37 senescence-associated transcription factors (Sen-TFs) ChIP-seq or DAP-seq data
| ABI5 Targets | Description |
| AT3G53400 | peptide upstream protein;(source:Araport11) |
| AT5G16810 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G15180 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G11960 | magnesium transporter, putative (DUF803);(source:Araport11) |
| AT1G47405 | transposable_element_gene;(source:Araport11);pseudogene, similar to SAE1-S9-protein, similar to putative non-LTR retroelement reverse transcriptase GB:AAC63678 (Arabidopsis thaliana) from (;(source:TAIR10) |
| AT1G18940 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
| AT5G55950 | Nucleotide/sugar transporter family protein;(source:Araport11) |
| AT2G42140 | VQ motif-containing protein;(source:Araport11) |
| AT1G11230 | transmembrane protein, putative (DUF761);(source:Araport11) |
| AT4G06650 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 9.1e-125 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10) |
| AT3G55840 | Hs1pro-1 protein;(source:Araport11) |
| AT1G75770 | hypothetical protein;(source:Araport11) |
| AT1G62422 | hypothetical protein;(source:Araport11) |
| AT1G34630 | transmembrane protein;(source:Araport11) |
| AT3G49950 | GRAS family transcription factor;(source:Araport11) |
| AT3G13910 | hypothetical protein (DUF3511);(source:Araport11) |
| AT5G66120 | 3-dehydroquinate synthase;(source:Araport11) |
| AT1G55820 | lysine-specific demethylase, putative (DUF1296);(source:Araport11) |
| AT4G32105 | Beta-1,3-N-Acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G27090 | glycine-rich protein;(source:Araport11) |
| AT5G63941 | Pseudogene of AT5G09270 |
| AT4G09060 | hypothetical protein;(source:Araport11) |
| AT4G00300 | AT4G00300 has been split into two loci based on new cDNA evidence provided by Aleksander Riise Hansen of University of Copenhagen: AT4G00300.2 becomes AT4G00300.1; a new locus AT4G00295 is created. See comments field for AT4G00295 annotation. |
| AT1G51400 | Photosystem II 5 kD protein;(source:Araport11) |
| AT2G13115 | pseudogene of bZIP family transcription factor |
| AT3G25950 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT1G21940 | transmembrane protein;(source:Araport11) |
| AT1G09980 | Putative serine esterase family protein;(source:Araport11) |
| AT1G80540 | envelope glycoprotein B;(source:Araport11) |
| AT4G31960 | hypothetical protein;(source:Araport11) |
| AT1G03520 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G15175 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
| AT3G17070 | Peroxidase family protein;(source:Araport11) |
| AT3G61930 | hypothetical protein;(source:Araport11) |
| AT5G13140 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT3G49790 | Carbohydrate-binding protein;(source:Araport11) |
| AT1G73920 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G70780 | hypothetical protein;(source:Araport11) |
| AT3G32465 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 0.00075 P-value blast match to GB:AAA29366 ORF1 (LINE-element) (Anopheles gambiae);(source:TAIR10) |
| AT4G21020 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT5G38670 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G11325 | Phospholipid/glycerol acyltransferase family protein;(source:Araport11) |
| AT4G21260 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT1G56100 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G40230 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT2G03700 | pre-tRNA tRNA-Thr (anticodon: CGT);(source:Araport11, TAIR10) |
| AT3G22100 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G27980 | trichohyalin-like protein (DUF3444);(source:Araport11) |
| AT3G46385 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G05870 | hypothetical protein (DUF1685);(source:Araport11) |
| AT1G68470 | Exostosin family protein;(source:Araport11) |
| AT4G16470 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G78990 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G10730 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G15910 | hypothetical protein;(source:Araport11) |
| AT1G41790 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 0.00017 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT1G73120 | F-box/RNI superfamily protein;(source:Araport11) |
| AT4G36610 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G43480 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G55365 | hypothetical protein;(source:Araport11) |
| AT3G50380 | vacuolar protein sorting-associated protein, putative (DUF1162);(source:Araport11) |
| AT2G30230 | 6,7-dimethyl-8-ribityllumazine synthase;(source:Araport11) |
| AT4G35150 | O-methyltransferase family protein;(source:Araport11) |
| AT2G36320 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT2G14510 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G77855 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT2G27229 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G46308 | transmembrane protein;(source:Araport11) |
| AT3G27270 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT1G67785 | hypothetical protein;(source:Araport11) |
| AT5G20600 | ribosomal RNA processing-like protein;(source:Araport11) |
| AT1G11480 | eukaryotic translation initiation factor-like protein;(source:Araport11) |
| AT2G19320 | hypothetical protein;(source:Araport11) |
| AT5G64180 | tropomyosin;(source:Araport11) |
| AT4G35690 | hypothetical protein (DUF241);(source:Araport11) |
| AT1G74929 | hypothetical protein;(source:Araport11) |
| AT3G54680 | proteophosphoglycan-like protein;(source:Araport11) |
| AT4G10730 | Protein kinase superfamily protein |
| AT5G21100 | Plant L-ascorbate oxidase;(source:Araport11) |
| AT3G43830 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.0e-15 P-value blast match to GB:226407 retrotransposon del1-46 (Gypsy_Ty3-element) (Lilium henryi);(source:TAIR10) |
| AT3G54800 | Pleckstrin homology (PH) and lipid-binding START domains-containing protein;(source:Araport11) |
| AT2G27420 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G52130 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT5G12270 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G11405 | hypothetical protein;(source:Araport11) |
| AT2G14080 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G27657 | hypothetical protein;(source:Araport11) |
| AT4G12680 | transmembrane protein;(source:Araport11) |
| AT3G58910 | F-box family protein;(source:Araport11) |
| AT5G37710 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G56570 | SET domain-containing protein;(source:Araport11) |
| AT3G16850 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G38670 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT4G03010 | RNI-like superfamily protein;(source:Araport11) |
| AT1G71110 | transmembrane protein;(source:Araport11) |
| AT5G11070 | hypothetical protein;(source:Araport11) |
| AT4G32090 | Beta-1,3-N-Acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G44060 | embryo sac development arrest protein;(source:Araport11) |
| AT2G07711 | pseudogene of NADH dehydrogenase 5B;(source:Araport11) |
| AT5G23890 | GPI-anchored adhesin-like protein;(source:Araport11) |
| AT3G52230 | hypothetical protein;(source:Araport11) |
| AT5G63700 | zinc ion binding / DNA binding protein;(source:Araport11) |
| AT2G18360 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G53270 | Seed maturation protein;(source:Araport11) |
| AT3G03790 | ankyrin repeat family protein / regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT2G28810 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
| AT1G05170 | Galactosyltransferase family protein;(source:Araport11) |
| AT2G07000 | hypothetical protein;(source:Araport11) |
| AT1G03730 | pyrroline-5-carboxylate reductase;(source:Araport11) |
| AT5G40590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G04590 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 5.3e-36 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
| AT1G63770 | Peptidase M1 family protein;(source:Araport11) |
| AT3G26782 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G42570 | B-cell receptor-associated 31-like protein;(source:Araport11) |
| AT5G47530 | Auxin-responsive family protein;(source:Araport11) |
| AT3G18362 | None;(source:Araport11) |
| AT5G61190 | putative endonuclease or glycosyl hydrolase with C2H2-type zinc finger domain-containing protein;(source:Araport11) |
| AT5G35860 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G38037.1);(source:TAIR10) |
| AT1G08040 | trimethylguanosine synthase (DUF707);(source:Araport11) |
| AT5G50140 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G28730 | nuclease;(source:Araport11) |
| AT1G75530 | Forkhead-associated (FHA) domain-containing protein;(source:Araport11) |
| AT1G78910 | Pseudouridine synthase family protein;(source:Araport11) |
| AT3G06780 | glycine-rich protein;(source:Araport11) |
| AT2G28200 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT4G08895 | inorganic phosphate transporter family protein;(source:Araport11) |
| AT2G13460 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.0e-35 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G42434 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 8.5e-111 P-value blast match to gb|AAL06419.1|AF378075_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10) |
| AT5G55560 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G10670 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G28240.1);(source:TAIR10) |
| AT3G54130 | Josephin family protein;(source:Araport11) |
| AT2G20670 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
| AT4G03200 | catalytics;(source:Araport11) |
| AT5G03980 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT1G54095 | DUF1677 family protein, putative (DUF1677);(source:Araport11) |
| AT1G78450 | SOUL heme-binding family protein;(source:Araport11) |
| AT2G40745 | hypothetical protein;(source:Araport11) |
| AT5G35460 | membrane protein;(source:Araport11) |
| AT4G03823 | pseudogene of expressed protein;(source:Araport11) |
| AT4G23420 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G24970 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G58630 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT2G26380 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G55550 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G12600 | UDP-N-acetylglucosamine (UAA) transporter family;(source:Araport11) |
| AT1G07210 | Ribosomal protein S18;(source:Araport11) |
| AT5G16210 | HEAT repeat-containing protein;(source:Araport11) |
| AT1G10350 | DNAJ heat shock family protein;(source:Araport11) |
| AT3G29175 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.8e-22 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT2G07230 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 8.1e-59 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G22788 | other_RNA;(source:Araport11) |
| AT4G11845 | Interleukin-1 receptor-associated kinase 4 protein;(source:Araport11) |
| AT3G03150 | hypothetical protein;(source:Araport11) |
| AT1G78150 | N-lysine methyltransferase;(source:Araport11) |
| AT5G24155 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT3G24490 | Alcohol dehydrogenase transcription factor Myb/SANT-like family protein;(source:Araport11) |
| AT3G53040 | late embryogenesis abundant protein, putative / LEA protein;(source:Araport11) |
| AT3G25640 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT4G26810 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
| AT2G17960 | hypothetical protein;(source:Araport11) |
| AT1G67340 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
| AT1G27620 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G26840 | transmembrane protein;(source:Araport11) |
| AT5G15560 | hypothetical protein;(source:Araport11) |
| AT1G61065 | 1,3-beta-glucan synthase component (DUF1218);(source:Araport11) |
| AT5G08680 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. The mRNA is cell-to-cell mobile. |
| AT1G04985 | triacylglycerol lipase-like protein;(source:Araport11) |
| AT3G22250 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G19000 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G33905 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
| AT4G18690 | delay of germination protein;(source:Araport11) |
| AT4G38950 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT1G27000 | GRIP/coiled-coil protein, putative (DUF1664);(source:Araport11) |
| AT2G15320 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G50030 | ARM-repeat/Tetratricopeptide repeat (TPR)-like protein;(source:Araport11) |
| AT5G37550 | hypothetical protein;(source:Araport11) |
| AT5G31821 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 6.2e-86 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G43320 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G37050.1);(source:TAIR10) |
| AT5G28926 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 2.3e-152 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10) |
| AT5G64970 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT5G37210 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G21030 | BREVIS RADIX-like protein;(source:Araport11) |
| AT3G61826 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G33131 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32610.1);(source:TAIR10) |
| AT1G19680 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G49820 | hypothetical protein;(source:Araport11) |
| AT1G27860 | hypothetical protein (DUF626);(source:Araport11) |
| AT1G23830 | transmembrane protein;(source:Araport11) |
| AT5G35450 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT3G62820 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G25240 | sulfate/thiosulfate import ATP-binding protein, putative (DUF506);(source:Araport11) |
| AT1G69480 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT2G41840 | Ribosomal protein S5 family protein;(source:Araport11) |
| AT5G16110 | hypothetical protein;(source:Araport11) |
| AT1G48095 | nucleic acid-binding/zinc ion-binding protein;(source:Araport11) |
| AT2G36430 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G12210 | DNA binding protein;(source:Araport11) |
| AT4G00695 | Spc97/Spc98 family of spindle pole body (SBP) component;(source:Araport11) |
| AT3G14160 | 2-oxoglutarate-dependent dioxygenase family protein;(source:Araport11) |
| AT4G10955 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G31460 | transposable_element_gene;(source:Araport11);retroelement pol polyprotein -related;(source:TAIR10) |
| AT1G60380 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT4G09360 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT3G55640 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT4G19550 | zinc ion binding / transcription regulator;(source:Araport11) |
| AT1G34230 | transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBb0041J06.18, blastp match of 33%25 identity and 2.8e-10 P-value to GP|27818010|dbj|BAC55773.1||AP005176 OSJNBb0041J06.18 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT5G16990 | molecular function has not been defined, was shown involved in oxidative stress tolerance. The mRNA is cell-to-cell mobile. |
| AT4G34480 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT3G07150 | amino acid-ligase;(source:Araport11) |
| AT3G33205 | pseudogene of hypothetical protein (Protein of unknown function;(source:Araport11) |
| AT3G15530 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G42430 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G37045.1);(source:TAIR10) |
| AT2G44430 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT3G33154 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.5e-36 P-value blast match to GB:CAB39733 rotease, reverse transcriptase, ribonuclease H, integrase (Gypsy_Ty3-element) (Drosophila buzzatii);(source:TAIR10) |
| AT1G64050 | hypothetical protein;(source:Araport11) |
| AT5G11090 | serine-rich protein-like protein;(source:Araport11) |
| AT1G12990 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G50040 | formin-like protein, putative (DUF1005);(source:Araport11) |
| AT3G18170 | Glycosyltransferase family 61 protein;(source:Araport11) |
| AT5G05220 | hypothetical protein;(source:Araport11) |
| AT4G19190 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
| AT1G75710 | C2H2-like zinc finger protein;(source:Araport11) |
| AT4G29780 | Expression of the gene is affected by multiple stresses. Knockout and overexpression lines show no obvious phenotypes. |
| AT2G14840 | pseudogene of phosphoenolpyruvate carboxykinase 1;(source:Araport11) |
| AT2G17300 | hypothetical protein;(source:Araport11) |
| AT1G02070 | zinc ion-binding protein;(source:Araport11) |
| AT5G16030 | mental retardation GTPase activating protein;(source:Araport11) |
| AT3G27210 | hypothetical protein;(source:Araport11) |
| AT2G41710 | Integrase-type DNA-binding superfamily protein;(source:Araport11) |
| AT1G52855 | hypothetical protein;(source:Araport11) |
| AT3G63340 | kinase superfamily protein;(source:Araport11) |
| AT1G45170 | outer envelope pore 24B-like protein;(source:Araport11) |
| AT5G20190 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G24480 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G13410 | pseudogene of myosin heavy chain-like protein;(source:Araport11) |
| AT2G37650 | GRAS family transcription factor;(source:Araport11) |
| AT1G27330 | Ribosome associated membrane protein RAMP4;(source:Araport11) |
| AT1G50880 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G09480 | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase The mRNA is cell-to-cell mobile. |
| AT1G18130 | Class II aaRS and biotin synthetases superfamily protein;(source:Araport11) |
| AT3G10580 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT2G05290 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G41570.1);(source:TAIR10) |
| AT5G67430 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT2G19130 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G43580 | Sphingomyelin synthetase family protein;(source:Araport11) |
| AT5G54530 | serine protease, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT5G56310 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G14940 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.1e-37 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G09760 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G12940 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G67140 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G15165 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT1G42655 | transposable_element_gene;(source:Araport11);pseudogene, similar to Putative retroelement, blastp match of 45%25 identity and 3.2e-41 P-value to GP|21671994|gb|AAM74356.1|AC115686_23|AC115686 Putative retroelement {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT5G64980 | transcription factor;(source:Araport11) |
| AT3G01513 | hypothetical protein;(source:Araport11) |
| AT2G21960 | transmembrane protein;(source:Araport11) |
| AT2G02400 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G09520 | hypothetical protein;(source:Araport11) |
| AT5G59070 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G64020 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT1G07820 | Histone superfamily protein;(source:Araport11) |
| AT4G17560 | Ribosomal protein L19 family protein;(source:Araport11) |
| AT3G60040 | F-box family protein;(source:Araport11) |
| AT4G01730 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT4G04175 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, blastp match of 28%25 identity and 7.7e-08 P-value to GP|14018103|gb|AAK52166.1|AC084831_20|AC084831 putative reverse transcriptase {Oryza sativa};(source:TAIR10) |
| AT5G33624 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.9e-181 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT5G05965 | cell wall RBR3-like protein;(source:Araport11) |
| AT5G35760 | Beta-galactosidase related protein;(source:Araport11) |
| AT5G45660 | adenine phosphoribosyltransferase;(source:Araport11) |
| AT4G30470 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G49930 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT1G25300 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT3G20898 | hypothetical protein;(source:Araport11) |
| AT4G09647 | Encodes a defensin-like (DEFL) family protein. |
| AT5G25490 | Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11) |
| AT4G37705 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.5e-203 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT3G51230 | chalcone-flavanone isomerase family protein;(source:Araport11) |
| AT5G34868 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.1e-131 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G15200 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G44770 | transmembrane protein, putative (DUF626);(source:Araport11) |
| AT3G33555 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to hypothetical protein GB:AAD26889 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G14878 | other_RNA;(source:Araport11) |
| AT5G17670 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G25720 | hypothetical protein;(source:Araport11) |
| AT2G46550 | transmembrane protein;(source:Araport11) |
| AT5G58090 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT1G69030 | BSD domain-containing protein;(source:Araport11) |
| AT1G35360 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.5e-38 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT3G52610 | GATA zinc finger protein;(source:Araport11) |
| AT2G34450 | HMG-box (high mobility group) DNA-binding family protein;(source:Araport11) |
| AT1G41760 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 7.1e-11 P-value blast match to GB:226407 retrotransposon del1-46 (Gypsy_Ty3-element) (Lilium henryi);(source:TAIR10) |
| AT2G40008 | Natural antisense transcript overlaps with AT2G40010;(source:Araport11) |
| AT1G73390 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT2G38990 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to MURA transposase of maize Mutator transposon;(source:TAIR10) |
| AT2G03937 | Encodes a defensin-like (DEFL) family protein. |
| AT5G17350 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT1G34100 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
| AT1G20270 | 2-oxoglutarate-dependent dioxygenase |
| AT1G52615 | other_RNA;(source:Araport11) |
| AT4G35720 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT3G30703 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.1e-20 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT5G45730 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G19970 | GRAS family transcription factor family protein;(source:Araport11) |
| AT1G23070 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
| AT1G27671 | pseudogene of DRM2/DMT7 (domain rearranged methyltransferase protein) |
| AT3G30742 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative non-LTR retroelement reverse transcriptase, similar to GB:S65812 from (Arabidopsis thaliana);(source:TAIR10) |
| AT2G22590 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G50220 | F-box family protein;(source:Araport11) |
| AT4G21903 | MATE efflux family protein;(source:Araport11) |
| AT2G15017 | Pseudogene of AT4G00416; MBD3 (methyl-CpG-binding domain 3); DNA binding |
| AT3G16415 | pseudogene of myrosinase-binding protein 2;(source:Araport11) |
| AT1G62370 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G05140 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT1G52000 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G09260 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT4G16190 | Papain family cysteine protease;(source:Araport11) |
| AT4G02110 | transcription coactivator;(source:Araport11) |
| AT2G31790 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G78070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G34985 | pre-tRNA tRNA-Thr (anticodon: CGT);(source:Araport11, TAIR10) |
| AT5G59760 | hypothetical protein (DUF1635);(source:Araport11) |
| AT1G04320 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT5G43100 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G06660 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.8e-275 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G01550 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.9e-48 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
| AT4G36600 | Late embryogenesis abundant (LEA) protein;(source:Araport11) |
| AT1G22160 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT5G66770 | GRAS family transcription factor;(source:Araport11) |
| AT1G04140 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT5G25240 | stress induced protein;(source:Araport11) |
| AT5G66810 | Ran-binding protein in the microtubule-organising centre protein;(source:Araport11) |
| AT3G28280 | F-box/associated interaction domain protein;(source:Araport11) |
| AT4G23030 | MATE efflux family protein;(source:Araport11) |
| AT1G27100 | Actin cross-linking protein;(source:Araport11) |
| AT5G65100 | Ethylene insensitive 3 family protein;(source:Araport11) |
| AT5G22580 | Stress responsive A/B Barrel Domain-containing protein;(source:Araport11) |
| AT5G66480 | bacteriophage N4 adsorption B protein;(source:Araport11) |
| AT2G20724 | Annotated as pseudogene of unknown protein.Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 . |
| AT2G28980 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.3e-43 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G50130 | pseudogene of ATP binding/leucine-tRNA ligases/aminoacyl-tRNA ligase;(source:Araport11) |
| AT3G01850 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT3G18060 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT1G47460 | pseudogene of S-locus related protein SLR1;(source:Araport11) |
| AT4G01865 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT1G02670 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G52430 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G18407 | Encodes a defensin-like (DEFL) family protein. |
| AT5G47660 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G50290 | wall-associated receptor kinase galacturonan-binding protein;(source:Araport11) |
| AT3G14595 | Ribosomal protein L18ae family;(source:Araport11) |
| AT2G43590 | Chitinase family protein;(source:Araport11) |
| AT3G18350 | Plant protein of unknown function (DUF639);(source:TAIR10) |
| AT4G17690 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G49560 | Putative methyltransferase family protein;(source:Araport11) |
| AT1G32120 | serine/threonine-protein phosphatase 7 long form-like protein;(source:Araport11) |
| AT4G16550 | HSP20-like chaperone, expression is induced by stress. |
| AT5G39560 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G07460 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42430.1);(source:TAIR10) |
| AT5G40855 | hypothetical protein;(source:Araport11) |
| AT1G44608 | hypothetical protein;(source:Araport11) |
| AT2G28080 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G63130 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G55180 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT1G67856 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G26600 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT1G48200 | hypothetical protein;(source:Araport11) |
| AT4G25620 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G26120 | Ankyrin repeat family protein / BTB/POZ domain-containing protein;(source:Araport11) |
| AT1G73850 | DNA ligase (DUF1666);(source:Araport11) |
| AT2G47150 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G42792 | transposable_element_gene;(source:Araport11);Mutator-related transposase, temporary automated functional assignment;(source:TAIR10) |
| AT4G11175 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT4G38401 | hypothetical protein;(source:Araport11) |
| AT2G21860 | violaxanthin de-epoxidase-like protein;(source:Araport11) |
| AT5G57070 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT2G41810 | imidazolonepropionase (Protein of unknown function, DUF642);(source:Araport11) |
| AT4G15270 | glucosyltransferase-like protein;(source:Araport11) |
| AT2G15110 | hypothetical protein (Protein of unknown function, DUF601);(source:Araport11) |
| AT1G08340 | Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11) |
| AT4G14310 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G51390 | hypothetical protein;(source:Araport11) |
| AT3G31370 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G31915.1);(source:TAIR10) |
| AT5G31787 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32312.1);(source:TAIR10) |
| AT2G22890 | Kua-ubiquitin conjugating enzyme hybrid localization domain-containing protein;(source:Araport11) |
| AT5G49710 | RING finger protein;(source:Araport11) |
| AT2G06180 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G51900 | Cytochrome P450 family protein;(source:Araport11) |
| AT5G13090 | hypothetical protein;(source:Araport11) |
| AT1G36185 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G06868 | vitellogenin-like protein;(source:Araport11) |
| AT3G53830 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT1G07795 | forkhead box protein G1;(source:Araport11) |
| AT2G44500 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G49320 | transmembrane protein, putative (DUF1218);(source:Araport11) |
| AT3G50690 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G64385 | transmembrane protein;(source:Araport11) |
| AT2G19220 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
| AT4G09830 | nuclear receptor family 2 group C protein;(source:Araport11) |
| AT5G20700 | senescence-associated family protein, putative (DUF581);(source:Araport11) |
| AT5G07675 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT1G75740 | pre-tRNA tRNA-Thr (anticodon: CGT);(source:Araport11, TAIR10) |
| AT2G05690 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.9e-45 P-value blast match to O22273 /233-373 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT2G37880 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT1G13605 | Encodes a defensin-like (DEFL) family protein. |
| AT2G15555 | other_RNA;(source:Araport11) |
| AT2G22080 | transmembrane protein;(source:Araport11) |
| AT3G50625 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.1e-96 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT1G34580 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G46554 | other_RNA;(source:Araport11) |
| AT1G12850 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT2G20690 | A synthetic gene encoding the catalytic domain of the Arabidopsis thaliana gene At2g20690 was recombinant expressed in E. coli demonstrating the molecular function of riboflavin synthase. The mRNA is cell-to-cell mobile. |
| AT5G67455 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT2G47250 | RNA helicase family protein;(source:Araport11) |
| AT5G51930 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT5G18310 | ubiquitin hydrolase;(source:Araport11) |
| AT3G02340 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G29860 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G14247 | Expressed protein;(source:Araport11) |
| AT4G30150 | Urb2/Npa2 family protein;(source:Araport11) |
| AT3G48830 | tRNA nucleotidyltransferase/polyA polymerase family protein;(source:Araport11) |
| AT3G17130 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G29870 | tRNA synthetase class II (G, H, P and S) family protein;(source:Araport11) |
| AT2G24550 | major centromere autoantigen B-like protein;(source:Araport11) |
| AT3G02590 | Fatty acid hydroxylase superfamily protein;(source:Araport11) |
| AT5G53140 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G47050 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT1G02460 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G26290 | hypothetical protein;(source:Araport11) |
| AT3G29720 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G51470 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G04040 | transmembrane protein;(source:Araport11) |
| AT3G05980 | hypothetical protein;(source:Araport11) |
| AT1G34340 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G03160 | B-cell receptor-associated-like protein;(source:Araport11) |
| AT3G61290 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT1G33590 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT2G05430 | Ubiquitin-specific protease family C19-related protein;(source:Araport11) |
| AT3G48980 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT1G07870 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G15800 | transposable_element_gene;(source:Araport11) |
| AT3G11690 | hypothetical protein;(source:Araport11) |
| AT5G37250 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G04000 | hypothetical protein;(source:Araport11) |
| AT3G03400 | EF hand calcium-binding protein family;(source:Araport11) |
| AT5G16410 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT2G17940 | WEB family protein (DUF827);(source:Araport11) |
| AT5G60630 | transmembrane protein;(source:Araport11) |
| AT4G35070 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT1G33420 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT3G09930 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G51670 | hypothetical protein (DUF668);(source:Araport11) |
| AT1G18310 | glycosyl hydrolase family 81 protein;(source:Araport11) |
| AT4G06570 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 4.3e-26 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G46940 | fold protein;(source:Araport11) |
| AT5G25280 | serine-rich protein-like protein;(source:Araport11) |
| AT4G09890 | mediator of RNA polymerase II transcription subunit, putative (DUF3511);(source:Araport11) |
| AT5G07030 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G02813 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
| AT1G71695 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G22400 | Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11) |
| AT3G49890 | hypothetical protein;(source:Araport11) |
| AT2G37435 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT1G18773 | acyl thioesterase-like protein;(source:Araport11) |
| AT5G61530 | small G protein family protein / RhoGAP family protein;(source:Araport11) |
| AT1G47970 | nucleolin;(source:Araport11) |
| AT2G04680 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G38149 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-51 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G01060 | lysine-tRNA ligase;(source:Araport11) |
| AT3G23080 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT4G19140 | exopolysaccharide production negative regulator;(source:Araport11) |
| AT5G02090 | hypothetical protein;(source:Araport11) |
| AT4G35850 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G63290 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT5G59330 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT5G35530 | Ribosomal protein S3 family protein;(source:Araport11) |
| AT5G45790 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT2G22335 | pseudogene of cytochrome P450 family protein |
| AT1G52211 | Pseudogene of AT2G02180; TOM3 (tobamovirus multiplication protein 3) |
| AT3G29820 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, blastp match of 23%25 identity and 1.1e-09 P-value to GP|13786450|gb|AAK39575.1|AC025296_10|AC025296 putative reverse transcriptase {Oryza sativa};(source:TAIR10) |
| AT5G56530 | tRNA-splicing ligase (DUF239);(source:Araport11) |
| AT4G14620 | hypothetical protein (DUF506);(source:Araport11) |
| AT2G05790 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT1G49570 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G20300 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
| AT3G22510 | Pre-rRNA-processing protein TSR2, conserved region;(source:Araport11) |
| AT4G18820 | AAA-type ATPase family protein;(source:Araport11) |
| AT4G20700 | RNA-binding;(source:Araport11) |
| AT4G29950 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT1G22403 | other_RNA;(source:Araport11) |
| AT2G21300 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT4G40011 | hypothetical protein;(source:Araport11) |
| AT5G08570 | Pyruvate kinase family protein;(source:Araport11) |
| AT3G42542 | Encodes a defensin-like (DEFL) family protein. |
| AT4G03150 | plant/protein;(source:Araport11) |
| AT4G34930 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT1G55700 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G71710 | DNAse I-like superfamily protein;(source:Araport11) |
| AT1G31270 | hypothetical protein;(source:Araport11) |
| AT1G36880 | pseudogene of FAR1-related sequence 5;(source:Araport11) |
| AT1G37080 | transposable_element_gene;(source:Araport11);similar to DNA binding [Arabidopsis thaliana] (TAIR:AT4G01980.1);(source:TAIR10) |
| AT1G70640 | octicosapeptide/Phox/Bem1p (PB1) domain-containing protein;(source:Araport11) |
| AT5G56190 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G51980 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G16670 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-190 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
| AT4G18660 | delay of germination protein;(source:Araport11) |
| AT3G48950 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G44510 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT3G48510 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G23250 | Succinyl-CoA ligase, alpha subunit;(source:Araport11) |
| AT3G42798 | transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBb0043H09.1, similar to En/Spm-like transposon protein;(source:TAIR10) |
| AT5G23330 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
| AT2G01410 | NHL domain-containing protein;(source:Araport11) |
| AT5G66590 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT3G62990 | myelin transcription factor-like protein;(source:Araport11) |
| AT2G46290 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G62480 | Vacuolar calcium-binding protein-like protein;(source:Araport11) |
| AT1G53400 | Ubiquitin domain-containing protein;(source:Araport11) |
| AT1G73885 | AT-rich interactive domain protein;(source:Araport11) |
| AT4G29103 | transmembrane protein;(source:Araport11) |
| AT2G24545 | Natural antisense transcript overlaps with AT2G24540;(source:Araport11) |
| AT1G37050 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G43320.1);(source:TAIR10) |
| AT1G80610 | hypothetical protein;(source:Araport11) |
| AT5G06990 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT4G25870 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT3G04650 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT4G37220 | Cold acclimation protein WCOR413 family;(source:Araport11) |
| AT2G27590 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G50732 | transmembrane protein;(source:Araport11) |
| AT1G47300 | F-box family protein;(source:Araport11) |
| AT1G47655 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
| AT2G01580 | transmembrane protein;(source:Araport11) |
| AT4G15955 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G53550 | FBD-like domain family protein;(source:Araport11) |
| AT3G29220 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30843.1);(source:TAIR10) |
| AT3G47170 | Encodes enzymes that can efficiently convert putrescine and caffeoyl-CoA to di-caffeoyl putrescine. Has a preference for caffeoyl CoA and putrescine. |
| AT2G07806 | hypothetical protein;(source:Araport11) |
| AT5G42440 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G52410 | oxidoreductase/transition metal ion-binding protein;(source:Araport11) |
| AT4G06565 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G75800 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT5G24060 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G27910 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G05071 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G07950 | DNA-directed RNA polymerase, subunit M, archaeal;(source:Araport11) |
| AT3G11402 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G11840 | YCF36, putative (DUF1230);(source:Araport11) |
| AT2G07716 | pseudogene of Sec-independent periplasmic protein translocase;(source:Araport11) |
| AT2G47540 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT2G14430 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.5e-45 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT4G32020 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT1G07850 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT5G12930 | inactive rhomboid protein;(source:Araport11) |
| AT5G23850 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT2G43795 | corepressor;(source:Araport11) |
| AT2G43890 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G39720 | VQ motif-containing protein;(source:Araport11) |
| AT1G16850 | transmembrane protein;(source:Araport11) |
| AT4G16790 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G40470 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.9e-102 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT1G31150 | K-box region protein (DUF1985);(source:Araport11) |
| AT4G32080 | hypothetical protein;(source:Araport11) |
| AT5G26010 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G24880 | chromo domain cec-like protein;(source:Araport11) |
| AT5G08139 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G25460 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G01671 | transmembrane protein;(source:Araport11) |
| AT1G33610 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G32925 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.0e-105 P-value blast match to GB:AAA66266 unknown protein ORF1 transposable element En-1 (CACTA-element) (Zea mays);(source:TAIR10) |
| AT3G24780 | Uncharacterized conserved protein UCP015417, vWA;(source:Araport11) |
| AT2G23755 | transmembrane family 220 helix protein;(source:Araport11) |
| AT3G25160 | ER lumen protein retaining receptor family protein;(source:Araport11) |
| AT4G28260 | acyl-UDP-N-acetylglucosamine O-acyltransferase;(source:Araport11) |
| AT2G44660 | ALG6, ALG8 glycosyltransferase family;(source:Araport11) |
| AT2G22805 | Encodes a defensin-like (DEFL) family protein. |
| AT5G36293 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.2e-12 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
| AT5G59480 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G40470 | RNI-like superfamily protein;(source:Araport11) |
| AT4G24100 | Protein kinase superfamily protein |
| AT5G49950 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G40350 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT5G50460 | secE/sec61-gamma protein transport protein;(source:Araport11) |
| AT3G63020 | hypothetical protein (DUF3049);(source:Araport11) |
| AT2G39270 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G63520 | F-box/LRR protein;(source:Araport11) |
| AT2G40995 | Encodes a defensin-like (DEFL) family protein. |
| AT5G17040 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G33310 | hypothetical protein;(source:Araport11) |
| AT4G04392 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.7e-51 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G52960 | tRNA dimethylallyltransferase;(source:Araport11) |
| AT1G80555 | Isocitrate/isopropylmalate dehydrogenase family protein;(source:Araport11) |
| AT1G02810 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT3G27970 | Exonuclease family protein;(source:Araport11) |
| AT5G65170 | VQ motif-containing protein;(source:Araport11) |
| AT5G28463 | transmembrane protein;(source:Araport11) |
| AT1G25530 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT1G65820 | microsomal glutathione s-transferase;(source:Araport11) |
| AT1G22600 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT3G49796 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G01740 | Unknown gene, induced by abiotic stress treatments. |
| AT2G18540 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT5G10190 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G22792 | pseudogene of F-box family protein |
| AT4G10507 | other_RNA;(source:Araport11) |
| AT5G67020 | hypothetical protein;(source:Araport11) |
| AT5G13100 | Gap junction beta-4 protein;(source:Araport11) |
| AT4G21926 | hypothetical protein;(source:Araport11) |
| AT3G05675 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT1G70590 | F-box family protein;(source:Araport11) |
| AT5G01200 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT1G41750 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G32903.1);(source:TAIR10) |
| AT5G05250 | hypothetical protein;(source:Araport11) |
| AT3G11420 | beta-1,3-N-acetylglucosaminyltransferase lunatic protein, putative (DUF604);(source:Araport11) |
| AT3G51360 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G76720 | eukaryotic translation initiation factor 2 (eIF-2) family protein;(source:Araport11) |
| AT2G23060 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT3G25400 | dCTP pyrophosphatase-like protein;(source:Araport11) |
| AT3G59850 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G30150 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G63040 | a pseudogene member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The translated product contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT5G24690 | plant/protein, putative (DUF3411);(source:Araport11) |
| AT5G47020 | MraZ;(source:Araport11) |
| AT2G36970 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G47470 | ECA1 gametogenesis family protein (DUF784);(source:Araport11) |
| AT4G23510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G49350 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT1G12500 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT5G01210 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT2G28140 | enabled-like protein (DUF1635);(source:Araport11) |
| AT4G28405 | Expressed protein;(source:Araport11) |
| AT5G27800 | Class II aminoacyl-tRNA and biotin synthetases superfamily protein;(source:Araport11) |
| AT1G42480 | TLR4 regulator/MIR-interacting MSAP protein;(source:Araport11) |
| AT1G48720 | Copia-like polyprotein/retrotransposon;(source:Araport11) |
| AT4G21437 | unknown pseudogene |
| AT4G31310 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT5G07640 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G18090 | hypothetical protein;(source:Araport11) |
| AT5G17960 | Encodes a member of a Cys-rich protein family known as C1-clan proteins, that contains C1_2, C1_3 and ZZ/PHD type C1 domains. Its expression is responsive to phytohormones and is affected by biotic (chitin) and different abiotic (salinity, drought, cold and UV) treatments. |
| AT2G21390 | Coatomer subunit alpha-2. Part of endomembrane trafficking system. Interacts with SINAT1. |
| AT5G43150 | elongation factor;(source:Araport11) |
| AT5G59210 | myosin heavy chain-like protein;(source:Araport11) |
| AT2G36090 | F-box family protein;(source:Araport11) |
| AT1G28395 | hypothetical protein;(source:Araport11) |
| AT3G30235 | General transcription factor 2-related zinc finger protein;(source:Araport11) |
| AT5G51490 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G06908 | hypothetical protein;(source:Araport11) |
| AT2G21720 | ArgH (DUF639);(source:Araport11) |
| AT5G57700 | BNR/Asp-box repeat family protein;(source:Araport11) |
| AT1G47317 | Encodes a defensin-like (DEFL) family protein. |
| AT2G40095 | Alpha/beta hydrolase related protein;(source:Araport11) |
| AT5G18450 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT5G01420 | Glutaredoxin family protein;(source:Araport11) |
| AT4G10510 | Subtilase family protein;(source:Araport11) |
| AT1G36035 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to gb|AAO73523.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT2G45610 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G17890 | hypothetical protein;(source:Araport11) |
| AT4G09630 | transmembrane protein (DUF616);(source:Araport11) |
| AT5G36937 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.2e-09 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G23440 | Peptidase C15, pyroglutamyl peptidase I-like protein;(source:Araport11) |
| AT1G61260 | cotton fiber (DUF761);(source:Araport11) |
| AT5G48270 | DUF868 family protein (DUF868);(source:Araport11) |
| AT2G48090 | hypothetical protein;(source:Araport11) |
| AT1G77810 | Galactosyltransferase family protein;(source:Araport11) |
| AT4G08240 | histone-lysine N-methyltransferase;(source:Araport11) |
| AT5G51800 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G18860 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT1G11070 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G11300 | ROH1, putative (DUF793);(source:Araport11) |
| AT2G24440 | selenium binding protein;(source:Araport11) |
| AT3G60540 | Preprotein translocase Sec, Sec61-beta subunit protein;(source:Araport11) |
| AT1G28640 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G02580 | argininosuccinate lyase;(source:Araport11) |
| AT1G43502 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.1e-158 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT5G66660 | pectinesterase, putative (DUF677);(source:Araport11) |
| AT1G24095 | Putative thiol-disulfide oxidoreductase DCC;(source:Araport11) |
| AT2G43960 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT5G59990 | CCT motif family protein;(source:Araport11) |
| AT2G05133 | Pseudogene of AT2G37680 |
| AT2G26520 | transmembrane protein;(source:Araport11) |
| AT1G28135 | hypothetical protein;(source:Araport11) |
| AT5G41060 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT4G04692 | pseudogene of expressed protein;(source:Araport11) |
| AT2G39320 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G76290 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT3G43690 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family protein, has a 1.4e-29 P-value blast match to gb|AAG52950.1| putative envelope protein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT5G36210 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G37700 | hypothetical protein;(source:Araport11) |
| AT5G24370 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G43270 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G05160 | CCCH-type zinc fingerfamily protein with RNA-binding domain-containing protein;(source:Araport11) |
| AT2G43220 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G20760 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G13463 | hypothetical protein;(source:Araport11) |
| AT4G13710 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G57230 | Thioredoxin superfamily protein;(source:Araport11) |
| AT5G45200 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G04632 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G63930 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G15002 | Natural antisense transcript overlaps with AT1G15000;(source:Araport11) |
| AT2G15695 | peptide methionine sulfoxide reductase (Protein of unknown function DUF829, transmembrane 53);(source:Araport11) |
| AT3G18310 | TATA box-binding protein associated factor RNA polymerase I subunit C;(source:Araport11) |
| AT5G32002 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.5e-200 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT1G72820 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT1G52347 | None;(source:Araport11) |
| AT5G01260 | Carbohydrate-binding-like fold;(source:Araport11) |
| AT1G71015 | PADRE protein. |
| AT1G42520 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 5.3e-69 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G20680 | plant/protein (DUF1995);(source:Araport11) |
| AT5G48500 | pathogenic type III effector avirulence factor Avr AvrRpt-cleavage: cleavage site protein;(source:Araport11) |
| AT4G37022 | hypothetical protein;(source:Araport11) |
| AT4G36700 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT5G42110 | hypothetical protein;(source:Araport11) |
| AT4G38932 | Natural antisense transcript overlaps with AT4G38930;(source:Araport11) |
| AT1G03440 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT2G01275 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT2G19930 | RNA-dependent RNA polymerase family protein;(source:Araport11) |
| AT2G40600 | appr-1-p processing enzyme family protein;(source:Araport11) |
| AT3G03440 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G11145 | hypothetical protein (DUF674);(source:Araport11) |
| AT3G60200 | hypothetical protein;(source:Araport11) |
| AT2G21237 | transmembrane protein;(source:Araport11) |
| AT3G47610 | transcription regulator/ zinc ion binding protein;(source:Araport11) |
| AT3G48660 | transmembrane protein, putative (DUF 3339);(source:Araport11) |
| AT5G30584 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-15 P-value blast match to GB:CAA28054 ORF (Ty1_Copia-element) (Drosophila melanogaster);(source:TAIR10) |
| AT2G05680 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G10220 | ZCF37;(source:Araport11) |
| AT4G27852 | Natural antisense transcript overlaps with AT4G27850 and AT4G27860;(source:Araport11) |
| AT4G07742 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.2e-55 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
| AT1G18900 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G01480 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G34920 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT4G26880 | Stigma-specific Stig1 family protein;(source:Araport11) |
| AT5G11940 | Subtilase family protein;(source:Araport11) |
| AT5G46260 | disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G24130 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G37660 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G01570 | Oleosin family protein;(source:Araport11) |
| AT5G27238 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT1G21590 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT4G20730 | transposable_element_gene;(source:Araport11);similar to ASY2, DNA binding [Arabidopsis thaliana] (TAIR:AT4G32200.1);(source:TAIR10) |
| AT4G20250 | hypothetical protein;(source:Araport11) |
| AT3G43540 | initiation factor 4F subunit (DUF1350);(source:Araport11) |
| AT1G61795 | PAK-box/P21-Rho-binding family protein;(source:Araport11) |
| AT3G08780 | BRISC complex subunit Abro1-like protein;(source:Araport11) |
| AT1G71480 | Nuclear transport factor 2 (NTF2) family protein;(source:Araport11) |
| AT3G21600 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
| AT4G18580 | hypothetical protein;(source:Araport11) |
| AT1G27470 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT5G34839 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-09 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G25770 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT2G45720 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G43000 | hypothetical protein;(source:Araport11) |
| AT4G18940 | RNA ligase/cyclic nucleotide phosphodiesterase family protein;(source:Araport11) |
| AT5G24220 | Lipase class 3-related protein;(source:Araport11) |
| AT5G04000 | hypothetical protein;(source:Araport11) |
| AT5G45690 | histone acetyltransferase (DUF1264);(source:Araport11) |
| AT5G44310 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT2G24625 | Encodes a defensin-like (DEFL) family protein. |
| AT5G02970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G37420 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT1G43570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G52065.1);(source:TAIR10) |
| AT2G15630 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G64380 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT3G04140 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G18350 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G27030 | hypothetical protein;(source:Araport11) |
| AT1G24530 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G48210 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G64780 | holocarboxylase synthetase;(source:Araport11) |
| AT1G52320 | kinesin-like protein;(source:Araport11) |
| AT1G11010 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT4G03600 | pyrroline-5-carboxylate reductase;(source:Araport11) |
| AT4G02320 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT3G49070 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT5G10740 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G44230 | transmembrane protein;(source:Araport11) |
| AT1G68440 | Transmembrane protein;(source:Araport11). Expression induced by abiotic stressors such as ABA, drought, heat, light, NaCl, osmotic stress and wounding. |
| AT5G15500 | Ankyrin repeat family protein;(source:Araport11) |
| AT2G43340 | hypothetical protein (DUF1685);(source:Araport11) |
| AT4G11380 | Adaptin family protein;(source:Araport11) |
| AT3G16117 | hypothetical protein;(source:Araport11) |
| AT5G43770 | proline-rich family protein;(source:Araport11) |
| AT1G64710 | GroES-like zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
| AT3G06433 | pseudogene of nodulin MtN3 family protein |
| AT4G08873 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.4e-21 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G20890 | caveolin-1 protein;(source:Araport11) |
| AT2G46995 | hypothetical protein;(source:Araport11) |
| AT3G05110 | early endosome antigen-like protein, putative (DUF3444);(source:Araport11) |
| AT1G49952 | None;(source:Araport11) |
| AT3G59120 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G23340 | carboxyl-terminal proteinase, putative (DUF239);(source:Araport11) |
| AT1G18120 | pseudogene of GDSL-like lipase/acylhydrolase superfamily protein;(source:Araport11) |
| AT1G11930 | Putative pyridoxal phosphate-dependent enzyme, YBL036C type;(source:Araport11) |
| AT1G75163 | snoRNA;(source:Araport11) |
| AT3G01520 | Encodes a universal stress protein (USP)-like protein that has been crystallized in complex with AMP, suggesting that it belongs to the ATP-binding USP subfamily. The mRNA is cell-to-cell mobile. |
| AT2G17680 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT2G46420 | helicase with zinc finger protein;(source:Araport11) |
| AT2G24580 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT1G46840 | F-box family protein;(source:Araport11) |
| AT1G66180 | The gene encodes a putative aspartyl protease (ASP). Its expression is induced in response to light and ascorbate. The mRNA is cell-to-cell mobile. |
| AT1G18610 | Galactose oxidase/kelch repeat superfamily protein, induced by calcium. |
| AT5G01850 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G32896 | hypothetical protein;(source:Araport11) |
| AT5G24940 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT1G77780 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT1G69080 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT1G70870 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT3G63220 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G37820 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G01250 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT3G05260 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G69020 | Prolyl oligopeptidase family protein;(source:Araport11) |
| AT2G27180 | hypothetical protein;(source:Araport11) |
| AT1G80230 | Rubredoxin-like superfamily protein;(source:Araport11) |
| AT4G15040 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT5G53050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G44267 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.1e-114 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT2G32360 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G10370 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G13820 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G06526 | nucleic acid binding / zinc ion binding protein;(source:Araport11) |
| AT5G41612 | Natural antisense transcript overlaps with AT5G41610;(source:Araport11) |
| AT4G39952 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G19920 | BTB/POZ domain protein;(source:Araport11) |
| AT3G33058 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-112 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G55135 | hypothetical protein;(source:Araport11) |
| AT5G09445 | hypothetical protein;(source:Araport11) |
| AT5G62400 | transmembrane protein;(source:Araport11) |
| AT1G33785 | pseudogene of photosynthetic electron transfer B;(source:Araport11) |
| AT2G03000 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G01350 | UvrABC system C protein;(source:Araport11) |
| AT4G02540 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G22510 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G65320 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G23670 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT3G19430 | late embryogenesis abundant protein-related / LEA protein-like protein;(source:Araport11) |
| AT5G36960 | hypothetical protein;(source:Araport11) |
| AT2G37810 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G48515 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT4G11350 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT5G47380 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT5G45630 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT2G19210 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT3G43710 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G47740 | pre-tRNA tRNA-Gly (anticodon: CCC);(source:Araport11, TAIR10) |
| AT5G07215 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.9e-34 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G17365 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G26450 | hypothetical protein;(source:Araport11) |
| AT2G38610 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT2G40050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G54000 | TIP41-like protein;(source:Araport11) |
| AT1G20030 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT1G53370 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G05460 | sporozoite surface protein-like protein;(source:Araport11) |
| AT1G52990 | thioredoxin family protein;(source:Araport11) |
| AT2G11610 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.6e-24 P-value blast match to O22278 /203-375 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G42610 | calcium uniporter (DUF607);(source:Araport11) |
| AT3G13510 | carboxyl-terminal peptidase, putative (DUF239);(source:Araport11) |
| AT5G05530 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G45300 | encodes 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase involved in chorismate biosynthesis The mRNA is cell-to-cell mobile. |
| AT5G07090 | Ribosomal protein S4 (RPS4A) family protein;(source:Araport11) |
| AT5G48430 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G18340 | late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11) |
| AT1G26270 | Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11) |
| AT4G34630 | prostatic spermine-binding-like protein;(source:Araport11) |
| AT1G09750 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G10865 | cytochrome C oxidase assembly factor;(source:Araport11) |
| AT1G48220 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G05200 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G51070 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G36470 | DUF868 family protein, putative (DUF868);(source:Araport11) |
| AT3G42794 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.2e-05 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT5G47920 | transcription elongation factor;(source:Araport11) |
| AT1G70550 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT5G44020 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT3G32047 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT4G16770 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G21440 | Phosphoenolpyruvate carboxylase family protein;(source:Araport11) |
