| AT1G01120 | Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis. |
| AT1G01150 | Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
| AT1G01180 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G01190 | cytochrome P450, family 78, subfamily A, polypeptide 8;(source:Araport11) |
| AT1G01380 | ETC1 is involved in trichome and root hair patterning in Arabidopsis. |
| AT1G01390 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G01460 | Type I phosphatidylinositol-4-phosphate 5-kinase, subfamily A. |
| AT1G01480 | a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family, isolated from a flower-specific cDNA library. |
| AT1G01580 | Encodes the low-iron-inducible ferric chelate reductase responsible for reduction of iron at the root surface. It is likely to be the major Fe(III) chelate reductase in Arabidopsis iron metabolism. Coordinately regulated with IRT1, the major transporter responsible for high-affinity iron uptake from the soil, at both transcriptional and posttranscriptional levels. Steady state mRNA levels are regulated by several metals. Its transcription is regulated by FIT1. |
| AT1G01590 | Encodes a ferric-chelate reductase that is expressed at extremely low levels in Fe deficiency-induced seedlings. |
| AT1G01610 | bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly and is functionally redundant with GPAT8. |
| AT1G01630 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G01700 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT1G01750 | actin depolymerizing factor 11;(source:Araport11) |
| AT1G01790 | Encodes a member of the cation/proton antiporters-2 antiporter superfamily, the K efflux antiporter KEA1 that is localized to the chloroplast envelope. |
| AT1G01820 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
| AT1G01960 | Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking. |
| AT1G01980 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
| AT1G02000 | UDP-D-glucuronate 4-epimerase The mRNA is cell-to-cell mobile. |
| AT1G02010 | member of KEULE Gene Family |
| AT1G02080 | Acts as scaffold protein in the CCR4-NOT complex, by interacting with various NOT proteins and CAF1. Essential protein for proper pollen development and germination capacity. |
| AT1G02110 | bZIP domain class transcription factor (DUF630 and DUF632);(source:Araport11) |
| AT1G02390 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT1G02400 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins but not C20 gibberellins. |
| AT1G02405 | proline-rich family protein;(source:Araport11) |
| AT1G02510 | Encodes AtTPK4, a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK4 is targeted to the plasma membrane. In contrast other members of the AtTPK proteins are located in tonoplast. AtTPK4 forms a voltage-independent K+ channel that is blocked by extracellular calcium ions. May form homomeric ion channels in vivo. |
| AT1G02520 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. The mRNA is cell-to-cell mobile. |
| AT1G02540 | hypothetical protein;(source:Araport11) |
| AT1G02570 | transmembrane protein;(source:Araport11) |
| AT1G02630 | Nucleoside transporter family protein;(source:Araport11) |
| AT1G02750 | Drought-responsive family protein;(source:Araport11) |
| AT1G02790 | encodes a exopolygalacturonase. |
| AT1G02860 | Encodes a ubiquitin E3 ligase with RING and SPX domains that is involved in mediating immune responses and mediates degradation of PHT1s at plasma membranes. Targeted by MIR827. Ubiquitinates PHT1;3, PHT1;2, PHT1;1/AtPT1 and PHT1;4/AtPT2. |
| AT1G02950 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G02980 | encodes an Arabidopsis cullin |
| AT1G02990 | hypothetical protein;(source:Araport11) |
| AT1G03010 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT1G03020 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
| AT1G03050 | Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane. |
| AT1G03170 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
| AT1G03300 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
| AT1G03390 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G03440 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G03490 | NAC domain containing protein 6;(source:Araport11) |
| AT1G03580 | pseudogene of MATH domain/coiled-coil protein;(source:Araport11) |
| AT1G03660 | Ankyrin-repeat containing protein;(source:Araport11) |
| AT1G03710 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT1G03850 | Encodes glutaredoxin ATGRXS13, required to facilitate Botrytis cinerea infection of Arabidopsis thaliana plants. Sylvain La Camera et al (2011, PMID:21756272) reported a third splice variant in addition to the two annotated in TAIR10. It is a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT1G03930 | Phosphorylates serine, threonine, and tyrosine |
| AT1G04000 | hypothetical protein;(source:Araport11) |
| AT1G04090 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
| AT1G04180 | YUCCA 9;(source:Araport11) |
| AT1G04230 | rRNA-processing EFG1-like protein (DUF2361);(source:Araport11) |
| AT1G04360 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G04450 | Encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). It interacts with Rop1 and is involved in pollen tube growth and function, and exocytosis in the pollen tube tip. The protein most similar to RIC1 (family subgroup III). Gene is expressed predominantly in inflorescence and flower tissue. Interacts with ROP1 to modulate calcium ion influxes required to generate tip-focused calcium gradients.It |
| AT1G04457 | Pseudogene of AT2G33450; 50S ribosomal protein L28, chloroplast (CL28) |
| AT1G04470 | hypothetical protein (DUF810);(source:Araport11) |
| AT1G04500 | CCT motif family protein;(source:Araport11) |
| AT1G04680 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G04710 | EC2.3.1.16 thiolase. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT1G04870 | Encodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts. |
| AT1G04910 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G04920 | Encodes a sucrose-phosphate synthase whose activity is stimulated by Glc-6-P and inhibited by Pi. |
| AT1G05020 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT1G05060 | coiled-coil protein;(source:Araport11) |
| AT1G05170 | Galactosyltransferase family protein;(source:Araport11) |
| AT1G05220 | Transmembrane protein 97, Putative;(source:Araport11) |
| AT1G05320 | myosin heavy chain, embryonic smooth protein;(source:Araport11) |
| AT1G05330 | hypothetical protein;(source:Araport11) |
| AT1G05360 | KMS2 encode a endoplasmic reticulum protein involved in the early secretory pathway. |
| AT1G05510 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT1G05560 | A UDP-glucose transferase localized in the phragmoplast. It has been co-purified with the callose synthase complex and may transfer UDP-glucose from sucrose synthase to the callose synthase and thus help form a substrate channel for the synthesis of callose at the forming cell plate. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. UGT1 encodes a protein with glucosyltransferase activity with high sequence homology to UGT2 (AT1G05530). It belongs to an UGT subfamily that binds UDP-glucose but not UDP-glucuronate, UDP-galactose, or UDP-rhamnose as the glycosyl donor. UGT1 was shown to be able to use abscisic acid as glycosylation substrate in the presence of UDP-glucose. UGT1/UGT75B1 catalyzes the formation of the p-aminobenzoate-glucose ester in vitro and in vivo. It appears to be the enzyme predominantly responsible for pABA-Glc formation in Arabidopsis based on assays in leaves, flowers, and siliques. |
| AT1G05577 | SOK1 is a DUF966 domain containing protein. It is expressed during embryogenesis in the apical-lateral plasma membrane. SOK1 can form homodimers and it's polar localization of SOK1 depends on N terminal domains within the protein. Misexpression of SOK1 or delocalization alters cell division planes. |
| AT1G05610 | Encodes the small subunit of ADP-glucose pyrophosphorylase. The small subunit is the catalytic isoform responsible for ADP-glucose pyrophosphorylase activity. The presence of the small subunit is required for large subunit stability. Two isoforms of the small subunit (ApS1 and ApS2) have been described. ApS2 is a minor small subunit isoform present in all plant tissues tested. |
| AT1G05680 | Encodes a UDP-glucosyltransferase, UGT74E2, that acts on IBA (indole-3-butyric acid) and affects auxin homeostasis. The transcript and protein levels of this enzyme are strongly induced by H2O2 and may allow integration of ROS (reactive oxygen species) and auxin signaling. This enzyme can also transfer glycosyl groups to several compounds related to the explosive TNT when this synthetic compound is taken up from the environment. |
| AT1G05700 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT1G05750 | Encodes a pentatricopeptide repeat protein required for editing of rpoA and clpP chloroplast transcripts. |
| AT1G05800 | Encodes a galactolipase. Located in the chloroplast. Involved in the initial step of jasmonic acid biosynthesis. Expressed in vegetative tissues and is necessary for the biosynthesis of basal-level JAs in vegetative tissues. |
| AT1G05820 | SIGNAL PEPTIDE PEPTIDASE-LIKE 5;(source:Araport11) |
| AT1G05880 | Encodes ARI12 (ARIADNE 12). ARI12 belongs to a family of `RING between RING fingers' (RBR) domain proteins with E3 ligase activity. Expression of ARI12 is induced by UV-B exposure. |
| AT1G05890 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G05920 | B3 domain protein (DUF313);(source:Araport11) |
| AT1G05960 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G05990 | EF hand calcium-binding protein family;(source:Araport11) |
| AT1G06020 | Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). |
| AT1G06040 | Encodes salt tolerance protein (STO) which confers salt tolerance to yeast cells. Fully complements calcineurin deficient yeast but does not encode a phosphoprotein phosphatase. Sequence has similarities to CONSTANS. STO co-localizes with COP1 and plays a role in light signaling.STO transcript levels are regulated by photoperiod and phtyohormones. STO competes with FLC in the regulation of floral transition genes SOC1 and FT. |
| AT1G06135 | transmembrane protein;(source:Araport11) |
| AT1G06148 | hypothetical protein;(source:Araport11) |
| AT1G06170 | Encodes a bHLH transcription factor that together with bHLH010 and bHLH091 is important for the normal transcriptome of the developing Arabidopsis anther, possibly by forming a feed-forward loop with DYT1. Recognizes the TCATGTGC box to activate the expression of target genes, including ATA20, EXL4, and MEE48. |
| AT1G06190 | Encodes a novel ribonucleic acid-binding protein that interacts with the endonuclease RNase E and supports its function in processing plastid ribonucleic acids. |
| AT1G06340 | Plant Tudor-like protein;(source:Araport11) |
| AT1G06680 | Encodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution. Phosphorylation of this protein is dependent on calcium. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the stroma. The mRNA is cell-to-cell mobile. |
| AT1G06750 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G06780 | Encodes a protein with putative galacturonosyltransferase activity. Required for synthesis of native homogalacturonan in growing pollen tubes; critical role in pollen tube growh and male fertility. |
| AT1G06820 | Encodes carotenoid isomerase. Catalyzes the isomerization of poly-cis-carotenoids to all-trans-carotenoids. Together with PDS and ZDS, CRTiso is required to complete the synthesis of lycopene from phytoene. |
| AT1G06850 | bZIP protein involved in heat stress response. Under heat stress localization moves exclusively to nucleus. |
| AT1G06923 | transcription repressor OFP17-like protein;(source:Araport11) |
| AT1G06970 | member of Putative Na+/H+ antiporter family |
| AT1G06980 | PADRE protein |
| AT1G07000 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT1G07050 | FITNESS encodes a protein with a single CCT domain and belongs to the CCT motif family genes (CMF). FITNESS acts upstream JUB1 thereby controlling H2O2 levels. FITNESS has a role in cellular redox homeostasis controlling H2O2 levels, due to changes in enzymes, metabolites and transcripts related to ROS detoxification. |
| AT1G07120 | CHUP1-like protein;(source:Araport11) |
| AT1G07180 | Internal NAD(P)H dehydrogenase in mitochondria. The predicted protein sequence has high homology with other designated NAD(P)H DHs from microorganisms; the capacity for matrix NAD(P)H oxidation via the rotenone-insensitive pathway is significantly reduced in the Atndi1 mutant plant line; the in vitro translation product of AtNDI1 is imported into isolated mitochondria and located on the inside of the inner membrane. |
| AT1G07190 | Lon protease;(source:Araport11) |
| AT1G07250 | UDP-glucosyl transferase 71C4;(source:Araport11) |
| AT1G07340 | sugar transporter 2;(source:Araport11) |
| AT1G07420 | Arabidopsis thaliana sterol 4-alpha-methyl-oxidase mRNA. The sterol 4alpha-methyl oxidase2 family proteins SMO2-1 and SMO2-2 function partially through effects on auxin accumulation, auxin response and PIN1 expression to regulate embryogenesis in Arabidopsis. |
| AT1G07530 | Encodes a member of the GRAS family of transcription factors. The protein interacts with the TGA2 transcription factor and affects the transcription of stress-responsive genes. The protein is found in the nucleus and is also exported to the cytoplasm. |
| AT1G07540 | Arabidopsis thaliana telomere-binding protein, putative (At1g07540) |
| AT1G07640 | A member of the DOF transcription factors. Prominently expressed in the phloem of leaves and other organs. Expression is induced by wounding, MeJA and insect feeding. Upregulates glucosinolate biosynthesis. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT1G07850 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT1G07960 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. |
| AT1G08140 | member of Putative Na+/H+ antiporter family |
| AT1G08500 | early nodulin-like protein 18;(source:Araport11) |
| AT1G08600 | The Arabidopsis ATRX harbours a N-terminal ADD domain and a C-terminal helicase domain and is devoid of the large central region involved in DAXX interaction in mammals. Arabidopsis ATRX mutant alleles are viable, but with reduced fertility. Their combination with mutants for the H3.3 chaperone HIRA impairs plant survival. ATRX loss affects cellular histone H3.3 pools and modulates the H3.1/H3.3 balance. Notably, at a genome-wide scale, loss of ATRX leads to a reduced H3.3 level at genes characterized by elevated H3.3 occupancy and high expression, including the 45S ribosomal DNA (45S rDNA) loci. Indeed, expression of specific 45S rDNA sequence variants is altered by ATRX loss (DOI:10.1105/tpc.16.00877) |
| AT1G08630 | Encodes a threonine aldolase, involved in threonine degradation to glycine. Primarily expressed in seeds and seedlings. |
| AT1G08640 | Encodes a choloroplast membrane protein CJD1 (Chloroplast J-like Domain 1). Predicted to contain a transit peptide, three transmembrane domains and an N-terminal J-like domain. Influences fatty acid composition of chloroplast lipids. |
| AT1G08790 | 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase epsilon-1, putative (DUF1685);(source:Araport11) |
| AT1G09080 | Heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
| AT1G09110 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
| AT1G09155 | phloem protein 2-B15;(source:Araport11) |
| AT1G09170 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
| AT1G09370 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G09380 | nodulin MtN21-like transporter family protein |
| AT1G09400 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
| AT1G09410 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT1G09540 | Encodes putative transcription factor. Mutants lack of mucilage extrusion from the seeds during imbibition. Reduced quantities of mucilage are deposited during the development of the seed coat epidermis in myb61 mutants. Expressed in guard cells,loss of function mutations show an increase in stomatal pore opening suggesting a role in ABA independent regulation of stomatal pore size. |
| AT1G09640 | Translation elongation factor EF1B, gamma chain;(source:Araport11) |
| AT1G09645 | transmembrane protein;(source:Araport11) |
| AT1G09680 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G09710 | Paralog of DRMY1 with unknown function. |
| AT1G09812 | multidrug resistance protein;(source:Araport11) |
| AT1G09890 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
| AT1G09940 | Encodes glutamyl-tRNA reductase. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins |
| AT1G10060 | encodes a mitochondrial branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. |
| AT1G10070 | Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. Involved in cell wall development. |
| AT1G10090 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT1G10130 | Encodes a golgi localized P2A-type Ca2+ ATPase involved in Mn nutrition and homeostasis. |
| AT1G10220 | ZCF37;(source:Araport11) |
| AT1G10340 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G10385 | Vps51/Vps67 family (components of vesicular transport) protein;(source:Araport11) |
| AT1G10417 | Encodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens. |
| AT1G10620 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G10640 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G10680 | P-glycoprotein 10;(source:Araport11) |
| AT1G10790 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G10810 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT1G10890 | arginine/glutamate-rich 1 protein;(source:Araport11) |
| AT1G11030 | pre-tRNA tRNA-Arg (anticodon: TCG);(source:Araport11, TAIR10) |
| AT1G11160 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
| AT1G11250 | member of SYP12 Gene Family |
| AT1G11390 | Atypical kinase which functions in plant salt stress tolerance by regulating reactive oxygen species (ROS). |
| AT1G11410 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G11440 | hypothetical protein;(source:Araport11) |
| AT1G11482 | pseudogene of hypothetical protein (DUF295);(source:Araport11) |
| AT1G11570 | NTF2-like protein;(source:Araport11) |
| AT1G11608 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G11620 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G11670 | MATE efflux family protein;(source:Araport11) |
| AT1G11690 | BRANCHLESS TRICHOME-like protein;(source:Araport11) |
| AT1G11770 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
| AT1G11860 | T-protein is the aminomethyltransferase of the glycine cleavage multienzyme system GCS. |
| AT1G11915 | wall-associated receptor kinase galacturonan-binding protein;(source:Araport11) |
| AT1G11930 | Putative pyridoxal phosphate-dependent enzyme, YBL036C type;(source:Araport11) |
| AT1G11990 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G12090 | extensin-like protein (ELP) |
| AT1G12150 | weak chloroplast movement under blue light protein (DUF827);(source:Araport11) |
| AT1G12240 | Encodes a vacuolar invertase betaFruct4. betaFruct4 is transported from the endoplasmic reticulum through the intermediate compartments as a membrane protein. The N-terminal cytoplasmic domain contains multiple sequence motifs that are involved at various stages in the trafficking of betaFruct4 from the ER to the central vacuole. The mRNA is cell-to-cell mobile. |
| AT1G12244 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G12250 | Pentapeptide repeat-containing protein;(source:Araport11) |
| AT1G12260 | Encodes a NAC-domain transcription factor that is expressed in developing xylem. Over expression of this protein causes ectopic secondary cell wall growth. Complements some of the cell wall defects seen in SND1/NST1 double mutants. |
| AT1G12320 | ankyrin repeat/KH domain protein (DUF1442);(source:Araport11) |
| AT1G12460 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G12725 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G28570.1);(source:TAIR10) |
| AT1G12740 | encodes a protein with cytochrome P450 domain |
| AT1G12855 | F-box family protein;(source:Araport11) |
| AT1G12870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G13070 | putative cytochrome P450 |
| AT1G13090 | putative cytochrome P450 |
| AT1G13100 | putative cytochrome P450 |
| AT1G13110 | member of CYP71B The mRNA is cell-to-cell mobile. |
| AT1G13140 | member of CYP86C |
| AT1G13200 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G13230 | Encodes a leucine-rich repeat protein pii-2. Located in the endoplasmic reticulum/plasma membrane continuum in Arabidopsis roots. Required for growth promotion and enhanced seed production mediated by the endophytic fungus Piriformospora indica in Arabidopsis. |
| AT1G13260 | Encodes an AP2/B3 domain transcription factor which is upregulated in response to low temperature. It contains a B3 DNA binding domain. It has circadian regulation and may function as a negative growth regulator. The mRNA is cell-to-cell mobile. |
| AT1G13310 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT1G13430 | Encodes a sulfotransferase. Unlike the related ST4A protein (At2g14920), in vitro experiements show that this enzyme does not act brassinosteroids. ST4C is expressed in the roots and transcript levels rise in response to cytokinin treatment. |
| AT1G13485 | hypothetical protein;(source:Araport11) |
| AT1G13520 | hypothetical protein (DUF1262);(source:Araport11) |
| AT1G13640 | Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11) |
| AT1G13670 | hypothetical protein;(source:Araport11) |
| AT1G13700 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
| AT1G13730 | Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein;(source:Araport11) |
| AT1G13740 | Encodes a member of a small plant-specific gene family whose members interact with ABI5 and appear to be involved in mediating stress responses. AFP2 mutants affect a number of ABA mediated processes such as germination and response to osmotic and sugar stress. AFP2 nuclear localization is stress dependent. |
| AT1G13860 | Encodes QUASIMODO2 LIKE1 (QUL1), a paralog of QUASIMODO2 (QUA2). AT1G78240 (QUA2), AT1G13860 (QUL1) and AT2G03480 (QUL2) form a clade with a possible role in plant vasculature development. |
| AT1G13920 | Remorin family protein;(source:Araport11) |
| AT1G13970 | beta-hexosaminidase (DUF1336);(source:Araport11) |
| AT1G14070 | member of Xyloglucan fucosyltransferase family |
| AT1G14071 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCUUCUCCAAAUAGUUUAGGUU |
| AT1G14100 | member of Glycosyltransferase Family- 37. FUT8 was previously associated to AT1G14110 |
| AT1G14160 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT1G14190 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT1G14210 | Ribonuclease T2 family protein;(source:Araport11) |
| AT1G14250 | GDA1/CD39 nucleoside phosphatase family protein;(source:Araport11) |
| AT1G14280 | Encodes phytochrome kinase substrate 2. PKS proteins are critical for hypocotyl phototropism. Forms a complex with Phot1, Phot2 and NPH3. |
| AT1G14315 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G14340 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
| AT1G14390 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G14410 | Encodes a homolog of the potato p24 protein. Binds single strand telomeric repeats. Negatively regulates telomerase activity and telomere length. |
| AT1G14420 | Pectate lyase family protein;(source:Araport11) |
| AT1G14500 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G14510 | Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7). |
| AT1G14530 | tobamovirus multiplication-like protein (DUF1084);(source:Araport11) |
| AT1G14580 | C2H2-like zinc finger protein;(source:Araport11) |
| AT1G14686 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT1G14688 | E3 ubiquitin ligase;(source:Araport11) |
| AT1G14700 | purple acid phosphatase 3;(source:Araport11) |
| AT1G14710 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G14740 | Encodes a PHD-finger protein that, with TTA1, is redundantly required for MP-dependent embryonic root meristem initiation. |
| AT1G14780 | MAC/Perforin domain-containing protein;(source:Araport11) |
| AT1G15200 | protein-protein interaction regulator family protein;(source:Araport11) |
| AT1G15210 | pleiotropic drug resistance 7;(source:Araport11) |
| AT1G15520 | ABC transporter family involved in ABA transport and resistance to lead. Localizes to plasma membrane. Upregulated by lead. Expressed in leaves, flowers, stomata and roots. |
| AT1G15530 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT1G15590 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT1G15990 | Encodes a plasma membrane localized member of the cyclic nucleotide gated channel (CNGC) family that is essential for male reproductive fertility. |
| AT1G16320 | plant/protein (DUF2358);(source:Araport11) |
| AT1G16330 | core cell cycle genes |
| AT1G16370 | organic cation/carnitine transporter 6;(source:Araport11) |
| AT1G16380 | member of Putative Na+/H+ antiporter family |
| AT1G16420 | Encodes a metacaspase (cysteine-type endopeptidase) that is involved in promoting programmed cell death in response to hydrogen peroxide (H2O2), UV light, and methyl viologen (MV). Transcript levels rise in response to UV-C, H2O2, and MV. In vitro assays demonstrate that this enzyme has a preference for cleaving after an arginine residue, and it has a pH optimum of 8.0. |
| AT1G16440 | Member of AGC VIIIa Kinase gene family. Invovled in the maintenance of (p)ppGpp level to accustom plastidial gene expression to darkness. |
| AT1G16530 | ASYMMETRIC LEAVES 2-like 9;(source:Araport11) |
| AT1G16740 | Ribosomal protein L20;(source:Araport11) |
| AT1G16760 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT1G16770 | hypothetical protein;(source:Araport11) |
| AT1G16860 | Plasma membrane-localized proteins that negatively regulate cellulose synthesis by inhibiting the exocytosis of CESAs. |
| AT1G16900 | Encodes the Arabidopsis ortholog of the yeast/human ALG9 catalyzing the luminal addition of two alpha-1,2 Man residues in assembling Glc3Man9GlcNAc2. |
| AT1G16905 | Curculin-like (mannose-binding) lectin family protein;(source:Araport11) |
| AT1G16950 | transmembrane protein;(source:Araport11) |
| AT1G17000 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active but no trehalose phosphatase (TPP)-like domain. |
| AT1G17010 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G17020 | Encodes a novel member of the Fe(II)/ascorbate oxidase gene family; senescence-related gene. |
| AT1G17170 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). It is involved in the detoxification of the environmental pollutant 2,4,6-trinitrotoluene. Arabidopsis plants over-expressing At1g17170 were more resistant to TNT, removed more TNT from sterile and soil-based media, and had reduced levels of glutathione when grown in the presence of TNT. |
| AT1G17180 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). Detoxification of the environmental pollutant 2,4,6-trinitrotoluene. Arabidopsis plant over-expressing At1g17180 were more resistant to TNT, removed more TNT from sterile and soil-based media, and had reduced levels of glutathione when grown in the presence of TNT. |
| AT1G17270 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G17310 | MADS-box transcription factor family protein;(source:Araport11) |
| AT1G17340 | Phosphoinositide phosphatase family protein;(source:Araport11) |
| AT1G17345 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G17400 | Protein of unknown function. Similar to LAZY1, a gene required or gravitropic response in shoots and roots. Involved in determining lateral root branch angle. |
| AT1G17480 | Transient expression of Pro35S:GFP-IQD7 in leaves of N. benthamiana alters microtubule organization, in patterns similar to Pro35S:GFP-IQD8 and Pro35S:GFP-IQD6.Member of IQ67 (CaM binding) domain containing family. |
| AT1G17495 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-213 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G17580 | Encodes a member of the type XI myosin protein family involved in organelle trafficking and overall plant development. |
| AT1G17590 | Binds directly to CCAAT cis-elements in the promoters of multiple MIR156 genes and inhibits the juvenile-to adult transition by activating transcription of these MIR156s. |
| AT1G17620 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G17700 | prenylated RAB acceptor 1.F1;(source:Araport11) |
| AT1G17780 | ATG8A/F interacting protein containing a WxxL LIR motif at the C terminus which is essential for interaction with ATG8. Stress (abiotic or biotic) results in the formation of ATG8- and ATI3-labeled punctate structures, likely reflecting increased formation of ATG8-labeled phagophores or autophagosomes. ATI3 proteins probably act as selective autophagy receptors that target specific cellular components during the plant stress response. ATI3 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
| AT1G17840 | Encodes a plasma membrane-localized ATP-binding cassette transporter, that is required for cutin transport to the extracellular matrix. The mRNA is cell-to-cell mobile. |
| AT1G17910 | Wall-associated kinase family protein;(source:Araport11) |
| AT1G17960 | Threonyl-tRNA synthetase;(source:Araport11) |
| AT1G18060 | localized to chloroplasts |
| AT1G18191 | Pseudogene of AT1G18200; AtRABA6b (Arabidopsis Rab GTPase homolog A6b); GTP binding |
| AT1G18265 | zein-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT1G18300 | nudix hydrolase homolog 4;(source:Araport11) |
| AT1G18350 | MAP kinase kinase7. Member of plant mitogen-activated protein kinase kinase group D. Negative regulator of polar auxin transport. Overexpression leads to activation of basal and systemic acquired resistance. |
| AT1G18382 | Natural antisense transcript overlaps with AT1G18380;(source:Araport11) |
| AT1G18420 | Involved in malate efflux response to P-deficiency in root hairs. |
| AT1G18470 | Putative C3HC4 zinc-finger ubiquitin E3 ligase that is induced by ABA and plays a positive role in ABA signaling. |
| AT1G18540 | Ribosomal protein L6 family protein;(source:Araport11) |
| AT1G18670 | Encodes a cyclin-dependent kinase-like protein with a ser/thr protein kinase domain and an N-terminal myristoylation sequence. Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. |
| AT1G18790 | RWP-RK domain-containing protein;(source:Araport11) |
| AT1G18835 | Encodes a small zinc finger protein whose overexpression induces ectopic meristem formation on leaf margins. |
| AT1G18860 | member of WRKY Transcription Factor; Group II-b |
| AT1G18871 | hypothetical protein;(source:Araport11) |
| AT1G18900 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G18960 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
| AT1G18970 | Encodes a germin-like protein with possible oxalate oxidase activity (based on GenBank record). |
| AT1G19040 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT1G19086 | hypothetical protein;(source:Araport11) |
| AT1G19160 | F-box family protein;(source:Araport11) |
| AT1G19200 | cyclin-dependent kinase, putative (DUF581);(source:Araport11) |
| AT1G19250 | FMO1 is required for full expression of TIR-NB-LRR conditioned resistance to avirulent pathogens and for basal resistance to invasive virulent pathogens. Functions in an EDS1-regulated but SA-independent mechanism that promotes resistance and cell death at pathogen infection sites. FMO1 functions as a pipecolate N-hydroxylase and catalyzes the biochemical conversion of pipecolic acid to N-hydroxypipecolic acid (NHP). NHP systemically accumulates in the plant foliage and induces systemic acquired resistance to pathogen infection. |
| AT1G19390 | Wall-associated kinase family protein;(source:Araport11) |
| AT1G19530 | Direct target of RGA, plays an essential role in GA-mediated tapetum and pollen development. |
| AT1G19630 | cytochrome P450, family 722, subfamily A, polypeptide 1;(source:Araport11) |
| AT1G19690 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G19780 | Encodes a member of the cyclic nucleotide gated channel (CNGC) family that is essential for male reproductive fertility. |
| AT1G19835 | TCS1 encodes a coiled-coil domain protein that binds to microtubules and co-localizes with the cortical microtubules. Mutants have defects in trichome branching and hypocotyl elongation. TCS1 interacts with ZWI and appears to be involved in microtubule assembly. |
| AT1G20180 | transmembrane protein (DUF677);(source:Araport11) |
| AT1G20190 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT1G20240 | SWI-SNF-related chromatin binding protein;(source:Araport11) |
| AT1G20280 | homeobox-leucine zipper protein-like protein;(source:Araport11) |
| AT1G20320 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G20350 | mitochondrial inner membrane translocase |
| AT1G20360 | F-box family protein;(source:Araport11) |
| AT1G20440 | Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. Cold regulated gene, amino acid sequence homology with Group II LEA (late embryogenesis abundant) proteins. Also responds to osmotic stress, ABA, dehydration and inhibits e.coli growth while overexpressed. COR47 and RAB18 double overexpressor plants are cold tolerant. Regulated by heat shock. |
| AT1G20500 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G20520 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT1G20670 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
| AT1G20735 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G20740 | transport/golgi organization-like protein (DUF833);(source:Araport11) |
| AT1G20750 | RAD3-like DNA-binding helicase protein;(source:Araport11) |
| AT1G20790 | F-box family protein;(source:Araport11) |
| AT1G20795 | F-box family protein;(source:Araport11) |
| AT1G20800 | F-box family protein |
| AT1G20830 | Encodes MCD1 (MULTIPLE CHLOROPLAST DIVISION SITE 1). Determines the site of chloroplast division in concert with MinD (AT5G24020). |
| AT1G20850 | Cysteine peptidase. Enzyme activity detected in leaf. |
| AT1G20920 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G20940 | F-box family protein;(source:Araport11) |
| AT1G21050 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT1G21130 | O-methyltransferase family protein;(source:Araport11) |
| AT1G21330 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G40680.1);(source:TAIR10) |
| AT1G21350 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G21430 | Flavin-binding monooxygenase family protein;(source:Araport11) |
| AT1G21470 | hypothetical protein;(source:Araport11) |
| AT1G21480 | Exostosin family protein;(source:Araport11) |
| AT1G21528 | hypothetical protein;(source:Araport11) |
| AT1G21620 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G21640 | Encodes a protein with NAD kinase activity. The protein was also shown to bind calmodulin. |
| AT1G21850 | SKU5 similar 8;(source:Araport11) |
| AT1G21910 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT1G21990 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G22050 | membrane-anchored ubiquitin-fold protein 6 precursor;(source:Araport11) |
| AT1G22090 | hypothetical protein;(source:Araport11) |
| AT1G22100 | Inositol-pentakisphosphate 2-kinase family protein;(source:Araport11) |
| AT1G22150 | sulfate transporter Sultr1;3 |
| AT1G22160 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT1G22180 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G22210 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G22240 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G22290 | 14-3-3 family protein;(source:Araport11) |
| AT1G22400 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G22420 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G22510 | E3 ubiquitin-protein ligase RNF170-like protein (DUF 1232);(source:Araport11) |
| AT1G22550 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
| AT1G22570 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G22650 | Plant neutral invertase family protein;(source:Araport11) |
| AT1G22760 | Putative poly(A) binding protein May there fore function in posttranscriptional regulation, including mRNA turnover and translational initiation. Expression detected only in floral organs. |
| AT1G22940 | Encodes a bifunctional enzyme required for thiamine (vitamin B1) biosynthesis. TH1 can phosphorylate HMP-P to produce HMP-PP, the pyrimidine heterocyclic subunit of thiamine. TH1 also catalyzes the condensation of HMP-PP and HET to form thiamine monophosphate (TMP). TH1 also appears capable of phosphorylating HMP based on E.coli mutant complementation assays. th1 mutants are thiamine auxotrophs that die as seedlings on unsupplemented media. |
| AT1G23020 | Encodes a ferric chelate reductase whose transcription is regulated by FIT1. Expressed in the root, shoot, flower and cotyledon. |
| AT1G23037 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G23040 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G23090 | Encodes AST91 mRNA for sulfate transporter. |
| AT1G23150 | hypothetical protein;(source:Araport11) |
| AT1G23190 | Encodes a cytosolic phosphoglucomutase (PGM). Two Arabidopsis PGM proteins (AT1G70730/PGM2 and AT1G23190/PGM3) have high sequence similarities and redundant functions. Mature plants possessing a single cPGM allele had a major reduction in cPGM activity. Whereas pgm2 and pgm3 single mutants are undistinguishable from the wild type, loss of both PGM2 and PGM3 severely impairs male and female gametophyte development. The mRNA is cell-to-cell mobile. |
| AT1G23200 | ProPME pectin methyl esterase involved in embryo development. |
| AT1G23205 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G23300 | MATE efflux family protein;(source:Araport11) |
| AT1G23380 | homeodomain transcription factor KNAT6, belonging to class I of KN transcription factor family (which also includes KNAT1 and KNAT2). Expression is increased in as and bop1 leaf mutants. |
| AT1G23390 | A kelch domain-containing F-box protein. Its N terminus contains a typical F-box motif but its C-terminal domain only consists of one predicted kelch motif. Predicted to be stu Interacts with chalcone synthase CHS to mediate CHS ubiquitination and degradation. |
| AT1G23450 | pentatricopeptide (PPR) repeat-containing protein |
| AT1G23510 | OBP32pep protein;(source:Araport11) |
| AT1G23520 | hypothetical protein (DUF220);(source:Araport11) |
| AT1G23550 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Its transcript level is up-regulated by tunicamycin (N-linked glycosylation inhibitor causing ER stress). |
| AT1G23560 | OBP32pep, putative (DUF220);(source:Araport11) |
| AT1G23640 | OBP32pep protein;(source:Araport11) |
| AT1G23690 | hypothetical protein (Domain of unknown function DUF220);(source:Araport11) |
| AT1G23710 | hypothetical protein (DUF1645);(source:Araport11) |
| AT1G23730 | beta carbonic anhydrase 3;(source:Araport11) |
| AT1G23740 | AOR is an alkenal/one oxidoreductase that acts on compounds with unsaturated alpha,beta-carbonyls. The activity of this enzyme with a number of substrates, including acrolein and 3-buten-2-one, was demonstrated in vitro using a truncated form of the protein that lacked approximately 80 of the first amino acids. This protein appears to localize to the chloroplast where it likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation. |
| AT1G23760 | Encodes aromatic rich glycoprotein JP630. |
| AT1G23790 | dicer-like protein (DUF936);(source:Araport11) |
