein;(source:Araport11) |
| AT4G10960 | Encodes a protein with UDP-D-glucose 4-epimerase activity. |
| AT4G11040 | Encodes a nuclear localized protein with sequence similarity to PP2C phosphatases that is involved in seed dormancy. Loss of function mutations have reduced seed dormancy but does not act through ABA or DOG1 pathways. Lacks several conserved key residues and does not possess any appreciable phosphatase activity in in vitro assays. QTL allele with a nonsynonymous amino acid change confers seed dormancy phenotype. |
| AT4G11050 | glycosyl hydrolase 9C3;(source:Araport11) |
| AT4G11090 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues.A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT4G11140 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT4G11175 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT4G11211 | hypothetical protein;(source:Araport11) |
| AT4G11290 | Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
| AT4G11300 | ROH1, putative (DUF793);(source:Araport11) |
| AT4G11320 | Papain family cysteine protease;(source:Araport11) |
| AT4G11405 | pre-tRNA tRNA-Thr (anticodon: TGT);(source:Araport11, TAIR10) |
| AT4G11450 | bromo-adjacent domain protein, putative (DUF3527);(source:Araport11) |
| AT4G11480 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G11500 | pseudogene of cysteine-rich RLK (RECEPTOR-like protein kinase) 34;(source:Araport11) |
| AT4G11530 | Encodes a cysteine-rich receptor-like protein kinase. The mRNA is cell-to-cell mobile. |
| AT4G11610 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G11670 | DNA topoisomerase 4 subunit B (DUF810);(source:Araport11) |
| AT4G11730 | Cation transporter/ E1-E2 ATPase family protein;(source:Araport11) |
| AT4G11745 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G11780 | GAR2-like protein;(source:Araport11) |
| AT4G11940 | Encodes a nuclear localized dosage sensitive paternally expressed imprinted gene. It is a member of a family of molecular chaperones called J-domain. Loss of ADM function suppresses seed abortion of triploid embryos and also partially rescues the effect of mea mutations. |
| AT4G11945 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to transposases;(source:TAIR10) |
| AT4G11950 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT4G12020 | Encodes a member of the A1 subgroup of the MEKK (MAPK/ERK kinase kinase) family. MEKK is another name for Mitogen-Activated Protein Kinase Kinase Kinase (MAPKKK or MAP3K). This subgroup has four members: At4g08500 (MEKK1, also known as ARAKIN, MAP3Kb1, MAPKKK8), At4g08480 (MEKK2, also known as MAP3Kb4, MAPKKK9), At4g08470 (MEKK3, also known as MAP3Kb3, MAPKKK10) and At4g12020 (MEKK4, also known as MAP3Kb5, MAPKKK11, WRKY19). Nomenclatures for mitogen-activated protein kinases are described in Trends in Plant Science 2002,7(7):301. Co-regulates with DSC1 basal levels of immunity to root-knot nematodes. |
| AT4G12030 | Required for the biosynthesis of methionine-derived glucosinolates. Involved in the transport of 2-keto acids between chloroplasts and the cytosol. |
| AT4G12050 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
| AT4G12065 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT4G12080 | AT-hook motif nuclear-localized protein 1;(source:Araport11) |
| AT4G12130 | Encodes a mitochondrial COG0354 protein that requires folate for its function in Fe/S cluster biogenesis. |
| AT4G12150 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G12160 | pseudogene of Ribosomal protein S4;(source:Araport11) |
| AT4G12230 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G12250 | UDP-D-glucuronate 4-epimerase |
| AT4G12270 | Copper amine oxidase family protein;(source:Araport11) |
| AT4G12390 | pectin methylesterase inhibitor 1;(source:Araport11) |
| AT4G12690 | DUF868 family protein (DUF868);(source:Araport11) |
| AT4G12710 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G12730 | AF333971 Arabidopsis thaliana fasciclin-like arabinogalactan-protein 2 (Fla2) mRNA, complete cds. Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT4G12917 | other_RNA;(source:Araport11) |
| AT4G12950 | Fasciclin-like arabinogalactan family protein;(source:Araport11) |
| AT4G13000 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT4G13040 | Encodes a member of the AP2/EREBP transcription factor family that has only one AP2 domain. It is a positive regulator of disease defense that functions upstream of SA accumulation. |
| AT4G13050 | Acyl-ACP thioesterase;(source:Araport11) |
| AT4G13070 | RNA-binding CRS1 / YhbY (CRM) domain protein;(source:Araport11) |
| AT4G13100 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G13195 | Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini. The C-terminal 12 amino acid sequence of CLE44 is identical to that of a dodeca peptide (TDIF, tracheary element differentiation inhibitory factor) isolated from Arabidopsis and functions as a suppressor of plant stem cell differentiation. TDIF sequence is also identical to the C-terminal 12 amino acids of CLE41 (At3g24770). The protein is expressed in the vascular system and is involved in axillary bud formation. |
| AT4G13240 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT4G13245 | snoRNA;(source:Araport11) |
| AT4G13260 | Encodes YUC2. Catalyzes conversion of IPA (indole-3-pyruvic acid) to IAA (indole-3-acetic acid) in auxin biosynthesis pathway. |
| AT4G13270 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT4G13330 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G13340 | Leucine rich extensin protein involved in cell wall biogenesis and organization. Interacts with several members of the RALF family of ligand peptides. |
| AT4G13400 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G13480 | Member of the R2R3 factor gene family. |
| AT4G13490 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G13500 | transmembrane protein;(source:Araport11) |
| AT4G13540 | ADR is a peroxisome localized, myristoylated protein. It is expressed in flowers and plays a role in suppressing ROS accumulation in anthers. Overexpression results in reduced ROS, lower levels of NST1 and NST2 and, consequently alterations in lignification of the anther endothecium resulting in male sterility. |
| AT4G13600 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT4G13710 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G13730 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT4G13760 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G13790 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G13850 | Encodes a glycine-rich RNA-binding protein. Gene expression is induced by cold. |
| AT4G13890 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT4G13920 | receptor like protein 50;(source:Araport11) |
| AT4G14010 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT4G14040 | selenium-binding protein 2;(source:Araport11) |
| AT4G14070 | Plastidic acyl activating enzyme involved in the elongation of exogenous medium-chain fatty acids to 16- and 18-carbon fatty acids. |
| AT4G14090 | The At4g14090 encodes a anthocyanidin 5-O-glucosyltransferase specifically glucosylating the 5-position of the flavonoid A-ring. |
| AT4G14104 | capsid-like protein;(source:Araport11) |
| AT4G14135 | Pseudogene of AT3G29785 |
| AT4G14149 | Pseudogene of AT2G24480; zinc finger (C3HC4-type RING finger) family protein |
| AT4G14230 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
| AT4G14240 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
| AT4G14310 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT4G14368 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT4G14390 | Ankyrin repeat family protein;(source:Araport11) |
| AT4G14465 | AT-hook protein. Overexpression results in early flowering in short and long days. |
| AT4G14550 | IAA14 is a member of the Aux/IAA protein family. Involved in lateral root development. Gain of function mutation decreases auxin-inducible gene expression. Protein is localized to the nucleus. Expressed in stele and root tip epidermis. Functions as a negative regulator of ARF7/19. |
| AT4G14580 | CBL-interacting protein kinase |
| AT4G14620 | hypothetical protein (DUF506);(source:Araport11) |
| AT4G14680 | Encodes one of three A. thaliana ATP-sulfurylases. APS is the first enzyme of sulfate assimilation that catalyzes the formation of adenosine-5'-phosphosulfate from ATP and sulfate. |
| AT4G14713 | PPD1 (and its paralog, PPD2) encode plant-specific putative DNA-binding proteins. PPD1 and PPD2 are not found in grasses. Overexpression of PPD reduces lamina size by promoting the early arrest of dispersed meristematic cells DMC proliferation during leaf and silique development. Deletion of the PPD locus increases leaf lamina size and results in dome-shaped rather than flat leaves. Siliques are also altered in shape because of extra lamina growth. The curvature of a deltappd leaf reflects the difference between excess growth of the lamina and a limitation to the extension capacity of its perimeter. |
| AT4G14730 | Stress induced membrane protein. Mutants show enhanced cell death under stress. |
| AT4G14740 | FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT4G14743 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT4G14746 | neurogenic locus notch-like protein;(source:Araport11) |
| AT4G14770 | Regulates fate transition and cell Divisions in the stomatal lineage. |
| AT4G14785 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT4G14805 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G14900 | FRIGIDA-like protein;(source:Araport11) |
| AT4G14940 | atao1 gene of Arabidopsis thaliana encodes an extracellular copper amine oxidase expressed during early stages of vascular tissue development. |
| AT4G15200 | Actin nucleation factor that directs the formation of actin cables in pollen tubes. Involved in cytoplasmic streaming and polarized growth in pollen tubes. |
| AT4G15210 | cytosolic beta-amylase expressed in rosette leaves and inducible by sugar. RAM1 mutants have reduced beta amylase in leaves and stems. |
| AT4G15250 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT4G15260 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G15270 | glucosyltransferase-like protein;(source:Araport11) |
| AT4G15280 | UDP-glucosyl transferase 71B5;(source:Araport11) |
| AT4G15330 | cytochrome P450, family 705, subfamily A, polypeptide 1;(source:Araport11) |
| AT4G15345 | cytochrome P450 pseudogene |
| AT4G15360 | member of CYP705A |
| AT4G15370 | Encodes an oxidosqualene cyclase that primarily produces the tetracyclic triterpene baruol in vitro and when expressed in yeast. It can also make 22 other minor triterpenoid products with varying numbers of rings. |
| AT4G15430 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
| AT4G15450 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
| AT4G15520 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
| AT4G15550 | UDP-glucose:indole-3-acetate beta-D-glucosyltransferase |
| AT4G15630 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G15650 | kinase-like protein;(source:Araport11) |
| AT4G15755 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT4G15760 | Encodes a protein with similarity to monooxygenases that are known to degrade salicylic acid (SA). |
| AT4G15770 | RNA binding protein;(source:Araport11) |
| AT4G15800 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. The mRNA is cell-to-cell mobile. |
| AT4G15890 | CAP-3D is a subunit of condensin. It a target of MMD1 regulation and also involved in meiotic chromosome condensation. Mutants have reduced fertility. Required for the correct spatial relationship between centromeres and rDNA arrays. |
| AT4G15900 | Mutations confer hypersensitivity to glucose and sucrose and augments sensitivity to cytokinin, ethylene, ABA and auxin. Encodes a nuclear WD40 protein that is imported into the nucleus. Essential for plant innate immunity. Interacts with MOS4 and AtCDC5. It is also predicted to have two DWD motifs. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase, and may affect the stability of AKIN10. |
| AT4G15910 | encodes a gene whose transcript level in root and leaves increases to progressive drought stress. The transcript level is also affected by changes of endogenous or exogenous abscisic acid level. It appears to be a member of plant-specific gene family that includes late embryo-abundant and zinc- IAA-induced proteins in other plants. The mRNA is cell-to-cell mobile. |
| AT4G15980 | ProPME pectin methylesterase |
| AT4G16030 | Ribosomal protein L19e family protein;(source:Araport11) |
| AT4G16060 | hypothetical protein;(source:Araport11) |
| AT4G16095 | RNI-like superfamily protein;(source:Araport11) |
| AT4G16110 | Encodes a pollen-specific transcription factor involved in the expression of nuclear genes for components of mitochondrial complex I in Arabidopsis. Acts in concert with other type-B ARRs in the cytokinin signaling pathway. AHK3 mediates cytokinin-induced phosphorylation of ARR2 on the Asp-80 residue. This phosphorylation plays a positive role of ARR2 in cytokinin-mediated control of leaf longevity. Also involved in cytokinin-dependent inhibition of hypocotyl elongation. |
| AT4G16160 | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. Two OEP16 genes are closely related to each other and are conserved in all land plants, OEP16-2, also named OEP16-S, and OEP16-1 (renamed OEP16-L) are result of the gene duplication event that occurred prior to divergence of bryophytes and seed plants. Predominantly expressed in seed and is not inducible by cold treatment. atOEP16-S gained an additional exon. The promoter region of atOEP16-S (but not atOEP16-L) contains multiple G-box ABA-responsive elements. The atOEP16-S promoter conferred developmentally regulated seed- and pollen-specific GUS expression in tobacco. |
| AT4G16190 | Papain family cysteine protease;(source:Araport11) |
| AT4G16260 | Encodes a putative beta-1,3-endoglucanase that interacts with the 30C02 cyst nematode effector. May play a role in host defense. |
| AT4G16370 | Encodes a phloem-specific iron transporter that is essential for systemic iron signaling and redistribution of iron and cadmium. It loads iron into the phloem, facilitates iron recirculation from the xylem to the phloem, and regulates both shoot-to-root iron signaling and iron redistribution from mature to developing tissues. |
| AT4G16390 | Encodes a pentatricopeptide repeat protein, SVR7 (SUPPRESSOR OF VARIEGATION7), required for FtsH-mediated chloroplast biogenesis. It is involved in accumulation and translation of chloroplast ATP synthase subunits. |
| AT4G16430 | bHLH3 interacts with JAZ proteins, and functions redundantly with bHLH13, bHLH14 and bHLH17 to negatively regulate jasmonate responses. |
| AT4G16490 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G16510 | YbaK/aminoacyl-tRNA synthetase-associated domain-containing protein;(source:Araport11) |
| AT4G16515 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
| AT4G16550 | HSP20-like chaperone, expression is induced by stress. |
| AT4G16630 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT4G16640 | Matrix metalloprotease. |
| AT4G16745 | Exostosin family protein;(source:Araport11) |
| AT4G16750 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT4G16810 | VEFS-Box of polycomb protein;(source:Araport11) |
| AT4G16835 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G16850 | 6-transmembrane (6TM) protein that underlies a QTL for petal size with increased expression correlating to increased petal size. |
| AT4G16950 | Contains a putative nucleotide binding site and leucine-rich repeats. Similar to the plant resistance genes N and L6, and to the toll and interleukin-1 receptors. Confers resistance to Peronospora parasitica.Redundant function together with SIKIC1 and 3 in SNC1-mediated autoimmunity. Protein levels controlled by MUSE1 and MUSE2. |
| AT4G17010 | transcription factor IIIB;(source:Araport11) |
| AT4G17020 | transcription factor-like protein;(source:Araport11) |
| AT4G17040 | HON5 (At4g17040) encodes the ClpR4 subunit of the chloroplast-localized Clp protease complex. hon mutations disturb plastid protein homeostasis, thereby activating plastid signaling and inducing stress acclimatization. |
| AT4G17070 | peptidyl-prolyl cis-trans isomerase;(source:Araport11) |
| AT4G17100 | poly(U)-specific endoribonuclease-B protein;(source:Araport11) |
| AT4G17310 | hypothetical protein;(source:Araport11) |
| AT4G17390 | Ribosomal protein L23/L15e family protein;(source:Araport11) |
| AT4G17440 | chromogranin (DUF1639);(source:Araport11) |
| AT4G17490 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-6). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. It is involved in the response to reactive oxygen species and light stress. Involved in regulating root architecture and the response to cold stress. |
| AT4G17500 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. The mRNA is cell-to-cell mobile. |
| AT4G17560 | Ribosomal protein L19 family protein;(source:Araport11) |
| AT4G17680 | Encodes an S-ribonuclease binding protein specifically involved in plant tolerance to NaHCO3. |
| AT4G17690 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G17700 | hypothetical protein;(source:Araport11) |
| AT4G17710 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT4G17780 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G17790 | SNARE associated Golgi protein family;(source:Araport11) |
| AT4G17860 | carboxyl-terminal proteinase-like protein, putative (DUF239);(source:Araport11) |
| AT4G17880 | MYC4 is bHLH transcriptional regulator. It functions as a JAZ-interacting transcription factor that acts together with MYC2 and MYC3 to activate JA-responses. It also functions in blue light mediated secondary cell wall biogenesis via regulation of NST1 expression. MYC4 directly binds to NST1 promoter and activates its expression. |
| AT4G17920 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G18020 | Encodes pseudo-response regulator 2 (APRR2) that interacts with a calcium sensor (CML9). |
| AT4G18050 | P-glycoprotein 9;(source:Araport11) |
| AT4G18160 | Encodes AtTPK3 (KCO6), a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK3 is found in the thylakoid stromal lamellae. May form homomeric ion channels in vivo. It modulates the partitioning of the proton motive force (pmf) between the delta psi and delta pH in chloroplasts in vivo at physiological light intensities. Vacuolar K+-conducting TPC1 and TPK1/TPK3 channels act in concert to provide for Ca2+- and voltageinduced electrical excitability to the central organelle of plant cells. |
| AT4G18170 | Member of WRKY Transcription Factor; Group II-c. Involved in the activation of salicylic acid biosynthesis genes ICS1 and PBS3. In the ovule, it is expressed in hypodermal somatic cells and appears to play a role in supression of megasporocyte cell fate. In the leaf if is upstream of FHY3 and regulates light-mediated leaf senescence. |
| AT4G18230 | UDP-N-acetylglucosamine transferase subunit ALG14-like protein;(source:Araport11) |
| AT4G18250 | receptor Serine/Threonine kinase-like protein;(source:Araport11) |
| AT4G18335 | hypothetical protein;(source:Araport11) |
| AT4G18340 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G18350 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
| AT4G18375 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT4G18422 | transmembrane protein;(source:Araport11) |
| AT4G18440 | L-Aspartase-like family protein;(source:Araport11) |
| AT4G18596 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT4G18600 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
| AT4G18640 | Required for root hair elongation during tip growth. The mRNA is cell-to-cell mobile. |
| AT4G18660 | delay of germination protein;(source:Araport11) |
| AT4G18670 | Leucine rich extensin protein involved in cell wall biogenesis and organization. Interacts with several members of the RALF family of ligand peptides. |
| AT4G18700 | Encodes CBL-interacting protein kinase 12 (CIPK12). |
| AT4G18890 | BES1/BZR1 homolog 3;(source:Araport11) |
| AT4G18910 | Encodes an aquaporin homolog. Functions in arsenite transport and tolerance.When expressed in yeast cells can conduct hydrogen peroxide into those cells. |
| AT4G18920 | histone acetyltransferase (DUF1264);(source:Araport11) |
| AT4G19040 | Encodes a PH and START domain-containing protein that mediates resistance to pathogenic fungi. Resistance requires salicylic acid signalling. Mutants are resistant to E. cichoracearum. Expressed throughout plant tissues and possibly localized to membranes /mitochondrion. |
| AT4G19130 | Replication factor-A protein 1-like protein;(source:Araport11) |
| AT4G19140 | exopolysaccharide production negative regulator;(source:Araport11) |
| AT4G19170 | Encodes a chloroplast-targeted member of a family of enzymes similar to nine-cis-epoxycarotenoid dioxygenase that acts as a major regulator of carotenoid degradation during dark-induced leaf senescence.. The mRNA is cell-to-cell mobile. |
| AT4G19220 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G19270 | hypothetical protein;(source:Araport11) |
| AT4G19390 | Uncharacterized protein family (UPF0114);(source:Araport11) |
| AT4G19430 | hypothetical protein;(source:Araport11) |
| AT4G19460 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G19510 | Disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT4G19520 | disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G19540 | Encodes a iron-suflur protein required for NADH dehydrogenase. |
| AT4G19640 | Encodes Ara7. |
| AT4G19700 | Encodes BOI (Botrytis Susceptible 1 Interactor). Has E3 ubiquitin ligase activity. Interacts with and ubiquitinates BOS1 (Botrytis Susceptible 1). It prevents caspase activation and attenuates cell death. |
| AT4G19810 | ChiC encodes a Class V chitinase that is a part of glycoside hydrolase family 18 based on CAZy groupings. It appears to primarily act as an exochitinase in vitro where it predominantly cleaves a chitobiose (GlcNAc)2 residue from the non-reducing end of a chitin oligosaccharide. However, it shows some minor endochitinase activity in vitro, as well. A putative 24 amino-acid signal peptide may direct this protein to the secretory system and it has been detected in cell wall apoplastic fluid. RT-PCR experiments demonstrate that ChiC transcript levels are increased in response to abscisisc acid, jasmonic acid, and NaCl stress. Microarray results also suggest that transcript levels rise in response to osmotic stress, two fungal pathogens, a bacterial pathogen, and the elicitor flagellin. The mRNA is cell-to-cell mobile. |
| AT4G19820 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
| AT4G19980 | hypothetical protein;(source:Araport11) |
| AT4G19990 | FAR1-related sequence 1;(source:Araport11) |
| AT4G20040 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G20070 | The gene encoding Arabidopsis thaliana Allantoate Amidohydrolase (AtAAH)which catalyzes the allantoate deiminase reaction (EC 3.5.3.9)is expressed in all parts of the plant being consistent with a function in purine turnover in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT4G20080 | Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G20140 | Encodes GASSHO1 (GSO1), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO1 and a homolog GSO2 (At5g44700) are required for the formation of a normal epidermal surface during embryogenesis. Necessary for localizing CASPARIAN STRIP DOMAIN PROTEINS (CASPs) - major players of endodermal differentiation - into an uninterrupted, ring-like domain. |
| AT4G20200 | Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
| AT4G20220 | Reverse transcriptase (RNA-dependent DNA polymerase);(source:Araport11) |
| AT4G20325 | ribonuclease H2 subunit B;(source:Araport11) |
| AT4G20480 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT4G20840 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
| AT4G20880 | ethylene-responsive nuclear protein / ethylene-regulated nuclear protein (ERT2);(source:Araport11) |
| AT4G20920 | double-stranded RNA-binding domain (DsRBD)-containing protein;(source:Araport11) |
| AT4G20960 | encodes diaminohydroxyphosphoribosylaminopyrimidine deaminase catalyzing the second step in the riboflavin biosynthesis |
| AT4G20980 | Eukaryotic translation initiation factor 3 subunit 7 (eIF-3);(source:Araport11) |
| AT4G20990 | alpha carbonic anhydrase 4;(source:Araport11) |
| AT4G21120 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Mediates efficient uptake of Lys, Arg and Glu in a yeast system. The mRNA is cell-to-cell mobile. |
| AT4G21210 | Encodes a PPDK regulatory protein that has both protein kinase and protein phosphatase activities towards PPDK (pyruvate orthophosphate dikinase). |
| AT4G21326 | subtilase 3.12;(source:Araport11) |
| AT4G21380 | encodes a putative receptor-like serine/threonine protein kinases that is similar to Brassica self-incompatibility (S) locus. Expressed in root. Shoot expression limited to limited to the root-hypocotyl transition zone and at the base of lateral roots as well as in axillary buds, and pedicels. |
| AT4G21390 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G21430 | protein B160;(source:Araport11) |
| AT4G21437 | unknown pseudogene |
| AT4G21470 | Bifunctional enzyme that catalyzes hydrolysis of FMN to riboflavin, and phosphorylation of riboflavin to FMN. The mRNA is cell-to-cell mobile. |
| AT4G21480 | Putative sugar transporter. Expressed in nematode-induced root syncytia. |
| AT4G21540 | Encodes a sphingosine kinase, also has enzyme activity towards other plant long-chain sphingoid bases. Involved in guard cell ABA signalling and seed germination. |
| AT4G21705 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G21750 | Encodes a homeobox protein similar to GL2. It is expressed in both the apical and basal daughter cells of the zygote as well as their progeny. Expression is detected starting the two-celled stage of embryo development and is later restricted to the outermost, epidermal cell layer from its inception. Its promoter is highly modular with each region contributing to specific aspects of the gene's spatial and temporal expression. Double mutant analysis with PDF2, another L1-specific gene, suggests that their functions are partially redundant and the absence of both of the genes result in abnormal shoot development. |
| AT4G21770 | Pseudouridine synthase family protein;(source:Araport11) |
| AT4G21820 | binding / calmodulin binding protein;(source:Araport11) |