| AT1G23300 | MATE efflux family protein;(source:Araport11) |
| AT4G13580 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT2G17590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G16740 | Ribosomal protein L20;(source:Araport11) |
| AT5G59080 | hypothetical protein;(source:Araport11) |
| AT1G14330 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G73170 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G37980 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G61890 | MATE efflux family protein;(source:Araport11) |
| AT1G50450 | Saccharopine dehydrogenase;(source:Araport11) |
| AT4G34500 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G66330 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G42796 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-31 P-value blast match to reverse transcriptase (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G13245 | snoRNA;(source:Araport11) |
| AT1G43300 | transposable_element_gene;(source:Araport11);pseudogene, Ulp1 protease family, contains Pfam profile PF02902: Ulp1 protease family, C-terminal catalytic domain;(source:TAIR10) |
| AT4G24050 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G52140 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
| AT3G57170 | N-acetylglucosaminyl transferase component family protein / Gpi1 family protein;(source:Araport11) |
| AT3G44757 | pseudogene of transmembrane protein;(source:Araport11) |
| AT1G30320 | Remorin family protein;(source:Araport11) |
| AT5G27160 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G07520.1);(source:TAIR10) |
| AT2G38260 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT4G19950 | polyadenylate-binding protein 1-B-binding protein;(source:Araport11) |
| AT2G09589 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.2e-32 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G06534 | transmembrane protein;(source:Araport11) |
| AT5G59960 | K-stimulated pyrophosphate-energized sodium pump protein;(source:Araport11) |
| AT3G29630 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G18240 | Rer1 family protein;(source:Araport11) |
| AT5G48655 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G23490 | fringe-like protein (DUF604);(source:Araport11) |
| AT4G06497 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.0e-48 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G27870 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT3G45820 | hypothetical protein;(source:Araport11) |
| AT3G15350 | G14 enzyme |
| AT2G38660 | Amino acid dehydrogenase family protein;(source:Araport11) |
| AT4G14420 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
| AT1G53970 | GDSL esterase/lipase-like protein;(source:Araport11) |
| AT5G67290 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT3G27680 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT2G44920 | Encodes a pentapeptide-repeat protein (PRP) composed of 25 repeats capped by N- and C-terminal a-helices. Unlike other PRPs, At2g44920 consists exclusively of type II b-turns |
| AT2G36895 | D-tagatose-1,6-bisphosphate aldolase subunit;(source:Araport11) |
| AT5G01881 | transmembrane protein;(source:Araport11) |
| AT5G39350 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G50290 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G61370 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G18815 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
| AT5G63180 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G20500 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G13640 | Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11) |
| AT5G48610 | myb-like protein X;(source:Araport11) |
| AT4G17440 | chromogranin (DUF1639);(source:Araport11) |
| AT1G68500 | hypothetical protein;(source:Araport11) |
| AT5G43540 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT1G23040 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G02030 | C2H2-like zinc finger protein;(source:Araport11) |
| AT5G49040 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT1G26450 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT1G75170 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT4G01505 | Encodes a Plantacyanin/Basic blue family protein [pseudogene] |
| AT4G03300 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G27780.1);(source:TAIR10) |
| AT5G58400 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G27480 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, putative replication proteins - Arabidopsis thaliana;(source:TAIR10) |
| AT3G20015 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G01630 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G35980 | pseudogene of Ta11-like non-LTR retrotransposon;(source:Araport11) |
| AT1G24480 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G10400 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G15190 | hypothetical protein;(source:Araport11) |
| AT3G56600 | phosphatidylinositol 4-kinase gamma-like protein;(source:Araport11) |
| AT1G20015 | snoRNA;(source:Araport11) |
| AT5G56100 | glycine-rich protein / oleosin;(source:Araport11) |
| AT4G28290 | hypothetical protein;(source:Araport11) |
| AT5G23470 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT2G41270 | pseudogene of strictosidine synthase-like 2;(source:Araport11) |
| AT3G57830 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G64065 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT4G28930 | hypothetical protein;(source:Araport11) |
| AT3G44080 | F-box family protein;(source:Araport11) |
| AT3G29075 | glycine-rich protein;(source:Araport11) |
| AT1G22850 | SNARE associated Golgi protein family;(source:Araport11) |
| AT4G29610 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
| AT4G03800 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.5e-125 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT1G36620 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-54 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G70209 | hypothetical protein;(source:Araport11) |
| AT2G34740 | protein phosphatase 2C family protein;(source:Araport11) |
| AT3G32387 | pseudogene of casein lytic proteinase B3;(source:Araport11) |
| AT5G35540 | transmembrane protein;(source:Araport11) |
| AT4G00750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G27340 | N-acetylglucosaminylphosphatidylinositol de-N-acetylase family protein;(source:Araport11) |
| AT2G01031 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G09910.1);(source:TAIR10) |
| AT4G36010 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT5G63270 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
| AT4G12065 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT5G23650 | Homeodomain-like transcriptional regulator;(source:Araport11) |
| AT5G25550 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT2G15950 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT4G08340 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10) |
| AT5G29560 | caleosin-related family protein;(source:Araport11) |
| AT1G47565 | transposable_element_gene;(source:Araport11);retrotransposon gag protein, contains Pfam:PF03732 Retrotransposon gag protein;(source:TAIR10) |
| AT1G49920 | MuDR family transposase;(source:Araport11) |
| AT4G01870 | tolB protein-like protein;(source:Araport11) |
| AT1G76210 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT1G70949 | hypothetical protein;(source:Araport11) |
| AT1G61240 | lysine ketoglutarate reductase trans-splicing-like protein (DUF707);(source:Araport11) |
| AT3G53470 | 2,3-bisphosphoglycerate-independent phosphoglycerate mutase;(source:Araport11) |
| AT1G63420 | O-glucosyltransferase-like protein (DUF821);(source:Araport11) |
| AT1G73860 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G73570 | HCP-like superfamily protein;(source:Araport11) |
| AT3G58980 | F-box family protein;(source:Araport11) |
| AT4G39838 | Natural antisense transcript overlaps with AT4G39840;(source:Araport11) |
| AT4G31340 | myosin heavy chain-like protein;(source:Araport11) |
| AT5G19270 | reverse transcriptase-like protein;(source:Araport11) |
| AT3G52800 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT3G15520 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT5G03495 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G76240 | DUF241 domain protein (DUF241);(source:Araport11) |
| AT2G22790 | hypothetical protein;(source:Araport11) |
| AT2G27310 | F-box family protein;(source:Araport11) |
| AT5G43830 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
| AT3G30220 | hypothetical protein;(source:Araport11) |
| AT2G28780 | P-hydroxybenzoic acid efflux pump subunit;(source:Araport11) |
| AT1G24657 | pseudogene of Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G61010 | Ferritin/ribonucleotide reductase-like family protein;(source:Araport11) |
| AT2G07200 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT5G61820 | stress up-regulated Nod 19 protein;(source:Araport11) |
| AT2G11190 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-90 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT5G44860 | polyadenylate-binding protein 1-B-binding protein;(source:Araport11) |
| AT1G15450 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT1G54850 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT4G27530 | hypothetical protein;(source:Araport11) |
| AT1G32710 | Cytochrome c oxidase, subunit Vib family protein;(source:Araport11) |
| AT1G51210 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G13010 | hAT transposon superfamily protein;(source:Araport11) |
| AT3G33163 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G06280 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT2G10210 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.0e-209 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT4G16155 | dihydrolipoamide dehydrogenase;(source:Araport11) |
| AT5G50175 | transmembrane protein;(source:Araport11) |
| AT1G10530 | PADRE protein |
| AT4G00305 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G30780 | ATP-dependent DNA helicase;(source:Araport11) |
| AT2G12660 | pseudogene of xyloglucan endotransglucosylase/hydrolase 21;(source:Araport11) |
| AT2G34540 | hypothetical protein;(source:Araport11) |
| AT5G29090 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G33131.1);(source:TAIR10) |
| AT5G41800 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT3G42922 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to Mutator-like transposase;(source:TAIR10) |
| AT5G13260 | myosin;(source:Araport11) |
| AT3G24517 | hypothetical protein;(source:Araport11) |
| AT3G46450 | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein;(source:Araport11) |
| AT3G11920 | glutaredoxin-like protein;(source:Araport11) |
| AT5G17165 | hypothetical protein;(source:Araport11) |
| AT1G20280 | homeobox-leucine zipper protein-like protein;(source:Araport11) |
| AT2G05270 | hypothetical protein;(source:Araport11) |
| AT4G00840 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT1G60590 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G13470 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G24255.1);(source:TAIR10) |
| AT1G52590 | Putative thiol-disulfide oxidoreductase DCC;(source:Araport11) |
| AT5G01670 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT2G38905 | Low temperature and salt responsive protein family;(source:Araport11) |
| AT2G46910 | Plastid-lipid associated protein PAP / fibrillin family protein;(source:Araport11) |
| AT2G16760 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT1G68620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G78995 | hypothetical protein;(source:Araport11) |
| AT5G57100 | Nucleotide/sugar transporter family protein;(source:Araport11) |
| AT4G17080 | Histone H3 K4-specific methyltransferase SET7/9 family protein;(source:Araport11) |
| AT2G18560 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G51440 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT2G39710 | Encodes a Cysteine-rich peptide (CRP) family protein |
| AT3G17770 | Dihydroxyacetone kinase;(source:Araport11) |
| AT5G03285 | other_RNA;(source:Araport11) |
| AT1G02110 | bZIP domain class transcription factor (DUF630 and DUF632);(source:Araport11) |
| AT2G21130 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT2G18876 | Encodes a microtubule-associated protein. |
| AT4G17670 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT1G48840 | Plant protein of unknown function (DUF639);(source:TAIR10) |
| AT2G32150 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G09432 | Natural antisense transcript overlaps with AT4G09430;(source:Araport11) |
| AT3G29310 | calmodulin-binding protein-like protein;(source:Araport11) |
| AT1G12030 | phosphoenolpyruvate carboxylase, putative (DUF506);(source:Araport11) |
| AT2G06500 | hAT family dimerization domain-containing protein;(source:Araport11) |
| AT4G31115 | DUF1997 family protein, putative (DUF1997);(source:Araport11) |
| AT5G28200 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, various predicted proteins, Arabidopsis thaliana;(source:TAIR10) |
| AT5G45475 | other_RNA;(source:Araport11) |
| AT5G46874 | Encodes a defensin-like (DEFL) family protein. |
| AT4G30310 | FGGY family of carbohydrate kinase;(source:Araport11) |
| AT1G27420 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G53340 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G46570 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT2G37290 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT1G11670 | MATE efflux family protein;(source:Araport11) |
| AT5G11990 | proline-rich family protein;(source:Araport11) |
| AT4G02005 | None;(source:Araport11) |
| AT1G75090 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT2G03570 | hypothetical protein;(source:Araport11) |
| AT5G64735 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT3G51250 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
| AT1G76000 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT5G50860 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G38700 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT3G27330 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT1G22750 | transmembrane protein;(source:Araport11) |
| AT3G51000 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G23530 | ROH1, putative (DUF793);(source:Araport11) |
| AT3G09690 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G03250 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT5G66580 | PADRE protein. |
| AT3G26935 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT4G14315 | transmembrane protein;(source:Araport11) |
| AT4G06686 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 6.7e-122 P-value blast match to gb|AAL06422.1|AF378081_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10) |
| AT2G29670 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G63835 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-17 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT1G01390 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT5G16340 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT3G43521 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
| AT1G22330 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G28923 | Pseudogene of AT5G01080; beta-galactosidase |
| AT2G47370 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT5G24210 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G42290 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G27090 | bZIP transcription factor (DUF630 and DUF632);(source:Araport11) |
| AT1G61780 | postsynaptic protein-like protein;(source:Araport11) |
| AT4G32870 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT2G42975 | myosin-G heavy chain-like protein;(source:Araport11) |
| AT3G52110 | interferon-activable protein;(source:Araport11) |
| AT1G43310 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT3G56360 | hypothetical protein;(source:Araport11) |
| AT2G45590 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G48030 | DNAse I-like superfamily protein;(source:Araport11) |
| AT2G46780 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G31910 | Ulp1 protease family protein (DUF1985);(source:Araport11) |
| AT4G08145 | transposable_element_gene;(source:Araport11);hypothetical protein, contains Pfam domain, PF04827: Protein of unknown function (DUF635);(source:TAIR10) |
| AT5G04010 | F-box family protein;(source:Araport11) |
| AT1G13930 | Involved in response to salt stress. Knockout mutants are hypersensitive to salt stress. The mRNA is cell-to-cell mobile. |
| AT3G08885 | pseudogene of ferretin 1;(source:Araport11) |
| AT2G45600 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G46610 | aluminum activated malate transporter family protein;(source:Araport11) |
| AT2G38820 | DNA-directed RNA polymerase subunit beta-beta protein, putative (DUF506);(source:Araport11) |
| AT2G31520 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.9e-44 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
| AT1G21475 | hypothetical protein (DUF506);(source:Araport11) |
| AT4G15260 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G49000 | transmembrane protein;(source:Araport11) |
| AT5G42677 | Pseudogene of AT5G19630 |
| AT2G44735 | transmembrane protein;(source:Araport11) |
| AT5G41400 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G19035 | transmembrane protein;(source:Araport11) |
| AT5G61997 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G28630 | transcriptional regulator EFH1-like protein;(source:Araport11) |
| AT3G59490 | hypothetical protein;(source:Araport11) |
| AT4G39420 | spatacsin carboxy-terminus protein;(source:Araport11) |
| AT2G09910 | transposable_element_gene;(source:Araport11);similar to ASY2, DNA binding [Arabidopsis thaliana] (TAIR:AT4G32200.1);(source:TAIR10) |
| AT2G25270 | transmembrane protein;(source:Araport11) |
| AT3G48240 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT3G51750 | hypothetical protein;(source:Araport11) |
| AT1G64618 | other_RNA;(source:Araport11) |
| AT3G36659 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G06980 | PADRE protein |
| AT1G57860 | Translation protein SH3-like family protein;(source:Araport11) |
| AT3G42150 | transmembrane protein;(source:Araport11) |
| AT3G15280 | hypothetical protein;(source:Araport11) |
| AT5G63380 | Encodes a peroxisomal protein involved in the activation of fatty acids through esterification with CoA. At5g63380 preferentially activates fatty acids with increased chain length (C9:0 to C8:0) and thus shares characteristics with long-chain fatty acyl-CoA synthases. Also able to catalyze the conversion of OPDA to its CoA ester and is therefore thought to be involved in the peroxisomal β-oxidation steps of jasmonic acid biosynthesis. |
| AT1G25510 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G28262 | other_RNA;(source:Araport11) |
| AT1G38131 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G02430 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G26510 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G27944 | MADS-box transcription factor family protein;(source:Araport11) |
| AT1G21670 | DPP6 amino-terminal domain protein;(source:Araport11) |
| AT3G19690 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT3G10510 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G36630 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT5G32404 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to Athila retroelement ORF2, putative;(source:TAIR10) |
| AT1G14010 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT3G30410 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.4e-26 P-value blast match to gb|AAG52950.1| putative envelope protein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT5G28056 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 0. P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
| AT1G32630 | FAM50A-like protein;(source:Araport11) |
| AT3G16330 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
| AT2G44280 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G01380 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT4G21930 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT4G03437 | Pseudogene of AT4G03480; ankyrin repeat family protein |
| AT5G31804 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-259 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G37480 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G72190 | D-isomer specific 2-hydroxyacid dehydrogenase family protein;(source:Araport11) |
| AT5G16090 | RAD23 UV excision repair family protein;(source:Araport11) |
| AT5G56120 | RNA polymerase II elongation factor;(source:Araport11) |
| AT3G60520 | zinc ion-binding protein;(source:Araport11) |
| AT4G13530 | transmembrane protein;(source:Araport11) |
| AT1G34420 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
| AT1G21326 | VQ motif-containing protein;(source:Araport11) |
| AT1G52610 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.0e-18 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT4G39560 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G59200 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G71350 | eukaryotic translation initiation factor SUI1 family protein;(source:Araport11) |
| AT3G24927 | pseudogene of expressed protein;(source:Araport11) |
| AT2G06002 | other_RNA;(source:Araport11) |
| AT5G65840 | Thioredoxin superfamily protein;(source:Araport11) |
| AT2G47710 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT4G04790 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G01322 | Encodes a ECA1 gametogenesis related family protein |
| AT3G03280 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT1G55440 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G32880 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G33399 | other_RNA;(source:Araport11) |
| AT1G49830 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G16460 | zinc finger CCCH domain protein;(source:Araport11) |
| AT3G45950 | Pre-mRNA splicing Prp18-interacting factor;(source:Araport11) |
| AT1G07080 | Thioredoxin superfamily protein;(source:Araport11) |
| AT5G52980 | ER-based factor for assembly of V-ATPase;(source:Araport11) |
| AT5G51560 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G25580 | CAP160 protein;(source:Araport11) |
| AT2G16450 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G03710 | replication factor C large subunit;(source:Araport11) |
| AT3G05858 | hypothetical protein;(source:Araport11) |
| AT3G57400 | transmembrane protein;(source:Araport11) |
| AT5G36300 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G01350 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G05415 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-48 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G11920 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G55525 | other_RNA;(source:Araport11) |
| AT2G39950 | flocculation protein;(source:Araport11) |
| AT1G29640 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT5G11700 | ephrin type-B receptor;(source:Araport11) |
| AT4G00780 | TRAF-like family protein;(source:Araport11) |
| AT1G01930 | zinc finger protein-like protein;(source:Araport11) |
| AT3G61490 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G02020 | nitroreductase family protein;(source:Araport11) |
| AT2G41190 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT2G17920 | nucleic acid binding / zinc ion binding protein;(source:Araport11) |
| AT3G60730 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT3G22980 | Ribosomal protein S5/Elongation factor G/III/V family protein;(source:Araport11) |
| AT4G19970 | nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT4G04653 | Pseudogene of AT1G35516 |
| AT4G00342 | hypothetical protein;(source:Araport11) |
| AT1G77250 | RING/FYVE/PHD-type zinc finger family protein;(source:Araport11) |
| AT1G67310 | Calmodulin-binding transcription activator protein with CG-1 and Ankyrin domain;(source:Araport11) |
| AT2G35859 | Natural antisense transcript overlaps with AT2G35860;(source:Araport11) |
| AT3G14250 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G14368 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT5G40860 | transmembrane protein;(source:Araport11) |
| AT3G22970 | hypothetical protein (DUF506);(source:Araport11) |
| AT3G52480 | transmembrane protein;(source:Araport11) |
| AT2G19803 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G32610 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G33715.1);(source:TAIR10) |
| AT2G45040 | Matrixin family protein;(source:Araport11) |
| AT4G05587 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative Athila retroelement ORF2;(source:TAIR10) |
| AT3G13820 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G32100 | Beta-1,3-N-Acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G15800 | hypothetical protein;(source:Araport11) |
| AT1G12080 | Vacuolar calcium-binding protein-like protein;(source:Araport11) |
| AT4G39790 | bZIP transcription factor, putative (DUF630 and DUF632);(source:Araport11) |
| AT3G42690 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT4G04130.1);(source:TAIR10) |
| AT3G28590 | transmembrane protein;(source:Araport11) |
| AT4G33540 | metallo-beta-lactamase family protein;(source:Araport11) |
| AT1G36510 | Nucleic acid-binding proteins superfamily;(source:Araport11) |
| AT4G17100 | poly(U)-specific endoribonuclease-B protein;(source:Araport11) |
| AT1G17820 | testis-expressed sequence 2-like protein (DUF2404);(source:Araport11) |
| AT1G54500 | RBD1 is a thylakoid membrane-bound iron-binding protein that is required for the proper assembly of photosystem II in Arabidopsis. It is found in all oxygenic photoautotrophic organisms (plants, algae and cyanobacteria). |
| AT1G77520 | O-methyltransferase family protein;(source:Araport11) |
| AT1G18090 | 5-3 exonuclease family protein;(source:Araport11) |
| AT1G33600 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G70280 | NHL domain-containing protein;(source:Araport11) |
| AT3G50910 | netrin receptor DCC;(source:Araport11) |
| AT2G29660 | zinc finger (C2H2 type) family protein;(source:Araport11) |
| AT1G23710 | hypothetical protein (DUF1645);(source:Araport11) |
| AT3G42786 | hypothetical protein;(source:Araport11) |
| AT1G21790 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT5G49152 | Natural antisense transcript overlaps with AT5G49150;(source:Araport11) |
| AT5G18850 | Low-density receptor-like protein;(source:Araport11) |
| AT1G62420 | DUF506 family protein (DUF506);(source:Araport11) |
| AT1G24580 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G36925 | hypothetical protein;(source:Araport11) |
| AT2G37780 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G58960 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G53190 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G22540 | hypothetical protein (DUF1677);(source:Araport11) |
| AT5G14500 | aldose 1-epimerase family protein;(source:Araport11) |
| AT5G46890 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G02390 | hypothetical protein;(source:Araport11) |
| AT5G25840 | DUF1677 family protein (DUF1677);(source:Araport11) |
| AT5G62770 | membrane-associated kinase regulator, putative (DUF1645);(source:Araport11) |
| AT4G36370 | hypothetical protein;(source:Araport11) |
| AT5G12043 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT2G24420 | DNA repair ATPase-like protein;(source:Araport11) |
| AT4G05523 | nucleoporin GLE1-like protein;(source:Araport11) |
| AT5G18980 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G07452 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT2G24930.1);(source:TAIR10) |
| AT1G21510 | TPRXL;(source:Araport11) |
| AT1G74840 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G03170 | hypothetical protein;(source:Araport11) |
| AT2G28790 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT5G30189 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.4e-179 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
| AT1G66130 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G27440 | pseudogene of rac GTPase activating protein |
| AT1G28815 | hypothetical protein;(source:Araport11) |
| AT2G01023 | hypothetical protein;(source:Araport11) |
| AT3G05835 | pre-tRNA tRNA-Ile (anticodon: TAT);(source:Araport11, TAIR10) |
| AT1G19540 | NmrA-like negative transcriptional regulator family protein;(source:Araport11) |
| AT3G32455 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.5e-24 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT5G41460 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT5G18920 | Cox19-like CHCH family protein;(source:Araport11) |
| AT4G06636 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-74 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT3G09540 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G42220 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT1G25400 | transmembrane protein;(source:Araport11) |
| AT1G49960 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT3G01870 | hypothetical protein (DUF946);(source:Araport11) |
| AT2G03980 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G14060 | hypothetical protein;(source:Araport11) |
| AT4G36850 | PQ-loop repeat family protein / transmembrane family protein;(source:Araport11) |
| AT1G55410 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G20230 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G36210 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-71 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G19380 | Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11) |
| AT3G61160 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G66050 | Wound-responsive family protein;(source:Araport11) |
| AT4G08033 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G17718 | Encodes a defensin-like (DEFL) family protein. |
| AT4G37240 | PADRE protein down-regulated after infection by S. sclerotiorun. |
| AT1G47980 | desiccation-like protein;(source:Araport11) |
| AT2G11852 | Natural antisense transcript overlaps with AT2G11851;(source:Araport11) |
| AT1G19394 | hypothetical protein;(source:Araport11) |
| AT2G16490 | XH domain-containing protein;(source:Araport11) |
| AT3G11415 | other_RNA;(source:Araport11) |
| AT1G68300 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT5G66053 | hypothetical protein;(source:Araport11) |
| AT5G11500 | coiled-coil protein;(source:Araport11) |
| AT2G31130 | hypothetical protein;(source:Araport11) |
| AT3G05400 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G46720 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G59230 | transcription factor-like protein;(source:Araport11) |
| AT2G20250 | hypothetical protein;(source:Araport11) |
| AT5G18470 | Curculin-like (mannose-binding) lectin family protein;(source:Araport11) |
| AT1G03030 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G41810 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G34590.1);(source:TAIR10) |
| AT3G11530 | Vacuolar protein sorting 55 (VPS55) family protein;(source:Araport11) |
| AT4G08090 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.4e-12 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G05425 | hypothetical protein;(source:Araport11) |
| AT5G64910 | Serine/Threonine-kinase;(source:Araport11) |
| AT4G06609 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.8e-179 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
| AT5G17750 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G75760 | ER lumen protein retaining receptor family protein;(source:Araport11) |
| AT4G15390 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G42590 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G12110.1);(source:TAIR10) |
| AT2G21500 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G40480 | WEB family protein (DUF827);(source:Araport11) |
| AT1G58050 | RNA helicase family protein;(source:Araport11) |
| AT4G15120 | VQ motif-containing protein;(source:Araport11) |
| AT1G53200 | TAF RNA polymerase I subunit A;(source:Araport11) |
| AT3G05620 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G56840 | myb-like transcription factor family protein;(source:Araport11) |
| AT2G40680 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G52065.1);(source:TAIR10) |
| AT4G37380 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G44950 | glycine-rich protein;(source:Araport11) |
| AT5G38790 | hypothetical protein;(source:Araport11) |
| AT2G13720 | putative DNA topoisomerase;(source:Araport11) |
| AT5G57785 | hypothetical protein;(source:Araport11) |
| AT5G03890 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT1G52800 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G63290 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G36440 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains Pfam profile PF03384: Drosophila protein of unknown function, DUF287;(source:TAIR10) |
| AT3G47010 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT4G32480 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
| AT3G56030 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G07510 | maternal effect embryo arrest protein;(source:Araport11) |
| AT1G32740 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT4G22730 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G38200 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
| AT5G38460 | ALG6, ALG8 glycosyltransferase family;(source:Araport11) |
| AT3G22440 | FRIGIDA-like protein;(source:Araport11) |
| AT5G06220 | LETM1-like protein;(source:Araport11) |
| AT1G53163 | membrane-associated kinase regulator;(source:Araport11) |
| AT1G55690 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT4G24790 | AAA-type ATPase family protein;(source:Araport11) |
| AT5G33533 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.9e-112 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
| AT3G17640 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT4G20040 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G26990 | Drought-responsive family protein;(source:Araport11) |
| AT3G43358 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.8e-69 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT5G37160 | P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11) |
| AT3G06840 | hypothetical protein;(source:Araport11) |
| AT5G04460 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G43886 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.3e-165 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT1G49870 | myosin-2 heavy chain-like protein;(source:Araport11) |
| AT1G15740 | Leucine-rich repeat family protein;(source:Araport11) |
| AT1G36430 | transposable_element_gene;(source:Araport11);retrotransposon family;(source:TAIR10) |
| AT1G80570 | RNI-like superfamily protein;(source:Araport11) |
| AT2G36200 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G52330 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G01250 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
| AT1G60060 | Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11) |
| AT3G15251 | hypothetical protein;(source:Araport11) |
| AT5G22180 | hypothetical protein;(source:Araport11) |
| AT2G24340 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT2G25150 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT2G11140 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.0e-71 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G29195 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT2G23390 | acyl-CoA;(source:Araport11) |
| AT5G61970 | signal recognition particle-related / SRP-like protein;(source:Araport11) |
| AT5G67460 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT1G10020 | formin-like protein (DUF1005);(source:Araport11) |
| AT1G12810 | proline-rich family protein;(source:Araport11) |
| AT5G17740 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G50230 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G63085 | Encodes a Plant thionin family protein |
| AT1G17940 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT2G25460 | EEIG1/EHBP1 protein amino-terminal domain protein;(source:Araport11) |
| AT3G45450 | Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G08970 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 8.1e-28 P-value blast match to Q9SL18 /349-510 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G52890 | AT hook motif-containing protein;(source:Araport11) |
| AT3G54440 | glycoside hydrolase family 2 protein;(source:Araport11) |
| AT1G01830 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G35995 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.4e-38 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT2G43240 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT5G54300 | cotton fiber-like protein (DUF761);(source:Araport11) |
| AT4G15140 | hypothetical protein;(source:Araport11) |
| AT2G15410 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.1e-217 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT4G14270 | Protein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins. |
| AT1G71840 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT5G02550 | hypothetical protein;(source:Araport11) |
| AT1G15970 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT5G54540 | Uncharacterized conserved protein (UCP012943);(source:Araport11) |
| AT3G06750 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G56423 | hypothetical protein;(source:Araport11) |
| AT5G52390 | PAR1 protein;(source:Araport11) |
| AT1G04290 | Thioesterase superfamily protein;(source:Araport11) |
| AT2G17295 | snoRNA;(source:Araport11) |
| AT4G07334 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.4e-97 P-value blast match to gb|AAL06422.1|AF378081_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10) |
| AT3G29550 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.7e-22 P-value blast match to gb|AAG52950.1| putative envelope protein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT3G16175 | Thioesterase superfamily protein;(source:Araport11) |
| AT3G12340 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT1G40104 | hypothetical protein;(source:Araport11) |
| AT5G28280 | pseudogene of sterol desaturase domain-containing protein;(source:Araport11) |
| AT1G27150 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G47590 | Heat shock protein HSP20/alpha crystallin family;(source:Araport11) |
| AT1G09870 | histidine acid phosphatase family protein;(source:Araport11) |
| AT5G41900 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G62420 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT4G15080 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT2G28730 | pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10) |
| AT5G60680 | transcription initiation factor TFIID subunit (Protein of unknown function, DUF584);(source:Araport11) |
| AT2G45750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G04880 | pseudogene of ABC transporter family protein |
| AT5G16200 | 50S ribosomal protein-like protein;(source:Araport11) |
| AT5G60190 | Encodes a protein that can cleave residues from the C-terminus of RUB1 to prepare it for conjugation to target proteins. |
| AT1G02550 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G53260 | Seed maturation protein;(source:Araport11) |
| AT4G30250 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G08210 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G17975 | pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10) |
| AT4G30060 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G17900 | microfibrillar-associated protein-like protein;(source:Araport11) |
| AT2G40920 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G17950 | transmembrane protein;(source:Araport11) |
| AT4G16330 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G29400 | oxidoreductase/transition metal ion-binding protein (DUF3531);(source:Araport11) |
| AT1G62305 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G19000 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G66190 | hypothetical protein;(source:Araport11) |
| AT3G44420 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G31030 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.0e-41 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G32390 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
| AT5G04090 | histidine-tRNA ligase;(source:Araport11) |
| AT4G16490 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G39140 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G52565 | cytochrome P450 family protein;(source:Araport11) |
| AT1G42530 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.8e-23 P-value blast match to Q9S9L1 /206-367 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G29030 | pseudogene of myosin heavy chain-like protein;(source:Araport11) |
| AT2G14710 | F-box family protein;(source:Araport11) |
| AT1G76600 | PADRE protein up-regulated after infection by S. sclerotiorun. |
| AT1G07175 | alternative NAD(P)H dehydrogenase;(source:Araport11) |
| AT2G07420 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-170 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT4G08330 | hypothetical protein;(source:Araport11) |
| AT2G37480 | hypothetical protein;(source:Araport11) |
| AT3G07250 | RNA-binding (RRM-RBD-RNP motif) domain nuclear transport factor 2 family protein;(source:Araport11) |
| AT2G19806 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 1.2e-19 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
| AT5G28580 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 7.3e-33 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT2G08986 | hypothetical protein;(source:Araport11) |
| AT5G45745 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
| AT2G30000 | PHF5-like protein;(source:Araport11) |
| AT1G53560 | Ribosomal protein L18ae family;(source:Araport11) |
| AT2G06980 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G31950 | nucleic acid-binding/zinc ion-binding protein;(source:Araport11) |
| AT4G07970 | transposable_element_gene;(source:Araport11);hypothetical protein, similar to A. thaliana hypothetical proteins;(source:TAIR10) |
| AT1G80850 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G47860 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-40 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT4G01110 | late embryogenesis abundant hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G31510 | major centromere autoantigen B-like protein;(source:Araport11) |
| AT1G21830 | hypothetical protein;(source:Araport11) |
| AT2G13080 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.7e-183 P-value blast match to GB:AAD11615 prpol (gypsy_Ty3-element) (Zea mays);(source:TAIR10) |
| AT4G00170 | Plant VAMP (vesicle-associated membrane protein) family protein;(source:Araport11) |
| AT3G07350 | sulfate/thiosulfate import ATP-binding protein, putative (DUF506);(source:Araport11) |
| AT2G23790 | calcium uniporter (DUF607);(source:Araport11) |
| AT3G30737 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, blastp match of 48%25 identity and 0. P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT5G22160 | transmembrane protein;(source:Araport11) |
| AT1G11380 | PLAC8 family protein;(source:Araport11) |
| AT4G29980 | fasciclin-like arabinogalactan protein;(source:Araport11) |
| AT1G01570 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT4G22580 | Exostosin family protein;(source:Araport11) |
| AT3G33118 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G25340 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G27840 | SNARE-like superfamily protein;(source:Araport11) |
| AT3G55240 | Overexpression leads to PEL (Pseudo-Etiolation in Light) phenotype. |
| AT1G57540 | 40S ribosomal protein;(source:Araport11) |
| AT4G26820 | GrpE-like protein;(source:Araport11) |
| AT1G21770 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT5G28765 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-70 P-value blast match to O22278 /203-375 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT4G33820 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT1G11700 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT2G15360 | fucosyltransferase;(source:Araport11) |
| AT1G77370 | Glutaredoxin family protein;(source:Araport11) |
| AT4G32860 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
| AT3G61420 | BSD domain (BTF2-like transcription factors, Synapse-associated proteins and DOS2-like proteins);(source:Araport11) |
| AT2G47440 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G46490 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G22510 | E3 ubiquitin-protein ligase RNF170-like protein (DUF 1232);(source:Araport11) |
| AT4G18920 | histone acetyltransferase (DUF1264);(source:Araport11) |
| AT1G69910 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G22730 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G02315 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT2G36145 | hypothetical protein;(source:Araport11) |
| AT1G68490 | translocase subunit seca;(source:Araport11) |
| AT4G22217 | Encodes a defensin-like (DEFL) family protein. |
| AT3G15420 | Transcription factor TFIIIC, tau55-related protein;(source:Araport11) |
| AT2G36030 | hypothetical protein;(source:Araport11) |
| AT1G68350 | cotton fiber protein;(source:Araport11) |
| AT1G63860 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G06648 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.0e-181 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G24100 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G01610 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G47500 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
| AT4G18970 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G04040 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT1G78210 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G24231 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G12570 | Ortholog of maize IPE1 gene which is involved in pollen exine development. |
| AT1G32910 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G56750 | plant/protein;(source:Araport11) |
| AT2G43200 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G50665 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
| AT4G30830 | myosin-like protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT5G46871 | Encodes a defensin-like (DEFL) family protein. |
| AT5G53048 | Natural antisense transcript overlaps with AT5G53050;(source:Araport11) |
| AT4G32670 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT1G75730 | hypothetical protein;(source:Araport11) |
| AT4G37175 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
| AT3G24190 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G05765 | snoRNA;(source:Araport11) |
| AT5G22355 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G69800 | Cystathionine beta-synthase (CBS) protein;(source:Araport11) |
| AT1G05370 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G49990 | F-box family protein;(source:Araport11) |
| AT4G31330 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
| AT1G14710 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G17250 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT1G01300 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G27720 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G06210 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G36770 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G03905 | Iron-sulfur cluster biosynthesis family protein;(source:Araport11) |
| AT3G26910 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G15548 | transmembrane protein;(source:Araport11) |
| AT3G50895 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
| AT2G22145 | Encodes a ECA1 gametogenesis related family protein |
| AT2G05550 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.6e-37 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G50850 | Putative methyltransferase family protein;(source:Araport11) |
| AT2G39865 | transmembrane protein;(source:Araport11) |
| AT5G45480 | transmembrane protein, putative (DUF594);(source:Araport11) |
| AT1G70420 | DNA ligase-like protein, putative (DUF1645);(source:Araport11) |
| AT5G27460 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G76440 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT1G77280 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT3G28410 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G21781 | Natural antisense transcript overlaps with AT3G21780;(source:Araport11) |
| AT3G30380 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G61270 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT3G15357 | phosphopantothenoylcysteine decarboxylase subunit;(source:Araport11) |
| AT5G23170 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G21320 | EARLY FLOWERING protein;(source:Araport11) |
| AT1G01240 | transmembrane protein;(source:Araport11) |
| AT2G25330 | TRAF-like family protein;(source:Araport11) |
| AT1G15330 | Cystathionine beta-synthase (CBS) protein;(source:Araport11) |
| AT2G45360 | ankyrin repeat/KH domain protein (DUF1442);(source:Araport11) |
| AT2G37730 | glycosyltransferase (DUF604);(source:Araport11) |
| AT3G22550 | NAD(P)H-quinone oxidoreductase subunit, putative (DUF581);(source:Araport11) |
| AT3G07120 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G15000 | Encodes a ECA1 gametogenesis related family protein |
| AT4G06522 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-22 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G10070 | RNase L inhibitor protein-like protein;(source:Araport11) |
| AT3G13130 | transmembrane protein;(source:Araport11) |
| AT2G03810 | 18S pre-ribosomal assembly protein gar2-like protein;(source:Araport11) |
| AT2G45840 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT5G37220 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G14500 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT3G13270 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G14450.1);(source:TAIR10) |
| AT5G21940 | hybrid signal transduction histidine kinase M-like protein;(source:Araport11) |
| AT3G25700 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G37895 | Natural antisense transcript overlaps with AT4G37890;(source:Araport11) |
| AT5G28615 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT5G54700 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G25422 | hypothetical protein;(source:Araport11) |
| AT3G06570 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G23690 | PADRE protein. |
| AT1G22180 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G60760 | hypothetical protein;(source:Araport11) |
| AT2G18570 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G15020 | hypothetical protein;(source:Araport11) |
| AT3G07025 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT1G67400 | ELMO/CED-12 family protein;(source:Araport11) |
| AT2G21780 | hypothetical protein;(source:Araport11) |
| AT2G46630 | serine/arginine repetitive matrix protein;(source:Araport11) |
| AT5G47180 | Plant VAMP (vesicle-associated membrane protein) family protein;(source:Araport11) |
| AT4G05616 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G04155.1);(source:TAIR10) |
| AT4G06700 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.7e-54 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
| AT3G49140 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G57890 | Tubulin binding cofactor C domain-containing protein;(source:Araport11) |
| AT5G39530 | hypothetical protein (DUF1997);(source:Araport11) |
| AT5G09960 | sorbin/SH3 domain protein;(source:Araport11) |
| AT2G36220 | hypothetical protein;(source:Araport11) |
| AT4G33550 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G12502 | Natural antisense transcript overlaps with AT3G12500;(source:Araport11) |
| AT2G39980 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT4G06548 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.5e-39 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT2G42760 | DUF1685 family protein;(source:Araport11) |
| AT2G37800 | cysteine/histidine-rich C1 domain protein;(source:Araport11) |
| AT5G07360 | Amidase family protein;(source:Araport11) |
| AT4G08022 | pseudogene of ECA1 gametogenesis family protein (DUF784);(source:Araport11) |
| AT3G62110 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G22241 | hypothetical protein;(source:Araport11) |
| AT3G24180 | Beta-glucosidase, GBA2 type family protein;(source:Araport11) |
| AT1G14345 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT2G46300 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT2G47640 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT2G12400 | plasma membrane fusion protein;(source:Araport11) |
| AT5G09620 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT1G69610 | zinc finger FYVE domain protein, putative (DUF1666);(source:Araport11) |
| AT4G16540 | Heat shock protein HSP20/alpha crystallin family;(source:Araport11) |
| AT2G37870 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G07940 | Calcium-dependent ARF-type GTPase activating protein family;(source:Araport11) |
| AT1G59950 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT4G23740 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G08430 | SWIB/MDM2 and Plus-3 and GYF domain-containing protein;(source:Araport11) |
| AT2G03580 | F-box family protein-like protein;(source:Araport11) |
| AT5G25430 | HCO3- transporter family;(source:Araport11) |
| AT2G03080 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-10 P-value blast match to GB:AAC24836 pol polyprotein (Ty1_Copia-element) (Candida albicans);(source:TAIR10) |
| AT3G58140 | phenylalanyl-tRNA synthetase class IIc family protein;(source:Araport11) |
| AT1G73950 | Transmembrane Fragile-X-F-associated protein;(source:Araport11) |
| AT3G22410 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT4G11385 | hypothetical protein;(source:Araport11) |
| AT1G23750 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT2G18193 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G24130 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT5G47225 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10) |
| AT1G19970 | ER lumen protein retaining receptor family protein;(source:Araport11) |
| AT1G31310 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G30180 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.5e-115 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G01500 | Erythronate-4-phosphate dehydrogenase family protein;(source:Araport11) |
| AT2G33180 | hypothetical protein;(source:Araport11) |
| AT1G80970 | XH domain-containing protein;(source:Araport11) |
| AT2G07811 | pseudogene of mitochondrial protein |
| AT1G77640 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT1G21680 | DPP6 N-terminal domain-like protein;(source:Araport11) |
| AT4G22485 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT2G05770 | transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBb0043H09.1, blastp match of 30%25 identity and 1.6e-29 P-value to GP|21740634|emb|CAD40195.1||AL606611 OSJNBb0043H09.1 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT4G35240 | DNA-directed RNA polymerase subunit beta, putative (DUF630 and DUF632);(source:Araport11) |
| AT3G11560 | LETM1-like protein;(source:Araport11) |
| AT1G22720 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G02816 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
| AT5G15910 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G15090 | GroES-like zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
| AT5G14370 | CCT motif family protein;(source:Araport11) |
| AT1G11970 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT3G45093 | Encodes a defensin-like (DEFL) family protein. |
| AT3G57900 | import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein;(source:Araport11) |
| AT3G50340 | hypothetical protein;(source:Araport11) |
| AT1G53180 | hypothetical protein;(source:Araport11) |
| AT3G20340 | Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT5G42825 | hypothetical protein;(source:Araport11) |
| AT1G52415 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G16630 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G33350 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G29660 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G44380 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G04120 | Encodes a cofactor-dependent phosphoglycerate mutase (dPGM) - like protein with phosphoserine phosphatase activity that may be responsible for serine anabolism. |
| AT3G30405 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.1e-154 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT3G54390 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT3G14240 | Subtilase family protein;(source:Araport11) |
| AT5G66800 | membrane-associated kinase regulator-like protein;(source:Araport11) |
| AT1G15490 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G14378 | Encodes a ECA1 gametogenesis related family protein |
| AT4G38070 | transcription factor bHLH131-like protein;(source:Araport11) |
| AT1G19650 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT2G30700 | GPI-anchored protein;(source:Araport11) |
| AT1G03270 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
| AT5G19300 | methyltransferase C9orf114 protein;(source:Araport11) |
| AT3G60780 | hypothetical protein (DUF1442);(source:Araport11) |
| AT5G11550 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G26345 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-43 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT1G24010 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT2G25312 | Encodes a ECA1 gametogenesis related family protein |
| AT1G48610 | AT hook motif-containing protein;(source:Araport11) |
| AT4G01245 | hypothetical protein;(source:Araport11) |
| AT2G26940 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT1G54310 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G20820 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G75810 | transmembrane protein;(source:Araport11) |
| AT1G02650 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G04260 | Bromo-adjacent homology (BAH) domain-containing protein;(source:Araport11) |
| AT5G37540 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G20070 | hypothetical protein;(source:Araport11) |
| AT2G32020 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT3G53670 | hypothetical protein;(source:Araport11) |
| AT5G59740 | UDP-N-acetylglucosamine (UAA) transporter family;(source:Araport11) |
| AT1G20180 | transmembrane protein (DUF677);(source:Araport11) |
| AT1G12630 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT3G58640 | Mitogen activated protein kinase kinase kinase-like protein;(source:Araport11) |
| AT2G26695 | Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11) |
| AT3G11320 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT3G29640 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G29632.1);(source:TAIR10) |
| AT5G02660 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (DUF627 and DUF629);(source:Araport11) |
| AT3G26770 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G46535 | hypothetical protein;(source:Araport11) |
| AT1G79630 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT2G13440 | glucose-inhibited division family A protein;(source:Araport11) |
| AT2G17860 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT5G28667 | pseudogene of nuclease;(source:Araport11) |
| AT5G65440 | transmembrane protein;(source:Araport11) |
| AT1G56220 | Dormancy/auxin associated family protein;(source:Araport11) |
| AT4G29905 | hypothetical protein;(source:Araport11) |
| AT1G64600 | copper ion binding / methyltransferase;(source:Araport11) |
| AT1G69460 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT3G15830 | phosphatidic acid phosphatase-related / PAP2-like protein;(source:Araport11) |
| AT3G24840 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT4G03340 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT3G56280 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
| AT5G08240 | transmembrane protein;(source:Araport11) |
| AT5G06540 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G40290 | HD domain-containing metal-dependent phosphohydrolase family protein;(source:Araport11) |
| AT1G66890 | 50S ribosomal-like protein;(source:Araport11) |
| AT5G18460 | carboxyl-terminal peptidase (DUF239);(source:Araport11) |
| AT5G65250 | transmembrane protein;(source:Araport11) |
| AT3G30416 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G30580 | hypothetical protein;(source:Araport11) |
| AT3G29792 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-243 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G33055 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-282 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G56050 | Protein kinase family protein;(source:Araport11) |
| AT5G01080 | Beta-galactosidase related protein;(source:Araport11) |
| AT3G24640 | lyase;(source:Araport11) |
| AT1G68526 | hypothetical protein;(source:Araport11) |
| AT4G07946 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.8e-24 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G20740 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G14350 | transposable_element_gene;(source:Araport11);expressed protein, contains Pfam profile PF03384: Drosophila protein of unknown function, DUF287;(source:TAIR10) |
| AT5G55507 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G12150 | alpha/beta hydrolase family protein;(source:Araport11) |
| AT4G35130 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G26690 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT5G04250 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT5G53220 | hypothetical protein;(source:Araport11) |
| AT3G60510 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
| AT2G36670 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G30715 | transposable_element_gene;(source:Araport11);expressed protein;(source:TAIR10) |
| AT4G30490 | AFG1-like ATPase family protein;(source:Araport11) |
| AT2G39170 | MEF2BNB-like protein;(source:Araport11) |
| AT1G20940 | F-box family protein;(source:Araport11) |
| AT4G07931 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 8.2e-105 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
| AT3G25870 | hypothetical protein;(source:Araport11) |
| AT4G33467 | hypothetical protein;(source:Araport11) |
| AT1G07590 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G78230 | Outer arm dynein light chain 1 protein;(source:Araport11) |
| AT1G27990 | transmembrane protein;(source:Araport11) |
| AT2G27700 | eukaryotic translation initiation factor 2 family protein / eIF-2 family protein;(source:Araport11) |
| AT1G15175 | Natural antisense transcript overlaps with AT1G15170;(source:Araport11) |
| AT5G03660 | transcriptional activator (DUF662);(source:Araport11) |
| AT2G22460 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT4G16810 | VEFS-Box of polycomb protein;(source:Araport11) |
| AT1G72510 | DUF1677 family protein (DUF1677);(source:Araport11) |
| AT3G10595 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT5G58800 | Quinone reductase family protein;(source:Araport11) |
| AT1G32890 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-37 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT3G31023 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.0e-152 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT4G26770 | Phosphatidate cytidylyltransferase family protein;(source:Araport11) |
| AT5G65925 | hypothetical protein;(source:Araport11) |
| AT4G14900 | FRIGIDA-like protein;(source:Araport11) |
| AT1G02700 | GATA transcription factor-like protein;(source:Araport11) |