| AT1G24030 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G24068 | other_RNA;(source:Araport11) |
| AT1G24095 | Putative thiol-disulfide oxidoreductase DCC;(source:Araport11) |
| AT1G24110 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G24150 | Encodes a group I formin. Localized to cell junctions. Polymerizes actin. Binds profilin. Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. FORMIN4 is a spatial feedback element in a multi-layered, temporally defined sequence of cytoskeletal response, contributing to the distribution of actin filaments at the dynamic cell wall appositions boundary and to the outcomes of pre-invasion defense. |
| AT1G24212 | pseudogene of paired amphipathic helix repeat-containing protein |
| AT1G24220 | paired amphipathic helix repeat-containing protein;(source:Araport11) |
| AT1G24256 | hypothetical protein;(source:Araport11) |
| AT1G24270 | hypothetical protein;(source:Araport11) |
| AT1G24400 | High-affinity transporter for neutral and acidic amino acids, expressed in tapetum tissue of anthers. Transport of 1-Aminocyclopropane-1-carboxylic acid (ACC). |
| AT1G24405 | hypothetical protein;(source:Araport11) |
| AT1G24420 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G24430 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G24540 | member of CYP86C |
| AT1G24577 | hypothetical protein;(source:Araport11) |
| AT1G24580 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G24590 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and LEAFY PETIOLE. This gene functions in the regeneration of shoots in tissue culture, probably through transcriptional regulation of CUC1. May also be involved in activation of the cell cycle via CycD1;1. |
| AT1G24650 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G25300 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT1G25310 | basic helix-loop-helix (bHLH) DNA-binding family protein;(source:Araport11) |
| AT1G25370 | hypothetical protein (DUF1639);(source:Araport11) |
| AT1G25450 | Encodes KCS5, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G25530 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT1G25550 | Member of HHO/HRS GARP type transcriptional repressor family. Involved in Pi uptake and Pi starvation signaling. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
| AT1G25560 | Encodes a member of the RAV transcription factor family that contains AP2 and B3 binding domains. Involved in the regulation of flowering under long days. Loss of function results in early flowering. Overexpression causes late flowering and repression of expression of FT. Novel transcriptional regulator involved in ethylene signaling. Promoter bound by EIN3. EDF1 in turn, binds to promoter elements in ethylene responsive genes. |
| AT1G26110 | Encodes Decapping 5, required for mRNA decapping, P-body formation and translational repression during postembryonic development. |
| AT1G26140 | hypothetical protein;(source:Araport11) |
| AT1G26200 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT1G26290 | hypothetical protein;(source:Araport11) |
| AT1G26350 | hypothetical protein;(source:Araport11) |
| AT1G26380 | Functions in the biosynthesis of 4-hydroxy indole-3-carbonyl nitrile (4-OH-ICN), a cyanogenic phytoalexin in Arabidopsis. FOX1 acts as a dehydrogenase on indole cyanohydrin to form indole carbonyl nitrile. |
| AT1G26390 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G26410 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G26420 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G26570 | UDP-glucose dehydrogenase 1;(source:Araport11) |
| AT1G26590 | C2H2-like zinc finger protein;(source:Araport11) |
| AT1G26640 | Encodes a cytosolic isopentenyl phosphate kinase that plays an important role in regulating the formation of both MVA (mevalonic acid) and MEP (methylerythritol phosphate) pathway-derived terpenoid compounds by controlling the ratio of IP/DMAP to IPP/DMAPP. IPP and DMAPP are the universal C5 building blocks of all natural terpenoids. IPK enhances terpenoid formation by returning IP/DMAP to the terpenoid biosynthetic network. |
| AT1G26680 | transcriptional factor B3 family protein;(source:Araport11) |
| AT1G26690 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT1G26730 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT1G26760 | SET domain protein 35;(source:Araport11) |
| AT1G26770 | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT1G26790 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
| AT1G26797 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT1G26800 | MPSR1 is cytoplasmic E3 ligase that senses misfolded proteins independently of chaperones and targets those proteins for degradation via the 26S proteasome. Involved in the regulation of the homeostasis of sensor NLR immune receptors. |
| AT1G26850 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G26870 | NAC-domain protein. Expressed in root cap stem cells, where it promotes periclinal root cap-forming divisions. Involved in a regulatory feedback loop with SMB. FEZ activates SMB in hte root cap daughter cells soon after division, and SMB in turn represses FEZ expression in these cells, thereby preventing further stem cell divisions. |
| AT1G26911 | Pseudogene of AT1G66590; cox19 family protein |
| AT1G26970 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G27000 | GRIP/coiled-coil protein, putative (DUF1664);(source:Araport11) |
| AT1G27050 | Encodes a protein with a RNA recognition motif. Previously annotated as ATHB54, a homeodomain leucine zipper (HD-Zip) family protein. In the TAIR10 genome release (2010), this locus was split into two loci: AT1G27045 (containing homeodomain and leucine zipper domains) and AT1G27050 (containing a RNA recognition motif). AT1G27045 is now named ATHB54. Note that Affymetrix ATH1 Probe Set linked to symbol ATHB54 is in fact directed against the product of the AT1G27050 locus (the mRNA coding for the RNA-recognition-motif protein). |
| AT1G27080 | Encodes a protein with low-affinity nitrate transporter activity that is expressed in the vascular tissue of the funiculus and the silique. This plasma membrane-localized enzyme is predicted to have 12 transmembrane domains. Plants lacking NRT1.6 have reduced levels of nitrate in their seeds and have increased levels of early embryonic developmental defects and seed abortion. |
| AT1G27180 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT1G27260 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT1G27270 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT1G27290 | transmembrane protein;(source:Araport11) |
| AT1G27380 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Interacts with Rop1 and is involved in pollen tube growth and function. Protein most similar to RIC4 (family subgroup V). Gene is expressed in all tissues examined. |
| AT1G27385 | phosphoribosylformylglycinamidine synthase;(source:Araport11) |
| AT1G27461 | Nuclear localized protein involved in osmotic stress tolerance. |
| AT1G27680 | ADP-glucose pyrophosphorylase catalyzes the first, rate limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms of the large subunit (ApL1-4) have been described.Mutational analysis of APS1 suggests that APL1 and APL2 can compensate for loss of APS1 catalytic activity,suggesting both have catalytic as well as regulatory functions. The mRNA is cell-to-cell mobile. |
| AT1G27690 | lipase, putative (DUF620);(source:Araport11) |
| AT1G27890 | Deadenylase. |
| AT1G27910 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT1G27930 | Arabinogalactan methylesterase,involved in arabinogalactan glucuronic acid methylation. Interacts with eIF3. |
| AT1G27940 | P-glycoprotein 13;(source:Araport11) |
| AT1G28000 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G28010 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
| AT1G28020 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G28180 | DEAD-box ATP-dependent RNA helicase-like protein;(source:Araport11) |
| AT1G28220 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G28230 | Encodes a transporter that transports purines,cytokinins and other adenine derivatives. Expressed in the leaf hydathodes where it may be involved in re-uptake of cytokinins during guttation. |
| AT1G28300 | Transcription factor that contains a B3 domain, a DNA-binding motif unique to plants and characteristic of several transcription factors. Plays critical roles both early and late during embryo development. LEC2 RNA accumulates primarily during seed development. LEC2 is required for the maintenance of suspensor morphology, specification of cotyledon identity, progression through the maturation phase, and suppression of premature germination. It establishes a cellular environment sufficient to initiate embryo development - ectopic, postembryonic expression of LEC2 in transgenic plants induces the formation of somatic embryos and other organ-like structures and often confers embryonic characteristics to seedlings and to reproductive and vegetative organs of mature plants. |
| AT1G28323 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.9e-140 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT1G28470 | NAC domain containing protein 10;(source:Araport11) |
| AT1G28570 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT1G28580 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G28591 | Pseudogene of AT1G28610; GDSL-motif lipase, putative |
| AT1G28600 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G28610 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G28640 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G28650 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G28660 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G28670 | Arabidopsis thaliana lipase |
| AT1G28685 | Natural antisense transcript overlaps with AT1G28680;(source:Araport11) |
| AT1G29010 | verprolin;(source:Araport11) |
| AT1G29020 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G29025 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G29050 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G29100 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G29150 | specifically interacts with FUS6/COP11 via the C-terminal domain of FUS6/COP11 and associates with an ATPase subunit of the 19S proteasome regulatory complex, AtS6A. The mRNA is cell-to-cell mobile. |
| AT1G29160 | Encodes a DOF transcription factor involved in seed coat development. Regulates PRX2 and PRX25, involved in seed longevity. |
| AT1G29280 | member of WRKY Transcription Factor; Group II-e The mRNA is cell-to-cell mobile. |
| AT1G29290 | Group II CEP family member; binds to vascular tissue independently of CEPR1 or CRA2. |
| AT1G29380 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT1G29460 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G29475 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-91 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G29480 | hypothetical protein;(source:Araport11) |
| AT1G29560 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G29570 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G29640 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT1G29650 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-28 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G29660 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G29690 | Encodes a protein containing a domain with significant homology to the MACPF (membrane attack complex and perforin) domain of complements and perforin proteins that are involved in innate immunity in animals. Transgenic cad1-1 mutant plants show lesions seen in the hypersensitive response, as well as a spontaneous activation of expression of pathogenesis-related genes and leading to a 32-fold increase in salicylic acid (SA). CAD1 is postulated to act as a negative regulator controlling SA-mediated pathway of programmed cell death in plant immunity. |
| AT1G29710 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G29715 | pseudogene of Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT1G29740 | Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth. |
| AT1G29870 | tRNA synthetase class II (G, H, P and S) family protein;(source:Araport11) |
| AT1G29920 | Encodes lhcb1.1 a component of the LHCIIb light harvesting complex associated with photosystem II. |
| AT1G29930 | Subunit of light-harvesting complex II (LHCII),which absorbs light and transfers energy to the photosynthetic reaction center. The mRNA is cell-to-cell mobile. |
| AT1G30040 | Encodes a gibberellin 2-oxidase that acts on C-19 gibberellins. AtGA2OX2 expression is responsive to cytokinin and KNOX activities. |
| AT1G30050 | tropomyosin;(source:Araport11) |
| AT1G30080 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT1G30130 | DUF1365 family protein;(source:Araport11) |
| AT1G30150 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 2.2e-24 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
| AT1G30180 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.5e-115 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G30190 | cotton fiber protein;(source:Araport11) |
| AT1G30270 | Arabidopsis thaliana CBL-interacting protein kinase 23. CIPK23 serves as a positive regulator of the potassium transporter AKT1 by directly phosphorylating AKT1. CIPK23 is activated by the binding of two calcineurin B-like proteins, CBL1 and CBL9. The mRNA is cell-to-cell mobile. |
| AT1G30350 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G30370 | Encodes a mitochondria-localized class III phospholipase A1 that plays a role in seed viability. |
| AT1G30410 | member of MRP subfamily |
| AT1G30455 | cyclin/Brf1-like TBP-binding domain-containing protein;(source:Araport11) |
| AT1G30470 | SIT4 phosphatase-associated family protein;(source:Araport11) |
| AT1G30620 | encodes a type-II membrane protein that catalyzes 4-epimerization of UDP-D-Xylose to UDP-L-Arabinose in vitro, the nucleotide sugar used by glycosyltransferases in the arabinosylation of cell wall polysaccharides and wall-resident proteoglycans. |
| AT1G30660 | A truncated version of Twinkle that retains only the DNA primase domain. |
| AT1G30670 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G30680 | Twinkle is a dual localized (mitochondria and chloroplast) DNA primase-helicase. It synthesizes RNA primers from a 5′ -(G/C)GGA-3′ template, where the last two 3' nucleotides are cryptic. Mitochondrial protein involved in DNA replication which binds to DNA polymerases, Pol1A and Pol1B. |
| AT1G30700 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G30710 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G30750 | TPRXL;(source:Araport11) |
| AT1G30755 | elongation factor G, putative (DUF668);(source:Araport11) |
| AT1G30780 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G30814 | hypothetical protein;(source:Araport11) |
| AT1G30835 | Member of Sadhu non-coding retrotransposon family The mRNA is cell-to-cell mobile. |
| AT1G30845 | cell growth defect protein;(source:Araport11) |
| AT1G30850 | root hair specific 4;(source:Araport11) |
| AT1G30860 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G30910 | Molybdenum cofactor sulfurase family protein;(source:Araport11) |
| AT1G30925 | F-box/associated interaction domain protein;(source:Araport11) |
| AT1G30950 | Required for the proper identity of the floral meristem. Involved in establishing the whorled pattern of floral organs, in the control of specification of the floral meristem, and in the activation of APETALA3 and PISTILLATA. UFO is found at the AP3 promoter in a LFY-dependent manner, suggesting that it works with LFY to regulate AP3 expression. UFO may also promote the ubiquitylation of LFY. |
| AT1G31040 | ORE15 is a nuclear localized member of the PLATZ family of transcription factors. Based on over expression and loss of function phenotypes, ORE15 functions in regulation of leaf cell proliferation and senescence. |
| AT1G31290 | ARGONAUTE 3;(source:Araport11) |
| AT1G31300 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT1G31370 | Ubiquitin-specific protease family C19-related protein;(source:Araport11) |
| AT1G31380 | TRAF-like family protein;(source:Araport11) |
| AT1G31450 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G31490 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G31520 | hypothetical protein;(source:Araport11) |
| AT1G31530 | Deadenylase. |
| AT1G31550 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G31640 | A paternally expressed imprinted gene. |
| AT1G31720 | chitin synthase, putative (DUF1218);(source:Araport11) |
| AT1G31740 | Encodes a putative β-galactosidase. |
| AT1G32030 | plant-specific B3-DNA-binding domain protein (DUF313);(source:Araport11) |
| AT1G32172 | other_RNA;(source:Araport11) |
| AT1G32230 | Encodes a protein belonging to the (ADP-ribosyl)transferase domain-containing subfamily of WWE protein-protein interaction domain protein family. Superoxide radicals are necessary and sufficient to propagate cell death or lesion formation in rcd1 mutants. Without stress treatment, RCD1 is localized in the nucleus. Under high salt or oxidative stress, RCD1 is found not only in the nucleus but also in the cytoplasm. The mRNA is cell-to-cell mobile. |
| AT1G32250 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G32310 | Encodes a plant-specific negative regulator of the APC/C complex. It is expressed during embryogenesis and early plant development and plays a key role in organ size control. Mutants are defective in mitosis I of pollen development, resulting in pollen without sperm nuclei. |
| AT1G32320 | member of MAP Kinase Kinase |
| AT1G32361 | Putative RING-H2 finger protein ATL1F precursor. |
| AT1G32440 | encodes a chloroplast pyruvate kinase beta subunit. The enzyme is less active than the other chloroplast pyruvate kinase beta subunit encoded by AT5G52920. Involved in seed oil biosynthesis. Can partially complement the AT5G52920 mutant. |
| AT1G32600 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G32700 | PLATZ transcription factor family protein;(source:Araport11) |
| AT1G32710 | Cytochrome c oxidase, subunit Vib family protein;(source:Araport11) |
| AT1G32740 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT1G32780 | GroES-like zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT1G32850 | ubiquitin-specific protease 11;(source:Araport11) |
| AT1G32870 | Expression in rosette leaves is activated by high concentration of boron. |
| AT1G32890 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-37 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT1G32910 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G32920 | hypothetical protein;(source:Araport11) |
| AT1G32940 | Subtilase family protein;(source:Araport11) |
| AT1G32960 | Subtilase family protein;(source:Araport11) |
| AT1G32975 | hypothetical protein;(source:Araport11) |
| AT1G33020 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G33030 | O-methyltransferase family protein;(source:Araport11) |
| AT1G33180 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-05 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT1G33250 | beta-1,3-n-acetylglucosaminyltransferase radical fringe protein, putative (DUF604);(source:Araport11) |
| AT1G33320 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT1G33350 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G33410 | Encodes a nucleoporin that regulates CONSTANS (CO) protein stability through affecting nuclear pore complex localization of an E3-ubiquitin ligase, HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENES1 (HOS1), which destabilizes CO protein in the morning period. |
| AT1G33420 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT1G33430 | UPEX1 is arabinogalactan b-(1,3)-galactosyltransferase involved in the formation of pollen exine. Belongs to GT31 family. Mutants have reduced levels of AGPs. GALT8 has some but not complete functional overlap with KNS4/UPEX1. |
| AT1G33440 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G33470 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G33540 | serine carboxypeptidase-like 18;(source:Araport11) |
| AT1G33700 | Beta-glucosidase, GBA2 type family protein;(source:Araport11) |
| AT1G33710 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT1G33720 | cytochrome P450, family 76, subfamily C, polypeptide 6;(source:Araport11) |
| AT1G33730 | cytochrome P450, family 76, subfamily C, polypeptide 5;(source:Araport11) |
| AT1G33840 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT1G33930 | One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance. |
| AT1G34000 | Encodes a novel member of the Lhc family from Arabidopsis with one predicted transmembrane alpha-helix closely related to helix I of Lhc protein from PSI (Lhca4). Gene expression is triggered by light stress and both transcript and protein accumulate in a light intensity-dependent manner. Ohp2 is associated with PSI under low- or high-light conditions. Together with OHP1, OHP2 is essential for the formation of photosystem II reaction center, even though neither is a part of the final PSII RC. It forms a complex with OHP1 and HCF244, D1, D2, PsbI, and cytochrome b559 at an early stage of PSII de novo assembly and of PSII repair under high-light conditions. |
| AT1G34050 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G34095 | hypothetical protein;(source:Araport11) |
| AT1G34110 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT1G34140 | polyadenylate-binding protein, putative / PABP, putative, non-consensus splice donor TA at exon 1; similar to polyadenylate-binding protein (poly(A)-binding protein) from (Triticum aestivum) GI:1737492, (Nicotiana tabacum) GI:7673355, {Arabidopsis thaliana} SP:P42731; contains InterPro entry IPR000504: RNA-binding region RNP-1 (RNA recognition motif) (RRM). Only member of the class IV PABP family. |
| AT1G34340 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G34420 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
| AT1G34490 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT1G34500 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT1G34520 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT1G34530 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 7.8e-116 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G34540 | member of CYP94D |
| AT1G34570 | Essential protein Yae1, N-terminal;(source:Araport11) |
| AT1G34680 | pseudogene of maturase K;(source:Araport11) |
| AT1G35220 | FAM91 carboxy-terminus protein;(source:Araport11) |
| AT1G35320 | transmembrane protein;(source:Araport11) |
| AT1G35330 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G35420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G35465 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-27 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G35570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
| AT1G35580 | CINV1 / A/N-InvG is an alkaline/neutral invertase that breaks sucrose down into fructose and glucose (GH100). The exact localization of CINV1 remains under investigation but there is evidence that fluorescently-tagged CINV1 localizes to the cytoplasm. atinvg mutants have reduced root growth, reduced invertase activity, and increased expression of antioxidant genes under basal conditions. The levels of CINV1 / A/N-InvG transcripts rise in response to a hydrogen peroxide treatment. The protein has been shown to interact with PIP5K9. |
| AT1G35730 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G35750 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G35820 | heat shock protein;(source:Araport11) |
| AT1G36070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G36110 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.2e-59 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G36220 | pseudogene of seryl-tRNA synthetase / serine-tRNA ligase;(source:Araport11) |
| AT1G36440 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains Pfam profile PF03384: Drosophila protein of unknown function, DUF287;(source:TAIR10) |
| AT1G36880 | pseudogene of FAR1-related sequence 5;(source:Araport11) |
| AT1G36890 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.2e-20 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G36922 | hypothetical protein;(source:Araport11) |
| AT1G36927 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.8e-29 P-value blast match to GB:BAA01703 ORF (Ty1_Copia-element) (Drosophila simulans);(source:TAIR10) |
| AT1G36936 | transposable_element_gene;(source:Araport11);pseudogene, similar to Putative copia-type polyprotein, blastp match of 43%25 identity and 2.1e-28 P-value to GP|15209144|gb|AAK91877.1|AC091665_3|AC091665 Putative copia-type polyprotein {Oryza sativa};(source:TAIR10) |
| AT1G38065 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G38430 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 9.8e-109 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G41760 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 7.1e-11 P-value blast match to GB:226407 retrotransposon del1-46 (Gypsy_Ty3-element) (Lilium henryi);(source:TAIR10) |
| AT1G41825 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.9e-98 P-value blast match to gb|AAL06422.1|AF378081_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10) |
| AT1G41840 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.2e-23 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT1G41850 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.3e-29 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G41860 | transposable_element_gene;(source:Araport11);contains InterPro domain Retrotransposon gag protein;(source:TAIR10) |
| AT1G42240 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G42550 | Encodes a plant-specific protein of unknown function that appears to be conserved among angiosperms. The mRNA is cell-to-cell mobile. |
| AT1G42980 | Actin-binding FH2 (formin homology 2) family protein;(source:Araport11) |
| AT1G42990 | bZIP60 consists of a bZIP DNA binding domain followed by a putative transmembrane domain. bZIP60 mRNA is upregulated by the addition of ER stress inducers, tunicamycin (inhibitor of N-linked glycosylation), DTT (inhibitor of disulfide bond formation) and azetin-2-carboxylate (proline analog perturbing protein structure). Upon ER stress, bZIP60 mRNA is spliced by IRE1A and IRE1B to produce bZIP60-S, an active transcription factor without the transmembrane domain. bZIP60-U, a product of unspliced form of bZIP60 mRNA, is localized at the ER membrane and bZIP60-S is localized in the nucleus. |
| AT1G43010 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G43020 | electron protein, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT1G43030 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.1e-109 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT1G43040 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G43600 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G43630 | plant/protein (DUF793);(source:Araport11) |
| AT1G43640 | Member of TLP family of tubby like proteins that also contain an F-Box. |
| AT1G43710 | Encodes a serine decarboxylase that is involved in ethanolamine metabolism and is crucial for plant growth. |
| AT1G43775 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-147 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT1G43781 | Pseudogene of AT1G53790; F-box family protein |
| AT1G43810 | hypothetical protein;(source:Araport11) |
| AT1G43835 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 2.7e-63 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
| AT1G44080 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT1G44130 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G44160 | HSP40/DnaJ peptide-binding protein;(source:Araport11) |
| AT1G44170 | Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. It is also able to oxidize beta-unsaturated aldehydes, but not aromatic aldehydes. Activity of ALDH3H1 is NAD +-dependent. |
| AT1G44180 | Peptidase M20/M25/M40 family protein;(source:Araport11) |
| AT1G44382 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT1G44446 | Encodes chlorophyllide a oxygenase which converts chlorophyllide a to chlorophyllide b by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide a . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll b and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22. |
| AT1G44575 | Encoding PSII-S (CP22), a ubiquitous pigment-binding protein associated with photosystem II (PSII) of higher plants. Involved in nonphotochemical quenching rather than in photosynthesis. Mutant has a normal violaxanthin cycle but has a limited capacity of quenching singlet excited chlorophylls and is tolerant to lipid peroxidation. |
| AT1G44608 | hypothetical protein;(source:Araport11) |
| AT1G45100 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G45190 | downregulated in DIF1 18;(source:Araport11) |
| AT1G45191 | beta-glucosidase related protein, similar to beta-glucosidase GI:3820531 from (Pinus contorta); contains Pfam profile: PF00232 Glycosyl hydrolase family 1 |
| AT1G45545 | WEAK CHLOROPLAST MOVEMENT UNDER BLUE LIGHT-like protein (DUF827);(source:Araport11) |
| AT1G45616 | receptor like protein 6;(source:Araport11) |
| AT1G46264 | Encodes SCHIZORIZA, a member of Heat Shock Transcription Factor (Hsf) family. Functions as a nuclear factor regulating asymmetry of stem cell divisions. |
| AT1G46408 | AGAMOUS-like 97;(source:Araport11) |
| AT1G46840 | F-box family protein;(source:Araport11) |
| AT1G46912 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G46984 | F-box family protein;(source:Araport11) |
| AT1G47220 | Cyclin A3;(source:Araport11) |
| AT1G47265 | hypothetical protein;(source:Araport11) |
| AT1G47271 | Cystathionine beta-synthase (CBS) family protein;(source:Araport11) |
| AT1G47300 | F-box family protein;(source:Araport11) |
| AT1G47350 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G47370 | RBA1 variant in Ag0 background is a TIR-only receptor protein that binds to the bacterial type III effector protein HopBA. The Col-0 variant, which is not expressed, is likely a psuedogene and more highly methylated than the Ag0 variant which is expressed. |
| AT1G47590 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.Previously annotated as pseudogene, evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT1G47603 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G47620 | member of CYP96A |
| AT1G47630 | member of CYP96A |
| AT1G47840 | Encodes a putative hexokinase. |
| AT1G47885 | Ribonuclease inhibitor;(source:Araport11) |
| AT1G48000 | Encodes a putative transcription factor (MYB112). |
| AT1G48010 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G48060 | F-box/associated interaction domain protein;(source:Araport11) |
| AT1G48150 | MADS-box transcription factor family protein;(source:Araport11) |
| AT1G48220 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G48260 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.21), which has also been reported as a member of the CBL-interacting protein kinases (CIPK17). |
| AT1G48310 | chromatin remodeling factor18;(source:Araport11) |
| AT1G48400 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G48405 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT1G48480 | Arabidopsis thaliana receptor-like protein kinase (RKL1) gene |
| AT1G48510 | Encodes one of two Arabidopsis mitochondrial proteins similar to human SURF1 which is known to be involved in cytochrome c oxidase assembly. Mutations result in defects in hypocotyl elongation and changes in GA homeostasis. |
| AT1G48520 | Encodes Glu-tRNA(Gln) amidotransferase subunit B (from Genbank record AF239836). |
| AT1G48530 | proteasome inhibitor-like protein;(source:Araport11) |
| AT1G48625 | pseudogene of F-box family protein |
| AT1G48640 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT1G48745 | hypothetical protein;(source:Araport11) |
| AT1G48930 | glycosyl hydrolase 9C1;(source:Araport11) |
| AT1G48953 | hypothetical protein;(source:Araport11) |
| AT1G48980 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G49015 | DPP6 N-terminal domain-like protein;(source:Araport11) |
| AT1G49050 | Encodes a member of the aspartyl protease family. Interacts with BAGP1 and BAG6 and appears to be required for cleavage of BAG6 as BAG6 is not cleaved in APCB1 mutant backgrounds. |
| AT1G49110 | hypothetical protein;(source:Araport11) |
| AT1G49120 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT1G49270 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G49290 | Paternally expressed gene that is localized around the sperm nuclei of pollen. PEG2 acts as a sponge for siRNA854 during endosperm development, this action is necessary to induce triploid seed abortion. |
| AT1G49390 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G49405 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT1G49430 | Encodes a long chain acyl-CoA synthetase that catalyzes the synthesis of omega-hydroxy fatty acyl-CoA intermediates in the pathway to cutin synthesis. Required for repression of lateral root formation. |
| AT1G49450 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G49470 | transmembrane epididymal protein (DUF716);(source:Araport11) |
| AT1G49730 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G49750 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G49770 | Encodes a member of the basic helix loop helix family of transcription factors. Loss of RGE1 function causes shriveled seeds that contain small embryos. The cuticle in the embryos does not develop normally, possible due to the adeherence of the endosperm to the developing embryo. RGE1 is expressed in the endosperm surrounding region which directly surrounds the developing embryo, however it exerts its effect non autonomously- in the developing embryo. Mutant seedlings are extremely sensitive to desiccation due to the abnormal cuticle. Together with ICE1, ZOU determines primary seed dormancy depth independently of their joint role in endosperm development. |
| AT1G49860 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). The mRNA is cell-to-cell mobile. |
| AT1G49870 | myosin-2 heavy chain-like protein;(source:Araport11) |
| AT1G49900 | C2H2 type zinc finger transcription factor family;(source:Araport11) |
| AT1G49960 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT1G50070 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
| AT1G50090 | D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein;(source:Araport11) |
| AT1G50130 | pseudogene of ATP binding/leucine-tRNA ligases/aminoacyl-tRNA ligase;(source:Araport11) |
| AT1G50210 | pseudogene of NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT1G50220 | B3 domain protein;(source:Araport11) |
| AT1G50280 | BTB/POZ protein that forms a complex with CUL3a. Involved in repression of ABA responses. |
| AT1G50330 | pseudogene of methylesterase PCR A;(source:Araport11) |
| AT1G50370 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT1G50390 | pfkB-like carbohydrate kinase family protein;(source:Araport11) |
| AT1G50450 | Saccharopine dehydrogenase;(source:Araport11) |
| AT1G50500 | encodes a member of VPS53 family protein involved in the retrograde trafficking of vesicles to the late Golgi. Mutants in this gene are more sensitive to heat and osmotic stress. |
| AT1G50610 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G50630 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
| AT1G50680 | AP2/B3 transcription factor family protein;(source:Araport11) |
| AT1G50870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G50890 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G50930 | Serine/Threonine-kinase;(source:Araport11) |
| AT1G50990 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
| AT1G51000 | hypothetical protein;(source:Araport11) |
| AT1G51035 | hypothetical protein;(source:Araport11) |
| AT1G51050 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G51120 | AP2/B3 transcription factor family protein;(source:Araport11) |
| AT1G51210 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G51230 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT1G51440 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT1G51500 | Encodes an ABC transporter involved in cuticular wax biosynthesis. Lines carrying recessive mutations in this locus have weakly glaucous stem surface, and relative elevated secondary alcohols and ketones. |
| AT1G51620 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G51670 | hypothetical protein;(source:Araport11) |
| AT1G51700 | Encodes dof zinc finger protein (adof1). The mRNA is cell-to-cell mobile. |
| AT1G51780 | encodes a member of the six Arabidopsis IAA-amino acid conjugate hydrolase subfamily and conjugates and is very similar to IAR3. |
| AT1G51790 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G51800 | The gene encodes a putative member of the LRR-RLK protein family. Expressin and mutant analysis revealed that it contributes to the interaction between Arabidopsis and Hyaloperonospora arabidopsidis. and The mRNA is cell-to-cell mobile. |
| AT1G51840 | kinase-like protein;(source:Araport11) |
| AT1G51860 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G51880 | root hair specific 6;(source:Araport11) |
| AT1G51890 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G51900 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT1G51970 | B3 domain protein;(source:Araport11) |
| AT1G52030 | Similar to myrosinase binding proteins which may be involved in metabolizing glucosinolates and forming defense compounds to protect against herbivory. Also similar to lectins and other agglutinating factors. Expressed only in flowers. |
| AT1G52040 | Encodes myrosinase-binding protein expressed in flowers. |
| AT1G52100 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G52140 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
| AT1G52185 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:TAGAATGCTATTGTAATCCAG |
| AT1G52190 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
| AT1G52210 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-186 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G52220 | Thylakoid membrane localized protein that interacts with other CURT family proteins. Oligomerization is associated with grana thylakoid curavature. |
| AT1G52230 | Phosphorylation of this protein is dependent on calcium. The mRNA is cell-to-cell mobile. |
| AT1G52300 | Zinc-binding ribosomal protein family protein;(source:Araport11) |
| AT1G52315 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT1G52410 | Contains a novel calcium-binding repeat sequence. Binds TSK in vitro. Localizes to small cytoplasmic vesicles in interphase cells. In cells synchronized for cell division, TSA1 and TSK relocalize to ends of spindle microtubules that are ahead of separating chromatids during metaphase and anaphase of mitosis. May be involved in mitosis together with TSK. Expressed preferentially in the flower and shoot apex. Can form multimers. The mRNA is cell-to-cell mobile. |
| AT1G52415 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G52430 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT1G52440 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G52560 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT1G52660 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G52710 | Rubredoxin-like superfamily protein;(source:Araport11) |
| AT1G52790 | encodes a putative oxidoreductase, 2OG-Fe(II) oxygenase family protein, similar to GS-AOP loci (GI:16118889, GI:16118887, GI:16118891, GI:16118893); contains PF03171 2OG-Fe(II) oxygenase superfamily domain |
| AT1G52880 | Transcription factor with a NAC domain. Homologous to the petunia gene NAM which is required for the development of the shoot. Expressed in the embryo. |