| AT4G21850 | methionine sulfoxide reductase B9;(source:Araport11) |
| AT4G21903 | MATE efflux family protein;(source:Araport11) |
| AT4G21926 | hypothetical protein;(source:Araport11) |
| AT4G21970 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT4G22030 | F-box protein with a domain protein;(source:Araport11) |
| AT4G22070 | member of WRKY Transcription Factor; Group II-b |
| AT4G22240 | Involved in photoprotection of photosystem II. The RVSI and twin-positive motifs in the transit peptide are necessary for efficient leucoplast import of prFB. |
| AT4G22250 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G22260 | Similar to mitochondrial alternative oxidase. im mutants have a variegated phenotype and fail to differentiate chloroplasts in the majority of their cells under high light intensity continuous illumination. The white tissues of immutans accumulate phytoene, a non-colored C40 carotenoid intermediate. This suggests that immutans controls, either directly or indirectly, the activity of phytoene desaturase (PDS), the enzyme that converts phytoene to zeta-carotene in higher plants. However, im is not the structural gene for PDS. It is located in the lumenar face of the thylakoid membrane. IM is expressed ubiquitously in plant tissues. |
| AT4G22270 | Encodes a plasma membrane protein involved in the positive regulation of organ size development. Overexpression results in organ size enlargement. |
| AT4G22290 | Paralog of SHOU4-like. Predicted transmembrane protein. |
| AT4G22530 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G22540 | OSBP(oxysterol binding protein)-related protein 2A;(source:Araport11) |
| AT4G22550 | Phosphatidic acid phosphatase (PAP2) family protein;(source:Araport11) |
| AT4G22580 | Exostosin family protein;(source:Araport11) |
| AT4G22590 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G22620 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G22670 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The mRNA is cell-to-cell mobile. |
| AT4G22690 | member of CYP706A The mRNA is cell-to-cell mobile. |
| AT4G22770 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT4G22780 | Member of a family of ACT domain containing proteins . ACT domains are involved in amino acid binding . |
| AT4G22810 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
| AT4G22940 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G23030 | MATE efflux family protein;(source:Araport11) |
| AT4G23060 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G23150 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23160 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23210 | Encodes a Cysteine-rich receptor-like kinase (CRK13). Overexpression of CRK13 leads to hypersensitive response cell death, and induces defense against pathogens by causing increased accumulation of salicylic acid. |
| AT4G23260 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23270 | Encodes a cysteine-rich receptor-like protein kinase. The mRNA is cell-to-cell mobile. |
| AT4G23320 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23350 | transmembrane protein, putative (DUF239);(source:Araport11) |
| AT4G23420 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G23500 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G23530 | ROH1, putative (DUF793);(source:Araport11) |
| AT4G23540 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G23560 | glycosyl hydrolase 9B15;(source:Araport11) |
| AT4G23600 | Encodes cystine lyase which is expected to be involved in amino acid metabolism, providing the plant with cysteine and the generation of precursors of ethylene biosynthesis. mRNA levels are elevated in response to wounding. |
| AT4G23670 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT4G23680 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT4G23700 | member of Putative Na+/H+ antiporter family |
| AT4G23720 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT4G23810 | member of WRKY Transcription Factor; Group III |
| AT4G23820 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G23882 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G23950 | Encodes a member of the mid-SUN subfamily of SUN-domain proteins. It is involved in early seed development and nuclear morphology. |
| AT4G23980 | Encodes auxin response factor 9 (ARF9). The mRNA is cell-to-cell mobile. |
| AT4G24010 | encodes a protein similar to cellulose synthase |
| AT4G24050 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G24130 | ABA responsive SVB family gene. |
| AT4G24550 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
| AT4G24570 | Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470). The mRNA is cell-to-cell mobile. |
| AT4G24640 | Encodes AppB protein (AppB1). |
| AT4G24660 | homeobox protein 22;(source:Araport11) |
| AT4G24730 | manganese-dependent ADP-ribose/CDP-alcohol diphosphatase-like protein;(source:Araport11) |
| AT4G24780 | Encodes a pectate lyase involved in response to nematodes. |
| AT4G24790 | AAA-type ATPase family protein;(source:Araport11) |
| AT4G24805 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G24840 | oligomeric golgi complex subunit-like protein;(source:Araport11) |
| AT4G24920 | secE/sec61-gamma protein transport protein;(source:Araport11) |
| AT4G24940 | Encodes one of the two subunits of the SUMO activation enzyme required during sumolation. Sumolation is a post-translational protein modification process similar to ubiquitination during which a polypeptide (SUMO) is covalently attached to a target protein. |
| AT4G25000 | Predicted to be secreted protein based on signalP prediction. Involved in starch mobilization. Mutants are defective in alpha-amylase activity. (Note: AMY1 has been found in the literature to be referred to as AMY3, which is not to be confused with AMY3/At1g69830). |
| AT4G25070 | caldesmon-like protein;(source:Araport11) |
| AT4G25080 | Encodes a protein with methyltransferase activity responsible for the methylation of magnesium protoporphyrin IX. Mutants defective in this gene are affected in chlorophyll biosynthesis and show a reduction in the accumulation of a number of major thylakoid-associated proteins including components of PSI (LHCI), PSII (LHCII, D1, CP43) and the cytochrome b6f complex (Cytf). By contrast, no significant changes were detected for the proteins of the stroma and the chloroplast envelope. |
| AT4G25090 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
| AT4G25160 | Encodes a U-box domain-containing E3 ubiquitin ligase with central Ser/Thr protein kinase domain whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. |
| AT4G25260 | Pectin methylesterase inhibitor. Forms pH dependent complex with PME3. |
| AT4G25350 | SHB1 encodes a nuclear and cytosolic protein that has motifs homologous with SYG1 protein family members. Acts in cryptochrome signaling. Overexpression of SHB1 enhanced the expression of PHYTOCHROME-INTERACTING FACTOR4 (PIF4) under red light and promoted proteasome-mediated degradation of phytochrome A and hypocotyl elongation under far-red light. A knockout allele suppressed LONG HYPOCOTYL IN FAR-RED LIGHT1 (HFR1) expression and showed several deetiolation phenotypes. Acts upstream of HFR1. Regulates seed development. |
| AT4G25410 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G25470 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature, abscisic acid, and circadian rhythm. Overexpressing this gene leads to increased freeze tolerance and induces the expression level of 85 cold-induced genes and reduces the expression level of 8 cold-repressed genes, which constitute the CBF2 regulon. Mutations in CBF2 increases the expression level of CBF1 and CBF3, suggesting that this gene may be involved in a negative regulatory or feedback circuit of the CBF pathway. |
| AT4G25610 | C2H2-like zinc finger protein;(source:Araport11) |
| AT4G25700 | Converts beta-carotene to zeaxanthin via cryptoxanthin. |
| AT4G25710 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G25835 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G25860 | OSBP(oxysterol binding protein)-related protein 4A;(source:Araport11) |
| AT4G25970 | Encodes the major form of the two non-mitochondrail phosphatidylserine decarboxylase. Located at the ER. The mRNA is cell-to-cell mobile. |
| AT4G26090 | Encodes a plasma membrane protein with leucine-rich repeat, leucine zipper, and P loop domains that confers resistance to Pseudomonas syringae infection by interacting with the avirulence gene avrRpt2. RPS2 protein interacts directly with plasma membrane associated protein RIN4 and this interaction is disrupted by avrRpt2. The mRNA is cell-to-cell mobile. |
| AT4G26095 | Natural antisense transcript overlaps with AT4G26090;(source:Araport11) |
| AT4G26120 | Ankyrin repeat family protein / BTB/POZ domain-containing protein;(source:Araport11) |
| AT4G26140 | putative beta-galactosidase |
| AT4G26180 | Encodes a mitochondrial CoA transporter. |
| AT4G26260 | Encodes a myo-inositol oxygenase, which is the first enzyme in the inositol route to ascorbate (L‐ascorbic acid, AsA, vitamin C). Overexpression results in enhanced biomass and abiotic stress tolerance. |
| AT4G26310 | elongation factor P (EF-P) family protein;(source:Araport11) |
| AT4G26380 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G26390 | Pyruvate kinase family protein;(source:Araport11) |
| AT4G26470 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G26540 | Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11) |
| AT4G26700 | Encodes a member of the fimbrin family. Different members of the fimbrin/plastin family have diverged biochemically during evolution to generate either tight actin bundles or loose networks with distinct biochemical and biophysical properties. FIM4 generates both actin bundles and branched actin filaments whereas FIM5 only generates actin bundles. |
| AT4G26820 | GrpE-like protein;(source:Araport11) |
| AT4G26830 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT4G26850 | Encodes a novel protein involved in ascorbate biosynthesis, which was shown to catalyze the transfer of GMP from GDP-galactose to a variety of hexose-1-phosphate acceptors. Recessive mutation has a reduced amount of vitamin C, lower level of non-photochemical quenching, and reduced rate of conversion of violaxanthin to zeaxanthin in high light. |
| AT4G26880 | Stigma-specific Stig1 family protein;(source:Araport11) |
| AT4G26890 | Member of MEKK subfamily. Involved in wound response signaling. Interacts with At5g40440, and activates At1g59580. |
| AT4G26900 | encodes a glutamine amidotransferase and cyclase, catalyzes the fifth and sixth steps of the histidine biosynthetic pathway |
| AT4G27050 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT4G27190 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT4G27250 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G27290 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G27310 | Encodes an atypical B-box domain protein that negatively regulates photomorphogenic development by interfering with the binding of the transcription factor HY5 to target gene promoters. Degradation of BBX28 in darkness is dependent on COP1 and occurs via the 26S proteasome pathway. BBX28 acts as a key factor in the COP1-HY5 regulatory hub by maintaining proper HY5 activity to ensure normal photomorphogenic development in plants. Interacts with CO via B-box domain resulting in decreased FT expression and delayed flowering. |
| AT4G27320 | Contains a universal stress protein domain. Protein is phosphorylated in response to Phytophthora infestans zoospores and xylanase. |
| AT4G27480 | GT14 enzyme |
| AT4G27540 | prenylated RAB acceptor 1.H;(source:Araport11) |
| AT4G27550 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active but no trehalose phosphatase (TPP)-like domain. |
| AT4G27585 | Encodes a stomatin-like protein that is present in a mitochondrial membrane-bound 3 MDa protein complex and is involved in the assembly of mitochondrial respiratory supercomplexes. There is an observed increase in abundance of respiratory complex III2 in SLP1 single and double knockout mutants. The protein is not redundant with Arabidopsis SLP2 (At5g54100). |
| AT4G27610 | intracellular protein transporter;(source:Araport11) |
| AT4G27710 | member of CYP709B The mRNA is cell-to-cell mobile. |
| AT4G27730 | oligopeptide transporter |
| AT4G27780 | Encodes acyl-CoA-binding protein with ankyrin repeats The mRNA is cell-to-cell mobile. |
| AT4G27800 | Choroplast protein phosphatase TAP38/PPH1 is required for efficient dephosphorylation of the LHCII anthena and state transition from state 2 to state 1. |
| AT4G27810 | hypothetical protein;(source:Araport11) |
| AT4G27860 | vacuolar iron transporter (VIT) family protein;(source:Araport11) |
| AT4G27870 | Vacuolar iron transporter (VIT) family protein;(source:Araport11) |
| AT4G27875 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
| AT4G27960 | ubiquitin conjugating enzyme |
| AT4G28030 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT4G28050 | Member of TETRASPANIN family |
| AT4G28130 | diacylglycerol kinase 6;(source:Araport11) |
| AT4G28170 | transmembrane protein;(source:Araport11) |
| AT4G28240 | Member of the wound-induced polypeptide (WIP) family. Positively regulates plant resistance against Pst DC3000 by enhancing PTI responses. |
| AT4G28250 | putative beta-expansin/allergen protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT4G28290 | hypothetical protein;(source:Araport11) |
| AT4G28310 | microtubule-associated protein;(source:Araport11) |
| AT4G28330 | pyrroline-5-carboxylate reductase;(source:Araport11) |
| AT4G28395 | related to lipid transfer proteins |
| AT4G28400 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT4G28480 | DNAJ heat shock family protein;(source:Araport11) |
| AT4G28485 | The structure of this gene is mis-annotated in TAIR10. Please refer to PMID:20712629 and the Comment field on the TAIR locus page for revised annotation. |
| AT4G28490 | Member of Receptor kinase-like protein family. Controls the separation step of floral organ abscission. The mRNA is cell-to-cell mobile. |
| AT4G28652 | Natural antisense transcript overlaps with AT4G28650;(source:Araport11) |
| AT4G28700 | ammonium transporter 1;(source:Araport11) |
| AT4G28720 | Auxin biosynthetic gene regulated by RVE1. Overexpression leads to suppression of bri1 phenotype. |
| AT4G28750 | mutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Subunit E of Photosystem I |
| AT4G28811 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G28815 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G28890 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G28910 | Encodes a transcriptional repressor that functions in the jasmonic acid (JA) signalling pathway, root development, and has a key role in leaf development, likely due to the transcriptional regulation of CYCD3 expression. Transcriptional repressor that accumulates in short-day conditions. Regulates together with FRS7 and FRS12 glucosinolate biosynthesis. |
| AT4G29070 | Phospholipase A2 family protein;(source:Araport11) |
| AT4G29100 | Member of basic helix loop helix protein family. Expressed primarily in vascular system. Overexpression causes ABA sensitivity. Together with PFA1 and PFA2 governs the competence of pericycle cells to initiate lateral root primordium formation. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT4G29103 | transmembrane protein;(source:Araport11) |
| AT4G29150 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G29190 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT4G29240 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT4G29260 | VSP3 is a secreted acid phosphatase. |
| AT4G29276 | Pseudogene of AT4G29270; acid phosphatase class B family protein |
| AT4G29281 | Pseudogene of AT4G29270; acid phosphatase class B family protein |
| AT4G29390 | Ribosomal protein S30 family protein;(source:Araport11) |
| AT4G29440 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT4G29690 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT4G29740 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT4G29770 | Target of trans acting-siR480/255. Testing. |
| AT4G29790 | SAGA complex subunit. Regulates gene expression by affecting histone H3 acetylation. |
| AT4G29800 | PATATIN-like protein 8;(source:Araport11) |
| AT4G29840 | threonine synthase |
| AT4G29860 | Encodes a WD repeat protein with seven WD repeat motifs, predicted to function in protein-protein interaction. Mutations caused defects in both embryo and seedling development. |
| AT4G30010 | ATP-dependent RNA helicase;(source:Araport11) |
| AT4G30030 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G30097 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G30120 | encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc |
| AT4G30140 | Member of the GDSL lipase/esterase family of proteins that functions as cutinase. Expressed in pollen and at the zone of lateral root emergence. |
| AT4G30150 | Urb2/Npa2 family protein;(source:Araport11) |
| AT4G30190 | Belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal domain. Its plasma membrane localization is light-dependent. |
| AT4G30230 | hypothetical protein;(source:Araport11) |
| AT4G30260 | Encodes one of the two YPT/RAB GTPase Interacting Protein 4a (YIP4a) and YIP4b (formerly YIP2), which form a TGN-localized complex with ECHIDNA (ECH). This complex is required for the secretion of cell wall polysaccharides. |
| AT4G30300 | member of NAP subfamily |
| AT4G30350 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. Regulates root and root hair development downstream of KAI2-mediated signaling. |
| AT4G30420 | nodulin MtN21-like transporter family protein |
| AT4G30430 | Member of TETRASPANIN family |
| AT4G30440 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. |
| AT4G30450 | glycine-rich protein;(source:Araport11) |
| AT4G30530 | Encodes a gamma-glutamyl peptidase, outside the GGT family, that can hydrolyze gamma-glutamyl peptide bonds. The mRNA is cell-to-cell mobile. |
| AT4G30540 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
| AT4G30620 | Homolog of STIC2, recent duplication. |
| AT4G30690 | SVR9-LIKE1 (SVR9L1) |
| AT4G30840 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT4G30900 | DNAse I-like superfamily protein;(source:Araport11) |
| AT4G30960 | Encodes CBL-interacting protein kinase 6 (CIPK6). Required for development and salt tolerance. The mRNA is cell-to-cell mobile. |
| AT4G30980 | Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair and sperm cell development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3). |
| AT4G31010 | Encodes a nuclear CRM protein required for the processing of many mitochondrial introns. It is involved in the biogenesis of respiratory complexes I and IV in Arabidopsis. |
| AT4G31030 | Putative membrane lipoprotein;(source:Araport11) |
| AT4G31080 | Encodes one of two LUNAPARK proteins in Arabidopsis. Both LNPA and LNPB are predominantly distributed throughout the ER, but not preferentially localized at the three-way junctions. Mutation of both LNPA and LNPB together caused the cortical ER to develop poor ER cisternae and a less dense tubular network. E3 ligase involved in degradation of RHD3 to maintain a tubular ER network. |
| AT4G31250 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G31340 | myosin heavy chain-like protein;(source:Araport11) |
| AT4G31350 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT4G31390 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G31500 | Encodes an oxime-metabolizing enzyme in the biosynthetic pathway of glucosinolates. Is required for phytochrome signal transduction in red light. Mutation confers auxin overproduction. |
| AT4G31520 | SDA1 family protein;(source:Araport11) |
| AT4G31540 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT4G31550 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
| AT4G31680 | Transcriptional factor B3 family protein;(source:Araport11) |
| AT4G31730 | Glutamine dumper1 is a putative transmembrane protein. It is involved in glutamine secretion The mRNA is cell-to-cell mobile. |
| AT4G31890 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G32060 | Encodes an EF-hand protein with homology to constituents of the mitochondrial Ca2+ uniporter machinery in mammals. MICU binds Ca2+ and localizes to the mitochondria in Arabidopsis. It is a negative regulator of mitochondrial calcium uptake. Mutants display elevated matrix calcium at steady state and modified calcium transient kinetics in vivo. |
| AT4G32140 | EamA-like transporter family;(source:Araport11) |
| AT4G32160 | Phox (PX) domain-containing protein;(source:Araport11) |
| AT4G32250 | Encodes a component of the TOC machinery that phosphorylates import receptors, supports pre-protein import, and contributes to efficient chloroplast biogenesis. |
| AT4G32280 | indole-3-acetic acid inducible 29;(source:Araport11) |
| AT4G32285 | Putative clathrin assembly protein, component of TPLATE complex that functions in clathrin-mediated endocytosis. |
| AT4G32290 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT4G32320 | Encodes a cytosolic ascorbate peroxidase APX6. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
| AT4G32350 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT4G32410 | Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. |
| AT4G32470 | Cytochrome bd ubiquinol oxidase, 14kDa subunit;(source:Araport11) |
| AT4G32500 | Encodes AKT5, a member of the Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT4G32540 | Mutant has elevated levels of free IAA in dominant mutant allele; Flavin Monooxygenase-Like Enzyme; Auxin Biosynthesis |
| AT4G32640 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
| AT4G32650 | Encodes KAT3, a member of the Shaker family of voltage-gated potassium channel subunits. Does not form functional potassium channel on its own. Involved in down-regulating AKT1 and KAT1 channel activity by forming heteromers with AKT1 or KAT1. The Shaker family K+ ion channels include five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inwardly rectifying conductance): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT4G32660 | Encodes protein kinase AME3. |
| AT4G32680 | Similar to yeast GET2 encodes an ER localized transmembrane protein that interacts with GET1 receptor via its transmembrane domain. |
| AT4G32710 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT4G32714 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT4G32765 | pre-tRNA tRNA-Ser (anticodon: CGA);(source:Araport11, TAIR10) |
| AT4G32890 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT4G32920 | glycine-rich protein;(source:Araport11) |
| AT4G32990 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT4G33040 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
| AT4G33060 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT4G33150 | This is a splice variant of the LKR/SDH locus. It encodes a bifunctional polypeptide lysine-ketoglutarate reductase and saccharopine dehydrogenase involved in lysine degradation. There is another splice variant that encodes a mono saccharopine dehydrogenase protein. Gene expression is induced by abscisic acid, jasmonate, and under sucrose starvation. |
| AT4G33330 | Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. |
| AT4G33400 | Together with DEM2 plays an essential role in cell division in plants, most likely through an interaction with RAN1. |
| AT4G33465 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT4G33467 | hypothetical protein;(source:Araport11) |
| AT4G33480 | BTB/POZ domain protein TNFAIP protein;(source:Araport11) |
| AT4G33520 | Encodes a putative metal-transporting P-type ATPase PAA1. An alternative-splicing event of the PAA1 pre-mRNA produces a copper chaperon named PCH1. The mRNA is cell-to-cell mobile. |
| AT4G33550 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G33590 | transmembrane protein;(source:Araport11) |
| AT4G33630 | Encodes one of the two plastid proteins EXECUTER (EX1, AT4G33630) and EX2 (AT1G27510). Mediates singlet oxygen induced programmed cell death. |
| AT4G33650 | Encodes a protein with high sequence similarity to the dynamin superfamily. Among those members ADL2 was most closely related to Dnm1p of yeast and likely a member of the Vps1p subfamily. Widely expressed in various tissues with highest expression in flower tissues. Localizes to the chloroplast, mitochondrion and peroxisome. Involved in peroxisome and mitochondria fission in combination with DRP3B. |
| AT4G33660 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
| AT4G33690 | G patch domain protein;(source:Araport11) |
| AT4G33720 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT4G33770 | Inositol pyrophosphate kinase. Catalyzes the phosphorylation of phytic acid (InsP6) to the symmetric InsP7 isomer 5-InsP7. |
| AT4G33790 | Encodes an alcohol-forming fatty acyl-CoA reductase, involved in cuticular wax biosynthesis. Lines carrying recessive mutations are deficient in primary alcohol and have glossy stem surfaces. |
| AT4G33810 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G33890 | Component of SAGA complex, SPT module subunit, interacts with HAG1. |
| AT4G33920 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT4G34090 | cyclin delta-3;(source:Araport11) |
| AT4G34100 | Encodes a putative E3 ubiquitin ligase that is involved in cuticular wax biosynthesis and regulates 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) activity. HMGR catalyzes the major rate-limiting step of the mevalonic acid (MVA) pathway from which sterols and other isoprenoids are synthesized. Lines carrying a recessive mutation in this locus have reduced chain-length distribution, weakly glaucous stem surface, and has reduced fertility in early flowers, non-spreading floret, downward cupped leaves, leaf waxes nearly pure C24 and C26 acid. |
| AT4G34120 | Encodes a single cystathionine beta-Synthase domain-containing protein. Modulates development by regulating the thioredoxin system. The mRNA is cell-to-cell mobile. |
| AT4G34215 | Encodes a member of the SGNH-hydrolase superfamily of enzymes. The enzymes of the SGNH-hydrolase superfamily facilitate the hydrolysis of ester, thioester and amide bonds in a range of substrates including complex polysaccharides, lysophospholipids, acyl-CoA esters and other compounds. |
| AT4G34230 | Encodes a catalytically active cinnamyl alcohol dehydrogenase which uses p-coumaryl aldehyde as a preferred substrate. It can also use sinapyl, caffeyl, coniferyl and d-hydroxyconiferyl aldehydes as substrates. |