| AT2G01913 | hypothetical protein;(source:Araport11) |
| AT3G43291 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G54955 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G05145.1);(source:TAIR10) |
| AT5G33390 | glycine-rich protein;(source:Araport11) |
| AT3G13525 | snoRNA;(source:Araport11) |
| AT4G09745 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
| AT3G57970 | Emsy N Terminus (ENT)/ plant Tudor-like domains-containing protein;(source:Araport11) |
| AT1G28540 | Tail-anchored (TA) OEP membrane protein which possesses a single C-terminal transmembrane domain targeting post-translationally to plastids. |
| AT4G06658 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-182 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT3G19274 | hypothetical protein;(source:Araport11) |
| AT3G50790 | esterase/lipase/thioesterase family protein;(source:Araport11) |
| AT2G40910 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G61510 | GroES-like zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
| AT2G33630 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G10090 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT2G45380 | myeloid leukemia factor;(source:Araport11) |
| AT4G39610 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT5G40670 | PQ-loop repeat family protein / transmembrane family protein;(source:Araport11) |
| AT2G21510 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT5G41420 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G28520 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT3G55430 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT3G29110 | Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
| AT3G56275 | pseudogene of expressed protein;(source:Araport11) |
| AT1G04560 | AWPM-19-like family protein;(source:Araport11) |
| AT5G64250 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT5G36100 | transmembrane protein;(source:Araport11) |
| AT4G24805 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G42086 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.5e-98 P-value blast match to GB:AAA66266 unknown protein ORF1 transposable element En-1 (CACTA-element) (Zea mays);(source:TAIR10) |
| AT3G20170 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G55265 | DUF538 family protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT5G53010 | calcium-transporting ATPase;(source:Araport11) |
| AT4G15960 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G74300 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G19570 | Encodes a member of the dehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica.Encodes about 50-60% of extractable leaf GSH-dependent DHAR activity, but single knockout mutants show unaltered ascorbate and glutathione status in optimal and oxidative stress conditions (PMID:28381499). Acts redundantly with DHAR2 to oxidize glutathione in response to increased intracelullar hydrogen peroxide (catalase deficiency) . Complementation of a cat2 dhar1 dhar2 dhar3 quadruple mutant with DHAR1 fully restores cat2 phenotype and pathogenesis-related responses |
| AT5G38120 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT5G24810 | ABC1 family protein;(source:Araport11) |
| AT4G25570 | Encodes cytochrome b561. |
| AT5G67410 | transcriptional regulator of RNA polII, SAGA, subunit;(source:Araport11) |
| AT1G27930 | Arabinogalactan methylesterase,involved in arabinogalactan glucuronic acid methylation. Interacts with eIF3. |
| AT3G27250 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G40790 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G40800 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT4G00370 | Encodes an inorganic phosphate transporter (PHT4;4) that can transport ascorbate and is located in the chloroplast envelope membrane. It has been shown to play a role in the xanthophyll cycle during photosynthesis and may be required for tolerance to strong light stress. |
| AT4G18020 | Encodes pseudo-response regulator 2 (APRR2) that interacts with a calcium sensor (CML9). |
| AT1G06400 | small GTP-binding protein (ara-2).RabGTPase functioning in anterograde trafficking from trans-Golgi network/early endosomal compartments to the plasma membrane as well as in responses to salinity stress. |
| AT5G67360 | Encodes a subtilisin-like serine protease essential for mucilage release from seed coats. |
| AT3G54840 | Encodes a novel Rab-like GTP-ase that is localized to the peripheral membrane of the endosome. . In its active state interferes with the assembly of GDP-bound ARA7, PUF2, and VPS9a by competitively binding to PUF2 to diminish endosomal transport mediated by canonical RAB5. |
| AT4G32200 | meiotic asynaptic mutant 2, homologue of ASY1 |
| AT4G16640 | Matrix metalloprotease. |
| AT1G59970 | Matrix metalloproteinase important for root development and root bacterial communities. Modulates auxin/ABA signaling rendering the plant sensitive to drought stress and recruiting differential root bacterial communities. |
| AT1G01720 | Belongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA. The mRNA is cell-to-cell mobile. |
| AT2G39190 | member of ATH subfamily |
| AT1G20823 | Encodes a RING E3 ubiquitin ligase ATL80. Involved in phosphate mobilization and cold stress response in sufficient phosphate growth conditions. The mRNA is cell-to-cell mobile. |
| AT3G09880 | Encodes B' regulatory subunit of PP2A (AtB'beta). Functions redundantly with the alpha subunit do maintain sister chromatid cohesion during meiosis. |
| AT1G01980 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
| AT1G30720 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G30740 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G20830 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). It is involved in plant immunity. Overexpressing plants are more resistant to B. cinerea. |
| AT4G20840 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
| AT1G30700 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G30320 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT2G30240 | Encodes a plasma membrane localized potassium transporter. |
| AT1G27840 | Encodes a DDB1a interacting protein ATCSA-1 required for UV-B tolerance and genomic integrity. |
| AT5G03760 | encodes a beta-mannan synthase that is required for agrobacterium-mediated plant genetic transformation involves a complex interaction between the bacterium and the host plant. 3' UTR is involved in transcriptional regulation and the gene is expressed in the elongation zone of the root. |
| AT2G25900 | Encodes a protein with two tandem-arrayed CCCH-type zinc fingers that binds RNA and is involved in RNA turnover. The mRNA is cell-to-cell mobile. |
| AT5G66940 | Encodes a nuclear localized DOF-domain binding transcription factor. |
| AT3G62600 | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast. Forms a complex SDF2-ERdj3B-BiP that is required for the proper accumulation of the surface-exposed leucine-rich repeat receptor kinases EFR. EFR is involved in PAMP (pathogen associated molecular patterns) triggered immunity. |
| AT3G62760 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT3G08030 | The mRNA of this gene is expressed in viable seeds. Its detection in a dry seed lot has potential for use as a molecular marker for germination performance as absence of expression correlates with decreased germination. Encodes DUF642 cell wall protein. |
| AT1G72310 | Encodes a putative RING-H2 zinc finger protein ATL3 (ATL3). |
| AT5G05810 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G76410 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G57160 | Encodes the Arabidopsis orthologue of the yeast and mammalian DNA ligase IV. Involved in the repair of DNA damage but, unlike in yeast, not required for T-DNA integration. Interacts with the Arabidopsis homologue of XRCC4. |
| AT1G18250 | encodes a thaumatin-like protein |
| AT2G01910 | Binds microtubules. Induces a crisscross mesh of microtubules, not bundles. Not involved in microtubule polymerization nor nucleation. Localizes to mitochondria. The mRNA is cell-to-cell mobile. |
| AT5G57345 | OXR is a single copy gene in Arabidopsis. It is localized to the ER. It is expressed throughout the plant and expression is induced in response to abiotic stress. While the function of OXR is unknown, overexpression results in increased abiotic stress tolerance and increased ascorbic acid content. |
| AT4G04640 | One of two genes (with ATPC2) encoding the gamma subunit of Arabidopsis chloroplast ATP synthase. |
| AT3G14300 | pectinesterase family protein;(source:Araport11) |
| AT2G02270 | pseudogene of phloem protein 2-B2;(source:Araport11) |
| AT4G11570 | Encodes plastid localized protein involved in riboflavin biosynthesis. It dephosphorylates 5-amino-6-ribitylamino- 2,4(1H,3H) pyrimidinedione 5′-phosphate (ARPP) . |
| AT5G21280 | Seed plant lineage specific gene that is expressed in response to oxidative and abiotic stresses. |
| AT1G19230 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
| AT4G01810 | Sec23 homolog , forms a distinct clade with SEC23D.Mutants have defects in pollen exine patterning, tapetal development and pollen intine formation. |
| AT1G05520 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
| AT1G29060 | Encodes a golgi localized QcSNARE involved in response to salt and osmotic stress. Overexpression confers increased resistance to NaCl, mannitol and LiCl. SFT12 may act by mediating vacuolar sequestration of NaCl and other ions. |
| AT5G51460 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
| AT1G22490 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G49130 | MATE efflux family protein;(source:Araport11) |
| AT4G37390 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. May function as a negative component in auxin signaling by regulating auxin activity. |
| AT3G12300 | Similar to Bug22p in Paramecium, a conserved centrosomal/ciliary protein. This protein is widespread in eukaryotes harboring centrioles/cilia at some stage of their life cycles. Among eukaryotes devoid of centrioles/cilia, plants possess BUG22 genes whereas some fungi (at least ascomycetes) do not. |
| AT2G33510 | CFL1 is a negative regulator of cuticle development. Overexpression of CFL1 causes defects in cuticle formation. Interacts with FBH1, FBH3 and HDG1 to regulate cuticle formation. The physical interaction requires the C terminal 50 amino acids. |
| AT4G12130 | Encodes a mitochondrial COG0354 protein that requires folate for its function in Fe/S cluster biogenesis. |
| AT1G56190 | One of a pair of plastid localized phosphoglycerate kinases involved in galactolipid biosynthesis. Functions redundantly with AT3g12780 (PGK1) in the chloroplast in the biosynthesis of thylakoid membrane galactolipids. Double mutants are photosynthetically incompetent, plants are albino and seedling lethal. |
| AT2G04530 | Encodes a protein with RNAse Z activity suggesting a role in tRNA processing. Protein contains a signal sequence for import into the chloroplast. |
| AT5G46390 | C-terminal peptidase |
| AT1G59620 | Encodes CW9. |
| AT2G40140 | zinc finger (CCCH-type) family protein;(source:Araport11) |
| AT4G29200 | Over-expressed by salt stress. |
| AT1G56300 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G64620 | Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis. |
| AT3G01420 | Encodes an alpha-dioxygenase involved in protection against oxidative stress and cell death. Induced in response to Salicylic acid and oxidative stress. Independent of NPR1 in induction by salicylic acid. The mRNA is cell-to-cell mobile. |
| AT2G40340 | Encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT1G69890 | Encodes a member of a conserved DUF domain family that is induced by NO. Based on mutant phenotype may be involved in NO stress response. |
| AT1G07920 | GTP binding Elongation factor Tu family protein;(source:Araport11) |
| AT3G05210 | encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10. |
| AT1G19210 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT2G37640 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT1G60950 | encodes a major leaf ferredoxin |
| AT5G55000 | FH protein interacting protein FIP2 |
| AT1G12130 | Encodes a flavin-containing monooxygenases involved in biosynthesis of aliphatic glucosinolates. |
| AT3G13040 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
| AT2G14960 | encodes a protein similar to IAA-amido synthases. Lines carrying an insertion in this gene are hypersensitive to auxin. |
| AT1G76890 | encodes a plant trihelix DNA-binding protein |
| AT5G61840 | Encodes a UDP-Xyl:beta-(1,4)-xylosyl transferase. |
| AT1G08880 | Encodes HTA5, a histone H2A protein. H2AX is a meiosis-specific isoform of histone H2A. Upon DSB formation, rapid accumulation of phosphorylated H2AX (γ-H2AX) occurs around the break site. H2AX foci accumulate in early G2. Immunolocalization studies in spread preparations of wild-type meiocytes at G2/early leptotene revealed the accumulation of numerous rather diffuse γ-H2AX foci throughout the chromatin. However, their accumulation is not contemporaneous with that of AtSPO11-1. At 3 h post-S, no γ-H2AX foci are detected. During the 3- to 5-h window when AtSPO11-1 foci rapidly disappear, there is an equally swift accumulation of γ-H2AX to a maximum of >50 diffuse foci. The level of γH2AX then remains constant for a further 13 h before undergoing a gradual decrease to 10?20 foci in the 18- to 24-h post-S period. By 30 h the foci have disappeared from the chromatin. |
| AT5G47370 | homeobox-leucine zipper genes induced by auxin, but not by other phytohormones. Plays opposite roles in the shoot and root tissues in regulating auxin-mediated morphogenesis. |
| AT4G37790 | Encodes homeobox protein HAT22, member of the HD-Zip II family. The mRNA is cell-to-cell mobile. |
| AT1G09940 | Encodes glutamyl-tRNA reductase. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins |
| AT3G14930 | Uroporphyrinogen decarboxylase;(source:Araport11) |
| AT2G40490 | Uroporphyrinogen decarboxylase;(source:Araport11) |
| AT5G24580 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G40490 | HLP1 is a member of the conserved hnRNP A/B family and contains RNA Recognition Motifs (RRM).It binds mRNA and appears to be involved in targeting alternative polyadenylation (APA). APA targets include genes involved in flowering. Loss of HLP1 function results causes late flowering under long and short day conditions. This phenotype is suppressed by loss of FLC. |
| AT3G18035 | A linker histone like protein |
| AT1G59860 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT2G29500 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT1G07400 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT5G02570 | Histone superfamily protein;(source:Araport11) |
| AT3G46030 | Histone superfamily protein;(source:Araport11) |
| AT2G28720 | Histone superfamily protein;(source:Araport11) |
| AT2G37470 | Histone superfamily protein;(source:Araport11) |
| AT3G53650 | Histone superfamily protein;(source:Araport11) |
| AT3G09480 | Histone superfamily protein;(source:Araport11) |
| AT1G08170 | Histone superfamily protein;(source:Araport11) |
| AT3G45980 | Encodes a histone 2B (H2B) protein. This protein can be ubiquitinated in planta, and this modification depends on the HUB1 and HUB2 E3 ubiquitin ligases as well as the UBC1 and UBC2 E2 ubiquitin conjugating enzymes. Lysine 146 appears to be the site of the ubiquitin addition. |
| AT1G75600 | Histone superfamily protein;(source:Araport11) |
| AT1G13370 | Histone superfamily protein;(source:Araport11) |
| AT2G23430 | Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. |
| AT2G47350 | HIT zinc finger and PAPA-1-like domain-containing protein;(source:Araport11) |
| AT4G22220 | Encodes a mitochondrial protein similar to E.coli IscU. In bacteria, IscU is a scaffold protein accepting sulfur and iron to build a transient Fe-S cluster,which is subsequently transferred to a target apoprotein. |
| AT1G32130 | The C-terminal portion of this protein has high homology to the C-termini of the IWS1 (Interacts With Spt6) proteins found in yeast and humans. Interacts with transcription factor BES1. Involved in brassinosteroid-regulated gene expression. |
| AT1G70480 | Protein residing in the chloroplast outer membrane, has channel-like properties facilitating the export of the jasmonate precursor 12-oxophytodienoic acid (OPDA) from the chloroplast. |
| AT3G50240 | Encodes a kinesin-related protein. |
| AT5G15970 | Encodes a gene that can be induced by cold and abscisic acid and may be involved in cold acclimation and salt tolerance. The mRNA is cell-to-cell mobile. |
| AT3G23670 | Microtubule motor kinesin PAKRP1L/Kinesin-12B. Together with PAKRP1/Kinesin-12A, serve as linkers of the plus ends of antiparallel microtubules in the phragmoplast. |
| AT3G24750 | Encodes a member of the LAZY gene family that is expressed in the hypocotyl and the root |
| AT3G27025 | Encodes a member of the LAZY gene family that is expressed in the shoot apex. |
| AT1G25570 | Di-glucose binding protein with Leucine-rich repeat domain-containing protein;(source:Araport11) |
| AT3G22400 | Encodes lipoxygenase5 (LOX5). LOX5 activity in roots facilitates green peach aphid colonization of Arabidopsis foliage by promoting green peach aphid feeding from sieve element and water consumption from xylem. |
| AT2G41280 | Encodes a hydrophilic protein similar to Late Embryogenesis Activated (LEA) proteins expressed during embryogenesis, which are thought to be involved in the acquisition of desiccation tolerance. |
| AT1G11090 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G16120 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G18360 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G03090 | MCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion. |
| AT4G36820 | Mitochondrial calcium channel. |
| AT1G23360 | Encodes a 2-phytyl-1,4-naphthoquinone methyltransferase that catalyzes the final step in phylloquinone (vitamin K1) biosynthesis. |
| AT4G01883 | Polyketide cyclase / dehydrase and lipid transport protein;(source:Araport11) |
| AT3G02090 | Insulinase (Peptidase family M16) protein;(source:Araport11) |
| AT2G34620 | Mitochondrial transcription termination factor family member. |
| AT4G09620 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT5G23930 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT5G55580 | Encodes a mitochondrial transcription termination factor (mTERF) family protein. The gene product is targeted to the chloroplast nucleoid and mutants are affected in plastid gene expression and chloroplast development. Mutants, named as twirt1 (twr-1), display altered root meristem function resulting in short roots. Mutation also affects shoot meristem function. |
| AT2G39450 | Encodes a Golgi-localized manganese transporter that is involved in Mn tolerance. When expressed into yeast cells, this gene confer Mn2+ and Cu2+ tolerance. |
| AT2G40970 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G04370 | A member of the Arabidopsis SABATH methyltransferase gene family. Encodes NAMT1, a methyltransferase that methylates nicotinic acid to yield methyl nicotinate. |
| AT2G28250 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G20800 | Cell differentiation, Rcd1-like protein;(source:Araport11) |
| AT5G47800 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT2G15430 | Non-catalytic subunit of nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB3 and the E. coli RNA polymerase alpha subunit. A closely related paralog, encoded by At2g15400, can substitute for At2g15430 in the context of Pol V. |
| AT4G14660 | Non-catalytic subunit specific to DNA-directed RNA polymerase V; homologous to budding yeast RPB7 |
| AT4G17300 | Asparaginyl-tRNA synthetase protein involved in amino acid activation/protein synthesis. |
| AT1G05500 | Encodes a endomembrane-localized synaptotagmin. Synaptotagmin family proteins are calcium sensors that regulate exocytosis in mammalian cells. |
| AT3G61690 | Putative TNAase |
| AT3G57990 | Encodes a ?-barrel protein, named OEP40, locates in in the outer envelope of chloroplasts, and functions as a solute channel which is selectively permeable for glucose. |
| AT5G22240 | Ovate family protein;(source:Araport11) |
| AT5G51740 | Mitochondrial ATP-independent protease .Important for maintenance of proper function of the oxphos system. |
| AT4G35870 | early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT3G44370 | Member of the Oxa1 super family protein insertases.It is structurally distinct having a tetratricopeptide repeat (TPR) domain at the C terminus. Paralog of OXA2a. Involved in biogenesis of mitochondrial respiratory chain complex IV, specifically via membrane insertion of COX2. |
| AT2G35795 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G30690 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT4G09160 | PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells. |
| AT5G18610 | Encodes a receptor-like cytoplasmic kinase that is an immediate downstream component of the chitin receptor CERK1 and contributes to the regulation of chitin-induced immunity. |
| AT1G66630 | Protein with RING/U-box and TRAF-like domain;(source:Araport11) |
| AT5G07500 | Encodes an embryo-specific zinc finger transcription factor required for heart-stage embryo formation. |
| AT4G22890 | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I). The mRNA is cell-to-cell mobile. |
| AT5G61120 | PHD finger-containing protein. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
| AT5G19390 | Encodes a protein with similarity to REN1, a Rho GTPase activating protein.It is cytoplasmic and plasma membrane associated in interphase, but during mitosis localizes to the CDZ/CDS in a POK-dependent manner. |
| AT5G65370 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT2G01600 | ANTH domain-containing protein which functions as adaptor protein for clathrin-mediated endocytosis (CME) of the secretory vesicle-associated longintype R-SNARE VAMP72 group. Interacts with the SNARE domain of VAMP72 and clathrin at the plasma membrane. Required for recycling of R-SNARE proteins. |
| AT2G25430 | AP180 N-terminal homology domain, TPLATE complex protein involved in clathrin-mediated endocytosis. |
| AT1G21000 | PLATZ transcription factor family protein;(source:Araport11) |
| AT5G47400 | sphingomyelin phosphodiesterase;(source:Araport11) |
| AT1G33612 | Encodes a receptor for the Plant Natriuretic Peptide (At2g18660, AtPNP-A). The receptor contains a functional guanylyl cyclase catalytic center embedded in the cytosolic kinase domain. This catalytic center can convert GTP into cGMP (and PPi) which enables ligand-specific downstream signalling. It is therefore consistent with the reported cGMP dependence of AtPNP-A effects (see DOI:10.1007/s11103-016-0465-8). |
| AT3G13720 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
| AT4G21960 | Encodes AT4g21960 (AT4g21960/T8O5_170). The mRNA is cell-to-cell mobile. |
| AT5G64040 | Encodes the only subunit of photosystem I located entirely in the thylakoid lumen. May be involved in the interaction between plastocyanin and the photosystem I complex. Phosphorylation of this protein is dependent on calcium. |
| AT1G03600 | PSB27 is a chloroplast lumen localized protein that is involved in adaptation to changes in light intensity. |
| AT5G01830 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G37490 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT2G45910 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT2G19410 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G65500 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G51270 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G56040 | HEAT/U-box protein;(source:Araport11) |
| AT2G40640 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G16630 | DNA repair protein Rad4 family;(source:Araport11) |
| AT2G33680 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G74730 | Encodes a grana core localized protein, is homologous to RIG1. Mutant plants have reduced NPQ, affected organization of light-havesting complex II and an enhanced grana stacking. |
| AT1G71980 | RMR2 is a secretory pathway protein localized to the trans-golgi network. It belongs to a family of vacuolar sorting receptors. If forms heterodimers with RMR1. |
| AT3G13740 | Encodes one of two chloroplast Mini-RNase III-like enzymes in Arabidopsis. Double mutants display imprecise maturation of 23S rRNA and other rRNAs. |
| AT5G11930 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
| AT4G33040 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
| AT3G21460 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT5G45400 | Replication factor-A protein 1-like protein;(source:Araport11) |
| AT5G28060 | Ribosomal protein S24e family protein;(source:Araport11) |
| AT4G29390 | Ribosomal protein S30 family protein;(source:Araport11) |
| AT1G58520 | GDSL-like lipase/acylhydrolase superfamily protein;(source:Araport11) |
| AT4G08685 | Encodes a protein, expressed in leaves, with similarity to pollen allergens. The mRNA is cell-to-cell mobile. |
| AT1G22870 | One of two paralogs in Arabidopsis.Loss of both SCYL2B and SCYL2A results in severe growth defects. |
| AT3G63460 | Together with SEC31A a component of the coat protein complex II (COPII) which promotes the formation of transport vesicles from the endoplasmic reticulum (ER). |
| AT4G22290 | Paralog of SHOU4-like. Predicted transmembrane protein. |
| AT1G07140 | Encodes a putative Ran-binding protein (siRanBP). |
| AT1G21410 | AtSKP2;1 is a homolog of human SKP2, the human F-box protein that recruits E2F1. Contains an F-box motif at the N-terminal region and a C-terminal Leu-rich repeat domain. Forms part of an E3-ubiquitin-ligase SCF (Skp1, cullin, F-box) complex and recruits phosphorylated AtE2Fc, a transcriptional factor that might play a role in cell division and during the transition from skotomorphogenesis to photomorphogenesis. AtSKP2;1 (At1g21410) and AtSKP2;2 (At1g77000) may be duplicated genes. |
| AT1G77000 | AtSKP2;2 is a homolog of human SKP2, the human F-box protein that recruits E2F1. Contains an F-box motif at the N-terminal region and a C-terminal Leu-rich repeat domain. Forms part of an E3-ubiquitin-ligase SCF (Skp1, cullin, F-box) complex and recruits phosphorylated AtE2Fc, a transcriptional factor that might play a role in cell division and during the transition from skotomorphogenesis to photomorphogenesis. AtSKP2;1 (At1g21410) and AtSKP2;2 (At1g77000) may be duplicated genes. AtSKP2b may also be involved in the degradation of KRP1/ICK1, a CDK inhibitor. |
| AT4G12420 | Encodes a protein of unknown function involved in directed root tip growth. It is a member of 19-member gene family and is distantly related structurally to the multiple-copper oxidases ascorbate oxidase and laccase, though it lacks the copper-binding domains. The protein is glycosylated and GPI-anchored. It is localized to the plasma membrane and the cell wall. The gene is expressed most strongly in expanding tissues. |
| AT2G28330 | hypothetical protein;(source:Araport11) |
| AT1G51355 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
| AT1G14200 | E3 ligase involved in the regulation of the homeostasis of sensor NLR immune receptors. |
| AT3G17520 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT1G71890 | Encodes a sucrose transporter that is expressed in the endosperm. Mutants have delayed accumulation of fatty acids and embryo maturation. |
| AT1G23090 | Encodes AST91 mRNA for sulfate transporter. |
| AT5G65300 | Gene of unknown function. Expression is induced by a variety of biotic (P. syringae) and abiotic stresses (salt, ABA,IAA, and more.)Member of a small family that includes AT1G35210, AT1G72240, and AT1G22470.Mutants have no obvious loss of function phenotype but overexpressors are early flowering. |
| AT3G04380 | Encodes SUVR4, a nucleolar histone methyltransferase with preference for monomethylated H3K9. One of the four closely related Arabidopsis SUVR proteins that belong to the SU(VAR)3-9 subgroup of SET-domain proteins. Proteins containing the evolutionarily conserved SET domain are involved in regulation of eukaryotic gene expression and chromatin structure through their histone lysine methyltransferase (HMTase) activity. SUVR1, SUVR2 and SUVR4 proteins contain a novel domain at their N-terminus, and a SUVR specific region preceding the SET domain. |
| AT4G25010 | Encodes a member of the SWEET sucrose efflux transporter family proteins. Together with SWEET13, it is likely involved in modulating the GA response and is required for proper development of anthers, seeds and seedlings. |
| AT1G66770 | Nodulin MtN3 family protein;(source:Araport11) |
| AT5G40260 | Encodes RPG1 (RUPTURED POLLEN GRAIN1), a member of the MtN3/saliva gene family. Crucial for exine pattern formation and cell integrity of microspores. |
| AT4G34290 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
| AT5G40840 | Cohesion family protein SYN2 (SYN2). Plays a role in somatic DNA double strand break damage repair. |
| AT5G11100 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT1G29310 | SecY protein transport family protein;(source:Araport11) |
| AT5G15570 | Bromodomain transcription factor;(source:Araport11) |
| AT4G23050 | PAS domain-containing protein tyrosine kinase family protein;(source:Araport11) |
| AT1G12250 | Pentapeptide repeat-containing protein;(source:Araport11) |
| AT5G25100 | Endomembrane protein 70 protein family;(source:Araport11) |
| AT5G15510 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
| AT1G30660 | A truncated version of Twinkle that retains only the DNA primase domain. |
| AT2G41160 | ATI3A interacting protein containing a large N-terminal rhomboid-like transmembrane domain and a UBA domain at their C terminus, localized in the ER with a role in plant heat tolerance. UBAC2 proteins may act as both cargo receptors and inducers of an ATI3-mediated selective autophagy pathway, where ATI3 and UBAC2 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
| AT4G15480 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
| AT4G15490 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
| AT1G16780 | Encodes a type II H+-PPases that localizes to and function as a proton pump of the Golgi apparatus in most tissues except for mature leaves. |
| AT4G19490 | Putative homolog of yeast Vps54. Thought to associate with POK and ATVPS53 in a plant GARP-like complex involved in the membrane trafficking system. |
| AT3G14370 | The WAG2 and its homolog, WAG1 each encodes protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT4G18600 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
| AT4G27260 | encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. It is involved in camalexin biosynthesis via conjugating indole-3-carboxylic acid (ICA) and cysteine (Cys). The mRNA is cell-to-cell mobile. |
| AT5G65130 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT4G01720 | member of WRKY Transcription Factor; Group II-b |
| AT4G28710 | member of Myosin-like proteins The mRNA is cell-to-cell mobile. |
| AT2G46520 | cellular apoptosis susceptibility protein, putative / importin-alpha re-exporter;(source:Araport11) |
| AT1G51510 | This gene is predicted to encode a protein involved in the exon junction complex. Though there is a predicted RNA binding motif, in the Drosophila ortholog (33% identity), this motif mediates interactions with Mago and is not available for RNA binding. The Arabidopsis Y14 protein appears to be predominantly nucleolar, but there is also some evidence for its presence in the cytoplasm. |
| AT5G21920 | One of four Arabidopsis homologs of bacterial ymlg proteins. |
| AT3G57720 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G58270 | ZW9 mRNA, complete cds The mRNA is cell-to-cell mobile. |
| AT5G19820 | Encodes an importin that transports HYL1, a component of the microprocessor, from the cytoplasm to the nucleus to constitute functional microprocessor, thereby affecting miRNA processing. Knockdown amiR mutants significantly reduced nuclear portion of HYL1 protein and correspondingly compromised the pri-miRNA processing in the nucleus.KETCH1 may protect RPs from the 26S proteasome-mediated degradation. |
| AT4G26200 | Member of a family of proteins in Arabidopsis that encode 1-Amino-cyclopropane-1-carboxylate synthase, an enzyme involved in ethylene biosynthesis. Not expressed in response to IAA. |
| AT1G48130 | encodes a protein similar to the 1-cysteine (1-Cys) peroxiredoxin family of antioxidants. Expression is limited to seed (aleurone and embryo) and is not induced by ABA or drought. |
| AT2G26420 | Encodes a phosphatidylinositol-4-phosphate 5-kinase. Exclusively expressed in roots. Essential for root hair growth. |
| AT1G01120 | Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis. |
| AT2G26250 | epidermis-specific, encodes KCS10, a putative 3-ketoacyl-CoA synthase. probably involved in the synthesis of long-chain lipids found in the cuticle. |
| AT1G04220 | Encodes KCS2, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G07720 | Encodes KCS3, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G68530 | Encodes KCS6, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT4G24770 | Encodes a chloroplast RNA-binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). Required for editing and stability of specific chloroplast mRNAs. |
| AT1G51680 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. In addition to 4-coumarate, it also converts ferulate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, ferulic acid, caffeic acid and 5-OH-ferulic acid. At4CL1 was unable to use sinapic acid as substrate. |
| AT1G48860 | 5-enolpyruvylshikimate-3-phosphate synthase involved in shikimic acid biosynthesis. |
| AT4G00810 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
| AT1G04620 | Encodes a 7-hydroxymethyl chlorophyll a reductase, an enzyme of the chlorophyll cycle that converts 7-hydroxymethyl chlorophyll a to chlorophyll a. |
| AT5G40010 | Encodes a mitochondrial ATPase involved in seed and silique development. |
| AT5G57050 | Encodes a protein phosphatase 2C and is involved in ABA signal transduction. Binds fibrillin preprotein in vitro and in vivo. |
| AT3G24650 | Homologous to the maize transcription factor Viviparous-1. Full length ABI3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of ABI3 requires the B3 DNA-binding domain and an activation domain. In addition to the known N-terminal-located activation domain, a second transcription activation domain was found in the B1 region of ABI3. ABI3 is essential for seed maturation. Regulator of the transition between embryo maturation and early seedling development. Putative seed-specific transcriptional activator. ABI3 is a central regulator in ABA signaling and is unstable in vivo. It interacts with and can by polyubiquitinated by AIP2 in vivo. Based on double mutant analyses, ABI3 interacts genetically with both FUS3 and LEC1 and is involved in controlling accumulation of chlorophyll and anthocyanins, sensitivity to abscisic acid, and expression of the members of the 12S storage protein gene family. In addition, both FUS3 and LEC1 regulate positively the abundance of the ABI3 protein in the seed. Alternative splicing of ABI3 is developmentally regulated by SUA (AT3G54230). |
| AT2G40220 | Encodes a member of the DREB subfamily A-3 of ERF/AP2 transcription factor family (ABI4). The protein contains one AP2 domain. There is only one member in this family. Involved in abscisic acid (ABA) signal transduction, ABA-mediated glucose response, and hexokinase-dependent sugar responses. Acts downstream of GUN1 in retrograde signaling. Expressed most abundantly in developing siliques and to a lesser degree in seedlings. |
| AT2G36270 | Encodes a member of the basic leucine zipper transcription factor family, involved in ABA signalling during seed maturation and germination. The Arabidopsis abscisic acid (ABA)-insensitive abi5 mutants have pleiotropic defects in ABA response, including decreased sensitivity to ABA inhibition of germination and altered expression of some ABA-regulated genes. Comparison of seed and ABA-inducible vegetative gene expression in wild-type and abi5-1 plants indicates that ABI5 regulates a subset of late embryogenesis-abundant genes during both developmental stages. Responsible for reducing cadmium uptake, mediated by interaction with MYB49 . |
| AT5G01520 | Encodes a cytosolic RING-type E3 ubiquitin (Ub) ligase that is critical for ABA and high salinity responses during germination. AtAIRP2 and SDIR1 likely play a combinatory role in ABA signaling and the response to high salt in Arabidopsis. |
| AT5G51760 | Encodes AHG1 (ABA-hypersensitive germination 1), a putative protein phosphatase 2C (PP2C). Expressed in seeds. AHG1 functions in seed development and germination. |
| AT5G50360 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G63350 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT3G18950 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G49450 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G02480 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT1G05805 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G64940 | ABC1K8 is a member of an atypical protein kinase family that is induced by heavy metals. Loss of function mutations affect the metabolic profile of chloroplast lipids. It appears to function along with ABC1K7 in mediating lipid membrane changes in response to stress. The mRNA is cell-to-cell mobile. |
| AT1G69260 | ABI five binding protein;(source:Araport11) |
| AT1G13740 | Encodes a member of a small plant-specific gene family whose members interact with ABI5 and appear to be involved in mediating stress responses. AFP2 mutants affect a number of ABA mediated processes such as germination and response to osmotic and sugar stress. AFP2 nuclear localization is stress dependent. |
| AT3G29575 | ABI five binding protein 3;(source:Araport11) |
| AT2G46225 | Encodes a subunit of the WAVE complex. The WAVE complex is required for activation of ARP2/3 complex which functions in actin microfilament nucleation and branching. One of four ABI-like proteins. |
| AT1G62340 | Subtilisin-like serine protease required for epidermal surface formation in embryos and juvenile plants |
| AT1G68810 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G57790 | Encodes a nuclear localized protein of unknown function that is involved in pollen and embryo sac development. |
| AT4G34000 | Encodes an ABA-responsive element-binding protein with similarity to transcription factors that is expressed in response to stress and abscisic acid. |
| AT4G37000 | Mutants have spontaneous spreading cell death lesions and constitutive activation of defenses in the absence of pathogen infection. Its product was shown to display red chlorophyll catabolite reductase (RCCR), which catalyzes one step in the breakdown of the porphyrin component of chlorophyll. The enzyme was further assessed to be a Type-1 (pFCC-1-producing) RCCR.Upon P. syringae infection, ACD2 localization shifts from being largely in chloroplasts to partitioning to chloroplasts, mitochondria, and to a small extent, cytosol. Overexpression of ACD2 delayed cell death and the replication of P. syringae. |
| AT5G61930 | ACCUMULATION OF PHOTOSYSTEM ONE 3 |
| AT4G25650 | Similar to ACD1. Leaves of antisense ACD1-like plants turn yellow in darkness like wild-type whereas antisense ACD1 plants remain dark after five days of dark treatment. |
| AT5G48230 | Encodes an acetoacetyl-CoA thiolase that generates the bulk of the acetoacetyl-CoA precursor needed for the cytosolic localized, mevalonate-derived isoprenoids biosynthetic pathway. Loss-of-function mutants are embryo lethal. |
| AT3G03480 | acetyl CoA:(Z)-3-hexen-1-ol acetyltransferase;(source:Araport11) |
| AT5G65890 | Member of ACT domain containing protein family. ACT domains are amino acid binding domains. Shows strongest expression in flowers and siliques. |
| AT2G03730 | Member of a small family of ACT domain containing proteins. ACT domains are thought to be involved in amino acid binding. |
| AT3G01990 | Member of a small family of ACT domain containing proteins in Arabidopsis. ACT domains are involved in amino acid binding. |
| AT4G22780 | Member of a family of ACT domain containing proteins . ACT domains are involved in amino acid binding . |
| AT1G12420 | ACT domain repeat 8;(source:Araport11) |
| AT5G59880 | Encodes actin depolymerizing factor 3 (ADF3). |
| AT3G46520 | Member of actin subclass composed of ACT12 and ACT4. RNA is expressed at very low levels in vegetative organs, low levels in flowers and very high levels in pollen. Expression of an ACT12/GUS fusion was found in vascular tissues, tapetum, developing and mature pollen, the root cap and in a ring of pericycle tissues during lateral root initiation and early development. |
| AT5G56180 | encodes a protein whose sequence is similar to actin-related proteins (ARPs) in other organisms. Member of nuclear ARP family of genes. |
| AT2G33385 | actin-related protein C2B;(source:Araport11) |
| AT1G60430 | actin-related protein C3;(source:Araport11) |
| AT1G74500 | Encodes a basic helix/loop/helix transcription factor that acts downstream of MP in root initiation. TMO7 protein moves to the hypophysis and to vascular cells, contributing to MP-dependent root formation. Promotes the correct definition of the hypophysis cell division plane. |
| AT1G20560 | acyl activating enzyme 1;(source:Araport11) |
| AT5G16370 | acyl activating enzyme 5;(source:Araport11) |
| AT1G30520 | Encodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal. |
| AT5G23050 | acyl-activating enzyme 17;(source:Araport11) |
| AT3G48990 | Encodes an oxalyl-CoA synthetase and is required for oxalate degradation, for normal seed development, and for defense against an oxalate-producing fungal pathogen. |
| AT3G16910 | Encodes a peroxisomal protein with acetyl-CoA synthetase activity that is responsible for the activation of acetate for entry into the glyoxylate cycle. |
| AT5G65110 | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. |
| AT3G50860 | Clathrin adaptor complex small chain family protein;(source:Araport11) |
| AT2G19790 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
| AT1G80050 | Encodes an adenosine phosphoribosyl transferase(E.C:2.4.2.7), a constitutively expressed enzyme involved in the one-step salvage of adenine to AMP. This isozyme has high affinity for cytokinins and is likely to be localized to the cytosol. |
| AT2G37250 | encodes adenylate kinase that is located in the chloroplast involved in the coordination of metabolism and growth |
| AT2G24765 | GTPase required for Golgi targeting of GRIP domain proteins. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner |
| AT3G49870 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
| AT1G22130 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL104 is expressed in pollen.It forms heterodimers with other MICK family members (AGL65 and AGL30). Involved in late stages of pollen development and pollen tube growth. |
| AT2G22630 | Encodes a MADs domain containing protein involved in promoting flowering. Loss of function mutations show delayed flowering in long days and reduced levels of LFY and AP1 expression. |
| AT4G22950 | MADS-box protein AGL19 |
| AT4G37940 | encodes a MADS box protein, highly expressed in the root. |
| AT2G26320 | AGAMOUS-like 33;(source:Araport11) |
| AT5G26650 | AGAMOUS-like 36;(source:Araport11) |
| AT2G14210 | MADS box gene, transcription factor |
| AT2G45650 | Sequence suggests this encodes a MADS-box transcription factor. Negatively regulates the FLC/MAF clade genes and positively regulates FT in Arabidopsis. |
| AT1G72350 | MADS-box transcription factor family protein;(source:Araport11) |
| AT1G77980 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL66 is expressed in pollen.It forms heterodimers with other MICK family members (AGL104). Involved in late stages of pollen development and pollen tube growth. |
| AT1G77950 | Cooperates with the histone mark reader EBS to modulate seed germination under high temperature. |
| AT2G15660 | AGAMOUS-like 95;(source:Araport11) |
| AT5G04640 | AGAMOUS-like 99;(source:Araport11) |
| AT5G10510 | Encodes an AP2-domain transcription factor involved in root stem cell identity and root development. It is also required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions. Intronic sequences are required for its expression in flowers.Acts redundantly with PLT5 and 7 in lateral root pattern formation. |
| AT5G65510 | Encodes one of three PLETHORA transcription factors required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions. |
| AT4G39660 | alanine:glyoxylate aminotransferase 2 homolog (AGT2). The mRNA is cell-to-cell mobile. |
| AT2G38400 | alanine:glyoxylate aminotransferase 2 homolog (AGT3) mRNA, |
| AT2G28800 | member of Chloroplast membrane protein ALBINO3 family. Similar to pea PPF1 and may play a role in plant senescence. |
| AT4G01800 | Encodes the ATPase subunit of the chloroplast Sec translocation machinery which plays an essential role in chloroplast biogenesis and the regulation of photosynthesis, the absence of which triggers a retrograde signal, eventually leading to a reprogramming of chloroplast and mitochondrial gene expression. |
| AT1G77120 | Catalyzes the reduction of acetaldehyde using NADH as reductant. Requires zinc for activity. Dimer. Anaerobic response polypeptide (ANP). Fermentation. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. The mRNA is cell-to-cell mobile. |
| AT3G48170 | ALDH10A9 encodes a protein that can function as a betaine aldehyde dehydrogenase in vitro. The C-terminal amino acids of this protein direct GFP to the peroxisome suggesting that ALDH10A9 accumulates in this organelle. ALDH10A9 transcript levels rise in response to ABA, NaCl, chilling, methyl viologen, and dehydration stress. The enzyme can catalyze the formation of glycine betaine in vitro, but there are still questions about whether Arabidopsis makes this protective compound under natural conditions. This enzyme may be involved in oxidizing aminoaldehydes formed through polyamine metabolism. |
| AT3G66658 | Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures. |
| AT3G24503 | Arabidopsis thaliana aldehyde dehydrogenase AtALDH1a mRNA. a sinapaldehyde dehydrogenase catalyzes both the oxidation of coniferylaldehyde and sinapaldehyde forming ferulic acid and sinapic acid, respectively |
| AT1G44170 | Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. It is also able to oxidize beta-unsaturated aldehydes, but not aromatic aldehydes. Activity of ALDH3H1 is NAD +-dependent. |
| AT4G34240 | Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. It is also able to oxidize beta-unsaturated aldehydes, but not aromatic aldehydes. ALDH3I1 was able to use both NAD+ and NADP+ as cofactors. |
| AT1G79440 | Encodes a mitochondrial succinic semialdehyde dehydrogenase (SSADH). Nomenclature according to Kirch, et al (2004). |
| AT5G60360 | Encodes a senescence-associated thiol protease. The mRNA is cell-to-cell mobile. |
| AT4G34860 | Plant neutral invertase family protein;(source:Araport11) |
| AT3G06500 | Encodes an alkaline/neutral invertase which localizes in mitochondria. It may be modulating hormone balance in relation to the radicle emergence. Mutants display severely reduced shoot growth and reduced oxygen consumption. Mutant root development is not affected as reported for A/N-InvA mutant (inva) plants. The mRNA is cell-to-cell mobile. |
| AT4G20070 | The gene encoding Arabidopsis thaliana Allantoate Amidohydrolase (AtAAH)which catalyzes the allantoate deiminase reaction (EC 3.5.3.9)is expressed in all parts of the plant being consistent with a function in purine turnover in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT1G73680 | Encodes an alpha dioxygenase. Recombinant protein catalyzes the conversion of a wide range of fatty acids into 2(R)-hydroperoxy derivatives. |
| AT1G69830 | Encodes a plastid-localized α-amylase. Expression is reduced in the SEX4 mutant. Loss of function mutations show normal diurnal pattern of starch accumulation/degradation. Expression follows circadian rhythms. |
| AT3G29320 | Encodes a plastidic alpha-glucan phosphorylase. In vitro, the enzyme has a preference for maltooligosaccharides, such as maltoheptaose. The mRNA is cell-to-cell mobile. |
| AT3G46970 | Encodes a cytosolic alpha-glucan phosphorylase. In vitro, the enzyme has a preference for branched polysaccharides, such as glycogen. |
| AT2G25940 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteinases that is expressed in vegetative organs and is upregulated in association with various types of cell death and under stressed conditions. |
| AT1G18460 | Alpha/beta hydrolase |
| AT2G24100 | ATP-dependent DNA helicase;(source:Araport11) |
| AT1G01520 | RVE3 is one of eleven homologous MYB-like transcription factors in Arabidopsis and a member of the RVE8 clade. Plays a minor role in clock regulation. |
| AT1G07180 | Internal NAD(P)H dehydrogenase in mitochondria. The predicted protein sequence has high homology with other designated NAD(P)H DHs from microorganisms; the capacity for matrix NAD(P)H oxidation via the rotenone-insensitive pathway is significantly reduced in the Atndi1 mutant plant line; the in vitro translation product of AtNDI1 is imported into isolated mitochondria and located on the inside of the inner membrane. |
| AT3G22370 | Encodes AOX1a, an isoform of alternative oxidase that is expressed in rosettes, flowers, and root. The alternative oxidase of plant mitochondria transfers electrons from the ubiquinone pool to oxygen without energy conservations. It is regulated through transcriptional control and by pyruvate. Plays a role in shoot acclimation to low temperature. Also is capable of ameliorating reactive oxygen species production when the cytochrome pathway is inhibited. AOX1a also functions as a marker for mitochondrial retrograde response. The mRNA is cell-to-cell mobile. |
| AT1G32350 | alternative oxidase 1D;(source:Araport11) |
| AT2G37330 | Encodes an ABC transporter-like protein, without an ATPase domain, required for aluminum (Al) resistance/tolerance and may function to redistribute accumulated Al away from sensitive tissues in order to protect the growing root from the toxic effects of Al. |
| AT5G27610 | protein ALWAYS EARLY 1;(source:Araport11) |
| AT4G14940 | atao1 gene of Arabidopsis thaliana encodes an extracellular copper amine oxidase expressed during early stages of vascular tissue development. |
| AT5G23810 | Encodes nonfunctional amino acid transporter. AAP7 is the most distantly related member of the AAP family, a group of well characterized amino acid transporters within the ATF1 superfamily. Expression of this gene has not been detected with RNA gel blots or promoter GUS studies. |
| AT1G13560 | Encodes aminoalcoholphosphotransferase AAPT1. |
| AT1G17500 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein. ALA4 acts redundantly with ALA3, ALA5, ALA9, ALA10 and ALA11 in root and shoot development |
| AT3G27870 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
| AT1G64780 | encodes an ammonium transporter protein believed to act as a high affinity transporter. It is expressed in the root, primarily in endodermal and cortical cells, and contributes to ammonium uptake in the root. |
| AT3G24300 | Encodes a plasma membrane localized ammonium transporter. |
| AT1G35720 | Encodes a member of the annexin gene family, a diverse, multigene family of calcium-dependent, membrane-binding proteins. The protein was determined to have peroxidase activity. This activity is thought to be dependent on the presence of post-translational modifications (most likely phosphorylation). The protein was shown to be present as a mixture of monomer and homodimer. The homodimerization seems to be dependent on the presence of Ca2+ or H2O2. The dimerization was prevented by the addition of DTT, β-mercaptoethanol and TCEP. Annat1 mRNA is expressed in flowers, roots,leaves and stems and is most abundant in stems. mRNA levels are increased in response to oxidative stress. Developmental expression patterns suggest a role in Golgi-mediated polysaccharide secretion. It is a Ca 2+-permeable transporter providing a molecular link between reactive oxygen species and cytosolic Ca 2+ in plants. The mRNA is cell-to-cell mobile. |
| AT2G38760 | Annexins are calcium binding proteins that are localized in the cytoplasm. When cytosolic Ca2+ increases, they relocate to the plasma membrane. The mRNA is cell-to-cell mobile. |
| AT4G36920 | Encodes a floral homeotic gene, a member of the AP2/EREBP (ethylene responsive element binding protein) class of transcription factors and is involved in the specification of floral organ identity, establishment of floral meristem identity, suppression of floral meristem indeterminancy, and development of the ovule and seed coat. AP2 also has a role in controlling seed mass. Dominant negative allele I28, revealed a function in meristem maintenance-mutant meristems are smaller than normal siblings. AP2 appears to act on the WUS-CLV pathway in an AG independent manner. |
| AT5G10760 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G39940 | adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete The mRNA is cell-to-cell mobile. |
| AT2G41460 | Apurinic endonuclease-redox protein. It functions as an apurinic/apyrimidinic class II endonuclease, and is involved in DNA repair. |
| AT4G38220 | Peptidase M20/M25/M40 family protein;(source:Araport11) |
| AT3G14180 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT1G62700 | Encodes a NAC-domain transcription factor. Expressed in the vascular tissue. |
| AT5G18270 | NAC domain containing protein 87;(source:Araport11) |
| AT1G09730 | Encodes a SUMO protease that positively regulates the transition to flowering in long and short days. Along with SPF2, its activity is required for fertility as asp1/spf2 double mutants have defects in gametogenesis and embroygenesis. |
| AT1G72200 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G40070 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09120 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G34990 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G42350 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G42360 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G23980 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G57750 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G18670 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G27940 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G47560 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G07040 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G35910 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G24015 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G28920 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G41450 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G44578 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G04360 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G05200 | Encodes a putative RING-H2 zinc finger protein ATL6 (ATL6). The mRNA is cell-to-cell mobile. |
| AT2G35000 | ATL9 is an E3 ligase-like protein that is induced by chitin oligomers and contributes to fungal resistance.It differs from other members of the ATL family in that it has a PEST domain. It is a short lived protein that is subject to proteosome mediated degradation. It is expressed in many aerial tissues in a pattern that varies with developmental stage. |
| AT5G64310 | Encodes arabinogalactan-protein (AGP1). The mRNA is cell-to-cell mobile. |
| AT4G09030 | Encodes arabinogalactan protein (AGP10). The mRNA is cell-to-cell mobile. |
| AT2G22470 | Encodes arabinogalactan-protein (AGP2). |
| AT5G10430 | Encodes arabinogalactan-protein (AGP4) that is expressed in female reproductive tissues. It is involved in promoting degeneration of the persistent synergid after fertilization. In mutant ovules, the persistent synergid does not degrade resulting in polytuby. |
| AT5G65390 | arabinogalactan protein 7;(source:Araport11) |
| AT1G48410 | Encodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus. |
| AT1G31280 | Encodes Argonaute gene that binds viral siRNAs and is involved in antiviral defense response. Regulates innate immunity.Mutants have increased susceptibility to Potato virus X and tobacco rattle virus. |
| AT1G31290 | ARGONAUTE 3;(source:Araport11) |
| AT1G16060 | Encodes ADAP, an AP2-domain protein that interacts with ARIA. ADAP is a positive regulator of the ABA response and is also involved in regulating seedling growth. |
| AT1G63760 | pseudogene of RING/U-box superfamily protein;(source:Araport11) |
| AT5G66200 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT4G36030 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT3G44720 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile. |
| AT5G22630 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile. |
| AT3G11900 | encodes an amino acid transporter that transports aromatic and neutral amino acids, IAA, and 2,4-D. Expressed in all tissues with highest abundance in flowers and cauline leaves. a member of a small gene family in Arabidopsis and represents a new class of amino acid transporters. |
| AT2G16220 | Stress induced gene. Mutants show increased sensitivity to arsenate. |
| AT1G68310 | Encodes a protein that has been shown to specifically interact with a sequence motif, PIEPPPHH, in the cytoplasmic tail of a membrane protein that directs the protein from the ER to vacuoles where it is internalized. Required for both leaf adaxial?abaxial polarity formation and normal cell proliferation. It is part of a protein complex with CIA1, NAR1, and MET18, which are highly conserved in eukaryotes and are involved in the biogenesis of cytosolic and nuclear Fe-S proteins. |
| AT3G09640 | Encodes a cytosolic ascorbate peroxidase APX2. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
| AT5G42050 | Stress responsive asparagine-rich protein. Binds to PevD (Verticillium dahliae ) fungal effector protein. NRP interacts with CRY2, leading to increased cytoplasmic accumulation of CRY2 in a blue light-independent manner (PMID:28633330).NRP also binds FyPP3 and recruits it to endosomes and thus targets it for degradation. |
| AT5G11520 | Encodes the chloroplastic isozyme of aspartate aminotransferase. Involved in aspartate biosynthesis and nitrogen metabolism. mRNA is expressed in senescing leaves. |
| AT1G31230 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
| AT4G19710 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
| AT3G18490 | Encodes ASPG1 (ASPARTIC PROTEASE IN GUARD CELL 1). Functions in drought avoidance through abscisic acid (ABA) signalling in guard cells. |
| AT2G37630 | Encodes a MYB-domain protein involved in specification of the leaf proximodistal axis. Mutation results in lobed and dissected leaves with a characteristic asymmetry. Homologous to the Antirrhinum PHANTASTICA (PHAN) and maize ROUGH SHEATH2 (RS2) genes Asymmetric placement of auxin response at the distal leaf tip precedes visible asymmetric leaf growth. Acts alongside AXR1 to exclude BP expression in leaves and with PIN1 to repress BP and promote lateral organ growth. Interacts physically with AS2 to form a complex that binds to the BP promoter and silences BP. Also functions as a regulator of the plant immune response. |
| AT3G60870 | Encodes an AT hook domain containing protein that, when overexpressed, delays flowering. Los s of function mutations have defects in primary and lateral root development. |
| AT5G49700 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
| AT2G35270 | Direct target of AGAMOUS. Regulates patterning and differentiation of reproductive organs. |
| AT4G17800 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
| AT1G14490 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
| AT4G25320 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT3G55560 | AT-hook protein of GA feedback 2;(source:Araport11) |
| AT2G42940 | Encodes a nuclear matrix protein with AT-hook DNA binding motifs that acts in the maintenance of genomic integrity by silencing TEs and repeat-containing genes through epigenetic machinery. It interacts with FVE and MSI5 which are components of HDAC corepressor complexes. It is expressed in tapetum during the tetrad stage. |
| AT3G04570 | AT-hook motif nuclear-localized protein 19;(source:Araport11) |
| AT2G45430 | Encodes a nuclear localized AT hook domain containing protein that can bind AT rich DNA in vitro. Overexpression of the gene results in delayed flowering. Is likely to act redundantly with AHL18, AHL27 and AHL29 in the regulation of flowering. It is also involved in both photo- and skotomorphogenesis. |
| AT1G20900 | Encodes an AT hook domain containing protein that acts redundantly with SOB3 to modulate hypocotyl growth inhibition in response to light. |
| AT1G76500 | Encodes an AT hook domain containing protein. Identified in a screen of activation tagged lines that suppress the long-hypocotyl phenotype of a weak phyB allele. Affects cell elongation in the hypocotyl and leaves.Acts redundantly with ESC to modulate hypocotyl growth inhibition in response to light |
| AT4G02940 | ALKBH10B is a functional RNA N6-methyladenosine demethylase. Reduction in ALKBH10B decreases m6A levels, and affects the stability of flowering time genes including FT, SPL3 and SPL9. Mutant plants are early flowering. |
| AT3G06590 | Encodes RITF1, a bHLH transcription factor that regulates the transcription of several genes involved in the detoxification of reactive oxygen species generated by salt stress. |
| AT3G62690 | Encodes a RING-H2 zinc finger protein related to ATL2. The ATL gene family is represented by fifteen sequences that contain, in addition to the RING, a transmembrane domain which is located in most of them towards the N-terminal end. |
| AT1G09795 | ATP phosphoribosyl transferase, catalyses first step of histidine biosynthesis |
| AT3G22890 | encodes ATP sulfurylase, the first enzyme in the sulfate assimilation pathway of Arabidopsis. It may also participate in selenium metabolism. The mRNA is cell-to-cell mobile. |
| AT1G71960 | Encodes a plasma membrane localized ABC transporter involved in abscisic acid transport and responses. |
| AT5G61690 | ABC2 homolog 15;(source:Araport11) |
| AT5G44110 | Encodes a member of the NAP subfamily of ABC transporters whose expression pattern is regulated by light and sucrose. |
| AT5G61730 | Encodes an ER-localized ABC transporter with a role in the supply of fatty acid substrates for TAG biosynthesis at the ER during the seed-filling stage. |
| AT3G62150 | Encodes a facultative transporter controlling auxin concentrations in plant cells. |
| AT4G25450 | member of NAP subfamily |
| AT4G01820 | member of MDR subfamily |
| AT2G07680 | Encodes ABCC13/MRP11, a member of the multidrug resistance associated protein MRP/ABCC subfamily. Its expression is induced by gibberellic acid and downregulated by naphthalene acetic acid, abscisic acid, and zeatin. |
| AT2G47800 | Encodes a plasma membrane localized ATPase transporter involved in multidrug transport. The expression of this gene is upregulated by herbicide safeners such as benoxacor, fluxofenim and fenclorim. The mRNA is cell-to-cell mobile. |
| AT1G04120 | encodes a high-affinity inositol hexakisphosphate transporter that plays a role in guard cell signaling and phytate storage. It is a member of MRP subfamily / ABC transporter subfamily C. |