| AT1G52910 | fiber (DUF1218);(source:Araport11) |
| AT1G52980 | Encodes a GTPase that belongs to the subfamily of YlqF/YawG GTPases. Functions in Pre-60S ribosomal subunit maturation. The mRNA is cell-to-cell mobile. |
| AT1G53010 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G53030 | encodes a copper chaperone, can functional complements the yeast COX17 null mutant. May play a role in the delivery of copper to mitochondria. Expressed in roots and thus may also play a role in copper transport in the roots. |
| AT1G53100 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G53160 | Encodes a member of the SPL (squamosa-promoter binding protein-like)gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. Contains the SBP-box, which encodes the SBP-domain, required and sufficient for interaction with DNA. It is involved in regulation of flowering and vegetative phase change. Its temporal expression is regulated by the microRNA miR156. The target site for the microRNA is in the 3'UTR. |
| AT1G53170 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT1G53180 | hypothetical protein;(source:Araport11) |
| AT1G53290 | Galactosyltransferase family protein;(source:Araport11) |
| AT1G53330 | encodes a member of the pentatricopeptide repeat (PPR) gene family. T-DNA insertion mutants had a complex phenotypic expression, ranging from embryo lethal to seedling lethal, to just subtle changes. |
| AT1G53430 | Probable LRR receptor-like ser/thr-protein kinase; Commonly-enriched candidate LPS-interacting PM-associated proteins for both LPS chemotypes subsequent to the polymyxin B affinity chromatography strategy. |
| AT1G53440 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT1G53470 | mechanosensitive channel of small conductance-like 4;(source:Araport11) |
| AT1G53530 | Mitochondrial ATP-independent protease |
| AT1G53550 | F-box family protein;(source:Araport11) |
| AT1G53625 | hypothetical protein;(source:Araport11) |
| AT1G53690 | Protein of unknown function that is homologous to At5g41010, which encodes a non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB12. |
| AT1G53708 | ROTUNDIFOLIA like 9;(source:Araport11) |
| AT1G53770 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G53780 | 26S proteasome regulatory complex ATPase;(source:Araport11) |
| AT1G53820 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G53850 | Encodes alpha5 subunit of 20s proteosome involved in protein degradation and RNA degradation. |
| AT1G54010 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G54035 | pseudogene of epithiospecifier protein |
| AT1G54070 | Dormancy/auxin associated family protein;(source:Araport11) |
| AT1G54095 | DUF1677 family protein, putative (DUF1677);(source:Araport11) |
| AT1G54120 | hypothetical protein;(source:Araport11) |
| AT1G54300 | hypothetical protein;(source:Araport11) |
| AT1G54560 | Encodes a class XI myosin that is involved in organelle motility, actin organization, and optimal growth of pollen tubes. |
| AT1G54600 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G54640 | F-box family protein-like protein;(source:Araport11) |
| AT1G54890 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
| AT1G54940 | Encodes a xylan glucuronosyltransferase. |
| AT1G55010 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT1G55020 | lipoxygenase, a defense gene conferring resistance Xanthomonas campestris The mRNA is cell-to-cell mobile. |
| AT1G55030 | RNI-like superfamily protein;(source:Araport11) |
| AT1G55035 | pseudogene of importin alpha isoform 1;(source:Araport11) |
| AT1G55060 | Ubiquitin-like gene, believed to be a pseudogene because of amino acid substitutions in 3 of the 5 ubiquitin repeats found in the UBQ12 gene product |
| AT1G55130 | Encodes an Arabidopsis Transmembrane nine (TMN) protein. Transmembrane nine (TM9) proteins are localized in the secretory pathway of eukaryotic cells and are involved in cell adhesion and phagocytosis. |
| AT1G55180 | member of C2-PLD. subfamily Represents a phospholipase D (PLD) gene with four exons, hence it is a member of the alpha class. Its amino acid sequence is quite different from other PLDs, therefore it might possess unique structural and/or catalytic properties. |
| AT1G55210 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT1G55240 | proteinase inhibitor I4, serpin (DUF716);(source:Araport11) |
| AT1G55265 | DUF538 family protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT1G55320 | Encodes a protein with similarity to acyl activating enzymes. AAE18 is localized to the peroxisome where it may be involved in metabolism of auxin precursors to active auxins. |
| AT1G55325 | Encodes the Arabidopsis homolog of the transcriptional regulator MED13, is dynamically expressed during embryogenesis and regulates both developmental timing and the radial pattern formation. |
| AT1G55365 | hypothetical protein;(source:Araport11) |
| AT1G55550 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G55570 | SKU5 similar 12;(source:Araport11) |
| AT1G55600 | member of WRKY Transcription Factor; Group I. It has WRKY domain at its N terminal end and zinc-finger like motif. |
| AT1G55604 | Pseudogene of AT1G26762 |
| AT1G55660 | FOF2, is the F-box protein family. Overexpression of FOF2 results in delayed transitions to flowering under both LD and SD conditions.FOF2 expression is induced by ABA during seed germination where it acts through ABI3 and ABI5 to modulate germination. |
| AT1G55670 | Encodes subunit G of photosystem I, an 11-kDa membrane protein that plays an important role in electron transport between plastocyanin and PSI and is involved in the stability of the PSI complex. PSI-G subunit is bound to PSI-B and is in contact with Lhca1. The protein inserts into thylakoids by a direct or "spontaneous" pathway that does not involve the activities of any known chloroplast protein-targeting machinery. PSI-G appears to be directly or indirectly involved in the interaction between Photosystem I and plastocyanin. |
| AT1G55690 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G55720 | member of Low affinity calcium antiporter CAX2 family |
| AT1G55730 | member of Low affinity calcium antiporter CAX2 family |
| AT1G55740 | seed imbibition 1;(source:Araport11) |
| AT1G55760 | Expression induced under NaCl, mannitol, ABA and indole-3-acetic acid (IAA) treatment. |
| AT1G55770 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G55840 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G55850 | encodes a protein similar to cellulose synthase The mRNA is cell-to-cell mobile. |
| AT1G55880 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
| AT1G55900 | component of a translocase in the mitochondrial inner membrane |
| AT1G55910 | member of Putative zinc transporter ZIP2 - like family |
| AT1G55940 | cytochrome P450 family protein;(source:Araport11) |
| AT1G56030 | RING/U-box protein;(source:Araport11) |
| AT1G56040 | HEAT/U-box protein;(source:Araport11) |
| AT1G56150 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G56160 | Encodes a member of the R2R3 transcription factor gene family that is involved in mediating induced systemic resistance. Genetic analysis of loss of function mutants and overexpressor lines indicates MYB72 is necessary but not sufficient for ISR.Interacts in vivo with EIL3. |
| AT1G56510 | TIR-NB-LRR protein that confers resistance to four races of Albugo candida. The mRNA is cell-to-cell mobile. |
| AT1G56620 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G56710 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G57560 | Member of the R2R3 factor gene family. |
| AT1G57565 | SWI-SNF-related chromatin binding protein;(source:Araport11) |
| AT1G57580 | F-box family protein;(source:Araport11) |
| AT1G57590 | Pectinacetylesterase family protein;(source:Araport11) |
| AT1G57630 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT1G57670 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT1G57690 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G57720 | Translation elongation factor EF1B, gamma chain;(source:Araport11) |
| AT1G57750 | Encodes a CYP96A15, midchain alkane hydroxylase, involved in cuticular wax biosynthesis. |
| AT1G57790 | F-box family protein;(source:Araport11) |
| AT1G57820 | Encodes a 645-amino acid methylcytosine-binding protein with a PHD domain, two RING finger domains, and an SRA domain that is involved in centromere heterochromatinization. This protein functions as an E3 ubiquitin ligase in vitro. The protein has been shown to bind to methylated cytosines of CG, CNG and CNN motifs via its SRA domain but has a preference for the former. It plays a role in the establishment/maintenance of chromatin structure during cell division and is localized in the nucleus. Plants over-expressing VIM1/ORTH2 show an inhibition in root growth and a delay in flowering. Both over-expression of GFP:ORTH2 and loss of ORTH2/VIM1 lead to decreased levels of DNA methylation. GFP:ORTH2 over-expressers also have increased levels of FWA transcripts. |
| AT1G57850 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT1G57870 | shaggy-like kinase 42;(source:Araport11) |
| AT1G58040 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-28 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G58090 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G58120 | hypothetical protein;(source:Araport11) |
| AT1G58170 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT1G58190 | receptor like protein 9;(source:Araport11) |
| AT1G58265 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT1G58340 | Encodes a plant MATE (multidrug and toxic compound extrusion) transporter that is localized to the Golgi complex and small organelles and is involved in determining the rate of organ initiation. It is also involved in iron homeostasis when plants are under osmotic stress. |
| AT1G58602 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
| AT1G58643 | Inositol-pentakisphosphate 2-kinase family protein;(source:Araport11) |
| AT1G59453 | B-block-binding subunit of TFIIIC protein;(source:Araport11) |
| AT1G59550 | This locus is annotated as a protein-coding gene in TAIR10. Based on communication with Jean-Luc GALLOIS (April 2013), this gene is re-annotated as a UBX domain-containing pseudogene. Note that the Map Detail Image on the locus detial page and in GBrowse will not be updated until after the next genome release. |
| AT1G59590 | ZCF37 mRNA, complete cds The mRNA is cell-to-cell mobile. |
| AT1G59720 | Pentatricopeptide Repeat Protein containing the DYW motif. Required for editing of multiple plastid transcripts. Endonuclease activity. |
| AT1G59740 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G59780 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT1G59860 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT1G60010 | PADRE protein down-regulated after infection by S. sclerotiorun. |
| AT1G60060 | Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11) |
| AT1G60070 | Gamma subunit 1 of AP-1 adaptor protein complex. |
| AT1G60095 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G60160 | Member of the KT/KUP/HAK family of proton-coupled potassium transporters which have potential effect on cellular expansion. |
| AT1G60190 | Encodes PUB19, a plant U-box armadillo repeat protein. Involved in salt inhibition of germination together with PUB18. The mRNA is cell-to-cell mobile. |
| AT1G60240 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT1G60260 | beta glucosidase 5;(source:Araport11) |
| AT1G60280 | NAC domain containing protein 23;(source:Araport11) |
| AT1G60300 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT1G60320 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT1G60330 | pseudogene of Chalcone-flavanone isomerase family protein;(source:Araport11) |
| AT1G60340 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT1G60350 | NAC domain containing protein 24;(source:Araport11) |
| AT1G60380 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT1G60390 | polygalacturonase 1;(source:Araport11) |
| AT1G60400 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G60510 | pseudogene of Dynamin related protein 4C;(source:Araport11) |
| AT1G60520 | pseudogene of Dynamin related protein 4A;(source:Araport11) |
| AT1G60590 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G60600 | Encodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport. |
| AT1G60750 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT1G60783 | cyclin-dependent kinase inhibitor SMR2-like protein;(source:Araport11) |
| AT1G60790 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G60880 | Root Specific |
| AT1G60920 | AGAMOUS-like 55;(source:Araport11) |
| AT1G60990 | Encodes a chloroplast-localized COG0354 protein that requires folate for its function in Fe/S cluster biogenesis. |
| AT1G61060 | F-box family protein;(source:Araport11) |
| AT1G61070 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT1G61090 | hypothetical protein;(source:Araport11) |
| AT1G61095 | hypothetical protein;(source:Araport11) |
| AT1G61130 | serine carboxypeptidase-like 32;(source:Araport11) |
| AT1G61140 | SNF2 domain-containing protein / helicase domain-containing protein / zinc finger protein-like protein;(source:Araport11) |
| AT1G61150 | LisH and RanBPM domains containing protein;(source:Araport11) |
| AT1G61224 | Encodes a microRNA that targets several Jacalin lectin family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCAUGGUCAGAUCCGUCAUCC |
| AT1G61330 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT1G61400 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G61560 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in roots and lateral root primordia, in flower and fruit abscission zone, in vascular system of cotyledons, young leaves and petals, in mature rosette leaves, in anthers, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G61575 | Serine/Threonine kinase;(source:Araport11) |
| AT1G61610 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G61620 | Encodes a RING-finger E3 ubiquitin ligase that plays a major role in maintaining COP1 homeostasis by targeting COP1 for ubiquitination and degradation in dark-grown seedlings. The mRNA is cell-to-cell mobile. |
| AT1G61660 | Encodes a transcriptional activator that regulates the expression of genes by binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT1G61710 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G61720 | Negative regulator of flavonoid biosynthesis, mutants accumulate flavonoid pigments in their seed coat, putative oxidoreductase. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. |
| AT1G61732 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCUAAGUCUUCUAUUGAUGUU |
| AT1G61740 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT1G61820 | beta glucosidase 46;(source:Araport11) |
| AT1G61850 | Encodes a non-specific lipase that hydrolyzes phospholipids as well as galactolipids, at both sn-1 and sn-2 positions. Involved in basal jasmonic acid biosynthesis by releasing the precursor fatty acid from membrane lipids. Mutant plants were impacted in resistance to fungus B. cinerea. |
| AT1G61860 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G61880 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT1G61940 | Member of TLP family |
| AT1G61950 | member of Calcium Dependent Protein Kinase |
| AT1G62160 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT1G62170 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT1G62280 | Encodes a protein with ten predicted transmembrane helices. The SLAH1 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. Although it is not expressed in guard cells, it can complement a slac1-2 mutant suggesting that it performs a similar function. SLAH1:GFP localizes to the plasma membrane. |
| AT1G62300 | Encodes a transcription factor WRKY6. Regulates Phosphate1 (Pho1) expression in response to low phosphate (Pi) stress. |
| AT1G62310 | Encodes a probable H3K9me2 demethylase. Functions in trichome morphogenesis via regulation of GL3. |
| AT1G62320 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
| AT1G62340 | Subtilisin-like serine protease required for epidermal surface formation in embryos and juvenile plants |
| AT1G62400 | Protein kinase involved in regulation of stomatal aperture in response to CO2. |
| AT1G62420 | DUF506 family protein (DUF506);(source:Araport11) |
| AT1G62510 | Expressed in the root cortex. |
| AT1G62560 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
| AT1G62630 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT1G62650 | pseudogene of P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G62660 | Glycosyl hydrolases family 32 protein;(source:Araport11) |
| AT1G62690 | hypothetical protein;(source:Araport11) |
| AT1G62700 | Encodes a NAC-domain transcription factor. Expressed in the vascular tissue. |
| AT1G62790 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G62800 | Encodes aspartate aminotransferase (Asp4). |
| AT1G62820 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G62870 | hypothetical protein;(source:Araport11) |
| AT1G62935 | transmembrane protein;(source:Araport11) |
| AT1G62990 | Encodes a homeodomain transcription factor of the Knotted family. May be involved in secondary cell wall biosynthesis. Mutants have moderately irregular xylem development. Expression of this gene is upregulated by SND1 and MYB46. |
| AT1G63100 | Transcription factor belonging to the GRAS family which controls the mitotic cell cycle and division plane orientation. |
| AT1G63105 | hypothetical protein;(source:Araport11) |
| AT1G63170 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
| AT1G63180 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in pollen development. |
| AT1G63220 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT1G63340 | Flavin-containing monooxygenase family protein;(source:Araport11) |
| AT1G63350 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT1G63460 | Encodes GPX8 (glutathione peroxidase 8). Involved in the suppression of oxidative damages in nucleus and cytosol. The mRNA is cell-to-cell mobile. |
| AT1G63480 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT1G63530 | hypothetical protein;(source:Araport11) |
| AT1G63535 | Encodes a defensin-like (DEFL) family protein. |
| AT1G63600 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT1G63650 | Mutant has reduced trichomes, anthocyanin, and seed coat mucilage and abnormally patterned stomates. Mutants are defective in jasmonate-induced anthocyanin accumulation. Encodes a bHLH Transcription Factor 1. The protein is functionally redundant with GL3 and TT8 and interacts with TTG1, the myb proteins GL1, PAP1 and 2, CPC and TRY, and it will form heterodimers with GL3. Expression in N (non-hair cell forming) cell layers is negatively regulated by WER. Expression in H cells (hair cell forming) is promoted by CPC/TRY. |
| AT1G63750 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G63760 | pseudogene of RING/U-box superfamily protein;(source:Araport11) |
| AT1G63800 | ubiquitin-conjugating enzyme 5;(source:Araport11) |
| AT1G63870 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G63960 | Copper transport protein family;(source:Araport11) |
| AT1G64020 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT1G64030 | serpin 3;(source:Araport11) |
| AT1G64035 | pseudogene of serpin 2;(source:Araport11) |
| AT1G64050 | hypothetical protein;(source:Araport11) |
| AT1G64065 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G64070 | Encodes a TIR-NBS-LRR class of disease resistance protein effective against Leptosphaeria maculans. |
| AT1G64107 | Encodes a defensin-like (DEFL) family protein. |
| AT1G64110 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT1G64160 | Encodes a dirigent protein involved in the synthesis of (-)pinoresinol. Dirigent proteins impart stereoselectivity on the phenoxy radical coupling reaction yielding optically active lignans from two molecules of coniferyl alcohol. |
| AT1G64170 | member of Putative Na+/H+ antiporter family |
| AT1G64270 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.0e-06 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT1G64290 | F-box protein-like protein;(source:Araport11) |
| AT1G64295 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G64330 | myosin heavy chain-like protein;(source:Araport11) |
| AT1G64390 | glycosyl hydrolase 9C2;(source:Araport11) |
| AT1G64560 | pseudogene of S-adenosylmethionine-dependent methyltransferase/rRNA (adenine-N6,N6-)-dimethyltransferase/rRNA methyltransferase |
| AT1G64570 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G64600 | copper ion binding / methyltransferase;(source:Araport11) |
| AT1G64625 | Encodes a plant-specific basic helix-loop-helix (bHLH) protein that is required for normal meiotic entry and the establishment of meiotic synchrony. It plays a role in xylem differentiation downstream of auxin. |
| AT1G64660 | Encodes a functional methionine gamma-lyase, a cytosolic enzyme catalyzes the degradation of methionine into methanethiol, alpha-ketobutyrate and ammonia. The catabolism of excess methionine is important to methionine homeostasis. The mRNA is cell-to-cell mobile. |
| AT1G64670 | Encodes a epidermally expressed extracellular protein that likely functions as an alpha-beta hydrolase and is required for normal cuticle formation. Homozygous mutant plants are dwarfed and have abnormal leaves, collapsed cells, reduced numbers of trichomes. The specific role of BDG is unclear: it may function in cutin biosynthesis or as a cross-linking enzyme in the cell wall itself. |
| AT1G64680 | beta-carotene isomerase D27;(source:Araport11) |
| AT1G64690 | Encodes BRANCHLESS TRICHOME (BLT) involved in trichome development. A large portion of the internal amino acid sequence of BLT is predicted to form a coiled-coil domain. BLT mutants form branchless trichomes with blunt tips. |
| AT1G64780 | encodes an ammonium transporter protein believed to act as a high affinity transporter. It is expressed in the root, primarily in endodermal and cortical cells, and contributes to ammonium uptake in the root. |
| AT1G64820 | MATE efflux family protein;(source:Araport11) |
| AT1G64830 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G64840 | LOW protein: F-box/kelch-repeat protein (DUF295);(source:Araport11) |
| AT1G64900 | Encodes cytochrome P450 (CYP89A2). The mRNA is cell-to-cell mobile. |
| AT1G64930 | member of CYP89A |
| AT1G64990 | Encodes a GPCR-type G protein receptor with nine predicted transmembrane domains. The protein binds abscisic acid (ABA) and is predicted to function as an ABA receptor. It has GTP-binding and GTPase activity and binds to ABA more effectively in the presence of GDP. GTG1 binds to GPA1, the alpha subunit of the heterotrimeric G protein. GPA1 (in its GTP-bound state) affects the GTP binding and GTPase activity of GTG1 and may act to down-regulate GTG1 binding to ABA. GTG1 is widely expressed throughout the plant and appears to be involved in the regulation of several ABA-dependent responses including seed germination, plant development, and promotion of stomatal closure. GTG1 transcript levels do not appear to change in response to ABA or abiotic stresses. |
| AT1G65110 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT1G65140 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT1G65160 | ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT1G65170 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT1G65300 | Encodes PHERES2, a homolog of PHERES1. PHERES1 and PHERES2 are both target genes of the FIS Polycomb group complex but only PHERES1 is regulated by genomic imprinting, which is likely caused by the presence of repeat sequences in the proximity of the PHERES1 locus. |
| AT1G65330 | Type I MADS-box protein, regulated by MEA and FIE, expressed transiently after fertilization in embryo and endosperm. |
| AT1G65342 | transmembrane protein;(source:Araport11) |
| AT1G65385 | pseudogene of serpin 3;(source:Araport11) |
| AT1G65483 | hypothetical protein;(source:Araport11) |
| AT1G65486 | Secreted peptide which functions in plant growth and pathogen defense. |
| AT1G65570 | Encodes a glycosyl hydrolase 28 (GH28) family polygalacturonase (PG) protein. Involved in root cap development. |
| AT1G65610 | Six-hairpin glycosidases superfamily protein;(source:Araport11) |
| AT1G65630 | Encodes a putative DegP protease. |
| AT1G65660 | Encodes a CCHC zinc finger protein that may function as a step II splicing factor. In an epigenetic allele of SMP1 (in which SMP1 and SMP2 mRNA is reduced) organs are smaller and contain fewer cells. |
| AT1G65670 | a member of the cytochrome P450 gene family. molecular function unknown. |
| AT1G65680 | member of BETA-EXPANSINS. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT1G65750 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.9e-18 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G65800 | Encodes a putative receptor-like serine/threonine protein kinases that is similar to brassica self-incompatibility (S) locus. expressed in specifically in cotyledons, leaves, and sepals, in correlation with the maturation of these structures. Together with AtPUB9, it is required for auxin-mediated lateral root development under phosphate-starved conditions. The mRNA is cell-to-cell mobile. |
| AT1G65845 | transmembrane protein;(source:Araport11) |
| AT1G65860 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates |
| AT1G65875 | pseudogene of AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G65880 | Encodes a benzoate-CoA ligase. Involved in the biosynthesis of benzoyloxyglucosinolate in Arabidopsis seeds. |
| AT1G65890 | acyl activating enzyme 12;(source:Araport11) |
| AT1G65970 | thioredoxin-dependent peroxidase 2 |
| AT1G66010 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT1G66030 | Encodes a protein with cytochrome P450 domain. Probable psuedogene. |
| AT1G66060 | hypothetical protein (DUF577);(source:Araport11) |
| AT1G66090 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
| AT1G66110 | hypothetical protein (DUF577);(source:Araport11) |
| AT1G66130 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G66140 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT1G66150 | Receptor-like transmembrane kinase I (TMK1); key regulator in auxin signaling. High auxin and TMK1 play essential and positive roles in ABA signaling through regulating ABA INSENSITIVE 1 and 2 (ABI1/2). Inhibits the phosphatase activity of ABI2 by direct phosphorylation of threonine 321 (T321), a conserved phosphorylation site in ABI2 proteins, whose phosphorylation status is important for both auxin and ABA responses. |
| AT1G66160 | CYS, MET, PRO, and GLY protein 1;(source:Araport11) |
| AT1G66190 | hypothetical protein;(source:Araport11) |
| AT1G66200 | encodes a cytosolic glutamate synthetase, this enzyme has low affinity with substrate ammonium |
| AT1G66210 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT1G66220 | Subtilase family protein;(source:Araport11) |
| AT1G66235 | no-apical-meristem-associated carboxy-terminal domain protein;(source:Araport11) |
| AT1G66460 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G66540 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT1G66760 | MATE efflux family protein;(source:Araport11) |
| AT1G66780 | MATE efflux family protein;(source:Araport11) |
| AT1G66820 | glycine-rich protein;(source:Araport11) |
| AT1G66830 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G66860 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
| AT1G66870 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT1G66910 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G66920 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G66930 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G66940 | kinase-like protein;(source:Araport11) |
| AT1G66950 | Encodes a plasma membrane-localized ABC transporter. Confers tolerance to herbicide paraquat. |
| AT1G66960 | Terpenoid cyclases family protein;(source:Araport11) |
| AT1G66990 | pseudogene of suppressor of npr1-1 constitutive 4;(source:Araport11) |
| AT1G67000 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G67020 | transmembrane protein;(source:Araport11) |
| AT1G67070 | Encodes a protein with phosphomannose isomerase activity that is involved in synthesis of ascorbic acid. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT1G67110 | cytochrome P450, family 735, subfamily A, polypeptide 2;(source:Araport11) |
| AT1G67120 | Represents a homolog of the yeast MDN gene, which encodes a non-ribosomal protein involved in the maturation and assembly of the 60S ribosomal subunit. In Arabidopsis, it is essential for female gametogenesis progression. |
| AT1G67130 | F-box family protein;(source:Araport11) |
| AT1G67220 | histone acetyltransferase of the CBP family 2;(source:Araport11) |
| AT1G67270 | Zinc-finger domain of monoamine-oxidase A repressor R1 protein;(source:Araport11) |
| AT1G67510 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G67520 | lectin protein kinase family protein;(source:Araport11) |
| AT1G67560 | PLAT/LH2 domain-containing lipoxygenase family protein;(source:Araport11) |
| AT1G67635 | phosphatidylinositol 4-kinase gamma-like protein;(source:Araport11) |
| AT1G67855 | hypothetical protein;(source:Araport11) |
| AT1G67856 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G68090 | Encodes a calcium-binding protein annexin (AnnAt5). Plays a vital role in pollen development via Ca2+ dependent membrane trafficking. |
| AT1G68150 | member of WRKY Transcription Factor; Group II-b The mRNA is cell-to-cell mobile. |
| AT1G68220 | aerobic coproporphyrinogen-III oxidase (DUF1218);(source:Araport11) |
| AT1G68230 | Reticulon family protein;(source:Araport11) |
| AT1G68330 | membrane-associated kinase regulator;(source:Araport11) |
| AT1G68350 | cotton fiber protein;(source:Araport11) |
| AT1G68420 | Class II aaRS and biotin synthetases superfamily protein;(source:Araport11) |
| AT1G68550 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT1G68560 | Encodes a bifunctional alpha-l-arabinofuranosidase/beta-d-xylosidase that belongs to family 3 of glycoside hydrolases. |
| AT1G68620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G68735 | Encodes a defensin-like (DEFL) family protein. |
| AT1G68750 | Encodes one of four Arabidopsis phosphoenolpyruvate (PEP) carboxylase proteins. But, it is more similar to bacterial PEP carboxylase than plant PEP carboxylase. Efforts to express this enzyme and to demonstrate its enzymatic activity in E.coli failed. |
| AT1G68820 | Putative C3HC4 zinc-finger ubiquitin E3 ligase, negative regulator in ABA and drought stress response. May act as a positive role in regulating the high temperature by mediating the degradation of unknown target proteins. |
| AT1G68840 | Rav2 is part of a complex that has been named `regulator of the (H+)-ATPase of the vacuolar and endosomal membranes' (RAVE) The mRNA is cell-to-cell mobile. |
| AT1G68850 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G68880 | basic leucine-zipper 8;(source:Araport11) |
| AT1G68970 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT1G69070 | nucleolar-like protein;(source:Araport11) |
| AT1G69080 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT1G69160 | suppressor;(source:Araport11) |
| AT1G69190 | encodes a bifunctional cytosolic hydroxymethyldihydropterin pyrophosphokinase/ dihydropteroate synthase (HPPK/DHPS)that is involved in tetrahydrofolate biosynthesis and is responsive to oxidative stress. |
| AT1G69200 | Encodes a fructokinase-like protein (AT3G54090/FLN1, AT1G69200/FLN2), a member of the pfkB-carbohydrate kinase family. FLN1 and FLN2 are potential plastidial thioredoxin z (TRX z) targets. Mutants display mutant chloroplast development, general plant growth and development defects and defects in PEP-dependent transcription. The mRNA is cell-to-cell mobile. |
| AT1G69270 | RPK1 is a leucine-rich receptor-like kinase located in the plasma membrane which is upregulated by abscisic acid, dehydration, high salt, low temperature, but not by other plant hormones. RPK1 knock-out and antisense plants show an ABA-insensitive phenotype. RPK1 plays a role in ABA-controlled cell proliferation and is a regulator of the ABA signal transduction pathway. Overexpression of the LRR domain has a dominant negative effect on RPK1. Mutations in RPK1 uncouple cotyledon anlagen and primordia by modulating epidermal cell shape and polarity. |
| AT1G69440 | Encodes ARGONAUTE7, a member of the ARGONAUTE family, characterised by the presence of PAZ and PIWI domains. Involved in the regulation of developmental timing. Required for the accumulation of TAS3 ta-siRNAs but not for accumulation of miR171, miR173, miR390 or mi391. Localized in mature rosette leaves and floral buds. |
| AT1G69480 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT1G69526 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G69540 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. |
| AT1G69550 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT1G69572 | Circadian regulated lncRNA, natural antisense gene of CDF5 (AT1G69570). Displays antiphasic expression pattern in relation to CDF5 expression (PMID:28758689). |
| AT1G69580 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G69630 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G69730 | Wall-associated kinase family protein;(source:Araport11) |
| AT1G69790 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G69820 | Note that conflicting nomenclature exists in the literature: At1g69820 is named as GGT4 in Plant J. 2007 Mar 49(5):878-88; and as GGT3 in Plant Physiol. 2007 Aug 144(4):1715-32. |
| AT1G69840 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT1G69860 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G69880 | thioredoxin H-type 8;(source:Araport11) |
| AT1G70120 | transmembrane protein, putative (DUF1163);(source:Araport11) |
| AT1G70370 | Polygalacturonase involved in cell wall modification. |
| AT1G70410 | Encodes a putative beta-carbonic anhydrase betaCA4. Together with betaCA1 (At3g01500) regulates CO2-controlled stomatal movements in guard cells, as well as attenuates immunity. Differential CA gene expression in response to changing atmospheric CO2 conditions contribute to altered disease resistance levels. |
| AT1G70420 | DNA ligase-like protein, putative (DUF1645);(source:Araport11) |
| AT1G70430 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G70440 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. |
| AT1G70480 | Protein residing in the chloroplast outer membrane, has channel-like properties facilitating the export of the jasmonate precursor 12-oxophytodienoic acid (OPDA) from the chloroplast. |
| AT1G70550 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT1G70670 | The gene encodes a stress-responsive and OB-associated non-seed caleosin-like protein. It plays a negative regulator role in ABA signaling. |
| AT1G70750 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT1G70820 | phosphoglucomutase, putative / glucose phosphomutase;(source:Araport11) |
| AT1G70830 | MLP-like protein 28;(source:Araport11) |
| AT1G71000 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G71002 | Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUCGUUGUCUGUUCGACCUU. Regulates flavonoid-specific MYB transcription factor genes resulting in resistance to pathogen infection. |
| AT1G71040 | Encodes LPR2. Function together with LPR1 (AT1G23010) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
| AT1G71120 | Contains lipase signature motif and GDSL domain. |
| AT1G71380 | cellulase 3;(source:Araport11) |
| AT1G71530 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G71830 | Plasma membrane LRR receptor-like serine threonine kinase expressed during embryogenesis in locules until stage 6 anthers, with higher expression in the tapetal cell layer. SERK1 and SERK2 receptor kinases function redundantly as an important control point for sporophytic development controlling male gametophyte production. SERK1 interacts with and transphosphorylates EMS1 |
| AT1G71880 | Sucrose transporter gene induced in response to nematodes; member of Sucrose-proton symporter family. The mRNA is cell-to-cell mobile. |
| AT1G71940 | SNARE associated Golgi protein family;(source:Araport11) |
| AT1G72100 | late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11) |
| AT1G72150 | novel cell-plate-associated protein that is related in sequence to proteins involved in membrane trafficking in other eukaryotes The mRNA is cell-to-cell mobile. |
| AT1G72180 | Encodes a leucine-rich repeat receptor kinase that functions as a receptor for CEP1 peptide. Mediates nitrate uptake signaling. |
| AT1G72220 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G72330 | Encodes for alanine aminotransferase ALAAT2. |
| AT1G72350 | MADS-box transcription factor family protein;(source:Araport11) |
| AT1G72410 | COP1-interacting protein-like protein;(source:Araport11) |
| AT1G72430 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G72460 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G72470 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT1G72480 | Lung seven transmembrane receptor family protein;(source:Araport11) |
| AT1G72500 | inter alpha-trypsin inhibitor, heavy chain-like protein;(source:Araport11) |
| AT1G72530 | Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
| AT1G72610 | germin-like protein (GLP1) |
| AT1G72620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G72720 | hypothetical protein (DUF3511);(source:Araport11) |
| AT1G72760 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G72780 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT1G72970 | Originally identified as a mutation that causes floral organs to fuse together. About 10-20% of mutants also have defects in ovules. Mutants have reduced fertility most likely as because of fusions that pistil emergence. The protein has similarity to the mandelonitrile lyase family of FAD containing oxidoreductases and is predicted to be secreted (SignalP).It is expressed in all tissue layers of roots, inflorescences, stems, leaves, and flowers and is also expressed in siliques. Expression is highest in inflorescence and flower tissue.Transmission of mutant alleles to the progeny shows non mendelian segregation- a percentage of mutant alleles revert back to a previous parental (e.g. grandparental) wild type allele. It has been suggested that an RNA template driven or other extra-DNA genomic mechanism may be responsible for the non-mendelian inheritance of HTH. Reversion events in alleles at other loci have also been observed to occur in plants with an hth mutant background indicating a genome wide effect. |
| AT1G72980 | LOB domain-containing protein 7;(source:Araport11) |
| AT1G73040 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G73170 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G73220 | Encodes Organic Cation Transporter 1 (OCT1), likely to be involved in polyamine transport. |
| AT1G73340 | ADTO1 is required for the activation of systemic acquired resistance. |
| AT1G73360 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. It is involved in trichome branching. The transcription factor directly upregulates the expression of several cell-wall-loosening protein genes and reveals the important role that these target genes play in coordinating cell-wall extensibility with root development. |
| AT1G73370 | Encodes a protein with sucrose synthase activity (SUS6). |
| AT1G73440 | calmodulin-like protein;(source:Araport11) |