| AT4G34320 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT4G34330 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT4G34430 | Member of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). |
| AT4G34440 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT4G34450 | Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation. |
| AT4G34490 | CYCLASE ASSOCIATED PROTEIN |
| AT4G34500 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G34530 | Encodes a transcription factor CIB1 (cryptochrome-interacting basic-helix-loop-helix). CIB1 interacts with CRY2 (cryptochrome 2) in a blue light-specific manner in yeast and Arabidopsis cells, and it acts together with additional CIB1-related proteins to promote CRY2-dependent floral initiation. CIB1 positively regulates FT expression. |
| AT4G34540 | Encodes a protein whose sequence is similar to pinoresinol-lariciresinol reductase from pine. Plays a positive role in developmental and dark -induced leaf senescence. |
| AT4G34610 | BEL1-like homeodomain 6;(source:Araport11) |
| AT4G34650 | Encodes a protein with similarity to squalene synthase which catalyzes the first committed step in sterol biosynthesis. To date no experimental evidence exists that SQS2 functions as a squalene synthase and some experiments indicate it does not have this function. |
| AT4G34700 | Encodes the B22 subunit of eukaryotic mitochondrial Complex I. Mutation in the gene display pleiotropic phenotypes including shorter roots, smaller plants and delayed flowering. The mRNA is cell-to-cell mobile. |
| AT4G34710 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1. |
| AT4G34750 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G34760 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G34770 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G34850 | Chalcone and stilbene synthase family protein;(source:Araport11) |
| AT4G34880 | Amidase family protein;(source:Araport11) |
| AT4G34940 | Armadillo repeat protein. One of a family of four in Arabidopsis. Located in the nucleus and cytoplasm of pollen vegetative cells, and in the cytoplasm of egg cells. Involved in the signaling network controlling tip growth and actin organization in the pollen tube. |
| AT4G34950 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G34975 | pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10) |
| AT4G35000 | Encodes a microsomal ascorbate peroxidase APX3. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. The APX3 protein interacts with AKR2 (ankyrin-containing protein that interacts with AFT1) and AFT1, a 14-3-3 protein. |
| AT4G35030 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G35080 | Encodes a nuclear-encoded chloroplast protein that plays an important role in vegetative growth, female gametogenesis, and embryogenesis likely by mediating chloroplast integrity and development. |
| AT4G35090 | Encodes a peroxisomal catalase, highly expressed in bolts and leaves. mRNA expression patterns show circadian regulation with mRNA levels being high in the subjective early morning. Loss of function mutations have increased H2O2 levels and increased H2O2 sensitivity. Mutants accumulate more toxic ions yet show decreased sensitivity to Li+. This decreased sensitivity is most likely due to an insensitivity to ethylene. Note that in Queval et al. (2007) Plant Journal, 52(4):640, SALK_057998 is named as cat2-1, SALK_076998 is named as cat2-2; in Bueso et al. (2007) Plant Journal, 52(6):1052, SALK_076998 is named as cat2-1. TAIR has adopted the nomenclature consistent with that in Bueso et al. (2007) after consultation with the authors: SALK_076998 (cat2-1), SALK_057998 (cat2-2). |
| AT4G35100 | a member of the plasma membrane intrinsic protein PIP. functions as aquaporin. Salt-stress-inducible MIP |
| AT4G35110 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT4G35150 | O-methyltransferase family protein;(source:Araport11) |
| AT4G35160 | Encodes a cytosolic N-acetylserotonin O-methyltransferase that can convert N-acetylserotonin to melatonin and serotonin to 5-methoxytryptamine in the process of melatonin synthesis. It does not have caffeic acid O- methyltransferase activity. |
| AT4G35220 | Cyclase family protein;(source:Araport11) |
| AT4G35230 | Encodes BR-signaling kinase 1 (BSK1), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
| AT4G35240 | DNA-directed RNA polymerase subunit beta, putative (DUF630 and DUF632);(source:Araport11) |
| AT4G35320 | hypothetical protein;(source:Araport11) |
| AT4G35390 | AT-hook protein of GA feedback 1;(source:Araport11) |
| AT4G35440 | Enclodes a choride channel protein that is localized to the thlakoid membrane. |
| AT4G35480 | Encodes a putative RING-H2 finger protein RHA3b. |
| AT4G35490 | mitochondrial ribosomal protein L11;(source:Araport11) |
| AT4G35530 | phosphatidylinositolglycan-like protein;(source:Araport11) |
| AT4G35550 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. WOX13 is the only family member that does not contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
| AT4G35600 | Encodes a receptor-like cytoplasmic kinase that acts as a spatial inhibitor of cell separation. Analysis of the cDNA previously described in Meiners et al., 1991 revealed mistakes in the predicted open reading frame. The mRNA is cell-to-cell mobile. |
| AT4G35670 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G35700 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT4G35760 | Encodes a bimodular enzyme comprising an integral domain homologous to the catalytic subunit of mammalian vitamin K epoxide reductase (VKORC1, EC 1.1.4.1) that is fused to a soluble thioredoxin-like moiety. Using yeast microsomes as a recombinant system, it was shown that the VKORC1 domain of At4g35760 functions as a stringent naphthoquinone reductase, and that its reduced Trx-like partner can serve as its electron donor. Located in plastid. Required for the assembly of photosystem II. Can catalyze disulfide bond formation in vitro. |
| AT4G35940 | hypothetical protein;(source:Araport11) |
| AT4G35950 | A member of ROP GTPases gene family-like. GTP binding protein Arac6. |
| AT4G35980 | hypothetical protein;(source:Araport11) |
| AT4G36010 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT4G36030 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT4G36032 | Natural antisense transcript overlaps with AT4G36030;(source:Araport11) |
| AT4G36040 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT4G36060 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G36130 | Ribosomal protein L2 family;(source:Araport11) |
| AT4G36140 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT4G36150 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G36180 | LRR-RLK which regulates lateral root development. |
| AT4G36210 | transmembrane/coiled-coil protein (DUF726);(source:Araport11) |
| AT4G36220 | encodes ferulate 5-hydroxylase (F5H). Involved in lignin biosynthesis. |
| AT4G36230 | transmembrane protein;(source:Araport11) |
| AT4G36250 | Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures. |
| AT4G36260 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Encodes protein with a single zinc finger motif and a members of a small gene family of putative transcription factors in which the SHORT INTERNODES (SHI) gene is found. STY2/STY1 double mutants showed defective style, stigma as well as serrated leaves. |
| AT4G36270 | Member of the microrchidia protein family which have been described as epigenetic regulators and plant immune mediators, contains a hallmark GHKL-type ATPase domain in N-terminus. |
| AT4G36410 | ubiquitin-conjugating enzyme |
| AT4G36490 | SEC14-like 12;(source:Araport11) |
| AT4G36610 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G36640 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT4G36660 | polyol transporter, putative (DUF1195);(source:Araport11) |
| AT4G36670 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G36680 | Ribosomal pentatricopeptide repeat protein |
| AT4G36720 | HVA22-like protein K;(source:Araport11) |
| AT4G36750 | Quinone reductase family protein;(source:Araport11) |
| AT4G36770 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G36790 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G36830 | ELO family protein. |
| AT4G36880 | cysteine proteinase1;(source:Araport11) |
| AT4G36900 | Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.10). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.9 and RAP2.1. |
| AT4G36910 | Encodes a single cystathionine beta-synthase domain-containing protein. Modulates development by regulating the thioredoxin system. |
| AT4G36920 | Encodes a floral homeotic gene, a member of the AP2/EREBP (ethylene responsive element binding protein) class of transcription factors and is involved in the specification of floral organ identity, establishment of floral meristem identity, suppression of floral meristem indeterminancy, and development of the ovule and seed coat. AP2 also has a role in controlling seed mass. Dominant negative allele I28, revealed a function in meristem maintenance-mutant meristems are smaller than normal siblings. AP2 appears to act on the WUS-CLV pathway in an AG independent manner. |
| AT4G36970 | Remorin family protein;(source:Araport11) |
| AT4G36990 | Encodes a protein whose sequence is similar to heat shock factors that regulate the expression of heat shock proteins. Transcript level is increased in response to heat shock. However, overexpression of this gene did not result in the increase of decrease of heat shock proteins. |
| AT4G37000 | Mutants have spontaneous spreading cell death lesions and constitutive activation of defenses in the absence of pathogen infection. Its product was shown to display red chlorophyll catabolite reductase (RCCR), which catalyzes one step in the breakdown of the porphyrin component of chlorophyll. The enzyme was further assessed to be a Type-1 (pFCC-1-producing) RCCR.Upon P. syringae infection, ACD2 localization shifts from being largely in chloroplasts to partitioning to chloroplasts, mitochondria, and to a small extent, cytosol. Overexpression of ACD2 delayed cell death and the replication of P. syringae. |
| AT4G37010 | Encodes a member of the Centrin family. Mutants are hypersensitive to UV and prone to UV induced DNA damage. Based on sequence similarity and mutant phenotype CEN2 is thought to be involved in nucelotide excision repair/DNA repair. |
| AT4G37020 | initiation factor 4A-like protein;(source:Araport11) |
| AT4G37140 | Encodes a protein with similarity to SABP2, a methyl salicylate esterase from tobacco. However, this protein is truncated and lacks two of the residues of the predicted catalytic triad, suggesting that it does not have this enzymatic activity. |
| AT4G37260 | Member of the R2R3 factor gene family. The mRNA is cell-to-cell mobile. |
| AT4G37330 | member of CYP81D |
| AT4G37370 | member of CYP81D |
| AT4G37390 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. May function as a negative component in auxin signaling by regulating auxin activity. |
| AT4G37520 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G37640 | Encodes a calmodulin-regulated Ca(2+)-pump located in the endoplasmic reticulum. Belongs to plant 2B ATPase's with an N-terminal autoinhibitor. |
| AT4G37670 | N-acetyl-l-glutamate synthase 2;(source:Araport11) |
| AT4G37690 | Unlike its close paralog MUCI10 (At2g22900), GT6 is not required for the biosynthesis of seed coat mucilage. GT6 is preferentially expressed in sub-epidermal cell layers of the seed coat. |
| AT4G37770 | Encodes an auxin inducible ACC synthase. |
| AT4G37780 | encoded by the Myb-like transcription factor MYB87, regulates axillary meristem formation, expressed throughout the plant. Member of the R2R3 factor gene family. |
| AT4G37820 | transmembrane protein;(source:Araport11) |
| AT4G37870 | Encodes a phosphoenolpyruvate carboxykinase that localizes to the cytosol. |
| AT4G37895 | Natural antisense transcript overlaps with AT4G37890;(source:Araport11) |
| AT4G38040 | Exostosin family protein;(source:Araport11) |
| AT4G38070 | transcription factor bHLH131-like protein;(source:Araport11) |
| AT4G38180 | FAR1-related sequence 5;(source:Araport11) |
| AT4G38200 | Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking. |
| AT4G38430 | Member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily, also known as DUF315). Interacts with ROP1 but the whole protein lacks Rho guanyl-nucleotide exchange factor activity in vitro. The DUF315/PRONE domain is sufficient to confer RopGEF catalytic activity. ropgef1 mutants have defects in auxin transport that result in abnormal development of embryos and growth defects. |
| AT4G38540 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT4G38552 | Natural antisense transcript overlaps with AT4G38550;(source:Araport11) |
| AT4G38590 | putative beta-galactosidase (BGAL14 gene) |
| AT4G38660 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT4G38690 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT4G38870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G38880 | GLN PHOSPHORIBOSYL PYROPHOSPHATE AMIDOTRANSFERASE 2 |
| AT4G38890 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
| AT4G38910 | Encodes a basic pentacysteine protein that is localized to the nucleus and specifically binds in vitro to GA dinucleotide repeats. |
| AT4G38990 | glycosyl hydrolase 9B16;(source:Araport11) |
| AT4G39010 | Cellulase involved in cell wall modification during valve dehiscence. |
| AT4G39050 | Kinesin motor family protein;(source:Araport11) |
| AT4G39090 | Similar to cysteine proteinases, induced by desiccation but not abscisic acid. Required for RRS1-R mediated resistance against Ralstonia solanacearum. Interacts with the R. solanacearum type III effector PopP2. RD19 associates with PopP2 to form a nuclear complex that is required for activation of the RRS1-R?mediated resistance response. |
| AT4G39120 | Encodes a chloroplast-localized member of the myo-inositol monophosphatase family, IMPL2 (myo-Inositol monophosphatase like 2) that seems to have multiple enzymatic activities. It contributes to histidine biosynthesis based on it histidinol-phosphate phosphatase activity. In addition, the protein can act as an inositol monophosphatase and an L-galactose-1-phosphate phosphatase in vitro. |
| AT4G39270 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G39400 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction. BRI1 ligand is brassinolide which binds at the extracellular domain. Binding results in phosphorylation of the kinase domain which activates the BRI1 protein leading to BR responses. Residue T-1049 and either S-1044 or T-1045 were essential for kinase function in vitro and normal BRI1 signaling in planta. The structure of BRI1 ligand-binding domain has been determined at 2.5A resolution. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. BRI1 appears to be involved in the autonomous pathway that regulates the transition to flowering, primarily through its effects on FLC expression levels, as uncovered by double mutant analyses. This most likely occurs as a result of BRI1-dependent effects on histone acetylation, but not histone triMeH3K4 methylation, at the FLC locus. The mRNA is cell-to-cell mobile. |
| AT4G39410 | Encodes a member of the Group II-c WRKY Transcription Factor family that is involved in stem development and has been shown to directly bind to the promoter of NST2. WRKY13 binds to the promoter of DCD to upregulate its expression and hydrogen sulfide production to enhance plant cadmium tolerance. Mutants show a weak stem phenotype and show decreased expression of lignin-synthesis-related genes. |
| AT4G39570 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G39610 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT4G39660 | alanine:glyoxylate aminotransferase 2 homolog (AGT2). The mRNA is cell-to-cell mobile. |
| AT4G39670 | Member of the glycolipid transfer protein (GLTP) superfamily, shuttles ceramide-1-phosphate (C1P) between membranes. |
| AT4G39690 | Encodes a homolog of the yeast mic60 protein that is localized in the inner membrane of the mitochondrion, interacts with Tom40 as part of a large lipid-enriched complex called the mitochondrial transmembrane lipoprotein complex (MTL) and is involved in mitochondrial lipid trafficking. |
| AT4G39720 | VQ motif-containing protein;(source:Araport11) |
| AT4G39730 | PLAT1 domain stress protein family member. Involved in mediating response to stresses such as pathogen infection. It is found in endoplasmic reticulum bodies. PLAT1 is induced by pathogenic fungi and induces the production of scopolin. |
| AT4G39753 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G39756 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G39795 | hypothetical protein (DUF581);(source:Araport11) |
| AT4G39820 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
| AT4G39830 | role in the degradation of ascorbate to (mono)dehydroascorbate |
| AT4G39940 | adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete The mRNA is cell-to-cell mobile. |
| AT4G39950 | Belongs to cytochrome P450 and is involved in tryptophan metabolism. Converts Trp to indo-3-acetaldoxime (IAOx), a precursor to IAA and indole glucosinolates. The mRNA is cell-to-cell mobile. |
| AT4G40042 | Microsomal signal peptidase 12 kDa subunit (SPC12);(source:Araport11) |
| AT4G40060 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT4G40070 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G40080 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT5G01030 | enolase, putative (DUF3527);(source:Araport11) |
| AT5G01040 | putative laccase, knockout mutant showed early flowering |
| AT5G01050 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G01070 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT5G01090 | Concanavalin A-like lectin family protein;(source:Araport11) |
| AT5G01100 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G01160 | Encodes a member of a core set of mRNA m6A writer proteins and is required for N6-adenosine methylation of mRNA. |
| AT5G01170 | hypothetical protein (DUF740);(source:Araport11) |
| AT5G01175 | Natural antisense transcript overlaps with AT5G01180;(source:Araport11) |
| AT5G01210 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G01215 | Natural antisense transcript overlaps with AT5G01210;(source:Araport11) |
| AT5G01225 | josephin-like protein;(source:Araport11) |
| AT5G01240 | Encodes LAX1 (LIKE AUXIN RESISTANT), a member of the AUX1 LAX family of auxin influx carriers. Required for the establishment of embryonic root cell organization. |
| AT5G01260 | Carbohydrate-binding-like fold;(source:Araport11) |
| AT5G01280 | Encodes a microtubule-associated protein. |
| AT5G01310 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
| AT5G01370 | Nuclear protein with a lysine-rich domain and a C-terminal serine-rich domain. Interacts with Alcatraz (ALC). ACI1 is mainly expressed in the vascular system. Involved in cell separation during fruit dehiscence. |
| AT5G01400 | Encodes a Symplekin/Pta1 homologue which would have the potential to interact with either ESP1 or AtCstF64. |
| AT5G01410 | Encodes a protein predicted to function in tandem with PDX2 to form glutamine amidotransferase complex with involved in vitamin B6 biosynthesis. |
| AT5G01420 | Glutaredoxin family protein;(source:Araport11) |
| AT5G01460 | LMBR1-like membrane protein;(source:Araport11) |
| AT5G01470 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G01520 | Encodes a cytosolic RING-type E3 ubiquitin (Ub) ligase that is critical for ABA and high salinity responses during germination. AtAIRP2 and SDIR1 likely play a combinatory role in ABA signaling and the response to high salt in Arabidopsis. |
| AT5G01540 | Encodes LecRKA4.1, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. Positively regulates pattern-triggered immunity. |
| AT5G01542 | Natural antisense transcript overlaps with AT5G01540;(source:Araport11) |
| AT5G01560 | Encodes LecRKA4.3, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. |
| AT5G01600 | Encodes a ferretin protein that is targeted to the chloroplast. Member of a Ferritin gene family. Gene expression is induced in response to iron overload and by nitric oxide. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT5G01690 | member of Putative Na+/H+ antiporter family |
| AT5G01715 | pseudogene of RNI-like superfamily protein;(source:Araport11) |
| AT5G01730 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
| AT5G01732 | Natural antisense transcript overlaps with AT5G01730;(source:Araport11) |
| AT5G01750 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT5G01780 | 2-oxoglutarate-dependent dioxygenase family protein;(source:Araport11) |
| AT5G01790 | hypothetical protein;(source:Araport11) |
| AT5G01830 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G01840 | Encodes a member of the plant specific ovate protein family. Members of this family have been shown to bind to KNOX and BELL- like TALE class homeodomain proteins. This interaction may mediate relocalization of the TALE homeodomain from the nucleus to the cytoplasm. Functions as a transcriptional repressor that suppresses cell elongation. May also directly affect microtubule organization via interactions with TON2. |
| AT5G01890 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT5G01900 | member of WRKY Transcription Factor; Group III |
| AT5G01950 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G02025 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT5G02030 | Mutant has additional lateral organs and phyllotaxy defect. Encodes a homeodomain transcription factor. Has sequence similarity to the Arabidopsis ovule development regulator Bell1. Binds directly to the AGAMOUS cis-regulatory element. Its localization to the nucleus is dependent on the coexpression of either STM or BP. |
| AT5G02060 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT5G02080 | phosphopantothenate-cysteine ligase-like protein;(source:Araport11) |
| AT5G02170 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G02190 | encodes an aspartic protease, has an important role in determining cell fate during embryonic development and in reproduction processes. The loss-of-function mutation of PCS1 causes degeneration of both male and female gametophytes and excessive cell death of developing embryos during torpedo stage. |
| AT5G02230 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G02260 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT5G02400 | Encodes a protein with similarity to the POL locus which is a novel protein phosphatase 2C. Ubiquitously expressed. No phenotype observed in homozygous null mutant background. |
| AT5G02420 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
| AT5G02500 | Encodes a member of heat shock protein 70 family. Hsc70-1 negatively regulates the expression of Hsp101 through HsfA1d, HsfA1e and HsfA2. During non-HS condition, Hsc70-1 attenuates the activity of HsfAs and finally affects the expression of HsfA2 and Hsp101 genes. hsc70-1 mutant showed thermotolerance phenotype due to higher expression of Hsp101 and other HS inducible genes. |
| AT5G02530 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G02560 | Encodes HTA12, a histone H2A protein. |
| AT5G02590 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G02620 | Encodes a member of the ankyrin repeat protein. Localized in the endoplasmic reticulum. |
| AT5G02640 | hypothetical protein;(source:Araport11) |
| AT5G02740 | Ribosomal protein S24e family protein;(source:Araport11) |
| AT5G02750 | Encodes an E3 ligase, SHOOT GRAVITROPISM9. Modulates the interaction between statoliths and F-Actin in gravity sensing. |
| AT5G02800 | Encodes CDL1, a homolog of CDG1. CDL1 positively regulates brassinosteroid signaling and plant growth. |
| AT5G02830 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G02850 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G02870 | Ribosomal protein L4/L1 family;(source:Araport11) |
| AT5G02890 | Encodes a protein with similarity to transferases in plants and fungi. |
| AT5G02970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G02980 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G03000 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G03020 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G03080 | Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene, LPPgamma appears to be more important for diacylglycerol formation than LPPepsilon1 and LPPepsilon2 in the plastids. Heterozygous lppgamma mutants produce pollen that have defects in pollen tube germination and no homozygous mutants have been recovered. The mRNA is cell-to-cell mobile. |
| AT5G03140 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G03160 | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast. |
| AT5G03170 | Encodes FLA11, a member of fasciclin-like arabinogalactan proteins (FLAs) containing a cell adhesion fasciclin (FAS) domain. Mutations result in altered stem biomechanics with reduced tensile strength and reduced tensile modulus of elasticity, as well as altered cell wall architecture and composition, with increased cellulose microfibril angle, reduced arabinose, galactose and cellulose content. |
| AT5G03200 | Paralog of LOG2 (At3g09770), a ubiquitin ligase that regulates amino acid export. |
| AT5G03260 | LAC11 is a putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G03280 | Involved in ethylene signal transduction. Acts downstream of CTR1. Positively regulates ORE1 and negatively regulates mir164A,B,C to regulate leaf senescence. A maternally expressed imprinted gene. Mutations in ein2 block ethylene stimulation of flavonol synthesis. The mRNA is cell-to-cell mobile. |
| AT5G03290 | Encodes a catalytic subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase. The mRNA is cell-to-cell mobile. |
| AT5G03310 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G03330 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT5G03370 | acylphosphatase family;(source:Araport11) |
| AT5G03377 | pseudogene of acylphosphatase family protein |
| AT5G03435 | Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT5G03555 | Encodes PLUTO (plastidic nucleobase transporter), a member of the Nucleobase:Cation-Symporter1 protein family, capable of transporting purine and pyrimidine nucleobases. |
| AT5G03610 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G03650 | Encodes starch branching enzyme (E.C.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout the plant and highest in seedlings and cauline leaves. |