| AT5G60790 | Member of GCN subfamily; essential for translation inhibition under cold stress through interacting with GCN2 to phosphorylate eukaryotic translation initiation factor 2. GCN1 regulated gens are involved in flower development, seed dormancy and seed development, response to osmotic stress, amino acid biosynthesis, photosynthesis, cell wall organization, protein transport and localization, lipid biosynthesis, transcription, macroautophagy, proteolysis and cell death. |
| AT5G09930 | ABCF2 is one of five members of the ABCF gene family in Arabidopsis, which are homologs of the yeast ABCF protein, GCN20. |
| AT5G64840 | ABCF5 is one of five members of the ABCF gene family in Arabidopsis, which are homologs of the yeast ABCF protein GCN20. |
| AT2G39350 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT1G17840 | Encodes a plasma membrane-localized ATP-binding cassette transporter, that is required for cutin transport to the extracellular matrix. The mRNA is cell-to-cell mobile. |
| AT3G55090 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT3G55110 | ABC-2 type transporter family protein;(source:Araport11) |
| AT2G36380 | pleiotropic drug resistance 6;(source:Araport11) |
| AT4G15236 | ABC-2 and Plant PDR ABC-type transporter family protein;(source:Araport11) |
| AT2G01320 | ABC-2 type transporter family protein;(source:Araport11) |
| AT5G52860 | ABC-2 type transporter family protein;(source:Araport11) |
| AT1G19800 | Encodes a permease-like protein involved in lipid transfer from the ER to the chloroplast, more specifically, transfer of phosphatidate across the chloroplast inner membrane. Mutant leaves accumulate trigalactosyldiacylglycerol, triacylglycerol and phosphatidate. Chloroplast lipids are altered in their fatty acid composition and as a consequence the development of chloroplasts in the mutants are impacted. The mutant seeds has a higher abortion rate. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
| AT1G03905 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G18980 | Encodes a nuclear-targeted protein AtS40-3 that modulates senescence associated gene expression. |
| AT2G24540 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G32980 | HAUS augmin-like complex subunit;(source:Araport11) |
| AT5G40740 | Encodes a conserved AUGMIN subunit 6 (AUG6) which is known to be involved in microtuble nucleation. Mutants affect both male and female gametogenesis. |
| AT5G57110 | Arabidopsis-autoinhibited Ca2+ -ATPase, isoform 8, contains all of the characteristic motifs of Ca2+ -transporting P-type Ca2+ -ATPases and is localized to the plasma membrane. |
| AT1G54210 | Autophagy protein. |
| AT2G45170 | Involved in autophagy. Under nutrient starvation the protein localizes to autophagosomes. Involved in submergence (hypoxia) tolerance; ethanol induces autophagy. |
| AT3G60640 | Autophagy protein. |
| AT5G05150 | autophagy-related protein 18E;(source:Araport11) |
| AT3G61960 | autophagy gene |
| AT1G59750 | Encodes a member of the auxin response factor family. ARFs bind to the cis element 5'-TGTCTC-3' ARFs mediate changes in gene expression in response to auxin. ARF's form heterodimers with IAA/AUX genes. ARF1 enhances mutant phenotypes of ARF2 and may act with ARF2 to control aspects of maturation and senescence.ARF1:LUC and 3xHA:ARF1 proteins have a half-life of ~3-4 hours and their degradation is reduced by proteasome inhibitors. 3xHA:ARF1 degradation is not affected by a pre-treatment with IAA. A nuclear-targeted fusion protein containing the middle region of ARF1 linked to LUC:NLS has a similar half-life to the full-length ARF1:LUC construct. The degradation of 3xHA:ARF1 is not affected in an axr6-3 mutant grown at room temperature, although the degradation of AXR2/IAA7 is slowed under these conditions. |
| AT1G19220 | Encodes an auxin response factor that contains the conserved VP1-B3 DNA-binding domain at its N-terminus and the Aux/IAA-like domains III and IV present in most ARFs at its C-terminus. The protein interacts with IAA1 (yeast two hybrid) and other auxin response elements such as ER7 and ER9 (yeast one hybrid). ARF19 protein can complement many aspects of the arf7 mutant phenotype and , together with ARF7, is involved in the response to ethylene. In the arf7 arf19 double mutant, several auxin-responsive genes (e.g. IAA5, LBD16, LBD29 and LBD33) are no longer upregulated by auxin. |
| AT5G62000 | Encodes an auxin response factor. Mutants have many defects including enlarged rosette leaves, reduced fertility, later senescence, hypocotyl elongation defects, enlarged seeds and enlarged cotyledons. May not mediate auxin effects. Increase in seed size due to increased cell proliferation. The mRNA is cell-to-cell mobile. |
| AT1G30330 | Encodes a member of the auxin response factor family. Mediates auxin response via expression of auxin regulated genes. Acts redundantly with ARF8 to control stamen elongation and flower maturation. Expression of ARF6 is controlled by miR167. |
| AT1G78100 | F-box family protein;(source:Araport11) |
| AT3G07390 | isolated from differential screening of a cDNA library from auxin-treated root culture. sequence does not show homology to any known proteins and is predicted to be extracellular. The mRNA is cell-to-cell mobile. |
| AT4G12980 | Activated by OXS2 under the treatment of salt. |
| AT3G10960 | Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2). |
| AT3G21880 | Encodes a substrate of the COP1/SPA E3 ubiquitin ligase. It is degraded in darkness and stabilized by white, red and blue light. Overexpression results in decreased apical dominance, increased branching and delayed flowering in long days. The latter phenotype is due to reduced levels of FT and dependent on the presence of CO (PMID:29187570). |
| AT1G68520 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT1G25440 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT1G73870 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT1G68190 | B-box zinc finger family protein;(source:Araport11) |
| AT4G27310 | Encodes an atypical B-box domain protein that negatively regulates photomorphogenic development by interfering with the binding of the transcription factor HY5 to target gene promoters. Degradation of BBX28 in darkness is dependent on COP1 and occurs via the 26S proteasome pathway. BBX28 acts as a key factor in the COP1-HY5 regulatory hub by maintaining proper HY5 activity to ensure normal photomorphogenic development in plants. Interacts with CO via B-box domain resulting in decreased FT expression and delayed flowering. |
| AT5G54470 | B-box type zinc finger family protein;(source:Araport11) |
| AT3G21890 | B-box type zinc finger family protein;(source:Araport11) |
| AT3G21150 | Encodes a protein with a B-box domain predicted to act as a transcription factor. Expression of the BBX32 gene is affected by monochromatic red light. Genetic analysis shows BBX32 is under circadian control; it is a morning gene under clock regulation. |
| AT3G18080 | B-S glucosidase 44;(source:Araport11) |
| AT5G15160 | BNQ2 belongs to a family of atypical non-DNA binding basic helix-loop-helix (bHLH) proteins that heterodimerize with and negatively regulate bHLH transcription factors. Directly and negatively regulated by AP3 and PI in petals.Required for appropriate regulation of flowering time. |
| AT5G65700 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM2,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM1 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. The mRNA is cell-to-cell mobile. |
| AT3G25710 | Encodes a basic helix-loop-helix transcription factor that is expressed in the hypophysis-adjacent embryo cells, and is required and partially sufficient for MP-dependent root initiation. Involved in response to phosphate starvation. Negative regulator of root hair development, anthocyanin formation and Pi content. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
| AT3G54620 | bZIP transcription factor-like protein mRNA |
| AT4G38900 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT2G13150 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT1G75390 | basic leucine-zipper 44;(source:Araport11) |
| AT3G49760 | basic leucine-zipper 5;(source:Araport11) |
| AT2G22850 | basic leucine-zipper 6;(source:Araport11) |
| AT1G68880 | basic leucine-zipper 8;(source:Araport11) |
| AT3G08670 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT2G35530 | Encodes a G group bZIP transcription factor family member that can bind cis elements with an ACGT core, such as G-box, Hex, C-box and As-1. The protein is localized in the nucleus and can homodimerize and can heterodimerize with other G group members. |
| AT2G44330 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G52060 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT5G62100 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT5G07220 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT5G62390 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. Localized to the ER. Necessary for the proper maintenance of the unfolded protein response during heat and cold tolerance. |
| AT4G02660 | Beige/BEACH and WD40 domain-containing protein;(source:Araport11) |
| AT4G36870 | Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw1/saw2 may act redundantly to repress BP in leaves. Regulates together with BLH4 demethylesterification of homogalacturonan in seed mucilage. |
| AT1G69010 | Encodes BES1-INTERACTING MYC-LIKE 2 (BIM2), a PAR1 (PHYTOCHROME RAPIDLY REGULATED 1)-interacting protein that positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT5G08130 | Encodes a basic helix-loop-helix (bHLH) family protein BIM1 (BES1-INTERACTING MYC-LIKE 1), involved in brassinosteroid signaling. It synergistically interacts with BES1 to bind to E box sequences (CANNTG). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT4G36780 | BES1/BZR1 homolog 2;(source:Araport11) |
| AT3G18070 | beta glucosidase 43;(source:Araport11) |
| AT5G46690 | beta HLH protein 71;(source:Araport11) |
| AT5G65640 | bHLH093/NFL encodes a bHLH transcription factor involved in GA mediated control of flowering time. Mutants are non-flowering in short days and phenotype can be reversed with GA application. Based on the expression of GA biosynthetic genes in the mutant, it likely acts through regulation of GA metabolism. Its expression shows developmental stage and tissue specificity. In short days it is expressed mainly in root tips and SAM, with weak expression in cotyledons throughout development. In LD GUS activity was observed in the hypocotyl and in root tips and SAM throughout the developmental stages. |
| AT3G23920 | Encodes a chloroplast beta-amylase. Is necessary for leaf starch breakdown in the absence of BAM3.Activity of BAM1 increases 4 days after osmotic stress. BAM1 has a higher temperature optimum than BAM3 (PMID:25293962). |
| AT4G00490 | Encodes a chloroplast beta-amylase. The enzyme activity is very weak compared to BAM1 and BAM3. It forms a tetramer whose activity requires K+ and exhibits sigmoidal kinetics Mutants of BAM2 have no visible phenotype. |
| AT5G18670 | putative beta-amylase BMY3 (BMY3) |
| AT5G55700 | In vitro assay indicates no beta-amylase activity of BAM4. However mutation in BAM4 impairs starch breakdown. BAM4 may play a regulatory role. |
| AT5G52570 | Converts β-carotene to zeaxanthin via cryptoxanthin. |
| AT5G63810 | member of Glycoside Hydrolase Family 35 |
| AT5G56870 | beta-galactosidase 4;(source:Araport11) |
| AT1G65590 | Encodes a protein with beta-hexosaminidase activity. Located on the plasma membrane. |
| AT5G65940 | hydrolyzes beta-hydroxyisobutyryl-CoA |
| AT1G17810 | beta-tonoplast intrinsic protein (beta-TIP) mRNA, complete |
| AT1G02640 | encodes a protein similar to a beta-xylosidase located in the extracellular matrix. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
| AT1G75380 | Encodes a nuclease involved in ABA-mediated callose deposition. It has been shown to interact with JAZ proteins, binds to a jasmonic acid-responsive element (JARE) and repress AtJMT expression. |
| AT1G19660 | Wound-responsive family protein;(source:Araport11) |
| AT1G54200 | DNA mismatch repair Msh6-like protein;(source:Araport11) |
| AT3G13980 | SKI/DACH domain protein;(source:Araport11) |
| AT1G13670 | hypothetical protein;(source:Araport11) |
| AT1G59640 | A basic helix-loop-helix encoding gene (BIGPETAL, BPE) involved in the control of petal size. BPE is expressed via two mRNAs derived from an alternative splicing event. The BPEub (AT1G59640.1)transcript is expressed ubiquitously, whereas the BPEp (AT1G59640.2) transcript is preferentially expressed in petals. Plants that lack the petal-expressed variant BPEp have larger petals as a result of increased cell size. BPEp is positively regulated downstream of APETALA3, PISTILLATA, APETALA1 and PISTILLATA3 and is negatively regulated downstream of AGAMOUS. |
| AT4G35380 | Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking. |
| AT1G09080 | Heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
| AT4G30825 | P-class pentatricopeptide repeat (PPR) protein essential for accumulation of the dicistronic atpH/F transcript in chloroplasts. Acts as barrier to prevent the atpH/F transcript degradation by exoribonucleases by binding to the consensus sequence of the atpF-atpA intergenic region. |
| AT5G49550 | Putative homolog of mammalian BLOC-1 Subunit 2. Protein - protein interaction with BLOS1. |
| AT4G18950 | BHP1 is a Raf-like protein kinase involved in mediating blue light dependent stomatal opening. |
| AT3G54810 | Encodes a protein containing a GATA type zinc finger domain that is expressed in the embryo axis and involved in germination. Mutants have a reduced rate of germination even when stratified. |
| AT3G52740 | Plant specific protein.BIC1 and BIC2 inhibit cryptochrome function by blocking blue light-dependent cryptochrome dimerization.Light activated transcription of BICs is mediated by cryptochromes. |
| AT5G45100 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT1G79110 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT3G12920 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT3G19540 | glutamyl-tRNA (Gln) amidotransferase subunit A (DUF620);(source:Araport11) |
| AT5G05840 | replication factor C subunit, putative (DUF620);(source:Araport11) |
| AT5G66740 | spindle assembly abnormal protein (DUF620);(source:Araport11) |
| AT5G46870 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
| AT1G75080 | Encodes a positive regulator of the brassinosteroid (BR) signalling pathway that mediates both downstream BR responses and negative feedback regulation of BR biosynthesis. There is evidence for phosphorylation-dependent nucleocytoplasmic shuttling of BZR1. GSK3-like kinases (including BIN2), 14-3-3 proteins, and the phosphatase BSU1 seem to participate in this process. Phosphorylation also appears to affect BZR1's transcriptional activities. |
| AT4G39400 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction. BRI1 ligand is brassinolide which binds at the extracellular domain. Binding results in phosphorylation of the kinase domain which activates the BRI1 protein leading to BR responses. Residue T-1049 and either S-1044 or T-1045 were essential for kinase function in vitro and normal BRI1 signaling in planta. The structure of BRI1 ligand-binding domain has been determined at 2.5A resolution. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. BRI1 appears to be involved in the autonomous pathway that regulates the transition to flowering, primarily through its effects on FLC expression levels, as uncovered by double mutant analyses. This most likely occurs as a result of BRI1-dependent effects on histone acetylation, but not histone triMeH3K4 methylation, at the FLC locus. The mRNA is cell-to-cell mobile. |
| AT3G30180 | Encodes a cytochrome p450 enzyme that catalyzes the last reaction in the production of brassinolide. It is capable of converting 6-deoxocastasterone into castasterone, a C-6 oxidation, as well as the further conversion of castasterone into brassinolide by a Baeyer-Villinger oxidation reaction at C-6, resulting in the formation of an unusual seven-membered lactone ring. The enzyme possesses high affinity for both C28- and C27-Brassinosteroids. The expression of the gene using a CYP85A2 promoter:LUC fusion construct was shown to be under circadian and light control. |
| AT5G01630 | Ortholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with with both Rad51 and Dss1(I) or both Dmc1 and Dss1(I) in a tripartite complex. |
| AT5G60880 | Encodes BASL (BREAKING OF ASYMMETRY IN THE STOMATAL LINEAGE), a regulator of asymmetric divisions. In asymmetrically dividing stomatal-lineage cells, BASL accumulates in a polarized crescent at the cell periphery before division, and then localizes differentially to the nucleus and a peripheral crescent in self-renewing cells and their sisters after division. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT4G00020 | Ortholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with either AtRad51 or AtDmc1 and ATDSS1(I). Involved in embryo sac development and defense gene transcription during plant immune responses. |
| AT1G04020 | Encodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein-protein interactions. Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression. |
| AT1G31880 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. BRX encodes a key regulator of cell proliferation and elongation in the root, which has been implicated in the brassinosteroid (BR) pathway as well as regulation of auxin-responsive gene expression. Also involved in cytokinin-mediated inhibition of lateral root initiation. A loss-of-function allele, named brx-2 in Rodrigues et al. (2009) Plant Physiol. but changed to brx-3 to resolve nomenclature conflict (Li et al. Planta 2009:229(3):593-603), shows enhanced response to ABA-mediated inhibition of root growth. Plasma-membrane-associated element of a molecular rheostat that modulates auxin flux through developing protophloem sieve elements (PPSEs) while interacting with PAX, thereby timing PPSE differentiation. Dampens PIN-mediated auxin efflux. |
| AT1G54180 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
| AT5G20540 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
| AT5G42750 | Encodes a plasma-membrane associated phosphoprotein that interacts directly with the kinase domain of BRI1 through the evolutionarily conserved C-terminal BIM motif binding to the C-lobe of the BRI1 kinase domain. It interferes with the interaction between BRI1 with its signalling partner, the plasma membrane localised LRR-receptor kinase BAK1 by inhibiting the transphosphorylation to keep BRI1 at a basal level of activity. It is phosphorylated by BRI1 at Ser270 & Ser274 and at tyrosine site Tyr211 and dissociates from plasma membrane to end up in the cytosol after phosphorylation. Its loss-of-function mutant shows higher sensitivity to BR treatment. |
| AT2G45400 | involved in the regulation of brassinosteroid metabolic pathway |
| AT4G33430 | Leu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. Contributes to postinvasive immunity against Alternaria brassicola. |
| AT1G19350 | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes. Works with BRAVO to regulate QC division in the root. AT1G19350.3(BES1-L) is the long isoform of BES1. It contains an additive N-terminal NLS compared with the canonical BES1-S. This recently evolved isoform is expressed specifically in the Arabidopsis lineage |
| AT2G38740 | HAD-type phosphosugar phosphatase. |
| AT1G05910 | Encodes an acetylated histone-binding protein BRAT1. BRAT1 forms a complex with BRP1 to prevent transcriptional silencing. |
| AT5G55040 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
| AT5G59570 | Encodes BOA (BROTHER OF LUX ARRHYTHMO), a component of the circadian clock. The mRNA is cell-to-cell mobile. |
| AT3G18290 | Encodes BRUTUS (BTS), a putative E3 ligase protein with metal ion binding and DNA binding domains, which negatively regulates the response to iron deficiency. The mRNA is cell-to-cell mobile. |
| AT2G40400 | Encodes a chloroplast localized protein of unknown function that is involved in regulation of chloroplast development. |
| AT5G63160 | BTB and TAZ domain protein. Short-lived nuclear-cytoplasmic protein targeted for degradation by the 26S proteosome pathway. Acts redundantly with BT2 and BT3 during female gametophyte development. |
| AT3G48360 | Encodes a protein (BT2) that is an essential component of the TAC1-mediated telomerase activation pathway. Acts redundantly with BT3 and BT1 during female gametophyte development and with BT3 during male gametophyte development. BT2 also mediates multiple responses to nutrients, stresses, and hormones. |
| AT3G43700 | Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). |
| AT3G19590 | Encodes a protein that may have a role in the spindle assembly checkpoint. |
| AT5G18930 | S-adenosylmethionine decarboxylase family member. |
| AT1G18740 | DUF793 domain containing protein. Expression is induced by cold. Loss of function mutations are more sensitive to freezing and have reduced levels of CBFs. May act by preventing degradation of CBFs. |
| AT1G19490 | Putative bZIP transcription factor. Expression is induced by drought and mutants are sensitive to drought. |
| AT5G51990 | encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF4). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to drought stress and abscisic acid treatment, but not to low temperature. |
| AT4G25490 | Transcriptional activator that binds to the DRE/CRT regulatory element and induces COR (cold-regulated) gene expression increasing plant freezing tolerance. It encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. |
| AT4G25470 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature, abscisic acid, and circadian rhythm. Overexpressing this gene leads to increased freeze tolerance and induces the expression level of 85 cold-induced genes and reduces the expression level of 8 cold-repressed genes, which constitute the CBF2 regulon. Mutations in CBF2 increases the expression level of CBF1 and CBF3, suggesting that this gene may be involved in a negative regulatory or feedback circuit of the CBF pathway. |
| AT2G33540 | C-terminal domain phosphatase-like 3;(source:Araport11) |
| AT2G23440 | transmembrane protein;(source:Araport11) |
| AT1G72180 | Encodes a leucine-rich repeat receptor kinase that functions as a receptor for CEP1 peptide. Mediates nitrate uptake signaling. |
| AT1G73580 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT4G01840 | Encodes AtTPK5, a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK5 is targeted to the vacuolar membrane. May form homomeric ion channels in vivo. |
| AT5G17860 | Cation/Ca2+ exchanger family member. Double mutants with CCX4 show delayed greening and defects in ROS response. |
| AT5G23060 | Encodes a chloroplast-localized protein that modulates cytoplasmic Ca2+ concentration and is crucial for proper stomatal regulation in response to elevations of external Ca2+. Phosphorylation of this protein is dependent on calcium. |
| AT4G38810 | SnRK2-Interacting Calcium Sensor. Encodes two different isoforms that can both inhibit SnRK2. The longer form (AT4G38810.2) is calcium dependant, the other is not. |
| AT1G05570 | Encodes a callose synthase 1 catalytic subunit . Member of Glycosyltransferase Family- 48. |
| AT2G13680 | Responsible for the synthesis of callose deposited at the primary cell wall of meiocytes, tetrads and microspores. Required for exine formation during microgametogenesis and for pollen viability. Highest expression in meiocytes, tetrads, microspores and mature pollen. |
| AT2G41010 | Encodes a novel calmodulin binding protein whose gene expression is induced by dehydration and ionic (salt) and non-ionic (mannitol) osmotic stress. Lines over-expressing this gene are more sensitive and anti-sense lines are more tolerant to osmotic stress, suggesting this gene may be a negative regulator of response to osmotic stress. |
| AT2G41110 | Encodes a touch-inducible calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. The mRNA is cell-to-cell mobile. |
| AT3G56800 | encodes a calmodulin |
| AT5G64220 | CAMTA2 proteins bind to the AtALMT1 promoter at in vitro. The gene itself is Al inducible, and AtALMT1 expression is partially repressed in camta2 mutant. The mRNA is cell-to-cell mobile. |
| AT5G61790 | calnexin 1;(source:Araport11) |
| AT1G56340 | Encodes one of three Arabidopsis calreticulins. In CRT-deficient mouse fibroblasts, this protein restores ER Ca2+ levels. Post-transcriptionally regulates together with CRT2 VAMP721/722 levels under ER stress. Loss-of-function results in activation of the ethylene signaling pathway, reduced susceptibility to Verticillium longisporum. |
| AT1G09210 | Encodes one of three Arabidopsis calreticulins.Post-transcriptionally regulates together with CRT1 VAMP721/722 levels under ER stress. |
| AT5G18520 | Encodes a candidate G-protein Coupled Receptor that is involved in the regulation of root growth by bacterial N-acyl-homoserine lactones (AHLs) and plays a role in mediating interactions between plants and microbes. The mRNA is cell-to-cell mobile. |
| AT3G05520 | Encodes a capping protein that acts as a phosphatidic acid biosensor and key transducer of fluxes in membrane signaling phospholipids into changes in actin cytoskeleton dynamics. |
| AT2G46410 | Nuclear-localized R3-type MYB transcription factor. Positive regulator of hair-cell differentiation. Preferentially transcribed in hairless cells. Moves from atrichoblasts into trichoblast via plasmodesmata in a tissue-specific mode. N-terminus and part of the Myb domain are required for this movement, with W76 playing a crucial role. Capability to increase the size-exclusion limit of plasmodesmata. Regulated by WEREWOLF. |
| AT5G27420 | Encodes CNI1 (Carbon/Nitrogen Insensitive1) (also named as ATL31), a RING type ubiquitin ligase that functions in the Carbon/Nitrogen response for growth phase transition in Arabidopsis seedlings. The mRNA is cell-to-cell mobile. |
| AT5G14740 | Encodes a beta carbonic anhydrase likely to be localized in the cytoplasm. Expression of its mRNA is seen in etiolated seedlings and points to a possible nonphotosynthetic role for this isoform. |
| AT5G16080 | carboxyesterase 17;(source:Araport11) |
| AT4G04870 | Encodes a protein with cardiolipin synthase activity that is localized to the mitochondiria. |
| AT2G44990 | More Axillary Branching; carotenoid cleavage dioxygenases. |
| AT4G28860 | Member of CKL gene family (CKL-A group) |
| AT1G03700 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G15620 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G16300 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT1G79780 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G55390 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G53850 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT1G73875 | Deadenylase. |
| AT4G35090 | Encodes a peroxisomal catalase, highly expressed in bolts and leaves. mRNA expression patterns show circadian regulation with mRNA levels being high in the subjective early morning. Loss of function mutations have increased H2O2 levels and increased H2O2 sensitivity. Mutants accumulate more toxic ions yet show decreased sensitivity to Li+. This decreased sensitivity is most likely due to an insensitivity to ethylene. Note that in Queval et al. (2007) Plant Journal, 52(4):640, SALK_057998 is named as cat2-1, SALK_076998 is named as cat2-2; in Bueso et al. (2007) Plant Journal, 52(6):1052, SALK_076998 is named as cat2-1. TAIR has adopted the nomenclature consistent with that in Bueso et al. (2007) after consultation with the authors: SALK_076998 (cat2-1), SALK_057998 (cat2-2). |
| AT3G51860 | cation exchanger 3;(source:Araport11) |
| AT4G23700 | member of Putative Na+/H+ antiporter family |
| AT5G58460 | member of Putative Na+/H+ antiporter family |
| AT2G13620 | member of Putative Na+/H+ antiporter family |
| AT5G04770 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. Expressed in sink tissues. Induced during infestation of roots by the plant parasitic root-knot nematode, Meloidogyne incognita. Localized in the plasma membrane. |
| AT3G17510 | Encodes a CBL-interacting protein kinase. Specifically interacts with ECT1 and ECT2. |
| AT4G18700 | Encodes CBL-interacting protein kinase 12 (CIPK12). |
| AT5G01810 | Encodes a CBL-interacting serine/threonine protein kinase, also has similarities to SOS2 kinase. |
| AT2G25090 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.18), which has also been reported as a member of the CBL-interacting protein kinases (CIPK16) and is involved in salinity tolerance. |
| AT5G45810 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.5), which has also been reported as a member of the CBL-interacting protein kinases (CIPK19). |
| AT5G45820 | Encodes a CBL-interacting serine/threonine protein kinase comprised of an N-terminal kinase catalytic domain similar to SNF1/AMPK and a unique C-terminal regulatory domain. |
| AT1G30270 | Arabidopsis thaliana CBL-interacting protein kinase 23. CIPK23 serves as a positive regulator of the potassium transporter AKT1 by directly phosphorylating AKT1. CIPK23 is activated by the binding of two calcineurin B-like proteins, CBL1 and CBL9. The mRNA is cell-to-cell mobile. |
| AT1G01140 | Encodes a CBL-interacting protein kinase with similarity to SOS2 |
| AT1G80090 | Cystathionine beta-synthase (CBS) family protein;(source:Araport11) |
| AT3G44260 | Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses. |
| AT4G32410 | Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. |
| AT4G38190 | encodes a gene similar to cellulose synthase |
| AT5G22740 | Encodes a beta-mannan synthase based on in vitro enzyme assays from heterologously expressed protein. CSLA2 synthesizes the backbone of galactoglucomannan in seed coat epidermal cells. Both CSLA2 and MUCI10, which may be part of a protein complex, are critical for mucilage architecture. |
| AT1G02730 | Encodes a gene similar to cellulose synthase. Knock-out mutant has reduced growth, reduced xylan level and reduced xylan synthase activity in stems.It's expression is cell cycle dependent and it appears to function in cell plate formation. |
| AT2G47450 | A component of the chloroplast signal recognition particle pathway that is involved in LHCP targeting. It is downregulated in response to high light. It recognizes the DPLG motif in Lhcb1. The mRNA is cell-to-cell mobile. |
| AT3G02530 | TCP-1/cpn60 chaperonin family protein;(source:Araport11) |
| AT5G56500 | Encodes a subunit of chloroplasts chaperonins that are involved in mediating the folding of newly synthesized, translocated, or stress-denatured proteins. Cpn60 subunits are: Cpn60alpha1 (At2g28000), AtCpn60alpha2 (At5g18820), AtCpn60beta1 (At1g55490), AtCpn60beta2 (At3g13470), AtCpn60beta3 (At5g56500), AtCpn60beta4 (At1g26230). |
| AT3G14870 | hypothetical protein (DUF641);(source:Araport11) |
| AT2G30380 | MYB family transcription factor;(source:Araport11) |
| AT5G24090 | Chitinase A (class III) expressed exclusively under environmental stress conditions. Shown be a plant lysozyme involved in plant immunity. |
| AT3G27170 | member of Anion channel protein family The mRNA is cell-to-cell mobile. |
| AT1G44446 | Encodes chlorophyllide a oxygenase which converts chlorophyllide a to chlorophyllide b by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide a . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll b and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22. |
| AT1G29930 | Subunit of light-harvesting complex II (LHCII),which absorbs light and transfers energy to the photosynthetic reaction center. The mRNA is cell-to-cell mobile. |
| AT1G29920 | Encodes lhcb1.1 a component of the LHCIIb light harvesting complex associated with photosystem II. |
| AT1G54870 | ChlADR is an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. The N-terminal region of this protein directs GFP to the chloroplast where where ChlADR likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation. In addition, this enzyme can also reduce cis-3-hexenal, a major plant volatile compound that contributes to green leaf odor, as well as methylglyoxal in vitro. |
| AT3G04000 | ChlADR is an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. The N-terminal region of this protein directs GFP to the chloroplast where where ChlADR likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation. In addition, this enzyme can also reduce cis-3-hexenal, a major plant volatile compound that contributes to green leaf odor, as well as methylglyoxal in vitro. |
| AT4G13010 | Oxidoreductase, zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT5G57180 | Transcription regulator responsible for specific upregulation of the translocon genes atToc33 and atToc75 in leaves. Involved in protein import into chloroplast. |
| AT3G14330 | Encodes a pentatricopeptide repeat protein involved in chloroplast mRNA editing. Mutants display defects in C-U editing of psbE. |
| AT3G53460 | Encodes a nuclear gene with a consensus RNA-binding domain that is localized to the chloroplast. |
| AT5G03940 | mutant has Yellow first leaves; Chloroplast Signal Recognition Particle Subunit |
| AT2G25625 | Histone deacetylase-like protein;(source:Araport11). Induced by senescence and abiotic stresses. |
| AT5G66650 | Chloroplast localized mitochondrial calcium uniporter. |
| AT5G39520 | Plastid localized transmembrane protein involved in ABA mediated leaf senescence and stomatal movement. |
| AT5G16390 | Encodes for the biotin carboxyl-carrier subunit of the multi-enzyme plastidial acetyl-coenzyme A carboxylase complex. |
| AT5G55740 | Encodes a member of the E+ subgroup of the PPR protein family, containing the E and E+ motifs following a tandem array of PPR motifs. It also contains an unknown motif consisting of 15 aa, which is highly conserved in some PPR proteins, including CRR4. CRR21 is involved in RNA editing of the site 2 of ndhD (ndhD-2),which encodes a subunit of the NDH complex. The RNA editing changes aa 128 from Ser to Leu. Mutants have impaired NDH complex activity. |
| AT2G01590 | Likely a subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. Located in the membrane fraction of chloroplast. Mutant has impaired NAD(P)H dehydrogenase activity. |
| AT5G44800 | Interacts with transcription factors involved in floral meristem identity and affects the expression of key floral regulators. Affects H3K27me3 and H3K4me3 levels at a subset of loci in the genome. |
| AT2G13370 | Chromatin-remodeling factor; has large number of MAPK docking sites (D-sites). |
| AT4G25990 | chloroplast import apparatus CIA2-like. CIA2 is a transcription factor which upregulates chloroplast translocon genes |
| AT1G80820 | Encodes an cinnamoyl CoA reductase isoform. Involved in lignin biosynthesis. |
| AT4G34230 | Encodes a catalytically active cinnamyl alcohol dehydrogenase which uses p-coumaryl aldehyde as a preferred substrate. It can also use sinapyl, caffeyl, coniferyl and d-hydroxyconiferyl aldehydes as substrates. |
| AT4G39330 | cinnamyl alcohol dehydrogenase 9;(source:Araport11) |
| AT2G46830 | Encodes a transcriptional repressor that performs overlapping functions with LHY in a regulatory feedback loop that is closely associated with the circadian oscillator of Arabidopsis. Binds to the evening element in the promoter of TOC1 and represses TOC1 transcription. CCA1 and LHY colocalize in the nucleus and form heterodimers in vivo. CCA1 and LHY function synergistically in regulating circadian rhythms of Arabidopsis. CCA1 binds the GI promoter. |
| AT2G23410 | Encodes cis-prenyltransferase involved in dolichol biosynthesis. |
| AT2G23400 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
| AT5G58782 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
| AT2G42790 | Encodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development. |
| AT3G11130 | CHC1 heavy chain subunit of clathrin. Involved in vesicle mediated trafficking. Mutants show reduced rates of endocytosis and defects clathrin mediated exocytosis. Mutants also have increased dehydration tolerance which may be related to the overall slower stomatal aperture dynamics. Overall growth is affected. |
| AT3G51890 | Clathrin light chain protein;(source:Araport11) |
| AT4G38060 | hypothetical protein;(source:Araport11) |
| AT5G12990 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT1G25425 | CLAVATA3/ESR-RELATED 43;(source:Araport11) |
| AT2G31083 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT4G27110 | COBRA-like protein 11 precursor;(source:Araport11) |
| AT1G09790 | COBRA-like protein 6 precursor;(source:Araport11) |
| AT5G36120 | One of four Arabidopsis homologs of bacterial ymlg proteins. |
| AT1G01290 | COFACTOR OF NITRATE REDUCTASE AND XANTHINE DEHYDROGENASE 3. Encodes a protein involved in molybdenum cofactor biosynthesis. Homologous to E.coli MoaC. Expression is low in all tissues examined, except in roots. Appears to have targeting signals for chloroplast or mitochondria |
| AT1G29390 | Integral membrane protein in the inner envelope of chloroplasts. Provide freezing tolerance. |
| AT2G15970 | encodes an alpha form of a protein similar to the cold acclimation protein WCOR413 in wheat. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. The mRNA is cell-to-cell mobile. |
| AT5G42900 | Acts with COR28 as a key regulator in the COP1-HY5 regulatory hub by regulating HY5 activity to ensure proper skotomorphogenic growth in the dark and photomorphogenic development in the light. |
| AT2G17870 | Encodes COLD SHOCK DOMAIN PROTEIN 3 (CSP3), involved in the acquisition of freezing tolerance. |
| AT2G42540 | A cold-regulated gene whose product is targeted to the chloroplast. Cor15am protects stromal proteins from aggregation under various stress conditions. Constitutive expression increases freezing tolerance in protoplasts in vitro and chloroplasts in vivo. NMR and x-ray diffraction studies suggest that COR15a alters the intrinsic curvature of the inner membrane of chloroplast envelope. Late Embryogenesis abundant protein (LEA). Protects chloroplast membranes during freezing. |
| AT3G50830 | cold acclimation protein WCOR413-like protein beta form. Transcript is not detectable. |
| AT4G33980 | Acts with COR27 as a key regulator in the COP1-HY5 regulatory hub by regulating HY5 activity to ensure proper skotomorphogenic growth in the dark and photomorphogenic development in the light. |
| AT2G41990 | late embryogenesis abundant protein;(source:Araport11) |
| AT4G35170 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G67370 | DUF1230 family protein (DUF1230);(source:Araport11) |
| AT5G11980 | COG8 is a component of a putative conserved oligomeric Golgi (COG) complex that is thought to be involved in tethering of retrograde intra Golgi vesicles. It is required for proper deposition of cell wall materials in pollen tube growth. In mutant pollen,golgi appear abnormal.When homozygotes can be produced (by complementing the defect in pollen), the plants are embryo lethal suggesting an essential function. COG8 interacts with several other putative COG components. |
| AT5G15840 | Encodes a protein showing similarities to zinc finger transcription factors, involved in regulation of flowering under long days. Acts upstream of FT and SOC1. |
| AT5G15850 | Homologous to the flowering-time gene CONSTANS. |
| AT5G24930 | Flowering repressor in long days (LD) and short days (SD) and acts on the expression of FT and FT-like genes as well as on SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1). |
| AT5G57660 | CONSTANS-like 5;(source:Araport11) |
| AT3G21290 | Nuclear-localized intrinsically disordered protein involved in promoting miRNA activity. |
| AT5G17880 | Encodes a TIR-NBS-LRR protein CSA1 that functions in photomorphogenic development. csa1 mutants display a constitutive shade-avoidance (CSA) phenotype (long stem) under high red:far-red rations (i.e. in the absence of a shade signal). csa1 mutation can be complemented by RPS4, a TIR-NBS-LRR protein that confers resistance against bacterium Pseudomonas syringae. |
| AT5G03730 | Homologous to the RAF family of serine/threonine protein kinases. Negative regulator in the ethylene signal transduction pathway. Interacts with the putative ethylene receptors ETR1 and ERS. Constitutively expressed. |
| AT3G50260 | Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. Involved in defense and freezing stress responses. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. The mRNA is cell-to-cell mobile. |
| AT1G71230 | Encodes a subunit of the COP9 complex, similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Involved in protein deneddylation. Double mutants with CSN5A are constitutively photomorphogenic (de-etiolated) and have abnormal auxin responses. |
| AT4G12290 | Copper amine oxidase. Induced by ABA and involved in stomatal closure. |
| AT3G56940 | Encodes a putative ZIP protein with varying mRNA accumulation in leaves, stems and roots. Has a consensus carboxylate-bridged di-iron binding site. The mRNA is cell-to-cell mobile. |
| AT3G46900 | encodes a member of copper transporter family and functionally complements a high affinity copper transporter mutant in yeast |
| AT5G13290 | Encodes a protein with predicted Ser/Thr kinase activity and membrane localization that is involved in the CLV3 signaling pathway that represses WUS expression in the meristem. Loss of function of CRN can suppress the phenotype caused by overexpression of CLV3. SOL2 isolated as a suppressor of root- specific overexpression of CLE19, a clavata3 like gene. sol2 partially suppresses the short root phenotype caused by CLE19 overexpression. Mutant flowers have extra carpels. |
| AT1G28680 | Catalyses trans-cis isomerization and lactonization in the biosynthesis of coumarins in roots. |
| AT2G47400 | CP12-1 encodes a small peptide found in the chloroplast stroma. It belongs to the CP12 gene family thought to be involved in the formation of a supramolecular complex with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) embedded in the Calvin cycle. The mRNA is cell-to-cell mobile. |
| AT3G09780 | CRINKLY4 related 1;(source:Araport11) |
| AT1G03880 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT4G28520 | Encodes a 12S seed storage protein that is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT5G44120 | Encodes a 12S seed storage protein. The Landsberg erecta genome contains another copy of 12S globulin gene, CRA2, which is located tandemly with CRA1. Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT5G51020 | Encodes CRL (CRUMPLED LEAF), a protein localized in the outer envelope membrane of plastids. Mutation in this gene affects the pattern of cell division, cell differentiation and plastid division. |
| AT5G48560 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G07340 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G24850 | Binds flavin adenine dinucleotide and DNA. It does not have photolyase activity, and it is likely to act as photoreceptor. Closely related to Synechocystis cryptochrome. |
| AT1G32790 | RNA-binding protein, putative, similar to RNA-binding protein GB:CAB40027 GI:4539439 from (Arabidopsis thaliana).Member of a family of PAB2 binding domain proteins. |
| AT4G10610 | RNA-binding protein, putative. Member of a family of proteins having an PABC binding domain (PAM motif). |
| AT5G25540 | Expressed protein contains PAM2 PABC interacting domain. |
| AT3G14450 | RNA-binding protein, putative, contains Pfam profile: PF00076 RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (2 copies). Contains PAM PABC binding domain. |
| AT1G30820 | Cytidine triphosphate synthase. |
| AT1G76420 | Identified in an enhancer trap line; member of the NAC family of proteins. Expressed at the boundary between the shoot meristem and lateral organs and the polar nuclei in the embryo sac. Together with CUC2-DA1-UBP15 part of a regulatory module which controls the initiation of axillary meristems, thereby determining plant architecture. Regulates axillary meristem initiation by directly binding to the DA1 promoter. |
| AT4G34490 | CYCLASE ASSOCIATED PROTEIN |
| AT2G46430 | Encodes a cyclic nucleotide gated channel, downstream component of the signaling pathways leading to hypersensitive response (HR) resistance. |
| AT1G15990 | Encodes a plasma membrane localized member of the cyclic nucleotide gated channel (CNGC) family that is essential for male reproductive fertility. |
| AT5G54250 | member of Cyclic nucleotide gated channel family, downstream component of the signaling pathways leading to HR resistance. mutant plants exhibit gene-for-gene disease resistance against avirulent Pseudomonas syringae despite the near-complete absence of the hypersensitive response (HR). Salicylic acid accumulation in dnd2 mutants is completely PAD4-independent. |
| AT1G20610 | Cyclin B2;(source:Araport11) |
| AT4G34160 | encodes a cyclin D-type protein involved in the switch from cell proliferation to the final stages of differentiation. The gene is transcriptionally regulated by cytokinin and brassinosteroid. Protein interacts with cyclin-dependent kinase inhibitor ICK1. |
| AT5G65420 | Encodes a D-type cyclin CYCD4;1 that physically interacts with CDC2A and is expressed during vascular tissue development, embryogenesis, and formation of lateral root primordia. Its expression is upregulated early during germination.Involved in stomatal cell lineage proliferation in the hypocotyl. |
| AT3G21870 | cyclin p2;(source:Araport11) |
| AT2G45080 | cyclin p3;(source:Araport11) |
| AT2G44740 | cyclin p4;(source:Araport11) |
| AT5G62430 | Dof-type zinc finger domain-containing protein, similar to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Represses expression of Constans (CO), a circadian regulator of flowering time. Interacts with LKP2 and FKF1. Expression oscillates under constant light conditions. Mainly expressed in the vasculature of cotyledons, leaves and hypocotyls, but also in stomata. Localized to the nucleus and acts as a repressor of CONSTANS through binding to the Dof binding sites in the CO promoter. Protein gets degraded by FKF1 in the afternoon. CDF1 binds to the TOPLESS co-repressor protein through an N-terminal motif which is conserved across CDF-like proteins throughout land-plants. This interaction is important for the repression of CO and FT genes during the morning. Loss of CDF1 dependent repression through omission of TPL coordinating residues or through the loss of TPL function in phloem companion cells results in early flowering due to an up regulation of FT. |
| AT5G39660 | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions. |
| AT3G47500 | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions. |
| AT1G69570 | CDF5 is a circadian regulated transcript that is antiphasic with respect to its natural antisense transcript (NAT) FLORE (AT1G69572).CDF5 transcript accumulation delays flowering. CDF5 links circadian oscillation and photoperiodism. |
| AT1G26790 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
| AT5G50375 | Converts pentacyclic cyclopropyl sterols to conventional tetracyclic sterols. CPI1 function during and just after division and support gravitropism by establishing polar PIN2 localization. Required for endocytosis of PIN2 |
| AT1G66160 | CYS, MET, PRO, and GLY protein 1;(source:Araport11) |
| AT2G40880 | Encodes a protein with cysteine proteinase inhibitor activity. Overexpression increases tolerance to abiotic stressors (i.e.salt,osmotic, cold stress). The mRNA is cell-to-cell mobile. |
| AT5G47550 | Putative phytocystatin expressed in seedlings and induced by heat stress and abscisic acid. Overexpression increases germination rate and heat stress tolerance. CYS5 is a target of ABF1 and ABF3 transcriptional regulators which bind to its promoter. |
| AT4G36880 | cysteine proteinase1;(source:Araport11) |
| AT3G03630 | Encodes a protein that possesses S-sulfocysteine synthase activity and lacks O-acetylserien(thiol)lyase activity. |
| AT4G23220 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G00970 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G33660 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
| AT1G56060 | CYSTM3 is a mitochondrial protein that is induced by salt stress and is a negative regulator of salt stress. |
| AT2G32210 | cysteine-rich/transmembrane domain A-like protein;(source:Araport11) |
| AT4G10040 | Encodes cytochrome c. Promoter directs preferential expression in vascular tissues of cotyledons, leaves, roots, and hypocotyls, and in anthers. Double mutants with CYTC-1 accumulate starch during the day, have delayed growth and development and reduced GA and DELLA proteins linking cellular metabolism and GA homeostasis. |
| AT3G61880 | Encodes a cytochrome p450 monooxygenase. Overexpression of this gene allows fruit growth independently of fertilization. The gene is normally expressed only in floral organs(during the Arabidopsis stage 14 flower) and in the funiculus at anthesis. |
| AT3G30290 | a member of cytochrome P450 gene family |
| AT4G12330 | member of CYP706A |
| AT5G45340 | Encodes a protein with ABA 8'-hydroxylase activity; involved in ABA catabolism. Mutant analyses show that disruption in the gene results in more drought tolerance whereas overexpression results in increased transpiration rate and reduced drought tolerance. Gene involved in postgermination growth. Plant P450 CYP707A3, ABA 8'-hydroxylase, binds enantioselectively (+)-ABA but not (-)-ABA, whereas the enzyme binds both enantiomers of AHI1 (a structural ABA analogue used as ABA 8'-hydroxylase competitive inhibitor). |
| AT2G34500 | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze in the presence of NADPH the conversion of β-sitosterol to stigmasterol, but not that of 24-epi-campesterol to brassicasterol (unlike CYP710A2). |
| AT2G28860 | member of CYP710A |
| AT3G60955 | a cytochrome P450 pseudogene. overlaps with a real gene on the other strand. |
| AT1G11600 | member of CYP77B |
| AT5G09970 | Member of CYP78A family. Paralog of CYP78A5 and appears to function in a shoot meristem maintainence pathway with LAMP1 that parallels AMP1/CYP87A5. |
| AT1G01190 | cytochrome P450, family 78, subfamily A, polypeptide 8;(source:Araport11) |
| AT1G79370 | member of CYP79C |
| AT5G36220 | member of CYP81D family of cytochrome p450s. This gene was originally called CYP91A1, but was later renamed to CYP81D1. |
| AT4G37330 | member of CYP81D |
| AT4G37370 | member of CYP81D |
| AT4G37400 | member of CYP81F |
| AT5G58860 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly only in root tissue. |
| AT4G00360 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems. |
| AT1G01600 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly at highest level in mature stems and flowers. |
| AT1G63710 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at highest level in mature stems and flowers. |
| AT2G45970 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems.Mutant seeds have reduced seed longevity, higher tetrazolium salt uptake and reduction, and reduced lipid polyester barriers (PMID:32519347). |
| AT1G64900 | Encodes cytochrome P450 (CYP89A2). The mRNA is cell-to-cell mobile. |
| AT5G63450 | AtWRKY33 regulates root apoplastic barrier formation by controlling AtCYP94B1 leading to increased salt tolerance of Arabidopsis plants. Regulation by WRKY33 to control apoplastic barrier formation in roots to confer salt tolerance. |
| AT3G48520 | CYP94B3 is a jasmonoyl-isoleucine-12-hydroxylase that catalyzes the formation of 12-OH-JA-Ile from JA-Ile. By reducing the levels of this the biologically active phytohormone, CYP94B3 attenuates the jasmonic acid signaling cascade. CYP94B3 transcript levels rise in response to wounding. |
| AT2G27690 | Encodes a CYP94C1. Has highest omega-hydroxylase activity with 9,10-epoxystearic acid, while also metabolized lauric acid (C12:0) and C18 unsaturated fatty acids. Gene expression is induced in response to wounding and jasmonic acid treatment. |
| AT4G15110 | member of CYP97B |
| AT2G19500 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT5G56970 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins.Acts on N6-(2-isopentenyl)adenine 9-riboside. |
| AT4G29740 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT1G75450 | This gene used to be called AtCKX6. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT5G21482 | This gene used to be called AtCKX5. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. Enzyme assays show preference for N6 -(2-isopentenyl)adenine 9-glucoside substrate. |
| AT1G68550 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT4G23750 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Monopteros target gene. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT5G53290 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT4G27950 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT3G61630 | CRF6 encodes one of the six cytokinin response factors. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves. |
| AT3G44326 | Cytokinin induced F-Box protein. Forms a unique F-Box family with AT2G27310 and AT2G36090. It is primarily expressed in the root. |
| AT1G04410 | predicted to encode a cytosolic malate dehydrogenase. |
| AT3G04620 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT4G02860 | Phenazine biosynthesis PhzC/PhzF protein;(source:Araport11) |
| AT4G39800 | ** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT4G36860 | DAR1 is a member of a small (7 member) ubiquitin binding protein family. It appears to play a role in regulation of endoreduplication in leaf epidermal tissue. |
| AT2G30550 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT4G18550 | DSEL is cytosolic acylhydrolase that shows prefential lipase activity against the sn-1 position of several classes of lipids, including 1,3-diacylglycerols and 1-monoacylglycerols. Overexpression of DSEL leads to increased peroxisome and oil body levels in cotyledons and reduced beta-oxidation activity in seedlings. |
| AT5G20250 | encodes a member of glycosyl hydrolase family 36. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile. |
| AT3G13450 | branched chain alpha-keto acid dehydrogenase E1 beta |
| AT3G20550 | Encodes a nuclear localized FHA (forhkead) domain containing protein.Mutant plants have shortened roots, delayed flowering time, altered floral organ number, defective floral organs and reduced fertility.Ddl mutants also show reduced levels of pri-miRNAs as well as mature miRNAs suggesting involvement in biogenesis of miRNAs. DDL does not affect transcription of miRNAs directly but may act through other proteins such as DCL. |
| AT1G18950 | DDT domain superfamily;(source:Araport11) |
| AT2G38050 | Similar to mammalian steroid-5-alpha-reductase. Involved in the brassinolide biosynthetic pathway. |
| AT1G17400 | Protein of unknown function. Similar to LAZY1, a gene required or gravitropic response in shoots and roots. Involved in determining lateral root branch angle. |
| AT2G44810 | Mutant has defects in anther dehiscence, pollen maturation, and flower opening. The DAD1 protein is a chloroplastic phospholipase A1 that catalyzes the initial step of jasmonic acid biosynthesis. |
| AT5G05280 | Encodes a RING-finger E3 ligase protein that controls anther dehiscence by positively regulating the expression of DAD1 in the jasmonic acid biosynthesis pathway. |
| AT1G65640 | Encodes a putative DegP protease. |
| AT2G21490 | dehydrin LEA;(source:Araport11) |
| AT3G50980 | dehydrin xero 1;(source:Araport11) |
| AT5G16710 | DHAR3 protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide.Encodes 30-40% of extractable leaf GSH-dependent DHAR activity. Single knockout mutants show unaltered ascorbate and glutathione status in optimal and oxidative stress conditions.Makes a minor contribution to glutathione oxidation in response to increased intracellular hydrogen peroxide (catalase deficiency) (PMID:28381499). |
| AT4G26630 | Encodes a chromatin-associated protein that specifically binds histones H3 and H4 and contributes to modulation of Arabidopsis chromatin structure and function. |
| AT5G45830 | Encodes DOG1 (DELAY OF GERMINATION 1). A quantitative trait locus involved in the control of seed dormancy. Belongs to a novel plant-specific gene family whose members include: DOG1-like 1-4 (DOGL1-4, At4g18660, At4g18680, At4g18690, At4g18650 respectively) and DOG1. DOG1 expression is seed-specific. |
| AT3G20210 | Encodes a vacuolar processing enzyme with caspase-1-like activity that is specifically expressed in inner integument of developing seeds. Mutants display abnormal seed coat development. It is speculated to be involved in cell death of limited cell layers, the purpose of which is to form a seed coat. |
| AT1G65520 | encodes a peroxisomal delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation |
| AT3G10010 | Encodes a protein with DNA glycosylase activity that is involved in maintaining methylation marks. |
| AT4G29330 | DERLIN-1;(source:Araport11) |
| AT5G06250 | Transcription repressor involved in regulation of inflorescence architecture. |
| AT1G48300 | Cytosolic iron-sulfur protein with a [2Fe-2S] cluster which synthesizes triacylglycerol (DGAT activity). |
| AT5G07920 | Encodes a putative diacylglycerol kinase that is mainly expressed in roots, shoots and leaves, but its enzyme product was not active in vitro. |
| AT1G63900 | Encodes a RING-type ubiquitin E3 ligase of the chloroplast outer membrane that associates with TOC complexes and mediates ubiquitination of TOC components, promoting their degradation. It not only regulates chloroplast protein import but also targets components of the peroxisome protein import apparatus, PEX13 in particular. Several studies have been done to examine the peroxisomal localization of this protein, with varying interpretations. |
| AT4G24570 | Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470). The mRNA is cell-to-cell mobile. |
| AT5G09470 | Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470). |
| AT3G11670 | Responsible for the final assembly of galactolipids in photosynthetic membranes. Provides stability to the PS I core complex (e.g. subunits PsaD, PsaE). |
| AT2G45440 | Encodes a protein that likely has dihydropicolinate synthase activity based on its mutant phenotype of decreased lysine levels and increased aspartate levels. The mutant also has increased levels of threonine. The enzyme is predicted to localize to the chloroplast. |
| AT5G42800 | dihydroflavonol reductase. Catalyzes the conversion of dihydroquercetin to leucocyanidin in the biosynthesis of anthocyanins. Not expressed in roots (qRT-PCR). The mRNA is cell-to-cell mobile. |
| AT2G40840 | Encodes a cytosolic protein with transglucosidase and amylomaltase activity. It is an essential component of the pathway from starch to sucrose and cellular metabolism in leaves at night. The protein binds to heteroglycans and utilizes glucose, mannose and xylose as acceptors. Fucose and galactose can also act as acceptors but less efficiently than the previous three. It was also was also recently reported to act on maltodextrins. On the other hand, arabinose and fructose were not efficiently used. Its role probably includes metabolizing maltose exported from the chloroplast. Studies using maltose extracted from the double mutant be2-1 be3-2 showed that this enzyme is preferentially active of β-maltose. The mRNA is cell-to-cell mobile. |
| AT3G22880 | Expression of the AtDMC1 is restricted to pollen mother cells in anthers and to megaspore mother cells in ovules. Similar to meiosis-specific yeast DMC gene. |
| AT1G30825 | Involved in trichome maturation. mutant displays enlarged trichomes |
| AT5G58900 | R-R-type MYB protein |
| AT5G04760 | R-R-type MYB protein which plays negative roles in salt stress and is required for ABA signaling in Arabidopsis. |
| AT3G14990 | Encodes a homolog of animal DJ-1 superfamily protein. In the A. thaliana genome, three genes encoding close homologs of human DJ-1 were identified AT3G14990 (DJ1A), AT1G53280 (DJ1B) and AT4G34020 (DJ1C). Among the three homologs, DJ1C is essential for chloroplast development and viability. It exhibits glyoxalase activity towards glyoxal and methylglyoxal. The mRNA is cell-to-cell mobile. |
| AT1G53280 | Encodes a homolog of animal DJ-1 superfamily protein. In the A. thaliana genome, three genes encoding close homologs of human DJ-1 were identified AT3G14990 (DJ1A), AT1G53280 (DJ1B) and AT4G34020 (DJ1C). Among the three homologs, DJ1C is essential for chloroplast development and viability. It exhibits glyoxalase activity towards glyoxal and methylglyoxal. |
| AT4G10500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT2G37590 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT4G38000 | DNA binding with one finger 4.7;(source:Araport11) |
| AT2G17880 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT3G13310 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT2G42750 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT1G66730 | Encodes a novel plant specific DNA ligase that is involved in seed germination and DNA repair. |
| AT1G20340 | recombination and DNA-damage resistance protein (DRT112) One of two Arabidopsis plastocyanin genes. Predominant form, expressed 10x higher than PETE1. PETE2 is thought to be post-transcriptionally regulated via copper accumulation and is involved in copper homeostasis. Mutation of this gene does not have obvious effect on photosynthesis. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the membrane. |
| AT1G51700 | Encodes dof zinc finger protein (adof1). The mRNA is cell-to-cell mobile. |
| AT2G47230 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. |
| AT4G25670 | stress response NST1-like protein;(source:Araport11) |
| AT1G45190 | downregulated in DIF1 18;(source:Araport11) |
| AT2G45830 | downstream target of AGL15 2;(source:Araport11) |
| AT5G24530 | Encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility to downy mildew. The mRNA is cell-to-cell mobile. |
| AT3G48160 | E2F-like protein, an inhibitor of the endocycle, preserves the mitotic state of proliferating cells by suppressing transcription of genes that are required for cells to enter the DNA endoreduplication cycle. |
| AT3G11020 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2B). The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A. |
| AT5G67190 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT1G27461 | Nuclear localized protein involved in osmotic stress tolerance. |
| AT5G55970 | Drought-induced gene encoding an ER-localized RING-type E3 Ub ligase. |
| AT1G30160 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G53230 | hypothetical protein (DUF295);(source:Araport11) |
| AT1G64110 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT4G35560 | Target promoter of the male germline-specific transcription factor DUO1. The mRNA is cell-to-cell mobile. |
| AT3G50660 | Encodes a 22α hydroxylase whose reaction is a rate-limiting step in brassinosteroid biosynthetic pathway. The protein is a member of CYP90B gene family. CLM is an epi-allele with small, compressed rosette, reduced internode length, and reduced fertility, appears in selfed ddm mutant plants possibly due to loss of cytosine methylation. Transcripts accumulate in actively growing tissues, and GUS expression is negatively regulated by brassinosteroids. Localized in the endoplasmic reticulum. The in vitro expressed protein can perform the C-22 hydroxylation of a variety of C27-, C28- and C29-sterols. Cholesterol was the best substrate, followed by campesterol. Sitosterol was a poor substrate. |