| AT1G73490 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G73500 | member of MAP Kinase Kinase family. Autophosphorylates and also phosphorylates MPK3 and MPK6. Independently involved in ethylene and calmalexin biosynthesis. Induces transcription of ACS2, ACS6, ERF1, ERF2, ERF5, ERF6, CYP79B2, CYP79B3, CYP71A13 and PAD3. |
| AT1G73680 | Encodes an alpha dioxygenase. Recombinant protein catalyzes the conversion of a wide range of fatty acids into 2(R)-hydroperoxy derivatives. |
| AT1G73780 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G73805 | Encodes SAR Deficient 1 (SARD1), a key regulator for ICS1 (Isochorismate Synthase 1) induction and salicylic acid (SA) synthesis. |
| AT1G73860 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G73870 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT1G74100 | encodes a desulfoglucosinolate sulfotransferase, involved in the final step of glucosinolate core structure biosynthesis. Has a broad-substrate specificity with different desulfoglucosinolates, the best substrate is indole-3-methyl-dsGS, followed by benzyl-dsGS. Expression was induced by wounding, jasmonate and ethylene stimulates. |
| AT1G74110 | member of CYP78A |
| AT1G74150 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G74180 | receptor like protein 14;(source:Araport11) |
| AT1G74220 | homeobox-like protein;(source:Araport11) |
| AT1G74480 | RWP-RK domain-containing protein;(source:Araport11) |
| AT1G74750 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G74770 | zinc ion binding protein;(source:Araport11) |
| AT1G74810 | HCO3- transporter family;(source:Araport11) |
| AT1G74820 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT1G74870 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G74940 | cyclin-dependent kinase, putative (DUF581);(source:Araport11) |
| AT1G74960 | Encodes a plastidic beta-ketoacyl-ACP synthase II, involved in fatty acid elongation from 16:0-ACP to 18:0-ACP. Homozygous knock-out mutants are embryo lethal, indicating early embryo development is sensitive to elevated 16:0. |
| AT1G75030 | encodes a PR5-like protein |
| AT1G75100 | Contains a J-domain at the C-terminus which is similar to the J-domain of auxilin, a clathrin-uncoating factor in cow, yeast and worm. Arabidopsis contains 6 other proteins similar to auxilin. Expressed in leaves and stems, but not in roots. Localized in the cytoplasm. Required for the chloroplast accumulation response, but not for the avoidance response. No molecular function known. Influences the composition of photosynthetic pigments, the efficiency of photosynthesis, and the CO2 uptake rate. Positive effect on water use efficiency (WUE) by reducing stomatal aperture and water vapor conductance; involved in the fine-tuning of H2O2 foliar levels, antioxidant enzymes activities and cell death after UV-C photooxidative stress. |
| AT1G75110 | Encodes an arabinosyltransferase that modifies extensin proteins in root hair cells. |
| AT1G75260 | oxidoreductases, acting on NADH or NADPH;(source:Araport11) |
| AT1G75261 | Pseudogene of AT4G39230; isoflavone reductase, putative |
| AT1G75410 | BEL1-like homeodomain 3 (BLH3) |
| AT1G75430 | BEL1-like homeodomain 11;(source:Araport11) |
| AT1G75530 | Forkhead-associated (FHA) domain-containing protein;(source:Araport11) |
| AT1G75700 | HVA22-like protein G;(source:Araport11) |
| AT1G75720 | WEB family protein (DUF827);(source:Araport11) |
| AT1G76050 | Pseudouridine synthase family protein;(source:Araport11) |
| AT1G76130 | alpha-amylase, putative / 1,4-alpha-D-glucan glucanohydrolase, putative, strong similarity to alpha-amylase GI:7532799 from (Malus x domestica);contains Pfam profile PF00128: Alpha amylase, catalytic domain. Predicted to be secreted based on SignalP analysis. |
| AT1G76180 | Encodes a dehydrin protein whose expression is induced early on in response to dehydration stress. This gene's expression to cold occurs in two waves, with early induction occurring within 1 h and secondary induction occurring 5 h after the beginning of cold stress. Expression is also induced in response to ABA but not in response to 2,4-D, BA, and GA3. ERD14 protein is capable of binding Ca2+, especially when the protein is phosphorylated. |
| AT1G76290 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G76310 | core cell cycle genes |
| AT1G76360 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G76560 | CP12 domain-containing protein 3;(source:Araport11) |
| AT1G76600 | PADRE protein up-regulated after infection by S. sclerotiorun. |
| AT1G76780 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT1G76890 | encodes a plant trihelix DNA-binding protein |
| AT1G76892 | Natural antisense transcript overlaps with AT1G76890;(source:Araport11) |
| AT1G76980 | patatin-like phospholipase domain protein;(source:Araport11) |
| AT1G77020 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT1G77110 | Rate-limiting factor in saturable efflux of auxins. PINs are directly involved of in catalyzing cellular auxin efflux. |
| AT1G77120 | Catalyzes the reduction of acetaldehyde using NADH as reductant. Requires zinc for activity. Dimer. Anaerobic response polypeptide (ANP). Fermentation. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. The mRNA is cell-to-cell mobile. |
| AT1G77150 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G77210 | AtSTP14 belongs to the family of sugar transport proteins (AtSTPs)in volved in monosaccharide transport. Heterologous expression in yeast revealed that AtSTP14 is the transporter specifc for galactose and does not transport other monosaccharides such as glucose or fructose. |
| AT1G77320 | Mutant is defective in meiosis and produces abnormal microspores. Encodes a BRCT-domain-containing protein that could be specific to the meiotic cell cycle and that plays a crucial role in some DNA repair events independent of SPO11 DSB recombination repair. |
| AT1G77480 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G77550 | tubulin-tyrosine ligase;(source:Araport11) |
| AT1G77620 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G77750 | Ribosomal protein S13/S18 family;(source:Araport11) |
| AT1G77840 | Translation initiation factor IF2/IF5;(source:Araport11) |
| AT1G77932 | FANTASTIC four protein, putative (DUF3049);(source:Araport11) |
| AT1G78010 | tRNA modification GTPase;(source:Araport11) |
| AT1G78120 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT1G78140 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G78160 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G78320 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G78340 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G78390 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
| AT1G78400 | PGX2 is a cell wall protein that codes for a polygalacturonase. |
| AT1G78450 | SOUL heme-binding family protein;(source:Araport11) |
| AT1G78490 | member of CYP708A family. The mRNA is cell-to-cell mobile. |
| AT1G78520 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT1G78640 | B3 domain protein;(source:Araport11) |
| AT1G78670 | gamma-glutamyl hydrolase 3;(source:Araport11) |
| AT1G78750 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G78910 | Pseudouridine synthase family protein;(source:Araport11) |
| AT1G78940 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT1G78970 | Lupeol synthase. Converts oxidosqualene to multiple triterpene alcohols and a triterpene diols. This conversion proceeds through the formation of a 17β-dammarenyl cation. |
| AT1G78980 | STRUBBELIG-receptor family 5;(source:Araport11) |
| AT1G78990 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G79110 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT1G79130 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G79245 | pseudogene of Winged helix-turn-helix transcription repressor DNA-binding protein;(source:Araport11) |
| AT1G79250 | AGC kinase 1.7;(source:Araport11) |
| AT1G79270 | evolutionarily conserved C-terminal region 8;(source:Araport11) |
| AT1G79330 | Metacaspase AtMCPb2/AMC6. Caspase family protein. Arginine/lysine-specific cysteine protease activity. Induces apoptosis in yeast. Contains Pfam domain, PF00656: ICE-like protease (caspase) p20 domain. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
| AT1G79370 | member of CYP79C |
| AT1G79400 | member of Putative Na+/H+ antiporter family |
| AT1G79410 | organic cation/carnitine transporter5;(source:Araport11) |
| AT1G79430 | Encodes gene product that is required for several aspects of phloem development in the root: (1) the specific divisions organizing the phloem pole, (2) sieve element differentiation and (3) the expression of a companion-specific gene. Mutant has a defect in the organization of phloem poles in the root. apl seedlings have a short, determinate root with only occasional lateral branches. |
| AT1G79480 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT1G79550 | Encodes cytosolic phosphoglycerate kinase (PGK3). Expression studies in PGK mutants showed that PGK1 and PGK3 were down-regulated in pgk3.2 and pgk1.1, respectively. These results indicate that the down-regulation of photosynthetic activity could be a plant strategy when glycolysis is impaired to achieve metabolic adjustment and optimize growth. |
| AT1G79610 | Encodes an endosomal Na(+)/H(+) antiporter: AT1G54370 (NHX5), AT1G79610 (NHX6). Double knockout nhx5 nhx6 showed reduced growth, with smaller and fewer cells and increased sensitivity to salinity. |
| AT1G79620 | VRLK1 is a LRR kinase involved in switching between cell elongation and secondary cell wall thickening.VRLK1 is a member of a gene family that includes a small number of recently duplicated paralogs. |
| AT1G79760 | Identified as target of the AGL15 binding motif CArG. |
| AT1G80050 | Encodes an adenosine phosphoribosyl transferase(E.C:2.4.2.7), a constitutively expressed enzyme involved in the one-step salvage of adenine to AMP. This isozyme has high affinity for cytokinins and is likely to be localized to the cytosol. |
| AT1G80150 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G80240 | DUF642 gene |
| AT1G80320 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G80470 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G80540 | envelope glycoprotein B;(source:Araport11) |
| AT1G80570 | RNI-like superfamily protein;(source:Araport11) |
| AT1G80940 | Snf1 kinase interactor-like protein;(source:Araport11) |
| AT1G80950 | Encodes an acyl-CoA: lysophosphatidylethanolamine acyltransferase with 16:0-CoA being the best acyl donor. Mutations adversely affect the growth of plants and result in decreased lipid content in roots and seeds. |
| AT1G80960 | F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT2G01200 | Belongs to auxin inducible gene family. |
| AT2G01275 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT2G01290 | Cytosolic ribose-5-phosphate isomerase. Knockout mutation causes chloroplast dysfunction, late flowering and premature cell death. |
| AT2G01300 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
| AT2G01440 | Encodes an ortholog of the bacterial RecG translocase, an organellar protein with multiple roles in mtDNA maintenance. The protein is targeted to mitochondria and plastids and is required for recombination-dependent repair and for suppression of ectopic recombination in mitochondria, most likely because of its role in recovery of stalled replication forks. |
| AT2G01550 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.9e-48 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
| AT2G01667 | hypothetical protein;(source:Araport11) |
| AT2G01780 | Curculin-like (mannose-binding) lectin family protein;(source:Araport11) |
| AT2G01810 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT2G01860 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G01880 | PEP complex component. |
| AT2G01920 | ENTH/VHS/GAT family protein;(source:Araport11) |
| AT2G01950 | Encodes a leucine rich repeat receptor kinase and associated with provascular/procambial cells. Similar to BRI, brassinosteroid receptor protein. |
| AT2G01960 | Member of TETRASPANIN family |
| AT2G02030 | F-box family protein;(source:Araport11) |
| AT2G02070 | RAVEN is part of the network regulated by BLJUEJAY, JACKDAW, SACRECROW and SHORT-ROOT to regulate root tissue patterning through cell lineage specification and asymmetric cell division. RAVEN is directly activated by SHORT-ROOT and directly repressed by JACKDAW. |
| AT2G02080 | C2H2 BIRD transcription factor family. |
| AT2G02240 | F-box family protein;(source:Araport11) |
| AT2G02270 | pseudogene of phloem protein 2-B2;(source:Araport11) |
| AT2G02300 | phloem protein 2-B5;(source:Araport11) |
| AT2G02380 | Encodes glutathione transferase belonging to the zeta class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT2G02400 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G02440 | transmembrane protein;(source:Araport11) |
| AT2G02580 | member of CYP71B |
| AT2G02700 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G02950 | Encodes a basic soluble protein which can independently bind to either PHYA or PHYB, regardless of whether the phytochromes are in the Pr or Pfr state. PKS1 can be phosphorylated by oat phyA in vitro in a light regulated manner. It is postulated to be a negative regulator of phyB signalling. |
| AT2G03010 | hypothetical protein (DUF577);(source:Araport11) |
| AT2G03050 | A locus involved in embryogenesis. Mutations in this locus result in embryo lethality. |
| AT2G03090 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G03130 | Ribosomal protein L12/ ATP-dependent Clp protease adaptor protein ClpS family protein;(source:Araport11) |
| AT2G03160 | SKP1-like 19;(source:Araport11) |
| AT2G03190 | one of SKP1 homologs. Gene is expressed specifically in the silique. |
| AT2G03200 | Atypical aspartic protease which modulates lateral root development. |
| AT2G03230 | GCK domain-containing protein;(source:Araport11) |
| AT2G03460 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G03520 | Encodes AtUPS4, a member of the Arabidopsis ureide permease family. |
| AT2G03565 | hypothetical protein;(source:Araport11) |
| AT2G03720 | Involved in root hair development |
| AT2G03760 | Encodes a brassinosteroid sulfotransferase. In vitro experiements show that this enzyme has a preference for 24-epibrassinosteroids, particularly 24-epicathasterone, but does not act on castasterone and brassinolide. It also shows sulfating activity toward flavonoids. It is differentially expressed during development, being more abundant in young seedlings and actively growing cell cultures. Expression is induced in response to salicylic acid and methyl jasmonate and bacterial pathogens. |
| AT2G03800 | encodes a D-aminoacyl-tRNA deacylase. Involved in detoxification of D-aminoacyl-tRNA. Mutants also show ethanol-hypersensitive phenotype. |
| AT2G03980 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G04030 | Encodes a chloroplast-targeted 90-kDa heat shock protein located in the stroma involved in red-light mediated deetiolation response and crucial for protein import into the chloroplast stroma. Mutants are resistant to chlorate, have elongated hypocotyls in light, and affect the expression of NR2, CAB, and RBCS but NOT NR1 and NiR. |
| AT2G04036 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 2.6e-169 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
| AT2G04050 | MATE efflux family protein;(source:Araport11) |
| AT2G04063 | glycine-rich protein;(source:Araport11) |
| AT2G04066 | MATE efflux family protein;(source:Araport11) |
| AT2G04070 | Expression in rosette leaves is activated by high concentration of boron. |
| AT2G04160 | isolated from differential screening of a cDNA library from auxin-treated root culture. encodes a protein similar to subtilisin-like serine protease which is believed to be active outside the plant cell. |
| AT2G04190 | TRAF-like family protein;(source:Araport11) |
| AT2G04220 | DUF868 family protein (DUF868);(source:Araport11) |
| AT2G04250 | pseudogene of ribonuclease H;(source:Araport11) |
| AT2G04290 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.1e-36 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G04530 | Encodes a protein with RNAse Z activity suggesting a role in tRNA processing. Protein contains a signal sequence for import into the chloroplast. |
| AT2G04690 | Pyridoxamine 5-phosphate oxidase family protein;(source:Araport11) |
| AT2G04790 | PTB domain engulfment adapter;(source:Araport11) |
| AT2G04810 | F-box only protein (DUF295);(source:Araport11) |
| AT2G04820 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.8e-214 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G04840 | F-box only protein (DUF295);(source:Araport11) |
| AT2G04890 | Encodes a scarecrow-like protein (SCL21). Member of GRAS gene family. |
| AT2G05090 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G37080.1);(source:TAIR10) |
| AT2G05120 | Nucleoporin, Nup133/Nup155-like protein;(source:Araport11) |
| AT2G05330 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT2G05420 | TRAF-like family protein;(source:Araport11) |
| AT2G05430 | Ubiquitin-specific protease family C19-related protein;(source:Araport11) |
| AT2G05440 | GLYCINE RICH PROTEIN 9;(source:Araport11) |
| AT2G05490 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.4e-88 P-value blast match to Q9SL18 /349-510 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT2G05580 | Glycine-rich protein family;(source:Araport11) |
| AT2G05600 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT2G05760 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT2G05940 | Encodes a receptor-like cytoplasmic kinase that phosphorylates the host target RIN4, leading to the activation of a plant innate immune receptor RPM1. |
| AT2G06020 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT2G06060 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.7e-05 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G06210 | Encodes a yeast CTR9 homolog that is involved in the control of flowering time by elevating FLC expression to a level that creates the vernalization-responsive, winter-annual habit. Yeast CTR9 is a component of a five-member PAF1 complex that associates with RNA pol II and is thought to regulate gene expression by recruiting SET1 (a histone 3 Lys 4 [H3-K4] methyl transferase) to the initially transcribed [5'] regions of target chromatin. Mutants display reduced H3-K4 methylation in both FLC and FLM chromatin. Member of PAF-C complex. |
| AT2G06480 | transposable_element_gene;(source:Araport11) |
| AT2G06500 | hAT family dimerization domain-containing protein;(source:Araport11) |
| AT2G06770 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.7e-15 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G06840 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-184 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G06908 | hypothetical protein;(source:Araport11) |
| AT2G06980 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT2G07000 | hypothetical protein;(source:Araport11) |
| AT2G07040 | Pollen receptor kinase. Coexpression of AtPRK2a with AtRopGEF12 resulted in isotropic pollen tube growth. |
| AT2G07213 | Natural antisense transcript overlaps with AT2G07215;(source:Araport11) |
| AT2G07510 | pseudogene of Ulp1 protease family protein |
| AT2G07550 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-313 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G07560 | H[+]-ATPase 6;(source:Araport11) |
| AT2G07690 | Member of the minichromosome maintenance complex, involved in DNA replication initiation. Abundant in proliferating and endocycling tissues. Localized in the nucleus during G1, S and G2 phases of the cell cycle, and are released into the cytoplasmic compartment during mitosis. Binds chromatin. |
| AT2G07700 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.7e-21 P-value blast match to GB:226407 retrotransposon del1-46 (Gypsy_Ty3-element) (Lilium henryi);(source:TAIR10) |
| AT2G10220 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 4.3e-151 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G10430 | pseudogene of hypothetical protein;(source:Araport11) |
| AT2G10440 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
| AT2G10610 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-162 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT2G10617 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.0e-32 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G10710 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to MURA transposase of maize Mutator transposon;(source:TAIR10) |
| AT2G10790 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT2G10802 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-28 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT2G11190 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-90 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT2G11235 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.6e-94 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT2G11405 | transmembrane protein;(source:Araport11) |
| AT2G11620 | hypothetical protein;(source:Araport11) |
| AT2G11630 | pseudogene of hAT transposon superfamily protein;(source:Araport11) |
| AT2G11778 | transmembrane protein;(source:Araport11) |
| AT2G11820 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.3e-40 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G11880 | None;(source:Araport11) |
| AT2G11950 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.9e-158 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT2G12025 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.9e-47 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G12320 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32169.1);(source:TAIR10) |
| AT2G12660 | pseudogene of xyloglucan endotransglucosylase/hydrolase 21;(source:Araport11) |
| AT2G13110 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.6e-102 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT2G13116 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G13274 | Pseudogene of AT2G13150; transcription factor |
| AT2G13360 | Encodes a peroxisomal photorespiratory enzyme that catalyzes transamination reactions with multiple substrates. It is involved in photorespiration. |
| AT2G13620 | member of Putative Na+/H+ antiporter family |
| AT2G13706 | Pseudogene of AT4G15975; zinc finger (C3HC4-type RING finger) family protein |
| AT2G14070 | wound-responsive protein-like protein;(source:Araport11) |
| AT2G14090 | pseudogene of F-box/RNI-like superfamily protein;(source:Araport11) |
| AT2G14200 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.0e-133 P-value blast match to gb|AAO73523.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT2G14247 | Expressed protein;(source:Araport11) |
| AT2G14500 | F-box family protein;(source:Araport11) |
| AT2G14530 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT2G14540 | serpin 2;(source:Araport11) |
| AT2G14550 | pseudogene of RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G14670 | sucrose-proton symporter 8;(source:Araport11) |
| AT2G14800 | hypothetical protein;(source:Araport11) |
| AT2G14830 | Ist1p;(source:Araport11) |
| AT2G14835 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G14980 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.2e-247 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
| AT2G15090 | Encodes KCS8, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). The mRNA is cell-to-cell mobile. |
| AT2G15140 | transposable_element_gene;(source:Araport11);pseudogene, Ulp1 protease family, contains Pfam profile PF02902: Ulp1 protease family, C-terminal catalytic domain;(source:TAIR10) |
| AT2G15220 | Plant basic secretory protein (BSP) family protein;(source:Araport11) |
| AT2G15310 | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor (GI:861205) (Chlamydomonas reinhardtii), other ARFs and ARF-like proteins. |
| AT2G15325 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT2G15350 | member of Glycosyltransferase Family- 37 |
| AT2G15370 | Predicted fucosyltransferase, based on similarity to FUT1, but not functionally redundant with FUT1. |
| AT2G15390 | Encodes an alpha-(1,2)-fucosyltransferase. |
| AT2G15490 | UDP-glycosyltransferase 73B4;(source:Araport11) |
| AT2G15630 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G15640 | F-box family protein;(source:Araport11) |
| AT2G15670 | transmembrane protein;(source:Araport11) |
| AT2G15680 | Encodes a calmodulin-like protein. |
| AT2G15695 | peptide methionine sulfoxide reductase (Protein of unknown function DUF829, transmembrane 53);(source:Araport11) |
| AT2G15740 | Member of a small family of zinc finger containing putative transcription factors.Similar to GAZ. |
| AT2G15760 | calmodulin-binding protein (DUF1645);(source:Araport11) |
| AT2G15910 | CSL zinc finger domain-containing protein;(source:Araport11) |
| AT2G16010 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G07630.1);(source:TAIR10) |
| AT2G16060 | Encodes a class 1 nonsymbiotic hemoglobin induced by low oxygen levels with very high oxygen affinity. It is not likely to be a hemoglobin transporter because of its extremely high affinity for oxygen. Overexpression impairs cold stress-induced nitric oxide (NO) production. |
| AT2G16120 | polyol/monosaccharide transporter 1;(source:Araport11) |
| AT2G16130 | polyol/monosaccharide transporter 2;(source:Araport11) |
| AT2G16230 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT2G16300 | F-box family protein;(source:Araport11) |
| AT2G16310 | pseudogene of endoplasmatic reticulum retrieval protein 1B;(source:Araport11) |
| AT2G16360 | 40S ribosomal protein S25;(source:Araport11) |
| AT2G16380 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT2G16420 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.8e-39 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G16450 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G16520 | RING/U-box protein with C6HC-type zinc finger protein;(source:Araport11) |
| AT2G16700 | Encodes actin depolymerizing factor 5 (ADF5). |
| AT2G16730 | putative beta-galactosidase (BGAL13 gene) |
| AT2G16740 | ubiquitin-conjugating enzyme 29;(source:Araport11) |
| AT2G16750 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT2G16760 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT2G16810 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G16840 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-06 P-value blast match to GB:AAC64917 gag-pol polyprotein (Ty1_Copia-element) (Glycine max);(source:TAIR10) |
| AT2G17000 | Mechanosensitive ion channel family protein;(source:Araport11) |
| AT2G17040 | Member of the NAC transcription factor family and more specifically, the ONAC022 subfamily. Involved in leaf and inflorescence stem morphogenesis. The mRNA is cell-to-cell mobile. |
| AT2G17043 | hypothetical protein;(source:Araport11) |
| AT2G17050 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT2G17060 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT2G17090 | Encodes a N-myrystolylated plasma membrane associated member of the RLCK II family of IRAK/Pelle-like kinases that regulates the MAPK pathway that promotes the elongation of the Arabidopsis zygote and the development of its basal daughter cell into the extra-embryonic suspensor. SSP transcripts are produced in mature pollen but are not translated until delivery to the zygote and the endosperm after fertilization, exerting a paternal effect on embryonic development. The primary role of its kinase domain may lie in protein binding rather than in catalysis as key residues of the active site are absent. |
| AT2G17150 | Plant regulator RWP-RK family protein;(source:Araport11) |
| AT2G17160 | Interleukin-1 receptor-associated kinase 4 protein;(source:Araport11) |
| AT2G17170 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G17440 | Encodes PIRL5, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. The mRNA is cell-to-cell mobile. |
| AT2G17460 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 5.5e-22 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT2G17470 | Encodes ALMT6, a member of the aluminum-activated malate transporter family. |
| AT2G17477 | Pseudogene of AT3G22350; F-box family protein |
| AT2G17580 | Encodes a bacterial-type poly(A) polymerase, AGS1. |
| AT2G17590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G17630 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT2G17670 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G17720 | Encodes a prolyl 4-hydroxylase that modifies the extensin proteins in root hair cells. |
| AT2G17740 | VACUOLELESS GAMETOPHYTES (VLG) as a DC1 domain containing protein that is found in the endomembrane system. It is essential for both female and male gametophyte development. |
| AT2G17770 | Encodes a paralog of bZIP transcription factor FD. This protein interacts with FD and FT. |
| AT2G17780 | Encodes a mechanosensitive channel candidate MCA2. The three-dimensional structure of MCA2 was reconstructed and appears to comprise a small transmembrane region and large cytoplasmic region. |
| AT2G17820 | Encodes a member of the histidine kinase family. |
| AT2G17840 | Identified as drought-inducible gene by differential hybridization. Upregulated by high light, drought, cold and salt stress determined by microarray analysis. |
| AT2G17890 | Encodes a member of Calcium Dependent Protein Kinase. Protein is N-myristoylated. Localizes to the plasma membrane. Localizes to the chloroplast when the myristoylation motif is mutated. |
| AT2G17940 | WEB family protein (DUF827);(source:Araport11) |
| AT2G18060 | Encodes a NAC-domain transcription factor that is expressed in developing vessels and protoxylem. Along with other members of this family, VND1 appears to regulate the development of genes required for secondary cell wall biosynthesis. |
| AT2G18140 | Peroxidase superfamily protein;(source:Araport11) |
| AT2G18150 | Peroxidase superfamily protein;(source:Araport11) |
| AT2G18190 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G18193 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G18260 | member of SYP11 Gene Family |
| AT2G18300 | DNA-binding bHLH protein involved in positive regulation of cell elongation and proliferation and, negative control of plant immunity.One component of PRE-IBH1-HBI1 tripartite module. |
| AT2G18330 | AAA-type ATPase family protein;(source:Araport11) |
| AT2G18380 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT2G18480 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G18500 | ovate family protein 7;(source:Araport11) |
| AT2G18540 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT2G18550 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT2G18570 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G18640 | Encodes an endoplasmic reticulum-targeted geranylgeranyl pyrophosphate synthase |
| AT2G18700 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. |
| AT2G18800 | xyloglucan endotransglucosylase/hydrolase 21;(source:Araport11) |
| AT2G18810 | B3 domain protein (DUF313);(source:Araport11) |
| AT2G18860 | Syntaxin/t-SNARE family protein;(source:Araport11) |
| AT2G18876 | Encodes a microtubule-associated protein. |
| AT2G18890 | RLCK VI_A class kinase which activity is regulated by Rho-of-plants (ROP) GTPases. Controls seedling and plant growth in parallel with gibberrellin. |
| AT2G19070 | encodes a protein whose sequence is similar to anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (gi:2239091). BAHD acyltransferase. Uses hydroxycinnamoyl CoAs, including caffeoyl/feruoyl/p-coumaroyl/sinapoyl-CoA as acyl donors to fully substitute the N1, N5, and N10 positions of spermidine. |
| AT2G19190 | Encodes a receptor-like protein kinase that is involved in early defense signaling. Expression of this gene is strongly induced during leaf senescence. It is a target of the transcription factor AtWRKY6. |
| AT2G19200 | pseudogene of hypothetical protein (DUF626);(source:Araport11) |
| AT2G19210 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT2G19220 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
| AT2G19230 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT2G19410 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT2G19420 | hypothetical protein;(source:Araport11) |
| AT2G19460 | DUF3511 domain protein (DUF3511);(source:Araport11) |
| AT2G19500 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT2G19530 | transmembrane protein;(source:Araport11) |
| AT2G19580 | Member of TETRASPANIN family |
| AT2G19610 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G19700 | hypothetical protein;(source:Araport11) |
| AT2G19755 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.2e-08 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT2G19830 | SNF7 family protein;(source:Araport11) |
| AT2G19890 | hypothetical protein;(source:Araport11) |
| AT2G19893 | Encodes a defensin-like (DEFL) family protein. |
| AT2G19910 | RNA-dependent RNA polymerase family protein;(source:Araport11) |
| AT2G19960 | hAT family dimerization domain-containing protein;(source:Araport11) |
| AT2G20000 | Required for cell division and cell differentiation in meristems. Encodes a homolog of the CDC27 subunit of the anaphase-promoting complex (APC). Unlike other CDC27 homologs in Arabidopsis, its transcription is cell cycle regulated. Strong hbt mutants give rise to seedlings that lack an anatomically recognizable quiescent center and differentiated columella root cap cells, the cell types derived from the wild-type hypophysis. Furthermore, they have no mitotically active root meristem and lack a differentiated lateral root cap. |
| AT2G20030 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G20110 | Tesmin/TSO1-like CXC domain-containing protein which is a transcriptional repressor of genes required for maintenance of DNA methylation, including MET1, CMT3, DDM1, KYP and VIMs. Functions redundantly with its paralogue TCX5 in repressing the expression of these genes. |
| AT2G20160 | E3 ubiquitin ligase SCF complex subunit SKP1/ASK1 family protein;(source:Araport11) |
| AT2G20180 | Encodes a novel Myc-related bHLH transcription factor that has transcriptional activation activity in the dark. It is a key negative regulator of phytochrome-mediated seed germination and acts by inhibiting chlorophyll biosynthesis, light-mediated suppression of hypocotyl elongation and far-red light-mediated suppression of seed germination, and promoting negative gravitropism in hypocotyls. Light reduces this activity in a phy-dependent manner. The protein preferentially interacts with the Pfr forms of Phytochrome A (PhyA) and Phytochrome B (PhyB), is physically associated with APRR1/TOC1 and is degraded in red (R) and far-red (FR) light through the ubiquitin (ub)-26S proteasome pathway to optimize photomorphogenic development in Arabidopsis. It also negatively regulates GA3 oxidase expression. |
| AT2G20230 | Tetraspanin family protein;(source:Araport11) |
| AT2G20350 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT2G20360 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G20380 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G20420 | ATP citrate lyase (ACL) family protein;(source:Araport11) |
| AT2G20510 | One of two loci encoding the TIM44 subunit of the mitochondrial inner membrane translocase complex. TIM44 subunit is the part of the complex that hydrolyzes ATP to provide energy for protein translocation to the inner membrane. |
| AT2G20625 | hypothetical protein (DUF626);(source:Araport11) |
| AT2G20635 | protein kinase and Mad3-BUB1-I domain-containing protein;(source:Araport11) |
| AT2G20670 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
| AT2G20720 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G20800 | NAD(P)H dehydrogenase B4;(source:Araport11) |
| AT2G20970 | lipid-binding protein;(source:Araport11) |
| AT2G21060 | Glycine-rich protein (AtGRP2b). Also named as CSP4 (cold shock domain protein 4) containing a well conserved cold shock domain (CSD) and glycine-rich motifs interspersed by two retroviral-like CCHC zinc fingers. AtCSP4 is expressed in all tissues but accumulates in reproductive tissues and those undergoing cell divisions. Overexpression of AtCSP4 reduces silique length and induces embryo lethality. |
| AT2G21172 | Pseudogene of AT5G16486 |
| AT2G21195 | hypothetical protein;(source:Araport11) |
| AT2G21210 | Putative auxin-regulated protein whose expression is downregulated in response to chitin oligomers. |
| AT2G21220 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G21430 | Papain family cysteine protease;(source:Araport11) |
| AT2G21510 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT2G21540 | SEC14-like 3;(source:Araport11) |
| AT2G21550 | One of three DRTS genes, this is the most divergent one.THY3/DRTS3 is preferentially expressed in the shoot apex, stipules and root caps. |
| AT2G21610 | pectinesterase 11;(source:Araport11) |
| AT2G21630 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
| AT2G21640 | Encodes a protein of unknown function that is a marker for oxidative stress response.Expression in rosette leaves is activated by high concentration of boron. |
| AT2G21680 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G21720 | ArgH (DUF639);(source:Araport11) |
| AT2G21780 | hypothetical protein;(source:Araport11) |
| AT2G21830 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G21910 | member of CYP96A |
| AT2G21980 | HAUS augmin-like complex subunit;(source:Araport11) |
| AT2G22050 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G22240 | ** Referred to as MIPS1 in Mitsuhashi et al 2008. Myo-inositol-1-phosphate synthase isoform 2. Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT2G22360 | Essential for chloroplast iron?sulfur cluster biogenesis. |
| AT2G22460 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT2G22620 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
| AT2G22680 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT2G22795 | hypothetical protein;(source:Araport11) |
| AT2G22810 | key regulatory enzyme in the biosynthesis of the plant hormone ethylene. ACS4 is specifically induced by indoleacetic acid (IAA). |
| AT2G22830 | squalene epoxidase 2;(source:Araport11) |
| AT2G23000 | serine carboxypeptidase-like 10;(source:Araport11) |
| AT2G23050 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
| AT2G23060 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT2G23110 | Late embryogenesis abundant protein, group 6;(source:Araport11) |
| AT2G23170 | encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. |
| AT2G23180 | member of CYP96A |
| AT2G23200 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G23220 | member of CYP81D |
| AT2G23270 | Encoding a precursor protein of a secreted peptide that is responsive to flg22 stimulus. Finetuning role in modulation of immunity through the regulation of SA and JA biosynthesis and signalling pathways. |
| AT2G23330 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-195 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT2G23390 | acyl-CoA;(source:Araport11) |
| AT2G23400 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
| AT2G23450 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G23630 | SKU5 similar 16;(source:Araport11) |
| AT2G23660 | LOB domain-containing protein 10;(source:Araport11) |
| AT2G23700 | Itga6 (Protein of unknown function, DUF547);(source:Araport11) |
| AT2G23760 | Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw2 and saw1 may act redundantly to repress BP in leaves. Regulates together with BLH2 demethylesterification of homogalacturonan in seed mucilage. |