| AT5G03660 | transcriptional activator (DUF662);(source:Araport11) |
| AT5G03668 | Natural antisense transcript overlaps with AT5G03670;(source:Araport11) |
| AT5G03700 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11) |
| AT5G03770 | Encodes a putative KDO (3-deoxy-D-manno-octulosonate) transferase |
| AT5G03795 | Exostosin family protein;(source:Araport11) |
| AT5G03860 | Encodes a protein with malate synthase activity. |
| AT5G03900 | Iron-sulfur cluster biosynthesis family protein;(source:Araport11) |
| AT5G03905 | Iron-sulfur cluster biosynthesis family protein;(source:Araport11) |
| AT5G03930 | F-box protein;(source:Araport11) |
| AT5G03980 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT5G04160 | UUAT1 is a UDP-Uronic acid transporter that is localized to the Golgi. It is expressed in the seed coat epidermis and is involved in the development of seed coat mucilage. |
| AT5G04170 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT5G04190 | Encodes phytochrome kinase substrate 4, a phytochrome signaling component involved in phototropism. It is phosphorylated in a phot1-dependent manner in vitro. Phosphorylation is transient and regulated by a type 2- protein phosphatase. |
| AT5G04200 | Encodes a putative metacaspase. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
| AT5G04238 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G04250 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT5G04310 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G04320 | Encodes a protein that protects meiotic centromere cohesion. |
| AT5G04370 | A member of the Arabidopsis SABATH methyltransferase gene family. Encodes NAMT1, a methyltransferase that methylates nicotinic acid to yield methyl nicotinate. |
| AT5G04400 | NAC domain protein;(source:Araport11) |
| AT5G04540 | Myotubularin-like phosphatases II superfamily;(source:Araport11) |
| AT5G04630 | member of CYP77A |
| AT5G04640 | AGAMOUS-like 99;(source:Araport11) |
| AT5G04660 | encodes a protein with cytochrome P450 domain |
| AT5G04720 | Encodes a member of the ADR1 family nucleotide-binding leucine-rich repeat (NB-LRR) immune receptors. The mRNA is cell-to-cell mobile. |
| AT5G04780 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G04820 | ovate family protein 13;(source:Araport11) |
| AT5G04970 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G05020 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT5G05090 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G05140 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT5G05210 | Surfeit locus protein 6;(source:Araport11) |
| AT5G05300 | IDL6 peptide is induced in response to Pathogen-Associated Molecular Patterns (PAMPs). Overexpression of IDL6 results in increased susceptibility to pathogens. |
| AT5G05330 | Encodes a protein with a putative HMG-box domain. The high-mobility group (HMG) proteins are chromatin-associated proteins that act as architectural factors in various nucleoprotein structures, which regulate DNA-dependent processes such as transcription and recombination. Expression of this gene was not detected according to Grasser et al. (J. Mol. Biol. 2006:358, 654-664). |
| AT5G05380 | prenylated RAB acceptor 1.B3;(source:Araport11) |
| AT5G05390 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G05410 | Encodes a transcription factor that specifically binds to DRE/CRT cis elements (responsive to drought and low-temperature stress). Belongs to the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2A). There are eight members in this subfamily including DREB2B. The protein contains one AP2 domain. Overexpression of transcriptional activation domain of DREB2A resulted in significant drought stress tolerance but only slight freezing tolerance in transgenic Arabidopsis plants. Microarray and RNA gel blot analyses revealed that DREB2A regulates expression of many water stress?inducible genes. The mRNA is cell-to-cell mobile. |
| AT5G05435 | Natural antisense transcript overlaps with AT5G05430;(source:Araport11) |
| AT5G05440 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT5G05540 | small RNA degrading nuclease 2;(source:Araport11) |
| AT5G05657 | late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G05690 | Encodes a member of the CP90A family, a cytochrome P450 monooxygenase which converts 6-deoxocathasterone to 6-deoxoteasterone in the late C6 oxidation pathway and cathasterone to teasterone in the early C6 oxidation pathway of brassinolide biosynthesis. Expressed in cotyledons and leaves. Mutants display de-etiolation and derepression of light-induced genes in the dark, dwarfism, male sterility and activation of stress-regulated genes in the light. The expression of the gene using a CPD promoter:LUC fusion construct was shown to be under circadian and light control. Additionally, the circadian regulation was shown to be independent of BR levels as it remains unchanged in bri1 mutant lines. CPD appears to be involved in the autonomous pathway that regulates the transition to flowering, primarily through a BRI1-mediated signaling pathway that affects FLC expression levels, as uncovered by double mutant analyses. |
| AT5G05770 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
| AT5G05800 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
| AT5G05810 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G05840 | replication factor C subunit, putative (DUF620);(source:Araport11) |
| AT5G05870 | UDP-glucosyl transferase 76C1;(source:Araport11) |
| AT5G05990 | Mitochondrial glycoprotein family protein;(source:Araport11) |
| AT5G06210 | Encodes a chloroplast protein involved in the responses to salt and oxidative stresses. |
| AT5G06220 | LETM1-like protein;(source:Araport11) |
| AT5G06290 | Encodes a 2-Cys peroxiredoxin (2-Cys PrxB) that contains two catalytic Cys residues. The mRNA is cell-to-cell mobile. |
| AT5G06320 | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus, spermine and Pseudomonas syringae pv. tomato DC3000. The gene product is localized to the plasma membrane. |
| AT5G06340 | nudix hydrolase homolog 27;(source:Araport11) |
| AT5G06350 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G06380 | hypothetical protein;(source:Araport11) |
| AT5G06390 | FASCICLIN-like arabinogalactan protein 17 precursor;(source:Araport11) |
| AT5G06400 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G06490 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G06520 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT5G06530 | Encodes ABCG22, an ABC transporter gene. Mutation results in increased water transpiration and drought susceptibility. |
| AT5G06570 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G06700 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). A tbr mutant is impaired in its ability to deposit secondary wall cellulose in specific cell types, most notably in trichomes. |
| AT5G06750 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G06760 | Encodes LEA4-5, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. Most of the diverse set of LEA proteins can be grouped according to properties such as high hydrophilicity and high content of glycine or other small amino acids in what has been termed hydrophilins. LEA4-5 protects enzyme activities from the adverse effects induced by freeze-thaw cycles in vitro. |
| AT5G06839 | bZIP transcription factor family protein;(source:Araport11) |
| AT5G06850 | Encodes an endoplasmic reticulum protein that is involved in the transport of the florigen FT from companion cells to sieve elements, thus affecting FT transport through the phloem to the SAM. |
| AT5G07000 | Encodes a member of the sulfotransferase family of proteins. Although it has 85% amino acid identity with ST2A (At5g07010), this protein is not able to transfer a sulfate group to 11- or 12-hydroxyjasmonic acid in vitro. It may be able to act on structurally related jasmonates. |
| AT5G07010 | Encodes a sulfotransferase that acts specifically on 11- and 12-hydroxyjasmonic acid. Transcript levels for this enzyme are increased by treatments with jasmonic acid (JA), 12-hydroxyJA, JA-isoleucine, and 12-oxyphytodienoic acid (a JA precursor). |
| AT5G07090 | Ribosomal protein S4 (RPS4A) family protein;(source:Araport11) |
| AT5G07120 | Encodes sorting nexin SNX2b. SNX2b is peripherally associated with membranes. Involved in vesicular trafficking from endosomes to the vacuole. |
| AT5G07180 | Encodes a receptor-like kinase that, together with ER and ERL1 governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. It is also important for maintaining stomatal stem cell activity and preventing terminal differentiation of the meristemoid into the guard mother cell. When heterozygous in an er/erl1 null background, plants are female sterile due to cell division defect in the integuments. |
| AT5G07480 | KAR-UP oxidoreductase 1;(source:Araport11) |
| AT5G07500 | Encodes an embryo-specific zinc finger transcription factor required for heart-stage embryo formation. |
| AT5G07530 | encodes a glycine-rich protein that has oleosin domain and is expressed specifically during flower stages 10 to 12. Protein is found on mature pollen coat. |
| AT5G07540 | encodes a glycine-rich protein that is expressed only in flowers during a specific developmental stage (flower stages 11 and 12). |
| AT5G07550 | member of Oleosin-like protein family |
| AT5G07580 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT5G07600 | Oleosin family protein;(source:Araport11) |
| AT5G07640 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G07690 | Encodes a putative transcription factor (MYB29) that acts as a negative regulator of mitochondrial stress responses. |
| AT5G07700 | Encodes a putative transcription factor (MYB76). |
| AT5G07720 | Galactosyl transferase GMA12/MNN10 family protein;(source:Araport11) |
| AT5G07730 | transmembrane protein;(source:Araport11) |
| AT5G07770 | Actin-binding FH2 protein;(source:Araport11) |
| AT5G07780 | Encodes a class II formin that nucleates actin assembly, binds to the barbed-end of actin filaments and antagonizes the effect of FH1 on actin dynamics. The mRNA is cell-to-cell mobile. |
| AT5G07920 | Encodes a putative diacylglycerol kinase that is mainly expressed in roots, shoots and leaves, but its enzyme product was not active in vitro. |
| AT5G08139 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G08141 | Part of complex with ENO2 which mediates secondary metabolism, affecting seed size and weight. |
| AT5G08170 | porphyromonas-type peptidyl-arginine deiminase family protein;(source:Araport11) |
| AT5G08230 | HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. |
| AT5G08260 | serine carboxypeptidase-like 35;(source:Araport11) |
| AT5G08300 | Succinyl-CoA ligase, alpha subunit;(source:Araport11) |
| AT5G08320 | E2F-associated phosphoprotein;(source:Araport11) |
| AT5G08330 | Circadian oscillator protein which interacts with bZIP63 and regulates a response of the circadian oscillator to sugar. Is not required for the sugar-induced circadian phase advance in the morning; regulates a response of CCA1 to sugars. |
| AT5G08370 | Member of Glycoside Hydrolase Family 27 (GH27)that functions as an α-galactosidase. |
| AT5G08390 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
| AT5G08400 | structural maintenance of chromosomes-like protein, putative (DUF3531);(source:Araport11) |
| AT5G08410 | ferredoxin/thioredoxin reductase subunit A (variable subunit) 2;(source:Araport11) |
| AT5G08510 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G08640 | Encodes a flavonol synthase that catalyzes formation of flavonols from dihydroflavonols. Co-expressed with CHI and CHS (qRT-PCR). |
| AT5G09320 | vacuolar protein sorting-associated 9A-like protein;(source:Araport11) |
| AT5G09350 | Encodes a phosphatidylinositol 4-OH kinase, PI-4Kbeta2. Arabidopsis contains 12 PI-4Ks in three separate families: PI-4Kalphs, PI-4kbeta, and PI-4Kgamma. PI-4Kbeta2 is 83% identical to PI-4kbeta1 encoded by At5g64070. Important for polarized root hair growth as the loss of this gene and its close relative PI-4kbeta1, leads to the formation of abnormal root hairs. |
| AT5G09360 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G09380 | RNA polymerase III RPC4;(source:Araport11) |
| AT5G09410 | calmodulin-binding protein, similar to another ethylene-upregulated calmodulin-binding protein ER1 GI:11612392 from (Nicotiana tabacum) |
| AT5G09430 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G09440 | EXORDIUM like 4;(source:Araport11) |
| AT5G09450 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G09530 | The gene encodes a unique protein which contains 36 repeats of a unique pentapeptide (Pro-Glu-Leu|Ile|Val-Pro-Lys). It has been shown tobe involved in growth and development. |
| AT5G09560 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT5G09580 | heat shock protein;(source:Araport11) |
| AT5G09610 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G09620 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G09740 | Encodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2. |
| AT5G09750 | Encodes a bHLH transcription factor that is involved in transmitting tract and stigma development. |
| AT5G09760 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G09795 | pseudogene of F-box family protein |
| AT5G09850 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT5G09890 | Protein kinase family protein;(source:Araport11) |
| AT5G09920 | Non-catalytic subunit specific to DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB4) |
| AT5G10020 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT5G10170 | myo-inositol-1-phosphate synthase isoform 3.Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT5G10270 | Encodes CDKC;1, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. |
| AT5G10280 | Encodes a putative transcription factor (MYB92). |
| AT5G10380 | Encodes a RING finger domain protein with E3 ligase activity that is localized to the lipid rafts of the plasma membrane. Expression is increased in response to fungal pathogen. May be involved in regulation of programmed cell death by facilitating degredation of regulation of PDC activators. The mRNA is cell-to-cell mobile. |
| AT5G10410 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT5G10450 | Encodes a member of the 14-3-3 gene family that is a lambda isoform (14-3-3λ). Interacts with APX3 (ascorbate peroxidase) and AKR2 , suggesting a role in mediating oxidative metabolism in stress response. This protein was shown to colocalize and interact with SERK1 by which it is phosphorylated. This protein is also reported to interact with the phosphorylated form of the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1. Interacts with JAZ10.4 which lacks the Jas motif. It is also phosphorylated by CRPK1 as part of the response to cold and translocates to the nucleus after phosphorylation. |
| AT5G10530 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G10550 | This gene is predicted to encode a bromodomain-containing protein. A plant line expressing RNAi constructs targeted against GTE7 shows some resistance to agrobacterium-mediated root transformation. |
| AT5G10590 | hypothetical protein;(source:Araport11) |
| AT5G10710 | centromere protein O;(source:Araport11) |
| AT5G10750 | enhanced disease resistance-like protein (DUF1336);(source:Araport11) |
| AT5G10760 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G10820 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G10860 | Encodes a single cystathionine beta-Synthase domain-containing protein. Modulates development by regulating the thioredoxin system. |
| AT5G10900 | PP7-type family member. Mutants display defects in chloroplast biogenesis and mersitem maintenance. Interacts with MAIL1 and MAIN to regulate gene expression and TE gene silencing. |
| AT5G10930 | Encodes CBL-interacting protein kinase 5 (CIPK5). |
| AT5G10946 | hypothetical protein;(source:Araport11) |
| AT5G10980 | Histone superfamily protein;(source:Araport11) |
| AT5G10990 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G11070 | hypothetical protein;(source:Araport11) |
| AT5G11130 | Exostosin family protein;(source:Araport11) |
| AT5G11310 | The SOAR1 gene encodes a pentatricopeptide repeat (PPR) protein which localizes to both the cytosol and nucleus. Down-regulation of SOAR1 strongly enhances, but up-regulation of SOAR1 almost completely impairs, ABA responses, revealing that SOAR1 is a critical, negative, regulator of ABA signalling. Further genetic evidence supports that SOAR1 functions downstream of ABAR and probably upstream of an ABA-responsive transcription factor ABI5. Changes in the SOAR1 expression alter expression of a subset of ABA-responsive genes including ABI5. These findings provide important information to elucidate further the functional mechanism of PPR proteins and the complicated ABA signalling network. |
| AT5G11370 | FBD / Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT5G11410 | Similar to receptor like kinase but does not appear to have kinase activity (psuedokinase). It is involved in HopZ1a effector triggered immunity. Interacts with ZAR1 and ZED1.Localization to membrane is dependent on N-terminal myristoylation domain |
| AT5G11530 | Involved in regulating reproductive development |
| AT5G11540 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
| AT5G11550 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G11590 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT5G11610 | Exostosin family protein;(source:Araport11) |
| AT5G11620 | SWIM zinc finger family protein / mitogen-activated protein kinase kinase kinase (MAPKKK)-like protein;(source:Araport11) |
| AT5G11650 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G11720 | Glycosyl hydrolases family 31 protein;(source:Araport11) |
| AT5G11740 | Encodes arabinogalactan protein (AGP15). The mRNA is cell-to-cell mobile. |
| AT5G11830 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G11840 | YCF36, putative (DUF1230);(source:Araport11) |
| AT5G11850 | MAP3 kinase involved phosphorylation of a critical Ser171 for OST1/SnRK2.6 activation. |
| AT5G11890 | harpin-induced protein;(source:Araport11) |
| AT5G11940 | Subtilase family protein;(source:Araport11) |
| AT5G11970 | ABC family ABC transporter, putative (DUF3511);(source:Araport11) |
| AT5G12010 | nuclease;(source:Araport11) |
| AT5G12043 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G12070 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G12100 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT5G12120 | Ubiquitin-associated/translation elongation factor EF1B protein;(source:Araport11) |
| AT5G12280 | SWAP (Suppressor-of-White-APricot)/surp RNA-binding domain-containing protein;(source:Araport11) |
| AT5G12300 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT5G12330 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Expressed in lateral root primordia and induced by auxin. SWP1 is involved in the repression of LRP1 via histone deacetylation. |
| AT5G12390 | Encodes a protein with similarity to yeast FIS proteins. These membrane anchored proteins bind DRP proteins and function during organelle division. FIS1B is expressed ubiquitously and appears to be involved in peroxisome division. |
| AT5G12850 | CCCH-type zinc finger protein with ARM repeat domain-containing protein;(source:Araport11) |
| AT5G12890 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G12940 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G13080 | WRKY75 is one of several transcription factors induced during Pi deprivation. It is nuclear localized and regulated differentially during Pi starvation. RNAi mediated suppression of WRKY75 made the plants more susceptible to Pi stress as indicated by the higher accumulation of anthocyanin during Pi starvation. |
| AT5G13100 | Gap junction beta-4 protein;(source:Araport11) |
| AT5G13181 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G13250 | RING finger protein;(source:Araport11) |
| AT5G13280 | Asp kinase inhibited by Lys and S-adenosylmethionine. Contains regulatory domains that belong to the ACT domain family, which allow binding to a extreme variety of ligands. Can function as a monomer or as a dimer with acetohydroxyacid synthase (HSDH). |
| AT5G13340 | arginine/glutamate-rich 1 protein;(source:Araport11) |
| AT5G13380 | Auxin-responsive GH3 family protein;(source:Araport11) |
| AT5G13410 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT5G13548 | Pseudogene of AT3G12600; ATNUDT16 (Arabidopsis thaliana Nudix hydrolase homolog 16); hydrolase |
| AT5G13640 | arabidopsis phospholipid:diacylglycerol acyltransferase (PDAT) |
| AT5G13655 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
| AT5G13720 | Uncharacterized protein family (UPF0114);(source:Araport11) |
| AT5G13830 | FtsJ-like methyltransferase family protein;(source:Araport11) |
| AT5G13860 | ELCH-like protein;(source:Araport11) |
| AT5G13910 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (LEAFY PETIOLE). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and LEAFY PETIOLE. Acts as a positive regulator of gibberellic acid-induced germination. |
| AT5G13940 | aminopeptidase;(source:Araport11) |
| AT5G13970 | midasin-like protein;(source:Araport11) |
| AT5G14030 | translocon-associated protein beta (TRAPB) family protein;(source:Araport11) |
| AT5G14100 | Member of NAP subfamily. Putative component of chloroplast ECF/ABC-Transporter involved in metal homeostasis. |
| AT5G14160 | F-box family protein;(source:Araport11) |
| AT5G14230 | ankyrin;(source:Araport11) |
| AT5G14260 | Suppresses singlet oxygen-induced stress responses by protecting grana margins. |
| AT5G14370 | CCT motif family protein;(source:Araport11) |
| AT5G14480 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G14570 | Encodes ATNRT2.7, a nitrate transporter that controls nitrate content in seeds. Expression is detected in reproductive organs and peaks in seeds. Localized to the vacuolar membrane. |
| AT5G14640 | shaggy-like kinase 13;(source:Araport11) |
| AT5G14750 | Encodes a MyB-related protein containing R2 and R3 repeats, involved in root and hypocotyl epidermal cell fate determination. Loss of function mutations make extra root hairs. Nuclear localized protein is a positive regulator for expression of CAPRICE (CPC). |
| AT5G14840 | pseudogene of hypothetical protein;(source:Araport11) |
| AT5G14850 | Encodes a putative mannosyltransferase homolog to human PIG-B and yeast GPI10, both of which are involved in the biosynthesis of glycosylphosphatidylinositol (GPI) anchors. Disruption of the gene affects COBRA-LIKE10 localization, a GPI-anchored protein (GPI-AP) important for pollen tube growth and guidance. |
| AT5G14860 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G14870 | Encodes a member of the cyclic nucleotide gated channel family that is asymmetrically localized to the plasma membrane at the growing tip of the pollen tube and is involved in pollen tube growth and pollen tube guidance to ovules. It likely directly transduces a cNMP signal into an ion flux that can produce a localized signal capable of regulating the pollen tip-growth machinery. Also functions as a Ca2+ permeable channel. |
| AT5G14900 | helicase associated (HA2) domain-containing protein;(source:Araport11) |
| AT5G14940 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G14950 | Encodes a golgi alpha-mannosidase, an enzyme responsible for the formation of major complex-type N-glycans. |
| AT5G14980 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G15080 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G15130 | member of WRKY Transcription Factor; Group II-b; contribute to basal immunity. The mRNA is cell-to-cell mobile. |
| AT5G15170 | Tyrosyl-DNA phosphodiesterase 1 involved in DNA repair. TDP1 is involved the repair of Topoisomerase 1 cleavage complexes (tdp1 mutants are camptotecin hypersensitive). tdp1/wss1A double mutants show a synergistic sensitivity after camptothecin treatment. tdp1/mus81 double mutants show an elevated number of dead cells in root meristems after camptothecin treatment (compared to the single mutants). |
| AT5G15210 | Encodes ZFHD3, a member of the zinc finger homeodomain transcriptional factor family. |
| AT5G15400 | Single copy gene encoding a putative ubiquitin conjugating E4 factor. Contains Ub elongating factor core domain and C-terminal U-box. Involved in ubiquitination of NLRs. |
| AT5G15410 | 'defense, no death' gene (DND1) encodes a mutated cyclic nucleotide-gated cation channel; Same as CNGC2 (article ID 229): Cyclic nucleotide gated channel, activated by cAMP, conducts K+ and other monovalent cations but excludes Na+, does not contain the GYG amino acid sequence found in other channels with this conductivity profile. Conducts Ca2+ into cells which is linked to the generation of NO and the NO signaling pathway involved in the innate immune response to pathogens. CNGC2 could be the key step mediating bulk Ca2+ influx into leaf cells after unloading from the vascular and have no direct roles in the leaf development and HR. |
| AT5G15500 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G15510 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
| AT5G15570 | Bromodomain transcription factor;(source:Araport11) |
| AT5G15650 | RGP2 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1(at3g02230)/rgp2 double mutants have a male gametophyte lethal phenotype. RGP2 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. RGP2 was originally identified as Reversibly Glycosylated Polypeptide-2. Constitutive expression in tobacco impairs plant development and virus spread. |
| AT5G15840 | Encodes a protein showing similarities to zinc finger transcription factors, involved in regulation of flowering under long days. Acts upstream of FT and SOC1. |
| AT5G16000 | NSP-interacting kinase (NIK1), receptor-like kinase, involved in defense response against geminivirus It acts as a virulence target of the begomovirus nuclear shuttle protein (NSP). |
| AT5G16080 | carboxyesterase 17;(source:Araport11) |
| AT5G16090 | RAD23 UV excision repair family protein;(source:Araport11) |
| AT5G16120 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G16150 | Encodes a putative plastidic glucose transporter. |
| AT5G16235 | Natural antisense transcript overlaps with AT5G16230;(source:Araport11) |
| AT5G16300 | Vps51/Vps67 family (components of vesicular transport) protein;(source:Araport11) |
| AT5G16340 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT5G16360 | NC domain-containing protein-like protein;(source:Araport11) |