| AT1G50430 | Mutants are defective in Brassinosteroid biosynthesis (delta7-sterol-C7 reduction step) and have a dwarf phenotype. EXO70 interactor and presumed negative secretion regulator. |
| AT1G12610 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (DDF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. Overexpression of this gene results in delayed flowering and dwarfism, reduction of gibberellic acid biosynthesis, and increased tolerance to high levels of salt. This gene is expressed in all tissues examined, but most abundantly expressed in upper stems. Overexpression of this gene is also correlated with increased expression of GA biosynthetic genes and RD29A (a cold and drought responsive gene). Under salt stress it induces the expression of GAOX7, which encodes ad C20-GA inhibitor. |
| AT1G63030 | encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (DDF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. Overexpression of this gene results in the reduction of gibberellic acid biosynthesis. This gene is expressed in all tissues examined, but most abundantly expressed in rosette leaves and stems. Overexpression of DDF1, a putative paralog of this gene, also reduces gibberellic acid biosynthesis and makes the plants more tolerant to high-salinity levels. |
| AT5G54510 | Encodes an IAA-amido synthase that conjugates Ala, Asp, Phe, and Trp to auxin. Lines overexpressing this gene accumulate IAA-ASP and are hypersensitive to several auxins. Identified as a dominant mutation that displays shorter hypocotyls in light grown plants when compared to wild type siblings. Protein is similar to auxin inducible gene from pea (GH3). |
| AT4G03400 | Encodes a GH3-related gene involved in red light-specific hypocotyl elongation. Analysis of sense and antisense transgenic plants suggests that DFL2 is located downstream of red light signal transduction and determines the degree of hypocotyl elongation. |
| AT1G03055 | Encodes the ortholog of rice D27. It is plastid-localized and is required for the inhibition of secondary bud outgrowth and operates on a nonmobile precursor upstream of MAX1 in the SL biosynthesis pathway. |
| AT1G61210 | DWA3 encodes a DWD(DDB1 binding WD40) protein. Invitro analyses suggest its involvement in the negative regulation of ABA responses.One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
| AT2G14120 | Encodes a dynamin related protein. DRPs are self-assembling GTPasse involved in fission and fusion of membranes. DRP3B functions in mitochondrion and peroxisome fission in combination with DRP3A. |
| AT1G60540 | Annotated as pseudogene of the dynamin family.Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT2G40550 | Encodes a nuclear localized target of E2Fa-DPa, transcription factors controlling cell cycle progression. Required for sister chromatid cohesion and DNA repair. |
| AT5G16260 | Encodes a RNA binding protein ELF9 (EARLY FLOWERING9). Loss of ELF9 function in the Wassilewskija ecotype causes early flowering in short days. ELF9 reduces SOC1 (SUPPRESSOR OF OVEREXPRESSION OF CO1) transcript levels, possibly via nonsense-mediated mRNA decay. The mRNA is cell-to-cell mobile. |
| AT1G77300 | Encodes a protein with histone lysine N-methyltransferase activity required specifically for the trimethylation of H3-K4 in FLC chromatin (and not in H3-K36 dimethylation). Acts as an inhibitor of flowering specifically involved in the autonomous promotion pathway. EFS also regulates the expression of genes involved in carotenoid biosynthesis and nitrogen assimilation.Modification of histone methylation at the CRTISO locus reduces transcript levels 90%. The increased shoot branching seen in some EFS mutants is likely due to the carotenoid biosynthesis defect having an effect on stringolactones.Required for ovule, embryo sac, anther and pollen development. |
| AT5G53870 | early nodulin-like protein 1;(source:Araport11) |
| AT2G23990 | early nodulin-like protein 11;(source:Araport11) |
| AT5G15350 | early nodulin-like protein 17;(source:Araport11) |
| AT1G76180 | Encodes a dehydrin protein whose expression is induced early on in response to dehydration stress. This gene's expression to cold occurs in two waves, with early induction occurring within 1 h and secondary induction occurring 5 h after the beginning of cold stress. Expression is also induced in response to ABA but not in response to 2,4-D, BA, and GA3. ERD14 protein is capable of binding Ca2+, especially when the protein is phosphorylated. |
| AT1G20450 | Encodes a gene induced by low temperature and dehydration. Inhibits e.coli growth while overexpressed. Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. LTI29 and LTI30 double overexpressors confer cold tolerance. Localized to membranes and cytoplasm. |
| AT3G30775 | Encodes a proline oxidase that is predicted to localize to the inner mitochondrial membrane, its mRNA expression induced by high levels of Al and by osmotic stress. The promoter contains an L-proline-inducible element. |
| AT1G42430 | Novel plant specific, chloroplast localized protein that is involved in regulation of starch degradation. |
| AT1G18330 | EARLY-PHYTOCHROME-RESPONSIVE1 |
| AT1G10370 | Encodes GSTU17 (Glutathione S-Transferase U17). Functions as a negative component of stress-mediated signal transduction pathways in drought and salt stress responses. |
| AT4G13840 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G26370 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G55830 | A member of the Glycosyltransferase Family 64, homologous to Poplar cambium-expressed GT64 gene. The EPC1 protein plays a critical role during plant development in maintaining the integrity of organs via cell-cell adhesion, thereby providing mechanical strength and facilitating the movement of metabolites throughout the plant.Loss of function specifically affects glycosylinositolphosphorylceramide (GIPC) mannosylation. |
| AT5G64720 | Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion. |
| AT3G63060 | EDL3 is an F-box protein involved that mediated the regulation of abscisic acid signalling. |
| AT1G54270 | member of eIF4A - eukaryotic initiation factor 4A |
| AT4G24800 | MA3 domain-containing protein;(source:Araport11) |
| AT3G18980 | EIN2 targeting protein1;(source:Araport11) |
| AT4G38495 | Subunit if INO80 chromatin remodeling complex. Along with EIN6 (REF6), redundantly controls the level and the localization of the repressive histone modification H3K27me3 and the histone variant H2A. |
| AT2G43400 | Encodes a unique electron-transfer flavoprotein:ubiquinone oxidoreductase that is localized to the mitochondrion. Mutants are more sensitive to sugar starvation when plants are kept in the dark for long periods. |
| AT2G29950 | Member of a small family of proteins containing DUF1313 domain. Involved in flowering time. |
| AT3G06470 | ELO family protein containing a characteristic histidine motif which binds to AtCb5-B, interacts with AtBI-1. Together with AtCb5-B interacts with KCR1, PAS2, and CER10, which are essential for the synthesis of VLCFAs. |
| AT1G75000 | ELO family protein. |
| AT5G50320 | A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1?ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. Two lines with RNAi constructs directed against HAG3 grow normally and can produce root calli, but have defects in agrobacterium-mediated transformation. |
| AT5G16715 | protein EMBRYO DEFECTIVE 2247;(source:Araport11) |
| AT1G30610 | Pentatricopeptide repeat protein .Mutations in this locus result in embryo lethality due to defects in chloroplast development. Embryo shape at seed maturity is globular. |
| AT1G24340 | A locus involved in embryogenesis. Mutations in this locus result in embryo lethality. The mRNA is cell-to-cell mobile. |
| AT5G18570 | Encodes AtObgC, a plant ortholog of bacterial Obg. AtObgC is a chloroplast-targeting GTPase essential for early embryogenesis. Mutations in this locus result in embryo lethality. The protein is dually localized in the stroma and the inner envelope membrane and is involved in thylakoid membrane biogenesis and functions primarily in plastid ribosome biogenesis during chloroplast development. |
| AT5G55940 | Uncharacterized protein family (UPF0172);(source:Araport11) |
| AT2G38770 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G45000 | Encodes a nucleoporin, a component of the nuclear pore complex, that appears to be a major negative regulator of auxin signalling. Loss of function mutants are embryo lethal. |
| AT3G63490 | Ribosomal protein L1p/L10e family;(source:Araport11) |
| AT2G30200 | Malonyl-ACP expressed in developing seeds. Loss of function mutants are embryo lethal and over expression in seeds leads to increased seed oil content. |
| AT2G01860 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G35950 | embryo sac development arrest 12;(source:Araport11) |
| AT3G10000 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G23440 | embryo sac development arrest 6;(source:Araport11) |
| AT4G00310 | Putative membrane lipoprotein;(source:Araport11) |
| AT2G36640 | Encodes putative phosphotyrosine protein belonging to late embryogenesis abundant (LEA) protein in group 3 that might be involved in maturation and desiccation tolerance of seeds. RFLP and CAPS mapping place it on chromosome 4 but the nucleotide sequence maps it to chromosome 2. |
| AT5G66460 | Encodes a endo-beta-mannanase involved in seed germination and silique dehiscence. |
| AT1G07670 | TPLATE complex protein involved in clathrin-mediated endocytosis. |
| AT4G21600 | Encodes a protein with mismatch-specific endonuclease activity with a preference for T/G, A/G, and G/G of single base mismatches. It also has the ability to cleave indel types of mismatches (heteroduplexes with loops). |
| AT3G07100 | Encodes SEC24a/ERMO2. Required for endoplasmic reticulum (ER) morphology. Has epistatic interactions with AT1G55350, AT3G59420, and AT3G10525. |
| AT1G29330 | Encodes a protein similar in sequence to animal and yeast endoplasmic reticulum retention signal receptor. This protein can functionally complement the yeast homologue. Transcript is detected in flower buds, stems, root, and leaves. |
| AT2G01850 | EXGT-A3 has homology to xyloglucan endotransglucosylases/hydrolases (XTHs). Mutants in this gene show a lesion mimic phenotype associated with leaf maturation and a reduction in the number of tertiary veins. Individual tracheary elements in the mutants are shorter, but phloem transport activity is not severely affected. EXGT-A3 plays a role in xyloglucan degradation in the differentiating tracheary elements of rosette leaves. The mRNA is cell-to-cell mobile. |
| AT4G19040 | Encodes a PH and START domain-containing protein that mediates resistance to pathogenic fungi. Resistance requires salicylic acid signalling. Mutants are resistant to E. cichoracearum. Expressed throughout plant tissues and possibly localized to membranes /mitochondrion. |
| AT1G74710 | Encodes a protein with isochorismate synthase activity. Mutants fail to accumulate salicylic acid. Its function may be redundant with that of ICS2 (AT1G18870). |
| AT5G22090 | EAR1 is a negative regulator of ABA signaling that enhances the activity of all six clade A PP2Cs (ABI1, ABI2, HAB1, HAB2, AHG1, AHG3) by interacting with and releasing the N-terminal autoinhibition of these proteins. EAR1 indirectly affects OST1 activity through enhancing ABI1 activity. The EAR1 141-287 fragment is sufficient for the functioning of EAR1 in ABA responses; the 131-248 region harbors an intrinsically disordered region and only 249-278 can form a predicted regular structure. EAR1 is located in the ER, nuclei, and cytoplasm; ABA signaling promotes the translocation of EAR1 from the ER and/or cytoplasm to the nucleus. Mutations showed that it functions in seed germination, primary root growth, and drought tolerance. |
| AT4G31820 | A member of the NPY family genes (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Encodes a protein with similarity to NHP3. Contains BTB/POZ domain. Promoter region has canonical auxin response element binding site and Wus binding site. Co-localizes to the late endosome with PID. Regulates cotyledon development through control of PIN1 polarity in concert with PID. Also involved in sepal and gynoecia development. |
| AT1G01380 | ETC1 is involved in trichome and root hair patterning in Arabidopsis. |
| AT3G05600 | Encodes a cytosolic epoxide hydrolase capable of acting on 9,10-epoxystearic acid and on 12,13- epoxyoctadec-9-enoic acid that is involved in the synthesis of poly-hydroxylated cutin monomers. |
| AT5G62230 | Encodes a receptor-like kinase that, together with ER and ERL2 governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. It is important for maintaining stomatal stem cell activity and preventing terminal differentiation of the meristemoid into the guard mother cell. Along with erl2 functionally compensates for loss of erecta during integument development. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT2G20880 | Encodes ERF53, a drought-induced transcription factor. Belongs to the AP2/ERF superfamily, and has a highly conserved AP2 domain. Regulates drought-responsive gene expressions by binding to the GCC box and/or dehydration-responsive element (DRE) in the promoter of downstream genes. Overexpression of AtERF53 driven by the CaMV35S promoter resulted in an unstable drought-tolerant phenotype in T2 transgenic plants. Involved in heat shock response. |
| AT1G03800 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-10). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT1G28360 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ERF12). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. Regulates floral development. |
| AT3G55990 | Encodes ESK1 (Eskimo1). A member of a large gene family of DUF231 domain proteins whose members encode a total of 45 proteins of unknown function. ESK1 functions as a negative regulator of cold acclimation. Mutations in the ESK1 gene provides strong freezing tolerance. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). The mRNA is cell-to-cell mobile. |
| AT4G29960 | EBS7 encodes a plant specific, endoplasmic reticulum localized protein that is involved in endoplasmic reticulum-associated degradation (ERAD). It interacts with the ERAD component AtHRD1a and may regulate HRD1a stability. Identified in a screen for supressors of a mutation in bri1 that causes bri1 to be retained in the ER. Loss of EBS7 function restores BR sensitivity in the bri1-9 mutant allele. |
| AT5G21960 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT3G16280 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT1G53170 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT1G04310 | encodes an ethylene receptor related to bacterial two-component histidine kinases. |
| AT5G47220 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-2). The protein contains one AP2 domain. Functions as activator of GCC box?dependent transcription. Positive regulator of JA-responsive defense genes and resistance to F. oxysporum and enhances JA inhibition of root elongation. |
| AT3G15210 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-4). The protein contains one AP2 domain. Acts as a negative regulator of JA-responsive defense gene expression and resistance to the necrotrophic fungal pathogen Fusarium oxysporum and antagonizes JA inhibition of root elongation. The mRNA is cell-to-cell mobile. |
| AT5G47230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-5). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. The mRNA is cell-to-cell mobile. |
| AT4G17490 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-6). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. It is involved in the response to reactive oxygen species and light stress. Involved in regulating root architecture and the response to cold stress. |
| AT4G28140 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. Regulated by heat shock. |
| AT2G31230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT2G44940 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT3G60490 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT3G11400 | One of the 2 genes that code for the G subunit of eukaryotic initiation factor 3 (EIF3). The mRNA is cell-to-cell mobile. |
| AT2G39050 | Encodes a nucleocytoplasmic lectin that is capable of binding carbohydrates. It is involved in ABA mediated stomatal movement and increased expression is correlated with increased resistance to Pseudomonas syringae. |
| AT1G79270 | evolutionarily conserved C-terminal region 8;(source:Araport11) |
| AT4G33630 | Encodes one of the two plastid proteins EXECUTER (EX1, AT4G33630) and EX2 (AT1G27510). Mediates singlet oxygen induced programmed cell death. |
| AT1G47560 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
| AT3G09530 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G64260 | EXORDIUM like 2;(source:Araport11) |
| AT5G51550 | EXORDIUM like 3;(source:Araport11) |
| AT5G09440 | EXORDIUM like 4;(source:Araport11) |
| AT1G69530 | Member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT5G56320 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT3G55500 | expansin-like protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT5G05290 | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT2G39700 | putative expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT4G28250 | putative beta-expansin/allergen protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT3G45970 | member of EXPANSIN-LIKE. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) The mRNA is cell-to-cell mobile. |
| AT4G34390 | extra-large GTP-binding protein 2;(source:Araport11) |
| AT1G61340 | Encodes a F-box protein induced by various biotic or abiotic stress. |
| AT4G05010 | F-box family protein;(source:Araport11) |
| AT4G08980 | Encodes an F-box gene that is a novel negative regulator of AGO1 protein levels and may play a role in ABA signalling and/or response. It is a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins. |
| AT2G05970 | F-box protein (DUF295);(source:Araport11) |
| AT1G26380 | Functions in the biosynthesis of 4-hydroxy indole-3-carbonyl nitrile (4-OH-ICN), a cyanogenic phytoalexin in Arabidopsis. FOX1 acts as a dehydrogenase on indole cyanohydrin to form indole carbonyl nitrile. |
| AT3G24140 | Encodes a basic helix-loop-helix transcription factor whose activity is required to promote differentiation of stomatal guard cells and to halt proliferative divisions in their immediate precursors. It fulfills its role through recruitment of the Arabidopsis Retinoblastoma homologue, RETINOBLASTOMA-RELATED (RBR). Both transcript and protein are expressed in and are required for halting divisions at the end of the stomatal lineage. It also has a role in the promotion of guard cell fate and in controlling the transition from guard mother cell to guard cell. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT4G02810 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
| AT2G37678 | Positive regulator of photomorphogenesis in far-red light. Most abundant in young seedlings in the dark. Downregulated in the light and older as plants develop. Localized in the nucleus and the cytoplasm. Nuclear localization strongest in the dark. Degraded through the 26S proteasome. Regulated by PHYA. It is specifically required for the light-regulated nuclear accumulation of phyA ( but not phyB) likely by shuttling PHYA into the nucleus. |
| AT5G28530 | FAR1-related sequence 10;(source:Araport11) |
| AT1G10240 | FAR1-related sequence 11;(source:Araport11) |
| AT1G80010 | FAR1-related sequence 8;(source:Araport11) |
| AT3G59470 | Encodes one of four FRS (FAR1-RELATED SEQUENCE) factor-like genes in Arabidopsis. FRS factors are characterized by having an N-terminal C2H2-type chelating motif of the WRKY- Glial Cell Missing1 family, a central core transposase domain of Mutator-like element transposases, and a C-terminal SWIM domain. The four FRF-like genes in Arabidopsis share only the N-terminal motif with FRS proteins. FRF1 has been shown to bind the RB-box in vitro. The RB-box contributes to restricting SHOOTMERISTEMLESS expression to the shoot apical meristem. |
| AT5G63530 | Farnesylated protein that binds metals. |
| AT4G12730 | AF333971 Arabidopsis thaliana fasciclin-like arabinogalactan-protein 2 (Fla2) mRNA, complete cds. Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT3G11700 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT1G15190 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT5G06920 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT3G44550 | Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. The mRNA is cell-to-cell mobile. |
| AT3G44560 | fatty acid reductase 8;(source:Araport11) |
| AT3G23410 | Encodes a fatty alcohol oxidase. |
| AT3G63170 | Encodes a plastid stroma localized fatty acid binding protein involved in fatty acid metabolism. |
| AT5G11460 | FCS like zinc finger 10 is induced during energy starvation through SnRK1 signaling. Mutants accumulate more SnRK1alpha1 which results in the inhibition of seedling growth under favorable growth conditions. Increased SnRK1 activity in the mutant also results in the downregulation of TOR signaling (DOI:10.1111/tpj.13854). |
| AT1G78020 | FCS like zinc finger 6 is induced during energy starvation through SnRK1 signaling. Mutants accumulate more SnRK1alpha1 which results in the inhibition of seedling growth under favorable growth conditions. Increased SnRK1 activity in the mutant also results in the downregulation of TOR signaling (DOI:10.1111/tpj.13854). |
| AT4G25100 | Fe-superoxide dismutase |
| AT2G30766 | Functions in iron homeostasis, activates iron deficiency response genes such as bHLH38, bHLH39, IRT1, and FRO2. |
| AT2G35620 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots.Mucilage is easily detached from fei2 mutants seeds, and forms a capsule that is >50% smaller relative to wild-type. |
| AT1G10960 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G15140 | FAD/NAD(P)-binding oxidoreductase;(source:Araport11) |
| AT1G01580 | Encodes the low-iron-inducible ferric chelate reductase responsible for reduction of iron at the root surface. It is likely to be the major Fe(III) chelate reductase in Arabidopsis iron metabolism. Coordinately regulated with IRT1, the major transporter responsible for high-affinity iron uptake from the soil, at both transcriptional and posttranscriptional levels. Steady state mRNA levels are regulated by several metals. Its transcription is regulated by FIT1. |
| AT1G23020 | Encodes a ferric chelate reductase whose transcription is regulated by FIT1. Expressed in the root, shoot, flower and cotyledon. |
| AT3G11050 | ferritin 2;(source:Araport11) |
| AT3G56090 | Encodes FERRITIN 3, AtFER3. Ferritins are a class of 24-mer multi-meric proteins found in all kingdoms of life. Function as the main iron store in mammals. Evidence suggests that Arabidopsis ferritins are essential to protect cells against oxidative damage, but they do not constitute the major iron pool. |
| AT2G40300 | Encodes FERRITIN 4, AtFER4. Ferritins are a class of 24-mer multi-meric proteins found in all kingdoms of life. Function as the main iron store in mammals. Evidence suggests that Arabidopsis ferritins are essential to protect cells against oxidative damage, but they do not constitute the major iron pool. Localize to mitochondria. Knock out mutants are not sensitive to abiotic stress. |
| AT4G04020 | Fibrillin precursor protein. The fibrillin preprotein, but not the mature protein interacts with ABI2. Regulated by abscisic acid response regulators. Involved in abscisic acid-mediated photoprotection. The mRNA is cell-to-cell mobile. |
| AT5G19940 | Enables plants to cope with moderate light stress and affects cadmium tolerance. |
| AT4G00030 | Plastid-lipid associated protein PAP / fibrillin family protein;(source:Araport11) |
| AT4G26700 | Encodes a member of the fimbrin family. Different members of the fimbrin/plastin family have diverged biochemically during evolution to generate either tight actin bundles or loose networks with distinct biochemical and biophysical properties. FIM4 generates both actin bundles and branched actin filaments whereas FIM5 only generates actin bundles. |
| AT1G12200 | Putative flavin monooxygenase. |
| AT1G68050 | Encodes FKF1, a flavin-binding kelch repeat F box protein, is clock-controlled, regulates transition to flowering. Forms a complex with GI on the CO promoter to regulate CO expression. |
| AT1G65860 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates |
| AT1G62560 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
| AT1G62570 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
| AT5G28470 | Encodes a member of the nitrate/peptide NTR/PTR family of transporters is required for accumulation and transport of pollen-specific flavonol 3-O-sophorosides, characterized by a glycosidic β-1,2-linkage, to the pollen surface of Arabidopsis. |
| AT5G08640 | Encodes a flavonol synthase that catalyzes formation of flavonols from dihydroflavonols. Co-expressed with CHI and CHS (qRT-PCR). |
| AT3G12145 | A novel leucine-rich repeat protein. Interacts directly with MADS domain transcription factor. |
| AT1G43800 | Δ9 stearoyl-ACP desaturase which together with FAB2, AAD1, and AAD5 redundantly participates in oil storage during the maturation phase. |
| AT1G51140 | Encodes a basic helix-loop-helix-type transcription factor involved in photoperiodism flowering. Binds to the E-box cis-element in the CONSTANS (CO) promoter to regulate flowering. Interacts with CFL1 and along with CFLAP2 negatively regulates cuticle development. Binds to the potassium channel gene KAT1 as a dimer. The DNA-binding capacity is inhibited in response to ABA through phosphorylation-dependent monomerization. |
| AT5G10140 | MADS-box protein encoded by FLOWERING LOCUS C - transcription factor that functions as a repressor of floral transition and contributes to temperature compensation of the circadian clock. Expression is downregulated during cold treatment. Vernalization, FRI and the autonomous pathway all influence the state of FLC chromatin. Both maternal and paternal alleles are reset by vernalization, but their earliest activation differs in timing and location. Histone H3 trimethylation at lysine 4 and histone acetylation are associated with active FLC expression, whereas histone deacetylation and histone H3 dimethylation at lysines 9 and 27 are involved in FLC repression. Expression is also repressed by two small RNAs (30- and 24-nt) complementary to the FLC sense strand 3? to the polyA site. The small RNAs are most likely derived from an antisense transcript of FLC. Interacts with SOC1 and FT chromatin in vivo. Member of a protein complex. |
| AT5G43870 | FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT4G14740 | FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT5G14780 | Encodes a NAD-dependent formate dehydrogenase. |
| AT5G67470 | formin homolog 6;(source:Araport11) |
| AT5G58160 | Class II formin; modulator of pollen tube elongation. |
| AT4G31380 | encodes a small protein with unknown function and is similar to flower promoting factor 1. This gene is not expressed in apical meristem after floral induction but is expressed in roots, flowers, and in low abundance, leaves. |
| AT5G22940 | Homolog of FRA8 (AT2G28110), a member of a member of glycosyltransferase family 47; exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. |
| AT5G47820 | Encodes a kinesin-like protein with an N-terminal microtubule binding motor domain. Protein is localized to the periphery of the cytoplasm and mutants in the gene exhibit altered orientation of cellulose microfibrils and reduced mechanical strength of fibers. |
| AT2G28110 | Homolog to AT5G22940, a member of glycosyltransferase family 47 that is involved in secondary cell wall biosynthesis. It exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. Protein has a domain that shares significant similarity with the pfam03016 domain. It is expressed specifically in developing vessels and fiber cells, and FRA8 is targeted to Golgi. Mutants have irregular xylem formation, reduced cellulose levels and plants are smaller than normal siblings. |
| AT1G63930 | EXO70 interactor and presumed negative secretion regulator. |
| AT5G51830 | Encodes one of the several Arabidopsis fructokinases. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). Important for seed oil accumulation and vascular development. |
| AT3G59480 | Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). |
| AT1G43670 | Encodes a fructose-1,6-bisphosphatase. This enzyme, in addition to catalyzing the formation of fructose-6-phosphate for sucrose biosynthesis, appears to play a role in fructose-mediated signaling that is independent of its enzymatic activity. atcfbp-1/fins1 mutants have reduced photosynthetic rates, elevated levels of starch and reduced levels of sucrose during the day. Although the protein is expected to be cytosolic, a GFP-tagged version localizes to the cytoplasm and the nucleus. The mRNA is cell-to-cell mobile. |
| AT2G21330 | fructose-bisphosphate aldolase 1;(source:Araport11) |
| AT2G29080 | encodes an FtsH protease that is localized to the mitochondrion |
| AT3G47060 | encodes an FtsH protease that is localized to the chloroplast |
| AT5G02160 | Zinc-finger domain containing protein involved in abiotic stress response. Possesses an N-terminal transit peptide followed by a hydrophobic domain and a zinc-finger domain. Despite the presence of a zinc-finger domain (C4-type) with two CXXCXGXG conserved repeats, characteristic of DNAJ protein, the conserved J domain is absent in FIP. Interacts with FtsH5. Gene expression levels are reduced and negatively regulates stress response genes during stress conditions. |
| AT1G74420 | Predicted fucosyltransferase, based on similarity to FUT1, but not functionally redundantwith FUT1. |
| AT2G15390 | Encodes an alpha-(1,2)-fucosyltransferase. |
| AT3G13550 | Encodes a protein similar to ubiquitin-conjugating enzyme (E2) variant proteins (UEV); lacks catalytic cysteine residue found in ubiquitin-conjugating enzyme E2. Represses photomorphogenesis and induces skotomorphogenesis in the dark. |
| AT1G71450 | Encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. FUF1 appears to negatively regulate certain ethylene responsive EDF genes thereby negatively regulating flower senescence. |
| AT1G20110 | Encodes a protein that is localized to the peripheral membrane of late endosomal compartments. Involved in the regulation of mulitivesicular/prevacuolar compartment protein sorting. Loss of function mutations are embryo lethal. Regulates IRT1-dependent metal transport and metal homeostasis. The mRNA is cell-to-cell mobile. |
| AT1G03160 | A new plant-specific member of the dynamin superfamily; defines a new protein class within the dynamin superfamily of membrane remodeling GTPases that regulates organization of the thylakoid network in plants. Targeted to chloroplasts and associated with thylakoid and envelope membranes as punctate structures. Knockout mutants have abnormalities in chloroplast and thylakoid morphology, including disorganized grana stacks and alterations in the relative proportions of grana and stroma thylakoids. Overexpression of FZL-GFP also conferred defects in thylakoid organization. |
| AT4G36730 | member of a gene family encoding basic leucine zipper proteins (GBFs) which bind the G-box |
| AT4G01120 | bZIP (basic leucine zipper) transcription factor that binds to the G-box regulatory element found in many plant promoters. GBF2 nuclear localization is increased by blue light |
| AT2G46270 | encodes a bZIP G-box binding protein whose expression is induced by ABA. It has been shown to bind to Adh that contains the G-box and is induced by cold and water deprivation. GBF3 has been shown to be expressed mostly in the root and dark-grown leaves. GBF3 can act as homodimers and as heterodimers with GFB1, GBF2 and GBF4. In addition, GBF3!?s DNA binding activity is enhanced by GIP1, GPRI1 and GPRI2. |
| AT5G45580 | GARP-G2-like transcription factor involved in low temperature regulation of flavonoid biosynthesis. |
| AT4G17330 | gene of unknown function expressed in seedlings, flower buds and stems |
| AT2G18490 | GAZ is a nuclear localized transcriptional activator that is regulated (decreased) by GA and ABA levels. GAZ is expressed in the root stele and may function non-cell autonomously to effect hormone mediated control of ground tissue maturation. |
| AT5G44670 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT4G20170 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT5G30500 | Nucleotide-diphospho-sugar transferases superfamily protein;(source:Araport11) |
| AT1G56600 | GolS2 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS2 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS2 have increased tolerance to salt, chilling, and high-light stress. |
| AT1G09350 | Predicted to encode a galactinol synthase |
| AT3G53950 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT1G75620 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT3G57620 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT1G14430 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT5G47780 | Encodes a protein with putative galacturonosyltransferase activity. The mRNA is cell-to-cell mobile. |
| AT3G50760 | Encodes a protein with putative galacturonosyltransferase activity. The mRNA is cell-to-cell mobile. |
| AT1G13250 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT4G02130 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT5G66510 | Encodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex. |
| AT5G63510 | Encodes a mitochondrial gamma carbonic anhydrase-like protein. Component of the NADH dehydrogenase complex. |
| AT3G48680 | Encodes a mitochondrial gamma carbonic anhydrase-like protein. Component of the NADH dehydrogenase complex. The mRNA is cell-to-cell mobile. |
| AT4G32940 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteinases that is expressed in vegetative organs and is upregulated in association with various types of cell death and under stressed conditions. They are essential in processing seed storage proteins and for mediating the susceptible response of toxin-induced cell death. |
| AT4G30530 | Encodes a gamma-glutamyl peptidase, outside the GGT family, that can hydrolyze gamma-glutamyl peptide bonds. The mRNA is cell-to-cell mobile. |
| AT2G28340 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT4G36620 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT2G45050 | Encodes a member of the GATA factor family of zinc finger transcription factors. A positive regulator of photomorphogenesis. |
| AT3G60530 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT5G66320 | Encodes GATA transcription factor gene GNC, involved in regulating carbon and nitrogen metabolism. Expression occurs in aerial tissue at an early stage of development and is inducible by nitrate. |
| AT4G32890 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT2G20570 | Encodes GLK1, Golden2-like 1, one of a pair of partially redundant nuclear transcription factors that regulate chloroplast development in a cell-autonomous manner. GLK2, Golden2-like 2, is encoded by At5g44190. GLK1 and GLK2 regulate the expression of the photosynthetic apparatus. GLK1 is also a member of the GARP transcription factor family. |
| AT2G06025 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT2G04845 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT5G65280 | Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor. Loss of function mutations in GCL1 show no ABA response defects based on assays of seed germination and seedling development.GCL1 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase. |
| AT1G53940 | Encodes a lipase, has in vitro lipase activity with p-nitrophenyl acetate and p-nitrophenyl butyrate, gene expression induced by hormones, negatively regulates auxin signaling, involved in disease resistance |
| AT3G14225 | Contains lipase signature motif and GDSL domain. |
| AT3G59410 | Encodes an eIF2alpha kinase that can bind uncharged tRNA via its C-terminus and can phosphorylate both eIF2alpha homologues in Arabidopsis. |
| AT5G65430 | member of 14-3-3 proteins. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 |
| AT5G13630 | Encodes magnesium chelatase involved in plastid-to-nucleus signal transduction. |
| AT2G18640 | Encodes an endoplasmic reticulum-targeted geranylgeranyl pyrophosphate synthase |
| AT1G14920 | Similar to a putative transcription factor and transcriptional coactivators. Repressor of GA responses and involved in gibberellic acid mediated signaling. Member of the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. GAI may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. |
| AT1G47990 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins. AtGA2OX4 expression is responsive to cytokinin and KNOX activities. |
| AT1G80340 | Encodes a protein with gibberellin 3 β-hydroxylase activity. The protein was heterologously expressed in E. coli and shown to catalyze the hydroxylation of both GA9 and GA20. |
| AT1G22770 | Together with CONSTANTS (CO) and FLOWERING LOCUS T (FT), GIGANTEA promotes flowering under long days in a circadian clock-controlled flowering pathway. GI acts earlier than CO and FT in the pathway by increasing CO and FT mRNA abundance. Located in the nucleus. Regulates several developmental processes, including photoperiod-mediated flowering, phytochrome B signaling, circadian clock, carbohydrate metabolism, and cold stress response. The gene's transcription is controlled by the circadian clock and it is post-transcriptionally regulated by light and dark. Forms a complex with FKF1 on the CO promoter to regulate CO expression. The mRNA is cell-to-cell mobile. |
| AT2G37585 | Encodes GlcAT14C. Has glucuronosyltransferase activity adding glucuronic acid residues to beta-1,3- and beta-1,6-linked galactans. |
| AT4G38880 | GLN PHOSPHORIBOSYL PYROPHOSPHATE AMIDOTRANSFERASE 2 |
| AT5G65630 | This gene is predicted to encode a bromodomain-containing protein. Plant lines expressing RNAi constructs targeted against GTE7 show some resistance to agrobacterium-mediated root transformation. |
| AT3G27260 | Kinase like protein with similarity to yeast BDF1 and human RING3 protein, which have two bromodomains GTE8 has a single bromodomain |
| AT5G08000 | Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and binds callose. |
| AT4G04970 | encodes a gene similar to callose synthase The mRNA is cell-to-cell mobile. |
| AT1G70090 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT4G09990 | glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11) |
| AT4G31710 | member of Putative ligand-gated ion channel subunit family |
| AT5G64050 | Glutamate-tRNA ligase. Targeted to mitochondria and chloroplast. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana. |
| AT1G15040 | Encodes a nitrogen regulated putative glutamine amidotransferase that represses shoot branching. |
| AT4G31730 | Glutamine dumper1 is a putative transmembrane protein. It is involved in glutamine secretion The mRNA is cell-to-cell mobile. |
| AT5G57685 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
| AT1G48470 | Encodes cytosolic glutamine synthase isozyme. Expression of mRNA is not detectable in roots. |
| AT1G03850 | Encodes glutaredoxin ATGRXS13, required to facilitate Botrytis cinerea infection of Arabidopsis thaliana plants. Sylvain La Camera et al (2011, PMID:21756272) reported a third splice variant in addition to the two annotated in TAIR10. It is a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT4G11600 | Encodes glutathione peroxidase. Exhibits moderate binding affinity with dinotefuran. |
| AT1G63460 | Encodes GPX8 (glutathione peroxidase 8). Involved in the suppression of oxidative damages in nucleus and cytosol. The mRNA is cell-to-cell mobile. |
| AT5G17220 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). Mutants display no pigments on leaves and stems. Likely to function as a carrier to transport anthocyanin from the cytosol to tonoplasts. |
| AT1G10360 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G78380 | Encodes a glutathione transferase that is a member of Tau GST gene family. Expression is induced by drought stress, oxidative stress, and high doses of auxin and cytokinin. naming convention according to Wagner et al. (2002) The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
| AT5G62480 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT5G02790 | GST functions in reductive deglutathionylation of glutathione conjugates of quercetin. |
| AT3G24170 | Encodes a cytosolic glutathione reductase. |
| AT1G79530 | Encodes one of the chloroplast/plastid localized GAPDH isoforms (GAPCp1/At1g79530 and GAPCp2/At1g16300). gapcp double mutants display a drastic phenotype of arrested root development, dwarfism and sterility. GAPCps are important for the synthesis of serine in roots. |
| AT1G16300 | Encodes one of the chloroplast/plastid localized GAPDH isoforms (GAPCp1/At1g79530 and GAPCp2/At1g16300). gapcp double mutants display a drastic phenotype of arrested root development, dwarfism and sterility. GAPCps are important for the synthesis of serine in roots. |
| AT4G17550 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). |
| AT3G11430 | sn-glycerol-3-phosphate 2-O-acyltransferas, involved in the biosynthesis of suberin polyester. |
| AT2G38110 | bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly. |
| AT5G06090 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT5G41080 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
| AT1G71340 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
| AT4G38680 | Encodes a glycine-rich protein that binds nucleic acids and promotes DNA melting. Its transcript and protein levels are up-regulated in response to cold treatment with protein levels peaking earlier in shoots (~10-14 days) than in roots (~21 days). It is normally expressed in meristematic regions and developing tissues where cell division occurs. RNAi and antisense lines with lower levels of CSP2/GRP2 transcripts flower earlier than wild type plants and have some defects in anther and seed development. |
| AT2G21060 | Glycine-rich protein (AtGRP2b). Also named as CSP4 (cold shock domain protein 4) containing a well conserved cold shock domain (CSD) and glycine-rich motifs interspersed by two retroviral-like CCHC zinc fingers. AtCSP4 is expressed in all tissues but accumulates in reproductive tissues and those undergoing cell divisions. Overexpression of AtCSP4 reduces silique length and induces embryo lethality. |
| AT2G16260 | pseudogene of glycine-rich RNA-binding protein |
| AT5G49720 | Encodes a membrane-bound endo-1,4-beta-D-glucanase, involved in cellulose biosynthesis. Loss-of-function mutants have severe cellulose-deficient phenotypes. During cell elongation, KOR1 is associated with Golgi apparatus and early endosome. Inhibition of cellulose biosynthesis promoted a redistribution of KOR1 in subcellular locations. These observations suggest that deposition of cellulose involves the intracellular cycling of KOR1. |
| AT4G24260 | Encodes a protein with similarity to endo-1,4-b-glucanases. KOR3 is induced by nemotodes and is expressed in syncitia induced by Heterodera schachtii.May be involved in the development and function of syncitia. |
| AT4G38990 | glycosyl hydrolase 9B16;(source:Araport11) |
| AT1G64390 | glycosyl hydrolase 9C2;(source:Araport11) |
| AT2G44300 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT2G48130 | Encodes a plasma membrane-localized glycosylphosphatidylinositol-anchored lipid transfer protein expressed in root endodermis and seed coats that is involved in very long chain fatty acid (and their derivatives) transport. |
| AT1G18280 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT5G62220 | Encodes a Golgi apparatus-localized galactosyltransferase involved in galactosyl-substitution of xyloglucan at position 2. |
| AT1G11840 | Encodes Ni+ dependent glyoxalase I homolog ATGLX1. |
| AT1G15380 | Glyoxalase which affects ABA?JA crosstalk. |
| AT1G80160 | Vicinal oxygen chelate (VOC) superfamily member. |
| AT5G44190 | Encodes GLK2, Golden2-like 2, one of a pair of partially redundant nuclear transcription factors that regulate chloroplast development in a cell-autonomous manner. GLK1, Golden2-like 1, is encoded by At2g20570. GLK1 and GLK2 regulate the expression of the photosynthetic apparatus. |
| AT1G15880 | Golgi SNARE 11 protein (GOS11) |
| AT1G32900 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G33240 | Encodes a plant transcriptional activator that contains two separate, but similar, trihelix DNA-binding domains, similar to GT-2. Gene is expressed in all aerial parts of the plant, with higher level of expression in siliques. At-GTL2 was thought to be a duplicated copy of this gene but is likely to be a cloning artefact, the result of a chimeric clone. Regulates ploidy-dependent cell growth in trichome. |
| AT5G28300 | Encodes a Ca(2+)-dependent CaM-binding protein. AtGT2L specifically targets the nucleus and possesses both transcriptional activation and DNA-binding abilities, implicating its function as a nuclear transcription factor. |
| AT5G62670 | H[+]-ATPase 11;(source:Araport11) |
| AT4G30190 | Belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal domain. Its plasma membrane localization is light-dependent. |
| AT5G57350 | member of Plasma membrane H+-ATPase family |
| AT2G24520 | plasma membrane H+-ATPase;(source:Araport11) |
| AT4G28490 | Member of Receptor kinase-like protein family. Controls the separation step of floral organ abscission. The mRNA is cell-to-cell mobile. |
| AT2G35230 | Contains a plant-specific VQ motif. Involved in endosperm growth and seed size determination. IKU1 is expressed in the early endosperm and its progenitor, the central cell.IKU1 interacts with MINI3 in the yeast two-hybrid system. |
| AT4G00150 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
| AT2G36450 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Ectopic overexpression of HRD increases the density of the root network and improves water and salt stress tolerance in Arabidopsis. Overexpression of HRD in rice causes an increase in plant biomass and drought resistance. |
| AT5G02500 | Encodes a member of heat shock protein 70 family. Hsc70-1 negatively regulates the expression of Hsp101 through HsfA1d, HsfA1e and HsfA2. During non-HS condition, Hsc70-1 attenuates the activity of HsfAs and finally affects the expression of HsfA2 and Hsp101 genes. hsc70-1 mutant showed thermotolerance phenotype due to higher expression of Hsp101 and other HS inducible genes. |
| AT4G36990 | Encodes a protein whose sequence is similar to heat shock factors that regulate the expression of heat shock proteins. Transcript level is increased in response to heat shock. However, overexpression of this gene did not result in the increase of decrease of heat shock proteins. |
| AT4G14830 | 17.6 kDa class II heat shock protein;(source:Araport11) |
| AT4G16660 | heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
| AT3G22830 | member of Heat Stress Transcription Factor (Hsf) family |
| AT1G46264 | Encodes SCHIZORIZA, a member of Heat Shock Transcription Factor (Hsf) family. Functions as a nuclear factor regulating asymmetry of stem cell divisions. |
| AT3G24520 | member of Heat Stress Transcription Factor (Hsf) family |
| AT3G02990 | member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. |
| AT5G03720 | Member of Heat Stress Transcription Factor (Hsf) family. Expression is regulated by DREB2A and in turn HSFA3 regulates the expression of hsps Hsp18.1-CI and Hsp26.5-MII35S. Involved in establishing thermotolerence. |
| AT2G41690 | member of Heat Stress Transcription Factor (Hsf) family |
| AT4G21320 | Encodes heat-stress-associated 32-kD protein. Up-regulated by heat shock. Thermotolerance in a knockout mutant was compromised following a long recovery period (> 24 h) after acclimation heat shock treatment. |
| AT5G17450 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G56210 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G63950 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT2G36950 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G02960 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G06130 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G16380 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G39700 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G19090 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G27690 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G30120 | encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc |
| AT5G67060 | Encodes a bHLH transcription factor that is involved in transmitting tract and stigma development and acts as a local modulator of auxin and cytokinin responses to control gynoecium development. HEC1 affects auxin transport by acting as a transcriptional regulator of PIN1 and PIN3. Inhibits thermomorphogenesis. |
| AT5G09750 | Encodes a bHLH transcription factor that is involved in transmitting tract and stigma development. |
| AT2G24150 | heptahelical transmembrane protein HHP3 |
| AT1G47840 | Encodes a putative hexokinase. |
| AT3G45060 | member of High affinity nitrate transporter family |
| AT5G62940 | HCA2 induces the formation of interfascicular cambium and regulates vascular tissue development in the aerial parts of the plant. Evidence from both gain of function and dominant negative alleles. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT5G23120 | encodes a stability and/or assembly factor of photosystem II The mRNA is cell-to-cell mobile. |
| AT3G15095 | Encodes HCF243 (high chlorophyll fluorescence), a chloroplast-localized protein involved in the D1 protein stability of the photosystem II complex1. |
| AT4G35250 | HCF244 is a member of the atypical short-chain dehydrogenase/reductase superfamily, a modified group, which has lost enzyme activity.HCF244 interacts with unknown partners in a 200-400 kD membrane associated complex. |
| AT3G17040 | It is a RNA tetratricopeptide repeat-containing protein required for normal processing of transcripts from the polycistronic chloroplast psbB-psbT-psbH-petB-petD operon coding for proteins of the photosystem II and cytochrome b6/f complexes. Localizes to the chloroplast membrane. Involved in regulating plastidial gene expression and biogenesis. It binds in the psbT?psbH intercistronic region and blocks the progression of 5′ → 3′ exoribonucleases, which defines the 5′ end of processed psbH transcripts and also stabilizes the downstream RNA segment. In addition, HCF107 binding remodels the structure of the psbH 5′ UTR in a way that can account for its ability to enhance psbH translation. |
| AT5G36170 | Required for normal processing of polycistronic plastidial transcripts |
| AT3G54050 | Encodes a chloroplastic fructose 1,6-bisphosphate phosphatase. also known as HCEF1 (High Cyclic Electron Flow 1). hcef1 mutants have constitutively elevated electron flow (CEFI) and plants with antisense suppression of this enzyme have higher levels of net leaf photosynthesis and increased sucrose biosynthesis. The mRNA is cell-to-cell mobile. |
| AT1G48620 | This gene is predicted to encodes a histone H1/H5 family member. A plant line expressing an RNAi construct targeted against HON5 shows a reduced level of agrobacterium-mediated root transformation. |
| AT1G20696 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. The mRNA is cell-to-cell mobile. |
| AT2G17560 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. |
| AT5G23420 | Encodes HMGB6, a protein belonging to the subgroup of HMGB (high mobility group B) proteins. Localized in the nucleus. Binds to supercoiled DNA in vitro. HMGB6 is phosphorylated by protein kinase CK2alpha within its acidic C-terminal domain. |
| AT5G59220 | Encodes a member of the PP2C family (Clade A protein phosphatases type 2C). Functions as a negative regulator of osmotic stress and ABA signaling. |
| AT1G07430 | Encodes a member of the group A protein phosphatase 2C (PP2C) family that is responsible for negatively regulating seed dormancy. |
| AT1G23200 | ProPME pectin methyl esterase involved in embryo development. |
| AT3G56490 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
| AT4G14910 | Encodes a protein that is predicted to act as a imidazoleglycerol-phosphate dehydratase involved in histidine biosynthesis |
| AT5G10720 | member of Histidine Kinase |
| AT3G27360 | Histone superfamily protein;(source:Araport11) |
| AT5G10980 | Histone superfamily protein;(source:Araport11) |
| AT5G09740 | Encodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2. |
| AT2G18050 | encodes a structurally divergent linker histone whose gene expression is induced by dehydration and ABA. The mRNA is cell-to-cell mobile. |
| AT3G20670 | Encodes HTA13, a histone H2A protein. |
| AT5G27670 | Encodes HTA7, a histone H2A protein. |
| AT1G55250 | Encodes one of two orthologous E3 ubiquitin ligases in Arabidopsis that are involved in monoubiquitination of histone H2B. |
| AT5G66700 | Encodes a homeodomain protein. Member of HD-ZIP 1 family, most closely related to HB5. AtHB53 is auxin-inducible and its induction is inhibited by cytokinin, especially in roots therefore may be involved in root development. |
| AT2G46680 | encodes a putative transcription factor that contains a homeodomain closely linked to a leucine zipper motif. Transcript is detected in all tissues examined. Is transcriptionally regulated in an ABA-dependent manner and may act in a signal transduction pathway which mediates a drought response. |
| AT5G06710 | Homeobox-leucine zipper protein. |
| AT4G40060 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT4G16780 | Encodes a homeodomain-leucine zipper protein that is rapidly and strongly induced by changes in the ratio of red to far-red light. It is also involved in cell expansion and cell proliferation and in the response to auxin. The mRNA is cell-to-cell mobile. |
| AT2G18550 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT4G24660 | homeobox protein 22;(source:Araport11) |
| AT2G18350 | homeobox protein 24;(source:Araport11) |
| AT5G65410 | Encodes ZFHD2, a member of the zinc finger homeodomain transcriptional factor family.Gain of function of ATHB25 (35S and UBQ10 proomoters) and double loss of function of ATHB25 and ATHB22 increases and decreases, respectively, seed longevity. This phenotype is maternal and related to seed coat alterations. Gain of function increases expression of GA3OX2 and GA4 and GA1 levels. Together with REM7 induces the expression of genes controlling shoot stem characteristics by ectopic expression in roots. |
| AT3G50890 | homeobox protein 28;(source:Araport11) |
| AT5G15210 | Encodes ZFHD3, a member of the zinc finger homeodomain transcriptional factor family. |
| AT4G36740 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT2G22430 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein that is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis. |
| AT5G46880 | homeobox-7;(source:Araport11) |
| AT2G01430 | ATHB17 is a member of the HD-Zip transcription factor family. It is expressed most strongly in roots at different stages of development and induced by ABA, paraquat, drought, and NaCl treatments. Loss of function mutants are more sensitive to salt and drought stress.The protein is nuclear localized and has been shown to bind to the promoter of SIG5 and other genes. |
| AT1G70920 | homeobox-leucine zipper protein 18;(source:Araport11) |
| AT2G44910 | Encodes a homeodomain protein whose expression displays a dependence on phyB for both red and far-red light response. Also involved in the shade avoidance syndrome. |
| AT3G03260 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT3G22740 | homocysteine S-methyltransferase (HMT3) |
| AT5G54080 | Encodes a homogentisate 1,2-dioxygenase that can convert homogentisate to malylacetoacetate and is likely to be involved in tyrosine catabolism. |
| AT3G44530 | Encodes a nuclear localized WD-repeat containing protein involved in negative regulation of knox gene expression via epigenetic mechanism of chromatin re-organization. It is a part of the HISTONE REGULATOR complex that deposits histones in a DNA synthesis-independent manner and affects both nucleosome occupancy and the maintenance of transcriptional silencing. Interacts physically and genetically with AS1. Expressed in meristem and leaf primordia. Homozygous mutants are embryo lethal. Phenotype of cosuppressed lines is variable but show effects on leaf development similar to as1/as2. |
| AT5G03160 | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast. |
| AT2G22450 | riboflavin biosynthesis protein;(source:Araport11) |
| AT2G23670 | homolog of Synechocystis YCF37;(source:Araport11) |
| AT4G30510 | yeast autophagy 18 B-like protein;(source:Araport11) |
| AT2G31270 | Encodes a cyclin-dependent protein kinase. Involved in nuclear DNA replication and plastid division. Located in nucleus and chloroplast. |
| AT3G54710 | Encodes a cyclin-dependent protein kinase. Involved in nuclear DNA replication and plastid division. |
| AT1G65040 | Encodes one of the Arabidopsis homologs of the yeast/human Hrd1 protein: AT3G16090 (Hrd1A), AT1G65040 (Hrd1B). Involved in ERAD (Endoplasmic reticulum-associated degradation). |
| AT4G13940 | Encodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing. The mRNA is cell-to-cell mobile. |
| AT4G37580 | involved in apical hook development. putative N-acetyltransferase |
| AT1G70690 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT4G31750 | Encodes HopW1-1-Interacting protein 2 (WIN2). Interacts with the P. syringae effector HopW1-1. WIN2 has protein phosphatase activity. Modulates plant defenses against bacteria. Three WIN proteins are identified so far (WIN1: AT1G80600; WIN2: AT4G31750; WIN3: AT5G13320). |
| AT1G49560 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G08230 | HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. |
| AT2G48160 | HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. |
| AT5G62490 | Part of the AtHVA22 family. Protein expression is ABA- and stress-inducible. |
| AT4G36720 | HVA22-like protein K;(source:Araport11) |
| AT2G45630 | Hydroxyphenylpyruvate reductase (HPPR) family member with low activity. |
| AT5G25265 | Hyp O-arabinosyltransferase-like protein;(source:Araport11) |
| AT2G25260 | Hyp O-arabinosyltransferase-like protein;(source:Araport11) |
| AT1G68010 | Encodes hydroxypyruvate reductase. |
| AT3G01290 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT1G67700 | multidrug resistance protein;(source:Araport11) |
| AT3G21760 | Encodes HYR1, a UDP glycosyltransferase (UGT). HYR1 glucosylates hypostatin, an inhibitor of cell expansion in vivo to form a bioactive glucoside. |
| AT5G66985 | hypothetical protein;(source:Araport11) |
| AT3G10020 | plant/protein;(source:Araport11) |
| AT4G24110 | NADP-specific glutamate dehydrogenase;(source:Araport11) |
| AT5G10040 | transmembrane protein;(source:Araport11) |
| AT5G27760 | Hypoxia-responsive family protein;(source:Araport11) |
| AT5G55250 | Encodes an enzyme which specifically converts IAA to its methyl ester form MelIAA. This gene belongs to the family of carboxyl methyltransferases whose members catalyze the transfer of the methyl group from S-adenosyl-L-methionine to carboxylic acid-containing substrates to form small molecule methyl esters. Expression of TCP genes is downregulated in mutant iamt1-D. SABATH methyltransferase. |
| AT1G44350 | encodes a protein similar to IAA amino acid conjugate hydrolase. |
| AT3G18485 | Encodes a novel protein with no predicted membrane-spanning domains that is polymorphic among Arabidopsis accessions. The protein may modulate a metal transporter. Mutants are resistant to IAA-Leu, IAA-Phe, and the divalent metals cobalt and manganese but remain sensitive to free IAA; they are defective in lateral root formation and primary root elongation. |
| AT1G17210 | IAP-like protein 1;(source:Araport11) |
| AT2G32320 | Interacts genetically with its homolog ICA1; alters growth and flowering time plasticity in relation to temperature. Mutants display effects on growth, flowering and plant development, and ploidy level depending on ambient temperature (effects specific at >27C). |
| AT2G43060 | ILI1 binding bHLH 1;(source:Araport11) |
| AT1G64790 | ILITHYIA (ILA) is a HEAT repeat protein involved in plant immunity. The gene is also involved in systemic acquired resistance induced by P. syringae expressing avrRps4. Loss-of-function mutants of ILA caused pleiotropic defects in the mutant plants. The mutant plants are smaller in size and the leaves are serrated and yellow to light green in color. Required for bacterium-triggered stomatal closure. |
| AT3G23900 | Physically interacts with, and promotes canonical splicing of, transcripts encoding defense signaling proteins, including the key negative regulator of pattern recognition receptor signaling complexes, CALCIUM-DEPENDENT PROTEIN KINASE 28 (CPK28). Upon immune activation by Plant Elicitor Peptides (Peps), IRR is dephosphorylated, disrupting interaction with CPK28 transcripts and resulting in accumulation of an alternative splice variant encoding a truncated CPK28 protein with impaired kinase activity and diminished function as a negative regulator. |
| AT3G07610 | IBM1 likely encodes a protein with histone H3mK9 demethylation activity. It may preferentially demethylate H3mK9 at low-copy loci to protect them from silencing by nearby heterochromatin by preventing the spread of cytosine methylation. BONSAI (At1g73177) is hypermethylated in ibm1 mutants. ibm1 mutants have morphological defects that become apparent at the F3 generation, including small narrow leaves, arrested flower development, and faulty pollen development. These phenotypes cannot result solely from the BONSAI hypermethylation. Aberrant phenotypes in ibm1 mutants in both DNA methylation and plant development can be suppressed by mutations in the KYP H3K9 methyltransferase or the CMT3 non CG-cytosine methylase. |
| AT5G66730 | C2H2-like zinc finger protein;(source:Araport11) |
| AT3G13810 | indeterminate(ID)-domain 11;(source:Araport11) |
| AT3G23050 | Transcription regulator acting as repressor of auxin-inducible gene expression. Plays role in the control of gravitropic growth and development in light-grown seedlings. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. Pseudomonas syringae type III effector AvrRpt2 stimulates AXR2 protein turnover. |
| AT1G51950 | indole-3-acetic acid inducible 18;(source:Araport11) |
| AT3G15540 | Primary auxin-responsive gene. Involved in the regulation stamen filaments development. |
| AT2G46990 | Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA20 lacks the conserved degron (domain II) found in many family members, and IAA20 fusion proteins are stable in Arabidopsis seedlings. IAA20 transcripts are induced by auxin treatment, and overexpression of IAA20 leads to defects in gravitropism, root development, root meristem maintenance, etiolation, and cotyledon vascular development. |