| AT2G23770 | Encodes a putative LysM-containing receptor-like kinase LYK4. Shares overlapping function with LYK5 in mediating chitin-triggered immune responses. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain. |
| AT2G23830 | PapD-like superfamily protein;(source:Araport11) |
| AT2G23834 | hypothetical protein;(source:Araport11) |
| AT2G23870 | pseudogene of Terpenoid cyclases family protein;(source:Araport11) |
| AT2G23880 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.4e-41 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G24070 | QWRF motif protein (DUF566);(source:Araport11) |
| AT2G24140 | myosin-J heavy chain-like protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT2G24160 | pseudogene of receptor like protein 37;(source:Araport11) |
| AT2G24180 | Encodes a cytochrome P450 monooxygenase that converts indole-3-acetonitrile to indole-3-aldehyde / indole-3-carboxylic acid and cyanide. The mRNA is cell-to-cell mobile. |
| AT2G24255 | LOW protein: F-box/kelch-repeat protein;(source:Araport11) |
| AT2G24340 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT2G24370 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT2G24420 | DNA repair ATPase-like protein;(source:Araport11) |
| AT2G24460 | C3HC4-type RING finger protein;(source:Araport11) |
| AT2G24540 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G24545 | Natural antisense transcript overlaps with AT2G24540;(source:Araport11) |
| AT2G24560 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G24620 | S-locus glycoprotein family protein;(source:Araport11) |
| AT2G24700 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
| AT2G24710 | member of Putative ligand-gated ion channel subunit family |
| AT2G24760 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.9e-16 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G24762 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
| AT2G24791 | Pseudogene of AT5G18880; glucose transmembrane transporter |
| AT2G24800 | Peroxidase superfamily protein;(source:Araport11) |
| AT2G25025 | pseudogene of AGAMOUS-like 28;(source:Araport11) |
| AT2G25040 | pseudogene of casein lytic proteinase B4;(source:Araport11) |
| AT2G25140 | Encodes ClpB4, which belongs to the Casein lytic proteinase/heat shock protein 100 (Clp/Hsp100) family. Targeted to the mitochondrion, also referred to as ClpB-m. Transcripts of ClpB4 accumulate dramatically at high temperatures, suggesting that it may be involved in response to heat stress. |
| AT2G25200 | hypothetical protein (DUF868);(source:Araport11) |
| AT2G25220 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G25240 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11). Involved in stress response regulated cell death. |
| AT2G25290 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT2G25320 | TRAF-like family protein;(source:Araport11) |
| AT2G25330 | TRAF-like family protein;(source:Araport11) |
| AT2G25380 | pseudogene of zinc finger protein-related |
| AT2G25600 | Encodes SPIK, a member of the Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mutant plants have impaired pollen-tube growth. |
| AT2G25605 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
| AT2G25770 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT2G25790 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT2G26130 | Encodes a RING-type zinc finger ubiquitin ligase involved in seed longevity.Gain of function (35S promoter) increases, and loss of function decreases, seed longevity. |
| AT2G26135 | RING/U-box protein with C6HC-type zinc finger;(source:Araport11) |
| AT2G26240 | Transmembrane proteins 14C;(source:Araport11) |
| AT2G26400 | Encodes a protein predicted to belong to the acireductone dioxygenase (ARD/ARD?)family. |
| AT2G26410 | Member of IQ67 (CaM binding) domain containing family. |
| AT2G26450 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G26480 | UDP-glucosyl transferase 76D1;(source:Araport11) |
| AT2G26500 | cytochrome b6f complex subunit (petM);(source:Araport11) |
| AT2G26530 | Pheromone receptor-like protein involved in the early elicitor signaling events which occur within minutes and include ion fluxes across the plasma membrane, activation of MPKs and the formation of ROS related to PGPS1 and WRKY33. |
| AT2G26650 | Encodes AKT1, a member of the Shaker family inward rectifying potassium channel predominantly expressed in predominantly in root hairs and root endodermis. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT2G26690 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G26692 | Natural antisense transcript overlaps with AT2G26690;(source:Araport11) |
| AT2G26695 | Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11) |
| AT2G26730 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G26750 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G26880 | AGAMOUS-like 41;(source:Araport11) |
| AT2G26950 | Member of the R2R3 factor gene family. |
| AT2G26960 | Member of the R2R3 factor gene family.Expressed in microspores and required for progression into pollen mitosis I. |
| AT2G27000 | member of CYP705A |
| AT2G27010 | member of CYP705A |
| AT2G27035 | Has been classified as a stellacyanin. Has also been classified as an early nodulin-like protein (ENODL), because it does not have a His residue involved in Cu binding. ENODLs are proteins having one plastocyanin-like (PCNL) domain lacking the amino acid residues necessary for Cu binding. |
| AT2G27060 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G27120 | Encodes a protein with similarity to DNA polymerase epsilon catalytic subunit. Based on yeast two hybrid analysis, not predicted to be a subunit of the DNA polymerase epsilon complex. No phenotype observed in homozygous mutant embryos or plants but in combination with TIL1-1/til1-1 heterozygotes arrest earlier than til1 homozygotes suggesting TIL2 functions redundantly with TIL1. |
| AT2G27160 | hypothetical protein;(source:Araport11) |
| AT2G27180 | hypothetical protein;(source:Araport11) |
| AT2G27270 | transmembrane protein;(source:Araport11) |
| AT2G27410 | B3 domain protein, putative (DUF313);(source:Araport11) |
| AT2G27420 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT2G27440 | pseudogene of rac GTPase activating protein |
| AT2G27505 | FBD-like domain family protein;(source:Araport11) |
| AT2G27540 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT2G27700 | eukaryotic translation initiation factor 2 family protein / eIF-2 family protein;(source:Araport11) |
| AT2G27820 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT2G27880 | AGO5.Required for antiviral RNA silencing.Confers resistance to Potato virus X. |
| AT2G27900 | coiled-coil protein;(source:Araport11) |
| AT2G28085 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G28090 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT2G28200 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT2G28270 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G28420 | Vicinal oxygen chelate (VOC) superfamily member. |
| AT2G28490 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT2G28580 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT2G28590 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G28630 | Encodes KCS12, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT2G28690 | TOX high mobility group box protein, putative (DUF1635);(source:Araport11) |
| AT2G28720 | Histone superfamily protein;(source:Araport11) |
| AT2G28770 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT2G28780 | P-hydroxybenzoic acid efflux pump subunit;(source:Araport11) |
| AT2G28830 | Encodes a U-box E3 ubiquitin ligase involved in ubiquitination of pattern recognition receptor FLS2.pub12/pub13 double mutants enhanced chitin-induced ROS production and callose deposition suggesting they function redundantly to negatively regulate immune response to fungal elicitor. |
| AT2G28870 | cyclin-dependent kinase inhibitor SMR1-like protein;(source:Araport11) |
| AT2G28880 | ADCS encodes a protein that has two functional domains. The N-terminal domain has glutamine amidotransferase activity while the C-terminal domain has aminodeoxychorismate synthase (ADCS) activity. These two domains act together to catalyze the transformation of chorismate to 4-amino-4-deoxychorismate. This reaction is required for 4-aminobenzoate (pABA) production and ultimately for folate biosynthesis. The putative target peptide of ADCS can direct GFP to the chloroplast. |
| AT2G28970 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G29010 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G29040 | Exostosin family protein;(source:Araport11) |
| AT2G29060 | GRAS family transcription factor;(source:Araport11) |
| AT2G29090 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. This gene predominantly accumulates in dry seeds and is up-regulated immediately following imbibition. CYP707A2 appears to play a major role in the rapid decrease in ABA levels during early seed imbibition. |
| AT2G29110 | member of Putative ligand-gated ion channel subunit family |
| AT2G29120 | member of Putative ligand-gated ion channel subunit family |
| AT2G29180 | transmembrane protein;(source:Araport11) |
| AT2G29220 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G29250 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G29280 | pseudogene of tropinone reductase;(source:Araport11) |
| AT2G29300 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G29350 | Encodes a senescence associated protein required for resistance against fungal pathogens. Negative regulator of defense against bacterial pathogens. Induced by ROS. Required for defense against ROS and fungal pathogens most likely by activating anthocyanin biosynthesis. |
| AT2G29360 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G29370 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G29430 | coiled-coil protein (DUF572);(source:Araport11) |
| AT2G29480 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT2G29520 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT2G29590 | Thioesterase superfamily protein;(source:Araport11) |
| AT2G29610 | pseudogene of the F-box protein family, contains Pfam profile PF00646: F-box domain |
| AT2G29620 | dentin sialophosphoprotein;(source:Araport11) |
| AT2G29740 | UDP-glucosyl transferase 71C2;(source:Araport11) |
| AT2G29770 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G29790 | Encodes a Maternally expressed gene (MEG) family protein [pseudogene] |
| AT2G29800 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G29810 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G29820 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G29930 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT2G29940 | pleiotropic drug resistance 3;(source:Araport11) |
| AT2G29950 | Member of a small family of proteins containing DUF1313 domain. Involved in flowering time. |
| AT2G29980 | Endoplasmic reticulum enzyme responsible for the synthesis of 18:3 fatty acids from phospholipids. Uses cytochrome b5 as electron donor. |
| AT2G29990 | alternative NAD(P)H dehydrogenase 2;(source:Araport11) |
| AT2G30090 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT2G30105 | LRR/ubiquitin-like domain protein;(source:Araport11) |
| AT2G30160 | Mitochondrial iron transport protein. Member of the substrate carrier family (MCF) of protein transporters. |
| AT2G30220 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G30240 | Encodes a plasma membrane localized potassium transporter. |
| AT2G30250 | member of WRKY Transcription Factor; Group I. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. |
| AT2G30290 | VACUOLAR SORTING RECEPTOR 2;(source:Araport11) |
| AT2G30300 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G30310 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G30395 | Member of the plant specific ovate protein family of unknown function. |
| AT2G30400 | ovate family protein 2;(source:Araport11) |
| AT2G30490 | Encodes a cinnamate-4-hydroxylase. Mutations in this gene impact phenylpropanoid metabolism, growth and development. |
| AT2G30520 | Encodes a phototropin-interacting NRL protein that is an early signaling component in the phototrophic response and is essential for the phototropin-mediated chloroplast accumulation response but is not involved in the chloroplast avoidance response or stomatal opening. |
| AT2G30540 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
| AT2G30560 | Needs to be reannotated and split into two genes, AtEAL2 and AtEAL3, both encoding maize Ebb apparatus 1-like proteins. The current predicted structure is not well supported (T8, one *). The predicted proteins can be found in doi.org/10.1007/s00425-005-0174-z |
| AT2G30575 | Encodes a protein with putative galacturonosyltransferase activity. Required for synthesis of native homogalacturonan in growing pollen tubes; critical role in pollen tube growh and male fertility. |
| AT2G30600 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT2G30660 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
| AT2G30850 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT2G30900 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT2G30942 | Encodes a 56-amino acid polypeptide with low but significant similarity to human small subunit of serine palmitoyltransferase that localizes to the ER and physically interacts with and greatly stimulates the activity of LCB1/LCB2 heterodimer ser palmitoyltransferase complex. |
| AT2G31035 | oxysterol-binding-like protein;(source:Araport11) |
| AT2G31100 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G31130 | hypothetical protein;(source:Araport11) |
| AT2G31141 | hypothetical protein;(source:Araport11) |
| AT2G31250 | Glutamyl-tRNA reductase family protein;(source:Araport11) |
| AT2G31335 | hypothetical protein;(source:Araport11) |
| AT2G31345 | transmembrane protein;(source:Araport11) |
| AT2G31380 | a B-box zinc finger protein that interacts with COP1. contains a novel 11 amino acid motif at the C-terminus (also found at the N-terminus of HY5) that is involved in the COP1 interaction. |
| AT2G31410 | coiled-coil protein;(source:Araport11) |
| AT2G31460 | B3 domain protein, putative (DUF313);(source:Araport11) |
| AT2G31470 | Encodes a F-Box protein DOR (Drought tolerance Repressor) functionally as an inhibitory factor for abscisic acid-induced stomatal closure under drought stress. |
| AT2G31550 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT2G31560 | signal transducer/transcription protein, putative (DUF1685);(source:Araport11) |
| AT2G31570 | glutathione peroxidase GPx |
| AT2G31710 | Vacuolar ATPase assembly integral membrane protein VMA21-like domain-containing protein;(source:Araport11) |
| AT2G31725 | FAM136A-like protein (DUF842);(source:Araport11) |
| AT2G31760 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G31770 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G31830 | Encodes a 5-inositol-polyphosphate phosphatase, that, in vitro, shows some activity against Ins(1,4,5)P3 and PI(3,4,5)P3, but even higher activity against PI(4,5)P2 |
| AT2G31850 | hypothetical protein;(source:Araport11) |
| AT2G31862 | B3 domain protein;(source:Araport11) |
| AT2G31865 | poly(ADP-ribose) glycohydrolase 2;(source:Araport11) |
| AT2G31902 | Natural antisense transcript overlaps with AT2G31900;(source:Araport11) |
| AT2G32020 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT2G32050 | cell cycle control-like protein (DUF572);(source:Araport11) |
| AT2G32140 | transmembrane receptor;(source:Araport11) |
| AT2G32235 | hypothetical protein;(source:Araport11) |
| AT2G32290 | beta-amylase 6;(source:Araport11) |
| AT2G32350 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT2G32360 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT2G32380 | Transmembrane protein 97, predicted |
| AT2G32500 | Stress responsive alpha-beta barrel domain protein;(source:Araport11) |
| AT2G32510 | Member of MEKK subfamily involved in wound and JA induced signaling.Interacts with At5g40440, and activates At1g59580. |
| AT2G32610 | encodes a gene similar to cellulose synthase |
| AT2G32620 | encodes a gene similar to cellulose synthase |
| AT2G32630 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT2G32660 | receptor like protein 22;(source:Araport11) |
| AT2G32740 | galactosyltransferase 13;(source:Araport11) |
| AT2G32750 | Exostosin family protein;(source:Araport11) |
| AT2G32770 | purple acid phosphatase 13;(source:Araport11) |
| AT2G32800 | protein kinase family protein;(source:Araport11) |
| AT2G32820 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT2G32870 | TRAF-like family protein;(source:Araport11) |
| AT2G32930 | Encodes a zinc finger protein. |
| AT2G33010 | Ubiquitin-associated (UBA) protein;(source:Araport11) |
| AT2G33020 | receptor like protein 24;(source:Araport11) |
| AT2G33100 | encodes a gene similar to cellulose synthase |
| AT2G33160 | Gene structure annotation for AT2G33160.1 is inaccurate in TAIR10, see PMID:23709666 and Comments field on the locus page for updated annotation. |
| AT2G33200 | F-box family protein;(source:Araport11) |
| AT2G33205 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
| AT2G33233 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G33270 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. |
| AT2G33300 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT2G33320 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT2G33350 | CCT motif family protein;(source:Araport11) |
| AT2G33420 | hypothetical protein (DUF810);(source:Araport11) |
| AT2G33430 | Encodes a multiple organellar RNA editing factor, a chloroplast protein which is required for the maturation of the plastid ribosomal RNAs and is essential for chloroplast differentiation.Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
| AT2G33480 | NAC domain containing protein 41;(source:Araport11) |
| AT2G33585 | subtilisin-like protease;(source:Araport11) |
| AT2G33620 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT2G33680 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G33720 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT2G33750 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT2G33780 | VQ motif-containing protein;(source:Araport11) |
| AT2G33855 | transmembrane protein;(source:Araport11) |
| AT2G33860 | ettin (ett) mutations have pleiotropic effects on Arabidopsis flower development, causing increases in perianth organ number, decreases in stamen number and anther formation, and apical-basal patterning defects in the gynoecium. The ETTIN gene encodes a protein with homology to DNA binding proteins which bind to auxin response elements. ETT transcript is expressed throughout stage 1 floral meristems and subsequently resolves to a complex pattern within petal, stamen and carpel primordia. ETT probably functions to impart regional identity in floral meristems that affects perianth organ number spacing, stamen formation, and regional differentiation in stamens and the gynoecium. During stage 5, ETT expression appears in a ring at the top of the floral meristem before morphological appearance of the gynoecium, consistent with the proposal that ETT is involved in prepatterning apical and basal boundaries in the gynoecium primordium. It is a target of the ta-siRNA tasiR-ARF. ETT is also a target of AP2; integrateing the functions of AGAMOUS and APETALA2 in floral meristem determinacy. Positive regulation of drought stress response genes. |
| AT2G34000 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G34020 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT2G34030 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT2G34070 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TBL37 expression is regulated by MYC2 and activated in response to JA. |
| AT2G34080 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT2G34090 | maternal effect embryo arrest 18;(source:Araport11) |
| AT2G34150 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
| AT2G34270 | hypothetical protein;(source:Araport11) |
| AT2G34280 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G34360 | MATE efflux family protein;(source:Araport11) |
| AT2G34380 | Membrane protein involved in lipid droplet biogenesis primarily in pollen. The interaction between VAP27-1 and SEIPIN3 requires the N-terminal 25 amino acids of SEIPIN3 that contain an FFAT motif. |
| AT2G34430 | Photosystem II type I chlorophyll a/b-binding protein The mRNA is cell-to-cell mobile. |
| AT2G34530 | transmembrane protein;(source:Araport11) |
| AT2G34610 | cotton fiber protein;(source:Araport11) |
| AT2G34655 | hypothetical protein;(source:Araport11) |
| AT2G34740 | protein phosphatase 2C family protein;(source:Araport11) |
| AT2G34750 | RNA polymerase I specific transcription initiation factor RRN3 protein;(source:Araport11) |
| AT2G34820 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT2G34830 | member of WRKY Transcription Factor; Group II-e |
| AT2G34850 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G34890 | Cytidine triphosphate synthase. |
| AT2G35080 | ATP binding / aminoacyl-tRNA ligase/ nucleotide binding protein;(source:Araport11) |
| AT2G35345 | hypothetical protein;(source:Araport11) |
| AT2G35380 | Peroxidase superfamily protein;(source:Araport11) |
| AT2G35382 | snoRNA;(source:Araport11) |
| AT2G35430 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT2G35480 | envelope glycoprotein;(source:Araport11) |
| AT2G35585 | cystic fibrosis transmembrane conductance regulator;(source:Araport11) |
| AT2G35615 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G35650 | a member of Glycosyltransferase- Family 2 and encodes a beta-mannan synthase based on in vitro enzyme assays from heterologously expressed protein. Mutants exhibit defects in pollen tube growth and embryo development. The defective embryonic development was associated with reduced proliferation and failed cellularization of the endosperm. |
| AT2G35770 | serine carboxypeptidase-like 28;(source:Araport11) |
| AT2G35890 | member of Calcium Dependent Protein Kinase |
| AT2G35900 | Mal d 1-associated protein;(source:Araport11) |
| AT2G35930 | Encodes a cytoplasmically localized U-box domain containing E3 ubiquitin ligase that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT2G35945 | Natural antisense transcript overlaps with AT2G35940;(source:Araport11) |
| AT2G35950 | embryo sac development arrest 12;(source:Araport11) |
| AT2G35990 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT2G36305 | Encodes an endoprotease involved in the cleavage of prenylated CaaX-box proteins. In vitro, it can cleave a farnesylated tetrapeptide and it can promote membrane-localization of a farnesylated GFP:AtROP9 protein when both are expressed in yeast. |
| AT2G36430 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT2G36460 | Aldolase superfamily protein;(source:Araport11) |
| AT2G36530 | Involved in light-dependent cold tolerance and encodes an enolase. Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. Affects seed size and weight by adjusting cytokinin content and forming ENO2-bZIP75 complex. |
| AT2G36620 | RPL24A encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B (AT3G53020). |
| AT2G36650 | CHUP1-like protein;(source:Araport11) |
| AT2G36690 | Protein belonging to the Fe-dependent 2-oxoglutarate dioxygenase superfamily, catalyzes the stereospecific hydration of GA12 to produce DHGA12, negatively regulates ABA sensitivity during germination, phototrophic establishment and seedling development. |
| AT2G36695 | hypothetical protein;(source:Araport11) |
| AT2G36700 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G36750 | UDP-glucosyl transferase 73C1;(source:Araport11) |
| AT2G36760 | UDP-glucosyl transferase 73C2;(source:Araport11) |
| AT2G36770 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G36780 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G36790 | The At2g36790 gene encodes a UDP-glucose:flavonol-3-O-glycoside-7-O-glucosyltransferase (UGT73C6)attaching a glucosyl residue to the 7-O-position of the flavonols kaempferol, quercetin and their 3-O-glycoside derivatives. |
| AT2G36792 | Natural antisense transcript overlaps with AT2G36790;(source:Araport11) |
| AT2G36800 | Encodes a DON-Glucosyltransferase. The UGT73C5 glucosylates both brassinolide and castasterone in the 23-O position. The enzyme is presumably involved in the homeostasis of those steroid hormones hence regulating BR activity. Transgenic plants overexpressing UGT73C5 show a typical BR-deficient phenotype. |
| AT2G36815 | mid region of cactin;(source:Araport11) |
| AT2G36920 | B3 domain protein;(source:Araport11) |
| AT2G36980 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G37010 | member of NAP subfamily |
| AT2G37070 | Encodes a microtubule-associated protein track growing microtubule plus ends. |
| AT2G37090 | The IRX9 gene encodes a putative family 43 glycosyl transferase. It was coordinately expressed with the cellulose synthase subunits during secondary cell wall formation. Cell wall analysis revealed a decrease in the abundance of xylan in the irx9 mutant, indicating that IRX9 is required for xylan synthesis. Mutants have irregular xylem phenotype suggesting a role in secondary cell wall biosynthesis.IRX9 was identified as MUCI65 in a reverse genetic screen for MUCILAGE-RELATED genes. Despite producing only a few seeds, the irx9-1 mutant displays normal mucilage properties. |
| AT2G37260 | Encodes a protein similar to WRKY transcription factors that is expressed in the seed integument and endosperm. Mutants are defective in proanthocyanidin synthesis and seed mucilate deposition. Seeds are yellow colored. Seed size is also affected; seeds are reduced in size but only when the mutant allele is transmitted through the female parent.Loss of function alleles are associated with a reduction in interploidy lethality. |
| AT2G37280 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
| AT2G37320 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G37360 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT2G37430 | Encodes a member of the zinc finger family of transcriptional regulators. It is expressed in many root tips, primary roots, cotyledons and hypocotyl. The protein is localized to the nucleus. Overexpression of ZAT11 causes increased root growth and increased sensitivity to nickel ions. The mRNA is cell-to-cell mobile. |
| AT2G37470 | Histone superfamily protein;(source:Araport11) |
| AT2G37540 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G37660 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G37800 | cysteine/histidine-rich C1 domain protein;(source:Araport11) |
| AT2G37820 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G37950 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT2G38060 | Encodes an inorganic phosphate transporter (PHT4;2). |
| AT2G38120 | Encodes an auxin influx transporter. AUX1 resides at the apical plasma membrane of protophloem cells and at highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning. Shoot supplied ammonium targets AUX1 and inhibits lateral root emergence. The mRNA is cell-to-cell mobile. |
| AT2G38150 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
| AT2G38170 | Encodes a high affinity vacuolar calcium antiporter. The residue His 338 is critical to Ca2+ transport activity. Disruption of CAX1 reduces manganese and zinc of shoot tissue and results in a decrease in the activity of vacuolar V-type proton ATPase. |
| AT2G38280 | Encodes a protein with in vitro AMP deaminase activity that is involved in embryogenesis. Homozygous mutant embryos fail to develop past the zygote stage. |
| AT2G38350 | hypothetical protein;(source:Araport11) |
| AT2G38410 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT2G38450 | Sel1 repeat protein;(source:Araport11) |
| AT2G38500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT2G38590 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G38750 | Annexins are a family of calcium dependent membrane binding proteins though to be involved in Golgi mediated secretion. This is one of four annexins identified in Arabidopsis. |
| AT2G38790 | hypothetical protein;(source:Araport11) |
| AT2G38823 | hypothetical protein;(source:Araport11) |
| AT2G38860 | Encodes protease I (pfpI)-like protein YLS5. |
| AT2G38910 | member of Calcium Dependent Protein Kinase |
| AT2G38940 | Encodes Pht1;4, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
| AT2G38950 | Transcription factor jumonji (jmj) family protein / zinc finger (C5HC2 type) family protein;(source:Araport11) |
| AT2G39000 | Encodes a chloroplast localized n-acetyltransfefase involved in N-terminal protein amino acid acetylation. |
| AT2G39050 | Encodes a nucleocytoplasmic lectin that is capable of binding carbohydrates. It is involved in ABA mediated stomatal movement and increased expression is correlated with increased resistance to Pseudomonas syringae. |
| AT2G39170 | MEF2BNB-like protein;(source:Araport11) |
| AT2G39290 | Encodes a phosphatidylglycerolphosphate synthase 2C which is dual-targeted into chloroplasts and mitochondria. Mutant plants have mutant chloroplasts but normal mitochondria. |
| AT2G39300 | CAP-gly domain linker;(source:Araport11) |
| AT2G39320 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT2G39330 | jacalin-related lectin 23;(source:Araport11) |
| AT2G39360 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G39490 | F-box family protein;(source:Araport11) |
| AT2G39510 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
| AT2G39570 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. |
| AT2G39650 | cruciferin (DUF506);(source:Araport11) |
| AT2G39690 | ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547);(source:Araport11) |
| AT2G39705 | ROTUNDIFOLIA like 8;(source:Araport11) |
| AT2G39790 | Mitochondrial glycoprotein family protein;(source:Araport11) |
| AT2G39820 | Translation initiation factor IF6;(source:Araport11) |
| AT2G39850 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT2G39855 | plant/protein;(source:Araport11) |
| AT2G39860 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT2G40180 | Encodes PP2C5, a member of the PP2C family phosphatases. PP2C5 acts as a MAPK phosphatase that positively regulates seed germination, stomatal closure and ABA-inducible gene expression. |
| AT2G40250 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT2G40320 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). Chemical evidence for function comes from xylan NMR analysis. Secondary wall thickening phenotype can be only observed in double or triple mutant with esk1. |
| AT2G40370 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). Together with DP1/DIR12 involved in neolignan biosynthesis via sinapoylcholine/feruloylcholine. |
| AT2G40380 | prenylated RAB acceptor 1.B2;(source:Araport11) |
| AT2G40390 | neuronal PAS domain protein;(source:Araport11) |
| AT2G40450 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT2G40470 | LOB-domain containing protein. Involved in regulation of xylem differentiation- acts as a regulator of VND7 which is a master regulator of xylem cell differentiation. |
| AT2G40560 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G40620 | Basic leucine zipper transcription factor. Localizes from cytoplasm to the nucleus under heat stress. |
| AT2G40680 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G52065.1);(source:TAIR10) |
| AT2G40710 | hemolysin-III related integral membrane protein;(source:Araport11) |
| AT2G40850 | phosphoinositide 4-kinase gamma 1;(source:Araport11) |
| AT2G40880 | Encodes a protein with cysteine proteinase inhibitor activity. Overexpression increases tolerance to abiotic stressors (i.e.salt,osmotic, cold stress). The mRNA is cell-to-cell mobile. |
| AT2G40900 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
| AT2G40910 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G40925 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G40930 | Encodes ubiquitin-specific protease with nuclear localization signals that is likely to be involved in ubiquitin-mediated protein degradation. |
| AT2G40990 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT2G41140 | Encodes CDPK-related kinase 1 (CRK1). |
| AT2G41220 | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression is most abundant in root. The mRNA is cell-to-cell mobile. |
| AT2G41240 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT2G41290 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
| AT2G41415 | Encodes a Maternally expressed gene (MEG) family protein |
| AT2G41445 | agamous-like MADS-box protein;(source:Araport11) |
| AT2G41460 | Apurinic endonuclease-redox protein. It functions as an apurinic/apyrimidinic class II endonuclease, and is involved in DNA repair. |
| AT2G41473 | F-box family protein;(source:Araport11) |
| AT2G41480 | Encodes a cationic cell-wall-bound peroxidase homolog that is involved in the lignification of cell walls. Regulated by COG1, involved in seed longevity. |
| AT2G41680 | Encodes a NADPH thioredoxin reductase involved in chloroplast protection against oxidative damage. |
| AT2G41700 | ATP-binding cassette A1;(source:Araport11) |
| AT2G41730 | Expression in rosette leaves is activated by high concentration of boron. |
| AT2G41740 | Encodes a protein with high homology to animal villin. |
| AT2G41750 | Involved in posttranscriptional modification of tRNA. Can form acp3U20b on a tRNA expressed in yeast cells. The aspartate and tryptophan residues in the DXTW motif of this protein are required for modification activity. Required for the acp3U20a modification of cytosolic tRNA. |
| AT2G41780 | hypothetical protein;(source:Araport11) |
| AT2G41840 | Ribosomal protein S5 family protein;(source:Araport11) |
| AT2G41860 | member of Calcium Dependent Protein Kinase |
| AT2G41910 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G41930 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G41970 | Encodes MRI, a plasma membrane-localized member of the RLCK-VIII subfamily. Preferentially expressed in both pollen tubes and root hairs. mri-knockout mutants display spontaneous pollen tube and root-hair bursting. |
| AT2G42070 | Encodes a plastid-localized Nudix hydrolase that has FAD pyrophosphohydrolase activity. Negative feedback regulation of the metabolism of flavins through the hydrolysis of FAD by AtNUDX23 in plastids is involved in the flavin homeostasis in plant cells. |
| AT2G42090 | actin related gene or pseudogene, based on sequence divergence and lack of expression |
| AT2G42110 | hypothetical protein;(source:Araport11) |
| AT2G42170 | Actin family protein;(source:Araport11) |
| AT2G42220 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT2G42350 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G42360 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G42450 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G42460 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT2G42470 | TRAF-like family protein;(source:Araport11) |
| AT2G42480 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT2G42550 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G42560 | Late embryogenesis protein. Based on in vitro studies, likely plays a role in stablizing membranes in response to freezing stress. |
| AT2G42730 | F-box/FBD/LRR protein;(source:Araport11) |
| AT2G42850 | cytochrome P450, family 718;(source:Araport11) |
| AT2G42930 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT2G42980 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G42990 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G43120 | Encodes a member of the functionally diverse cupin protein superfamily that is involved in susceptibility to the bacterial plant pathogen Ralstonia solanacearum. It stabilizes the papain-like cysteine protease XCP2. The mRNA is cell-to-cell mobile. |
| AT2G43150 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT2G43230 | Member of cytosolic ABA receptor kinases; interacts with ABA receptors RCAR11-14. Positively regulates germination, seedling architecture and root growth in response to ABA. |
| AT2G43255 | O-acyltransferase WSD1-like protein;(source:Araport11) |
| AT2G43261 | transmembrane protein;(source:Araport11) |
| AT2G43270 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G43290 | Calmodulin-like MSS3.Encodes an endomembrane localized member of the CML subfamily VII. Contains a canonical CaM domain and unique N-terminal extension that distinguishes it from other members of the subfamily. |
| AT2G43480 | Peroxidase superfamily protein;(source:Araport11) |
| AT2G43590 | Chitinase family protein;(source:Araport11) |
| AT2G43630 | nucleusenvelope protein;(source:Araport11) |
| AT2G43745 | jacalin lectin-like protein;(source:Araport11) |
| AT2G43820 | Encodes a nicotinate-O-glycosyltransferase. Induced by Salicylic acid, virus, fungus and bacteria. Also involved in the tryptophan synthesis pathway. Independent of NPR1 for their induction by salicylic acid. UGT74F1 transfers UDP:glucose to salicylic acid (forming a glucoside (SAG) and a glucose ester (SGE)), benzoic acid, and anthranilate in vitro. UGT74F2 shows a weak ability to catalyze the formation of the p-aminobenzoate-glucose ester in vitro. But, UGT75B1 appears to be the dominant pABA acylglucosyltransferase in vivo based on assays in leaves, flowers, and siliques. |
| AT2G43860 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G43880 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G43890 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G43930 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G44070 | NagB/RpiA/CoA transferase-like superfamily protein;(source:Araport11) |
| AT2G44090 | Ankyrin repeat family protein;(source:Araport11) |
| AT2G44100 | GDP dissociation inhibitor involved in vesicular membrane traffic |
| AT2G44110 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO15 belongs to the clade II, with ATMLO13 and ATMLO15. The gene is expressed during early seedling growth, in root tips and flower (papillae, anthers and pollen grains), as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT2G44230 | hypothetical protein (DUF946);(source:Araport11) |
| AT2G44330 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G44370 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G44380 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G44390 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G44460 | Beta-glucosidase, major myrosinase which initiates sulfur reallocation by hydrolyzing particular GL species, conferring sulfur deficiency tolerance, especially during early development. |
| AT2G44490 | Encodes a glycosyl hydrolase that localizes to peroxisomes and acts as a component of an inducible preinvasion resistance mechanism. Required for mlo resistance. The mRNA is cell-to-cell mobile. |
| AT2G44520 | cytochrome c oxidase 10;(source:Araport11) |
| AT2G44540 | glycosyl hydrolase 9B9;(source:Araport11) |
| AT2G44550 | glycosyl hydrolase 9B10;(source:Araport11) |
| AT2G44560 | glycosyl hydrolase 9B11;(source:Araport11) |
| AT2G44570 | glycosyl hydrolase 9B12;(source:Araport11) |
| AT2G44580 | zinc ion binding protein;(source:Araport11) |
| AT2G44590 | DYNAMIN-like 1D;(source:Araport11) |
| AT2G44710 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G44740 | cyclin p4;(source:Araport11) |
| AT2G44780 | Encodes a Uclacyanin/Basic blue family protein [pseudogene] |
| AT2G44790 | Encodes a uclacyanin, a protein precursor that is closely related to precursors of stellacyanins and a blue copper protein from pea pods. |
| AT2G44830 | AGCVIII kinase involved in the pulse-induced first positive phototropism. Plasma-membrane-associated element of a molecular rheostat that modulates auxin flux through developing protophloem sieve elements (PPSEs) while interacting with BRX, thereby timing PPSE differentiation. Activates PIN-mediated auxin efflux. |