| AT5G16370 | acyl activating enzyme 5;(source:Araport11) |
| AT5G16420 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT5G16500 | Encodes a receptor-like cytoplasmic kinase localized in the membrane of pollen tube tip regions that controls micropylar pollen tube guidance in Arabidopsis. |
| AT5G16510 | RGP5 is a member of the reversably-glycosylated family of proteins. Analyses using tagged RGP5 suggest that it is present in the cytosol and in association with the Golgi apparatus. Recombinant RGP5 does not have UDP-arabinose mutase activity based on an in vitro assay even though the related RGP1, RGP2, and RGP3 proteins do have activity in the same assay. RGP5 can form complexes with RGP1 and RGP2. |
| AT5G16590 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G16640 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G16710 | DHAR3 protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide.Encodes 30-40% of extractable leaf GSH-dependent DHAR activity. Single knockout mutants show unaltered ascorbate and glutathione status in optimal and oxidative stress conditions.Makes a minor contribution to glutathione oxidation in response to increased intracellular hydrogen peroxide (catalase deficiency) (PMID:28381499). |
| AT5G16740 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G16850 | Encodes the catalytic subunit of telomerase reverse transcriptase. Involved in telomere homeostasis. Homozygous double mutants with ATR show gross morphological defects over a period of generations. TERT shows Class II telomerase activity in vitro, indicating that it can initiate de novo telomerase synthesis on non-telomeric DNA, often using a preferred position within the telomerase-bound RNA. Loss of function mutants have reduced telomere length in roots and over a period of generations, decreasing root meristem function. |
| AT5G16990 | molecular function has not been defined, was shown involved in oxidative stress tolerance. The mRNA is cell-to-cell mobile. |
| AT5G17000 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT5G17030 | UDP-glucosyl transferase 78D3;(source:Araport11) |
| AT5G17050 | The At5g17050 encodes a anthocyanidin 3-O-glucosyltransferase which specifically glucosylates the 3-position of the flavonoid C-ring. Anthocyanidins such as cyanidin and pelargonidin as well as flavonols such as kaempferol and quercetin are accepted substrates. |
| AT5G17070 | Encodes a PP4R2 domain protein that likely functions as a regulatory subunit of PP4, a highly conserved ser/thr protein phosphatase. |
| AT5G17320 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT5G17330 | Encodes one of two isoforms of glutamate decarboxylase. The mRNA is cell-to-cell mobile. |
| AT5G17360 | DNA ligase;(source:Araport11) |
| AT5G17380 | Thiamine pyrophosphate dependent pyruvate decarboxylase family protein;(source:Araport11) |
| AT5G17390 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT5G17480 | pollen calcium-binding protein 1;(source:Araport11) |
| AT5G17490 | Encodes a DELLA subfamily member that acts as a negative regulator of GA signaling and as a coactivator of ABI3 to promote seed storage protein biosynthesis during the seed maturation stage. |
| AT5G17500 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT5G17540 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G17670 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G17720 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G17790 | Encodes a zinc-finger motif containing protein that is essential for chloroplast RNA editing. The protein physically interacts with ORRM1 and other components of chloroplast editosomes. VAR3 is a part of a protein complex required for normal chloroplast and palisade cell development. Mutants display a variegated phenotype due to somatic areas lacking or containing developmentally retarded chloroplasts and greatly reduced numbers of palisade cells. |
| AT5G17800 | Member of the R2R3 factor gene family that acts as a cell-specific repressor of quiescent center (QC) divisions in the primary root, acting through the BR signaling pathway. Works with BES1 to regulate QC division in the root. |
| AT5G17810 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Together with WOX11, WOX12 is involved in de novo root organogenesis. |
| AT5G17860 | Cation/Ca2+ exchanger family member. Double mutants with CCX4 show delayed greening and defects in ROS response. |
| AT5G17880 | Encodes a TIR-NBS-LRR protein CSA1 that functions in photomorphogenic development. csa1 mutants display a constitutive shade-avoidance (CSA) phenotype (long stem) under high red:far-red rations (i.e. in the absence of a shade signal). csa1 mutation can be complemented by RPS4, a TIR-NBS-LRR protein that confers resistance against bacterium Pseudomonas syringae. |
| AT5G17980 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT5G17990 | Encodes the tryptophan biosynthetic enzyme phosphoribosylanthranilate transferase (PAT1, called trpD in bacteria). Converts anthranilate and phosphoribosylpyrophosphate into phosphoribosylanthranilate and inorganic pyrophosphate. The mRNA is cell-to-cell mobile. |
| AT5G18210 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G18220 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G18280 | Encodes an enzyme with ATPase and ADPase activity (an apyrase) that when mutated in combination with ATAPY1 causes a complete inhibition of pollen germination. |
| AT5G18290 | Belongs to a family of plant aquaporins.Similar to yeast and radish aquaporins. Located on ER |
| AT5G18310 | ubiquitin hydrolase;(source:Araport11) |
| AT5G18350 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G18430 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G18450 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT5G18460 | carboxyl-terminal peptidase (DUF239);(source:Araport11) |
| AT5G18480 | Encodes an IPC (inositol phosphorylceramide) glucuronosyltransferase. Defects in transmission via the pollen are evident but the defect in transmission through the male gametophyte is not due to improper pollen development or inability of pollen tubes to germinate and grow. Using a pollen specific complementation strategy to obtain homozygotes, loss of function results in constitutive hypersensitive response and severe growth defects. |
| AT5G18525 | Encodes a BEACH domain containing protein that is involved in targeting storage proteins to the protein storage vacuoles and effector triggered immunity to Psuedomonas syringae. |
| AT5G18550 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT5G18610 | Encodes a receptor-like cytoplasmic kinase that is an immediate downstream component of the chitin receptor CERK1 and contributes to the regulation of chitin-induced immunity. |
| AT5G18630 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G18661 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G18750 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT5G18770 | F-box/FBD-like domains containing protein;(source:Araport11) |
| AT5G18780 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G18830 | Encodes a member of the Squamosa Binding Protein family of transcriptional regulators. SPL7 is expressed highly in roots and appears to play a role in copper homeostasis. Mutants are hypersensitive to copper deficient conditions and display a retarded growth phenotype. SPL7 binds to the promoter of the copper responsive miRNAs miR398b and miR389c. |
| AT5G18850 | Low-density receptor-like protein;(source:Araport11) |
| AT5G18910 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G18940 | Mo25 family protein;(source:Araport11) |
| AT5G18970 | AWPM-19-like family protein;(source:Araport11) |
| AT5G19040 | Encodes cytokinin synthase. |
| AT5G19060 | cytochrome P450 family protein;(source:Araport11) |
| AT5G19070 | SNARE associated Golgi protein family;(source:Araport11) |
| AT5G19090 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G19110 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G19120 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G19180 | Encodes a subunit of a RUB-activating enzyme analogous to the E1 ubiquitin-activating enzyme. ECR1 functions as a heterodimer with AXR1 to activate RUB, a ubiquitin-related protein. |
| AT5G19220 | Encodes the large subunit of ADP-glucose pyrophosphorylase which catalyzes the first, rate limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms (ApL1-4) have been identified. ApL1 is the major large subunit isoform present in leaves. Mutational analysis of APS1 suggests that APL1 and APL2 can compensate for loss of APS1 catalytic activity,suggesting both have catalytic as well as regulatory functions. |
| AT5G19250 | Glycoprotein membrane precursor GPI-anchored;(source:Araport11) |
| AT5G19410 | ABC-2 type transporter family protein;(source:Araport11) |
| AT5G19540 | DY1 is a novel nuclear encoded protein that is imported into the chloroplast stroma. Mutants have reduced pigmentation and somewhat abnormal thylakoid membranes. |
| AT5G19640 | Influences leaf N export via sink-to-source feedback, perhaps via a role in sensing plant internal N-status. Necessary for normal leaf N export under low N. |
| AT5G19820 | Encodes an importin that transports HYL1, a component of the microprocessor, from the cytoplasm to the nucleus to constitute functional microprocessor, thereby affecting miRNA processing. Knockdown amiR mutants significantly reduced nuclear portion of HYL1 protein and correspondingly compromised the pri-miRNA processing in the nucleus.KETCH1 may protect RPs from the 26S proteasome-mediated degradation. |
| AT5G19980 | Encodes a Golgi-localized nucleotide-sugar transporter. |
| AT5G20080 | FAD/NAD(P)-binding oxidoreductase;(source:Araport11) |
| AT5G20090 | MPC1 negatively regulates ABA enhanced slow anion channel function during stomatal closure. |
| AT5G20140 | Encodes a haem-binding protein, HBP5. HBP5 binds haem and interacts with the haem oxygenase, HY1. Disrupting the binding of HBP5 to HY1 leads to oxidative stress. |
| AT5G20225 | Natural antisense transcript overlaps with AT5G20220;(source:Araport11) |
| AT5G20230 | Encodes a Al-stress-induced gene. Along with TCF, it promotes lignin biosynthesis in response to cold stress. The mRNA is cell-to-cell mobile. |
| AT5G20240 | Floral homeotic gene encoding a MADS domain transcription factor. Required for the specification of petal and stamen identities. |
| AT5G20250 | encodes a member of glycosyl hydrolase family 36. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile. |
| AT5G20270 | heptahelical transmembrane protein homologous to human adiponectin receptors and progestin receptors |
| AT5G20360 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G20380 | Encodes an inorganic phosphate transporter (PHT4;5). |
| AT5G20540 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
| AT5G20635 | Encodes an atypical heterotrimeric G-protein gamma-subunit involved in guard cell K+-channel regulation and morphological development. |
| AT5G20670 | DUF1677 family protein (DUF1677);(source:Araport11) |
| AT5G20680 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G20730 | Encodes an auxin-regulated transcriptional activator. Activates expression of IAA1 and IAA9 in the presence of auxin. Mutants affect blue light and gravitropic and auxin mediated growth responses. Together with AUX19, it is involved in the response to ethylene. In the arf7 arf19 double mutant, several auxin-responsive genes (e.g. IAA5, LBD16, LBD29 and LBD33) are no longer upregulated by auxin. |
| AT5G20790 | transmembrane protein;(source:Araport11) |
| AT5G20820 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G20850 | Encodes a homolog of yeast RAD51. Its mRNA is most abundant in early flower buds and is expressed at high levels in exponentially growing cells in suspension cultures and is induced in response to gamma radiation. Also involved in defense gene transcription during plant immune responses. |
| AT5G20870 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G20890 | TCP-1/cpn60 chaperonin family protein;(source:Araport11) |
| AT5G20970 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT5G20990 | Involved in molybdenum cofactor (Moco) biosynthesis, inserting Mo into Molybdopterin. sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling. |
| AT5G21050 | hyccin;(source:Araport11) |
| AT5G21105 | Plant L-ascorbate oxidase;(source:Araport11) |
| AT5G21130 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G21140 | Encodes a nuclear localized, structural subunit of the SMC 5/6 complex and a non- SMC element. Loss of function results in abnormal cell division and embryo lethality. Analysis of partially rescued lines indicates a role in double strand break DNA repair. Similar phenotype to NSE3 which it also interacts with. Maintains cell viability together with NSE3 during early embryogenesis. |
| AT5G21280 | Seed plant lineage specific gene that is expressed in response to oxidative and abiotic stresses. |
| AT5G21482 | This gene used to be called AtCKX5. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. Enzyme assays show preference for N6 -(2-isopentenyl)adenine 9-glucoside substrate. |
| AT5G21970 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT5G21990 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808). Functions as a chaperone receptor at the chloroplast outer envelope, mediating Hsp70-dependent protein targeting to chloroplasts. It has been localized to the ER membrane, interacts with the Sec translocon, and has a potential function in post-translational protein transport into the ER. The mRNA is cell-to-cell mobile. |
| AT5G22010 | Encodes RFC1, the largest subunit of replication factor C. Mediates genomic stability and transcriptional gene silencing. |
| AT5G22070 | Putative glycosyltransferase that negatively regulates leaf senescence in a SID2 dependent manner. |
| AT5G22120 | coiled-coil protein;(source:Araport11) |
| AT5G22180 | hypothetical protein;(source:Araport11) |
| AT5G22190 | hypothetical protein;(source:Araport11) |
| AT5G22220 | Member of the E2F transcription factors, (cell cycle genes), key components of the cyclin D/retinoblastoma/E2F pathway. Binds DPA and RBR1 proteins. Expressed throughout the cell cycle. Abundance increased by auxin through stabilization of the protein. Elevates CDK levels and activity, even under hormone-free conditions. Promotes cell division and shortens cell doubling time, inhibits cell growth. Transgenic plants overexpressing AtE2Fa contained an increased level of AtE2Fb transcripts that is paralleled by an increase in the amount of the AtE2Fb protein, suggesting that AtE2Fb expression might actually be up-regulated by the AtE2Fa transcription factor. |
| AT5G22240 | Ovate family protein;(source:Araport11) |
| AT5G22330 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G22470 | PARP3 is one of three canonical PARPs in Arabidopsis. |
| AT5G22490 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
| AT5G22560 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT5G22570 | member of WRKY Transcription Factor; Group III |
| AT5G22610 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G22630 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile. |
| AT5G22740 | Encodes a beta-mannan synthase based on in vitro enzyme assays from heterologously expressed protein. CSLA2 synthesizes the backbone of galactoglucomannan in seed coat epidermal cells. Both CSLA2 and MUCI10, which may be part of a protein complex, are critical for mucilage architecture. |
| AT5G22750 | DNA repair gene. gamma-radiation hypersensitive (RAD5) involved in stable transformation and T-DNA transfer |
| AT5G22840 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G22850 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G22940 | Homolog of FRA8 (AT2G28110), a member of a member of glycosyltransferase family 47; exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. |
| AT5G23020 | methylthioalkymalate synthase-like. Also known as 2-isopropylmalate synthase (IMS2). encodes a methylthioalkylmalate synthase involved in the biosynthesis of aliphatic glucosinolates which accepts all the omega-methylthio-2-oxoalkanoic acids needed to form the known C3 to C8 glucosinolates in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT5G23030 | Member of TETRASPANIN family |
| AT5G23060 | Encodes a chloroplast-localized protein that modulates cytoplasmic Ca2+ concentration and is crucial for proper stomatal regulation in response to elevations of external Ca2+. Phosphorylation of this protein is dependent on calcium. |
| AT5G23100 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT5G23160 | transmembrane protein;(source:Araport11) |
| AT5G23170 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G23210 | serine carboxypeptidase-like 34;(source:Araport11) |
| AT5G23220 | nicotinamidase 3;(source:Araport11) |
| AT5G23230 | nicotinamidase 2;(source:Araport11) |
| AT5G23250 | Succinyl-CoA ligase, alpha subunit;(source:Araport11) |
| AT5G23380 | hypothetical protein (DUF789);(source:Araport11) |
| AT5G23430 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
| AT5G23440 | ferredoxin/thioredoxin reductase subunit A (variable subunit) 1;(source:Araport11) |
| AT5G23680 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
| AT5G23730 | Encodes REPRESSOR OF UV-B PHOTOMORPHOGENESIS 2 (RUP2). Functions as a repressor of UV-B signaling. |
| AT5G23820 | ML3 can be modified by NEDD8 and ubiquitin. ML3 expression is regulated by NAI1. ML3 expression is regulated by MeJA, ethylene and wounding. ml3-3 is more susceptible against infections with Alternaria brassicicola and more resistant against infections with Pseudomonas syringae DC3000. |
| AT5G23850 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT5G23860 | beta-tubulin, preferentially expressed in endodermal and phloem cells of primary roots and in the vascular tissues of leaves, stems, and flowers. The mRNA is cell-to-cell mobile. |
| AT5G23890 | GPI-anchored adhesin-like protein;(source:Araport11) |
| AT5G23940 | Encodes PERMEABLE LEAVES3 (PEL3), a putative acyl-transferase. Mutation in this locus results in altered trichome phenotype (trcichomes become tangled during leaf expansion). Additional phenotype includes altered cuticle layer. |
| AT5G23980 | Encodes a ferric chelate reductase that is expressed at low levels in roots,shoots and cotyledons, but not flowers. Its transcription is regulated by FIT1. |
| AT5G24000 | keratin-associated protein (DUF819);(source:Araport11) |
| AT5G24070 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G24090 | Chitinase A (class III) expressed exclusively under environmental stress conditions. Shown be a plant lysozyme involved in plant immunity. |
| AT5G24100 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G24150 | squalene monooxygenase gene homolog |
| AT5G24155 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT5G24165 | hypothetical protein;(source:Araport11) |
| AT5G24170 | Got1/Sft2-like vescicle transport protein family;(source:Araport11) |
| AT5G24220 | Lipase class 3-related protein;(source:Araport11) |
| AT5G24270 | encodes a calcium sensor that is essential for K+ nutrition, K+/Na+ selectivity, and salt tolerance. The protein is similar to calcineurin B. Lines carrying recessive mutations are hypersensitive to Na+ and Li+ stresses and is unable to grow in low K+. The growth defect is rescued by extracellular calcium. |
| AT5G24318 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G24430 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
| AT5G24450 | Transcription factor IIIC, subunit 5;(source:Araport11) |
| AT5G24460 | RING-H2 zinc finger protein;(source:Araport11) |
| AT5G24470 | Encodes a pseudo-response regulator whose mutation affects various circadian-associated biological events such as flowering time in the long-day photoperiod conditions, red light sensitivity of seedlings during early photomorphogenesis, and the period of free-running rhythms of certain clock-controlled genes including CCA1 and APRR1/TOC1 in constant white light. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR7 and PRR9 to regulate hypocotyl growth under photoperiodic conditions. |
| AT5G24530 | Encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility to downy mildew. The mRNA is cell-to-cell mobile. |
| AT5G24570 | hypothetical protein;(source:Araport11) |
| AT5G24590 | Member of NAc protein family. Interacts with turnip crinkle virus (TCV) capsid protein. Transcription factor involved in regulating the defense response of Arabidopsis to TCV. |
| AT5G24650 | HP30/Tric1 is a component of the mitochondrial protein translocation complex and is involved in tRNA transport along with HP30-2/Tric2.It interacts with several members of the TOM complex such as TOM40 and this interaction is mediated by the SAM domain. Role in protein import into chloroplasts. |
| AT5G24740 | Encodes a vacuolar sorting protein that interacts with the plant-specific GRAS family transcription factor SHORT-ROOT and acts in a pathway that controls root growth and radial patterning. It provides a connections between gibberellic acid, SHR and PLT signaling in the root. |
| AT5G24790 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
| AT5G24930 | Flowering repressor in long days (LD) and short days (SD) and acts on the expression of FT and FT-like genes as well as on SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1). |
| AT5G25160 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT5G25220 | A member of class II knotted1-like homeobox gene family (together with KNAT4 and KNAT5). Expressed in: hypocotyl-root boundary, anther-filament junction in flowers, ovule-funiculus and peduncle-silique boundaries, petioles and root. Light-regulated expression with differential response to red/far-red light. KNAT3 promoter activity showed cell-type specific pattern along longitudinal root axis, restricted mainly to the differentiation zone of the root, namely in the cortex and pericycle. Not detected in lateral root primordia |
| AT5G25265 | Hyp O-arabinosyltransferase-like protein;(source:Araport11) |
| AT5G25280 | serine-rich protein-like protein;(source:Araport11) |
| AT5G25340 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G25410 | transmembrane protein, putative (DUF239);(source:Araport11) |
| AT5G25430 | HCO3- transporter family;(source:Araport11) |
| AT5G25440 | Receptor like kinase involved in HopZ1a effector triggered immunity. Interacts with ZAR1. Localization to membrane is dependent on N-terminal myristoylation domain. |
| AT5G25450 | Cytochrome bd ubiquinol oxidase, 14kDa subunit;(source:Araport11) |
| AT5G25475 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G25590 | DNA ligase (DUF630 and DUF632);(source:Araport11) |
| AT5G25600 | putative nucleic-acid protein;(source:Araport11) |
| AT5G25830 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT5G25890 | encodes a protein that may be a negative regulator of lateral root formation in response to auxin. It is a member of IAA/ARF gene family and is plant-specific. Gain of function mutations in this gene suppresses lateral root formation and is resistant to inhibition of root elongation by auxin, cytokinin, and ethylene. |
| AT5G25910 | putative disease resistance protein induced by chitin oligomers. |
| AT5G25930 | kinase family with leucine-rich repeat domain-containing protein;(source:Araport11) |
| AT5G26080 | proline-rich family protein;(source:Araport11) |
| AT5G26090 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G26180 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G26220 | ChaC-like family protein;(source:Araport11) |
| AT5G26250 | Sugar transporter expressed strongly in pollen and pollen tubes. |
| AT5G26310 | UGT72E3 is an UDPG:coniferyl alcohol glucosyltransferase which glucosylates sinapyl- and coniferyl alcohol as well as sinapic acid. The enzyme is thought to be involved in lignin- and phenylpropanoid metabolism. A knockdown mutant line (72E3KD) was obtained using RNAi silencing. No reduction in coniferyl alcohol 4-O-glucoside and sinapyl alcohol 4-O-glucoside was detected in this line compared to wildtype, in contrast with the knockdown line constructed for UGT72E2 displayed a twofold reduction in the these phenylpropanoid 4-O-glucosides. Can influence the kinetics of lignin deposition by regulating monolignol flow to the cell wall as well as the potential of this compartment to incorporate monomers into the growing lignin polymer. |
| AT5G26600 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT5G26617 | reverse transcriptase-like protein;(source:Araport11) |
| AT5G26622 | Beta-galactosidase related protein;(source:Araport11) |
| AT5G26680 | Encodes a FEN1 homolog that has double-flap endonuclease activity, weak GEN activity towards bubble DNA structures and flap endonuclease activity towards substrates with a single-flap structure, but lacks the 5′ exonuclease activity towards DNA substrates with a nick on one strand, and GEN activity towards gapped DNA without any flap. It is expressed in rapidly dividing cells and mutants have smaller roots and hypocotyls. |
| AT5G26790 | transmembrane protein;(source:Araport11) |
| AT5G27510 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G27620 | core cell cycle genes The mRNA is cell-to-cell mobile. |
| AT5G27670 | Encodes HTA7, a histone H2A protein. |
| AT5G27690 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G27771 | pseudogene of (SAUR) auxin-responsive family protein |
| AT5G27910 | nuclear factor Y, subunit C8;(source:Araport11) |
| AT5G27920 | Encodes a nuclear F-box protein that can directly interact with the C2H2‐type zinc finger transcription factor STOP1 and promote its ubiquitination and degradation. STOP1 is crucial for aluminum (Al) resistance. |
| AT5G27940 | WPP domain protein 3;(source:Araport11) |
| AT5G27990 | Pre-rRNA-processing protein TSR2, conserved region;(source:Araport11) |
| AT5G28150 | hypothetical protein (DUF868);(source:Araport11) |
| AT5G28200 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, various predicted proteins, Arabidopsis thaliana;(source:TAIR10) |
| AT5G28210 | mRNA capping enzyme family protein;(source:Araport11) |
| AT5G28237 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
| AT5G28300 | Encodes a Ca(2+)-dependent CaM-binding protein. AtGT2L specifically targets the nucleus and possesses both transcriptional activation and DNA-binding abilities, implicating its function as a nuclear transcription factor. |