| AT3G62100 | Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA30 lacks the conserved degron (domain II) found in many family members. IAA30 transcripts are induced by auxin treatment and accumulate preferentially in the quiescent center cells of the root meristem. Overexpression of IAA30 leads to defects in gravitropism, root development, root meristem maintenance, and cotyledon vascular development. Target of LEC2 and AGL15. Promotes somatyic embryogenesis. |
| AT2G04550 | Encodes a protein phosphatase that interacts with MPK12, but not with other MAP kinases. It can dephosphorylate a dually phosphorylated MPK12 in vitro and can inactivate MPK12 in vivo. ibr5 mutants have reduced sensitivity to auxin and abscisic acid. IBR5 promotes auxin responses, including auxin-inducible transcription, differently than the TIR1 auxin receptor and without destabilizing Aux/IAA repressor proteins. It plays a role in male gametophyte development, auxin and TCP growth regulatory pathways. Regulates leaf serrations development via modulation of the expression of PIN1. |
| AT3G56370 | LRR-RLK with distinct polar localization within the plasma membrane in different cell types of the root. Mutants show defects in cell divisions within the root ground tissue. |
| AT5G64667 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
| AT5G09805 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
| AT5G16760 | Encodes a inositol 1,3,4-trisphosphate 5/6-kinase. Catalyzes the phosphorylation of phytic acid (InsP6) to the symmetric InsP7 isomer 5-InsP7. |
| AT2G01900 | Encodes an inositol polyphosphate phosphatidylinositol 5-phosphatase that is expressed in roots and is involved in mediating salt tolerance through endocytosis. |
| AT3G49380 | Member of IQ67 (CaM binding) domain containing family. |
| AT1G01110 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G23060 | Member of IQ67 (CaM binding) domain containing family. |
| AT1G19870 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
| AT3G22190 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G36890 | IRX14 was identified as MUCI64 in a reverse genetic screen for MUCILAGE-RELATED genes. IRX14/MUCI64 is a GT43 protein essential for xylan elongation in seed coat mucilage. The xylan backbone maintains the attachment of mucilage to the seed surface and the distribution of cellulose. It was identified based on its gene expression co-variance with the IRX3 gene involved in secondary cell wall synthesis. A biochemical assay using the irx14 mutant indicates that IRX14 might function in xylose chain elongation. |
| AT5G67230 | Encodes a member of the GT43 family glycosyltransferases involved in glucuronoxylan biosynthesis: AT2G37090 (IRX9) and AT1G27600 (IRX9-L or I9H, IRX9 homolog); AT4G36890 (IRX14) and AT5G67230 (IRX14-L or I14H, IRX14 homolog). They form two functionally non-redundant groups essential for the normal elongation of glucuronoxylan backbone. I9H functions redundantly with IRX9, I14H is redundant with IRX14. IRX9 or I9H do not complement IRX14, IRX14 or I14H do not complement IRX9. |
| AT3G50220 | Encode a DUF579 (domain of unknown function 579) containing protein essential for normal xylan synthesis and deposition in the secondary cell wall. |
| AT1G27600 | Encodes a member of the GT43 family glycosyltransferases involved in glucuronoxylan biosynthesis: AT2G37090 (IRX9) and AT1G27600 (IRX9-L or I9H, IRX9 homolog); AT4G36890 (IRX14) and AT5G67230 (IRX14-L or I14H, IRX14 homolog). They form two functionally non-redundant groups essential for the normal elongation of glucuronoxylan backbone. I9H functions redundantly with IRX9, I14H is redundant with IRX14. IRX9 or I9H do not complement IRX14, IRX14 or I14H do not complement IRX9. |
| AT5G67210 | Encode a DUF579 (domain of unknown function 579) containing protein essential for normal xylan synthesis and deposition in the secondary cell wall. |
| AT1G32480 | Predicted to encode a protein related isocitrate dehydrogenases, but it appears to be missing the sequences encoding the N-terminal portion of the protein. |
| AT1G68460 | Encodes a putative adenylate isopentenyltransferase. It catalyzes the formation of isopentenyladenosine 5'-monophosphate (iPMP) from AMP and dimethylallylpyrophosphate (DMAPP), but it has a lower Km for ADP and likely works using ADP or ATP in plants. It is involved in cytokinin biosynthesis. |
| AT3G63110 | Encodes cytokinin synthase involved in cytokinin biosynthesis. IPT3 subcellular localization is modulated by farnesylation- when farnesylated it is localized to the nucleus, otherwise to the chloroplast. |
| AT4G24650 | AB061402 Arabidopsis thaliana AtIPT4 mRNA for cytokinin synthase, complete cds |
| AT5G19040 | Encodes cytokinin synthase. |
| AT3G02410 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G75100 | Contains a J-domain at the C-terminus which is similar to the J-domain of auxilin, a clathrin-uncoating factor in cow, yeast and worm. Arabidopsis contains 6 other proteins similar to auxilin. Expressed in leaves and stems, but not in roots. Localized in the cytoplasm. Required for the chloroplast accumulation response, but not for the avoidance response. No molecular function known. Influences the composition of photosynthetic pigments, the efficiency of photosynthesis, and the CO2 uptake rate. Positive effect on water use efficiency (WUE) by reducing stomatal aperture and water vapor conductance; involved in the fine-tuning of H2O2 foliar levels, antioxidant enzymes activities and cell death after UV-C photooxidative stress. |
| AT2G46370 | Encodes a jasmonate-amido synthetase that is a member of the GH3 family of proteins. JAR1 catalyzes the formation of a biologically active jasmonyl-isoleucine (JA-Ile) conjugate. JA-Ile promotes the interaction between JAZ1 and COI1 in the jasmonate signaling pathway. JAR1 localizes to the cytoplasm and is also a phytochrome A signaling component. JAR1 is an auxin-induced gene. Loss of function mutants are defective in a variety of responses to jasmonic acid. JAR1 has additional enzymatic activities in vitro, (e.g. the ability to synthesize adenosine 5'-tetraphosphate and other JA conjugates), but there are no data to show whether JAR1 catalyzes many of these reactions in vivo. JAR1 is involved in pathogen defense, sensitivity to ozone, and wound responses. |
| AT3G11180 | One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT2G38240 | One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT1G19180 | JAZ1 is a nuclear-localized protein involved in jasmonate signaling. JAZ1 transcript levels rise in response to a jasmonate stimulus. JAZ1 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ1:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. The Jas domain appears to be important for JAZ1-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. The mRNA is cell-to-cell mobile. |
| AT1G72450 | JAZ6 transcript levels rise in response to a jasmonate stimulus and a GFP:JAZ6 fusion protein localizes to the nucleus. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ6:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. |
| AT5G05600 | Encodes a protein with similarity to flavonol synthases that is involved in the detoxifcation polycyclic aromatic hydrocarbons.One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT4G00990 | jJumonji-domain-containing H3K9 histone demethylase. Loss of function mutants are susceptible to bacterial infection and early flowering. |
| AT5G46910 | H3K27me3 demethylase involved in temperature and photoperiod dependent repressing of flowering. |
| AT1G30810 | JMJ18 encodes a novel JmjC domain- containing histone H3K4 demethylase. PHD finger-containing protein. |
| AT2G19600 | member of Putative potassium proton antiporter family |
| AT5G51710 | member of Putative potassium proton antiporter family |
| AT4G33530 | potassium transporter |
| AT5G09400 | Encodes a potassium uptake permease with a functional adenylate cyclase (AC) center. The first 100 aa of this protein can complement AC-deficient E. coli and display AC activity in vitro. KUP7 is localized to the plasma membrane where it functions in potassium uptake and translocation. |
| AT5G07480 | KAR-UP oxidoreductase 1;(source:Araport11) |
| AT5G13530 | Encodes KEEP ON GOING (KEG), a RING E3 ligase involved in abscisic acid signaling. KEG is essential for Arabidopsis growth and development. ABA promotes KEG degradation via the ubiquitin dependent 26S proteasome pathway. Associates with and ubiquitinates MKK4 and MKK5 to regulate plant immunity. |
| AT1G23390 | A kelch domain-containing F-box protein. Its N terminus contains a typical F-box motif but its C-terminal domain only consists of one predicted kelch motif. Predicted to be stu Interacts with chalcone synthase CHS to mediate CHS ubiquitination and degradation. |
| AT1G50650 | KRS is a member of the STIG1 family of peptides. Its expression in embryos appears to be dependent upon ZOU.Loss of function results in a reduction of α-JIM12 labelled 'sheath' around the developing embryo. |
| AT1G05360 | KMS2 encode a endoplasmic reticulum protein involved in the early secretory pathway. |
| AT4G39050 | Kinesin motor family protein;(source:Araport11) |
| AT3G27960 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
| AT3G44730 | kinesin-like protein 1;(source:Araport11) |
| AT1G80440 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB20, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. The mRNA is cell-to-cell mobile. |
| AT1G15670 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB1, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. |
| AT2G44130 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family. Component of SCF ubiquitin protein ligase, interacts with phenylalanine ammonia-lyase. AtKFB39 is a homolog of previously identified AtKFB50 (At3g59940) and specifically interacts with Arabidopsis PAL3 and PAL4 in vitro. In planta, together with AtKFB01, KFB20 and KFB50, it regulates PAL protein stability thus controlling phenylpropanoid biosynthesis . |
| AT3G59940 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB50, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. The mRNA is cell-to-cell mobile. |
| AT1G62990 | Encodes a homeodomain transcription factor of the Knotted family. May be involved in secondary cell wall biosynthesis. Mutants have moderately irregular xylem development. Expression of this gene is upregulated by SND1 and MYB46. |
| AT5G11060 | A member of Class II KN1-like homeodomain transcription factors (together with KNAT3 and KNAT5), with greatest homology to the maize knox1 homeobox protein. Expression regulated by light. Detected in all tissues examined, but most prominent in leaves and young siliques. Transient expression of GFP translational fusion protein suggests bipartite localization in nucleus and cytoplasm. KNAT4 promoter activity showed cell-type specific pattern along longitudinal root axis; GUS expression pattern started at the elongation zone, predominantly in the phloem and pericycle cells, extending to endodermis toward the base of the root. |
| AT2G46750 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
| AT2G46740 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
| AT2G46760 | D-arabinono-1,4-lactone oxidase family protein;(source:Araport11) |
| AT5G65600 | L-type lectin receptor kinase which modulates metabolites and abiotic stress responses. Phosphorylates AvrPtoB which in turn reduces its virulence. |
| AT5G03140 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT1G18140 | putative laccase, a member of laccase family of genes (with 17 members in Arabidopsis). |
| AT5G01040 | putative laccase, knockout mutant showed early flowering |
| AT2G41500 | Encodes LACHESIS (LIS), a protein with seven WD40 repeats. LIS is homologous to the yeast splicing factor PRP4 which is associated with the U4/U6 complex of the spliceosome. LIS is involved in a mechanism that prevents accessory cells from adopting gametic cell fate: lis mutant forms supernumerary egg cells. |
| AT3G19260 | LAG1 homolog. Loss of function mutant is sensitive to AAL-toxin. LOH2 is presumed to function in sphingolipid metabolism. It encodes a ceramide synthase essential for production of LCFA-ceramides (mainly C16). Uses palmitoyl-CoA and dihydroxy LCB substrates. |
| AT1G01060 | LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1 |
| AT2G03740 | Late embryogenesis abundant protein. Associates with and stabilizes membranes as part of cryoprotective response. |
| AT1G01470 | Encodes late-embryogenesis abundant protein whose mRNA levels are induced in response to wounding and light stress. Might be involved in protection against desiccation. |
| AT2G35300 | Encodes LEA4-2/LEA18, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. |
| AT2G42560 | Late embryogenesis protein. Based on in vitro studies, likely plays a role in stablizing membranes in response to freezing stress. |
| AT2G44060 | Late embryogenesis abundant protein, group 2;(source:Araport11) |
| AT1G32560 | Encodes LEA4-1, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. |
| AT2G40170 | Encodes a group 1 LEA gene that is activated by direct binding of ABI5 to its promoter and is involved in response to ABA. Is required for normal seed development. Involved in regulating the timing of desiccation tolerance and rate of water loss during seed maturation. |
| AT1G52690 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT3G15670 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT5G48890 | Encodes a C(2) H(2) -type zinc-finger transcriptional regulator and is expressed in the leaf vasculature and the vegetative shoot apical meristem and controls the transition to flowering. |
| AT2G14560 | Encodes LURP1, a member of the LURP cluster (late upregulated in response to Hyaloperonospora parasitica) which exhibits a pronounced upregulation after recognition of the pathogenic oomycte H. parasitica. LURP1 is required for full basal defense to H. parasitica and resistance to this pathogen mediated by the R-proteins RPP4 and RPP5. The mRNA is cell-to-cell mobile. |
| AT5G63090 | Involved in lateral organ development |
| AT2G42430 | LOB-domain protein gene LBD16. This gene contains one auxin-responsive element (AuxRE). Regluates lateral root formation. |
| AT5G12330 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Expressed in lateral root primordia and induced by auxin. SWP1 is involved in the repression of LRP1 via histone deacetylation. |
| AT1G55580 | Encodes a member of the GRAS family of putative transcriptional regulators. It is involved in the initiation of axillary meristems during both the vegetative and reproductive growth phases and functions upstream of REV and AXR1 in the regulation of shoot branching. |
| AT1G77220 | LAZ1H1 is a DUF300 that is localized to the tonoplast. Along with LAZ1 it appears to play a role in maintaining the structural integrity of vacuoles and regulating BR signaling by modulating downstream subcellular distribution of BAK1. |
| AT2G47780 | Encodes a small rubber particle protein homolog. Plays dual roles as positive factors for tissue growth and development and in drought stress responses. |
| AT1G25390 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G61850 | Encodes transcriptional regulator that promotes the transition to flowering.Involved in floral meristem development. LFY is involved in the regulation of AP3 expression, and appears to bring the F-box protein UFO to the AP3 promoter. Amino acids 46-120 define a protein domain that mediates self-interaction. |
| AT1G28300 | Transcription factor that contains a B3 domain, a DNA-binding motif unique to plants and characteristic of several transcription factors. Plays critical roles both early and late during embryo development. LEC2 RNA accumulates primarily during seed development. LEC2 is required for the maintenance of suspensor morphology, specification of cotyledon identity, progression through the maturation phase, and suppression of premature germination. It establishes a cellular environment sufficient to initiate embryo development - ectopic, postembryonic expression of LEC2 in transgenic plants induces the formation of somatic embryos and other organ-like structures and often confers embryonic characteristics to seedlings and to reproductive and vegetative organs of mature plants. |
| AT1G07650 | Leucine-rich repeat receptor-like kinase with extracellular malectin-like domain, which possesses cell death induction activity in plant leaves. |
| AT1G49490 | Pollen expressed protein required for pollen tube growth.Along with other members of the LRX family, itnteracts with RALF4 to control pollen tube growth and integrity. Loss of function results in premature pollen tube rupture and reduced fertility. |
| AT1G03070 | Bax inhibitor-1 family protein;(source:Araport11) |
| AT4G15470 | Bax inhibitor-1 family protein;(source:Araport11) |
| AT5G01530 | light harvesting complex photosystem II;(source:Araport11) |
| AT2G40100 | Lhcb4:3 protein (Lhcb4.3, light harvesting complex of photosystem II The mRNA is cell-to-cell mobile. |
| AT1G15820 | Lhcb6 protein (Lhcb6), light harvesting complex of photosystem II. |
| AT2G31160 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT1G07090 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT4G18610 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT5G28490 | Encodes a nuclear protein that mediates light regulation of seedling development in a phytochrome-dependent manner. |
| AT3G47470 | Encodes a chlorophyll a/b-binding protein that is more similar to the PSI Cab proteins than the PSII cab proteins. The predicted protein is about 20 amino acids shorter than most known Cab proteins. |
| AT2G34430 | Photosystem II type I chlorophyll a/b-binding protein The mRNA is cell-to-cell mobile. |
| AT1G43130 | like COV 2;(source:Araport11) |
| AT3G01510 | Encodes a putative phosphatase, LSF1, required for normal starch turnover in leaves. |
| AT3G50920 | Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene (LPPepsilon1) and LPPepsilon2, appear to be less important for diacylglycerol formation in the plastids than LPPgamma. |
| AT5G03080 | Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene, LPPgamma appears to be more important for diacylglycerol formation than LPPepsilon1 and LPPepsilon2 in the plastids. Heterozygous lppgamma mutants produce pollen that have defects in pollen tube germination and no homozygous mutants have been recovered. The mRNA is cell-to-cell mobile. |
| AT2G38540 | Non-specific lipid transfer protein. Binds calmodulin in a Ca2+-independent manner. Localized to the cell wall. Specifically expressed in L1 epidermal layer. Predicted to be a member of PR-14 pathogenesis-related protein family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. The mRNA is cell-to-cell mobile. |
| AT5G59320 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. The mRNA is cell-to-cell mobile. |
| AT2G24260 | Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair and sperm cell development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3). |
| AT4G30980 | Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair and sperm cell development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3). |
| AT1G07900 | LOB domain-containing protein 1;(source:Araport11) |
| AT2G45420 | LOB domain-containing protein 18;(source:Araport11) |
| AT4G00210 | LOB domain-containing protein 31;(source:Araport11) |
| AT5G67420 | Encodes a LOB-domain protein involved in nitrogen metabolism and affecting leaf morphogenesis. |
| AT1G31320 | LOB domain-containing protein 4;(source:Araport11) |
| AT1G67100 | LOB domain-containing protein 40;(source:Araport11) |
| AT3G02550 | LOB domain-containing protein 41;(source:Araport11) |
| AT1G68510 | LOB domain protein. |
| AT1G19740 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
| AT5G47040 | Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins. |
| AT5G06300 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT2G04350 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT5G50150 | LOTR1 protein has an unknown function. It contains both DUF4409 and DUF239 domains. Loss of function mutations show defects in formation of the Casparian band- which is correlated with mis localization of CASP1. |
| AT4G36910 | Encodes a single cystathionine beta-synthase domain-containing protein. Modulates development by regulating the thioredoxin system. |
| AT1G73060 | Low PSII Accumulation 3;(source:Araport11) |
| AT1G23010 | Encodes a protein with multicopper oxidase activity. Located in ER. Function together with LPR2 (AT1G71040) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
| AT1G71040 | Encodes LPR2. Function together with LPR1 (AT1G23010) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
| AT3G50970 | Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. LTI29 and LTI30 double overexpressors confer freeze tolerance. Located in membranes. mRNA upregulated by water deprivation and abscisic acid. The mRNA is cell-to-cell mobile. |
| AT1G49435 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G30074 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G28405 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G28355 | low-molecular-weight cysteine-rich 5;(source:Araport11) |
| AT2G24330 | Encodes one of two LUNAPARK proteins in Arabidopsis. Both LNPA and LNPB are predominantly distributed throughout the ER, but not preferentially localized at the three-way junctions. Mutation of both LNPA and LNPB together caused the cortical ER to develop poor ER cisternae and a less dense tubular network. E3 ligase involved in degradation of RHD3 to maintain a tubular ER network. |
| AT1G78970 | Lupeol synthase. Converts oxidosqualene to multiple triterpene alcohols and a triterpene diols. This conversion proceeds through the formation of a 17β-dammarenyl cation. |
| AT1G78960 | Encodes a multifunctional 2-3-oxidosqualene (OS)-triterpene cyclase that can cyclize OS into lupeol, alpha- and beta-amyrin. |
| AT3G14840 | Encodes LRR-RLK protein that is localized to the plasma membrane and is involved in regulation of plant innate immunity to microbes. LIK1 is phosphorylated by CERK1, a kinase involved in chitin perception. The mRNA is cell-to-cell mobile. |
| AT2G23770 | Encodes a putative LysM-containing receptor-like kinase LYK4. Shares overlapping function with LYK5 in mediating chitin-triggered immune responses. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain. |
| AT2G33580 | Encodes a putative LysM-containing receptor-like kinase. LYK5 is a major chitin receptor and forms a chitin-induced complex with related kinase CERK1. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain. |
| AT5G63190 | Encodes a member of the MRF (MA3 DOMAIN-CONTAINING TRANSLATION REGULATORY FACTOR) gene family under TOR control that is transcriptionally induced by dark and starvation. MRF1 can be phosphorylated in vitro by S6K1 and S6K2. |
| AT3G48390 | MA3 domain-containing protein;(source:Araport11) |
| AT5G65060 | MADS domain protein - flowering regulator that is closely related to FLC |
| AT5G09690 | Transmembrane magnesium transporter. One of nine family members. Loss of function mutants exhibit poor growth under magnesium stress conditions. Splice variant AT5G09690.1 (386 aa) is a functional transporter while AT5G09690.4 (371 aa) does not have transporter activity. |
| AT5G07020 | Encodes an integral thylakoid membrane protein that interacts with PSII core complexes and contributes to the maintenance of PSII homeostasis upon exposure to photoinhibitory light conditions by participating in the protection and stabilization of PSII under photoinhibitory stress. |
| AT5G45840 | Encodes a leucine-rich-repeat RLK that is localized to the plasma membrane of pollen tubes and functions with MIK1/2 as the male receptor of the pollen tube chemo-attractant LURE1.MDIS1 forms a complex with MIK1/2 and binds LURE1. |
| AT4G20900 | Encodes a tetratricopeptide repeat protein required for cell cycle exit after meiosis II.ms5 mutants are male sterile, pollen tetrads undergo an extra round of division after meiosis II without chromosome replication, resulting in chromosome abnormalities. Gene product has some similarity to SCP1, a rat synaptonemal complex protein. |
| AT4G27940 | manganese tracking factor for mitochondrial SOD2;(source:Araport11) |
| AT1G73670 | member of MAP Kinase The mRNA is cell-to-cell mobile. |
| AT2G42880 | member of MAP Kinase |
| AT4G11330 | MAP kinase |
| AT2G18170 | MAP kinase 7;(source:Araport11) |
| AT1G32320 | member of MAP Kinase Kinase |
| AT5G42600 | Encodes an oxidosqualene synthase that produces the monocyclic triterpene marneral. Crucial for growth and development. |
| AT2G18650 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G02570 | Encodes a protein with phosphomannose isomerase activity. |
| AT5G45800 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G10110 | Mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein;(source:Araport11) |
| AT3G19350 | Encodes a the C-terminal domain of poly(A) binding proteins. MPC is imprinted such that only the maternal allele is expressed in the endosperm. MPC is silenced by the action of MET1 and its expression is promoted by DEM. |
| AT1G70170 | Matrix metalloprotease. Expression induced by fungal and bacterial pathogens. Mutants are late flowering with early senescence. |
| AT4G34830 | Encodes MRL1, a conserved pentatricopeptide repeat protein, required for stabilization of rbcL mRNA. |
| AT3G14810 | mechanosensitive channel of small conductance-like 5;(source:Araport11) |
| AT5G03220 | Encodes together with its paralog MED7B a subunit of the middle module of the transcriptional co-regulator Mediator complex. Regulates genes required for normal development of etiolated seedlings. |
| AT1G26665 | Mediator complex, subunit Med10;(source:Araport11) |
| AT5G38990 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT5G39000 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT5G39030 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT5G26230 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT5G52900 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT2G31840 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G79340 | Encodes MCP2d, the predominant and constitutively expressed member of type II metacaspases (MCPs). MCP2d plays a positive regulatory role in biotic and abiotic stress-induced programmed cell death (PCD). Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. The mRNA is cell-to-cell mobile. |
| AT5G02380 | cysteine-rich protein with copper-binding activity |
| AT1G64660 | Encodes a functional methionine gamma-lyase, a cytosolic enzyme catalyzes the degradation of methionine into methanethiol, alpha-ketobutyrate and ammonia. The catabolism of excess methionine is important to methionine homeostasis. The mRNA is cell-to-cell mobile. |
| AT1G53670 | 1-Cys methionine sulfoxide reductase. |
| AT2G23590 | Encodes a protein shown to have carboxylesterase activity in vitro. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
| AT3G63030 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT5G59800 | Encodes a protein containing a methyl-CpG-binding domain that acts as an anti-silencing factor that prevent gene repression and DNA hypermethylation by tethering other anti-silencing factors to methylated DNA, which enables the function of DNA demethylases that in turn limit DNA methylation and prevent transcriptional gene silencing. |
| AT3G10745 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCCCAAAUGUAGACAAAGCA. Pri-mRNA coordinates for MIR158a (converted to TAIR10 based on PMID19304749): Chr3: 3366553-3366019 (reverse), length: 535 bp; exon coordinates: exon 1: 3366553 to 3366303, exon 2: 3366185 to 3366019; mature miRNA and miRNA* are located on exon 1. |
| AT1G55591 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCCCCAAAUGUAGACAAAGCA |
| AT1G73687 | Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUUGGAUUGAAGGGAGCUCUA. Functions redundantly with MIR159B. Plants that are doubly mutated for MIR159AB have curled leaves and reduced stature. Pri-mRNA coordinates for MIR159a (converted to TAIR10 based on PMID19304749): Chr1: 27713700-27712893 (reverse), length: 808 bp; exon coordinates: exon 1: 27713700 to 27712893, mature miRNA and miRNA* are located on exon 1. |
| AT5G27807 | Encodes a microRNA that targets several genes containing NAC domains including NAC1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCG. Early extra petal mutant (eep1). Pri-mRNA coordinates for MIR164c (converted to TAIR10 based on PMID19304749): Chr5: 9852483-9853314 (forward), length: 832 bp; exon coordinates: exon 1: 9852483-9853314; mature miRNA and miRNA* are located on exon 1. |
| AT1G01183 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUCCCC. Accumulation of the pri-miRNA165a transcript is increased by the activity of the miPEP165 peptide which is encoded within the pri-miRNA165a transcript. |
| AT5G45307 | Encodes a microRNA that targets AGO1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGCUUGGUGCAGGUCGGGAA. MIR168a is highly expressed and predominantly produces a 21-nt miR168 species. By contrast, MIR168b is expressed at low levels and produces an equal amount of 21- and 22-nt miR168 species. Only the 21-nt miR168 is preferentially stabilized by AGO1, and consequently, the accumulation of the 22-nt but not the 21-nt miR168 is reduced when DCL1 activity is impaired. mir168a mutants with strongly reduced levels of 21-nt miR168 are viable but exhibit developmental defects, particularly during environmentally challenging conditions. |
| AT5G04275 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AGAAUCUUGAUGAUGCUGCAU. Pri-mRNA coordinates for MIR172b (converted to TAIR10 based on PMID19304749): Chr5: 1188916-1187500 (reverse), length: 1417 bp; exon coordinates: exon 1: 1188916 to 1188742, exon 2: 1188623 to 1188583, exon 3: 1188383 to 1188133, exon 4: 1187852 to 1187500; mature miRNA and miRNA* are located on exon 3. |
| AT2G22668 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:ATGAGTTGGGTCTAACCCATAACT |
| AT1G52185 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:TAGAATGCTATTGTAATCCAG |
| AT2G47015 | Encodes a microRNA that targets both a Laccase and Plantacyanin-like family member. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AUGCACUGCCUCUUCCCUGGC |
| AT1G70645 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UACGCAUUGAGUUUCGUUGCU |
| AT2G26211 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUCUCAAGAAGGUGCAUGAAC |
| AT1G61224 | Encodes a microRNA that targets several Jacalin lectin family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCAUGGUCAGAUCCGUCAUCC |
| AT4G13493 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UAAGAUCCGGACUACAACAAAG |
| AT4G14504 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AAGAUAAGCGCCUUAGUUCUGA |
| AT4G21362 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGAACAUGGUUUAUUAGGAA |
| AT5G44610 | Encodes a protein with seven repeated VEEKK motifs. RNAi and overexpression experiments suggest that the gene is not involved in cell division but might be consequential for cell shape of epidermal and cortical cells. The protein encoded by this gene binds to cortical microtubules and inhibits tubulin polymerization. Associates to the plasma membrane and interacts with calmodulin and phosphatidylinositol phosphates, indicating an involvement in cellular signal transduction. Expression is enhanced by abiotic and hormonal factors. Induced during senescence.Interacts with Ca2+/calmodulin complex, phosphatidylinositol phosphates, and free Ca2+. |
| AT1G74660 | Encodes MINI ZINC FINGER 1 (MIF1) which has a zinc finger domain but lacks other protein motifs normally present in transcription factors. MIF1 physically interact with a group of zinc finger-homeodomain (ZHD) transcription factors, such as ZHD5 (AT1G75240), that regulate floral architecture and leaf development. Gel mobility shift assays revealed that MIF1 blocks the DNA binding activity of ZHD5 homodimers by competitively forming MIF1-ZHD5 heterodimers. Constitutive overexpression of MIF1 caused dramatic developmental defects, seedlings were non-responsive to gibberellin (GA) for cell elongation, hypersensitive to the GA synthesis inhibitor paclobutrazol (PAC) and abscisic acid (ABA), and hyposensitive to auxin, brassinosteroid and cytokinin, but normally responsive to ethylene. |
| AT2G20980 | Similar to MCM10, which in other organism was shown to be involved in the initiation of DNA replication. |
| AT2G16440 | Regulates DNA replication via interaction with BICE1 and MCM7. |
| AT2G44620 | Encodes a mitochondrial acyl carrier protein (ACP) that forms part of the bridge domain which connects the membrane and the peripheral arm of mitochondrial complex I and contributes to the mitochondrial respiratory chain. Its acylated form is predominantly present in the mitochondrial membrane while the non-acylated form is soluble. The mRNA is cell-to-cell mobile. The designations of mtACP-1 and mtACP-2 in Klusch et al. 2021 (DOI:10.1093/plcell/koab092) are flipped with respect to the nomenclature published by Meyer et al. 2007 (DOI:10.1007/s11103-007-9156-9). |
| AT5G09590 | heat shock protein 70 (Hsc70-5); nuclear |
| AT1G07030 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT5G64710 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT4G35490 | mitochondrial ribosomal protein L11;(source:Araport11) |
| AT1G07150 | Member of MEKK subfamily. Involved in wound induced signaling where it interacts with At5g40440, and activates At1g59580. |
| AT2G30040 | Member of MEKK subfamily. Induced by jasmonic acid and wounding in involved in insectivory response signaling. Iinteracts with At5g40440, and activates At1g59580. |
| AT5G55090 | member of MEKK subfamily |
| AT4G26890 | Member of MEKK subfamily. Involved in wound response signaling. Interacts with At5g40440, and activates At1g59580. |
| AT2G32510 | Member of MEKK subfamily involved in wound and JA induced signaling.Interacts with At5g40440, and activates At1g59580. |
| AT1G05100 | member of MEKK subfamily. Negatively regulated by RGLG1 and RGLG2; involved in drought stress tolerance. |
| AT5G66850 | Encodes a member of the MEKK subfamily that functions redundantly with MAPKKK3 to activate MPK3/6 downstream of multiple pattern recognition receptors and confer resistance to both bacterial and fungal pathogens. |
| AT3G55270 | Encodes MAP kinase phosphatase 1 (MKP1). Loss of MKP1 results in hypersensitivity to acute UV-B stress, but without impairing UV-B acclimation. |
| AT5G49880 | Encodes a spindle assembly checkpoint protein MAD1. The mRNA is cell-to-cell mobile. |
| AT1G01453 | HeLo domain-containing mixed lineage kinase domain-like protein (MLKL). A pseudokinase, mediates necroptotic cell death in animals. |
| AT2G41660 | Essential for hydrotropism in roots. Mutant roots are defective in hydrotropism, and have slightly reduced phototropism and modified wavy growth response. Has normal gravitropism and root elongation. |
| AT2G01530 | MLP-like protein 329;(source:Araport11) |
| AT3G52880 | Encodes a peroxisomal monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2 |
| AT4G15760 | Encodes a protein with similarity to monooxygenases that are known to degrade salicylic acid (SA). |
| AT1G19850 | Encodes a transcription factor (IAA24) mediating embryo axis formation and vascular development. Similar to AUXIN RESPONSIVE FACTOR 1 (ARF1) shown to bind to auxin responsive elements (AREs), and to the maize transcriptional activator VIVIPAROUS 1( VP1). In situ hybridization shows expression in provascular tissue of embryos, the emerging shoot primordia, then is restricted to provascular tissue, and in the root central vascular cylinder. |
| AT2G42620 | The mutations at MAX2 cause increased hypocotyl and petiole elongation in light-grown seedlings. Positional cloning identifies MAX2 as a member of the F-box leucine-rich repeat family of proteins. MAX2 is identical to ORE9, a proposed regulator of leaf senescence. Involved in positive regulation of light responses. The mRNA is cell-to-cell mobile. |
| AT4G18640 | Required for root hair elongation during tip growth. The mRNA is cell-to-cell mobile. |
| AT2G03720 | Involved in root hair development |
| AT5G10490 | A member of MscS-like gene family, structurally very similar to MSL3, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL2-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. |
| AT2G22900 | Encodes MUCI10, a galactomannan-1,6-galactosyltransferase. MUCI10 likely decorates glucomannan, synthesized by CSLA2, with galactose residues in vivo. The degree of galactosylation is essential for the synthesis of the GGM backbone, the structure of cellulose, mucilage density, as well as the adherence of pectin. |
| AT2G16640 | multimeric translocon complex in the outer envelope membrane 132;(source:Araport11) |
| AT3G61300 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G20080 | Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT3G03680 | Member of a family of Multiple C2 Domain and Transmembrane Region Proteins. |
| AT5G17980 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT3G57880 | Required for maintenance of inflorescence and shoot SAMs and normal development of the derived vascular cambium, functions in the SAM to promote continuous organogenesis, affects SAM development through STM, where it affects intracellular localization of STM in SAM cells in the peripheral region and prevents STM localization toward the cell wall of SAM cells in the peripheral region. |
| AT4G00700 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT2G20370 | Encodes a xyloglucan galactosyltransferase located in the membrane of Golgi stacks that is involved in the biosynthesis of fucose. It is also involved in endomembrane organization. It is suggested that it is a dual-function protein that is responsible for actin organization and the synthesis of cell wall materials. The mRNA is cell-to-cell mobile. |
| AT4G36180 | LRR-RLK which regulates lateral root development. |
| AT5G16505 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
| AT4G17380 | Encodes the Arabidopsis homolog of MSH4, a meiosis-specific member of the MutS-homolog family of genes. It is expressed only in floral tissues and only during early meiotic prophase I, preceding the synapsis of homologous chromosomes. It is involved in the early steps of recombination. |
| AT1G69560 | Encodes LOF2 (LATERAL ORGAN FUSION2), a MYB-domain transcription factor expressed in organ boundaries. Functions in boundary specification, meristem initiation and maintenance, and organ patterning. Also see LOF1 (At1g26780). |
| AT3G02940 | Encodes a putative transcription factor (MYB107). |
| AT3G06490 | Encodes a MYB transcription factor involved in regulating anther dehiscence as well as regulating cell death, and cuticle-related Botrytis immunity. |
| AT3G55730 | putative transcription factor MYB109 (MYB109) mRNA, |
| AT3G62610 | Member of the R2R3 factor gene family. Together with MYB12 and MYB111 redundantly regulates flavonol biosynthesis. |
| AT1G48000 | Encodes a putative transcription factor (MYB112). |
| AT1G25340 | putative transcription factor (MYB116) |
| AT1G26780 | Encodes LOF1 (LATERAL ORGAN FUSION1), a MYB-domain transcription factor expressed in organ boundaries. Functions in boundary specification, meristem initiation and maintenance, and organ patterning. Also see LOF2 (At1g69560). |
| AT5G58850 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB119). |
| AT2G47460 | MYB12 belongs to subgroup 7 of the R2R3-MYB family. It strongly activates the promoters of chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), flavonol synthase (FLS) and - to a lesser extent - chalcone flavanone isomerase (CHI), but cannot activate the promoters of flavonoid-3'hydroxylase (F3'H) and dihydroflavonol 4-reductase (DF). The activation requires a functional MYB recognition element (MRE). Results from the myb12-1f allele indicate that an activation domain might be present in the C-terminus. Overexpression or knock-out plants do not show any obvious phenotype under greenhouse conditions. Young myb12-ko seedlings contain reduced amounts of flavonoids (quercetin and kaempferol), while seedlings as well as leaves of MYB12-OX plants displayed an increased flavonoid content. They did not show any significant difference in anthocyanin content. Expression of CHS and FLS shows a clear correlation to MYB12 expression levels. CHI and F3H show increased transcript levels in the MYB12-OX lines, but no differences in the knock-out. Even in the absence of functional MYB12, flavonol biosynthesis is not completely absent, suggesting functional redundancy. The redundant factors are MYB11 and MYB111 although MYB12 is primarily required for flavonol biosynthesis in roots. Mutations in MYB12 block both auxin and ethylene stimulation of flavonoid synthesis. |
| AT2G47190 | Encodes a MYB transcription factor that possesses an R2R3 MYB DNA binding domain and is known to regulate the expression of salt- and dehydration-responsive genes. Has been shown to bind calmodulin. |
| AT1G22640 | MYB-type transcription factor (MYB3) that represses phenylpropanoid biosynthesis gene expression |
| AT5G06100 | Encodes a member of the myb family of transcription factors (MYB33), contains Pfam profile: PF00249 myb DNA-binding domain. Double mutants with MYB65 are male sterile- anthers are small, pollen development is defective. Spatial expression appears to be under the control of miR159, contains a target site for this micro RNA. A highly conserved RNA secondary structure abuts the miR159 binding site which facilitates its regulation by miR159. When the target site is mutated, expression is detected in leaves, roots, anther filament, pistil. The expression of a translational fusion is specific to anther locules in contrast to constructs lacking the miR159 target site. Phenotype is conditional and can be restored by lower temperature or higher light intensity. |
| AT5G16600 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
| AT5G12870 | Encodes MYB46, member of the R2R3 factor gene family. Modulates Disease Susceptibility to Botrytis cinerea. |
| AT1G18710 | Member of the R2R3 factor gene family. Promotes seed longevity (viability of seed over time.) Expressed in the chalazal seed coat. Overexpresion enhances resistance of seed to deterioration (PMID:32519347). |
| AT3G11440 | Member of the R2R3-MYB gene family. Similar to GA-induced Barley myb gene. May be induced during germination in response to GA. Double mutants with MYB33 are male sterile, showing defects in pollen development and anther development. Contains a binding site for miRNA159 and may be spatially regulated by this micro RNA. A highly conserved RNA secondary structure abuts the miR159 binding site which facilitates its regulation by miR159. The male sterile phenotype of the MYB33/MYB65 double mutant is light and temperature sensitive. Fertility can be restored with increased light intensity and lower temperatures. |
| AT2G23290 | Member of the R2R3 factor gene family. |
| AT4G37260 | Member of the R2R3 factor gene family. The mRNA is cell-to-cell mobile. |
| AT4G05100 | Member of the R2R3 factor gene family. |
| AT3G50060 | Encodes a member of the R2R3 transcription factor gene family. Expressed in response to potassium deprivation and auxin. Involved in lateral root development. Interacts with ARF7 and regulates the expression of some auxin responsive genes. |
| AT4G22680 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
| AT5G26660 | myb domain protein 86;(source:Araport11) |
| AT3G47600 | Encodes a putative transcription factor (MYB94). |
| AT4G26930 | Encodes a putative transcription factor (MYB97). |
| AT5G62320 | Encodes a putative transcription factor (MYB99). |
| AT5G67300 | Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. The mRNA is cell-to-cell mobile. |
| AT4G21440 | Encodes a MYB transcription factor involved in wounding and osmotic stress response. Member of the R2R3 factor gene family. |
| AT1G71030 | Encodes a putative myb family transcription factor. In contrast to most other myb-like proteins its myb domain consists of a single repeat. A proline-rich region potentially involved in transactivation is found in the C-terminal part of the protein. Its transcript accumulates mainly in leaves. |
| AT2G46810 | MYC-type transcription factor which interacts with ICE1 and negatively regulates cold-responsive genes and cold tolerance. |
| AT1G14520 | Encodes MIOX1. Belongs to myo-inositol oxygenase gene family. |
| AT4G26260 | Encodes a myo-inositol oxygenase, which is the first enzyme in the inositol route to ascorbate (L‐ascorbic acid, AsA, vitamin C). Overexpression results in enhanced biomass and abiotic stress tolerance. |
| AT2G22240 | ** Referred to as MIPS1 in Mitsuhashi et al 2008. Myo-inositol-1-phosphate synthase isoform 2. Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT5G10170 | myo-inositol-1-phosphate synthase isoform 3.Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT3G57560 | encodes a N-acetylglutamate kinase, involved in arginine biosynthesis |
| AT4G35160 | Encodes a cytosolic N-acetylserotonin O-methyltransferase that can convert N-acetylserotonin to melatonin and serotonin to 5-methoxytryptamine in the process of melatonin synthesis. It does not have caffeic acid O- methyltransferase activity. |
| AT2G44170 | pseudogene of myristoyl-CoA:protein N-myristoyltransferase;(source:Araport11) |
| AT5G55470 | member of Sodium proton exchanger family |
| AT5G27150 | Encodes a vacuolar sodium/proton antiporter involved in salt tolerance, ion homeostasis, and leaf development. The mRNA is cell-to-cell mobile. |
| AT2G46770 | NAC transcription factor NST1. NST1 and NST2 are redundant in regulating secondary wall thickening in anther walls and siliques. An NST1 promoter fusion was detected in various tissues in which lignified secondary walls develop. Both MYC2 and MYC4 bind to the NST1 promoter and appear to regulate its expression in response to blue light. |
| AT1G12260 | Encodes a NAC-domain transcription factor that is expressed in developing xylem. Over expression of this protein causes ectopic secondary cell wall growth. Complements some of the cell wall defects seen in SND1/NST1 double mutants. |
| AT3G15510 | Note of caution: not to be confused with another protein (AtNAC6 locus AT5G39610) which on occasion has also been referred to as AtNAC2. |
| AT5G63790 | Encodes a member of the NAC family of transcription factors. ANAC102 appears to have a role in mediating response to low oxygen stress (hypoxia) in germinating seedlings. Its expression can be induced by beta-cyclocitral, an oxidized by-product of beta-carotene generated in the chloroplasts, mediates a protective retrograde response that lowers the levels of toxic peroxides and carbonyls, limiting damage to intracellular components. |
| AT1G52890 | encodes a NAC transcription factor whose expression is induced by drought, high salt, and abscisic acid. This gene binds to ERD1 promoter in vitro. |
| AT5G04410 | NAC family member, functions as a transcriptional activator, regulates flavonoid biosynthesis under high light. The mRNA is cell-to-cell mobile. |
| AT3G15500 | Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3. The mRNA is cell-to-cell mobile. |
| AT1G77450 | NAC domain transcriptional regulator that is induced by ROS in roots where it regulates the expression of downstream genes such as MYB30. |
| AT3G04070 | NAC domain containing protein 47;(source:Araport11) |
| AT3G10500 | Encodes a transcriptional activator that is associated with the plasma membrane in a dormant form and is proteolytically cleaved to create a form that can enter the nucleus. It is thought to promote ROS production by binding directly to the promoters of genes encoding ROS biosynthetic enzymes during drought-induced leaf senescence. The mRNA is cell-to-cell mobile. |
| AT3G17730 | NAC domain containing protein 57;(source:Araport11) |
| AT3G44290 | Represses sugar-induced ABI5 transcription. |
| AT3G49530 | Transcription factor that serves as a molecular link between cold signals and pathogen resistance responses. Undergoes proteolytic processing triggered by cold-induced changes in membrane fluidity.It relocates from the plasma membrane to the nucleus in response to ER stress. NAC062 is phosphorylated by SnRK2.8 at Thr-142. |
| AT4G01520 | NAC domain containing protein 67;(source:Araport11) |
| AT4G01550 | Encodes a plasma-membrane bound NAC transcription factor, whose controlled proteolytic activation allows it to enter the nucleus. |
| AT4G36160 | Encodes a NAC-domain transcription factor that is expressed in developing xylem. Over expression of this protein causes ectopic secondary cell wall growth. Complements some of the cell wall defects seen in SND1/NST1 double mutants. |
| AT5G07680 | NAC domain containing protein 80;(source:Araport11) |
| AT5G22290 | Encodes ANAC089, a membrane-tethered transcription factor that negatively regulates floral initiation. Also controls ER-stress-induced programmed cell death. |
| AT3G61910 | NAC transcription factor NST2. NST1 and NST2 are redundant in regulating secondary wall thickening in anther walls. NST2 promoter was particularly strong in anther tissue. |
| AT1G69490 | Encodes a member of the NAC transcription factor gene family. It is expressed in floral primordia and upregulated by AP3 and PI. Its expression is associated with leaf senescence. The mRNA is cell-to-cell mobile. |
| AT5G46830 | Calcium-binding transcription factor involved in salt stress signaling. |
| AT4G05020 | Miitochondrial alternative NADH dehydrogenase. |
| AT4G21490 | NAD(P)H dehydrogenase B3;(source:Araport11) |
| AT4G00570 | Encodes an NAD-dependent malic enzyme (NAD-ME) that does not act on oxaloacetate, indicating that it belongs to EC 1.1.1.39. It is a member of the beta family of NAD-MEs in plants. It appears to function as a homodimer or as a heterodimer with the alpha-type NAD-ME2 (At2g13560). NAD-ME2 transcript and protein levels are higher during the night than during the day. |
| AT1G74880 | Encodes subunit NDH-O of NAD(P)H:plastoquinone dehydrogenase complex (Ndh complex) present in the thylakoid membrane of chloroplasts. This subunit is thought to be required for Ndh complex assembly. |
| AT1G70760 | a subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. Located on the thylakoid membrane. Mutant has impaired NAD(P)H dehydrogenase activity. The mRNA is cell-to-cell mobile. |
| AT4G15545 | NAI1 interacting protein, involved in ER body formation. |
| AT5G67440 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
| AT2G23150 | Encodes a member of the Nramp2 metal transporter family; like its homolog Atnramp4, localized in vacuolar membrane. Seedlings of double mutant, atnramp3-1 atnramp4-1, were arrested at early germination. |
| AT1G55370 | NDH-dependent cyclic electron flow 5;(source:Araport11) |
| AT5G06320 | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus, spermine and Pseudomonas syringae pv. tomato DC3000. The gene product is localized to the plasma membrane. |
| AT2G16485 | Encodes NERD (Needed for RDR2-independent DNA methylation), a plant-specific GW repeat- and PHD finger-containing protein involved in siRNA-dependent DNA methylation. |
| AT3G22790 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It binds filamentous actin and is localized to the plasma membrane and plasmodesmata. |
| AT1G03470 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It colocalizes with filamentous actin and is localized to the nuclear membrane and the vacuolar membrane. |
| AT4G01940 | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU2 and 3 than to NFU4 and 5. Targeted to the chloroplast. |
| AT3G11580 | SOD7 encodes nuclear localized B3 DNA binding domain and a transcriptional repression motif. Belongs to the RAV gene family. Functions in regulation of seed size and binds to and represses KLU. Transcription repressor involved in regulation of inflorescence architecture. |
| AT2G46870 | Member of the RAV family of DNA binding proteins. Contains B3 domain. Recognizes 5'-CACCTG-'3 motif. |
| AT3G61970 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT1G01030 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G64170 | LNK1 is a member of a small family (4 proteins) in Arabidopsis that have some overlap in function. LNK1 functions in the integration of light signaling and circadian clock. It is regulated by the clock TOC1 complex.Functions as a transcriptional coactivator. |
| AT3G54500 | Member of a small family (4 proteins) in Arabidopsis that have some overlap in function. LNK2 along with LNK1 functions in the integration of light signaling and circadian clock. It is regulated by the clock TOC1 complex. Functions as a transcriptional coactivator. |
| AT5G06980 | Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK3 in having affects on biomass accumulation and phototrophism. |
| AT3G02680 | DNA repair and meiotic recombination protein, component of MRE11 complex with RAD50 and MRE11 |
| AT3G25882 | encodes a kinase that physically interacts with NPR1/NIM1 |
| AT2G33160 | Gene structure annotation for AT2G33160.1 is inaccurate in TAIR10, see PMID:23709666 and Comments field on the locus page for updated annotation. |
| AT3G59580 | Plant regulator RWP-RK family protein;(source:Araport11) |
| AT3G14440 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane. |
| AT3G24220 | A member of gene NCED-related gene family, encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
| AT1G78390 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
| AT1G77760 | Encodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. Similar to molybdopterin oxidoreductases at the N-terminus, and to FAD/NAD-binding cytochrome reductases at the C-terminus. Cofactors: FAD, heme iron (cytochrome B-557), and molybdenum-pterin. |
| AT3G16180 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
| AT1G08100 | Encodes a high-affinity nitrate transporter. |
| AT5G60780 | member of High affinity nitrate transporter family |
| AT1G08090 | High-affinity nitrate transporter. Up-regulated by nitrate. Functions as a repressor of lateral root initiation independently of nitrate uptake. |
| AT3G44310 | Mutants are resistant to indole-3-acetonitrile (IAN). NIT1 catalyzes the terminal activation step in indole-acetic acid biosynthesis. Predominantly expressed isoform of nitrilase isoenzyme family. Aggregation of NIT1 in cells directly abutting wound sites is one of the earliest events associated with wound and herbicide-induced cell death. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. It is also involved in the conversion of IAN to IAM (indole-3-acetamide) and other non-auxin-related metabolic processes. The mRNA is cell-to-cell mobile. |
| AT2G33070 | Encodes a nitrile-specifier protein NSP2. NSP2 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. |
| AT5G65720 | Encodes a cysteine desulfurase whose activity is dependent on AtSufE activation. It requires pyridoxal phosphate (PLP) for proper folding. Its catalytic efficiency is increase three-fold in the presence of AtFH (frataxin). |
| AT1G52880 | Transcription factor with a NAC domain. Homologous to the petunia gene NAM which is required for the development of the shoot. Expressed in the embryo. |
| AT5G13390 | Required for normal pollen development and lipid accumulation within the tapetum |
| AT3G57670 | Encodes a a C2H2/C2HC zinc finger transcription factor specifically expressed in the transmitting tract and involved in transmitting tract development and pollen tube growth.Acts redundantly with WIP4 and WIP5 to determine distal cell fate in the root. MP binds to regulatory elements within the NTT locus and likely regulates its expression. |
| AT3G53180 | Encodes a protein that is the product of a fusion gene with a C-terminal GSI like sequence and an N-terminal part sharing homology with nodulins. It self-assembles into oligomers and its expression is increased in response to flagellin treatment. The protein co-localizes with microtubules and binds gamma-tubulin. RNAi lines are affected in root morphogenesis. |
| AT1G07230 | non-specific phospholipase C1;(source:Araport11) |
| AT3G48610 | Non-specific phospholipase C6 involved in gametophyte development. |
| AT4G13250 | Encodes a chlorophyll b reductase involved in the degradation of chlorophyll b and LHCII (light harvesting complex II). |
| AT4G22920 | Similar to the tomato senescence-inducible chloroplast stay-green protein 1. It is upregulated during maximal senescence in the Arabidopsis life cycle, especially in senescent leaves. Acts antagonistically with SGR2 to balance chlorophyll catabolism in chloroplasts with the dismantling and remobilizing of other cellular components in senescing leaf cells. |
| AT1G64280 | This gene is a key regulator of the salicylic acid (SA)-mediated systemic acquired resistance (SAR) pathway. It is similar to the transcription factor inhibitor I kappa B, and contains ankyrin repeats. It confers resistance to the pathogens Pseudomonas syringae and Peronospora parasitica in a dosage-dependent fashion. Although transgenic Arabidopsis plants overexpressing NPR1 acquire enhanced sensitivity to SA and (benzothiadiazole) BTH, they display no obvious detrimental morphological changes and do not have elevated pathogenesis-related gene expression until activated by inducers or pathogens. |
| AT4G11910 | Acts antagonistically with SGR1 to balance chlorophyll catabolism in chloroplasts with the dismantling and remobilizing of other cellular components in senescing leaf cells. |
| AT5G45110 | Encodes NPR3, a paralog of NPR1. Involved in negative regulation of defense responses against bacterial and oomycete pathogens. npr3 mutants has elevated level of PR1 expression. Interacts with TGA2, TGA3, TGA5 and TGA6 in yeast two hybrid assays. NPR3 and NPR4 are receptors for the immune signal salicylic acid. The mRNA is cell-to-cell mobile. |
| AT1G59740 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G02020 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G27300 | NTL8 is a membrane-associated NAC transcription factor that binds both TRY and TCL1. Overexpression results in fewer trichomes. |
| AT2G20470 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT4G33080 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT1G30640 | Protein kinase family protein;(source:Araport11) |
| AT5G09890 | Protein kinase family protein;(source:Araport11) |
| AT5G12840 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. |
| AT1G72830 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. Expression is upregulated in the shoot of cax1/cax3 mutant. |
| AT5G23090 | nuclear factor Y, subunit B13;(source:Araport11) |
| AT2G47810 | nuclear factor Y, subunit B5;(source:Araport11) |
| AT2G37060 | nuclear factor Y, subunit B8;(source:Araport11) |
| AT1G56170 | Encodes a protein with similarity to a subunit of the CCAAT promoter motif binding complex of yeast.One of two members of this class (HAP5B) and expressed in vegetative and reproductive tissues. Involved in the regulation of response to nutrient levels. |
| AT1G08970 | Encodes a NUCLEAR FACTOR-Y C (NF-YC) homologue NF-YC9. NF-YC3., NF-YC4 and NF-YC9 redundantly modulate GA- and ABA-mediated seed germination. |
| AT1G79150 | binding protein;(source:Araport11) |
| AT1G80300 | Encodes an ATP/ADP transporter. The mRNA is cell-to-cell mobile. |
| AT1G63000 | nucleotide-rhamnose synthase/epimerase-reductase;(source:Araport11) |
| AT1G14860 | nudix hydrolase homolog 18;(source:Araport11) |
| AT1G30110 | Encodes a ppGpp pyrophosphohydrolase. |
| AT5G47240 | nudix hydrolase homolog 8;(source:Araport11) |
| AT5G04900 | Encodes a chlorophyll b reducatase involved in the degradation of chlorophyll b and LHCII (light harvesting complex II). |
| AT3G07780 | Encodes a nuclear PHD finger protein that is functionally redundant with OBE2 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems. The mRNA is cell-to-cell mobile. |
| AT3G50410 | Arabidopsis Dof protein containing a single 51-amino acid zinc finger DNA-binding domain, which may play an important roles in plant growth and development. |
| AT5G60850 | Encodes a zinc finger protein. |
| AT3G55370 | Encodes a nuclear localized Dof domain containing transcription factor expressed primarily in roots. Responsive to salicylic acid. Transgenic overexpressors have yellow leaves and short, defective roots. |
| AT5G53450 | OBP3-responsive protein 1;(source:Araport11) |
| AT5G58930 | hypothetical protein (DUF740);(source:Araport11) |
| AT4G25140 | Encodes oleosin1, a protein found in oil bodies, involved in seed lipid accumulation. Suppression of OLEO1 (and OLEO2) resulted in an aberrant phenotype of embryo cells that contain unusually large oilbodies that are not normally observed in seeds. Changes in the size of oilbodies caused disruption of storage organelles, altering accumulation of lipids and proteins and causing delay in germination. Functions in freezing tolerance of seeds. |
| AT4G16370 | Encodes a phloem-specific iron transporter that is essential for systemic iron signaling and redistribution of iron and cadmium. It loads iron into the phloem, facilitates iron recirculation from the xylem to the phloem, and regulates both shoot-to-root iron signaling and iron redistribution from mature to developing tissues. |
| AT5G02120 | Encodes a one helix protein homologous to cyanobacterial high-light inducible proteins. The protein is localized to the thylakoid membrane and its transcript is transiently induced by exposure to high light conditions. The mRNA is cell-to-cell mobile. |
| AT3G21140 | Pyridoxamine 5-phosphate oxidase family protein;(source:Araport11) |
| AT1G51560 | Pyridoxamine 5-phosphate oxidase family protein;(source:Araport11) |
| AT4G33950 | Encodes calcium-independent ABA-activated protein kinase, a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Mutations disrupted ABA induction of stomatal closure as well as ABA inhibition of light-induced stomatal opening. However, regulation of stomatal opening/closing by light or CO(2) is not affected in these mutants. May act in the interval between ABA perception and reactive oxygen species production in the ABA signalling network. |
| AT2G41225 | Encodes a protein of unknown function that is involved in regulation of cell expansion. Based on sequence similarity OSR2 is localized to the plasma membrane. It is expressed in organs that are undergoing cell expansion. Over-expression modifies plant sensitivity to ethylene, leading to improved drought tolerance. |
| AT1G47720 | Encodes an organellar single-strand DNA binding protein, located in mitochondria, controls the stoichiometry of alternative mitochondrial DNA forms generated by homologous recombination. |
| AT3G48810 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G29760 | Encodes a chloroplast RNA editing factor. |
| AT1G79360 | organic cation/carnitine transporter 2;(source:Araport11) |
| AT1G16370 | organic cation/carnitine transporter 6;(source:Araport11) |
| AT1G79410 | organic cation/carnitine transporter5;(source:Araport11) |
| AT4G08180 | OSBP(oxysterol binding protein)-related protein 1C;(source:Araport11) |
| AT4G25860 | OSBP(oxysterol binding protein)-related protein 4A;(source:Araport11) |
| AT5G57240 | OSBP(oxysterol binding protein)-related protein 4C;(source:Araport11) |
| AT2G27350 | Encodes an otubain-like histone deubiquitinase involved in chromatin modification and regulation of plant gene expression. |
| AT1G05420 | ovate family protein 12;(source:Araport11) |