| AT2G44930 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT2G44990 | More Axillary Branching; carotenoid cleavage dioxygenases. |
| AT2G45170 | Involved in autophagy. Under nutrient starvation the protein localizes to autophagosomes. Involved in submergence (hypoxia) tolerance; ethanol induces autophagy. |
| AT2G45300 | encodes 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase involved in chorismate biosynthesis The mRNA is cell-to-cell mobile. |
| AT2G45400 | involved in the regulation of brassinosteroid metabolic pathway |
| AT2G45406 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G45460 | SMAD/FHA domain-containing protein;(source:Araport11) |
| AT2G45530 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G45550 | Member of CYP76C family of cytochrome P450 enzymes.Has geraniol 9- or 8-hydroxylase activity. |
| AT2G45560 | cytochrome P450 monooxygenase |
| AT2G45570 | member of CYP76C |
| AT2G45650 | Sequence suggests this encodes a MADS-box transcription factor. Negatively regulates the FLC/MAF clade genes and positively regulates FT in Arabidopsis. |
| AT2G45660 | Controls flowering and is required for CO to promote flowering. It acts downstream of FT. Overexpression of (SOC1) AGL20 suppresses not only the late flowering of plants that have functional FRI and FLC alleles but also the delayed phase transitions during the vegetative stages of development. AGL20/SOC1 acts with AGL24 to promote flowering and inflorescence meristem identity.AGL20 upregulates expression of AGL24 in response to GA. |
| AT2G45720 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G45750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G45840 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT2G45900 | Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11) |
| AT2G45920 | U-box domain-containing protein;(source:Araport11) |
| AT2G45940 | hypothetical protein (DUF295);(source:Araport11) |
| AT2G46170 | Reticulon family protein;(source:Araport11) |
| AT2G46308 | transmembrane protein;(source:Araport11) |
| AT2G46450 | Member of Cyclic nucleotide gated channel family.Positive regulator of resistance against avirulent fungal pathogen.Suppresses the phenotype conferred by cpr22 in a dosage-dependent manner. |
| AT2G46455 | OxaA/YidC-like membrane insertion protein;(source:Araport11) |
| AT2G46480 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT2G46493 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G46494 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G46495 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G46780 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G46860 | Encodes a protein that might have inorganic pyrophosphatase activity. |
| AT2G46880 | purple acid phosphatase 14;(source:Araport11) |
| AT2G46940 | fold protein;(source:Araport11) |
| AT2G46950 | cytochrome P450, family 709, subfamily B, polypeptide 2;(source:Araport11) |
| AT2G46960 | member of CYP709B |
| AT2G46995 | hypothetical protein;(source:Araport11) |
| AT2G47000 | Encodes an auxin efflux transmembrane transporter that is a member of the multidrug resistance P-glycoprotein (MDR/PGP) subfamily of ABC transporters. Functions in the basipetal redirection of auxin from the root tip. Exhibits apolar plasma membrane localization in the root cap and polar localization in tissues above and is involved in root hair elongation. |
| AT2G47010 | calcium/calcium/calmodulin-dependent Serine/Threonine-kinase;(source:Araport11) |
| AT2G47240 | Encodes an acyl-CoA synthetase that acts on long-chain and very-long-chain fatty acids, involved in cuticular wax and cutin biosynthesis The mRNA is cell-to-cell mobile. |
| AT2G47360 | transmembrane protein;(source:Araport11) |
| AT2G47420 | Encodes a putative rRNA dimethyltransferase. |
| AT2G47430 | Encodes a putative plasma membrane-bound hybrid histidine kinase and cytokinin sensor that is expressed within the female gametophyte. |
| AT2G47520 | encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12. It plays a role in hypoxia-induced root slanting. |
| AT2G47590 | photolyase/blue light photoreceptor PHR2 (PHR2) mRNA, |
| AT2G47740 | pre-tRNA tRNA-Gly (anticodon: CCC);(source:Araport11, TAIR10) |
| AT2G47800 | Encodes a plasma membrane localized ATPase transporter involved in multidrug transport. The expression of this gene is upregulated by herbicide safeners such as benoxacor, fluxofenim and fenclorim. The mRNA is cell-to-cell mobile. |
| AT2G47890 | Acts as a positive regulator of red light signaling; overexpression causes markedly shortened hypocotyls under various light states. Binds to the HY5 promoter to activate its transcription, while both BBX21 and HY5 associate with its promoter to positively regulate its expression. T |
| AT2G47895 | Natural antisense transcript overlaps with AT2G47900;(source:Araport11) |
| AT3G01030 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT3G01085 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G01190 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G01270 | Pectate lyase family protein;(source:Araport11) |
| AT3G01280 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. The mRNA is cell-to-cell mobile. |
| AT3G01290 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT3G01311 | actin cross-linking protein, putative (DUF569);(source:Araport11) |
| AT3G01420 | Encodes an alpha-dioxygenase involved in protection against oxidative stress and cell death. Induced in response to Salicylic acid and oxidative stress. Independent of NPR1 in induction by salicylic acid. The mRNA is cell-to-cell mobile. |
| AT3G01540 | RNA HELICASE DRH1 |
| AT3G01600 | NAC domain containing protein 44;(source:Araport11) |
| AT3G01660 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G01670 | Encodes a protein localized to phloem filaments that is required for phloem filament formation. The mRNA is cell-to-cell mobile. |
| AT3G01680 | Encodes a protein localized to phloem filaments that is required for phloem filament formation. The mRNA is cell-to-cell mobile. |
| AT3G01750 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G01830 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT3G01880 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
| AT3G01900 | member of CYP94B |
| AT3G01950 | peroxidase (DUF 3339);(source:Araport11) |
| AT3G02010 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G02100 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G02125 | pinin-like protein;(source:Araport11) |
| AT3G02150 | a chloroplast trans-acting factor of the psbD light-responsive promoter.TCP gene involved in heterochronic control of leaf differentiation. |
| AT3G02210 | COBRA-like protein 1 precursor;(source:Araport11) |
| AT3G02250 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G02300 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT3G02370 | tRNA-splicing endonuclease subunit;(source:Araport11) |
| AT3G02440 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G02480 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT3G02540 | Encodes a member of the RADIATION SENSITIVE23 (RAD23) family: AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome. |
| AT3G02550 | LOB domain-containing protein 41;(source:Araport11) |
| AT3G02590 | Fatty acid hydroxylase superfamily protein;(source:Araport11) |
| AT3G02670 | Glycine-rich protein family;(source:Araport11) |
| AT3G02800 | Encodes an atypical dual-specificity phosphatase. |
| AT3G02970 | EXORDIUM like 6;(source:Araport11) |
| AT3G03000 | Calmodulin like protein localized in the plant vacuolar compartment with a function of binding and modifying the activity of a tonoplast transporter (AtNHX1) from within the vacuole in a Ca+2- and pH-dependent manner |
| AT3G03060 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G03200 | NAC domain containing protein 45;(source:Araport11) |
| AT3G03270 | HRU1 is a hypoxia induced universal stress protein. It exists as two splice variants with AT3G03270.2 , which contains a putative dimerization domain, the predominant transcript found under anoxia. It is induced by RAP2.12. Subcellular localization is dynamic; under anoxia the localization of HRU1 shifts from cytoplasm to the plasma membrane. |
| AT3G03480 | acetyl CoA:(Z)-3-hexen-1-ol acetyltransferase;(source:Araport11) |
| AT3G03510 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G03530 | PHOSPHOESTERASE FAMILY PROTEIN, NPC4 is significantly induced upon phosphate starvation and plays an important role in the supply of inorganic phosphate and diacylglycerol from membrane-phospholipids during phosphate deprivation.Has a preference for glycosylinositolphosphorylceramide (GIPC) as a substrate. |
| AT3G03570 | signal transducer, putative (DUF3550/UPF0682);(source:Araport11) |
| AT3G03680 | Member of a family of Multiple C2 Domain and Transmembrane Region Proteins. |
| AT3G03790 | ankyrin repeat family protein / regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT3G03800 | member of SYP13 Gene Family |
| AT3G03870 | transmembrane protein;(source:Araport11) |
| AT3G03880 | sterol O-acyltransferase, putative (DUF1639);(source:Araport11) |
| AT3G03910 | GDH3 encodes a member of the glutamate dehydrogenease family. Its expression is upregulated in response to cytokinin and it may play a role in the control of nitrogen metabolism in leaf development. |
| AT3G03930 | kinase-like protein;(source:Araport11) |
| AT3G04050 | Pyruvate kinase family protein;(source:Araport11) |
| AT3G04070 | NAC domain containing protein 47;(source:Araport11) |
| AT3G04110 | putative glutamate receptor (GLR1.1). Contains a functional cation - permeable pore domain. Involved in cellular cation homeostasis. |
| AT3G04120 | encodes cytosolic GADPH (C subunit) involved in the glycolytic pathway but also interacts with H2O2 potentially placing it in a signalling cascade induced by ROS. The mRNA is cell-to-cell mobile. |
| AT3G04150 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT3G04170 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT3G04200 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT3G04290 | Li-tolerant lipase 1;(source:Araport11) |
| AT3G04420 | NAC domain containing protein 48;(source:Araport11) |
| AT3G04430 | NAC domain containing protein 49;(source:Araport11) |
| AT3G04650 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT3G04660 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G04715 | Based on qRT-PCR data, this annotated pseudogene is expressed and upregulated in response to infection with the yellow strain of Cucumber mosaic virus in C24 and Col-0. Exhibited higher levels of H3K27me3; H3K27me3 was significantly decreased (fourfold) in response to infection with CMV(Y). |
| AT3G05160 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G05170 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT3G05320 | Golgi localized protein with similarity to protein O-fucosyltransferases. Mutants show lower seed set/reduced fertility. Mutant pollen fails to compete with wild type due to the inability to penetrate the stigma-style boundary. |
| AT3G05327 | Cyclin family protein;(source:Araport11) |
| AT3G05350 | Metallopeptidase M24 family protein;(source:Araport11) |
| AT3G05390 | S-adenosyl-L-methionine-dependent methyltransferase;(source:Araport11) |
| AT3G05460 | sporozoite surface protein-like protein;(source:Araport11) |
| AT3G05470 | Actin-binding FH2 (formin homology 2) family protein;(source:Araport11) |
| AT3G05540 | Encodes TCTP2, a homolog of Translationally Controlled Tumor Protein. Enhances in vitro plant regeneration. |
| AT3G05620 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT3G05630 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. Regulates vesicle trafficking. Required for auxin transport and distribution and hence auxin responses. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Plays a major role in phosphatidic acid production during phosphate deprivation. Induced upon Pi starvation in both shoots and roots. Involved in hydrolyzing phosphatidylcholine and phosphatidylethanolamine to produce diacylglycerol for digalactosyldiacylglycerol synthesis and free Pi to sustain other Pi-requiring processes. Does not appear to be involved in root hair patterning. Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT3G05741 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G05746 | hypothetical protein;(source:Araport11) |
| AT3G05770 | hypothetical protein;(source:Araport11) |
| AT3G05960 | Encodes a hexose sugar transporter that is expressed in pollen. STP6 may play a role in providing sugars during late pollen maturation or pollen tube germination. |
| AT3G06050 | Encodes a mitochondrial matrix localized peroxiredoxin involved in redox homeostasis. Knockout mutants have reduced root growth under certain oxidative stress conditions. |
| AT3G06070 | hypothetical protein;(source:Araport11) |
| AT3G06090 | homolog of prePIP1 |
| AT3G06210 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G06230 | member of MAP Kinase Kinase |
| AT3G06280 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G06360 | Encodes an arabinogalactan-protein (AGP27). |
| AT3G06470 | ELO family protein containing a characteristic histidine motif which binds to AtCb5-B, interacts with AtBI-1. Together with AtCb5-B interacts with KCR1, PAS2, and CER10, which are essential for the synthesis of VLCFAs. |
| AT3G06500 | Encodes an alkaline/neutral invertase which localizes in mitochondria. It may be modulating hormone balance in relation to the radicle emergence. Mutants display severely reduced shoot growth and reduced oxygen consumption. Mutant root development is not affected as reported for A/N-InvA mutant (inva) plants. The mRNA is cell-to-cell mobile. |
| AT3G06530 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G06560 | Encodes a poly(A) polymerase. Located in the cytoplasm. |
| AT3G06590 | Encodes RITF1, a bHLH transcription factor that regulates the transcription of several genes involved in the detoxification of reactive oxygen species generated by salt stress. |
| AT3G06640 | PAS domain-containing protein tyrosine kinase family protein;(source:Araport11) |
| AT3G06780 | glycine-rich protein;(source:Araport11) |
| AT3G06790 | Encodes a protein involved in RNA editing in mitochondria. Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
| AT3G06880 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G07040 | Contains an N-terminal tripartite nucleotide binding site and a C-terminal tandem array of leucine-rich repeats. Confers resistance to Pseudomonas syringae strains that carry the avirulence genes avrB and avrRpm1. |
| AT3G07070 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G07120 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G07230 | wound-responsive protein-like protein;(source:Araport11) |
| AT3G07250 | RNA-binding (RRM-RBD-RNP motif) domain nuclear transport factor 2 family protein;(source:Araport11) |
| AT3G07310 | phosphoserine aminotransferase, putative (DUF760);(source:Araport11) |
| AT3G07360 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT3G07450 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G07500 | Encodes one of four FRS (FAR1-RELATED SEQUENCE) factor-like genes in Arabidopsis. FRS factors are characterized by having an N-terminal C2H2-type chelating motif of the WRKY- Glial Cell Missing1 family, a central core transposase domain of Mutator-like element transposases, and a C-terminal SWIM domain. The four FRF-like genes in Arabidopsis share only the N-terminal motif with FRS proteins. |
| AT3G07620 | glycosyltransferase;(source:Araport11) |
| AT3G07680 | Encodes an Golgi-localized p24 protein. Interacts with p24delta5 at ER export sites for ER exit and coupled transport to the Golgi apparatus. The mRNA is cell-to-cell mobile. |
| AT3G07820 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G07830 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G07870 | FBX92 is an F-box containing protein. Overexpression produces plants with smaller leaves while reduced expression is correlated with increased leaf size and increased rates of cell proliferation. |
| AT3G07960 | Encodes phosphatidylinositol-4-phosphate 5-kinase 6 (PIP5K6). Regulates clathrin-dependent endocytosis in pollen tubes. |
| AT3G07970 | Required for pollen separation during normal development. In qrt mutants, the outer walls of the four meiotic products of the pollen mother cell are fused, and pollen grains are released in tetrads.May be required for cell type-specific pectin degradation. |
| AT3G08040 | Encodes a member of the MATE (multidrug and toxin efflux family), expressed in roots but not shoots. Mutants accumulate excess iron, manganese and zinc, and express root Fe(III) chelatase activity even under iron sufficiency conditions. FRD3 is likely to function in root xylem loading of an iron chelator or other factor necessary for efficient iron uptake out of the xylem or apoplastic space and into leaf cells. |
| AT3G08500 | Encodes a putative R2R3-type MYB transcription factor (MYB83). |
| AT3G08590 | Encodes a 2,3-biphosphoglycerate-independent phosphoglycerate mutase that is involved in pollen development and stomatal movement. |
| AT3G08800 | Encodes a nuclear and endosome localized protein with ARM and HEAT domains that interacts with SHR and other non-cell-autonomous proteins and may be involved in their intercellular movement. Hypomorphic mutant phenotypes suggest involvement of the protein in root patterning. |
| AT3G08860 | Encodes a protein that is predicted to have beta-alanine aminotransferase activity. |
| AT3G09330 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT3G09375 | pseudogene of eukaryotic initiation factor 4A-III;(source:Araport11) |
| AT3G09400 | Similar to POLTERGEIST (POL) protein phosphatase 2C. No phenotype observed in plants homozygous for a null allele. Ubiquitously expressed. |
| AT3G09510 | Ribonuclease H-like superfamily protein;(source:Araport11) |
| AT3G09530 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT3G09550 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G09780 | CRINKLY4 related 1;(source:Araport11) |
| AT3G09830 | Encodes a member of subfamily VIIa of the receptor-like cytoplasmic kinases (RLCKs). It contributes to pattern-triggered immunity in response to P. syringae. |
| AT3G09930 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G09940 | Encodes a member of the monodehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica. |
| AT3G10010 | Encodes a protein with DNA glycosylase activity that is involved in maintaining methylation marks. |
| AT3G10290 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT3G10320 | MUCI21 is a GT61 protein required for the production of highly branched xylan in seed coat mucilage. MUCI21 likely decorates xylan with xylose side chains that seem to be necessary for pectin attachment to the seed surface. |
| AT3G10350 | One of 3 GET paralogs in Arabidopsis. GET3b is a chloroplast localized protein with no obvious role in Tail Anchored (TA) protein insertion. |
| AT3G10370 | mitochondrial FAD-dependent glycerol-3-phosphate dehydrogenase. possibly involved in storage lipid catabolism and glycerol assimilation, and in glycerol-3-phosphate shuttle which transports reducing power from cytosol to mitochondrion. |
| AT3G10480 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. It binds the NAC-binding site, the Mitochondrial Dysfunction Motif. |
| AT3G10670 | Plastidic SufC-like ATP-binding cassette/ATPase essential for Arabidopsis embryogenesis. Involved in the biogenesis and/or repair of oxidatively damaged Fe?S clusters. Expressed in embryos and meristems. |
| AT3G10760 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G10820 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT3G10870 | Encodes a methyl IAA esterase. Methyl IAA is believed to be an inactive form of auxin that needs to be demethylated to exert a biological effect. MES17 does not act on methyl JA, MeSA, MeGA4, or MEGA9 in vitro. This gene is expressed in several tissues of seedlings and adult plants, with a higher relative level of expression in the seedling shoot apex and the adult stem. |
| AT3G10910 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G10930 | Encodes a small secreted signaling peptide that processed both N- and C-terminally after translation and is rapidly induced in response to ROS and flg22-induced stress and may act as a negative modulator of stress-induced ROS signalling. |
| AT3G10986 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT3G11020 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2B). The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A. |
| AT3G11280 | Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay). |
| AT3G11285 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
| AT3G11300 | hypothetical protein;(source:Araport11) |
| AT3G11310 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
| AT3G11320 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT3G11350 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G11390 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G11397 | prenylated RAB acceptor 1.A3;(source:Araport11) |
| AT3G11405 | hypothetical protein;(source:Araport11) |
| AT3G11415 | other_RNA;(source:Araport11) |
| AT3G11420 | beta-1,3-N-acetylglucosaminyltransferase lunatic protein, putative (DUF604);(source:Araport11) |
| AT3G11490 | ROP (Rho of plant GTPases) family member Involved in cell wall patterning. Encodes ROP inactivator, regulates the formation of ROP-activated domains; these in turn determined the pattern of cell wall pits. Positively regulates pit formation, but negatively regulates pit size, required for periodic formation of secondary cell wall pits. |
| AT3G11550 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G11570 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G11640 | transmembrane protein;(source:Araport11) |
| AT3G11660 | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus. Localization of the gene product is similar to that of NHL3 (plasma membrane) but it is yet inconclusive. |
| AT3G11773 | Thioredoxin superfamily protein;(source:Araport11) |
| AT3G12090 | TET6 encodes a member of the TETRASPANIN gene family that is expressed in the vascular system and is involved in organ growth redundantly with TET5. |
| AT3G12120 | Major enzyme responsible for the synthesis of 18:2 fatty acids in the endoplasmic reticulum. Contains His-rich motifs, which contribute to the interaction with the electron donor cytochrome b5. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
| AT3G12200 | Encodes AtNek7, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
| AT3G12540 | ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547);(source:Araport11) |
| AT3G12585 | pre-tRNA tRNA-Arg (anticodon: CCG);(source:Araport11, TAIR10) |
| AT3G12600 | nudix hydrolase homolog 16;(source:Araport11) |
| AT3G12710 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT3G12720 | Member of the R2R3 factor gene family. |
| AT3G12770 | Encodes a pentatricopeptide repeat protein (PPR) protein involved in mitochondrial mRNA editing. |
| AT3G12775 | ubiquitin-conjugating enzyme family protein;(source:Araport11) |
| AT3G12850 | COP9 signalosome complex-related / CSN complex-like protein;(source:Araport11) |
| AT3G12960 | seed maturation protein;(source:Araport11) |
| AT3G13010 | hAT transposon superfamily protein;(source:Araport11) |
| AT3G13061 | Natural antisense transcript overlaps with AT3G13060;(source:Araport11) |
| AT3G13065 | STRUBBELIG-receptor family 4;(source:Araport11) |
| AT3G13080 | encodes an ATP-dependent MRP-like ABC transporter able to transport glutathione-conjugates as well as chlorophyll catabolites. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
| AT3G13175 | transmembrane protein;(source:Araport11) |
| AT3G13220 | Encodes a ATP-binding cassette transporter G26 (ABCG26) involved in tapetal cell and pollen development. Required for male fertility and pollen exine formation. |
| AT3G13228 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G13229 | kinesin-like protein (DUF868);(source:Araport11) |
| AT3G13320 | low affinity calcium antiporter CAX2 The mRNA is cell-to-cell mobile. |
| AT3G13330 | Encodes a protein that interacts with the 26S proteasome. Mutants are phenotypically indistinguishable from wild type plants under a variety of growth conditions. Protein levels increase upon exposure of seedlings to MG132, a specific, potent, reversible, and cell-permeable proteasome inhibitor. |
| AT3G13390 | SKU5 similar 11;(source:Araport11) |
| AT3G13432 | transmembrane protein;(source:Araport11) |
| AT3G13480 | nuclear polyadenylated RNA-binding protein;(source:Araport11) |
| AT3G13500 | hypothetical protein;(source:Araport11) |
| AT3G13590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G13600 | calmodulin-binding family protein;(source:Araport11) |
| AT3G13610 | Encodes a Fe(II)- and 2-oxoglutarate-dependent dioxygenase family gene F6'H1. Mutations in this gene compromise iron uptake and the production of fluorescent phenolics involved in Fe uptake. The mRNA is cell-to-cell mobile. |
| AT3G13782 | Plants mutated in three ubiquitously expressed NAP1 genes (NAP1;1~NAP1;3) and organ-specifically expressed NAP1;4 gene show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. The NAP1 genes act synergistically with NRP genes in promoting somatic homologous recombination. |
| AT3G13800 | Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11) |
| AT3G13820 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G13840 | GRAS family transcription factor;(source:Araport11) |
| AT3G13882 | Ribosomal protein L34;(source:Araport11) |
| AT3G13900 | Encodes a member of the P4 subfamily of P-type ATPases expressed in the pollen plasma membrane. Double mutants with ALA6 display pollen and pollen tube defects. |
| AT3G13910 | hypothetical protein (DUF3511);(source:Araport11) |
| AT3G14120 | nuclear pore complex protein;(source:Araport11) |
| AT3G14150 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT3G14250 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G14270 | Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant. |
| AT3G14300 | pectinesterase family protein;(source:Araport11) |
| AT3G14370 | The WAG2 and its homolog, WAG1 each encodes protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT3G14380 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G14440 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane. |
| AT3G14480 | glycine/proline-rich protein;(source:Araport11) |
| AT3G14690 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT3G14710 | RNI-like superfamily protein;(source:Araport11) |
| AT3G14760 | transmembrane protein;(source:Araport11) |
| AT3G14780 | callose synthase;(source:Araport11) |
| AT3G14810 | mechanosensitive channel of small conductance-like 5;(source:Araport11) |
| AT3G14850 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G14940 | Encodes a cytosolic phosphoenolpyruvate carboxylase (PEPC) that has activity when expressed in E.coli. Its mRNA is most abundantly expressed in roots and siliques. PPC3 belongs to the plant-type PEPC family. It can form an enzymatically active complex with a castor bean ortholog of PPC4, which encodes a bacterial-type PEPC. The mRNA is cell-to-cell mobile. |
| AT3G14960 | Galactosyltransferase family protein;(source:Araport11) |
| AT3G14970 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G15040 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT3G15110 | transmembrane protein;(source:Araport11) |
| AT3G15115 | serine/arginine repetitive matrix protein;(source:Araport11) |
| AT3G15270 | Encodes a member of the SPL (squamosa-promoter binding protein-like)gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. Contains the SBP-box, which encodes the SBP-domain, required and sufficient for interaction with DNA. It is involved in regulation of flowering and vegetative phase change. Its temporal expression is regulated by the microRNA miR156. The target site for the microRNA is in the 3'UTR. |
| AT3G15280 | hypothetical protein;(source:Araport11) |
| AT3G15300 | VQ motif-containing protein;(source:Araport11) |
| AT3G15330 | pseudogene of the NLI interacting factor (NIF) protein family |
| AT3G15340 | Encodes PPI2 (proton pump interactor 2), a homologue of PPI1, a protein that interacts with the plasma membrane H+ ATPase AHA1. |
| AT3G15350 | G14 enzyme |
| AT3G15370 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT3G15490 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT3G15540 | Primary auxin-responsive gene. Involved in the regulation stamen filaments development. |
| AT3G15700 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G15720 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G15770 | hypothetical protein;(source:Araport11) |
| AT3G15840 | Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport. |
| AT3G15960 | mismatched DNA binding / ATP binding protein;(source:Araport11) |
| AT3G16100 | RAB GTPase homolog G3C;(source:Araport11) |
| AT3G16130 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT3G16140 | Encodes subunit H of photosystem I reaction center subunit VI. |
| AT3G16180 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
| AT3G16210 | F-box family protein;(source:Araport11) |
| AT3G16340 | Encodes a p-coumaryl alcohol exporter involved in lignin biosynthesis. |
| AT3G16350 | MYB-like transcription factor involved in nitrate signaling trough regulation of CHL1. |
| AT3G16370 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. The mRNA is cell-to-cell mobile. |
| AT3G16430 | Encodes a protein that increases the beta-glucosidase activities of three scopolin glucosidases in vitro. |
| AT3G16510 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G16555 | F-box and associated interaction domains-containing protein;(source:Araport11).SON1 paralog. |
| AT3G16600 | SNF2 domain-containing protein / helicase domain-containing protein / zinc finger protein-like protein;(source:Araport11) |
| AT3G16880 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G16960 | plant self-incompatibility protein S1 family protein;(source:Araport11) |
| AT3G17180 | serine carboxypeptidase-like 33;(source:Araport11) |
| AT3G17265 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G17270 | F-box/associated interaction domain protein;(source:Araport11) |
| AT3G17520 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT3G17550 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT3G17620 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G17668 | DnaJ/Hsp40 cysteine-rich domain superfamily protein;(source:Araport11) |
| AT3G17690 | member of Cyclic nucleotide gated channel family |
| AT3G17730 | NAC domain containing protein 57;(source:Araport11) |
| AT3G17760 | glutamate decarboxylase 5;(source:Araport11) |
| AT3G17820 | encodes a cytosolic glutamine synthetase, the enzyme has low affinity with substrate ammonium The mRNA is cell-to-cell mobile. |
| AT3G17980 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G18080 | B-S glucosidase 44;(source:Araport11) |
| AT3G18120 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G18170 | Glycosyltransferase family 61 protein;(source:Araport11) |
| AT3G18180 | Glycosyltransferase family 61 protein;(source:Araport11) |
| AT3G18220 | Phosphatidic acid phosphatase (PAP2) family protein;(source:Araport11) |
| AT3G18280 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G18310 | TATA box-binding protein associated factor RNA polymerase I subunit C;(source:Araport11) |
| AT3G18420 | Protein prenylyltransferase superfamily protein;(source:Araport11) |
| AT3G18650 | AGAMOUS-like 103;(source:Araport11) |
| AT3G18660 | Plants expressing an RNAi construct specifically targeting PGSIP1 was shown to have a dramatically reduced amount of starch. Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. |
| AT3G18670 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G18720 | F-box family protein;(source:Araport11) |
| AT3G18810 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT3G18827 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: CUUCUUAAGUGCUGAUAAUGC |
| AT3G18870 | Mitochondrial transcription termination factor family member. |
| AT3G18910 | EIN2 targeting protein2;(source:Araport11) |
| AT3G18950 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G19010 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G19050 | PHRAGMOPLAST ORIENTING KINESIN 2 is one of the two Arabidopsis homologs isolated in yeast two-hybrid screen for interaction partners of maize gene TANGLED1 (TAN1). Based on sequence homology in their motor domains, POK1 and POK2 belong to the kinesin-12 class which also includes the well-characterized group of phragmoplast-associated kinesins AtPAKRPs. Both kinesins are composed of an N-terminal motor domain throughout the entire C terminus and putative cargo binding tail domains. The expression domains for POK2 constructs were broader than those for POK1; both are expressed in tissues enriched for dividing cells. The phenotype of pok1/pok2 double mutants strongly resembles that of maize tan1 mutants, characterized by misoriented mitotic cytoskeletal arrays and misplaced cell walls. |
| AT3G19055 | hypothetical protein;(source:Araport11) |
| AT3G19090 | RNA-binding protein;(source:Araport11) |
| AT3G19170 | Zinc metalloprotease pitrilysin subfamily A. Signal peptide degrading enzyme targeted to mitochondria and chloroplasts. Expressed only in siliques and flowers |
| AT3G19200 | hypothetical protein;(source:Araport11) |
| AT3G19230 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G19270 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. |
| AT3G19274 | hypothetical protein;(source:Araport11) |
| AT3G19310 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT3G19320 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G19380 | PUB25 and PUB26 are closely related paralogs that encode functional E3 ligases. They function in immune response pathway by targeting BIK1 for degradation. |
| AT3G19410 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G19430 | late embryogenesis abundant protein-related / LEA protein-like protein;(source:Araport11) |
| AT3G19440 | Pseudouridine synthase family protein;(source:Araport11) |
| AT3G19460 | Reticulon family protein;(source:Araport11) |
| AT3G19580 | Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild desiccation. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT3G19595 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT3G19600 | Encodes a Ser-2-specific RNAPII CTD phosphatase with two tandem-repeated CTD phosphatase domains that belongs to the group III CTD phosphatase-like (CPL) family. It positively regulates ABA and drought responses. |
| AT3G19610 | Member of a novel, plant specific family of microtubule associated proteins. |
| AT3G19620 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT3G19700 | Encodes leucine rich repeat (LRR) kinase. Iku2-3 identified in a screen for mutants with abnormal endosperm. Sporophytic recessive mutants have reduced embryo and endosperm size. Seed size is also reduced and the shape is abnormal suggesting an interaction between the endosperm and cell elongation in the integuments. |
| AT3G19800 | Encodes the DUF177B version of the two DUF177 proteins in Arabidopsis. This version differs from DUF177A in containing a 23 aa insertion compared to the DUF177A sequence. |
| AT3G19850 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G19930 | Encodes a sucrose hydrogen symporter that is induced by wounding. The mRNA is cell-to-cell mobile. |
| AT3G19940 | Encodes a hexose-H(+) symporter that catalyzes the high-affinity uptake of glucose, galactose and mannose that is induced under low-glucose conditions in pollen tubes. |
| AT3G19960 | member of Myosin-like proteins |
| AT3G20140 | member of CYP705A |
| AT3G20200 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT3G20220 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G20300 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
| AT3G20320 | Encodes a permease-like component of an ABC transporter involved in lipid transfer from ER to chloroplast. A phosphatidic acid-binding protein with a predicted mycobacterial cell entry domain. It is tethered to the inner chloroplast envelope membrane facing the outer envelope membrane. Presumed bacterial orthologs of TGD1 and TGD2 in Gram-negative bacteria are typically organized in transcriptional units, suggesting their involvement in a common biological process. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
| AT3G20360 | TRAF-like family protein;(source:Araport11) |
| AT3G20510 | Encodes a member of the Tmemb_14 family that is predicted to be localized to the membranes of the secretory pathway. The mRNA is cell-to-cell mobile. |
| AT3G20570 | early nodulin-like protein 9;(source:Araport11) |
| AT3G20655 | pre-tRNA tRNA-Arg (anticodon: ACG);(source:Araport11, TAIR10) |
| AT3G20700 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G20780 | Encodes putative eukaryotic homolog of archaebacterial topoisomerase VI subunit B, TOP6B. Is essential for endoreduplication and is involved in cell expansion and cell proliferation. The hlq (harlequin) dwarf mutant has fewer root hair and leaf trichome. It has abnormal epidermal cell and accumulates callose. |
| AT3G20830 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT3G20850 | proline-rich family protein;(source:Araport11) |
| AT3G20935 | cytochrome P450, family 705, subfamily A, polypeptide 28;(source:Araport11) |
| AT3G20993 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G21010 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.6e-15 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT3G21080 | ABC transporter-like protein;(source:Araport11) |
| AT3G21090 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G21120 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G21210 | zinc ion binding protein;(source:Araport11) |
| AT3G21240 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, ferulic acid, 5-OH-ferulic acid and cinnamic acid. At4CL2 was unable to use sinapic acid as substrate. |
| AT3G21310 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT3G21330 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G21340 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G21500 | Encodes a protein postulated to have 1-deoxy-D-xylulose 5-phosphate synthase activity. |
| AT3G21680 | hypothetical protein;(source:Araport11) |
| AT3G21700 | Monomeric G protein. Expressed in root epidermal cells that are destined to become atrichoblasts. Also expressed during pollen development and in the pollen tube tip. |
| AT3G21755 | Natural antisense transcript overlaps with AT3G21760;(source:Araport11) |
| AT3G21781 | Natural antisense transcript overlaps with AT3G21780;(source:Araport11) |
| AT3G21791 | Pseudogene of AT3G21790; UDP-glucoronosyl/UDP-glucosyl transferase family protein |
| AT3G21800 | UDP-glucosyl transferase 71B8;(source:Araport11) |
| AT3G21860 | SKP1-like 10;(source:Araport11) |
| AT3G21880 | Encodes a substrate of the COP1/SPA E3 ubiquitin ligase. It is degraded in darkness and stabilized by white, red and blue light. Overexpression results in decreased apical dominance, increased branching and delayed flowering in long days. The latter phenotype is due to reduced levels of FT and dependent on the presence of CO (PMID:29187570). |
| AT3G21960 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT3G22010 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT3G22310 | Sequence similarity ot DEAD-box RNA helicases. Binds RNA and DNA. Involved in drought, salt and cold stress responses. The mRNA is cell-to-cell mobile. |