| AT5G28490 | Encodes a nuclear protein that mediates light regulation of seedling development in a phytochrome-dependent manner. |
| AT5G28523 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 8.9e-31 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT5G28622 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.1e-21 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G28680 | Receptor-like kinase required for maintenance of pollen tube growth. Display polar localization at the plasma membrane of the pollen tube tip. |
| AT5G28770 | BASIC LEUCINE ZIPPER protein which regulates the circadian oscillator gene PSEUDO RESPONSE REGULATOR7 (PRR7) to change the circadian phase in response to sugars. It upregulates PRR7 in response to low energy. bZIP63 and PRR7 are required for correct oscillator phase under light/dark cycles. bZIP protein BZO2H3 mRNA, partial cds |
| AT5G29560 | caleosin-related family protein;(source:Araport11) |
| AT5G29577 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.9e-17 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
| AT5G31804 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-259 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G33280 | Voltage-gated chloride channel family protein;(source:Araport11) |
| AT5G33320 | Encodes a plastid inner envelope protein PPT (phosphoenolpyruvate/phosphate translocator) that catalyzes the transport of phosphoenolpyruvate and phosphate across the inner envelope membrane of plastids. The mRNA is cell-to-cell mobile. |
| AT5G33350 | pseudogene of Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G33365 | transposable_element_gene;(source:Araport11);expressed protein, similar to reverse transcriptase, putative;(source:TAIR10) |
| AT5G33370 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. Mutants are defective in cuticle formation with reduced sepal cuticle ridge formation. |
| AT5G33382 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-126 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
| AT5G34780 | Putative ketopantoate reductase (KPR). This enzyme is speculated to be the missing enzyme in the biosynthesis of pantothenate. |
| AT5G34849 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.5e-166 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT5G35100 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT5G35110 | hypothetical protein;(source:Araport11) |
| AT5G35180 | ENHANCED DISEASE RESISTANCE protein (DUF1336);(source:Araport11) |
| AT5G35390 | Encodes a member of the receptor-like kinase family of genes. In pollen tubes, it accumulates in the plasma membrane of the apical growing tip through the process of exocytosis. |
| AT5G35407 | Encodes a microRNA that targets several GRF family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCCACAGCUUUCUUGAACUU. Expression increased with leaf development, antagonizing with expression of GRFs. Transcript accumulates in the distal zone of young developing seeds, restricing the expression of GRF2 to the proximal part. miR396 attenuates cell proliferation in developing leaves through the repression of GRF activity and a decrease in the expression of cell cycle genes. |
| AT5G35410 | encodes a member of the CBL-interacting protein kinase family, is a regulatory component controlling plant potassium nutrition |
| AT5G35430 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G35660 | Glycine-rich protein family;(source:Araport11) |
| AT5G35736 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G35750 | Encodes histidine kinase AHK2. |
| AT5G35760 | Beta-galactosidase related protein;(source:Araport11) |
| AT5G35840 | Encodes the apoprotein of phytochrome;one of a family of photoreceptors that modulate plant growth and development. The mRNA is cell-to-cell mobile. |
| AT5G35880 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G32680.1);(source:TAIR10) |
| AT5G35980 | Encodes a dual specificity protein kinase which phosphorylates substract proteins on Ser/Thr and Tyr residues. Some substrates include annexin family proteins. YAK1 mutations suppress TOR deficiency in Arabidopsis and consequences of lst8 mutations. The YAK1 protein is phosphorylated by the TOR kinase. |
| AT5G36150 | putative pentacyclic triterpene synthase 3;(source:Araport11) |
| AT5G36210 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G36220 | member of CYP81D family of cytochrome p450s. This gene was originally called CYP91A1, but was later renamed to CYP81D1. |
| AT5G36970 | NDR1/HIN1-like protein, expression induced during incompatible response to a pathogen, expression is at least partly dependent on the salicylic acid signaling pathway |
| AT5G37060 | member of Putative Na+/H+ antiporter family |
| AT5G37130 | Protein prenylyltransferase superfamily protein;(source:Araport11) |
| AT5G37270 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G37360 | LOW protein: ammonium transporter 1-like protein;(source:Araport11) |
| AT5G37442 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.7e-44 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G37490 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G37530 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G37540 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G37770 | Encodes a protein with 40% similarity to calmodulin. Binds Ca(2+) and, as a consequence, undergoes conformational changes. CML24 expression occurs in all major organs, and transcript levels are increased from 2- to 15-fold in plants subjected to touch, darkness, heat, cold, hydrogen peroxide, abscisic acid (ABA), and indole-3-acetic acid. However, CML24 protein accumulation changes were not detectable. The putative CML24 regulatory region confers reporter expression at sites of predicted mechanical stress; in regions undergoing growth; in vascular tissues and various floral organs; and in stomata, trichomes, and hydathodes. CML24-underexpressing transgenics are resistant to ABA inhibition of germination and seedling growth, are defective in long-day induction of flowering, and have enhanced tolerance to CoCl(2), molybdic acid, ZnSO(4), and MgCl(2). Also regulates nitric oxide levels. |
| AT5G37800 | RHD SIX-LIKE 1;(source:Araport11) |
| AT5G37950 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G38020 | encodes a protein whose sequence is similar to SAM:salicylic acid carboxyl methyltransferase (SAMT) (GI:6002712)(Clarkia breweri) and to SAM:benzoic acid carboxyl methyltransferase (BAMT)(GI:9789277)(Antirrhinum majus). SABATH family methyltransferase. |
| AT5G38030 | MATE transporter involved in auxin homeostasis in roots. |
| AT5G38120 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT5G38210 | Protein kinase family protein;(source:Araport11) |
| AT5G38212 | Natural antisense transcript overlaps with AT5G38210;(source:Araport11) |
| AT5G38220 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G38240 | Protein kinase family protein;(source:Araport11) |
| AT5G38300 | homeobox Hox-B3-like protein;(source:Araport11) |
| AT5G38310 | hypothetical protein;(source:Araport11) |
| AT5G38344 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT5G38393 | pseudogene of F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G38450 | cytochrome P450, family 735, subfamily A, polypeptide 1;(source:Araport11) |
| AT5G38590 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G38640 | NagB/RpiA/CoA transferase-like superfamily protein;(source:Araport11) |
| AT5G38710 | Methylenetetrahydrofolate reductase family protein;(source:Araport11) |
| AT5G38990 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT5G39000 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT5G39050 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. |
| AT5G39095 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-250 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT5G39250 | F-box family protein;(source:Araport11) |
| AT5G39350 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G39450 | F-box family protein;(source:Araport11) |
| AT5G39510 | Encodes a member of SNARE gene family. Homologous with yeast VTI1 and is involved in vesicle transport. Mutant alleles such as sgr4/zig are defective in the shoots response to gravity resulting in a zigzag growth pattern of the stem. Involved in protein trafficking to lytic vacuoles. Can conditionally substitute VTI12 in protein storage vacuole trafficking when plants are devoid of VTI12. The mRNA is cell-to-cell mobile. |
| AT5G39570 | Protein of unknown function. Binds phosphatidic acid and acts downstream of PLDalpha. |
| AT5G39720 | avirulence induced protein 2 like protein;(source:Araport11) |
| AT5G39760 | Functions together with TZP in co-regulation of the expression of blue-light dependent transcriptional regulators. Coassociates with and regulates the expression of light-regulated loci as well as transcriptional regulators to shape plant development in response to environmental stimuli with targets in RNA processing factors as well as proteins involved in salt stress and ABA signaling, in addition to embryo development. Acts downstream of TZP action with regard to blue-light-regulated hypocotyl elongation. |
| AT5G39861 | pseudogene of receptor kinase 3;(source:Araport11) |
| AT5G39890 | Plant Cysteine Oxidase (PCO). Involved in controlling the stability of Group VII ethylene response factors (ERF-VIIs) via N-Arg/degron pathway through catalyzing the oxidation of their N-Cys for subsequent Arginyl-tRNA--protein transferase 1 (ATE1) mediated arginine installation. |
| AT5G40155 | Encodes a defensin-like (DEFL) family protein. |
| AT5G40160 | Encodes ankyrin repeat protein EMB506. Mutations in this locus result in embryo lethality. |
| AT5G40210 | nodulin MtN21-like transporter family protein |
| AT5G40240 | nodulin MtN21-like transporter family protein |
| AT5G40250 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G40270 | VEN4 is homologous to human SAMHD1 and functions in chloroplast biogenesis. |
| AT5G40310 | Exonuclease family protein;(source:Araport11) |
| AT5G40390 | Encodes a protein which might be involved in the formation of verbascose. A T-DNA insertion mutant was shown to have a decreased amount of verbascose (as well as mannitol) whereas the levels of raffinose and stachyose remained unchanged. Enhances drought tolerance through raffinose synthesis or galactinol hydrolysis. |
| AT5G40460 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
| AT5G40560 | Encodes a putative DegP protease. |
| AT5G40620 | transmembrane protein;(source:Araport11) |
| AT5G40630 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G40640 | transmembrane protein;(source:Araport11) |
| AT5G40710 | zinc finger (C2H2 type) family protein;(source:Araport11) |
| AT5G40720 | C3H4 type zinc finger protein (DUF23);(source:Araport11) |
| AT5G40790 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G40800 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G40880 | Involved in seed germination, seedling/seed development, interacting with PPPDE family protein Desi1. |
| AT5G40900 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT5G41130 | Esterase/lipase/thioesterase family protein;(source:Araport11) |
| AT5G41170 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT5G41190 | Encodes a cytoplasmic protein with RNA endonuclease activity. Mutants display aberrant RNA processing and male and female gametophyte development. |
| AT5G41270 | RNase P Rpr2/Rpp21 subunit domain protein;(source:Araport11) |
| AT5G41315 | Encodes a basic helix loop helix domain protein that interacts with GL1 in trichome development.GL3 interacts with JAZ and DELLA proteins to regulate trichome initiation. |
| AT5G41410 | Homeodomain protein required for ovule identity.Loss of function mutations show homeotic conversion of integuments to carpels.Forms heterodimers with STM and KNAT1. Interacts with AG-SEP heterodimers is thought to restrict WUS expression. BEL interacts with MADS box dimers composed of SEP1(or SEP3) and AG, SHP1, SHP2 and STK. The interaction of BEL1 with AG-SEP3 is required for proper integument development and specification of integument identity. |
| AT5G41420 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G41460 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT5G41580 | Encodes an SP-RING domain containing protein that functions in sumolaytion and is involved in positive regulation of sulfur metabolism and stress response. |
| AT5G41590 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT5G41600 | VIRB2-interacting protein 3;(source:Araport11) |
| AT5G41620 | intracellular protein transporter USO1-like protein;(source:Araport11) |
| AT5G41790 | encodes a protein that physically interacts specifically with the putative coiled-coil region of COP1 in vitro. In hypocotyl and cotyledon protoplasts, it is associated to the cytoskeleton, but not in the root. expression is not regulated by light. The mRNA is cell-to-cell mobile. |
| AT5G41800 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G41850 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G42050 | Stress responsive asparagine-rich protein. Binds to PevD (Verticillium dahliae ) fungal effector protein. NRP interacts with CRY2, leading to increased cytoplasmic accumulation of CRY2 in a blue light-independent manner (PMID:28633330).NRP also binds FyPP3 and recruits it to endosomes and thus targets it for degradation. |
| AT5G42140 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
| AT5G42210 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G42240 | serine carboxypeptidase-like 42;(source:Araport11) |
| AT5G42250 | Zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
| AT5G42290 | transcription activator-like protein;(source:Araport11) |
| AT5G42370 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT5G42380 | calmodulin like 37;(source:Araport11) |
| AT5G42440 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G42505 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-23 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT5G42540 | Encodes a protein with similarity to yeast 5'-3'exonucleases and can functionally complement the yeast mutations. In Arabidopsis XRN2 acts as a suppressor of posttranscriptional gene silencing. |
| AT5G42560 | Abscisic acid-responsive (TB2/DP1, HVA22) family protein;(source:Araport11) |
| AT5G42650 | Encodes a member of the cytochrome p450 CYP74 gene family that functions as an allene oxide synthase. This enzyme catalyzes dehydration of the hydroperoxide to an unstable allene oxide in the JA biosynthetic pathway. It shows a dual catalytic activity, the major one being a 13-AOS but also expressing a 9-AOS activity. CFA-Leu, CFA-Val, CFA-Met and CFA-Ala can induce the expression of AOS. |
| AT5G42780 | Zinc finger and homeobox domain protein which interacts with RMB1 and ROS1 acting in the base excision repair pathway through DNA methylation. |
| AT5G42800 | dihydroflavonol reductase. Catalyzes the conversion of dihydroquercetin to leucocyanidin in the biosynthesis of anthocyanins. Not expressed in roots (qRT-PCR). The mRNA is cell-to-cell mobile. |
| AT5G42960 | outer envelope pore 24B-like protein;(source:Araport11) |
| AT5G42980 | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. The mRNA is cell-to-cell mobile. |
| AT5G43010 | 26S proteasome AAA-ATPase subunit RPT4a (RPT4a) mRNA, |
| AT5G43050 | Chloroplast localized YCF20-like gene involved in nonphotochemical quenching. Has overlapping functions with npq7 The mRNA is cell-to-cell mobile. |
| AT5G43066 | Homolog of prePIP1. |
| AT5G43070 | WPP family members contains an NE targeting domain. This domain, called the WPP domain after a highly conserved Trp-Pro-Pro motif, is necessary and sufficient for NE targeting of WPP1. RNAi suppression of WPP1 resulted in reduced mitotic activity. |
| AT5G43100 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G43170 | Encodes zinc finger protein. mRNA levels are elevated in response to high salinity and low temperature. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT5G43260 | chaperone protein dnaJ-like protein;(source:Araport11) |
| AT5G43280 | Encodes the peroxisomal delta 3,5-delta2,4-dienoyl-CoA isomerase, a enzyme involved in degradation of unsaturated fatty acids. Gene expression is induced upon seed germination. |
| AT5G43535 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT5G43560 | Encodes MUSE14, a TRAF domain protein. Regulates the turnover of nucleotide-binding domain and leucine-rich repeat-containing (NLR) immune receptors SNC1 and RPS2. Loss of both MUSE13 and MUSE14 leads to enhanced pathogen resistance, NLR accumulation, and autoimmunity. In addition, MUSE13/14 physically interact with ATG6 and appear to regulate ATG6 ubiquitination and thus formation of autophagosomes. |
| AT5G43590 | Acyl transferase/acyl hydrolase/lysophospholipase superfamily protein;(source:Araport11) |
| AT5G43750 | NAD(P)H dehydrogenase 18;(source:Araport11) |
| AT5G43840 | member of Heat Stress Transcription Factor (Hsf) family |
| AT5G43860 | Encodes a chlorophyllase, the first enzyme in chlorophyll degradation. It catalyzes the hydrolysis of the ester bond to chlorophyllide and phytol. AtCLH2 has a typical signal sequence for the chloroplast. Gene expression does not respond to methyljasmonate, a known promoter of senescence and chlorophyll degradation. |
| AT5G43980 | Encodes a plasmodesmal protein that affects the intercellular movement of molecules through the plasmodesmata. The cytoplasmic C-terminal portion of the protein is connected to the apoplastic N-terminal portion of the protein by a single transmembrane domain (TMD). It is transported to the plasmodesmata through the secretory pathway. PDLP1 has two DUF26 domains and a signal peptide, but the proper localization of the protein appears to depend on the TMD. |
| AT5G43990 | Encodes SUVR2, one of the four closely related Arabidopsis SUVR proteins that belong to the SU(VAR)3-9 subgroup of SET-domain proteins. Proteins containing the evolutionarily conserved SET domain are involved in regulation of eukaryotic gene expression and chromatin structure through their histone lysine methyltransferase (HMTase) activity. SUVR1, SUVR2 and SUVR4 proteins contain a novel domain at their N-terminus, and a SUVR specific region preceding the SET domain. Localized to the nucleolus, maybe involved in regulation of rRNA expression. |
| AT5G44060 | embryo sac development arrest protein;(source:Araport11) |
| AT5G44070 | Phytochelatin synthase gene confers tolerance to cadmium ions. Catalyzes phytochelatin (PC) synthesis from glutathione (GSH) in the presence of Cd2+, Zn2+, Cu2+ and Fe3+, but not by Co2+ or Ni2+. The mRNA is cell-to-cell mobile. |
| AT5G44080 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT5G44180 | Interacts with CHR11, CHR17, and ARID5, several known subunits of ISWI. JA biosynthesisis is positively regulated by this chromatin remodeling complex, thereby promoting stamen filament elongation. |
| AT5G44190 | Encodes GLK2, Golden2-like 2, one of a pair of partially redundant nuclear transcription factors that regulate chloroplast development in a cell-autonomous manner. GLK1, Golden2-like 1, is encoded by At2g20570. GLK1 and GLK2 regulate the expression of the photosynthetic apparatus. |
| AT5G44230 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G44260 | Encodes a Tandem CCCH Zinc Finger protein. Interacts and co-localizes with MARD1 and RD21A in processing bodies (PBs) and stress granules (SGs). |
| AT5G44320 | Eukaryotic translation initiation factor 3 subunit 7 (eIF-3);(source:Araport11) |
| AT5G44360 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44400 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44410 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44417 | pseudogene of FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44530 | Subtilase family protein;(source:Araport11) |
| AT5G44540 | Tapetum specific protein TAP35/TAP44;(source:Araport11) |
| AT5G44550 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT5G44565 | transmembrane protein;(source:Araport11) |
| AT5G44569 | other_RNA;(source:Araport11) |
| AT5G44670 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT5G44700 | Encodes GASSHO2 (GSO2), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO2 and a homolog GSO1 (At4g20140) are required for the formation of a normal epidermal surface during embryogenesis. |
| AT5G44780 | Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
| AT5G44785 | Organellar Single-stranded DNA Binding protein. Decreases MMEJ on long ssDNA templates. |
| AT5G44800 | Interacts with transcription factors involved in floral meristem identity and affects the expression of key floral regulators. Affects H3K27me3 and H3K4me3 levels at a subset of loci in the genome. |
| AT5G44960 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G45085 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.2e-148 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10) |
| AT5G45100 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT5G45170 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G45190 | Encodes a cyclin T partner CYCT1;5. Plays important roles in infection with Cauliflower mosaic virus (CaMV). |
| AT5G45250 | RPS4 belongs to the Toll/interleukin-1 receptor (TIR)-nucleotide binding site (NBS)-Leu-rich repeat (LRR) class of disease resistance (R ) genes. Confers specific resistance to Pseudomonas syringae pv. tomato carrying the avirulence gene AvrRPS4. Produces alternative transcripts with truncated open reading frames. |
| AT5G45280 | Pectin acetylesterase involved in pectin remodelling. |
| AT5G45300 | Encodes a beta-amylase-like protein present in the nucleus rather than targeted to the chloroplast. Contains BRASSINAZOLE RESISTANT1 (BZR1)-type DNA binding domains. Activates gene expression in protoplast transactivation assays. |
| AT5G45330 | decapping 5-like protein;(source:Araport11) |
| AT5G45370 | nodulin MtN21-like transporter family protein |
| AT5G45380 | urea-proton symporter DEGRADATION OF UREA 3 (DUR3);(source:Araport11) |
| AT5G45530 | transmembrane protein, putative (DUF594);(source:Araport11) |
| AT5G45600 | The GSA41 human homolog is expressed in nuclei and binds NuMA, a component of the nuclear matrix in interphase nuclei. It negatively regulates flowering by controlling the H4 acetylation levels in the FLC and FT chromatin. |
| AT5G45800 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G45810 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.5), which has also been reported as a member of the CBL-interacting protein kinases (CIPK19). |
| AT5G45840 | Encodes a leucine-rich-repeat RLK that is localized to the plasma membrane of pollen tubes and functions with MIK1/2 as the male receptor of the pollen tube chemo-attractant LURE1.MDIS1 forms a complex with MIK1/2 and binds LURE1. |
| AT5G45880 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT5G45920 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT5G45980 | Arabidopsis thaliana WOX8 protein. Contains similarity to homeodomain transcription factor. Positively regulates early embryonic growth. Together with CLE8 it forms a signaling module that promotes seed growth and overall seed size. |
| AT5G45990 | crooked neck protein, putative / cell cycle protein;(source:Araport11) |
| AT5G46000 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT5G46040 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G46170 | F-box family protein;(source:Araport11) |
| AT5G46210 | Arabidopsis CULLIN4 (CUL4) forms an E3 ubiquitin ligase with the CDD complex and a common catalytic subunit RBX1 in mediating light control of development. This CUL4-based E3 ligase is essential for the repression of photomorphogenesis. The partial loss of CUL4 function resulted in a constitutive photomorphogenic phenotype with respect to morphogenesis and light-regulated gene expression. CUL4 exhibits a synergistic genetic interaction with COP10 and DET1. |
| AT5G46230 | ABA responsive SVB family gene. |
| AT5G46240 | Encodes a potassium channel protein (KAT1). ABA triggers KAT1 endocytosis both in epidermal cells as well as guard cells. Upon removal of ABA, KAT1 is recycled back to the plasma membrane. KAT1 is localized within 0.5?0.6 μm diameter microdomains at the plasma membrane surface. KAT1 belongs to the Shaker family K+ channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT5G46300 | hypothetical protein;(source:Araport11) |
| AT5G46330 | Encodes a leucine-rich repeat serine/threonine protein kinase that is expressed ubiquitously. FLS2 is involved in MAP kinase signalling relay involved in innate immunity. Essential in the perception of flagellin, a potent elicitor of the defense response. FLS2 is directed for degradation by the bacterial ubiquitin ligase AvrPtoB. The mRNA is cell-to-cell mobile. |
| AT5G46340 | Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Has high similarity to RWA2 whose mutant displays reduced acetylation. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. |
| AT5G46350 | member of WRKY Transcription Factor; Group II-c |
| AT5G46370 | Encodes AtTPK2 (KCO2), a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK2 is targeted to the vacuolar membrane. May form homomeric ion channels in vivo. |
| AT5G46520 | VICTR (VARIATION IN COMPOUND TRIGGERED ROOT growth response) encodes a TIR-NB-LRR (for Toll-Interleukin1 Receptor-nucleotide binding-Leucine-rich repeat) protein. VICTR is necessary for DFPM-induced root growth arrest and inhibition of abscisic acid-induced stomatal closing (DFPM is [5-(3,4-dichlorophenyl)furan-2-yl]-piperidine-1-ylmethanethione)(PMID:21620700). DFPM-mediated root growth arrest is accession-specific and depends on EDS1 and PAD4; Col-0 has a functional copy of VICTR. Induction of the VICTR gene by DFPM treatment requires functional VICTR (Col). A close homolog to VICTR, named VICTL (At5g46510) lies in tandem with VICTR. The mRNA is cell-to-cell mobile. |
| AT5G46595 | pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10) |
| AT5G46640 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT5G46830 | Calcium-binding transcription factor involved in salt stress signaling. |
| AT5G46890 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT5G46940 | pectin methylesterase inhibitor |
| AT5G46950 | One of of a pair of paralogous invertase with very high similarity.Expressed in female gametophyte and endosperm, particularly mycropylar endosperm. May function during embryogenesis to provide sugars to the developing embryo. |