| AT2G32100 | ovate family protein 16;(source:Araport11) |
| AT3G52540 | ovate family protein 18;(source:Araport11) |
| AT3G52525 | ovate family protein 6;(source:Araport11) |
| AT2G41900 | AtOXS2 specifcally entered the nuclear under salt stress. Te specifc nuclear localization of AtOXS2 could play a role in salt tolerance at the molecular level. Tese results implied that AtOXS2 might target some downstream cis-elements which are required for salt stress responses |
| AT5G37830 | Encodes a 5-oxoprolinase that acts in the glutathione degradation pathway and in 5-oxoproline metabolism. |
| AT3G07680 | Encodes an Golgi-localized p24 protein. Interacts with p24delta5 at ER export sites for ER exit and coupled transport to the Golgi apparatus. The mRNA is cell-to-cell mobile. |
| AT1G21900 | Encodes an ER-localized p24 protein. Interacts with p24beta2 at ER export sites for ER exit and coupled transport to the Golgi apparatus. Once in the Golgi, p24delta5 interacts very efficiently with the COPI machinery for retrograde transport back to the ER. |
| AT3G28857 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
| AT1G19300 | The PARVUS/GLZ1 gene encodes a putative family 8 glycosyl transferase that contributes to xylan biosynthesis. Its gene expression shows good co-variance with the IRX3 gene involved in secondary cell wall synthesis. PARVUS/GLZ1 is predicted to have galacturonosyltransferase activity and may be involved in the formation of the complex oligosaccharide sequence present at the reducing end of xylan. PARVUS is expressed in cells undergoing secondary wall thickening, and parvus mutants have thinner cell walls. |
| AT2G02710 | Encodes a putative blue light receptor protein. |
| AT2G39220 | Phospholipase pPLAIIIa involved in seed germination and resistance to Turnip Crinkle Virus. |
| AT3G63200 | PATATIN-like protein 9;(source:Araport11) |
| AT3G54950 | Encodes pPLAIIIbeta, a member of the Group 3 patatin-related phospholipases. pPLAIIIbeta hydrolyzes phospholipids and galactolipids and additionally has acyl-CoA thioesterase activity. Alterations of pPLAIIIβ result in changes in lipid levels and composition. |
| AT2G19990 | Encodes a PR-1-like protein homolog that is differentially expressed in resistant compared to susceptible cultivars by powdery mildew infection. The deduced amino acid sequence has 24 amino acids comprising the signal peptide and 140 amino acids of the mature peptide (15 kDa). Northern blot analysis showed accumulation of the corresponding mRNA 12 h after inoculation of resistant barley cultivars with Erysiphe graminis. Though the Genbank record for the cDNA associated to this gene model is called 'PR-1', the sequence actually corresponds to PR-1-like. Expression of this gene is not salicylic-acid responsive. |
| AT1G61590 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G47070 | Encodes a member of the RLCK VII-4 subfamily of receptor-like cytoplasmic kinases that has been shown to phosphorylate MAPKKK5 Ser-599 and MEKK1 Ser-603, both players in PRR-mediated resistance to bacterial and fungal pathogens. |
| AT1G72540 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G28690 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G28940 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G21750 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily; isoform contains non-consensus GA donor splice site at intron 9. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response. The mRNA is cell-to-cell mobile. |
| AT3G54960 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response. |
| AT1G04980 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. |
| AT4G14713 | PPD1 (and its paralog, PPD2) encode plant-specific putative DNA-binding proteins. PPD1 and PPD2 are not found in grasses. Overexpression of PPD reduces lamina size by promoting the early arrest of dispersed meristematic cells DMC proliferation during leaf and silique development. Deletion of the PPD locus increases leaf lamina size and results in dome-shaped rather than flat leaves. Siliques are also altered in shape because of extra lamina growth. The curvature of a deltappd leaf reflects the difference between excess growth of the lamina and a limitation to the extension capacity of its perimeter. |
| AT4G14720 | PPD2 (and its paralog, PPD1) encode plant-specific putative DNA-binding proteins. Deletion of the PPD locus increases leaf lamina size and results in dome-shaped rather than flat leaves. Siliques are also altered in shape because of extra lamina growth. |
| AT5G04310 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G45280 | Pectin acetylesterase involved in pectin remodelling. |
| AT4G19420 | Pectinacetylesterase family protein;(source:Araport11) |
| AT1G53830 | encodes a pectin methylesterase |
| AT3G14310 | encodes a pectin methylesterase, targeted by a cellulose binding protein (CBP) from the parasitic nematode Heterodera schachtii during parasitism. |
| AT3G49220 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G00190 | pectin methylesterase 38;(source:Araport11) |
| AT3G59010 | Encodes PME35, a pectin methylesterase. PME35-mediated demethylesterification of the primary cell wall regulates the mechanical strength of the supporting tissue. |
| AT2G47670 | PMEI6 pectin methylesterase inhibitor functions in establishing a patter of homogalacturonan methylesterification of seed coat cell wall proteins . |
| AT4G25260 | Pectin methylesterase inhibitor. Forms pH dependent complex with PME3. |
| AT5G53370 | pectin methylesterase PCR fragment F;(source:Araport11) |
| AT5G04960 | Encodes a protein that modulates the activity of pectin methylesterase within the cell wall. |
| AT4G27650 | Encodes Arabidopsis homolog of Drosophila pelota protein. Functions in RNA the non-stop decay (NSD) and no-go decay (NGD) quality control systems that act during translation. |
| AT2G44490 | Encodes a glycosyl hydrolase that localizes to peroxisomes and acts as a component of an inducible preinvasion resistance mechanism. Required for mlo resistance. The mRNA is cell-to-cell mobile. |
| AT2G45740 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. The mRNA is cell-to-cell mobile. |
| AT3G21865 | Interacts with PEX4 in a yeast two-hybrid. The PEX4 and PEX22 pair may be important during the remodeling of peroxisome matrix contents as glyoxysomes transition to leaf peroxisomes. |
| AT3G04460 | RING finger protein involved in peroxisome biogenesis. Also involved in peroxisomal import of nitric oxide synthase. Has been demonstrated to have E3 ubiquitin ligase activity. |
| AT5G03680 | Recessive mutations are defective in organ initiation and orientation in the second whorl. This gene encodes a trihelix transcription factor whose expression is limited to margins of floral and vegetative organs. Overexpression and double mutant analyses suggest that this gene is involved in limiting lateral growth of organs. |
| AT5G39050 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. |
| AT3G10340 | Encodes PAL4, a putative a phenylalanine ammonia-lyase. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
| AT5G02460 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT5G61480 | Encodes PXY, a receptor-like kinase essential for maintaining polarity during plant vascular-tissue development. |
| AT1G63090 | phloem protein 2-A11;(source:Araport11) |
| AT3G61060 | phloem protein 2-A13;(source:Araport11) |
| AT3G53000 | phloem protein 2-A15;(source:Araport11) |
| AT1G09155 | phloem protein 2-B15;(source:Araport11) |
| AT2G33770 | Encodes a ubiquitin-conjugating E2 enzyme. UBC24 mRNA accumulation is suppressed by miR399f, miR399b and miR399c. Involved in phosphate starvation response and mediates degradation of PHO1 and PHT1s at endomembrane. Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
| AT1G73010 | Encodes PPsPase1, a pyrophosphate-specific phosphatase catalyzing the specific cleavage of pyrophosphate (Km 38.8 uM) with an alkaline catalytic pH optimum. Expression is upregulated in the shoot of cax1/cax3 mutant. |
| AT2G32830 | Encodes Pht1;5, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT1G20860 | Encodes Pht1;8, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT1G76430 | Encodes Pht1;9, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT1G35140 | EXL1 is involved in the C-starvation response. Phenotypic changes of an exl1 loss of function mutant became evident only under corresponding experimental conditions. For example, the mutant showed diminished biomass production in a short-day/low light growth regime, impaired survival during extended night, and impaired survival of anoxia stress. |
| AT2G39290 | Encodes a phosphatidylglycerolphosphate synthase 2C which is dual-targeted into chloroplasts and mitochondria. Mutant plants have mutant chloroplasts but normal mitochondria. |
| AT3G58830 | Encodes a phosphatidylglycerophosphate (PGP) phosphatase that localizes to chloroplasts in above ground plant parts and mitochondria in root tips and root hairs and is involved in the synthesis of plastidial Phosphatidylglycerol (PG). This enzyme is responsible for the second step of PG synthesis. Mutants show reduced root growth. |
| AT1G03050 | Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane. |
| AT1G77740 | Encodes PIP5K2, a phosphatidylinositol-4-phosphate 5-kinase (PtdIns(4)P 5-kinase 2; or PIP5K2 that is involved in regulating lateral root formation and root gravity response. The mRNA is cell-to-cell mobile. |
| AT5G58700 | phosphatidylinositol-speciwc phospholipase C4;(source:Araport11) |
| AT4G37870 | Encodes a phosphoenolpyruvate carboxykinase that localizes to the cytosol. |
| AT5G65690 | Encodes a putative phosphoenolpyruvate carboxykinase (ATP-dependent). The mRNA is cell-to-cell mobile. |
| AT1G08650 | Encodes a phosphoenolpyruvate carboxylase kinase that is expressed at highest levels in leaves. Expression is induced by light. The mRNA is cell-to-cell mobile. |
| AT3G04530 | Encodes a second Arabidopsis phosphoenolpyruvate carboxylase kinase gene product with a different expression pattern from PPCK1. Expression of the gene is upregulated by exposure of the plant to light and is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
| AT1G17710 | Encodes a phosphoethanolamine/phosphocholine phosphatase. It is likely to be involved in the liberation of inorganic phosphate from intracellular sources. Expression is upregulated in the shoot of cax1/cax3 mutant. |
| AT5G47810 | phosphofructokinase 2;(source:Araport11) |
| AT2G46500 | Phosphoinositide kinase which undergo autophosphorylation and phosphorylate serine/threonine residues of protein substrates. Contains phosphoinositide 3/4-kinase and ubiquitin-like domains. Phosphorylates PUFD1 and RPN10 in vitro. |
| AT2G03890 | Phosphoinositide kinase which undergo autophosphorylation and phosphorylate serine/threonine residues of protein substrates. Contains phosphoinositide 3/4-kinase and ubiquitin-like domains. The mRNA is cell-to-cell mobile. |
| AT4G16820 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT1G06800 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT4G00240 | member of C2-PLD subfamily |
| AT4G11830 | Encodes one of three phospholipase D enzymes of the gamma class. |
| AT3G16785 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Does not appear to be involved in root hair patterning. Not induced upon Pi starvation. |
| AT3G05630 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. Regulates vesicle trafficking. Required for auxin transport and distribution and hence auxin responses. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Plays a major role in phosphatidic acid production during phosphate deprivation. Induced upon Pi starvation in both shoots and roots. Involved in hydrolyzing phosphatidylcholine and phosphatidylethanolamine to produce diacylglycerol for digalactosyldiacylglycerol synthesis and free Pi to sustain other Pi-requiring processes. Does not appear to be involved in root hair patterning. Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT1G32060 | phosphoribulokinase;(source:Araport11) |
| AT1G12370 | encodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele |
| AT3G13670 | MUT9-like protein kinase. Contributes to phosphorylation of photoexcited CRY2. Interaction with CRY2 occurs via the non catalytic PPKC domain.MLK4 phosphorylates the conserved H2A serine 95 residue. Synthetic mutants that cannot phosphorylate H2AS95 fail to complement the late flowering phenotype suggesting that MLK4 promotes long day flowering via phosphorylation.MLK4 is required for H2A295 phosphorylation of GI. |
| AT1G68650 | Member of the UPF0016 family of membrane proteins, belongs to the conserved group of Mn/Ca transporters. Might act to fine tune Mn allocation into the endoplasmic reticulum of specific cell types. |
| AT1G14150 | Encodes a subunit of the NAD(P)H dehydrogenase complex located in the chloroplast thylakoid lumen. |
| AT3G54890 | Encodes a component of the light harvesting complex associated with photosystem I. |
| AT1G61520 | PSI type III chlorophyll a/b-binding protein (Lhca3*1) The mRNA is cell-to-cell mobile. |
| AT1G45474 | Encodes a component of the light harvesting complex of photosystem I. |
| AT1G19150 | PSI type II chlorophyll a/b-binding protein (Lhca2*1) mRNA, The mRNA is cell-to-cell mobile. |
| AT2G46820 | Encodes the P subunit of Photosystem I. About 25% of the TMP14 pool appeared to be phosphorylated, and this ratio is not affected by light. Contains seven phosphorylation sites on threonine residue and chloroplast targeting signal. Located in the proximity of PSI-L, -H and -O subunits. Forms oligomers with other members of CURT1 family to modulate grana structure. |
| AT2G20260 | Encodes subunit E of photosystem I. The mRNA is cell-to-cell mobile. |
| AT3G16140 | Encodes subunit H of photosystem I reaction center subunit VI. |
| AT1G52230 | Phosphorylation of this protein is dependent on calcium. The mRNA is cell-to-cell mobile. |
| AT1G08380 | Encodes subunit O of photosystem I. |
| AT2G05070 | Encodes Lhcb2.2. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus. |
| AT3G27690 | Encodes Lhcb2.4. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus. The mRNA is cell-to-cell mobile. |
| AT4G28660 | Similar to PsbW subunit of photosystem II. |
| AT2G20890 | Chloroplast-localized Thylakoid formation1 gene product involved in vesicle-mediated formation of thylakoid membranes. Thf1 antisense lines contain abnormal chloroplasts early in leaf development (chloroplasts have loosely stacked thylakoid membranes). Expression was induced in the light and decreased under dark conditions. G-alpha interaction partner that functions downstream of the plasma membrane?delimited heterotrimeric G-protein (GPA1) in a D-glucose signaling pathway. Localized to both the outer plastid membrane and the stroma. Probably involved in the metabolic pathway that controls the assembly of the PS II complex. The mRNA is cell-to-cell mobile. |
| AT2G30570 | Encodes PsbW, a protein similar to photosystem II reaction center subunit W. Loss of PsbW destabilizes the supramolecular organization of PSII. |
| AT3G50820 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO2 is the minor isoform in the wild-type. Mutants defective in this gene have been shown to be affected in the dephosphorylation of the D1 protein of PSII. |
| AT1G06680 | Encodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution. Phosphorylation of this protein is dependent on calcium. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the stroma. The mRNA is cell-to-cell mobile. |
| AT2G30790 | Encodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution. |
| AT4G05180 | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II. |
| AT4G21280 | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II. |
| AT1G79040 | Encodes for the 10 kDa PsbR subunit of photosystem II (PSII). This subunit appears to be involved in the stable assembly of PSII, particularly that of the oxygen-evolving complex subunit PsbP. Mutants defective in this gene have reduced amounts of subunits PsbP and PsbQ in PSII. In turn, assembly of PsbR is dependent on the presence of PsbJ. |
| AT3G21055 | Encodes photosystem II 5 kD protein subunit PSII-T. This is a nuclear-encoded gene (PsbTn) which also has a plastid-encoded paralog (PsbTc). |
| AT2G06520 | Encodes a protein with sequence similarity to the spinach photosystem II subunit PsbX. |
| AT3G45780 | Blue-light photoreceptor. Contains a light activated serine-threonine kinase domain and LOV1 and LOV2 repeats. Mutants are defective in blue-light response. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT1 undergoes blue-light-dependent autophosphorylation. At least eight phosphorylation sites have been identified in PHOT1. Phosphorylation of serine851 in the activation loop of PHOT1 appears to be required for stomatal opening, chloroplast accumulation, leaf flattening, and phototropism, and phosphorylation of serine849 may also contribute to the regulation of these responses. Phosphorylation-dependent binding of 14-3-3 proteins to the Hinge1 region of PHOT1 appears to require serine350 and serine376. |
| AT1G62390 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G20360 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT2G42870 | Encodes PHYTOCHROME RAPIDLY REGULATED1 (PAR1), an atypical basic helix-loop-helix (bHLP) protein. Closely related to PAR2 (At3g58850). Up regulated after simulated shade perception. Acts in the nucleus to control plant development and as a negative regulator of shade avoidance response. Functions as transcriptional repressor of auxin-responsive genes SAUR15 (AT4G38850) and SAUR68 (AT1G29510). |
| AT2G26710 | Encodes a member of the cytochrome p450 family that serves as a control point between multiple photoreceptor systems and brassinosteroid signal transduction. Involved in brassinolide metabolism. Mediates response to a variety of light signals including hypocotyl elongation and cotyledon expansion. |
| AT3G52430 | Encodes a lipase-like gene that is important for salicylic acid signaling and function in resistance (R) gene-mediated and basal plant disease resistance. PAD4 can interact directly with EDS1, another disease resistance signaling protein. Expressed at elevated level in response to green peach aphid (GPA) feeding, and modulates the GPA feeding-induced leaf senescence through a mechanism that doesn't require camalexin synthesis and salicylic acid (SA) signaling. Required for the ssi2-dependent heightened resistance to GPA. The mRNA is cell-to-cell mobile. |
| AT3G59060 | Encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. Involved in shade avoidance. Functions as negative regulator of PhyB. Protein levels are modulated by phytochrome B. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
| AT2G43010 | Isolated as a semidominant mutation defective in red -light responses. Encodes a nuclear localized bHLH protein that interacts with active PhyB protein. Negatively regulates phyB mediated red light responses. Involved in shade avoidance response. Protein abundance is negatively regulated by PhyB.Involved in the regulation of response to nutrient levels. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
| AT5G61270 | Basic helix-loop-helix (bHLH) phytochrome interacting factor. Interacts specifically with the far-red light?absorbing Pfr form of phyB through a conserved domain called the active phyB binding motif. Upon light exposure, PIF7 rapidly migrates to intranuclear speckles, where it colocalizes with phyB. Role as negative regulator of phyB-mediated seedling deetiolation. |
| AT3G46640 | Encodes a myb family transcription factor with a single Myb DNA-binding domain (type SHAQKYF) that is unique to plants and is essential for circadian rhythms, specifically for transcriptional regulation within the circadian clock. LUX is required for normal rhythmic expression of multiple clock outputs in both constant light and darkness. It is coregulated with TOC1 and seems to be repressed by CCA1 and LHY by direct binding of these proteins to the evening element in the LUX promoter. The mRNA is cell-to-cell mobile. |
| AT4G16500 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT1G06570 | Mutation of the PDS1 locus disrupts the activity of p-hydroxyphenylpyruvate dioxygenase (HPPDase), the first committed step in the synthesis of both plastoquinone and tocopherols in plants. |
| AT1G73590 | Encodes an auxin efflux carrier involved in shoot and root development. It is involved in the maintenance of embryonic auxin gradients. Loss of function severely affects organ initiation, pin1 mutants are characterised by an inflorescence meristem that does not initiate any flowers, resulting in the formation of a naked inflorescence stem. PIN1 is involved in the determination of leaf shape by actively promoting development of leaf margin serrations. In roots, the protein mainly resides at the basal end of the vascular cells, but weak signals can be detected in the epidermis and the cortex. Expression levels and polarity of this auxin efflux carrier change during primordium development suggesting that cycles of auxin build-up and depletion accompany, and may direct, different stages of primordium development. PIN1 action on plant development does not strictly require function of PGP1 and PGP19 proteins. |
| AT2G01420 | Encodes a putative auxin efflux carrier that is localized in developing and mature root meristems. It is involved in the maintenance of embryonic auxin gradients. A role for AtPIN4 in generating a sink for auxin below the quiescent center of the root meristem that is essential for auxin distribution and patterning is proposed. In the root, PIN4 is detected around the quiescent center and cells surrounding it, and localizes basally in provascular cells. PIN4 expression is upregulated in brassinosteroid-insensitive mutant (PMID 16141452). |
| AT1G20925 | Member of family of proteins that are similar to PIN auxin transporter. |
| AT2G17500 | Auxin efflux carrier family protein;(source:Araport11) |
| AT2G34650 | Encodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID. |
| AT5G54490 | Encodes a PINOID (PID)-binding protein containing putative EF-hand calcium-binding motifs. The interaction is dependent on the presence of calcium. mRNA expression is up-regulated by auxin. Not a phosphorylation target of PID, likely acts upstream of PID to regulate the activity of this protein in response to changes in calcium levels. |
| AT2G26700 | Member of AGC VIIIa Kinase gene family. Encodes PID2, a homolog of PID. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT1G32100 | Encodes a pinoresinol reductase involved in lignan biosynthesis. Expressed strongly in roots and less strongly in stems. Shows specificity for pinoresinol and not lariciresinol. |
| AT3G59220 | encodes a cupin-domain containing protein that is similar to pirins which interact with a CCAAT box binding transcription factor. The protein interacts with GPA1 (G protein alpha-subunit) in vitro. Mutants in the gene are affected in germination and early seedling development. |
| AT2G43120 | Encodes a member of the functionally diverse cupin protein superfamily that is involved in susceptibility to the bacterial plant pathogen Ralstonia solanacearum. It stabilizes the papain-like cysteine protease XCP2. The mRNA is cell-to-cell mobile. |
| AT5G20240 | Floral homeotic gene encoding a MADS domain transcription factor. Required for the specification of petal and stamen identities. |
| AT3G02800 | Encodes an atypical dual-specificity phosphatase. |
| AT5G15120 | 2-aminoethanethiol dioxygenase, putative (DUF1637);(source:Araport11) |
| AT1G08990 | plant glycogenin-like starch initiation protein 5;(source:Araport11) |
| AT4G16600 | Nucleotide-diphospho-sugar transferases superfamily protein;(source:Araport11) |
| AT4G35470 | Encodes PIRL4, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
| AT4G26050 | Encodes PIRL8, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. The mRNA is cell-to-cell mobile. |
| AT3G11330 | Encodes PIRL9, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen. |
| AT5G58650 | Encodes PSY1, an18-aa tyrosine-sulfated glycopeptide that promotes cellular proliferation and expansion. PSY1 is widely expressed in various tissues, including shoot apical meristem, and is highly up-regulated by wounding. Perception of PSY1 depends on At1g72300, a leucine-rich repeat receptor kinase (LRR-RK). |
| AT1G10560 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT1G60190 | Encodes PUB19, a plant U-box armadillo repeat protein. Involved in salt inhibition of germination together with PUB18. The mRNA is cell-to-cell mobile. |
| AT3G11840 | Encodes a U-box-domain-containing E3 ubiquitin ligase that acts as a negative regulator of PAMP-triggered immunity. |
| AT1G49780 | PUB25 and PUB26 are closely related paralogs that encode functional E3 ligases. They function in immune response pathway by targeting BIK1 for degradation. |
| AT3G54790 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G18320 | One of three tandemly located, paralogous plant U-box proteins. Mutants show increased sensitivity to water stress.Expression in roots is enhanced by auxin and to a lesser extent ABA and cytokinin treatment. |
| AT5G18340 | One of three tandemly located, paralogous plant U-box proteins. Mutants show increased sensitivity to water stress. E3 ligase which acts as a regulator in the heat response signaling pathway. Over-expressing AtPUB48 could induce the expression of the heat-related genes (HSP101, HSP70, HSP25.3, HSFA2, and ZAT12). Enhances plant resistance to heat stress during seed germination and seedling growth. |
| AT3G07360 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT2G40120 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G00430 | a member of the plasma membrane intrinsic protein subfamily PIP1. involved redundantly with PIP1;1/2/3/5 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
| AT3G53420 | a member of the plasma membrane intrinsic protein subfamily PIP2. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed specifically in the vascular bundles and protein level increases slightly during leaf dev. When expressed in yeast cells can conduct hydrogen peroxide into those cells. |
| AT4G35100 | a member of the plasma membrane intrinsic protein PIP. functions as aquaporin. Salt-stress-inducible MIP |
| AT3G04370 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT2G01660 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT5G37660 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT5G53280 | An integral outer envelope membrane protein (as its homolog PDV2), component of the plastid division machinery. Similar to ARC5, PDV1 localized to a discontinuous ring at the division site in wild-type plants. PDV1 and PDV2 are required for localization of ARC5 at the chloroplast division site. Topological analysis showed that the large N-terminal region of PDV1 upstream of the transmembrane helix bearing a putative coiled-coil domain is exposed to the cytosol. Mutation of the conserved PDV1 C-terminal Gly residue did not block PDV1 insertion into the outer envelope membrane but did abolish its localization to the division site. The mRNA is cell-to-cell mobile. |
| AT3G62590 | PLIP3 is a glycerolipid A1 lipase with substrate specificity for phosphatidylglycerol. Expression is induced by ABA. |
| AT1G10522 | Encodes PRIN2 (plastid redox insensitive 2). PRIN2 mutants are impaired in PEP (plastid-encoded RNA polymerase) activity and high light-dependent plastid redox signalling to the nucleus. |
| AT3G02150 | a chloroplast trans-acting factor of the psbD light-responsive promoter.TCP gene involved in heterochronic control of leaf differentiation. |
| AT3G09210 | plastid transcriptionally active 13;(source:Araport11) |
| AT3G46780 | plastid transcriptionally active 16;(source:Araport11) |
| AT3G56910 | Encodes PSRP5 (PLASTID-SPECIFIC 50S RIBOSOMAL PROTEIN 5). Functions in plastid translation. |
| AT1G76100 | One of two Arabidopsis plastocyanin genes. Expressed at 1/10th level of PETE2. Does not respond to increased copper levels and is thought to be the isoform that participates in electron transport under copper-limiting conditions. Mutation of this gene does not have obvious effect on photosynthesis. |
| AT5G39570 | Protein of unknown function. Binds phosphatidic acid and acts downstream of PLDalpha. |
| AT5G02400 | Encodes a protein with similarity to the POL locus which is a novel protein phosphatase 2C. Ubiquitously expressed. No phenotype observed in homozygous null mutant background. |
| AT3G09400 | Similar to POLTERGEIST (POL) protein phosphatase 2C. No phenotype observed in plants homozygous for a null allele. Ubiquitously expressed. |
| AT5G17480 | pollen calcium-binding protein 1;(source:Araport11) |
| AT1G67960 | POD1 is involved in pollen tube guidence and early embryo patterning. |
| AT1G50610 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G28890 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT5G22470 | PARP3 is one of three canonical PARPs in Arabidopsis. |
| AT5G51120 | Encodes a homolog of the protein PABN1, a polyadenylation factor subunit. |
| AT2G43020 | Encodes a polyamine oxidase. |
| AT3G59050 | Encodes a polyamine oxidase. |
| AT4G29720 | polyamine oxidase 5;(source:Araport11) |
| AT1G70370 | Polygalacturonase involved in cell wall modification. |
| AT1G02790 | encodes a exopolygalacturonase. |
| AT1G48100 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G56710 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G18830 | This gene encodes a plasma membrane-localized polyol/cyclitol/monosaccharide-H+-symporter. The symporter is able to catalyze the energy-dependent membrane passage of a wide range of linear polyols (three to six carbon backbone), of cyclic polyols (myo-inositol), and of numerous monosaccharides, including pyranose ring-forming and furanose ring-forming hexoses and pentoses. This gene belongs to a monosaccharide transporter-like (MST-like) superfamily. |
| AT3G20160 | Terpenoid synthases superfamily protein;(source:Araport11) |
| AT3G01150 | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination. |
| AT4G05320 | One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. The mRNA is cell-to-cell mobile. |
| AT3G47640 | Encodes POPEYE (PYE), a bHLH transcription factor regulating response to iron deficiency in Arabidopsis roots. |
| AT1G04690 | potassium channel beta subunit 1;(source:Araport11) |
| AT4G18290 | Encodes KAT2, a member of the Shaker family potassium ion (K+) channel. Critical to stomatal opening induced by blue light. Critical to circadian rhythm of stomatal opening. Involved in plant development in response to high light intensity. Under high light intensity, the mutant plant produced less biomass compared to the wild type. The Shaker family K+ ion channels include five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT4G32650 | Encodes KAT3, a member of the Shaker family of voltage-gated potassium channel subunits. Does not form functional potassium channel on its own. Involved in down-regulating AKT1 and KAT1 channel activity by forming heteromers with AKT1 or KAT1. The Shaker family K+ ion channels include five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inwardly rectifying conductance): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT4G22200 | Encodes AKT2, a photosynthate- and light-dependent inward rectifying potassium channel with unique gating properties that are regulated by phosphorylation. Expressed in guard cell protoplasts and in the phloem and xylem of aerial portions of the plant. The channel can coassemble with another K+ channel, KAT1, in vitro. In guard cells, AKT2/3 is responsible for the Ca2+ sensitivity of the K+ uptake channel. In the phloem, it regulates the sucrose/H+ symporters via the phloem potential. AKT2 belongs to the Shaker family K+ channels which include the following groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT5G51700 | Encodes a resistance signalling protein with two zinc binding (CHORD) domains that are highly conserved across eukaryotic phyla. Mutant has reduced RPS5 and RPM1 mediated resistance. Potentially involved in transduction of R gene mediated disease resistance. Required for R protein accumulation. |
| AT3G19670 | Binds the carboxyl-terminal domain (CTD) of the largest subunit of RNA polymerase II and functions as a scaffold for RNA processing machineries. Ubiquitously expressed and localize to the nucleus. |
| AT3G11397 | prenylated RAB acceptor 1.A3;(source:Araport11) |
| AT2G27820 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT3G19170 | Zinc metalloprotease pitrilysin subfamily A. Signal peptide degrading enzyme targeted to mitochondria and chloroplasts. Expressed only in siliques and flowers |
| AT3G21295 | Pro-Trp-Pro-Trp repeat protein. |
| AT2G19770 | Encodes profilin 5, originally named profilin 4 (PRO4/PFN4). Low-molecular weight, actin monomer-binding protein that regulates the organization of actin cytoskeleton. Pollen-specific plant profilin present predominantly in mature pollen and growing pollen tubes. |
| AT5G14300 | prohibitin 5;(source:Araport11) |
| AT1G26150 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT4G32710 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT2G17720 | Encodes a prolyl 4-hydroxylase that modifies the extensin proteins in root hair cells. |
| AT5G04270 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT5G47420 | PAWH2 along with PAWH1 is part of endoplasmic reticulum ubiquitin ligase complex with Arabidopsis HRD1 via interaction with EBS7. As such it plays a role in promoting protein degradation via the ERAD pathway. |
| AT1G55480 | Encodes a member of a novel plant protein family containing a PDZ, a K-box, and a TPR motif. mRNA but not protein levels decrease after wounding. ZKT is phosphorylated at Thr and Ser residues after wounding. The mRNA is cell-to-cell mobile. |
| AT1G08910 | Encodes an SP-RING domain containing protein that functions in sumolaytion and is involved in positive regulation of sulfur metabolism and stress response. |
| AT2G33700 | Encodes a putative protein phosphatase 2C that positively regulates salt tolerance in abscisic acid-dependent manner. |
| AT5G50240 | L-isoaspartyl methyltransferase 2 (PIMT2)gene, alternatively spliced. |
| AT4G27440 | light-dependent NADPH:protochlorophyllide oxidoreductase B The mRNA is cell-to-cell mobile. |
| AT1G03630 | Encodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent. |
| AT4G04890 | Encodes a homeodomain protein that is expressed in the LI layer of the vegetative, floral and inflorescence meristems. Binds to the L1 box promoter element which is required in some proteins for L1 specific expression. |
| AT4G40100 | Encodes PRSL1 (PP1 regulatory subunit2-like protein1). Functions as a regulatory subunit of PP1 (protein phosphatase 1) and regulates blue light signaling in stomata. |
| AT5G66570 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO1 is the major isoform in the wild-type. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the membrane. The mRNA is cell-to-cell mobile. |
| AT4G28750 | mutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Subunit E of Photosystem I |
| AT2G01918 | Encode a protein homologous to each PQL protein. Mutational analysis indicates that PQL3 is also required for NDH activity. |
| AT5G60100 | Encodes pseudo-response regulator 3 (APRR3/PRR3). PRR3 transcript levels vary in a circadian pattern with peak expression at dusk under long and short day conditions. PRR3 affects the period of the circadian clock and seedlings with reduced levels of PRR3 have shorter periods, based on transcriptional assays of clock-regulated genes. PRR3 is expressed in the vasculature of cotyledons and leaves where it may help stabilize the TOC1 protein by preventing interactions between TOC1 and the F-box protein ZTL. |
| AT5G24470 | Encodes a pseudo-response regulator whose mutation affects various circadian-associated biological events such as flowering time in the long-day photoperiod conditions, red light sensitivity of seedlings during early photomorphogenesis, and the period of free-running rhythms of certain clock-controlled genes including CCA1 and APRR1/TOC1 in constant white light. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR7 and PRR9 to regulate hypocotyl growth under photoperiodic conditions. |
| AT2G46790 | Pseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR5 and PRR7 to regulate hypocotyl growth under photoperiodic conditions. |
| AT1G49350 | PsiMP Glycosylase (PUMY) that hydrolyzes PsiMP to uracil and ribose-5-phosphate. Acts together with PUMY in the peroxisome to prevent toxic pseudouridine monophosphate accumulation. Acts together with the a pseudouridine kinase PUKI in the peroxisome to prevent toxic pseudouridine monophosphate accumulation. |
| AT5G52420 | transmembrane protein;(source:Araport11) |
| AT3G50110 | Encodes a phosphatase with low in vitro tyrosine phosphatase activity that is NOT capable of dephosphorylating in vitro the 3'phosphate group of PI3P, PI(3,4)P2. |
| AT1G21620 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G09610 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT3G20250 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. APUM5 is involved in susceptibility to CMV and is not required for bacterial or fungal pathogen resistance although its expression is induced upon bacterial and fungal infection. It is involved in the osmotic, salt, and drought stress responses. |
| AT1G30840 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT2G46880 | purple acid phosphatase 14;(source:Araport11) |
| AT3G10150 | purple acid phosphatase 16;(source:Araport11) |
| AT2G03450 | purple acid phosphatase 9;(source:Araport11) |
| AT5G40340 | PWWP domain protein involved in regulation of FLC and flowering time. |
| AT5G02950 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
| AT2G38310 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. The mRNA is cell-to-cell mobile. |
| AT2G40330 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT4G01026 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of ABI1 and ABI2. |
| AT3G16050 | Encodes a protein with pyridoxal phosphate synthase activity whose transcripts were detected mostly in roots and accumulate during senescence. The protein was found in very low abundance, which prevented a specific localisation. |
| AT1G01050 | Encodes a soluble protein with inorganic pyrophosphatase activity that is highly specific for Mg-inorganic pyrophosphate. |
| AT5G54960 | pyruvate decarboxylase-2 |
| AT1G59900 | encodes the e1 alpha subunit of the pyruvate dehydrogenase complex (PDC) The mRNA is cell-to-cell mobile. |
| AT1G30120 | Encodes a putative plastid pyruvate dehydrogenase E1 beta subunit that is distinct from the mitochondrial pyruvate dehydrogenase E1 beta subunit. |
| AT3G30720 | QQS is an orphan gene that arose recently in the Arabidopsis thaliana lineage. It was first identified in a screen for genes with altered expression pattern in SS3 mutants which make an abundance of starch. Overexpression of QQS in Arabidopsis increases protein content and decreases total starch content. Thus it appears to function to modulate carbon/nitrogen allocation in Arabidopsis. Over expression of QQS in soybean, rice and maize also results in an increase in protein and decrease in starch levels suggesting that QQS affects similar pathways in a wide range of plants. QQS interacts with NF-YC4 in Arabidopsis and NF-YC4 homologs in rice, soybean and maize. In Arabidopsis QQS is localized the the cytoplasm and when complexed with NF-YC4 , it localizes to the nucleus. Putative OXS2-binding DEGs were constitutively activated by OXS2. |
| AT3G07970 | Required for pollen separation during normal development. In qrt mutants, the outer walls of the four meiotic products of the pollen mother cell are fused, and pollen grains are released in tetrads.May be required for cell type-specific pectin degradation. |
| AT1G61580 | R-protein L3 B;(source:Araport11) |
| AT5G47200 | AtRabD2b encodes a Rab GTPase, which plays important roles in pollen development, germination and tube elongation. The mRNA is cell-to-cell mobile. |
| AT4G17530 | AtRabD2c encodes a Rab GTPase, which plays important roles in pollen development, germination and tube elongation. |
| AT3G46830 | RAB GTPase homolog A2C;(source:Araport11) |
| AT5G65270 | RAB GTPase homolog A4A;(source:Araport11) |
| AT5G47960 | Encodes a small molecular weight g-protein. |
| AT4G17160 | RAB GTPase homolog B1A;(source:Araport11) |
| AT5G39620 | RAB GTPase homolog G1;(source:Araport11) |
| AT5G53570 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT3G02540 | Encodes a member of the RADIATION SENSITIVE23 (RAD23) family: AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome. |
| AT1G32230 | Encodes a protein belonging to the (ADP-ribosyl)transferase domain-containing subfamily of WWE protein-protein interaction domain protein family. Superoxide radicals are necessary and sufficient to propagate cell death or lesion formation in rcd1 mutants. Without stress treatment, RCD1 is localized in the nucleus. Under high salt or oxidative stress, RCD1 is found not only in the nucleus but also in the cytoplasm. The mRNA is cell-to-cell mobile. |
| AT5G27920 | Encodes a nuclear F-box protein that can directly interact with the C2H2‐type zinc finger transcription factor STOP1 and promote its ubiquitination and degradation. STOP1 is crucial for aluminum (Al) resistance. |
| AT2G33775 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT4G14010 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT3G16570 | Encodes RALF23, a member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. RALF23 is significantly downregulated by brassinolide treatment of seedlings. Overexpression of AtRALF23 impairs brassinolide-induced hypocotyls elongation, and mature overexpressing plants are shorter and bushier. RALF23 overexpression produces slower growing seedlings with roots that have reduced capacity to acidify the rhizosphere. |
| AT4G34220 | Encodes a receptor like kinase involved in ABA-mediated seedling development and drought tolerance.RDK1 is an atypical or pseudokinase and has no phosphorylation activity. Its expression is upregulated in response to ABA.interacts with ABI1 and other PP2C phosphatases. |
| AT1G07390 | receptor like protein 1;(source:Araport11) |
| AT1G74200 | receptor like protein 16;(source:Araport11) |
| AT2G25440 | receptor like protein 20;(source:Araport11) |
| AT2G32660 | receptor like protein 22;(source:Araport11) |
| AT3G23120 | receptor like protein 38;(source:Araport11) |
| AT5G49290 | receptor like protein 56;(source:Araport11) |
| AT5G67280 | receptor-like kinase;(source:Araport11) |
| AT1G48480 | Arabidopsis thaliana receptor-like protein kinase (RKL1) gene |
| AT2G48010 | receptor-like serine/threonine kinase (RKF3) The mRNA is cell-to-cell mobile. |
| AT4G00340 | Encodes a receptor-like protein kinase that is expressed in roots. |
| AT1G01320 | Encodes REDUCED CHLOROPLAST COVERAGE 1 (REC1) a protein with similarity to the FLOURY locus in maize. Located in the nucleus and cytosol. Contributes to establishing the size of the chloroplast compartment. |
| AT1G15290 | Encodes REDUCED CHLOROPLAST COVERAGE 3 (REC3). Contributes to establishing the size of the chloroplast compartment. |
| AT3G15820 | Functions as phosphatidylcholine:diacylglycerol cholinephosphotransferase, a major reaction for the transfer of 18:1 into phosphatidylcholine for desaturation and also for the reverse transfer of 18:2 and 18:3 into the triacylglycerols synthesis pathway |
| AT1G79950 | Encodes a homologue of human Regulator of Telomere Elongation Helicase1 (RTEL1). Plays a central role in the preservation of genome stability. |
| AT1G01360 | Encodes RCAR1 (regulatory components of ABA receptor). Interacts with and regulates the type 2C protein phosphatases (PP2Cs) ABI1 and ABI2. Functions as abscisic acid sensor. The mRNA is cell-to-cell mobile. |
| AT5G53160 | Encodes RCAR3, a regulatory component of ABA receptor. Interacts with protein phosphatase 2Cs ABI1 and ABI2. Stimulates ABA signaling. The mRNA is cell-to-cell mobile. |
| AT4G38630 | Regulatory particle non-ATPase subunit of the 26S proteasome with multiubiquitin-chain-binding capabilities |
| AT1G54130 | This gene appears to be at least partially redundant with RSH2 (At3g14050). Guanosine tetraphosphate synthesized by RSH2/RSH3 (and CRSH At3g17470) to an unknown extent can repress chloroplast gene expression, and also reduce chloroplast size. Involved in the maintenance of the (p)ppGp level to accustom plastidial gene expression to darkness. |
| AT1G13260 | Encodes an AP2/B3 domain transcription factor which is upregulated in response to low temperature. It contains a B3 DNA binding domain. It has circadian regulation and may function as a negative growth regulator. The mRNA is cell-to-cell mobile. |
| AT1G78080 | Encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family (RAP2.4). The protein contains one AP2 domain. Role in mediating light and ethylene signaling. The mRNA is cell-to-cell mobile. |
| AT1G43160 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family (RAP2.6). The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT5G13330 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT2G22010 | Encodes a protein predicted to act as a RING E3 ubiquitin ligase. It appears to regulate the stability of the KRP1/ICK1 cyclin dependent kinase inhibitor. Induced by beet severe curly virus (BSCTV) C4 protein. |
| AT3G61260 | Lipid raft regulatory protein, crucial for plasma membrane nanodomain assembly to control plasmodesmata aperture and functionality. Negatively regulates the cell-to-cell movement of TuMV via competition with PCaP1 for binding actin filaments. |
| AT2G45820 | Lipid raft regulatory protein, crucial for plasma membrane nanodomain assembly to control plasmodesmata aperture and functionality. |
| AT3G57540 | Remorin family protein;(source:Araport11) |
| AT2G41870 | Remorin family protein;(source:Araport11) |
| AT1G77470 | Encodes a protein with high homology to the Replication Factor C, Subunit 3 (RFC3) of yeast and other eukaryotes. rfc3 mutants are hypersensitive to salicylic acid and exhibit enhanced induction of PR genes and resistance against virulent oomycete Hyaloperonospora arabidopsidis Noco2. The enhanced pathogen resistance in the mutant is NPR1-independent. |
| AT2G01570 | Member of the VHIID/DELLA regulatory family. Contains homopolymeric serine and threonine residues, a putative nuclear localization signal, leucine heptad repeats, and an LXXLL motif. Putative transcriptional regulator repressing the gibberellin response and integration of phytohormone signalling. DELLAs repress cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. RGA1 binds to PIF3 and inhibits its DNA binding activity and thus affects the expression of PIF3 regulated genes. RGA may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. Involved in fruit and flower development. |
| AT5G52250 | Encodes a transducin protein whose gene expression is induced by UV-B. This induction is reduced in hy5 mutant and may be a target of HY5 during UV-B response. Functions as a repressor of UV-B signaling. |
| AT4G31620 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
| AT1G74810 | HCO3- transporter family;(source:Araport11) |
| AT4G22790 | Encodes a plasma membrane localized MATE type transporter that is involved in CO2 signaling during stomatal aperture regulation. RHC1 regulates HT1 which phosphorylates OST1, a kinase that regulates the SLAC1 anion channel and thus stomatal closing. |
| AT4G26090 | Encodes a plasma membrane protein with leucine-rich repeat, leucine zipper, and P loop domains that confers resistance to Pseudomonas syringae infection by interacting with the avirulence gene avrRpt2. RPS2 protein interacts directly with plasma membrane associated protein RIN4 and this interaction is disrupted by avrRpt2. The mRNA is cell-to-cell mobile. |
| AT5G07390 | respiratory burst oxidase homolog A;(source:Araport11) |
| AT2G27070 | member of Response Regulator: B- Type |
| AT5G58080 | member of Response Regulator: B- Type |
| AT1G10470 | Encodes a two-component response regulator. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
| AT5G66400 | Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. ABA- and drought-induced glycine-rice dehydrin protein. The ABA-induced expression of RAB18 was reduced following ACC application, indicating that ethylene inhibits the ABA signaling pathway. RAB18 is also expressed in response to the formation of the phospholipid diacylglycerol pyrophosphate. COR47 and RAB18 double overexpressor plants are cold tolerant. Expressed in guard cells. |
| AT3G22490 | Atrab28 plays a role in the ion cell balance during late embryogenesis and germination. |
| AT1G03120 | responsive to abscisic acid 28;(source:Araport11) |
| AT1G47128 | Cysteine proteinase precursor-like protein/ dehydration stress-responsive gene (RD21). Has been shown to have peptide ligase activity and protease activity in vitro. RD21 is involved in immunity to the necrotrophic fungal pathogen Botrytis cinerea.Activity detected in root, leaf, flower and cell culture. |
| AT2G33380 | Encodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to desiccation. mRNA expression under drought conditions is apparent particularly in leaves and flowers. Isoform of caleosin with a role as a peroxygenase involved in oxylipin metabolism during biotic and abiotic stress. Involved in the production of 2-hydroxy-octadecatrienoic acid. The peroxygenase has a narrow substrate specificity thus acting as a fatty acid hydroperoxide reductase in vivo. |
| AT5G25610 | responsive to dehydration 22 (RD22) mediated by ABA |
| AT2G37180 | a member of the plasma membrane intrinsic protein PIP2. functions as aquaporin and is involved in desiccation. |
| AT5G59820 | Encodes a zinc finger protein involved in high light and cold acclimation. Overexpression of this putative transcription factor increases the expression level of 9 cold-responsive genes and represses the expression level of 15 cold-responsive genes, including CBF genes. Also, lines overexpressing this gene exhibits a small but reproducible increase in freeze tolerance. Because of the repression of the CBF genes by the overexpression of this gene, the authors speculate that this gene may be involved in negative regulatory circuit of the CBF pathway. The mRNA is cell-to-cell mobile. |
| AT2G23640 | Encodes RTNLB13, a reticulon protein integral to the endoplasmic reticulum (ER) membrane that have the ability to shape the ER into tubules. |
| AT1G64090 | Reticulan like protein B3;(source:Araport11) |
| AT3G56140 | DUF399 family protein, putative (DUF399 and DUF3411);(source:Araport11) |
| AT2G46170 | Reticulon family protein;(source:Araport11) |
| AT4G02960 | a copia-type retrotransposon element containing LTRs and encoding a polyprotein. This retro element exists in two loci in Landsberg erecta but only once in Columbia |
| AT5G17300 | Myb-like transcription factor that regulates hypocotyl growth by regulating free auxin levels in a time-of-day specific manner. |
| AT5G37260 | Encodes a MYB family transcription factor Circadian 1 (CIR1). Involved in circadian regulation in Arabidopsis. |
| AT5G15650 | RGP2 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1(at3g02230)/rgp2 double mutants have a male gametophyte lethal phenotype. RGP2 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. RGP2 was originally identified as Reversibly Glycosylated Polypeptide-2. Constitutive expression in tobacco impairs plant development and virus spread. |
| AT1G19530 | Direct target of RGA, plays an essential role in GA-mediated tapetum and pollen development. |
| AT1G66350 | Negative regulator of GA responses, member of GRAS family of transcription factors. Also belongs to the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. RGL1 may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Rapidly degraded in response to GA. Involved in flower and fruit development. |
| AT5G37800 | Basic helix-loop-helix transcription factor similar to RHD6. Acts redundantly with RHD6 in root hair development. |
| AT3G17611 | RHOMBOID-like protein 14;(source:Araport11) |
| AT2G39460 | Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB. |
| AT2G37600 | cytosolic ribosomal protein gene, part of eL36 familyl |
| AT5G40950 | ribosomal protein large subunit 27;(source:Araport11) |
| AT1G67090 | Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Functions to yield sufficient Rubisco content for leaf photosynthetic capacity. |
| AT4G03510 | RMA1 encodes a novel 28 kDa protein with a RING finger motif and a C-terminal membrane-anchoring domain that is involved in the secretory pathway. Has E3 ubiquitin ligase activity. |
| AT4G28270 | Encodes a RING finger E3 ubiquitin ligase. Binds and ubiquitinates ABP1 in vivo and in vitro. |
| AT3G56580 | Encodes a functional E3 ubiquitin ligase involved in the dehydration stress response and regulation of proline biosynthesis. |
| AT4G11370 | Encodes a putative RING-H2 finger protein RHA1a. |
| AT4G11360 | Encodes a putative RING-H2 finger protein RHA1b. The mRNA is cell-to-cell mobile. |
| AT1G15100 | Encodes a putative RING-H2 finger protein RHA2a. |
| AT4G35480 | Encodes a putative RING-H2 finger protein RHA3b. |
| AT2G40830 | Encodes an E3 ubiquitin ligase for the GA-receptor GID1 that functions as a negative regulator of GA signaling in seedlings and seeds by inducing ubiquitin-dependent proteolysis of GID1s. Tyr321 phosphorylation of GARU by TAGK2 inactivates GARU. |
| AT3G11770 | RICE1 is a 23kDa protein with 3?- 5? exoribonuclease activity. It is expressed ubiquitously and localized to the cytoplasm. When RICE1 and its paralog RICE2 are knocked down, miRNA levels are decreased. RICE1 interacts with AGO1 and AGO10. It may affect miRNA accumulation by clearing RISC by degrading 5? products of AGO cleavage. |
| AT5G65900 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G55150 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G60200 | RBM25 is an alternative splicing factor involved in mediation of abiotic stress response and ABA response. Its expression is modulated by a variety of stressors and it in turn appears to affect the ratio of splice variants of stress responsive genes such as HAB1.2/HAB1.1. |
| AT3G22680 | Encodes RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex with DMS3 (AT3G49250) and DRD1 (AT2G16390). This complex is termed DDR. The DDR complex is required for polymerase V transcripts and RNA-directed DNA methylation. |
| AT1G07910 | Encodes a tRNA ligase that resembles the yeast Trl1 RNA ligase in structure and function but very different in sequence. Like Trl1, AtRNL consists of two domains, an N-terminal ligase component and a C-terminal 5'-kinase/2',3'-cyclic phosphodiesterase (CPD) component that can function in tRNA splicing in vivo when expressed as separate polypeptides. Requires a 2'-PO4 end for tRNA splicing in vivo. |
| AT1G64440 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Mutants in RHD1 have abnormally shaped root hairs with a bulbous region at the base. Allelic to REB1 encoding a UDP-D-glucose 4-epimerase involved in cell wall biosynthesis.Involved in growth and cell wall carbohydrate biosynthesis. |
| AT4G22080 | root hair specific 14;(source:Araport11) |
| AT4G16515 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
| AT2G23470 | DUF647 domain containing protein. Mutants are male sterile with defects in endothecium, tapetum and stamen maturation. |
| AT4G38430 | Member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily, also known as DUF315). Interacts with ROP1 but the whole protein lacks Rho guanyl-nucleotide exchange factor activity in vitro. The DUF315/PRONE domain is sufficient to confer RopGEF catalytic activity. ropgef1 mutants have defects in auxin transport that result in abnormal development of embryos and growth defects. |
| AT3G55660 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT2G46710 | ROP (Rho of plant GTPases) family member Involved in cell wall patterning. Encodes ROP inactivator, regulates the formation of ROP-activated domains; these in turn determined the pattern of cell wall pits. Positively regulates pit formation, but negatively regulates pit size, required for periodic formation of secondary cell wall pits. |
| AT4G24580 | Encodes a Rho GTPase-activating protein that interacts with ROP1 (a Rho GTPase) and regulates pollen tube development. This protein can be observed at the apical tip of growing pollen tubes and on endocytic vesicles traveling to this region of the pollen tube. |
| AT5G58710 | Encodes cyclophilin ROC7. The mRNA is cell-to-cell mobile. |
| AT3G25717 | ROTUNDIFOLIA like 16;(source:Araport11) |
| AT1G13245 | ROTUNDIFOLIA like 17;(source:Araport11) |
| AT2G39705 | ROTUNDIFOLIA like 8;(source:Araport11) |
| AT2G32415 | Polynucleotidyl transferase, ribonuclease H fold protein with HRDC domain-containing protein;(source:Araport11) |
| AT1G23860 | Encodes a 9G8-like serine-arginine rich (SR) protein that interacts in vivo with U1-70K, a U1 small nuclear ribonucleoprotein 70-kDa protein that is involved in nuclear precursor mRNA processing. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT5G38410 | Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Functions to yield sufficient Rubisco content for leaf photosynthetic capacity. |
| AT1G19900 | RUBY encodes a secreted galactose oxidase involved in cell wall modification. |
| AT2G35800 | Encodes a predicted calcium-dependent S-adenosyl methionine carrier. |
| AT5G15950 | Adenosylmethionine decarboxylase family protein;(source:Araport11) |
| AT4G32300 | S-domain-2 5;(source:Araport11) |
| AT3G23700 | Encodes a chloroplast-localized S1 domain-containing protein with RNA chaperone activity that affects the splicing and processing of chloroplast transcripts and plays a role in seedling growth in the presence of ABA. Binds the chloroplast psbA RNA and some other chloroplast RNAs. Required for the stability of the chloroplast ndhC RNA. Inhibits ribosome association with psbA RNA and ycf1 RNA. Not required for the splicing of chloroplast trnL, as had been reported previously. |
| AT3G51830 | putative transmembrane protein G5p (AtG5) mRNA, complete. autophagy-related (ATG) gene |
| AT5G22450 | SAGA complex subunit. Regulates gene expression by affecting histone H3 acetylation. |
| AT2G37050 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G75060 | Evening-expressed key component of Sin3-HDAC complex, which bind directly to the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and PSEUDO-RESPONSE REGULATOR 9 (PRR9) promoters and catalyze histone 3 (H3) deacetylation at the cognate regions to repress expression, allowing the declining phase of their expression at dusk. |
| AT1G19330 | Evening-expressed key component of Sin3-HDAC complex, which bind directly to the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and PSEUDO-RESPONSE REGULATOR 9 (PRR9) promoters and catalyze histone 3 (H3) deacetylation at the cognate regions to repress expression, allowing the declining phase of their expression at dusk. |
| AT1G73805 | Encodes SAR Deficient 1 (SARD1), a key regulator for ICS1 (Isochorismate Synthase 1) induction and salicylic acid (SA) synthesis. |
| AT1G15215 | Encodes SHH1, a homeodomain protein required for DNA methylation. It is an atypical RNA-directed DNA methylation component, and functions in transcriptional silencing through both DNA methylation-dependent and -independent pathways. |
| AT1G50420 | Encodes a scarecrow-like protein (SCL3) Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay). |
| AT5G52510 | SCARECROW-like 8;(source:Araport11) |
| AT1G12860 | Encodes ICE2 (Inducer of CBF Expression 2), a transcription factor of the bHLH family that participates in the response to deep freezing through the cold acclimation-dependent pathway. Overexpression of ICE2 results in increased tolerance to deep freezing stress after cold acclimation. |
| AT5G51110 | Encodes a protein involved in Rubisco assembly that also mediates Abscisic acid-dependent stress response. It is a ubiquitination target of the intracellular E3 ligase SDIR1. It selectively regulates the expression of the downstream basic region/leucine zipper motif transcription factor gene ABA-INSENSITIVE5, rather than ABA-RESPONSIVE ELEMENTS BINDING FACTOR3 (ABF3) or ABF4, to regulate ABA-mediated seed germination and the plant salt response. |
| AT4G36490 | SEC14-like 12;(source:Araport11) |
| AT3G04240 | Protein O-GlcNAc transferase. Together with SPY functions to competitively regulate RGA1 (At2g01570). |
| AT1G11890 | Member of SEC22 Gene Family; regulates cell morphogenesis via affecting cytoskeleton organization and stabilities. |
| AT1G56330 | Encodes a small GTP-binding protein implicated in ER to cis-Golgi transport of other proteins. A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. The protein is found associated to the ER and free in the cytosol. |
| AT1G11180 | Secretory carrier membrane protein (SCAMP) family protein;(source:Araport11) |
| AT3G55800 | Encodes the chloroplast enzyme sedoheptulose-1,7-bisphosphatase (SBPase), involved in the carbon reduction of the Calvin cycle. Increase in SBPase activity in transgenic lines accumulate up to 50% more sucrose and starch than wild-type. The mRNA is cell-to-cell mobile. |
| AT5G07190 | Gene is expressed preferentially in the embryo and encodes a unique protein of unknown function. |
| AT1G55740 | seed imbibition 1;(source:Araport11) |
| AT5G40390 | Encodes a protein which might be involved in the formation of verbascose. A T-DNA insertion mutant was shown to have a decreased amount of verbascose (as well as mannitol) whereas the levels of raffinose and stachyose remained unchanged. Enhances drought tolerance through raffinose synthesis or galactinol hydrolysis. |
| AT3G57520 | SIP2 encodes a raffinose-specific alpha-galactosidase that catalyzes the breakdown of raffinose into alpha-galatose and sucrose. This enzyme may function in unloading raffinose from the phloem as part of sink metabolism. Although it was originally predicted to act as a raffinose synthase (RS), that activity was not observed for recombinant SIP2. |
| AT3G10420 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G16460 | Membrane protein involved in lipid droplet biogenesis primarily in embryos. |
| AT4G14030 | selenium-binding protein 1;(source:Araport11) |
| AT3G10985 | A senescence-associated gene whose expression is induced in response to treatment with Nep1, a fungal protein that causes necrosis. The mRNA is cell-to-cell mobile. |
| AT5G13170 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
| AT3G14067 | Encodes a protein with similarity to serine protease, subtilisin, that is upregulated during senescence and expressed in the arial portions of the plant.Loss of function mutations have increased branch number but normal silique length and seed set and therefore have increased fertility. |
| AT3G02040 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. Has glycerophosphodiester phosphodiesterase activity. Functions in maintaining cellular phosphate homeostasis under phosphate starvation. The mRNA is cell-to-cell mobile. |
| AT1G24260 | Member of the MADs box transcription factor family. SEP3 is redundant with SEP1 and 2. Flowers of SEP1/2/3 triple mutants show a conversion of petals and stamens to sepals.SEP3 forms heterotetrameric complexes with other MADS box family members and binds to the CArG box motif. |