| AT3G22360 | encodes an alternative oxidase whose expression is limited to flowers and floral buds. |
| AT3G22370 | Encodes AOX1a, an isoform of alternative oxidase that is expressed in rosettes, flowers, and root. The alternative oxidase of plant mitochondria transfers electrons from the ubiquinone pool to oxygen without energy conservations. It is regulated through transcriptional control and by pyruvate. Plays a role in shoot acclimation to low temperature. Also is capable of ameliorating reactive oxygen species production when the cytochrome pathway is inhibited. AOX1a also functions as a marker for mitochondrial retrograde response. The mRNA is cell-to-cell mobile. |
| AT3G22400 | Encodes lipoxygenase5 (LOX5). LOX5 activity in roots facilitates green peach aphid colonization of Arabidopsis foliage by promoting green peach aphid feeding from sieve element and water consumption from xylem. |
| AT3G22415 | hypothetical protein;(source:Araport11) |
| AT3G22440 | FRIGIDA-like protein;(source:Araport11) |
| AT3G22540 | hypothetical protein (DUF1677);(source:Araport11) |
| AT3G22630 | Encodes 20S proteasome beta subunit PBD1 (PBD1). |
| AT3G22640 | cupin family protein;(source:Araport11) |
| AT3G22730 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G22850 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
| AT3G22990 | Armadillo-repeat containing protein. Involved in leaf and flower development. Located in nucleus. Broadly expressed throughout vegetative and floral tissues. LFR is functionally associated with AS2 to mediate leaf development. |
| AT3G23010 | receptor like protein 36;(source:Araport11) |
| AT3G23070 | Encodes a CRM domain protein CFM3a, involved in group IIB intron splicing in chloroplasts. |
| AT3G23130 | Flower-specific gene controlling the boundary of the stamen and carpel whorls. Similar to zinc finger transcription factors. Involved in shoot regenaration from root explants. |
| AT3G23150 | Involved in ethylene perception in Arabidopsis The mRNA is cell-to-cell mobile. |
| AT3G23175 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
| AT3G23190 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
| AT3G23250 | Member of the R2R3 factor gene family. Key regulator of lignin biosynthesis in effector-triggered immunity |
| AT3G23270 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
| AT3G23360 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G23380 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Interacts with Rop1 and is involved in pollen tube growth and function. Gene is expressed predominantly in inflorescence and flower tissue. |
| AT3G23390 | Zinc-binding ribosomal protein family protein;(source:Araport11) |
| AT3G23420 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G23440 | embryo sac development arrest 6;(source:Araport11) |
| AT3G23480 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
| AT3G23510 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
| AT3G23530 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
| AT3G23580 | Encodes one of the 3 ribonucleotide reductase (RNR) small subunit genes (RNR2A). Functionally redundant with the ribonucleotide reductase TSO2. mRNA was shown to specifically accumulate during the S-phase of the cell cycle in synchronized tobacco BY2 cells. Critical for cell cycle progression, DNA damage repair and plant development. |
| AT3G23630 | Encodes an isopentenyl transferase involved in cytokinin biosynthesis. |
| AT3G23685 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G23730 | xyloglucan endotransglucosylase/hydrolase 16;(source:Araport11) |
| AT3G23770 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT3G23800 | selenium-binding protein 3;(source:Araport11) |
| AT3G23805 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT3G23820 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. The mRNA is cell-to-cell mobile. |
| AT3G23880 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G23930 | troponin T, skeletal protein;(source:Araport11) |
| AT3G24100 | Encodes a secreted peptide that enhances stress indued cell death. |
| AT3G24200 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT3G24210 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G24220 | A member of gene NCED-related gene family, encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
| AT3G24230 | Pectate lyase family protein;(source:Araport11) |
| AT3G24250 | glycine-rich protein;(source:Araport11) |
| AT3G24310 | snapdragon myb protein 305 homolog (myb) |
| AT3G24460 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
| AT3G24490 | Alcohol dehydrogenase transcription factor Myb/SANT-like family protein;(source:Araport11) |
| AT3G24500 | One of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is specifically elevated in response to pathogen infection, salinity, drought, heat, hydrogen peroxide, and application of abscisic acid or salicylic acid. Constitutive expression enhances the tolerance of transgenic plants to various biotic and abiotic stresses. |
| AT3G24530 | AAA-type ATPase family protein / ankyrin repeat family protein;(source:Araport11) |
| AT3G24580 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G24615 | Encodes a Z43 snoRNA. Gb: AJ240080 |
| AT3G24620 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT3G24690 | hypothetical protein;(source:Araport11) |
| AT3G24750 | Encodes a member of the LAZY gene family that is expressed in the hypocotyl and the root |
| AT3G24780 | Uncharacterized conserved protein UCP015417, vWA;(source:Araport11) |
| AT3G24810 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. |
| AT3G24850 | B3 domain protein (DUF313);(source:Araport11) |
| AT3G25050 | Encodes an endotransglucosylase that cleaves the beta-1,4-glucosidic linkage in amorphous cellulose and ligates the nascent reducing end to a non-reducing terminus of either cellulosic or xyloglucan oligosaccharide. Higher expression in flowers and in response to IAA treatment. |
| AT3G25090 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G25182 | Pseudogene of AT5G24050; DNA binding protein |
| AT3G25200 | hypothetical protein;(source:Araport11) |
| AT3G25225 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G25250 | Arabidopsis protein kinase The mRNA is cell-to-cell mobile. |
| AT3G25290 | Auxin-responsive family protein;(source:Araport11) |
| AT3G25470 | bacterial hemolysin-like protein;(source:Araport11) |
| AT3G25510 | disease resistance protein (TIR-NBS-LRR class) family protein;(source:Araport11) |
| AT3G25550 | F-box family protein;(source:Araport11) |
| AT3G25570 | S-adenosylmethionine decarboxylase family member. |
| AT3G25573 | transmembrane protein;(source:Araport11) |
| AT3G25577 | hypothetical protein;(source:Araport11) |
| AT3G25600 | Calmodulin like protein. Paralog of CML15. |
| AT3G25610 | Encodes aminophospholipid ATPase10 (ALA10), a P4-type ATPase flippase that internalizes exogenous phospholipids across the plasma membrane. |
| AT3G25650 | SKP1-like 15;(source:Araport11) |
| AT3G25655 | Similar to Inflorescence Deficient in Abscission (IDA). Involved in floral organ abscission. |
| AT3G25670 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G25717 | ROTUNDIFOLIA like 16;(source:Araport11) |
| AT3G25760 | encodes allene oxide cyclase. One of four genes in Arabidopsis that encode this enzyme, which catalyzes an essential step in jasmonic acid biosynthesis. Gene expression is induced during senescence, a process that involves jasmonic acid signalling pathway. The mRNA is cell-to-cell mobile. |
| AT3G25770 | Encodes allene oxide cyclase. One of four genes in Arabidopsis that encode this enzyme, which catalyzes an essential step in jasmonic acid biosynthesis. Gene expression is induced during senescence, a process that involves jasmonic acid signalling pathway. Note: Nomenclature for Arabidopsis allene oxide cyclase 2 (AOC2, AT3G25770) gene is based on Stenzel et al. 2003 Plant Molecular Biology 51:895-911. AOC2 (AT3G25770) is also referred to as AOC3 in He et al. 2002 Plant Physiology, 128:876-884. The mRNA is cell-to-cell mobile. |
| AT3G25900 | Homocysteine S-methyltransferase family protein;(source:Araport11) |
| AT3G25960 | Pyruvate kinase family protein;(source:Araport11) |
| AT3G26050 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
| AT3G26120 | Similar to terminal ear1 in Zea mays. A member of mei2-like gene family; phylogenetic analysis revealed that TEL1 belongs to the third clade of mei2-like proteins (TEL clade), with conserved two N-terminal RNA recognition motifs (RRM), in addition to the C-terminal RRM, shared among all mei2-like proteins. |
| AT3G26125 | encodes a protein with cytochrome P450 domain |
| AT3G26140 | Cellulase (glycosyl hydrolase family 5) protein;(source:Araport11) |
| AT3G26150 | putative cytochrome P450 |
| AT3G26160 | putative cytochrome P450 |
| AT3G26210 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT3G26220 | cytochrome P450 monooxygenase |
| AT3G26230 | putative cytochrome P450 |
| AT3G26235 | hypothetical protein;(source:Araport11) |
| AT3G26270 | putative cytochrome P450 |
| AT3G26280 | cytochrome P450 monooxygenase |
| AT3G26290 | putative cytochrome P450 |
| AT3G26295 | putative cytochrome P450. |
| AT3G26320 | putative cytochrome P450 |
| AT3G26330 | putative cytochrome P450 |
| AT3G26470 | Powdery mildew resistance protein, RPW8 domain-containing protein;(source:Araport11) |
| AT3G26490 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G26500 | Encodes PIRL2, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
| AT3G26520 | gamma tonoplast intrinsic protein 2 (TIP2). expressed throughout the plant and transcript level is increased upon NaCl or ABA treatments. NaCl stress-sensitive yeast mutant strains exhibit more resistance to salt when expressing this protein. |
| AT3G26580 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G26612 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT3G26740 | transcripts are differentially regulated at the level of mRNA stability at different times of day controlled by the circadian clock. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. |
| AT3G26790 | Transcriptional factor with high similarity to the B3 region of the VP1/ABI3-like proteins. Full length FUS3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of FUS3 requires the B3 DNA-binding domain and an activation domain. FUS3 specifies cotyledon identity. Regulator of gene expression during late embryogenesis. Involved in the control foliar organ identity in Arabidopsis by regulating the synthesis of two hormones, abscisic acid and gibberellin. FUS3 together with LEC1 positively regulate the abundance of the ABI3 protein in the seed. |
| AT3G26805 | pseudogene of Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G26820 | Esterase/lipase/thioesterase family protein;(source:Araport11) |
| AT3G26830 | Mutations in pad3 are defective in biosynthesis of the indole derived phytoalexin camalexin. Encodes a cytochrome P450 enzyme that catalyzes the conversion of dihydrocamalexic acid to camalexin. The mRNA is cell-to-cell mobile. |
| AT3G26840 | Encodes a protein with phytyl ester synthesis and diacylglycerol acyltransferase activities that is involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. |
| AT3G26880 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G26935 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G26940 | Receptor-like cytoplasmic kinase, RLCKVII subfamily. Overexpression causes abnormal differential and elongation growth after organ differentiation. |
| AT3G26960 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT3G26990 | ENTH/VHS family protein;(source:Araport11) |
| AT3G27030 | transmembrane protein;(source:Araport11) |
| AT3G27095 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G27150 | Target gene of MIR2111-5p. |
| AT3G27280 | Part of protein complexes that are necessary for proficient mitochondrial function or biogenesis, thereby supporting cell division and differentiation in apical tissues |
| AT3G27440 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
| AT3G27620 | encodes an isoform of alternate oxidase. expressed in all tissues examined and expression is not induced by antimycin A, an inhibitor of complex III in the mitochondrial respiratory chain. |
| AT3G27690 | Encodes Lhcb2.4. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus. The mRNA is cell-to-cell mobile. |
| AT3G27710 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G27865 | snoRNA;(source:Araport11) |
| AT3G27900 | hypothetical protein (DUF1184);(source:Araport11) |
| AT3G27960 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
| AT3G27965 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.5e-26 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
| AT3G28040 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT3G28050 | nodulin MtN21-like transporter family protein |
| AT3G28060 | nodulin MtN21-like transporter family protein |
| AT3G28080 | nodulin MtN21-like transporter family protein |
| AT3G28150 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. A putative xyloglucan O-acetyltransferase. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G28160 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-06 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G28170 | hypothetical protein;(source:Araport11) |
| AT3G28180 | encodes a gene similar to cellulose synthase The mRNA is cell-to-cell mobile. |
| AT3G28190 | transmembrane protein;(source:Araport11) |
| AT3G28210 | Encodes a putative zinc finger protein (PMZ). |
| AT3G28223 | F-box family protein;(source:Araport11) |
| AT3G28340 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT3G28390 | P-glycoprotein 18;(source:Araport11) |
| AT3G28420 | Putative membrane lipoprotein;(source:Araport11) |
| AT3G28455 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can not replace CLV3 function in vivo.CLE25 participates in long distance signaling in response to dehydration. It produces a graft transmissible signal from root to shoot that induces ABA synthesis and results in stomatal closure. The BAM1 and BAM3 receptor-kinases are likely receptors for CLE25 as they are required for this signaling. |
| AT3G28510 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G28540 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G28560 | BCS1 AAA-type ATPase;(source:Araport11) |
| AT3G28570 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G28580 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G28600 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G28610 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G28740 | Encodes a member of the cytochrome p450 family. Expression is upregulated in response to cis-jasmonate treatment. Overexpression induces synthesis of volatile compounds that affect chemical ecology and insect interactions. |
| AT3G28770 | transmembrane protein, putative (DUF1216);(source:Araport11) |
| AT3G28780 | transmembrane protein, putative (DUF1216);(source:Araport11) |
| AT3G28790 | transmembrane protein, putative (DUF1216);(source:Araport11) |
| AT3G28850 | Glutaredoxin family protein;(source:Araport11) |
| AT3G28860 | Encodes a member of the ATP-binding cassette (ABC) transporter family that is involved in auxin transport and is involved in postembryonic organ separation. Also known as AtMDR11 and PGP19. Possibly regulates auxin-dependent responses by influencing basipetal auxin transport in the root. Acts upstream of phyA in regulating hypocotyl elongation and gravitropic response. Exerts nonredundant, partially overlapping functions with the ABC transporter encoded by AtPGP1. |
| AT3G28880 | serine/threonine-protein phosphatase 6 regulatory ankyrin repeat subunit;(source:Araport11) |
| AT3G28890 | receptor like protein 43;(source:Araport11) |
| AT3G28918 | hypothetical protein;(source:Araport11) |
| AT3G28940 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT3G28980 | mediator of RNA polymerase II transcription subunit-like protein, putative (DUF1216);(source:Araport11) |
| AT3G29153 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.3e-238 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT3G29156 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.9e-175 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G29250 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G29290 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G29300 | transmembrane protein;(source:Araport11) |
| AT3G29330 | zinc finger RNA-binding-like protein;(source:Araport11) |
| AT3G29340 | zinc finger (C2H2 type) family protein;(source:Araport11) |
| AT3G29360 | Encodes one of four UDP-glucose dehydrogenase UGD) genes. Mutation of this gene in combination with UGD3 leads to swollen plant cell walls and severe developmental defects associated with changes in pectic polysaccharides. |
| AT3G29670 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. The mRNA is cell-to-cell mobile. |
| AT3G29720 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G29725 | pseudogene of HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G29776 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-178 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G29788 | pseudogene of transmembrane protein;(source:Araport11) |
| AT3G29800 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G29830 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G30145 | transposable_element_gene;(source:Araport11);pseudogene, putative helicase protein, blastp match of 39%25 identity and 7.7e-124 P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT3G30160 | transmembrane protein;(source:Araport11) |
| AT3G30180 | Encodes a cytochrome p450 enzyme that catalyzes the last reaction in the production of brassinolide. It is capable of converting 6-deoxocastasterone into castasterone, a C-6 oxidation, as well as the further conversion of castasterone into brassinolide by a Baeyer-Villinger oxidation reaction at C-6, resulting in the formation of an unusual seven-membered lactone ring. The enzyme possesses high affinity for both C28- and C27-Brassinosteroids. The expression of the gene using a CYP85A2 promoter:LUC fusion construct was shown to be under circadian and light control. |
| AT3G30212 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.6e-19 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT3G30214 | pseudogene of transmembrane protein;(source:Araport11) |
| AT3G30250 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G31150.1);(source:TAIR10) |
| AT3G30280 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G30290 | a member of cytochrome P450 gene family |
| AT3G30530 | basic leucine-zipper 42;(source:Araport11) |
| AT3G30705 | transmembrane protein;(source:Araport11) |
| AT3G30805 | Class II aminoacyl-tRNA and biotin synthetases superfamily protein;(source:Araport11) |
| AT3G30813 | pseudogene of lysyl-tRNA synthetase 1;(source:Araport11) |
| AT3G30840 | hypothetical protein;(source:Araport11) |
| AT3G30842 | pleiotropic drug resistance 10;(source:Araport11) |
| AT3G31023 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.0e-152 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G31395 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.3e-23 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT3G31915 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G31370.1);(source:TAIR10) |
| AT3G31950 | nucleic acid-binding/zinc ion-binding protein;(source:Araport11) |
| AT3G31970 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.3e-294 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT3G32116 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 5.9e-284 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G32160 | hypothetical protein;(source:Araport11) |
| AT3G32383 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.7e-05 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT3G32925 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.1e-13 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT3G33058 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-112 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G33121 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.0e-10 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT3G33130 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.9e-256 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT3G33154 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.5e-36 P-value blast match to GB:CAB39733 rotease, reverse transcriptase, ribonuclease H, integrase (Gypsy_Ty3-element) (Drosophila buzzatii);(source:TAIR10) |
| AT3G33163 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G33193 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.4e-232 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10) |
| AT3G41979 | 5.8SrRNA |
| AT3G42047 | pseudogene of Ta11-like non-LTR retrotransposon;(source:Araport11) |
| AT3G42052 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.0e-162 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT3G42233 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.2e-82 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT3G42386 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.5e-116 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10) |
| AT3G42430 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G37045.1);(source:TAIR10) |
| AT3G42540 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43940.1);(source:TAIR10) |
| AT3G42570 | peroxidase family protein;(source:Araport11) |
| AT3G42798 | transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBb0043H09.1, similar to En/Spm-like transposon protein;(source:TAIR10) |
| AT3G42800 | AF-like protein;(source:Araport11) |
| AT3G42886 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-89 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT3G42890 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.4e-10 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G42900 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.7e-44 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT3G43090 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 8.4e-12 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT3G43170 | hypothetical protein;(source:Araport11) |
| AT3G43180 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G43190 | Encodes a protein with sucrose synthase activity (SUS4). |
| AT3G43210 | Encodes a kinesin TETRASPORE. Required for cytokinesis in pollen. In mutants, all four microspore nuclei remain within the same cytoplasm after meiosis. |
| AT3G43320 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G37050.1);(source:TAIR10) |
| AT3G43580 | Beta-galactosidase related protein;(source:Araport11) |
| AT3G43622 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.7e-37 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G43670 | Copper amine oxidase family protein;(source:Araport11) |
| AT3G43700 | Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). |
| AT3G43710 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G43720 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G43760 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
| AT3G43835 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.4e-26 P-value blast match to GB:NP_038604 L1 repeat, Tf subfamily, member 26 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G43840 | 3-oxo-5-alpha-steroid 4-dehydrogenase family protein;(source:Araport11) |
| AT3G43850 | hypothetical protein;(source:Araport11) |
| AT3G43920 | Encodes a ribonuclease III family protein that is required for endogenous RDR2-dependent siRNA (but not miRNA) formation. |
| AT3G44100 | MD-2-related lipid recognition domain-containing protein;(source:Araport11) |
| AT3G44117 | Encodes a ECA1 gametogenesis related family protein [pseudogene] |
| AT3G44250 | putative cytochrome P450 |
| AT3G44260 | Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses. |
| AT3G44262 | pseudogene of subtilisin-like serine protease 2;(source:Araport11) |
| AT3G44274 | pseudogene of Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G44300 | Encodes an enzyme that catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (nitrile aminohydrolase, EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. Mutants have reduced sensitivity to IAN and are sensitive to IAA. This enzyme likely participates in other non-auxin-related metabolic pathways. The mRNA is cell-to-cell mobile. |
| AT3G44320 | This enzyme catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. It is the only one of the four Arabidopsis nitrilases whose mRNA levels are strongly induced when plants experience sulphur deprivation. This enzyme likely participates in other non-auxin-related metabolic pathways. |
| AT3G44326 | Cytokinin induced F-Box protein. Forms a unique F-Box family with AT2G27310 and AT2G36090. It is primarily expressed in the root. |
| AT3G44510 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G44560 | fatty acid reductase 8;(source:Araport11) |
| AT3G44605 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.1e-38 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT3G44705 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.6e-46 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G44713 | hypothetical protein;(source:Araport11) |
| AT3G44760 | transmembrane protein;(source:Araport11) |
| AT3G44780 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT3G44810 | F-box family protein;(source:Araport11) |
| AT3G44840 | SABATH methyltransferase |
| AT3G44900 | member of Putative Na+/H+ antiporter family |
| AT3G44910 | member of Putative Na+/H+ antiporter family |
| AT3G44920 | member of Putative Na+/H+ antiporter family |
| AT3G44930 | member of Putative Na+/H+ antiporter family |
| AT3G44935 | hypothetical protein;(source:Araport11) |
| AT3G44970 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT3G44980 | hypothetical protein;(source:Araport11) |
| AT3G44990 | Encodes a xyloglucan endotransglycosylase/hydrolase. Protein sequence and phylogenetic analysis indicates that this enzyme resides in Group III-A of the XTH family, with high similarity to Tropaeolum majus (nasturtium) xyloglucanase 1 (TmNXG1).Enzyme kinetic analysis indicates predominant xyloglucan endo-hydrolase activity (EC 3.2.1.151) with only limited potential to act as a xyloglucan endo-transglycosylase (EC 2.4.1.207). |
| AT3G45000 | SNF7 family protein;(source:Araport11) |
| AT3G45070 | Encodes a sulfotransferase with sulfating activity toward flavonoids. |
| AT3G45120 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G17900.1);(source:TAIR10) |
| AT3G45130 | lanosterol synthase 1;(source:Araport11) |
| AT3G45310 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT3G45390 | LOW protein: L-type lectin-domain receptor kinase-like protein;(source:Araport11) |
| AT3G45450 | Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G45460 | IBR domain containing protein;(source:Araport11) |
| AT3G45470 | IBR domain containing protein;(source:Araport11) |
| AT3G45480 | RING/U-box protein with C6HC-type zinc finger;(source:Araport11) |
| AT3G45490 | reverse transcriptase-like protein;(source:Araport11) |
| AT3G45500 | hypothetical protein;(source:Araport11) |
| AT3G45510 | RING/U-box protein;(source:Araport11) |
| AT3G45540 | RING/U-box protein with C6HC-type zinc finger;(source:Araport11) |
| AT3G45560 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT3G45577 | tRNA-intron endonuclease;(source:Araport11) |
| AT3G45610 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT3G45670 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G45680 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G45700 | NPF2.4 is a member of the NAXT NPF subfamily. It encodes a plasmamembrane localized chloride transporter that is expressed in the root and is down regulated in response to ABA and salt treatment. NPF2.3 miRNA induced knockdowns have less Cl in the shoots when grown on low NaCl concentrations. |
| AT3G45710 | Encodes a chloride permeable transporter. Modulates chloride efflux from roots. |
| AT3G45730 | hypothetical protein;(source:Araport11) |
| AT3G45780 | Blue-light photoreceptor. Contains a light activated serine-threonine kinase domain and LOV1 and LOV2 repeats. Mutants are defective in blue-light response. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT1 undergoes blue-light-dependent autophosphorylation. At least eight phosphorylation sites have been identified in PHOT1. Phosphorylation of serine851 in the activation loop of PHOT1 appears to be required for stomatal opening, chloroplast accumulation, leaf flattening, and phototropism, and phosphorylation of serine849 may also contribute to the regulation of these responses. Phosphorylation-dependent binding of 14-3-3 proteins to the Hinge1 region of PHOT1 appears to require serine350 and serine376. |
| AT3G45790 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G45810 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
| AT3G45850 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G45930 | Histone superfamily protein;(source:Araport11) |
| AT3G45935 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT3G45940 | Glycosyl hydrolases family 31 protein;(source:Araport11) |
| AT3G45965 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT3G46050 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G46080 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT3G46090 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT3G46160 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G46260 | kinase-like protein;(source:Araport11) |
| AT3G46280 | kinase-like protein;(source:Araport11) |
| AT3G46340 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G46400 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G46482 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT3G46530 | Confers resistance to the biotrophic oomycete, Peronospora parasitica. Encodes an NBS-LRR type R protein with a putative amino-terminal leucine zipper. Fungal protein ATR13 induces RPP13 gene expression and disease resistance. The mRNA is cell-to-cell mobile. |
| AT3G46600 | GRAS family transcription factor;(source:Araport11) |
| AT3G46650 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G46690 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G46700 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G46730 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT3G46780 | plastid transcriptionally active 16;(source:Araport11) |
| AT3G46800 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G46840 | Subtilase family protein;(source:Araport11) |
| AT3G46860 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860. |
| AT3G46890 | maternal effect embryo arrest protein;(source:Araport11) |
| AT3G47030 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G47040 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT3G47080 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G47180 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G47200 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G47210 | hypothetical protein (DUF247);(source:Araport11) |
| AT3G47230 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G12505.1);(source:TAIR10) |
| AT3G47330 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G09370.1);(source:TAIR10) |
| AT3G47350 | Encodes a putative hydroxysteroid dehydrogenase (HSD). Genes that encode HSD include: At5g50600 and At5g50700 (HSD1), At3g47350(HSD2), At3g47360(HSD3), At5g50590 and At5g50690(HSD4), At5g50770(HSD6) (Plant Cell Physiology 50:1463). Two copies of HSD1 and HSD4 exist due to a gene duplication event. In Plant Physiology 145:87, At5g50690 is HSD7, At4g10020 is HSD5. |
| AT3G47440 | Encodes AtTIP5;1, functions as water and urea channels in pollen. Target promoter of the male germline-specific transcription factor DUO1. Essential target of gibberellins, promotes hypocotyl cell elongation under excess boron stress. |
| AT3G47470 | Encodes a chlorophyll a/b-binding protein that is more similar to the PSI Cab proteins than the PSII cab proteins. The predicted protein is about 20 amino acids shorter than most known Cab proteins. |
| AT3G47610 | transcription regulator/ zinc ion binding protein;(source:Araport11) |
| AT3G47660 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT3G47740 | member of ATH subfamily |
| AT3G47750 | member of ATH subfamily |
| AT3G47760 | ABC2 homolog 4;(source:Araport11) |
| AT3G47780 | member of ATH subfamily The mRNA is cell-to-cell mobile. |
| AT3G47790 | ABC2 homolog 7;(source:Araport11) |
| AT3G47990 | SUGAR-INSENSITIVE 3;(source:Araport11) |
| AT3G48000 | Encodes a putative (NAD+) aldehyde dehydrogenase. |
| AT3G48010 | member of Cyclic nucleotide gated channel family |
| AT3G48220 | F-box protein;(source:Araport11) |
| AT3G48231 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G48260 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. |
| AT3G48390 | MA3 domain-containing protein;(source:Araport11) |
| AT3G48470 | embryo defective 2423;(source:Araport11) |
| AT3G48515 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT3G48550 | SHOOT GRAVITROPISM-like protein;(source:Araport11) |
| AT3G48780 | Encodes one of the two LCB2 subunits (LCB2a and LCB2b) of serine palmitoyltransferase, an enzyme involved in sphingolipid biosynthesis. LCB2a and LCB2b are functional redundant. Double mutants are gametophytic lethal. The mRNA is cell-to-cell mobile. |
| AT3G48790 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT3G48850 | Encodes a mitochondrial phosphate transporter. Modulates plant responses to salt stress. |
| AT3G48990 | Encodes an oxalyl-CoA synthetase and is required for oxalate degradation, for normal seed development, and for defense against an oxalate-producing fungal pathogen. |
| AT3G49070 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT3G49270 | extensin-like protein;(source:Araport11) |
| AT3G49305 | transmembrane protein;(source:Araport11) |
| AT3G49380 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G49410 | Transcription factor IIIC, subunit 5;(source:Araport11) |
| AT3G49440 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G49480 | F-Box Gene regulated by Agrobacterium virulence protein VirD5 and essential for Agrobacterium-mediated plant transformation. |
| AT3G49520 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G49700 | encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family. Mutants produce elevated levels of ethylene as etiolated seedlings. |
| AT3G49725 | GTP-binding protein, HflX;(source:Araport11) |
| AT3G49832 | pseudogene of kelch repeat-containing F-box family |
| AT3G49845 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
| AT3G49940 | LOB domain-containing protein 38;(source:Araport11) |
| AT3G49970 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G50180 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G50230 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G50270 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G50280 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G50290 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G50295 | pseudogene of Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G50376 | pseudogene of NLI interacting factor (NIF) family protein |
| AT3G50610 | DNA-directed RNA polymerase II subunit RPB1-like protein;(source:Araport11) |
| AT3G50730 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G50750 | BES1/BZR1 homolog 1;(source:Araport11) |
| AT3G50755 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.3e-35 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G50820 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO2 is the minor isoform in the wild-type. Mutants defective in this gene have been shown to be affected in the dephosphorylation of the D1 protein of PSII. |
| AT3G50880 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT3G50890 | homeobox protein 28;(source:Araport11) |
| AT3G50910 | netrin receptor DCC;(source:Araport11) |
| AT3G50930 | Encodes a protein that is present in a homo-multimeric protein complex on the outer mitochondrial membrane and plays a role in cell death and amplifying salicylic acid signalling. The mRNA is cell-to-cell mobile. |
| AT3G51190 | Ribosomal protein L2 family;(source:Araport11) |
| AT3G51220 | WEB family protein (DUF827);(source:Araport11) |
| AT3G51325 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G51375 | Encodes a microRNA that targets several SCL family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAUUGAGCCGCGCCAAUAUC |
| AT3G51400 | hypothetical protein (DUF241);(source:Araport11) |
| AT3G51410 | hypothetical protein (DUF241);(source:Araport11) |
| AT3G51540 | mucin-5AC-like protein;(source:Araport11) |
| AT3G51700 | PIF1 helicase;(source:Araport11) |
| AT3G51800 | putative nuclear DNA-binding protein G2p (AtG2) mRNA, |
| AT3G51850 | member of Calcium Dependent Protein Kinase The mRNA is cell-to-cell mobile. |
| AT3G51870 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT3G51895 | Encodes a chloroplast-localized sulfate transporter. |
| AT3G51930 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G51970 | acyl-CoA sterol acyl transferase 1;(source:Araport11) |
| AT3G52080 | encodes a cation:proton exchanger expressed in pollen |
| AT3G52220 | leukocyte immunoglobulin-like receptor family A protein;(source:Araport11) |
| AT3G52250 | Encodes a protein with a putative role in mRNA splicing. The mRNA is cell-to-cell mobile. |
| AT3G52260 | Pseudouridine synthase family protein;(source:Araport11) |
| AT3G52270 | Transcription initiation factor IIF, beta subunit;(source:Araport11) |
| AT3G52320 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G52330 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G52430 | Encodes a lipase-like gene that is important for salicylic acid signaling and function in resistance (R) gene-mediated and basal plant disease resistance. PAD4 can interact directly with EDS1, another disease resistance signaling protein. Expressed at elevated level in response to green peach aphid (GPA) feeding, and modulates the GPA feeding-induced leaf senescence through a mechanism that doesn't require camalexin synthesis and salicylic acid (SA) signaling. Required for the ssi2-dependent heightened resistance to GPA. The mRNA is cell-to-cell mobile. |
| AT3G52450 | Encodes a cytoplasmically localized U-box domain E3 ubiquitin ligase protein that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT3G52460 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G52490 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. |
| AT3G52530 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G52730 | ubiquinol-cytochrome C reductase UQCRX/QCR9-like family protein;(source:Araport11) |
| AT3G52840 | beta-galactosidase 2;(source:Araport11) |
| AT3G52870 | IQ calmodulin-binding motif family protein;(source:Araport11) |
| AT3G52930 | Aldolase superfamily protein;(source:Araport11) |
| AT3G52990 | Pyruvate kinase family protein;(source:Araport11) |
| AT3G53040 | late embryogenesis abundant protein, putative / LEA protein;(source:Araport11) |
| AT3G53060 | SKP1-like 6;(source:Araport11) |
| AT3G53150 | UDP-glucosyl transferase 73D1;(source:Araport11) |
| AT3G53160 | UGT73C7 is induced by pathogen infection. It glycosylates p-coumaric acid and ferulic acid to modulate phenylpropanoid metabolism and induce innate immune response. |
| AT3G53200 | Member of the R2R3 factor gene family. |
| AT3G53232 | ROTUNDIFOLIA like 1;(source:Araport11) |
| AT3G53280 | cytochrome P450 monooxygenase The mRNA is cell-to-cell mobile. |