| AT5G47000 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G47010 | Required for nonsense-mediated mRNA decay. Involved in RNA interference. lba1 mutants has reduced sugar-induced expression of Atb- amylase, is hypersensitive to glucose and abscisic acid and resistant to mannose, and shows early flowering, short day-sensitive growth, and seed germination phenotypes. The mRNA is cell-to-cell mobile. |
| AT5G47050 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT5G47060 | hypothetical protein (DUF581);(source:Araport11) |
| AT5G47080 | Regulatory subunit beta of casein kinase II (CK2). purified CKB1 resulted in up 100-fold stimulation of casein kinase activity compared with the CKA1 activity alone. Forms a tetrameric complex with CKA1 (CKA1(2)CKB1(2)). One known substrate of CK2 is Phytochrome Interacting Factor 1 (PIF1). CK2-mediated phosphorylation enhances the light-induced degradation of PIF1 to promote photomorphogenesis. |
| AT5G47090 | coiled-coil protein;(source:Araport11) |
| AT5G47220 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-2). The protein contains one AP2 domain. Functions as activator of GCC box?dependent transcription. Positive regulator of JA-responsive defense genes and resistance to F. oxysporum and enhances JA inhibition of root elongation. |
| AT5G47230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-5). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. The mRNA is cell-to-cell mobile. |
| AT5G47380 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT5G47455 | hypothetical protein;(source:Araport11) |
| AT5G47530 | Auxin-responsive family protein;(source:Araport11) |
| AT5G47540 | Mo25 family protein;(source:Araport11) |
| AT5G47550 | Putative phytocystatin expressed in seedlings and induced by heat stress and abscisic acid. Overexpression increases germination rate and heat stress tolerance. CYS5 is a target of ABF1 and ABF3 transcriptional regulators which bind to its promoter. |
| AT5G47660 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G47680 | Encodes a protein involved in modification of nucleosides in tRNA. Mutants have 50% less 1-methylguanosine than wt counterparts. |
| AT5G47710 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT5G47780 | Encodes a protein with putative galacturonosyltransferase activity. The mRNA is cell-to-cell mobile. |
| AT5G47800 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT5G47850 | CRINKLY4 related 4;(source:Araport11) |
| AT5G48020 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G48070 | putative xyloglucan endotransglycosylase/hydrolase, expressed primarily in the stele of mature non-elongating regions of both the main and the lateral root. Is expressed in lateral root primordia but expression ceases after lateral root begins to grow. Involved in cell proliferation in incised inflorescence stems. |
| AT5G48130 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT5G48170 | encodes an F-box protein whose protein sequence is similar to SLY1, which belongs to SCF-SLY1 E3 ligase complex. SCF-SLY1 E3 ligase degrades DELLA proteins that are involved in promoting growth. Overexpression of SLY2 can partially compensate sly1-10 mutant phenotype of dwarfism. |
| AT5G48180 | Encodes a nitrile-specifier protein NSP5. NSP5 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. |
| AT5G48270 | DUF868 family protein (DUF868);(source:Araport11) |
| AT5G48375 | Is a myrosinase pseudogene that codes for a truncated and frameshifted protein. Although TGG3 apparently is a pseudogene, its mRNA is expressed specifically in stamen and petal according to RT-PCR analysis. Western analysis shows no band of the size expected for a TGG3 protein. |
| AT5G48500 | pathogenic type III effector avirulence factor Avr AvrRpt-cleavage: cleavage site protein;(source:Araport11) |
| AT5G48510 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT5G48560 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G48657 | defense protein-like protein;(source:Araport11) |
| AT5G48820 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type and CDC2A cyclins and may inhibit cell cycle. Seven KRP genes were found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. |
| AT5G48890 | Encodes a C(2) H(2) -type zinc-finger transcriptional regulator and is expressed in the leaf vasculature and the vegetative shoot apical meristem and controls the transition to flowering. |
| AT5G48905 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT5G48910 | Encodes LPA66, a chloroplast protein of the pentatricopeptide repeat family. In lpa66 mutants, editing of psbF that converts serine to phenylalanine is specifically impaired. lpa66 mutants also display a high chlorophyll fluorescence phenotype. |
| AT5G48930 | At5g48930 has been shown to encode for the hydroxycinnamoyl-Coenzyme A shikimate/quinate hydroxycinnamoyltransferase (HCT) both synthesizing and catabolizing the hydroxycinnamoylesters (coumaroyl/caffeoyl shikimate and quinate) involved in the phenylpropanoid pathway. Influence on the accumulation of flavonoids which in turn inhibit auxin transport and reduce plant growth. The mRNA is cell-to-cell mobile. |
| AT5G49120 | DUF581 family protein, putative (DUF581);(source:Araport11) |
| AT5G49138 | Natural antisense transcript overlaps with AT5G49130;(source:Araport11) |
| AT5G49200 | WD-40 repeat family protein / zfwd4 protein (ZFWD4);(source:Araport11) |
| AT5G49270 | Involved in successfully establishing tip growth in root hairs. |
| AT5G49280 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G49320 | transmembrane protein, putative (DUF1218);(source:Araport11) |
| AT5G49360 | Encodes a bifunctional {beta}-D-xylosidase/{alpha}-L-arabinofuranosidase required for pectic arabinan modification. Located in the extracellular matrix. Gene is expressed specifically in tissues undergoing secondary wall thickening. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
| AT5G49480 | AtCP1 encodes a novel Ca2+-binding protein, which shares sequence similarities with calmodulins. The expression of AtCP1 is induced by NaCl. The mRNA is cell-to-cell mobile. |
| AT5G49490 | AGAMOUS-like 83;(source:Araport11) |
| AT5G49520 | Encodes WRKY48, a member of the WRKY Transcription Factor. WRKY48 is a stress- and pathogen-induced transcriptional activator that represses plant basal defense. The mRNA is cell-to-cell mobile. |
| AT5G49525 | transmembrane protein;(source:Araport11) |
| AT5G49560 | Putative methyltransferase family protein;(source:Araport11) |
| AT5G49570 | Encodes a protein that has peptide:N-glycanase activity in enzymatic assay in heterologous systems (although the activity was not detected in wild-type plants). |
| AT5G49650 | Encodes a cytosolic protein capable of phosphorylating xylulose and deoxy-xylulose. It most likely plays a role in producing precursors for isoprenoid biosynthesis. |
| AT5G49660 | The gene encodes receptorlike kinase (RLK). Involved in the maintenance organization of cell files or cell morphology in conductive elements. Functions as a receptor for CEP1 peptide. Mediates nitrate uptake signaling. |
| AT5G49665 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT5G49680 | Conserved among eukaryotes, similar to Arabidopsis SABRE. The phenotype of the kip/sab double mutant suggests related functions for both genes, however, the KIP protein is mostly required for tip-growth. Predicted to be targeted to the secretory pathway. mRNA was detected in all organs, with most abundance in pollen and roots. |
| AT5G49690 | UDP-glycosyltransferase that can act upon sulcotrione herbicide. Overexpression confers resistance to herbicide. |
| AT5G49700 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
| AT5G49710 | RING finger protein;(source:Araport11) |
| AT5G49760 | Leucine rich receptor kinase. Encodes a receptor of extracellular reactive oxygen species. |
| AT5G49920 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G50070 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G50150 | LOTR1 protein has an unknown function. It contains both DUF4409 and DUF239 domains. Loss of function mutations show defects in formation of the Casparian band- which is correlated with mis localization of CASP1. |
| AT5G50160 | Encodes a ferric chelate reductase that is expressed in shoots and flowers. |
| AT5G50200 | Wound-responsive gene 3 (WR3). Encodes a high-affinity nitrate transporter. Up-regulated by nitrate. Involved in jasmonic acid-independent wound signal transduction. |
| AT5G50300 | Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2). |
| AT5G50360 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G50380 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G50410 | ribonucleoside-diphosphate reductase subunit beta;(source:Araport11) |
| AT5G50450 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
| AT5G50470 | nuclear factor Y, subunit C7;(source:Araport11) |
| AT5G50480 | nuclear factor Y, subunit C6;(source:Araport11) |
| AT5G50720 | Encodes one of five HVA22 homologs in Arabidopsis. HVA22 is an ABA- and stress-inducible gene first isolated from barley. Members of this gene family have only been found in eukaryotes. AtHVA22e mRNA is upregulated to varying degrees in response to cold stress, salt stress, ABA treatment or dehydration. |
| AT5G50830 | nuclear polyadenylated RNA-binding protein;(source:Araport11) |
| AT5G50900 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G50915 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G50920 | Encodes a protein that is similar to ATP-dependent Clp protease ATP-binding subunit / ClpC. Involved in protein import into the chloroplast. May provide ATP source that drives the TIC (Translocon at the Inner envelope membrane of Chloroplasts) translocation machinery. Association of Hsp93 with the inner envelope membrane through its N domain is important for the functions of Hsp93 in vivo. |
| AT5G50960 | Highly similar to Saccharomyces cerevisiae NBP35, locus YGL091C. Cytosolic protein that homodimerizes and can assemble both 4Fe-4S - type and 2Fe-2S - type clusters on its amino terminal and carboxy therminal respectively. Null mutants are embryo lethal. |
| AT5G51020 | Encodes CRL (CRUMPLED LEAF), a protein localized in the outer envelope membrane of plastids. Mutation in this gene affects the pattern of cell division, cell differentiation and plastid division. |
| AT5G51060 | RHD2 (along with RHD3 and RHD4) is required for normal root hair elongation. Has NADPH oxidase activity. Gene is expressed in the elongation and differention zone in trichoblasts and elongating root hairs. RDH2 is localized to the growing tips of root hair cells. It is required for the production of reactive oxygen species in response to extracellular ATP stimulus. The increase in ROS production stimulates Ca2+ influx. |
| AT5G51190 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture and the response to cold stress. |
| AT5G51260 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT5G51290 | Encodes a ceramide kinase that plays a role in modulating cell death. |
| AT5G51380 | RNI-like superfamily protein;(source:Araport11) |
| AT5G51460 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
| AT5G51545 | Encodes LPA2 (low psii accumulation2), an intrinsic thylakoid membrane protein required for efficient assembly of Photosystem II. |
| AT5G51690 | Encodes an aminotransferase with broad specificity for aspartate and aromatic amino aids such as tyrosine and phenylalanine. It does not act on branched chain amino acids and does not have ACC synthase activity. |
| AT5G51710 | member of Putative potassium proton antiporter family |
| AT5G51760 | Encodes AHG1 (ABA-hypersensitive germination 1), a putative protein phosphatase 2C (PP2C). Expressed in seeds. AHG1 functions in seed development and germination. |
| AT5G51770 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G51795 | DNA/RNA-binding protein Kin17, conserved region;(source:Araport11) |
| AT5G51800 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G51900 | Cytochrome P450 family protein;(source:Araport11) |
| AT5G51930 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT5G51950 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT5G52020 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT5G52030 | TraB family protein;(source:Araport11) |
| AT5G52110 | chaperone (DUF2930);(source:Araport11) |
| AT5G52190 | Sugar isomerase (SIS) family protein;(source:Araport11) |
| AT5G52250 | Encodes a transducin protein whose gene expression is induced by UV-B. This induction is reduced in hy5 mutant and may be a target of HY5 during UV-B response. Functions as a repressor of UV-B signaling. |
| AT5G52300 | Encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and desiccation. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. Upregulation by P. polymyxa CR1 increases drought resistance. |
| AT5G52310 | cold regulated gene, the 5' region of cor78 has cis-acting regulatory elements that can impart cold-regulated gene expression The mRNA is cell-to-cell mobile. |
| AT5G52320 | cytochrome P450, family 96, subfamily A, polypeptide 4;(source:Araport11) |
| AT5G52340 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G52410 | oxidoreductase/transition metal ion-binding protein;(source:Araport11) |
| AT5G52420 | transmembrane protein;(source:Araport11) |
| AT5G52510 | SCARECROW-like 8;(source:Araport11) |
| AT5G52520 | Encodes a chloroplast and mitochondria localized prolyl-tRNA synthetase. |
| AT5G52570 | Converts β-carotene to zeaxanthin via cryptoxanthin. |
| AT5G52610 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G52640 | Encodes a cytosolic heat shock protein AtHSP90.1. AtHSP90.1 interacts with disease resistance signaling components SGT1b and RAR1 and is required for RPS2-mediated resistance. The mRNA is cell-to-cell mobile. |
| AT5G52700 | Member of plant specific copper transport protein family. Expressed in response to Al treatment. |
| AT5G52840 | NADH-ubiquinone oxidoreductase-like protein;(source:Araport11) |
| AT5G52880 | F-box family protein;(source:Araport11) |
| AT5G52900 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT5G53000 | PP2A-associated protein with a possible function in the chilling response |
| AT5G53030 | hypothetical protein;(source:Araport11) |
| AT5G53050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G53110 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G53210 | Encodes a basic helix-loop-helix (bHLH) transcription factor that is necessary and sufficient for the asymmetric divisions that establish the stomatal lineage in Arabidopsis thaliana. Expression of SPCH in young epidermal cells allows these cells to make asymmetric divisions. SPCH is a substrate of a kinase MPK3 and MPK6. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT5G53220 | hypothetical protein;(source:Araport11) |
| AT5G53270 | Seed maturation protein;(source:Araport11) |
| AT5G53290 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT5G53310 | myosin heavy chain-like protein;(source:Araport11) |
| AT5G53450 | OBP3-responsive protein 1;(source:Araport11) |
| AT5G53460 | NADH-dependent glutamate synthase The mRNA is cell-to-cell mobile. |
| AT5G53540 | Encodes a P-loop NTPase APP1. The disruption of APP1 is accompanied by a reduction in ROS level, a rise in the rate of cell division in the quiescent center (QC) and the promotion of root distal stem cell (DSC) differentiation. |
| AT5G53560 | Encodes a cytochrome b5 isoform that can be reduced by AtCBR, a cytochrome b5 reductase. |
| AT5G53570 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT5G53590 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G53620 | RNA polymerase II degradation factor;(source:Araport11) |
| AT5G53650 | ABC transporter A family protein;(source:Araport11) |
| AT5G53660 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in shoot and flower. |
| AT5G53770 | Nucleotidyltransferase family protein;(source:Araport11) |
| AT5G53800 | nucleic acid-binding protein;(source:Araport11) |
| AT5G53810 | O-methyltransferase family protein;(source:Araport11) |
| AT5G53820 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT5G53850 | Encodes a trifunctional dehydratase / enolase / phosphatase involved in the methionine salvage. |
| AT5G53890 | Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of phytosulfokine (PSK), which is a 5-aa tyrosine-sulfated peptide that primarily promotes cellular proliferation. |
| AT5G53940 | Yippee family putative zinc-binding protein;(source:Araport11) |
| AT5G53960 | Mid-1-related chloride channel domain-containing protein;(source:Araport11) |
| AT5G53970 | Encodes a cytosolic tyrosine aminotransferase which is strongly induced upon aging and coronatine treatment. AtTAT1 prefers Tyr as an amino donor but can also use Phe, Trp, His, Met, and Leu. The mRNA is cell-to-cell mobile. |
| AT5G54000 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G54060 | Encodes a anthocyanin 3-O-glucoside: 2"-O-xylosyl-transferase involved in anthocyanin modification that converts cyanidin 3-O-glucoside to cyanidin 3-O-xylosyl(1->2)glucoside. Its preferred sugar donor is UDP-xylose. |
| AT5G54080 | Encodes a homogentisate 1,2-dioxygenase that can convert homogentisate to malylacetoacetate and is likely to be involved in tyrosine catabolism. |
| AT5G54100 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT5G54130 | Calcium-binding endonuclease/exonuclease/phosphatase family;(source:Araport11) |
| AT5G54160 | A caffeic acid/5-hydroxyferulic acid O-methyltransferase. Interacts with 14-4-3 proteins in yeast 2 hybrid assay. AtOMT1 (At5g54160) encodes a flavonol 3?-O-methyltransferase that is highly active towards quercetin and myricetin. The substrate specificity identifies the enzyme as flavonol 3?-methyltransferase which replaces the former annotation of the gene to encode a caffeic acid/5-hydroxyferulic acid O-methyltransferase The mRNA is cell-to-cell mobile. |
| AT5G54180 | Encodes a member of the Mitochondrial Transcription Termination Factor Family and is involved in the transcription termination of the chloroplast gene psbJ1. pTAC15 specifically binds to the 3'-terminal region of psbJ. |
| AT5G54190 | light-dependent NADPH:protochlorophyllide oxidoreductase A |
| AT5G54210 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G54240 | membrane lipoprotein lipid attachment site-like protein, putative (DUF1223);(source:Araport11) |
| AT5G54300 | cotton fiber-like protein (DUF761);(source:Araport11) |
| AT5G54365 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT5G54380 | Encodes THESEUS1 (THE1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
| AT5G54390 | Encodes a 3'-phosphoadenosine-5'-phosphate (PAP) phosphatase that is sensitive to physiological concentrations of Na+. It does not also act as inositol polyphosphate 1-phosphatases, which other members of the HAL2-like family do. It is proposed that AHL acts in concert with sulphotransferases to prevent both the toxicity of PAP on RNA processing enzymes as well as the product inhibition of PAP on sulphate conjugation. The mRNA is cell-to-cell mobile. |
| AT5G54400 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G54430 | Contains a universal stress protein domain. Protein is phosphorylated in response to Phytophthora infestans zoospores and xylanase. |
| AT5G54520 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G54660 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT5G54860 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G54865 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT5G55000 | FH protein interacting protein FIP2 |
| AT5G55040 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
| AT5G55050 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. The mRNA is cell-to-cell mobile. |
| AT5G55090 | member of MEKK subfamily |
| AT5G55110 | Stigma-specific Stig1 family protein;(source:Araport11) |
| AT5G55130 | putative molybdopterin synthase sulphurylase (cnx5) |
| AT5G55180 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G55210 | Involved in hygromycin resistance through facilitating hygromycin phosphotransferase transportation from cytosol to chloroplast. |
| AT5G55240 | Catalyze hydroperoxide-dependent mono-oxygenation reactions. Require calcium for peroxygenase activity. Probably deeply buried in lipid droplets or microsomes. |
| AT5G55250 | Encodes an enzyme which specifically converts IAA to its methyl ester form MelIAA. This gene belongs to the family of carboxyl methyltransferases whose members catalyze the transfer of the methyl group from S-adenosyl-L-methionine to carboxylic acid-containing substrates to form small molecule methyl esters. Expression of TCP genes is downregulated in mutant iamt1-D. SABATH methyltransferase. |
| AT5G55310 | Encodes one of two Arabidopsis type-I DNA topoisomerase I genes. Reducing the level of expression of this gene in a top1alpha (At5g55300) mutant background causes seedling lethality. |
| AT5G55370 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT5G55420 | Encodes a Protease inhibitor/seed storage/LTP family protein [pseudogene] |
| AT5G55440 | F-box protein, putative (DUF295);(source:Araport11) |
| AT5G55507 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G55580 | Encodes a mitochondrial transcription termination factor (mTERF) family protein. The gene product is targeted to the chloroplast nucleoid and mutants are affected in plastid gene expression and chloroplast development. Mutants, named as twirt1 (twr-1), display altered root meristem function resulting in short roots. Mutation also affects shoot meristem function. |
| AT5G55700 | In vitro assay indicates no beta-amylase activity of BAM4. However mutation in BAM4 impairs starch breakdown. BAM4 may play a regulatory role. |
| AT5G55730 | Encodes fasciclin-like arabinogalactan-protein 1 (Fla1). fla1 mutants show defects in shoot regeneration. Possibly involved in embryogenesis and seed development. |
| AT5G55800 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G55893 | hypothetical protein;(source:Araport11) |
| AT5G55950 | Nucleotide/sugar transporter family protein;(source:Araport11) |
| AT5G56040 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT5G56160 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT5G56230 | prenylated RAB acceptor 1.G2;(source:Araport11) |
| AT5G56300 | A member of the Arabidopsis SABATH methyltransferase gene family. Encodes GAMT2, a methyltransferase that uses S-adenosine-L-methionine (SAM) as a methyl donor to methylate the carboxyl group of GAs, resulting in the methyl esters of GAs (MeGAs). Expressed most highly in the siliques during seed development. |
| AT5G56310 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G56320 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT5G56360 | Encodes PSL4, beta-subunit of endoplasmic reticulum-resident glucosidase II, which is essential for stable accumulation and quality control of the elf18 receptor EFR but not the flg22 receptor FLS2. The mRNA is cell-to-cell mobile. |
| AT5G56490 | D-arabinono-1,4-lactone oxidase family protein;(source:Araport11) |
| AT5G56620 | NAC domain containing protein 99;(source:Araport11) |
| AT5G56750 | AGB1/AGG dimmer interacting protein, response to water deficit. |
| AT5G56800 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
| AT5G56840 | myb-like transcription factor family protein;(source:Araport11) |
| AT5G56870 | beta-galactosidase 4;(source:Araport11) |
| AT5G56960 | basic helix-loop-helix (bHLH) DNA-binding family protein;(source:Araport11) |
| AT5G57080 | transmembrane protein;(source:Araport11) |
| AT5G57120 | nucleolar/coiled-body phosphoprotein;(source:Araport11) |
| AT5G57140 | purple acid phosphatase 28;(source:Araport11) |
| AT5G57150 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G57170 | Chemokine-like MDL protein; modulates flowering time and innate immunity. |
| AT5G57190 | Encodes the minor form of the two non-mitochondrail phosphatidylserine decarboxylase. The gene expression level is very low. Located at the tonoplast. |
| AT5G57220 | member of CYP81F, involved in glucosinolate metabolism. Mutants had impaired resistance to fungi. The mRNA is cell-to-cell mobile. |
| AT5G57260 | putative cytochrome P450 |
| AT5G57345 | OXR is a single copy gene in Arabidopsis. It is localized to the ER. It is expressed throughout the plant and expression is induced in response to abiotic stress. While the function of OXR is unknown, overexpression results in increased abiotic stress tolerance and increased ascorbic acid content. |
| AT5G57370 | U4/U6.U5 small nuclear ribonucleoprotein;(source:Araport11) |
| AT5G57580 | Calmodulin-binding protein;(source:Araport11) |
| AT5G57590 | Encodes a bifunctional enzyme with both dethiobiotin synthetase and diaminopelargonic acid aminotransferase activities that is involved in biotin synthesis. |
| AT5G57610 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
| AT5G57660 | CONSTANS-like 5;(source:Araport11) |
| AT5G57690 | Involved in nitric oxide-dependent pollen tube guidance and fertilization. |
| AT5G57700 | BNR/Asp-box repeat family protein;(source:Araport11) |
| AT5G57710 | SMAX1 (SUPPRESSOR OF MAX2 1) is a member of an eight-gene family in Arabidopsis that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. SMAX1 is an important component of KAR/SL signaling during seed germination and seedling growth, but is not necessary for all MAX2-dependent responses. The mRNA is cell-to-cell mobile. |
| AT5G57720 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G57810 | Member of TETRASPANIN family |
| AT5G57870 | Encodes a putative eukaryotic translation initiation factor The mRNA is cell-to-cell mobile. |
| AT5G57900 | F-box protein, interacts with SKP1/ASK1 subunit of SCF ubiquitin ligase in a glucose-dependent manner |
| AT5G58000 | Reticulon family protein;(source:Araport11) |
| AT5G58050 | Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family. |
| AT5G58080 | member of Response Regulator: B- Type |
| AT5G58250 | Involved in tetrapyrrole biosynthesis. May function as a scaffold protein to stabilize CHL27. |
| AT5G58270 | Encodes a mitochondrial half-molecule ABC transporter, a member of ATM subfamily. Mutants are dwarfed, chlorotic plants with altered leaf morphology. ATM3 transcription is induced by Cd(II) or Pb(II). Involved in heavy metal resistance. Arabidopsis thaliana has three ATM genes, namely ATM1, ATM2 and ATM3. Only ATM3 has an important function for plant growth. Role in Moco biosynthesis. |
| AT5G58440 | sorting nexin 2A;(source:Araport11) |
| AT5G58460 | member of Putative Na+/H+ antiporter family |
| AT5G58470 | TBP-associated factor 15B;(source:Araport11) |