| AT4G12910 | serine carboxypeptidase-like 20;(source:Araport11) |
| AT3G52020 | serine carboxypeptidase-like 39;(source:Araport11) |
| AT3G10410 | SERINE CARBOXYPEPTIDASE-LIKE 49;(source:Araport11) |
| AT3G08720 | Encodes a ribosomal-protein S6 kinase. Gene expression is induced by cold and salt (NaCl). Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Phosphorylates specifically mammalian and plant S6 at 25 degrees C but not at 37 degrees C. Involved in translational up-regulation of ribosomal proteins. |
| AT1G69960 | type 2A serine/threonine protein phosphatase (PP2A) mRNA, positive regulators of SPCH and thus stomatal production. |
| AT4G35780 | ACT-like protein tyrosine kinase family protein;(source:Araport11) |
| AT4G38470 | Serine/threonine kinase that phosphorylate transit peptides of chloroplast and mitochondria targeted pre-proteins. |
| AT2G17700 | ACT-like protein tyrosine kinase family protein;(source:Araport11) |
| AT2G24360 | STYK serine threonine kinase that phosphorylates several oil body proteins including OLE1 and CLO4/CAL4. |
| AT1G11870 | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana. |
| AT2G05900 | Predicted to encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. |
| AT3G61740 | Encodes SET domain containing protein that acts redundantly with ATX4/5 to regulate histone H3-K4 methylation. Involved in bolting/flowering time together with ATX1 and ATX4. |
| AT4G25520 | SEUSS-like 1;(source:Araport11) |
| AT5G62090 | Encodes a protein that functions with LUH to promote Al binding to the root cell wall. |
| AT4G34660 | SH3 domain-containing protein;(source:Araport11) |
| AT5G14640 | shaggy-like kinase 13;(source:Araport11) |
| AT4G00720 | Encodes ASKtheta, a group III Arabidopsis GSK3/shaggy-like kinase. Functions in the brassinosteroid signalling pathway. |
| AT4G26690 | Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development. |
| AT4G24190 | encodes an ortholog of GRP94, an ER-resident HSP90-like protein and is involved in regulation of meristem size and organization. Single and double mutant analyses suggest that SHD may be required for the correct folding and/or complex formation of CLV proteins. Lines carrying recessive mutations in this locus exhibits expanded shoot meristems, disorganized root meristems, and defective pollen tube elongation. Transcript is detected in all tissues examined and is not induced by heat. Endoplasmin supports the protein secretory pathway and has a role in proliferating tissues. |
| AT2G18120 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
| AT1G75520 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis.SRS5 is a positive regulator of photomorphogenesis. |
| AT1G19790 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
| AT5G11190 | Encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT5G25390 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT1G31480 | encodes a novel protein that may be part of a gene family represented by bovine phosphatidic acid-preferring phospholipase A1 (PA-PLA1)containing a putative transmembrane domain. SGR2 is involved in the formation and function of the vacuole. |
| AT5G02750 | Encodes an E3 ligase, SHOOT GRAVITROPISM9. Modulates the interaction between statoliths and F-Actin in gravity sensing. |
| AT4G39100 | Encodes a plant-specific histone reader capable of recognizing both H3K27me3 and H3K4me3 via its bromo-adjacent homology (BAH) and plant homeodomain (PHD) domains, respectively. Detailed biochemical and structural studies suggest a binding mechanism that is mutually exclusive for either H3K4me3 or H3K27me3. SHL plays a role in the repression of flowering. |
| AT2G41312 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT4G37650 | Involved in radial organization of the root and shoot axial organs. Essential for normal shoot gravitropism. The protein moves in a highly specific manner from the cells of the stele in which it is synthesized outward. Movement requires sequences within the GRAS and VHIID domains. SHORT-ROOT forms a network in combination with JACKDAW, BLUEJAY AND SCARECROW to regulate tissue patterning through asymmetric cell division. The ground tissue lineage remains in shortroot mutant, while it is progressively lost in the triple mutant bluejay jackdaw scarecrow and double mutant jackdaw scarecrow. In addition, ground tissue basal identity remains in shortroot mutant while it is defective in the quadruple mutant bluejay jackdaw magpie nutcracker. |
| AT2G47140 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G51680 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G08800 | Encodes a nuclear and endosome localized protein with ARM and HEAT domains that interacts with SHR and other non-cell-autonomous proteins and may be involved in their intercellular movement. Hypomorphic mutant phenotypes suggest involvement of the protein in root patterning. |
| AT5G04470 | Encodes a novel nuclear 14-kD protein containing a cyclin binding motif and a motif found in ICK/KRP cell cycle inhibitor proteins. It is required for coordinating cell division and cell differentiation during the development of Arabidopsis trichomes, playing a key role in the mitosis-to-endoreduplication transition. It interacts with D-type cyclins in vivo. |
| AT5G02220 | cyclin-dependent kinase inhibitor;(source:Araport11) |
| AT1G07500 | SMR5 is a member of the SIAMESE-RELATED Cyclin-Dependent Kinase Inhibitor family. It is induced by ROS/oxidative stress. |
| AT5G13730 | Encodes sigma 4 factor, involved in regulating the activity of the plastid-encoded RNA polymerase PEP. Regulates the overall quantity of NDH complexes and thus influences NDH activity. |
| AT3G56710 | Sig1 binding protein; interacts with Sig1R4. As well as Sig1, SibI is imported into chloroplasts and its expression is light-dependent in mature chloroplasts. |
| AT1G73990 | Encodes a putative protease SppA (SppA). |
| AT2G47980 | Essential to the monopolar orientation of the kinetochores during meiosis. |
| AT5G57900 | F-box protein, interacts with SKP1/ASK1 subunit of SCF ubiquitin ligase in a glucose-dependent manner |
| AT2G03160 | SKP1-like 19;(source:Araport11) |
| AT2G45950 | SKP1-like 20;(source:Araport11) |
| AT3G61415 | SKP1-like 21;(source:Araport11) |
| AT3G60020 | SKP1-like 5;(source:Araport11) |
| AT1G06110 | SKP1/ASK-interacting protein 16;(source:Araport11) |
| AT5G67250 | Encodes an SKP1 interacting partner (SKIP2).Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,2, and 3. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes. |
| AT1G21190 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT1G16510 | Encodes a clade III SAUR gene with a distinctive expression pattern in root meristems. It is normally expressed in the quiescent center and cortex/endodermis initials and upon auxin stimulation, the expression is found in the endodermal layer. Overexpression studies suggest roles in cell expansion and auxin transport. |
| AT2G18010 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G51200 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G53590 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G61900 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G34810 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G75590 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G19840 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G60690 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G10990 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G20440 | small nuclear ribonucleoprotein associated protein B;(source:Araport11) |
| AT4G30350 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. Regulates root and root hair development downstream of KAI2-mediated signaling. |
| AT3G58030 | Encodes a RING domain E3 ligase. Has overlapping function with MUSE2 in the negative regulation of defence responses. SIKIC2 (and possibly SIKIC1 and 3) is ubiquination target. |
| AT3G01090 | encodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It can also interact with PRL1 DWD-containing protein. Based on in vitro degradation assays and cul4cs and prl1 mutants, there is evidence that AKIN10 is degraded in a proteasome-dependent manner, and that this depends on a CUL4-PRL1 E3 ligase |
| AT1G78290 | encodes a member of SNF1-related protein kinase (SnRK2) family whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress and dehydration. |
| AT3G48530 | SNF1-related protein kinase regulatory subunit gamma 1;(source:Araport11) |
| AT2G37570 | encodes a protein that can complement the salt-sensitive phenotype of a calcineurin (CaN)-deficient yeast mutant. This gene occurs in a single-copy and is 75% identical to tobacco SLT1 gene. |
| AT3G19490 | member of Na+/H+ antiporter-Putative family |
| AT1G78510 | Encodes one of the two paralogous solanesyl diphosphate synthases - SPS1 (At1g78510) and SPS2 (At1g17050) - that assemble the side-chain of plastoquinone-9 in plastids. |
| AT1G03790 | Encodes SOMNUS (SOM), a nucleus-localized CCCH-type zinc finger protein. SOM negatively regulates light-dependent seed germination downstream of PIL5 (AT2G20180). |
| AT4G30960 | Encodes CBL-interacting protein kinase 6 (CIPK6). Required for development and salt tolerance. The mRNA is cell-to-cell mobile. |
| AT2G30360 | Encodes a SOS2-like protein kinase that is a member of the CBL-interacting protein kinase family.Loss of function mutants show a decrease in sensitivity to high pH.Phosphorylates AHA2, a plasma membrane H+ ATPase.This phosphorylation appears to regulate the activity of the proton transporter. |
| AT5G10150 | SOK2 is a DUF966 domain containing protein of unknown function. Expressed in discrete domains of the PM. In root endodermis and embryo, expression is in inner basal edges and in basal |
| AT4G36930 | Encodes a transcription factor of the bHLH protein family. Mutants have abnormal, unfused carpels and reduced seed dormancy. |
| AT4G21540 | Encodes a sphingosine kinase, also has enzyme activity towards other plant long-chain sphingoid bases. Involved in guard cell ABA signalling and seed germination. |
| AT4G21534 | Diacylglycerol kinase family protein;(source:Araport11) |
| AT1G03060 | Encodes a WD/BEACH domain protein involved in cell morphogenesis and ribonucleoprotein particle formation. It interacts with the P-body core component DCP2, associates to mRNA processing bodies (P-bodies), and regulates their assembly upon salt stress. It accumulates at the root hair apex via post-Golgi compartments and positively regulates tip growth by maintaining tip-focused vesicle secretion and filamentous-actin integrity. |
| AT4G27330 | Encodes a putative transcription factor that is required for the initiation of both micro- and megagametogenesis and is expressed in the sporogenous tissue of the anther and the ovule. SPL is a chalaza identity gene that share overlapping functions in establishing the prospective chalaza of the ovule. It also plays a central role in patterning both the proximal-distal and the adaxial-abaxial axes in the ovule and generally interacts with YABBY proteins in vitro. Mutant is defective in the differentiation of primary sporogenous cells into microsporocytes, and does not properly form the anther wall. Regulator of anther cell differenctiation. Interacts with TPL and TCP proteins. |
| AT3G13170 | Encodes AtSPO11-1, one of the three Arabidopsis homologues of the archaeal DNA topoisomerase VIA subunit (topo VIA). Required for meiotic recombination. AtSPO11-1 and AtSPO11-2 have overlapping functions (i.e. both required for meiotic recombination) whereas AtSPO11-3 functions in DNA replication. AtSPO11-1 accumulates in foci in early G2. At 1 h post-S phase, no foci are observed, but by 3 h a majority (80%) of meiocytes at this time point contain >50 foci. However, by 5 h, AtSPO11-1 foci are no longer detectable. This suggests that the protein undergoes a rapid cycle of accumulation and disappearance in meiocytes over a period of between 1 and 5 h post-S phase. |
| AT5G24160 | squalene monooxygenase 6;(source:Araport11) |
| AT5G18830 | Encodes a member of the Squamosa Binding Protein family of transcriptional regulators. SPL7 is expressed highly in roots and appears to play a role in copper homeostasis. Mutants are hypersensitive to copper deficient conditions and display a retarded growth phenotype. SPL7 binds to the promoter of the copper responsive miRNAs miR398b and miR389c. |
| AT1G02065 | Encodes an SBP-box gene, a member of the SPL gene family. Mutants are affected in micro- and megasporogenesis, trichome formation on sepals, and stamen filament elongation. |
| AT2G36390 | Encodes a starch branching enzyme (EC.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout plant tissues. The mRNA is cell-to-cell mobile. |
| AT1G10760 | Encodes an α-glucan, water dikinase required for starch degradation. Involved in cold-induced freezing tolerance. Mutations that eliminate the GWD protein or affect the dikinase domain of the enzyme dramatically reduce both the amount of phosphate in the amylopectin and the rate of starch degradation. Mature leaves of these mutants accumulate amounts of starch up to seven times greater than those in wild-type leaves. NMR analysis of the mutants, suggests that the gene is specifically involved in the phosphorylation of the glucosyl residues of starch at the C6 position. |
| AT5G24300 | SSI is a plastidial enzyme and crucial for the synthesis of normal amylopectin in the leaves of Arabidopsis. The absence of SSI results in a deficiency in the number of shorter glucans which in turn affect the formation and connection of the amylopectin clusters in starch. |
| AT1G11720 | Encodes a starch synthase that in addition to its role in starch biosynthesis also has a negative regulatory function in the biosynthesis of transient starch. The protein apparently contains a starch-binding domain (SBD). |
| AT1G44000 | STAY-GREEN-like protein;(source:Araport11) |
| AT3G02850 | Encodes SKOR, a member of Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mediates the delivery of K+ from stelar cells to the xylem in the roots towards the shoot. mRNA accumulation is modulated by abscisic acid. K+ gating activity is modulated by external and internal K+. Involved in response to low potassium. |
| AT5G35770 | A recessive mutation in the Arabidopsis STERILE APETALA (SAP) causes severe aberrations in inflorescence and flower and ovule development. |
| AT2G25790 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT5G56040 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT3G02580 | Brassinosteroid biosynthetic enzyme, catalyzes delta7 sterol C-5 desaturation step. Mutant has dwarf phenotype. |
| AT4G22756 | Encodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha-methyl oxidase. Works together with SMO1-1 to maintain correct sterol composition and balance auxin and cytokinin activities during embryogenesis. |
| AT1G20330 | Encodes a sterol-C24-methyltransferases involved in sterol biosynthesis. Mutants display altered sterol composition, serrated petals and sepals and altered cotyledon vascular patterning as well as ectopic endoreduplication. This suggests that suppression of endoreduplication is important for petal morphogenesis and that normal sterol composition is required for this suppression. |
| AT4G30620 | Homolog of STIC2, recent duplication. |
| AT4G13266 | PGG domain containing transmembrane protein.Functions in the stigma to prevent interspecies pollen from forming pollen tubes. |
| AT5G65590 | Encodes a plant-specific Dof-type transcription factor expressed in maturing guard cells, but not in guard mother cells. It regulates essential processes of stomatal guard cell maturation and functions as a key transcription factor regulating the final stages of guard cell differentiation. |
| AT4G34190 | Encodes a stress enhanced protein that localizes to the thylakoid membrane and whose mRNA is upregulated in response to high light intensity. It may be involved in chlorophyll binding. |
| AT2G21970 | stress enhanced protein 2 (SEP2) chlorophyll a/b-binding protein |
| AT1G74000 | encodes a protein similar to strictosidine synthase, which is involved in the production of monoterpene indole alkaloids. This gene belongs to a family of 13 members in Arabidopsis. |
| AT2G25110 | Encodes an endoplasmic reticulum protein SDF2 (stromal-derived factor-2). Forms a complex SDF2-ERdj3B-BiP that is required for the proper accumulation of the surface-exposed leucine-rich repeat receptor kinases EFR. EFR is involved in PAMP (pathogen associated molecular patterns) triggered immunity. |
| AT5G06820 | STRUBBELIG-receptor family 2;(source:Araport11) |
| AT4G03390 | STRUBBELIG-receptor family 3;(source:Araport11) |
| AT3G51060 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. STY1/STY2 double mutants showed defective style, stigma as well as serrated leaves. Binds to the promoter of YUC4 and YUC8 (binding site ACTCTAC) |
| AT5G59120 | SBT4.13 subtilase. Activity is inhibited by SPI-1. |
| AT2G39851 | Proteinase inhibitor, propeptide;(source:Araport11) |
| AT3G27380 | One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Expressed during germination and post-germinative growth. |
| AT5G65165 | One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Transcripts appear during seed maturation, persist through desiccation, are abundant in dry seeds, and markedly decline during germination. |
| AT5G66880 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. The mRNA is cell-to-cell mobile. |
| AT1G04920 | Encodes a sucrose-phosphate synthase whose activity is stimulated by Glc-6-P and inhibited by Pi. |
| AT5G20830 | Encodes a protein with sucrose synthase activity (SUS1). |
| AT2G02860 | encodes a sucrose transporter in sieve elements and a number of sink tissues and cell types. Gene expression is induced by wounding. |
| AT1G71880 | Sucrose transporter gene induced in response to nematodes; member of Sucrose-proton symporter family. The mRNA is cell-to-cell mobile. |
| AT1G22710 | Encodes for a high-affinity transporter essential for phloem loading and long-distance transport. A major sucrose transporter, AtSUC2 can also transport a wide range of physiological and synthetic glucose conjugates with both α- or β-linkage. |
| AT1G07340 | sugar transporter 2;(source:Araport11) |
| AT3G10370 | mitochondrial FAD-dependent glycerol-3-phosphate dehydrogenase. possibly involved in storage lipid catabolism and glycerol assimilation, and in glycerol-3-phosphate shuttle which transports reducing power from cytosol to mitochondrion. |
| AT1G78000 | Encodes a sulfate transporter that can restore sulfate uptake capacity of a yeast mutant lacking sulfate transporter genes. |
| AT4G02700 | sulfate transporter 3;(source:Araport11) |
| AT5G13550 | Encodes a sulfate transporter. |
| AT5G07010 | Encodes a sulfotransferase that acts specifically on 11- and 12-hydroxyjasmonic acid. Transcript levels for this enzyme are increased by treatments with jasmonic acid (JA), 12-hydroxyJA, JA-isoleucine, and 12-oxyphytodienoic acid (a JA precursor). |
| AT2G14920 | Encodes a brassinosteroid sulfotransferase that may be involved in brassinosteroid inactivation. In vitro experiements show that this enzyme can act on a broad group of naturally occurring brassinosteroids, including the 24-epimers and (22R,23R)-28 homobrassinosteroids, that have an array of different side chains, though it shows a preference for (22R,23R)-28 homobrassinosteroids. ST4A is expressed in the roots and transcript levels fall in response to cytokinin treatment. |
| AT1G67810 | Encodes a protein capable of stimulating the cysteine desulfurase activity of CpNifS (AT1G08490) in vitro. SufE2:GFP localizes to the chloroplasts where it is likely to play a role in iron-sulfur cluster assembly. Transcript levels for this gene are high in the pollen relative to other organs based on RT-PCR analysis. The mRNA is cell-to-cell mobile. |
| AT5G66170 | Encodes a thiosulfate sulfurtransferase/rhodanese. |
| AT3G55880 | A gain-of-function mutant of SUE4 exhibited improved low sulphur tolerance. |
| AT5G48850 | Homologous to the wheat sulphate deficiency-induced gene sdi1. Expression in root and leaf is induced by sulfur starvation. Knockout mutants retained higher root and leaf sulfate concentrations, indicating a role in regulation of stored sulfate pools. |
| AT1G71360 | Encodes a member of the mid-SUN subfamily of SUN-domain proteins that is localized to both the nuclear envelope and the ER. It is involved in early seed development and nuclear morphology. |
| AT3G14205 | Phosphoinositide phosphatase family protein;(source:Araport11) |
| AT3G59770 | Encodes a phosphoinositide phosphatase. The sac9 null mutant accumulates elevated levels of PtdIns(4,5)P2 and Ins(1,4,5)P3. The mutant plants have characteristics of constitutive stress responses. |
| AT2G31880 | Encodes a putative leucine rich repeat transmembrane protein that is expressed in response to Pseudomonas syringae. Expression of SRRLK may be required for silencing via lsiRNAs. Regulates cell death and innate immunity. |
| AT2G17690 | Encodes an F-box domain containing protein that is regulated by non-CG DNA methylation. In drm1 drm2 cmt3 triple mutant background SDC expression is no longer suppressed and plants display abnormal development including curled leaves and reduced stature. A maternally expressed imprinted gene. |
| AT5G23570 | Required for posttranscriptional gene silencing and natural virus resistance.SGS3 is a member of an 'unknown' protein family. Members of this family have predicted coiled coiled domains suggesting oligomerization and a potential zinc finger domain. Involved in the production of trans-acting siRNAs, through direct or indirect stabilization of cleavage fragments of the primary ta-siRNA transcript. Acts before RDR6 in this pathway. The mRNA is cell-to-cell mobile. |
| AT3G60400 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT1G71696 | Encodes a Putative Zn2+ carboxypeptidase, 4 splice variants have been identified but not characterized for different functions and/or expression patterns.SOL1 isolated as a suppressor of root- specific overexpression of CLE19, a clavata3 like gene. sol1 partially suppresses the short root phenotype caused by CLE19 overexpression. |
| AT3G06670 | SMEK1 forms a catalytically active complex with PP4 proteins. The complex has been shown to target and dephosphorylate HYL1 which in turn promotes miRNA biogenesis. Mutants have pleiotrophic phenotypes and decreased production of miRNA. SMEK1 accumulation is responsive to ABA. |
| AT2G24020 | STIC2 was identifided in a screen for suppressors of chloroplast protein import defect in tic40. |
| AT5G13650 | Encodes SVR3, a putative chloroplast TypA translation elongation GTPase. Loss of SVR3 suppresses variegation mediated by var2. SVR3 is essential for plants? ability to develop functional chloroplasts under chilling stress (8C), but not at normal temperature (22C). |
| AT2G45070 | Sec61 Beta Subunit |
| AT5G51330 | Encodes novel protein involved in sister chromatid cohesion and meiotic chromosome organization during both male and female meiosis. Gene has two alternate transcripts which produce two similar proteins, one 57 aa shorter than the other. |
| AT4G17730 | member of SYP2 Gene Family. Together with SYP23 interacts with Tobacco mosaic virus 126 kDa protein; required for normal local virus accumulation and spread. |
| AT3G05710 | Encodes a member of SYP4 Gene Family that is a plant ortholog of the Tlg2/syntaxin16 Qa-SNARE. Together with SYP42, it regulates the secretory and vacuolar transport pathways in the post-Golgi network and maintains the morphology of the Golgi apparatus and TGN and is required for extracellular resistance responses to a fungal pathogen. |
| AT3G61450 | syntaxin of plants 73 (SYP73) |
| AT5G44260 | Encodes a Tandem CCCH Zinc Finger protein. Interacts and co-localizes with MARD1 and RD21A in processing bodies (PBs) and stress granules (SGs). |
| AT5G58620 | Involved in control of defence gene expression post-transcriptionally through release from translation arrest within TZF9-PAB2-containing RNA granules. TZF9 shows phospho-mobility shift after flg22 treatment, inferred to be caused by phosphorylation through MPK3 and/or MPK6. The major MPK3/6-targeted phospho-sites are S181, S323, S343, S352, S356, S362 and S377. |
| AT5G43630 | Encodes a zinc knuckle protein that negatively regulates morning specific growth. The role of TZP in hypocotyl elongation was established through a QTL analysis of BayXSha RIL populations. The Bay-0 allele contains a deletion causing a frameshift mutation. TZP is under circadian control and acts to regulate morning-specific hypocotyl growth. The mRNA is cell-to-cell mobile. |
| AT5G60120 | AP2 family transcription factor that is involved in regulation of flowering and innate immunity.Interacts with CRY1 and CRY2 during flowering as part of a regulatory circuit including FT and CO. TOE1/TOE2 are also targets of MiR172b repression and functions in regulation of innate immunity via repression of FLS. |
| AT5G67180 | target of early activation tagged (EAT) 3;(source:Araport11) |
| AT3G13445 | TBP (TATA binding protein) associates with TAF(II)s (TBP-associated factors) to form the TFIID general transcription factor complex |
| AT1G55520 | TATA-box binding protein. Required for basal transcription. Acts facilitating the recruitment of TFIID to the promoter, which together with the RNA polymerase form the preinitiation complex. |
| AT2G18000 | TBP-associated factor 14;(source:Araport11) |
| AT5G43130 | TBP-associated factor 4;(source:Araport11) |
| AT1G54360 | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. |
| AT4G34340 | Member of SAGA complex, SPT module, interacts with HAG1. |
| AT5G08070 | TCP gene involved in heterochronic control of leaf differentiation. |
| AT5G08330 | Circadian oscillator protein which interacts with bZIP63 and regulates a response of the circadian oscillator to sugar. Is not required for the sugar-induced circadian phase advance in the morning; regulates a response of CCA1 to sugars. |
| AT5G23280 | Transcription factor which plays an important role during leaf and hypocotyl development, redundantly, with at least six class I TCPs, and regulates the expression of CYCD1;1 to affect endoreplication. |
| AT2G45680 | TCP family transcription factor;(source:Araport11) |
| AT3G15030 | Arabidopsis thaliana TCP family transcription factor. Regulated by miR319. Involved in heterchronic regulation of leaf differentiation. |
| AT2G20080 | hypothetical protein;(source:Araport11) |
| AT2G34010 | verprolin;(source:Araport11) |
| AT5G13820 | Encodes a protein that specifically binds plant telomeric DNA repeats. It has a single Myb telomeric DNA-binding (SANT) domain in C-terminus that prefers the sequence TTTAGGG. Single Myb Histone (SMH) gene family member. |
| AT5G59430 | Encodes a telomeric repeat binding protein with a DNA binding domain at its C terminus. The DNA binding domain has a preference for GGTTTAG sequences and at least five of these repeats are required for recognition by a nearly full-length TRP1 protein. |
| AT5G58070 | Encodes a temperature-induced lipocalin TIL1. Involved in thermotolerance. Peripherally associated with plasma membrane. |
| AT1G25560 | Encodes a member of the RAV transcription factor family that contains AP2 and B3 binding domains. Involved in the regulation of flowering under long days. Loss of function results in early flowering. Overexpression causes late flowering and repression of expression of FT. Novel transcriptional regulator involved in ethylene signaling. Promoter bound by EIN3. EDF1 in turn, binds to promoter elements in ethylene responsive genes. |
| AT4G15870 | encodes a putative terpene synthase |
| AT4G14770 | Regulates fate transition and cell Divisions in the stomatal lineage. |
| AT5G23030 | Member of TETRASPANIN family |
| AT2G01960 | Member of TETRASPANIN family |
| AT5G57810 | Member of TETRASPANIN family |
| AT2G19580 | Member of TETRASPANIN family |
| AT3G45600 | Member of TETRASPANIN family |
| AT5G60220 | Member of TETRASPANIN family |
| AT4G23410 | TET5 encodes a member of the TETRASPANIN gene family that is expressed in the embryo and vascular system and is involved in organ growth redundantly with TET6. |
| AT4G30430 | Member of TETRASPANIN family |
| AT3G43210 | Encodes a kinesin TETRASPORE. Required for cytokinesis in pollen. In mutants, all four microspore nuclei remain within the same cytoplasm after meiosis. |
| AT5G21990 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808). Functions as a chaperone receptor at the chloroplast outer envelope, mediating Hsp70-dependent protein targeting to chloroplasts. It has been localized to the ER membrane, interacts with the Sec translocon, and has a potential function in post-translational protein transport into the ER. The mRNA is cell-to-cell mobile. |
| AT1G53300 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. The mRNA is cell-to-cell mobile. |
| AT2G42580 | Encodes a member of the TTL family and contains a thioredoxin like domain and three tandom TPRs. Interacts physically with BRL2/VH1 and appears to play a role in brassiosteroid and auxin signaling. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. The mRNA is cell-to-cell mobile. |
| AT3G58620 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. |
| AT1G75030 | encodes a PR5-like protein |
| AT2G44750 | Encodes a thiamine pyrophosphokinase capable of producing thiamine pyrophosphate from free thiamine. |
| AT2G29630 | Encodes a protein involved in thiamin biosynthesis. The protein is an iron-sulfur cluster protein predicted to catalyze the conversion of 5-aminoimidazole ribonucleotide (AIR) to hydroxymethylpyrimidine (HMP) or hydroxymethylpyrimidine phosphate (HMP-P). A severe reduction of THIC levels in plants decreases vitamin B1 (thiamin diphosphate (TPP)) levels and also leads to changes in the levels of numerous other metabolites since so many primary metabolic enzymes require a TPP co-factor. thiC mutants are chlorotic and arrest in their development at the cotyledon stage. A N-terminal targeting sequence directs the THIC protein to the chloroplast stroma. A conserved TPP-binding site is located in the 3' UTR of the At2g29630.2 gene model, and is predicted to function as a riboswitch. The riboswitch controls the formation of transcripts with alternative 3' UTR lengths, which affect mRNA accumulation and protein production. THIC transcripts are observed in seedlings 5 or more days after germination, and light promotes the expression of this gene. Recessive mutant isolated by Redei. Leaves but not cotyledons white, lethal; restored to normal by thiamine or 2,5-dimethyl-4-aminopyrimidine. |
| AT5G32470 | The classical thiamin-requiring th2-1 mutation corresponds to At5g32470, encoding a HAD (haloacid dehalogenase) family phosphatase fused to a TenA (thiamin salvage) family protein. The HAD domain is a thiamin monophosphate-selective phosphatase, and the TenA domain has the expected thiamin salvage activity. |
| AT3G15360 | encodes a prokaryotic thioredoxin The mRNA is cell-to-cell mobile. |
| AT1G08630 | Encodes a threonine aldolase, involved in threonine degradation to glycine. Primarily expressed in seeds and seedlings. |
| AT5G53490 | thylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein. |
| AT2G30440 | Encodes a thylakoidal processing peptidase that removes signal sequences from proteins synthesized in the cytoplasm and transported into the thylakoid lumen. The mRNA is cell-to-cell mobile. |
| AT4G01050 | hydroxyproline-rich glycoprotein family protein, contains a rhodanese homology domain. Required for anchoring the FNR flavoenzyme to the thylakoid membranes and sustaining high efficiency photosynthetic linear electron flow. The mRNA is cell-to-cell mobile. |
| AT1G77490 | Encodes a chloroplastic thylakoid ascorbate peroxidase tAPX. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
| AT5G23070 | Encodes a thymidine kinase that salvages DNA precursors. The pyrimidine salvage pathway is crucial for chloroplast development and genome replication, as well as for the maintenance of its integrity. |
| AT3G63180 | TIC-like protein;(source:Araport11) |
| AT2G46640 | Encodes TAC1 (Tiller Angle Control 1). Influences axillary branch growth angle. Inflorescence stems of TAC1 mutants are vertically oriented and have axillary shoots with narrow branch angles. |
| AT3G22380 | Encodes a nucleus-acting plant-specific clock regulator working close to the central oscillator and affecting the circadian gating of light responses. Circadian gating is the alteration of circadian phase according to the photoperiod of the entraining day/light cycle and the rhythmic antagonism of light responses in the early subjective night. TIC differentially regulates CCA1 and PRR9 from LHY, with LHY expression as a dominant genetic target of TIC action. Also shown to be invoved in the maintenance of Arabidopsis thaliana metabolic homeostasis. |
| AT5G61380 | Pseudo response regulator involved in the generation of circadian rhythms. TOC1 appears to shorten the period of circumnutation speed. TOC1 contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. PRR3 may increase the stability of TOC1 by preventing interactions between TOC1 and the F-box protein ZTL. Expression of TOC1 is correlated with rhythmic changes in chromatin organization. The mRNA is cell-to-cell mobile. |
| AT1G17615 | TN2 is an atypical TIR-NBS protein that lacks the LRR domain common in typical NLR receptors. It interacts with EXO70B1, a subunit of the exocyst complex. Loss of function mutants in TN2 can suppress EXO70B1 mutants suggesting that EXO70B1 acts through TN2. |
| AT1G32400 | TOM2A encodes a 280 amino acid putative four-pass transmembrane protein with a C-terminal farnesylation signal, essential for efficient multiplication of tobacco mosaic viruses. |
| AT2G02180 | Necessary for the efficient multiplication of tobamoviruses. The mRNA is cell-to-cell mobile. |
| AT1G14530 | tobamovirus multiplication-like protein (DUF1084);(source:Araport11) |
| AT5G63640 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT4G32760 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT5G05570 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT5G62170 | LOW protein: M-phase inducer phosphatase-like protein;(source:Araport11) |
| AT1G01695 | Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11) |
| AT3G24630 | hypothetical protein;(source:Araport11) |
| AT3G63430 | zinc finger CCCH domain protein;(source:Araport11) |
| AT3G05750 | Encodes a member of the TRM superfamily, that plays a role in preprophase band formation during plant cell division and controls the robustness of the orientation of that cell division. |
| AT5G47560 | Encodes a tonoplast malate/fumarate transporter. |
| AT4G27060 | Encodes a novel, plant-specific microtubule-associated protein that regulates the orientation of cortical microtubules and the direction of organ growth. The protein plays a role in control of microtubule dependent anisotropic cell elongation. spr2 mutant rosette leaves, cauline leaves, roots, petioles and petals curl in an anticlockwise direction. |
| AT3G16720 | RING-H2 protein induced after exposure to chitin or inactivated crude cellulase preparations. The mRNA is cell-to-cell mobile. |
| AT5G58580 | Encodes a functional E3 ligase that is involved in membrane trafficking and regulation of salt stress responses. It is localized to membranes including the plasma membrane, pre-vacuolar compartments and Golgi. |
| AT5G57460 | TPLATE complex subunit involved in clathirin mediated endocytosis. |
| AT5G49615 | trans-acting siRNA (tasi-RNA) |
| AT4G37130 | Encodes a member of the Nup62 subcomplex of the Arabidopsis NPC. |
| AT5G24710 | WD40/YVTN repeat protein which cooperates with the AP2 complex in the clathrin-mediated endocytosis of cellulose synthase to regulate cellulose biosynthesis. |
| AT1G20350 | mitochondrial inner membrane translocase |
| AT2G29530 | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. Together with AtTIM9, AtTIM10 is non-redundantly essential for maintaining mitochondrial function of early embryo proper cells and endosperm free-nuclei. |
| AT5G13930 | Encodes chalcone synthase (CHS), a key enzyme involved in the biosynthesis of flavonoids. Required for the accumulation of purple anthocyanins in leaves and stems. Also involved in the regulation of auxin transport and the modulation of root gravitropism. The mRNA is cell-to-cell mobile. |
| AT3G28430 | Encodes a peripheral membrane protein localized at the Golgi apparatus that is involved in membrane trafficking, vacuole development and in flavonoid accumulation in the seed coat. Mutant seed color is pale brown. |
| AT2G37260 | Encodes a protein similar to WRKY transcription factors that is expressed in the seed integument and endosperm. Mutants are defective in proanthocyanidin synthesis and seed mucilate deposition. Seeds are yellow colored. Seed size is also affected; seeds are reduced in size but only when the mutant allele is transmitted through the female parent.Loss of function alleles are associated with a reduction in interploidy lethality. |
| AT3G62980 | Encodes an auxin receptor that mediates auxin-regulated transcription. It contains leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation. Mutations in TIR1 block auxin stimulation of flavonoid synthesis. |
| AT2G18700 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. |
| AT1G78090 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
| AT1G35910 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT2G22190 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G12430 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G22590 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G39770 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G06410 | Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants. |
| AT3G46590 | Encodes a protein that specifically binds plant telomeric DNA (TTTAGGG)n repeats. Involved in bending DNA. Expressed throughout the plant with highest levels in flowers. |
| AT1G17460 | Arabidopsis thaliana myb family transcription factor (At1g17460) |
| AT1G72650 | Arabidopsis thaliana myb family transcription factor (At1g72650) |
| AT5G19160 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT2G37720 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G28150 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. A putative xyloglucan O-acetyltransferase. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G70230 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. A putative xyloglucan O-acetyltransferase. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G14850 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G78710 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G56330 | Involved in posttranscriptional modification of plastid tRNA. |
| AT5G17990 | Encodes the tryptophan biosynthetic enzyme phosphoribosylanthranilate transferase (PAT1, called trpD in bacteria). Converts anthranilate and phosphoribosylpyrophosphate into phosphoribosylanthranilate and inorganic pyrophosphate. The mRNA is cell-to-cell mobile. |
| AT2G47770 | Encodes a membrane-bound protein designated AtTSPO (Arabidopsis thaliana TSPO-related). AtTSPO is related to the bacterial outer membrane tryptophan-rich sensory protein (TspO) and the mammalian mitochondrial 18 kDa Translocator Protein (18 kDa TSPO), members of the TspO/MBR domain-containing membrane proteins. Mainly detected in dry seeds, but can be induced in vegetative tissues by osmotic or salt stress or abscisic acid treatment. Located in endoplasmic reticulum and the Golgi stacks. It is degraded through the autophagy pathway. |
| AT1G78240 | Encodes TSD2 (TUMOROUS SHOOT DEVELOPMENT2), a putative methyltransferase with an essential role in cell adhesion, anthocyanin accumulation, and coordinated plant development. |
| AT5G64510 | Encodes Tunicamycin Induced 1(TIN1), a plant-speci c ER stress-inducible protein. TIN1 mutation affects pollen surface morphology. Transcriptionally induced by treatment with the N-linked glyclsylation inhibitor tunicamycin. |
| AT5G01075 | Encodes a small ER-localized protein that is strongly expressed in seeds and regulates both embryo development and accumulation of storage compounds. At the cellular level, TWS1 is responsible for cuticle deposition on epidermal cells and organization of the endomembrane system. |
| AT3G02140 | Encodes a protein that acts in the nucleus and is an important negative regulator of ABA and salt stress responses, and could play a critical role in controlling root elongation, floral initiation and starch degradation. |
| AT4G03560 | Encodes a depolarization-activated Ca(2+) channel. Anti-sense experiments with this gene as well as Sucrose-H(+) symporters and complementation of yeast sucrose uptake mutant cch1 suggest that this protein mediates a voltage-activated Ca(2+ )influx. Mutants lack detectable SV channel activity suggesting TPC1 is essential component of the SV channel. Patch clamp analysis of loss of function mutation indicates TPC1 does not affect Ca2+ signaling in response to abiotic and biotic stress. |
| AT3G62260 | Type 2C protein phosphatase (PP2C) which negatively regulates AtHKT1;1 activity and thus determines systemic Na+ allocation during salt stress. |
| AT5G53970 | Encodes a cytosolic tyrosine aminotransferase which is strongly induced upon aging and coronatine treatment. AtTAT1 prefers Tyr as an amino donor but can also use Phe, Trp, His, Met, and Leu. The mRNA is cell-to-cell mobile. |
| AT4G10970 | UAP56-interacting factor1, binds single stranded RNA and, along with UIEF2,,appears to play a role in nuclear export of RNA. |
| AT4G05050 | polyubiquitin gene, belongs to a subtype group with UBQ10 and UBQ14. Various ecotypes of Arabidopsis have different numbers of ubiquitin repeats within this gene. |
| AT3G17205 | ubiquitin protein ligase 6;(source:Araport11) |
| AT1G75440 | ubiquitin-conjugating enzyme 16;(source:Araport11) |
| AT1G50490 | Encodes one of two ubiquitin-conjugating enzymes belonging to the E2-C gene family (the other being UBC19). Transcript is always found in diving cells, but also in other non-dividing cells. |
| AT1G53025 | Ubiquitin-conjugating enzyme family protein;(source:Araport11) |
| AT3G17000 | Group XIV ubiquitin-conjugating enzyme that functions negative regulation of drought stress. |
| AT3G45180 | Ubiquitin like protein that appears to play a role in pre-mRNA splicing. |
| AT5G02880 | encodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT3G53090 | encodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis. |
| AT1G17110 | Encodes a ubiquitin-specific protease, and its activity has been confirmed in an in vitro assay. ubp15 mutants have defects in cell proliferation, and the associated processes of leaf, root, stem, flower, and silique development. UBP15 can be found in the nucleus and cytoplasm in transient assays. Though UBP15 is expressed in many tissues, UBP15 transcript levels are higher in rosette leaves and inflorescences than in other parts of the plant. Together with CUC2/CUC3-DA1 part of a regulatory module controls the initiation of axillary meristems, thereby determining plant architecture. As a direct substrate of DA1 peptidase, it represses the initiation of axillary meristems. |
| AT1G04860 | Encodes a ubiquitin-specific protease. |
| AT5G10790 | Encodes a ubiquitin-specific protease. |
| AT5G03490 | Encodes a dihydroxybenzoic acid (DHBA) glycosyltransferase. The Col-0 enzyme is responsible for biosynthesis of 2,3-DHBA xyloside and 2,5-DHBA xyloside. The Col-0 enzyme is specific for UDP-xylose and the C24 enzyme uses both UDP-glucose and UDP-xylose. This difference in sugar donor specificity was shown to be largely due to a single amino acid change between the two isoforms. |
| AT1G12780 | Encodes a UDP-glucose epimerase that catalyzes the interconversion of the sugar nucleotides UDP-glucose UDP-galactose via a UDP-4-keto-hexose intermediate. Responsive to stress. |
| AT4G23920 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in growth and cell wall carbohydrate biosynthesis. |
| AT4G30440 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. |
| AT2G41490 | UDP-GlcNAc:dolichol phosphate N-acetylglucosamine-1-phosphate transferase |
| AT3G03250 | Is thought to encode a cytosolic UDP-glucose pyrophosphorylase with strong similarity to potato UTP--glucose-1-phosphate uridylyltransferase. Downregulated by flooding. |
| AT3G56040 | UDP-glucose pyrophosphorylase 3;(source:Araport11) |
| AT4G15280 | UDP-glucosyl transferase 71B5;(source:Araport11) |
| AT2G29750 | UDP-glucosyl transferase 71C1;(source:Araport11) |
| AT2G29740 | UDP-glucosyl transferase 71C2;(source:Araport11) |
| AT1G07260 | Encodes a uridine diphosphate-glycosyltransferase that acts on methyl salicylate (MeSA) to form MeSA glucosides in vitro and in vivo and facilitates negative regulation of the SAR response by modulating homeostasis of MeSA and SA. |
| AT1G07250 | UDP-glucosyl transferase 71C4;(source:Araport11) |
| AT1G01420 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT2G31750 | Encodes an auxin glycosyltransferase that is likely to be involved in regulation of auxin by glycosylation. |
| AT1G05530 | Encodes a protein with glucosyltransferase activity with high sequence homology to UGT1 (AT1G05560). It belongs to an UGT subfamily that binds UDP-glucose but not UDP-glucuronate, UDP-galactose, or UDP-rhamnose as the glycosyl donor. UGT2 was shown to be able to use abscisic acid as glycosylation substrate in the presence of UDP-glucose. |
| AT1G30530 | The At1g30530 gene encodes a UDP-rhamnose:flavonol-3-O-rhamnosyltransferase (UGT78D1) attaching a rhamnosyl residue to the 3-O-position of the flavonols kaempferol and quercetin |
| AT5G17050 | The At5g17050 encodes a anthocyanidin 3-O-glucosyltransferase which specifically glucosylates the 3-position of the flavonoid C-ring. Anthocyanidins such as cyanidin and pelargonidin as well as flavonols such as kaempferol and quercetin are accepted substrates. |
| AT5G17030 | UDP-glucosyl transferase 78D3;(source:Araport11) |
| AT3G21560 | Encodes a protein with sinapic acid:UDP-glucose glucosyltransferase activity. Mutants defective in this gene are hyper-fluorescent (which accumulate in their trichomes a compound that is likely to be 3',5'-dimethoxynaringenin chalcone or sinapoyltriacetic acid lactone, potential products of the concerted action of 4-coumarate CoA ligase and chalcone synthase on sinapic acid). Also shown to be required for Arabidopsis nonhost resistance to the Asian soybean rust pathogen Phakopsora pachyrhizi. |
| AT1G22360 | UDP-glucosyl transferase 85A2;(source:Araport11) |
| AT1G22380 | Encodes a putative UDP-glucosyl transferase. At1g22380 was initially identified as encoding the protein AAF87154, which has been classified as a bHLH protein (AtbHLH152). Subsequently it has been found that the AAF87154 protein appears to be encoded by the AT1G23970 genomic locus. |
| AT1G78270 | UDP-glucosyl transferase 85A4;(source:Araport11) |
| AT2G30140 | Encodes a putative glycosyltransferase. Regulates flowering time via FLOWERING LOCUS C. |
| AT5G59290 | Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
| AT4G02500 | Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides. The mRNA is cell-to-cell mobile. |
| AT2G22500 | Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470). |
| AT4G00080 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G47470 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. The mRNA is cell-to-cell mobile. |
| AT3G20830 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT3G58450 | USP domain containing protein, member of the universal stress protein family, regulated by ABA and possibly regulated by the ABA-dependent transcription factor AREB/ABF. Involved in the regulation of seed germination. |
| AT2G40900 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
| AT4G08300 | nodulin MtN21-like transporter family protein |
| AT1G21890 | nodulin MtN21-like transporter family protein |
| AT1G43650 | nodulin MtN21-like transporter family protein |
| AT1G01070 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
| AT4G01430 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
| AT4G01440 | nodulin MtN21-like transporter family protein |
| AT3G28100 | nodulin MtN21-like transporter family protein The mRNA is cell-to-cell mobile. |
| AT5G07050 | nodulin MtN21-like transporter family protein |
| AT3G15620 | Required for photorepair of 6-4 photoproducts in Arabidopsis thaliana. |
| AT1G76030 | One of three genes encoding the vacuolar ATP synthase subunit B1. This subunit was shown to interact with the gene product of hexokinase1 (ATHXK1). This interaction, however, is solely restricted to the nucleus. The protein binds to and co-localizes with F-actin, bundles F-actin to form higher-order structure, and stabilizes actin filaments in vitro. The mRNA is cell-to-cell mobile. |
| AT4G23710 | vacuolar ATP synthase subunit G2;(source:Araport11) |
| AT1G08190 | Might be involved in protein sorting to the vacuole. The mRNA is cell-to-cell mobile. |
| AT2G21410 | Vacuolar proton ATPase subunit VHA-a isoform 2. Localized in the tonoplast. Required for efficient nutrient storage but not for sodium accumulation. |
| AT1G57820 | Encodes a 645-amino acid methylcytosine-binding protein with a PHD domain, two RING finger domains, and an SRA domain that is involved in centromere heterochromatinization. This protein functions as an E3 ubiquitin ligase in vitro. The protein has been shown to bind to methylated cytosines of CG, CNG and CNN motifs via its SRA domain but has a preference for the former. It plays a role in the establishment/maintenance of chromatin structure during cell division and is localized in the nucleus. Plants over-expressing VIM1/ORTH2 show an inhibition in root growth and a delay in flowering. Both over-expression of GFP:ORTH2 and loss of ORTH2/VIM1 lead to decreased levels of DNA methylation. GFP:ORTH2 over-expressers also have increased levels of FWA transcripts. |
| AT1G57800 | predicted to encode a protein with an N-terminal PHD domain and two RING domains surrounding an SRA domain. Attempts to isolate ORTH3/VIM5 cDNA through RT-PCR were unsuccessful and only one Arabidopsis EST is associated with this locus. A paternally expressed imprinted gene. |
| AT1G71930 | Encodes a NAC-domain transcription factor with transcriptional activation activity that is involved in xylem formation. Induces transdifferentiation of various cells into protoxylem vessel elements. Located in the nucleus. Expression induced in the presence of auxin, cytokinin and brassinosteroids. |
| AT3G24440 | Encodes Vernalization Insensitive 3-like 1 (VIL1). VIL1 is involved in the photoperiod and vernalization of Arabidopsis by regulating expression of the related floral repressors Flowering Locus C (FLC) and Flowering Locus M (FLM). VIL1, along with VIN3 (Vernalization Insensitive 3) is necessary for the chromatin modification to FLC and FLM. |
| AT1G26670 | member of VTI1 Gene Family. Normally localizes to the transgolgi network and plasma membrane. A dominant mutation (zip1) alters the subcellular localization of VTI12 and suppresses loss of function mutation (zag1) of VTI11. Interacts with members of the SYP family. Involved in protein trafficking to protein storage vacuoles. |
| AT2G25340 | Member of Synaptobrevin-like AtVAMP7C, v-SNARE protein family. |
| AT1G14000 | Encodes a protein with similarity to members of the C1 subgroup of MAP kinase kinase kinases. Interacts physically with the receptor kinase BRL2/VH1 and appears to be involved in auxin and brassinosteriod signaling. The mRNA is cell-to-cell mobile. |
| AT4G23630 | VIRB2-interacting protein 1;(source:Araport11) |
| AT5G41600 | VIRB2-interacting protein 3;(source:Araport11) |
| AT5G04490 | Encodes a protein with phytol kinase activity involved in tocopherol biosynthesis. |
| AT1G53700 | The WAG1 and its homolog, WAG2 each encodes a protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT1G21210 | cell wall-associated ser/thr kinase involved in cell elongation and lateral root development |
| AT1G16150 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. Likely involved in Arabidopsis root mineral responses to Zn2+, Cu2+, K+, Na+ and Ni+. The mRNA is cell-to-cell mobile. |
| AT1G75500 | An Arabidopsis thaliana homolog of Medicago truncatula NODULIN21 (MtN21). The gene encodes a plant-specific, predicted integral membrane protein and is a member of the Plant-Drug/Metabolite Exporter (P-DME) family (Transporter Classification number: TC 2.A.7.3) and the nodulin MtN21-like transporter family. |
| AT1G72290 | Encodes a Kunitz-protease inhibitor, a water-soluble chlorophyll protein involved in herbivore resistance activation. |
| AT2G22680 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT4G32330 | WDL5 is an target of EIN3 that co-localizes with cortical microtubles. It its thought to function to stabilize microtubles during ethylene induced hypocotyl elongation. |
| AT2G35880 | Microtubule-stabilizing protein. |
| AT5G04260 | Encodes a thioredoxin (WCRKC2) localized in chloroplast stroma. Contains a WCRKC motif. Functions in redox cascade with 2CPA and 2CPB via the ferredoxin-thioredoxin reductase (FTR)/thioredoxin (Trx) pathway to mediate the light-responsive reductive control of target proteins. Oxidizes redox-regulated proteins. |
| AT2G26570 | Encodes a coiled-coil protein WEB1 (weak chloroplast movement under blue light 1). WEB1, together with another coiled-coil protein WEB2/PMI2 (At1g66840), maintains the chloroplast photorelocation movement velocity. |
| AT3G04910 | Serine/threonine protein kinase, whose transcription is regulated by circadian rhythm. |
| AT3G48260 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. |
| AT3G18750 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
| AT5G56210 | Encodes an outer nuclear membrane protein that anchors RanGAP1 to the nuclear envelope. It interacts with SUN proteins and is required for maintaining the elongated nuclear shape of epidermal cells. |
| AT1G30650 | member of WRKY Transcription Factor; Group II-e |
| AT2G24570 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
| AT5G56270 | Encodes WRKY transcription factor 2, a zinc-finger protein. In wrky2 mutants, egg cells polarize normally but zygotes fail to reestablish polar organelle positioning from a transient symmetric state, resulting in equal cell division and distorted embryo development. |
| AT2G47260 | Encodes a member of WRKY Transcription Factor; Group I. Involved in nematode feeding site establishment and auxin mediated PIN polar localization in roots. Expression is induced by auxin. |
| AT5G52830 | Encodes a WRKY transcription factor WRKY27. Mutation in Arabidopsis WRKY27 results in delayed symptom development in response to the bacterial wilt pathogen Ralstonia solanacearum. |
| AT4G18170 | Member of WRKY Transcription Factor; Group II-c. Involved in the activation of salicylic acid biosynthesis genes ICS1 and PBS3. In the ovule, it is expressed in hypodermal somatic cells and appears to play a role in supression of megasporocyte cell fate. In the leaf if is upstream of FHY3 and regulates light-mediated leaf senescence. |
| AT2G03340 | Encodes WRKY DNA-binding protein 3 (WRKY3). |
| AT2G34830 | member of WRKY Transcription Factor; Group II-e |
| AT5G49520 | Encodes WRKY48, a member of the WRKY Transcription Factor. WRKY48 is a stress- and pathogen-induced transcriptional activator that represses plant basal defense. The mRNA is cell-to-cell mobile. |
| AT5G64810 | member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses. |
| AT2G25000 | Pathogen-induced transcription factor. Forms protein complexes with itself and with WRKY40. Coexpression with WRKY18 or WRKY40 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. |
| AT1G29280 | member of WRKY Transcription Factor; Group II-e The mRNA is cell-to-cell mobile. |
| AT5G46350 | member of WRKY Transcription Factor; Group II-c |
| AT1G68150 | member of WRKY Transcription Factor; Group II-b The mRNA is cell-to-cell mobile. |
| AT2G17950 | Homeobox gene controlling the stem cell pool. Expressed in the stem cell organizing center of meristems. Required to keep the stem cells in an undifferentiated state. Regulation of WUS transcription is a central checkpoint in stem cell control. The size of the WUS expression domain controls the size of the stem cell population through WUS indirectly activating the expression of CLAVATA3 (CLV3) in the stem cells and CLV3 repressing WUS transcription through the CLV1 receptor kinase signaling pathway. Repression of WUS transcription through AGAMOUS (AG) activity controls stem cell activity in the determinate floral meristem. Binds to TAAT element core motif. WUS is also involved in cell differentiation during anther development. Responds to CMV infection and represses virus accumulation in the meristem central and peripheral zones; inhibits viral protein synthesis by repressing the expression of plant S-adenosyl-L-methionine?dependent methyltransferases, which are involved in ribosomal RNA processing and ribosome stability. |
| AT3G18010 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Its mRNA is expressed in the initiating vascular primordium of the cotyledons during heart and torpedo stages. |
| AT1G46480 | Encodes WOX4, a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. This protein also contains an acidic domain approximately 10 residues upstream of the WUS box. Part of the TDIF-TDR-WOX4 signaling pathway that plays a crucial role in the maintenance of the vascular meristem organization during secondary growth. WOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation. |
| AT3G11260 | WOX5 is a member of the Wuschel (WUS) family of homeodomain transcription factors and is required for quiescent center (QC) function and columella stem cell maintenance in the root meristem. It is expressed in the QC and moves to the columella stem cells where it represses their differentiation. WOX5 binds members of the Topless family of transcriptional co-repressors. |
| AT5G07270 | hypothetical protein;(source:Araport11) |
| AT3G23280 | Encodes a ubiquitin ligase that is a novel player in ethylene signaling involved in negatively regulating apical hook curvature, with alternative splicing controlling dual targeting to the nuclear and cytoplasmic compartments. |
| AT5G49660 | The gene encodes receptorlike kinase (RLK). Involved in the maintenance organization of cell files or cell morphology in conductive elements. Functions as a receptor for CEP1 peptide. Mediates nitrate uptake signaling. |
| AT5G64530 | xylem NAC domain 1;(source:Araport11) |
| AT4G14130 | xyloglucan endotransglycosylase-related protein (XTR7) |
| AT1G14720 | member of Glycoside Hydrolase Family 16 |
| AT5G65730 | xyloglucan endotransglucosylase/hydrolase 6;(source:Araport11) |
| AT4G37800 | xyloglucan endotransglucosylase/hydrolase 7;(source:Araport11) |
| AT4G03210 | Encodes a member of xyloglucan endotransglucosylase/hydrolases (XTHs) that catalyze the cleavage and molecular grafting of xyloglucan chains function in loosening and rearrangement of the cell wall. Gene is expressed in shoot apex region, flower buds, flower stalks and internodes bearing flowers. |
| AT5G07720 | Galactosyl transferase GMA12/MNN10 family protein;(source:Araport11) |
| AT1G18690 | Galactosyl transferase GMA12/MNN10 family protein;(source:Araport11) |
| AT1G74380 | xyloglucan xylosyltransferase 5;(source:Araport11) |
| AT1G10550 | Encodes a membrane-localized protein that is predicted to function during cell wall modification.Overexpression of XTH33 results in abnormal cell morphology. It's expression is under epigenetic control by ATX1. |
| AT3G62720 | Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides. |
| AT3G22690 | YS1 is a PPR protein involved in RNA editing of plastid encoded genes. Natural variation in this locus is associated with increased photosynthetic acclimation. |
| AT3G17650 | Arabidopsis thaliana metal-nicotianamine transporter YSL5 |
| AT3G27020 | Arabidopsis thaliana metal-nicotianamine transporter YSL6 |
| AT3G51430 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
| AT1G63700 | Member of MEKK subfamily, a component of the stomatal development regulatory pathway. Mutations in this locus result in embryo lethality. |
| AT1G48910 | A paternally expressed imprinted gene. |
| AT1G04610 | Encodes a member of the YUC family that is expressed in the root apex and is ethylene inducible in the root. |
| AT4G28720 | Auxin biosynthetic gene regulated by RVE1. Overexpression leads to suppression of bri1 phenotype. |
| AT1G04180 | YUCCA 9;(source:Araport11) |
| AT5G43890 | Encodes a YUCCA-like putative flavin monooxygenase, the activation tagging mutant has increased level of IAA, increased auxin response and phenotype of auxin overproduction, rescues erecta mutant phenotype |
| AT5G25620 | Encodes a member of a family of flavin monooxygenases with an important role in auxin biosynthesis. YUC6 possesses an additional thiol-reductase activity that confers drought resistance independently of auxin biosynthesis. |
| AT3G14890 | Encodes a base excision repair protein that, together with APE2, it plays overlapping roles in the maintenance of epigenome and genome stability in plants. |
| AT1G69600 | Encodes ZFHD1, a member of the zinc finger homeodomain transcriptional factor family. Binds to the 62 bp promoter region of ERD1 (early responsive to dehydration stress 1). Expression of ZFHD1 is induced by drought, high salinity and abscisic acid. |
| AT5G04340 | Encodes a C2H2 zinc finger transcription factor that coordinately activates phytochelatin-synthesis related gene expression and directly targets GSH1 by binding to its promoter to positively regulate Cd accumulation and tolerance. |
| AT3G02830 | Encodes a zinc finger protein that binds to PORA mRNA in vivo and recruits the Pfr form of phytochrome to the 5′-UTR of PORA mRNA to regulate translation of the mRNA. |
| AT4G17810 | C2H2 domain regulatory protein. Functions downstream of GL2 during root hair development and regulates expression of targets RDH6, RSL2 and RSL4. |
| AT1G10480 | Encodes a zinc finger protein containing only a single zinc finger that acts downstream of ZFP6 in regulating trichome development by integrating GA and cytokinin signaling. |
| AT1G67030 | Encodes a novel C2H2 zinc finger protein containing only a single zinc finger which plays a key role in regulating trichome development by integrating GA and cytokinin signaling. The mRNA is cell-to-cell mobile. |
| AT1G05300 | member of Fe(II) transporter isolog family |
| AT5G43170 | Encodes zinc finger protein. mRNA levels are elevated in response to high salinity and low temperature. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT4G24470 | ZIM is a putative transcription factor containing an atypical GATA-type zinc-finger motif. |
| AT2G48020 | Encodes a zinc transporter ZIF2. Expression of ZIF2 is regulated by alternative splicing. |
| AT5G59520 | encodes a metal ion transporter whose expression is regulated by copper. |
| AT4G31877 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC. Pri-mRNA coordinates for MIR156c (converted to TAIR10 based on PMID19304749): Chr4: 15415873-15413295 (reverse), length: 2580 bp; exon coordinates: exon 1: 15415873 |