| AT5G58510 | Rab3 GTPase-activating protein catalytic protein;(source:Araport11) |
| AT5G58520 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G58575 | Component of the deubiquitination module of the SAGA complex. |
| AT5G58580 | Encodes a functional E3 ligase that is involved in membrane trafficking and regulation of salt stress responses. It is localized to membranes including the plasma membrane, pre-vacuolar compartments and Golgi. |
| AT5G58600 | Belongs to a large family of plant-specific genes of unknown function. Involved in resistance to the powdery mildew species Erysiphe cichoracearum and Erysiphe orontii, but not to the unrelated pathogens Pseudomonas syringae or Peronospora parasitica. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G58660 | Encodes a class III gibberellin 2-oxidase that oxidizes GA12 to GA110 and GA9 to GA40. |
| AT5G58720 | smr (Small MutS Related) domain-containing protein;(source:Araport11) |
| AT5G58782 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
| AT5G58860 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly only in root tissue. |
| AT5G58900 | R-R-type MYB protein |
| AT5G58910 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G58930 | hypothetical protein (DUF740);(source:Araport11) |
| AT5G58960 | Mutant plants display impaired light-regulation of the hypocotyl randomization response. |
| AT5G58980 | Neutral/alkaline non-lysosomal ceramidase;(source:Araport11) |
| AT5G59000 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT5G59020 | hepatocyte growth factor activator, putative (DUF3527);(source:Araport11) |
| AT5G59030 | encodes a putative copper transport protein that contains copper-binding motif and functionally complements in copper-transport defective yeast strains |
| AT5G59040 | encodes a member of copper transporter family and functionally complements a high affinity copper transporter mutant in yeast |
| AT5G59055 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT5G59060 | reverse transcriptase family protein;(source:Araport11) |
| AT5G59120 | SBT4.13 subtilase. Activity is inhibited by SPI-1. |
| AT5G59130 | Subtilase family protein;(source:Araport11) |
| AT5G59190 | subtilase family protein;(source:Araport11) |
| AT5G59220 | Encodes a member of the PP2C family (Clade A protein phosphatases type 2C). Functions as a negative regulator of osmotic stress and ABA signaling. |
| AT5G59270 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G59430 | Encodes a telomeric repeat binding protein with a DNA binding domain at its C terminus. The DNA binding domain has a preference for GGTTTAG sequences and at least five of these repeats are required for recognition by a nearly full-length TRP1 protein. |
| AT5G59500 | protein C-terminal S-isoprenylcysteine carboxyl O-methyltransferase;(source:Araport11) |
| AT5G59530 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G59550 | Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants. |
| AT5G59570 | Encodes BOA (BROTHER OF LUX ARRHYTHMO), a component of the circadian clock. The mRNA is cell-to-cell mobile. |
| AT5G59590 | UDP-glucosyl transferase 76E2;(source:Araport11) |
| AT5G59650 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G59660 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G59720 | encodes a low molecular weight heat shock protein that contains the heat shock element in the promoter region. Expression is induced in response to heat shock. |
| AT5G59800 | Encodes a protein containing a methyl-CpG-binding domain that acts as an anti-silencing factor that prevent gene repression and DNA hypermethylation by tethering other anti-silencing factors to methylated DNA, which enables the function of DNA demethylases that in turn limit DNA methylation and prevent transcriptional gene silencing. |
| AT5G59945 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT5G59970 | Histone superfamily protein;(source:Araport11) |
| AT5G59990 | CCT motif family protein;(source:Araport11) |
| AT5G60000 | transmembrane protein;(source:Araport11) |
| AT5G60010 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
| AT5G60030 | hypothetical protein;(source:Araport11) |
| AT5G60050 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT5G60060 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT5G60110 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G60270 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G60430 | antiporter/ drug transporter;(source:Araport11) |
| AT5G60480 | homeobox protein 26;(source:Araport11) |
| AT5G60490 | Encodes a member of fasciclin-like arabinogalactan proteins (FLAs) containing a cell adhesion fasciclin (FAS) domain. Mutations result in altered stem biomechanics with reduced tensile strength and reduced tensile modulus of elasticity, as well as altered cell wall architecture and composition, with increased cellulose microfibril angle, reduced arabinose, galactose and cellulose content. Possibly involved in embryogenesis and seed development. |
| AT5G60520 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
| AT5G60580 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G60590 | DHBP synthase RibB-like alpha/beta domain-containing protein;(source:Araport11) |
| AT5G60630 | transmembrane protein;(source:Araport11) |
| AT5G60660 | A member of the plasma membrane intrinsic protein subfamily PIP2.When expressed in yeast cells can conduct hydrogen peroxide into those cells. Mutants exhibit longer root hairs. |
| AT5G60670 | Ribosomal protein L11 family protein;(source:Araport11) |
| AT5G60680 | transcription initiation factor TFIID subunit (Protein of unknown function, DUF584);(source:Araport11) |
| AT5G60710 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT5G60720 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT5G60770 | member of High affinity nitrate transporter family |
| AT5G60780 | member of High affinity nitrate transporter family |
| AT5G60850 | Encodes a zinc finger protein. |
| AT5G60870 | Encodes a mitochondrial protein RUG3 that is required for accumulation of mitochondrial respiratory chain complex I. RUG3 is related to human REGULATOR OF CHROMOSOME CONDENSATION 1 (RCC1) and Arabidopsis UV-B RESISTANCE 8 (UVR8). |
| AT5G60880 | Encodes BASL (BREAKING OF ASYMMETRY IN THE STOMATAL LINEAGE), a regulator of asymmetric divisions. In asymmetrically dividing stomatal-lineage cells, BASL accumulates in a polarized crescent at the cell periphery before division, and then localizes differentially to the nucleus and a peripheral crescent in self-renewing cells and their sisters after division. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT5G60920 | Encodes a glycosylphosphatidylinositol-anchored protein localized primarily in the plasma membrane of the longitudinal sides of root cells. Necessary for oriented cell expansion in Arabidopsis. Cob mutants have abnormal roots that expand radially rather than longitudinally under certain growth conditions. |
| AT5G60930 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G60950 | COBRA-like protein 5 precursor;(source:Araport11) |
| AT5G60960 | Encodes PNM1 (for PPR protein localized to the nucleus and mitochondria 1), a PPR protein that is dual localized to mitochondria and nuclei. Loss of PNM1 function in mitochondria, but not in nuclei, is lethal for the embryo. In mitochondria, it is associated with polysomes and may play a role in translation. |
| AT5G60970 | TCP gene involved in heterochronic control of leaf differentiation. Transcription factor which controls thermomorphogenesis by positively regulating PIF4 activity. |
| AT5G61100 | PHD finger-containing protein. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
| AT5G61290 | Flavin-binding monooxygenase family protein;(source:Araport11) |
| AT5G61340 | transmembrane protein;(source:Araport11) |
| AT5G61350 | Encodes a membrane-localized receptor-like kinase that regulates root hair tip growth by maintaining cytoplasmic Ca2+ gradients. Knockouts of CAP1 produced more cytoplasmic NH4+ and ceased growth of root hairs on MS medium except when NH4+ was depleted; NH4+ depletion reestablished the Ca2+ gradient necessary for normal growth. The lower net NH4+ influx across the vacuolar membrane and relatively alkaline cytosolic pH of root hairs in cap1-1 relative to wild type implied that mutation of CAP1 results in more NH4+ accumulation in the cytoplasm. Furthermore, CAP1 functionally complemented npr1 kinase yeast mutant defective in high-affinity NH4+ uptake via MEP2, distinguishing CAP1 as a cytosolic modulator of NH4+ level that participates in NH4+ homeostasis-regulated root hair growth by modulating tip-focused cytoplasmic Ca2+ gradients. |
| AT5G61360 | hypothetical protein;(source:Araport11) |
| AT5G61370 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G61380 | Pseudo response regulator involved in the generation of circadian rhythms. TOC1 appears to shorten the period of circumnutation speed. TOC1 contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. PRR3 may increase the stability of TOC1 by preventing interactions between TOC1 and the F-box protein ZTL. Expression of TOC1 is correlated with rhythmic changes in chromatin organization. The mRNA is cell-to-cell mobile. |
| AT5G61480 | Encodes PXY, a receptor-like kinase essential for maintaining polarity during plant vascular-tissue development. |
| AT5G61520 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G61540 | N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein;(source:Araport11) |
| AT5G61560 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G61600 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture. |
| AT5G61620 | myb-like transcription factor family protein;(source:Araport11) |
| AT5G61700 | ABC2 homolog 16;(source:Araport11) |
| AT5G61750 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT5G61760 | Encodes an inositol polyphosphate 3-/6-/5-kinase that is localized to the nucleus. Able to complement a mutation in a yeast transcriptional regulator gene (ARG82/IPK2). Acts redundantly with ATIPK2alpha during pollen development, pollen tube guidance and embryogenesis. |
| AT5G61850 | Encodes transcriptional regulator that promotes the transition to flowering.Involved in floral meristem development. LFY is involved in the regulation of AP3 expression, and appears to bring the F-box protein UFO to the AP3 promoter. Amino acids 46-120 define a protein domain that mediates self-interaction. |
| AT5G61930 | ACCUMULATION OF PHOTOSYSTEM ONE 3 |
| AT5G61960 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML1 is a member of two sister clades of mei2-like gene family, AML1 through AML5 and belongs to the clade named ALM14. AML1 is expressed during early embryo development, particularly along embryonic axis at torpedo stage, in shoot apex (weaker expression) and in the organogenic regions of floral apices. |
| AT5G61970 | signal recognition particle-related / SRP-like protein;(source:Araport11) |
| AT5G61990 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G62020 | member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. |
| AT5G62040 | BFT is a member of The FLOWERING LOCUS T (FT)/TERMINAL FLOWER 1 (TFL1) gene family that encodes regulators involved in control of flower development. |
| AT5G62070 | Member of IQ67 (CaM binding) domain containing family. |
| AT5G62150 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
| AT5G62170 | LOW protein: M-phase inducer phosphatase-like protein;(source:Araport11) |
| AT5G62180 | Carboxyesterase that binds stringolactones. |
| AT5G62220 | Encodes a Golgi apparatus-localized galactosyltransferase involved in galactosyl-substitution of xyloglucan at position 2. |
| AT5G62320 | Encodes a putative transcription factor (MYB99). |
| AT5G62460 | RZFP is a zinc finger protein involved in mediating abiotic stress tolerance. |
| AT5G62580 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G62620 | Encodes a Golgi-localized hydroxyproline-O-galactosyltransferase. Mutants display multiple phenotypes including reduced seed coat mucilage and accelerated leaf senescence. |
| AT5G62627 | Encodes a defensin-like (DEFL) family protein. |
| AT5G62650 | Tic22-like family protein;(source:Araport11) |
| AT5G62670 | H[+]-ATPase 11;(source:Araport11) |
| AT5G62680 | Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds. |
| AT5G62720 | Integral membrane HPP family protein. Putative nitrate transporter. |
| AT5G62730 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G62770 | membrane-associated kinase regulator, putative (DUF1645);(source:Araport11) |
| AT5G63080 | Encodes a HR demethylase that acts as a positive regulator of seed germination in the PHYB-PIL5-SOM pathway. |
| AT5G63110 | RPD3-like histone deacetylase. HDA6 mutations specifically increase the expression of auxin-responsive transgenes, suggesting a role in transgene silencing. |
| AT5G63130 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G63140 | purple acid phosphatase 29;(source:Araport11) |
| AT5G63160 | BTB and TAZ domain protein. Short-lived nuclear-cytoplasmic protein targeted for degradation by the 26S proteosome pathway. Acts redundantly with BT2 and BT3 during female gametophyte development. |
| AT5G63180 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G63350 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G63370 | CDKG1 interacts with the splicing factor RSZ33 to regulate proper splicing of Cals5 Pre-mRNA. |
| AT5G63390 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G63450 | AtWRKY33 regulates root apoplastic barrier formation by controlling AtCYP94B1 leading to increased salt tolerance of Arabidopsis plants. Regulation by WRKY33 to control apoplastic barrier formation in roots to confer salt tolerance. |
| AT5G63530 | Farnesylated protein that binds metals. |
| AT5G63580 | encodes a protein whose sequence is similar to flavonol synthase |
| AT5G63600 | encodes a protein whose sequence is similar to flavonol synthase |
| AT5G63630 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G63700 | zinc ion binding / DNA binding protein;(source:Araport11) |
| AT5G63800 | Involved in mucilage formation. Mutants form columella and outer cell wall architecture of the mucilage cells resembles wild-type. However, mum2 seeds completely lack seed coat mucilage. This mutation appears to represent a later step in the development of this cell-type. Encodes a beta-galactosidase involved in seed coat mucilage biosynthesis. Member of Glycoside Hydrolase Family 35 |
| AT5G63930 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G63960 | Encodes the catalytic subunits of DNA polymerase δ, which is involved in the deposition of epigenetic marks. |
| AT5G64050 | Glutamate-tRNA ligase. Targeted to mitochondria and chloroplast. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana. |
| AT5G64090 | hyccin;(source:Araport11) |
| AT5G64140 | Encodes a putative ribosomal protein S28. |
| AT5G64230 | 1,8-cineole synthase;(source:Araport11) |
| AT5G64250 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT5G64260 | EXORDIUM like 2;(source:Araport11) |
| AT5G64280 | dicarboxylate transporter 2.2;(source:Araport11) |
| AT5G64310 | Encodes arabinogalactan-protein (AGP1). The mRNA is cell-to-cell mobile. |
| AT5G64320 | MTL1 is a mitochondria localized PRR protein involved in mitochondrial protein translation and group II intron splicing. |
| AT5G64330 | Involved in blue light response signaling pathway; interacts with the blue light photoreceptor NPH1. Null mutations abolish phototrophic responses of etiolated seedlings to low fluence blue light. Protein contains multiple protein-protein interaction domains. |
| AT5G64360 | EIP9 interacts with EMF1 to regulate flowering. It functions partially redundantly with SDJ2 and SDJ3 and interacts with SUVH1 and SUVH3 to form a SUVH-SDJ complex. The complex binds promoters with DNA methylation and mediates transcriptional activation of promoter methylated genes. |
| AT5G64430 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G64470 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G64480 | hypothetical protein;(source:Araport11) |
| AT5G64510 | Encodes Tunicamycin Induced 1(TIN1), a plant-speci c ER stress-inducible protein. TIN1 mutation affects pollen surface morphology. Transcriptionally induced by treatment with the N-linked glyclsylation inhibitor tunicamycin. |
| AT5G64520 | Encodes a protein of the XRCC2 family involved in DNA repair. atxrcc2-1 Mutants are sensitive to MitomycinC but do not show fertility defects. |
| AT5G64572 | Natural antisense transcript overlaps with AT5G64570;(source:Araport11) |
| AT5G64660 | CYS, MET, PRO, and GLY protein 2;(source:Araport11) |
| AT5G64680 | mediator-associated protein;(source:Araport11) |
| AT5G64690 | neurofilament triplet H protein-like protein;(source:Araport11) |
| AT5G64750 | Encodes a putative transcription factor containing an AP2 domain. Is a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. Expressed in response to ABA, osmotic stress, sugar stress and drought. Mutants are hypersensitive to these stresses. May be involved in regulation of ABA mediated stress response. The mRNA is cell-to-cell mobile. |
| AT5G64790 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G64920 | Encodes a RING-H2 protein that interacts with the RING finger domain of COP1. CIP8 exhibits a strong interaction with the E2 ubiquitin conjugating enzyme AtUBC8 through its N-terminal domain and promotes ubiquitination in an E2-dependent fashion in vitro. It is possible that the AtUBC8-CIP8 module might interact with COP1 in vivo, thereby participating in proteasome-mediated degradation of HY5. |
| AT5G65100 | Ethylene insensitive 3 family protein;(source:Araport11) |
| AT5G65110 | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. |
| AT5G65130 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT5G65140 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G65158 | Lipase/lipooxygenase, PLAT/LH2 family protein;(source:Araport11) |
| AT5G65160 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G65207 | hypothetical protein;(source:Araport11) |
| AT5G65250 | transmembrane protein;(source:Araport11) |
| AT5G65270 | RAB GTPase homolog A4A;(source:Araport11) |
| AT5G65305 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT5G65310 | Encodes a class I HDZip (homeodomain-leucine zipper) protein that is a positive regulator of ABA-responsiveness, mediating the inhibitory effect of ABA on growth during seedling establishment. |
| AT5G65370 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT5G65380 | MATE efflux family protein;(source:Araport11) |
| AT5G65430 | member of 14-3-3 proteins. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 |
| AT5G65445 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
| AT5G65470 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G65520 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G65560 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G65570 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G65590 | Encodes a plant-specific Dof-type transcription factor expressed in maturing guard cells, but not in guard mother cells. It regulates essential processes of stomatal guard cell maturation and functions as a key transcription factor regulating the final stages of guard cell differentiation. |
| AT5G65640 | bHLH093/NFL encodes a bHLH transcription factor involved in GA mediated control of flowering time. Mutants are non-flowering in short days and phenotype can be reversed with GA application. Based on the expression of GA biosynthetic genes in the mutant, it likely acts through regulation of GA metabolism. Its expression shows developmental stage and tissue specificity. In short days it is expressed mainly in root tips and SAM, with weak expression in cotyledons throughout development. In LD GUS activity was observed in the hypocotyl and in root tips and SAM throughout the developmental stages. |
| AT5G65650 | sugar transporter, putative (DUF1195);(source:Araport11) |
| AT5G65660 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G65670 | auxin (indole-3-acetic acid) induced gene The mRNA is cell-to-cell mobile. |
| AT5G65683 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT5G65690 | Encodes a putative phosphoenolpyruvate carboxykinase (ATP-dependent). The mRNA is cell-to-cell mobile. |
| AT5G65700 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM2,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM1 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. The mRNA is cell-to-cell mobile. |
| AT5G65710 | Encodes a protein controlling the separation step of floral organ abscission.Necessary for pathogen-triggered leaf abscission. |
| AT5G65720 | Encodes a cysteine desulfurase whose activity is dependent on AtSufE activation. It requires pyridoxal phosphate (PLP) for proper folding. Its catalytic efficiency is increase three-fold in the presence of AtFH (frataxin). |
| AT5G65830 | receptor like protein 57;(source:Araport11) |
| AT5G65860 | ankyrin repeat family protein;(source:Araport11) |
| AT5G65925 | hypothetical protein;(source:Araport11) |
| AT5G66005 | Expressed protein;(source:Araport11) |
| AT5G66020 | Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. non-consensus AT donor splice site at exon 7, TA donor splice site at exon 10, AT acceptor splice at exon 13. |
| AT5G66030 | Involved in golgi protein trafficking. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner. Localized to the golgi apparatus, tyrosine 717 in AtGRIP is crucial for Golgi localization. |
| AT5G66070 | E3 ubiquitin ligase that functions in negative regulation of ABA signaling. |
| AT5G66110 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G66120 | 3-dehydroquinate synthase;(source:Araport11) |
| AT5G66180 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G66190 | Encodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the thylakoid. The affinity of this enzyme for ferredoxin is slightly, but significantly, higher than AtLFNR2, an isoform of the same enzyme. AtLFNR1 forms a heterodimer with AtFNR2 and is also a prerequisite to attach AtFNR2 to the thylakoid membrane. |
| AT5G66200 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT5G66280 | GDP-D-mannose 4,6-dehydratase |
| AT5G66440 | tRNA-methyltransferase non-catalytic subunit trm6MTase subunit;(source:Araport11) |
| AT5G66470 | GTP-binding protein Era-like protein;(source:Araport11) |
| AT5G66558 | Natural antisense transcript overlaps with AT5G66560;(source:Araport11) |
| AT5G66570 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO1 is the major isoform in the wild-type. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the membrane. The mRNA is cell-to-cell mobile. |
| AT5G66580 | PADRE protein. |
| AT5G66590 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT5G66680 | Encodes a protein ortholog of human SOT48 or yeast WBP1, an essential protein subunit of the oligosaccharyltransferase (OST) complex, which is responsible for the transfer in the ER of the N-linked glycan precursor onto Asn residues of candidate proteins. |
| AT5G66690 | UGT72E2 is an UDPG:coniferyl alcohol glucosyltransferase which glucosylates sinapyl- and coniferyl aldehydes as well as sinapyl- and coniferyl alcohol. The enzyme is thought to be involved in lignin metabolism. A knockdown mutant line (72E2KD) was obtained using RNAi silencing. A twofold reduction in coniferyl alcohol 4-O-glucoside and sinapyl alcohol 4-O-glucoside was detected in this line compared to wildtype. In comparison, both knockout and knockdown lines of UGT72E1 and UGT72E3, respectively, failed to display the same reduction in phenylpropanoid 4-O-glucosides. The mRNA is cell-to-cell mobile. |
| AT5G66720 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G66730 | C2H2-like zinc finger protein;(source:Araport11) |
| AT5G66770 | GRAS family transcription factor;(source:Araport11) |
| AT5G66790 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G66810 | Ran-binding protein in the microtubule-organising centre protein;(source:Araport11) |
| AT5G66820 | transmembrane protein;(source:Araport11) |
| AT5G66860 | Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain-containing protein;(source:Araport11) |
| AT5G66900 | RPW8 -CNL gene is required for signal transduction of TNLs; functionally redundant to NRG1.2. Exhibits autoimmunity. |
| AT5G66940 | Encodes a nuclear localized DOF-domain binding transcription factor. |
| AT5G66950 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT5G67060 | Encodes a bHLH transcription factor that is involved in transmitting tract and stigma development and acts as a local modulator of auxin and cytokinin responses to control gynoecium development. HEC1 affects auxin transport by acting as a transcriptional regulator of PIN1 and PIN3. Inhibits thermomorphogenesis. |
| AT5G67080 | member of MEKK subfamily |
| AT5G67110 | encodes a myc/bHLH transcription factor-like protein. Gene product is involved in fruit dehiscence. Mutant siliques fail to dehisce. |
| AT5G67170 | SEC-C motif-containing protein / OTU-like cysteine protease family protein;(source:Araport11) |
| AT5G67190 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT5G67200 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G67280 | receptor-like kinase;(source:Araport11) |
| AT5G67290 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT5G67300 | Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. The mRNA is cell-to-cell mobile. |
| AT5G67310 | member of CYP81G |
| AT5G67350 | hypothetical protein;(source:Araport11) |
| AT5G67411 | GRAS family transcription factor;(source:Araport11) |
| AT5G67420 | Encodes a LOB-domain protein involved in nitrogen metabolism and affecting leaf morphogenesis. |
| AT5G67430 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT5G67455 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT5G67460 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G67540 | Arabinanase/levansucrase/invertase;(source:Araport11) |
| AT5G67570 | Encodes a pentratricopeptide repeat containing protein that is targeted to the chloroplast. Mutants have pale young leave and reduced accumulation of plastid encoded transcripts suggesting a role for DG1 in regulation of plastid gene expression. |
| AT5G67590 | Mutant leaves have a reduced capacity for cold acclimation, appear water-soaked, leak electrolytes, and accumulate reactive oxygen species constitutively. Encode a protein with high similarity to the 18-kD Fe-S subunit of complex I (NADH dehydrogenase, EC 1.6.5.3) in the mitochondrial electron transfer chain. The mRNA is cell-to-cell mobile. |