| AT3G53290 | missing N-term 80 AA not found between end of 71B5 and start of this sequence probably a pseudogene, from http://drnelson.utmem.edu/biblioD.html |
| AT3G53300 | putative cytochrome P450 |
| AT3G53305 | putative cytochrome P450 |
| AT3G53350 | Encodes RIP3 (ROP interactive partner 3), a microtubule-binding protein that is anchored to the plasma membrane domains and promotes local microtubule disassembly, forming as specific pattern of secondary walls in xylem vessel cells. Localized at microtubules and interacts with the plant-specific kinesin AtKinesin-13A. |
| AT3G53420 | a member of the plasma membrane intrinsic protein subfamily PIP2. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed specifically in the vascular bundles and protein level increases slightly during leaf dev. When expressed in yeast cells can conduct hydrogen peroxide into those cells. |
| AT3G53450 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT3G53490 | valine-tRNA ligase;(source:Araport11) |
| AT3G53510 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). Phloem-expressed and plasma membrane-localized jasmonate transporter which together with JAT3 and GLR3.3 involved in regulating long-distance translocation of JA, which is important for driving the loading, translocation of JA in the phloem pathway by a self-propagation mode, contributing to wound-induced systemic response/resistance. |
| AT3G53550 | FBD-like domain family protein;(source:Araport11) |
| AT3G53690 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G53720 | member of Putative Na+/H+ antiporter family. Involved in the osmoregulation through K(+) fluxes and possibly pH modulation of an active endomembrane system in guard cells. |
| AT3G53780 | RHOMBOID-like protein 4;(source:Araport11) |
| AT3G53900 | Encodes UPP, a plastidial uracil phosphoribosyltransferase (UPRT) involved in uracil salvage. Loss-of-function mutation causes dramatic growth retardation, a pale-green to albino phenotype, abnormal root morphology and chloroplastic disorders. |
| AT3G53940 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT3G53980 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G53990 | Encodes universal stress protein (USP). Functions as a molecular chaperone under heat shock and oxidative stress conditions. Chaperone activity and assembly into complexes is redox regulated. |
| AT3G54020 | Inositol phosphorylceramide synthase |
| AT3G54030 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
| AT3G54100 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G54290 | hemerythrin HHE cation-binding domain protein;(source:Araport11) |
| AT3G54410 | hypothetical protein (DUF1163);(source:Araport11) |
| AT3G54440 | glycoside hydrolase family 2 protein;(source:Araport11) |
| AT3G54490 | NRPE5-like protein of unknown function; homologous to budding yeast RPB5 |
| AT3G54520 | hypothetical protein;(source:Araport11) |
| AT3G54530 | hypothetical protein;(source:Araport11) |
| AT3G54590 | Encodes a hydroxyproline-rich glycoprotein. The mRNA is cell-to-cell mobile. |
| AT3G54670 | Encodes a member of the Arabidopsis cohesin complex that is essential for viability and sister chromatid alignment. |
| AT3G54700 | Encodes Pht1;7, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT3G54800 | Pleckstrin homology (PH) and lipid-binding START domains-containing protein;(source:Araport11) |
| AT3G54826 | Zim17-type zinc finger protein;(source:Araport11) |
| AT3G55080 | SET domain-containing protein;(source:Araport11) |
| AT3G55090 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT3G55110 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G55130 | Encodes a vacuole localized protein of the ABC transporter White-Brown Complex (WBC) family. When overexpressed in planta, confers resistance to kanamycin. |
| AT3G55190 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G55420 | hypothetical protein;(source:Araport11) |
| AT3G55440 | Encodes triosephosphate isomerase. |
| AT3G55450 | PBS1-like 1;(source:Araport11) |
| AT3G55512 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AGAAUCUUGAUGAUGCUGCAG |
| AT3G55550 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G55590 | Glucose-1-phosphate adenylyltransferase family protein;(source:Araport11) |
| AT3G55620 | Translation initiation factor IF6;(source:Araport11) |
| AT3G55710 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G55720 | replication factor C subunit, putative (DUF620);(source:Araport11) |
| AT3G55810 | Pyruvate kinase family protein;(source:Araport11) |
| AT3G55880 | A gain-of-function mutant of SUE4 exhibited improved low sulphur tolerance. |
| AT3G55950 | CRINKLY4 related 3;(source:Araport11) |
| AT3G55980 | salt-inducible zinc finger 1;(source:Araport11) |
| AT3G56090 | Encodes FERRITIN 3, AtFER3. Ferritins are a class of 24-mer multi-meric proteins found in all kingdoms of life. Function as the main iron store in mammals. Evidence suggests that Arabidopsis ferritins are essential to protect cells against oxidative damage, but they do not constitute the major iron pool. |
| AT3G56100 | Protein kinase expressed in meristematic cells. Phosphorylates AGL24. |
| AT3G56180 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT3G56220 | transcription regulator;(source:Araport11) |
| AT3G56350 | Iron/manganese superoxide dismutase family protein;(source:Araport11) |
| AT3G56380 | response regulator 17 |
| AT3G56410 | hypothetical protein (DUF3133);(source:Araport11) |
| AT3G56520 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT3G56530 | NAC domain containing protein 64;(source:Araport11) |
| AT3G56560 | NAC domain containing protein 65;(source:Araport11) |
| AT3G56600 | phosphatidylinositol 4-kinase gamma-like protein;(source:Araport11) |
| AT3G56640 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
| AT3G56700 | Encodes a fatty-acyl-CoA reductase that is expressed in response to wounding. |
| AT3G56705 | U2-6;(source:Araport11) |
| AT3G56740 | ATI3A interacting protein containing a large N-terminal rhomboid-like transmembrane domain and a UBA domain at their C terminus, localized in the ER with an important role in plant heat tolerance. UBAC2 proteins may act as both cargo receptors and inducers of an ATI3-mediated selective autophagy pathway, where ATI3 and UBAC2 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
| AT3G56760 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G56800 | encodes a calmodulin |
| AT3G56930 | Protein S-acyl transferase 4 (PAT4). Mutants display defects in root hair elongation. Along with SCN1 , it may be involved in targeting of ROP2 to the plasma membrane. |
| AT3G56940 | Encodes a putative ZIP protein with varying mRNA accumulation in leaves, stems and roots. Has a consensus carboxylate-bridged di-iron binding site. The mRNA is cell-to-cell mobile. |
| AT3G56970 | Encodes a member of the basic helix-loop-helix transcription factor family protein. |
| AT3G56980 | Encodes a member of the basic helix-loop-helix transcription factor protein. |
| AT3G57072 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G57130 | Encodes BOP1. Contains Pfam domain, PF00023: Ankyrin repeat and Pfam domain, PF00651: BTB/POZ domain. Lines carrying recessive mutations exhibit a number of visible defects, most pronounced being ectopic outgrowths of in leaf petioles of rosette leaves. Along with BOP2, BOP1 is required for nectary development and formation of normal abscission zones.Forms homodimers and heterodimers with BOP2. Nuclear localization is required for activity which includes positive regulation of AS2 in leaves. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP1 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP1 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP1 expression is restricted to pedicel axils by BP and PNY. BOP1 promotes KNAT6 (At1g23380) expression.BOP1 Interacts with BIL1/BZR1 and Inhibits BIL1/BZR1 transport into the nucleus. |
| AT3G57230 | MADS-box transcription factor. Expressed in leaf, root and stem, with higher RNA accumulation in guard cells and trichomes. AGL16 can directly interact with SVP and indirectly interact with FLC. Furthermore, the accumulation of AGL16 transcripts is modulated by miR824 (AT4G24415). The flowering time effect for the miR824/AGL16 module is more obvious in the Col-FRI background than in the Col-0 background. AGL16 controls flowering via a allelic dosage effect in long-day non-vernalized conditions. |
| AT3G57240 | encodes a member of glycosyl hydrolase family 17 |
| AT3G57260 | beta 1,3-glucanase |
| AT3G57350 | Nucleoporin interacting component (Nup93/Nic96-like) family protein;(source:Araport11) |
| AT3G57410 | Encodes a protein with high homology to animal villin. VLN3 is a Ca2+-regulated villin involved in actin filament bundling. |
| AT3G57460 | catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding protein;(source:Araport11) |
| AT3G57710 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G57765 | encodes a small nuclear RNA, which is a part of small nuclear ribonuclear particle (snRNP) and is involved in RNA processing such as splicing and polyadenylation. |
| AT3G57800 | Together with bHLH48 associates with phytochrome interacting factor 7 to regulate hypocotyl elongation. |
| AT3G57840 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G57880 | Required for maintenance of inflorescence and shoot SAMs and normal development of the derived vascular cambium, functions in the SAM to promote continuous organogenesis, affects SAM development through STM, where it affects intracellular localization of STM in SAM cells in the peripheral region and prevents STM localization toward the cell wall of SAM cells in the peripheral region. |
| AT3G58020 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT3G58150 | Optic atrophy 3 protein (OPA3);(source:Araport11) |
| AT3G58160 | Class XI myosin gene expressed in flowers from 4-6 week old plants and leaves from 3 week old plants |
| AT3G58210 | TRAF-like family protein;(source:Araport11) |
| AT3G58230 | Ubiquitin-specific protease family C19-related protein;(source:Araport11) |
| AT3G58240 | TRAF-like superfamily protein;(source:Araport11) |
| AT3G58250 | TRAF-like family protein;(source:Araport11) |
| AT3G58270 | phospholipase-like protein (PEARLI 4) with TRAF-like domain protein;(source:Araport11) |
| AT3G58290 | TRAF-like superfamily protein;(source:Araport11) |
| AT3G58300 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT3G58330 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT3G58347 | Pseudogene of AT3G58330 |
| AT3G58360 | TRAF-like family protein;(source:Araport11) |
| AT3G58400 | TRAF-like family protein;(source:Araport11) |
| AT3G58410 | TRAF-like family protein;(source:Araport11) |
| AT3G58420 | TRAF-like superfamily protein;(source:Araport11) |
| AT3G58730 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
| AT3G58780 | One of two genes (SHP1 and SHP2) that are required for fruit dehiscence. The two genes control dehiscence zone differentiation and promote the lignification of adjacent cells. |
| AT3G58820 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G59030 | Encodes a proton antiporter. Involved in the transportation of proanthocyanidin precursors into the vacuole. In vitro transport experiments showed that cyanidin-3-O-glucoside (anthocyanin) was an effective substrate, whereas the proanthocyanidin precursor epicatechin was not transported. However catechin-3-O-glucoside inhibited anthocyanin transport in a dose-dependent manner suggesting that glycosylated epicatechin is the in vivo substrate. Recessive mutation has strong reduction of proanthocyanidin deposition in vacuoles and has reduced dormancy. Expressed in the endothelium of ovules and developing seeds. |
| AT3G59060 | Encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. Involved in shade avoidance. Functions as negative regulator of PhyB. Protein levels are modulated by phytochrome B. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
| AT3G59068 | Natural antisense transcript overlaps with AT3G59070;(source:Araport11) |
| AT3G59070 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11) |
| AT3G59100 | encodes a protein similar to callose synthase |
| AT3G59120 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G59140 | member of MRP subfamily |
| AT3G59170 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G59220 | encodes a cupin-domain containing protein that is similar to pirins which interact with a CCAAT box binding transcription factor. The protein interacts with GPA1 (G protein alpha-subunit) in vitro. Mutants in the gene are affected in germination and early seedling development. |
| AT3G59260 | pirin;(source:Araport11) |
| AT3G59340 | solute carrier family 35 protein (DUF914);(source:Araport11) |
| AT3G59440 | Encodes an endomembrane localized member of the CML subfamily VII. Contains a canonical CaM domain and unique N-terminal extension that distinguishes it from other members of the subfamily. |
| AT3G59540 | Ribosomal L38e protein family;(source:Araport11) |
| AT3G59580 | Plant regulator RWP-RK family protein;(source:Araport11) |
| AT3G59620 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT3G59710 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G59760 | Arabidopsis thaliana O-acetylserine (thiol) lyase (OAS-TL) isoform oasC. Required for pollen tube growth and/or fertilization. |
| AT3G59820 | LETM1-like protein;(source:Araport11) |
| AT3G59920 | RAB GDP DISSOCIATION INHIBITOR 2 The mRNA is cell-to-cell mobile. |
| AT3G59990 | Encodes a MAP2 like methionine aminopeptidase |
| AT3G60020 | SKP1-like 5;(source:Araport11) |
| AT3G60060 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G60110 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT3G60130 | beta glucosidase 16;(source:Araport11) |
| AT3G60238 | other_RNA;(source:Araport11) |
| AT3G60270 | Cupredoxin superfamily protein;(source:Araport11) |
| AT3G60280 | Encodes blue copper-binding protein III. |
| AT3G60328 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G60410 | hypothetical protein (DUF1639);(source:Araport11) |
| AT3G60510 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
| AT3G60710 | F-box family protein. |
| AT3G60960 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G60965 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.8e-146 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT3G60970 | member of MRP subfamily |
| AT3G61035 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT3G61190 | Encodes a protein with a C2 domain that binds to BON1 in yeast two hybrid analyses. Its ability to bind to phospholipids is enhanced by calcium ions. Involved in maintaining cell homeostasis. |
| AT3G61230 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. |
| AT3G61250 | LATE MERISTEM IDENTITY2 (LMI2) is a target of the meristem identity regulator LEAFY (LFY). Has a role in the meristem identity transition from vegetative growth to flowering. Member of the R2R3 factor gene family. |
| AT3G61300 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT3G61390 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT3G61410 | U-box kinase family protein;(source:Araport11) |
| AT3G61415 | SKP1-like 21;(source:Araport11) |
| AT3G61490 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G61500 | BPS1-like protein;(source:Araport11) |
| AT3G61560 | Reticulon family protein;(source:Araport11) |
| AT3G61620 | exonuclease RRP41 (RRP41) |
| AT3G61630 | CRF6 encodes one of the six cytokinin response factors. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves. |
| AT3G61680 | PLIP1 encodes a plastid localized phospholipase A1 involved in seed oil biosynthesis. |
| AT3G61720 | Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT3G61880 | Encodes a cytochrome p450 monooxygenase. Overexpression of this gene allows fruit growth independently of fertilization. The gene is normally expressed only in floral organs(during the Arabidopsis stage 14 flower) and in the funiculus at anthesis. |
| AT3G61940 | Member of Zinc transporter (ZAT) family. Expressed in roots under low zinc conditions. |
| AT3G62010 | metal ion-binding protein;(source:Araport11) |
| AT3G62020 | germin-like protein (GLP10) |
| AT3G62150 | Encodes a facultative transporter controlling auxin concentrations in plant cells. |
| AT3G62270 | BOR2 is involved in efficient borate crosslinking of rhamnogalacturonan II in cell walls under boron limitation. |
| AT3G62529 | pseudogene of pentatricopeptide (PPR) repeat-containing protein |
| AT3G62570 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G62620 | Encodes a protein of unknown function. Previously this protein has been annotated computationally as a sucrose-phosphatase-related protein. However, the source of this annotation can not be verified. This annotation (sucrose-phosphatase-related) has been removed. |
| AT3G62630 | stress response NST1-like protein (DUF1645);(source:Araport11) |
| AT3G62650 | hypothetical protein;(source:Araport11) |
| AT3G62670 | member of Response Regulator: B- Type |
| AT3G62690 | Encodes a RING-H2 zinc finger protein related to ATL2. The ATL gene family is represented by fifteen sequences that contain, in addition to the RING, a transmembrane domain which is located in most of them towards the N-terminal end. |
| AT3G62700 | member of MRP subfamily |
| AT3G62740 | beta glucosidase 7;(source:Araport11) |
| AT3G62760 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT3G62850 | zinc finger protein-like protein;(source:Araport11) |
| AT3G62890 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G63190 | The gene encodes a chloroplast ribosome recycling factor homologue. Analysis of mutants revealed its role in the chloroplast development and eary stages of embryo development. |
| AT3G63360 | Encodes a defensin-like (DEFL) family protein. |
| AT4G00060 | Nucleotidyltransferase family protein;(source:Araport11) |
| AT4G00160 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT4G00165 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G00210 | LOB domain-containing protein 31;(source:Araport11) |
| AT4G00232 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT4G00236 | pseudogene of Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT4G00260 | Transcriptional factor B3 family protein;(source:Araport11) |
| AT4G00290 | Encodes a non-selective mechanosensitive ion channel localized to the inner mitochondrial membrane. |
| AT4G00300 | AT4G00300 has been split into two loci based on new cDNA evidence provided by Aleksander Riise Hansen of University of Copenhagen: AT4G00300.2 becomes AT4G00300.1; a new locus AT4G00295 is created. See comments field for AT4G00295 annotation. |
| AT4G00330 | high overall homology to CRCK1 |
| AT4G00400 | bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly and is functionally redundant with GPAT4. |
| AT4G00460 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT4G00467 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT4G00480 | MYC-related protein with a basic helix-loop-helix motif at the C-terminus and a region similar to the maize B/R family at the N-terminus |
| AT4G00530 | UvrABC system protein A;(source:Araport11) |
| AT4G00600 | Amino acid dehydrogenase family protein;(source:Araport11) |
| AT4G00650 | Encodes a major determinant of natural variation in Arabidopsis flowering time. Dominant alleles of FRI confer a vernalization requirement causing plants to overwinter vegetatively. Many early flowering accessions carry loss-of-function fri alleles .Twenty distinct haplotypes that contain non-functional FRI alleles have been identified and the distribution analyzed in over 190 accessions. The common lab strains- Col and Ler each carry loss of function mutations in FRI. |
| AT4G00700 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G00780 | TRAF-like family protein;(source:Araport11) |
| AT4G00870 | bHLH14 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH13 and bHLH17 to negatively regulate jasmonate responses. |
| AT4G00900 | Type IIA (SERCA-type) Ca2+ ATPase, catalyzes the efflux of calcium from the cytoplasm. |
| AT4G00920 | COP1-interacting protein-like protein;(source:Araport11) |
| AT4G00970 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G01000 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G01010 | member of Cyclic nucleotide gated channel family |
| AT4G01023 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G01070 | the glycosyltransferase (UGT72B1) is involved in metabolizing xenobiotica (chloroaniline and chlorophenole). Comparison between wild type and knock-out mutant demonstrates the central role of this gene for metabolizing chloroaniline but significantly less for chlorophenole. The glucosyltransferase preferred UDP-xylose over UDP-glucose indicating its (additional) functioning as a xylosyltransferase in planta |
| AT4G01130 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G01150 | Integral thylakoid membrane protein required for proper grana stack curvature. |
| AT4G01230 | Reticulon family protein. Mutants are resistant to agrobacterium infection. |
| AT4G01265 | Pseudogene of AT4G01265; raffinose synthase family protein |
| AT4G01290 | Protein with evolutionarily conserved eIF4E-binding motif in its N-terminal domain that can form mRNA cap?binding complexes and has the potential for regulating gene expression as a translation factor associated plant-specific cell cycle regulator. |
| AT4G01380 | plastocyanin-like domain-containing protein;(source:Araport11) |
| AT4G01470 | Encodes AtTIP1;3, functions as water and urea channels in pollen. |
| AT4G01480 | Encodes a protein that might have inorganic pyrophosphatase activity. |
| AT4G01510 | Arv1-like protein;(source:Araport11) |
| AT4G01630 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT4G01640 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT4G01670 | hypothetical protein;(source:Araport11) |
| AT4G01810 | Sec23 homolog , forms a distinct clade with SEC23D.Mutants have defects in pollen exine patterning, tapetal development and pollen intine formation. |
| AT4G01820 | member of MDR subfamily |
| AT4G01830 | P-glycoprotein 5;(source:Araport11) |
| AT4G01960 | transmembrane protein;(source:Araport11) |
| AT4G01985 | hypothetical protein;(source:Araport11) |
| AT4G02100 | Heat shock protein DnaJ with tetratricopeptide repeat-containing protein;(source:Araport11) |
| AT4G02170 | cotton fiber protein;(source:Araport11) |
| AT4G02235 | AGAMOUS-like 51;(source:Araport11) |
| AT4G02280 | Encodes a protein with sucrose synthase activity (SUS3). It appears to be important for sucrose metabolism in developing seeds, especially during the late maturation phase, about 18 days after flowering. |
| AT4G02320 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G02465 | hypothetical protein;(source:Araport11) |
| AT4G02500 | Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides. The mRNA is cell-to-cell mobile. |
| AT4G02560 | Encodes a nuclear localized protein with similarity to transcriptional regulators. Recessive mutants are late flowering. Expression of LFY is reduced in LD mutants. LD has been reported to exhibit prion like behavior in yeast but it remains to be determined if such activity exists during normal plant development. |
| AT4G02630 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G02650 | Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane. |
| AT4G02670 | indeterminate(ID)-domain 12;(source:Araport11) |
| AT4G02740 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT4G02800 | GRIP/coiled-coil protein;(source:Araport11) |
| AT4G02810 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
| AT4G02820 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G02870 | B3 domain protein;(source:Araport11) |
| AT4G02930 | GTP binding Elongation factor Tu family protein;(source:Araport11) |
| AT4G02940 | ALKBH10B is a functional RNA N6-methyladenosine demethylase. Reduction in ALKBH10B decreases m6A levels, and affects the stability of flowering time genes including FT, SPL3 and SPL9. Mutant plants are early flowering. |
| AT4G02950 | Ubiquitin family protein;(source:Araport11) |
| AT4G03050 | The transcribed allele in ecotype Ler encodes a 2-oxoglutarate-dependent dioxygenase which is involved in glucosinolate biosynthesis. AOP3 is transcriptionally silent in leaf tissues of ecotype Col.The natural variation in this locus explains the diversification of hydroxyalkyl glucosinolates among different ecotypes of Arabidopsis. |
| AT4G03190 | Encodes an F box protein belonging to the TIR1 subfamily. This protein forms SCF complexes with ASK1 and CUL1 and interacts with Aux/IAA proteins in an auxin-dependent manner. It also has sequence similarity to the yeast protein GRR1, which is involved in glucose repression. |
| AT4G03205 | Coproporphyrinogen III oxidase;(source:Araport11) |
| AT4G03220 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
| AT4G03290 | EF hand calcium-binding protein family;(source:Araport11) |
| AT4G03320 | Encodes a component of the TIC (translocon at the inner envelope membrane of chloroplasts) protein translocation machinery mediating the protein translocation across the inner envelope of plastids. The Arabidopsis genome encodes four Tic20 homologous proteins, AT1G04940(Tic20-I), AT2G47840(Tic20-II), AT4G03320(Tic20-IV) and AT5G55710(Tic20-V). |
| AT4G03370 | Ubiquitin family protein;(source:Araport11) |
| AT4G03380 | hypothetical protein;(source:Araport11) |
| AT4G03450 | Ankyrin repeat family protein;(source:Araport11) |
| AT4G03620 | myosin heavy chain-like protein;(source:Araport11) |
| AT4G03630 | RNI-like superfamily protein;(source:Araport11) |
| AT4G03811 | other_RNA;(source:Araport11) |
| AT4G03816 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.6e-22 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT4G03873 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 8.5e-06 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT4G03930 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G04030 | transcription repressor;(source:Araport11) |
| AT4G04090 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT4G04170 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.3e-87 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G04260 | Bromo-adjacent homology (BAH) domain-containing protein;(source:Araport11) |
| AT4G04290 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-94 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
| AT4G04296 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.4e-13 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT4G04404 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT4G04423 | hypothetical protein;(source:Araport11) |
| AT4G04450 | member of WRKY Transcription Factor; Group II-b. Interacts with lncRNA APOLO to trigger root hair cell expansion in response to cold. |
| AT4G04490 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04510 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04547 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-68 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT4G04640 | One of two genes (with ATPC2) encoding the gamma subunit of Arabidopsis chloroplast ATP synthase. |
| AT4G04680 | Rix1 complex component;(source:Araport11) |
| AT4G04690 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G04695 | member of Calcium Dependent Protein Kinase. Involved in response to salicylic acid. |
| AT4G04710 | member of Calcium Dependent Protein Kinase |
| AT4G04830 | methionine sulfoxide reductase B5;(source:Araport11) |
| AT4G04850 | Encodes a potassium efflux antiporter; has three splice forms KEA3.1, KEA3.2, and KEA3.3, KEA3.2 is the most abundant splice form in all plant organs (silique, flower, leaf and root). KEA3.1 and KEA3.3 are minor variants that can be found in flowers and in leaves. KEA3 is localized to the thylakoid membrane and enriched in the stromal lamellae. It allows proton efflux from the thylakoid lumen by proton/potassium antiport. |
| AT4G04885 | Encodes PCFS4 (Pcf11p-similar protein 4), a homolog of yeast polyadenylation factor Protein 1 of Cleavage Factor (Pcf11p). Regulates FCA (AT4G16280) mRNA polyadenylation. Promotes flowering time. |
| AT4G04890 | Encodes a homeodomain protein that is expressed in the LI layer of the vegetative, floral and inflorescence meristems. Binds to the L1 box promoter element which is required in some proteins for L1 specific expression. |
| AT4G04900 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Most similar to RIC9 and RIC11 (subfamily group I). Gene is expressed predominantly in roots, leaves, and seedlings. |
| AT4G04950 | Encodes a monothiol glutaredoxin that is a critical component involved in ROS accumulation, auxin signaling, and temperature-dependent postembryonic growth in plants. It has been shown to associate with the cytosolic Fe-S assembly (CIA) complex and contributes to, but is not essential for, the correct functioning of client Fe-S proteins in unchallenged conditions. |
| AT4G04972 | hypothetical protein;(source:Araport11) |
| AT4G04980 | hypothetical protein;(source:Araport11) |
| AT4G05020 | Miitochondrial alternative NADH dehydrogenase. |
| AT4G05040 | ankyrin repeat family protein;(source:Araport11) |
| AT4G05071 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G05105 | Encodes a microRNA that targets several Laccase family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCAUUGAGUGCAGCGUUGAUG |
| AT4G05160 | Encodes a peroxisomal protein involved in the activation of fatty acids through esterification with CoA. At4g05160 preferentially activates fatty acids with medium chain length (C6:0 and C7:0) as well as even-numbered long-chain fatty acids (C14:0, C16:0 and C18:0). At4g05160 was also able to catalyze the conversion of OPC-6:0 to its CoA ester and is therefore thought to be involved in the peroxisomal β-oxidation steps of jasmonic acid biosynthesis. |
| AT4G05180 | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II. |
| AT4G05200 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G05230 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G05430 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT4G05530 | Encodes a peroxisomal member of the short-chain dehydrogenase/reductase (SDR) family of enzymes. Loss of IBR1 function causes increased resistance to indole-3-butyric acid without affecting plant responses to IAA, NAA, and 2,4-D. This enzyme may be responsible for catalyzing a dehydrogenation step in the beta-oxidation-like conversion of IBA to IAA. The mRNA is cell-to-cell mobile. |
| AT4G05540 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G05592 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-43 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT4G06474 | transposable_element_gene;(source:Araport11);retroelement pol polyprotein;(source:TAIR10) |
| AT4G06479 | nucleic acid binding / zinc ion binding protein;(source:Araport11) |
| AT4G06526 | nucleic acid binding / zinc ion binding protein;(source:Araport11) |
| AT4G06548 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.5e-39 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT4G06557 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 6.5e-16 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
| AT4G06629 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.6e-12 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G06646 | transposable_element_gene;(source:Araport11);pseudogene, similar to OJ1081_B12.13, blastp match of 33%25 identity and 9.8e-51 P-value to GP|27817864|dbj|BAC55632.1||AP003865 OJ1081_B12.13 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT4G06654 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.2e-88 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
| AT4G06658 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-182 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT4G06692 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.8e-160 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT4G06700 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.7e-54 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
| AT4G06702 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G07460 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42430.1);(source:TAIR10) |
| AT4G07516 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-08 P-value blast match to GB:AAC34906 reverse transcriptase (LINE-element) (Forficula auricularia);(source:TAIR10) |
| AT4G07736 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.6e-114 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G07803 | transposable_element_gene;(source:Araport11);pseudogene, helicase -related, similar to putative helicase;(source:TAIR10) |
| AT4G07896 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to contains similarity to Arabidopsis thaliana hypothetical protein (GB:AC004483);(source:TAIR10) |
| AT4G07932 | hypothetical protein;(source:Araport11) |
| AT4G07950 | DNA-directed RNA polymerase, subunit M, archaeal;(source:Araport11) |
| AT4G08032 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative transposable element, similar to transposase, putative;(source:TAIR10) |
| AT4G08040 | encodes an aminotransferase that belongs to ACC synthase gene family structurally |
| AT4G08053 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 3.4e-89 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
| AT4G08056 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30843.1);(source:TAIR10) |
| AT4G08110 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 4.2e-66 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G08290 | nodulin MtN21-like transporter family protein |
| AT4G08340 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10) |
| AT4G08360 | KOW domain-containing protein;(source:Araport11) |
| AT4G08450 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G08485 | Encodes a defensin-like (DEFL) family protein. |
| AT4G08555 | hypothetical protein;(source:Araport11) |
| AT4G08560 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT4G08596 | transposable_element_gene;(source:Araport11);pseudogene, FAR1 -related protein, temporary automated functional assignment;(source:TAIR10) |
| AT4G08740 | hypothetical protein;(source:Araport11) |
| AT4G08770 | Encodes a putative apoplastic peroxidase Prx37. Primarily expressed in the vascular bundles. Overexpression renders a dwarf phenotype with smaller plants and delayed development. Plants overexpressing Prx37 also shows an increase in the amount of esterified phenolic material associated with their walls. |
| AT4G08840 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT4G08895 | inorganic phosphate transporter family protein;(source:Araport11) |
| AT4G08910 | homeobox protein;(source:Araport11) |
| AT4G08980 | Encodes an F-box gene that is a novel negative regulator of AGO1 protein levels and may play a role in ABA signalling and/or response. It is a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins. |
| AT4G09090 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT4G09100 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09120 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09130 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09510 | CINV2 appears to function as a neutral invertase based on the phenotype of a cinv1(AT1G35580)/cinv2 double mutant. It is predicted to be a cytosolic enzyme. CINV1, CINV2, and possibly other cytosolic invertases may play an important role in supplying carbon from sucrose to non-photosynthetic tissues. |
| AT4G09540 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-43 P-value blast match to GB:AAC64917 gag-pol polyprotein (Ty1_Copia-element) (Glycine max);(source:TAIR10) |
| AT4G09870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G09920 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT4G09930 | Avirulence induced gene (AIG1) family protein;(source:Araport11) |
| AT4G09950 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G09965 | hypothetical protein;(source:Araport11) |
| AT4G10000 | Thioredoxin family protein;(source:Araport11) |
| AT4G10010 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G10020 | Encodes a putative hydroxysteroid dehydrogenase (HSD). Genes that encode HSD include: At5g50600 and At5g50700 (HSD1), At3g47350(HSD2), At3g47360(HSD3), At5g50590 and At5g50690(HSD4), At5g50770(HSD6) (Plant Cell Physiology 50:1463). Two copies of HSD1 and HSD4 exist due to a gene duplication event. In Plant Physiology 145:87, At5g50690 is HSD7, At4g10020 is HSD5. |
| AT4G10060 | Glucosylceramidase that preferentially hydrolyzes long acyl chain glucosylceramides. |
| AT4G10200 | TTF-type zinc finger protein with HAT dimerization domain-containing protein;(source:Araport11) |
| AT4G10310 | encodes a sodium transporter (HKT1) expressed in xylem parenchyma cells. Mutants over-accumulate sodium in shoot tissue and have increased sodium in the xylem sap and reduced sodium in phloem sap and roots. |
| AT4G10370 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G10380 | Boric acid channel. Essential for efficient boron uptake and plant development under boron limitation. Also functions in arsenite transport and tolerance. Localized preferentially in outer membrane domains of root cells. |
| AT4G10430 | TMPIT-like protein;(source:Araport11) |
| AT4G10480 | Nascent polypeptide-associated complex (NAC), alpha subunit family protein;(source:Araport11) |
| AT4G10490 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G10500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G10507 | other_RNA;(source:Araport11) |
| AT4G10510 | Subtilase family protein;(source:Araport11) |
| AT4G10520 | Subtilase family protein;(source:Araport11) |
| AT4G10530 | Subtilase family protein;(source:Araport11) |
| AT4G10540 | Proteolytic enzyme of that phytaspase family which at pH 5.5 is strictly Asp-specific. Strongly preferred cleavage motifs are YVAD and IETD. |
| AT4G10610 | RNA-binding protein, putative. Member of a family of proteins having an PABC binding domain (PAM motif). |
| AT4G10820 | F-box family protein;(source:Araport11) |
| AT4G11050 | glycosyl hydrolase 9C3;(source:Araport11) |
| AT4G11250 | AGAMOUS-like 52;(source:Araport11) |
| AT4G11300 | ROH1, putative (DUF793);(source:Araport11) |
| AT4G11330 | MAP kinase |
| AT4G11480 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G11485 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G11530 | Encodes a cysteine-rich receptor-like protein kinase. The mRNA is cell-to-cell mobile. |
| AT4G11580 | RNI-like superfamily protein;(source:Araport11) |
| AT4G11610 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G11690 | Encodes ABO8, a pentatricopeptide repeat (PPR) protein responsible for the splicing of NAD4 intron 3 in mitochondrial complex I. Abo8 mutants accumulate more reactive oxygen species (ROS) in root tips than the wild type. |
| AT4G11700 | hypothetical protein (DUF626);(source:Araport11) |
| AT4G11730 | Cation transporter/ E1-E2 ATPase family protein;(source:Araport11) |
| AT4G11740 | Isolated as a suppressor of a dominant mutant in the Ara4 gene that was expressed in yeast ypt1 mutant strains. A novel protein with a small region of similarity to coil-coiled domain of yeast VSP27 protein. |
| AT4G11745 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G11760 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G11770 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G11810 | Encodes an SPX domain protein that transports Pi into the vacuole. Overexpression of PHT5:2 leads to massive Pi sequestration into vacuoles and altered regulation of Pi starvation-responsive genes. |
| AT4G11820 | Encodes a protein with hydroxymethylglutaryl-CoA synthase activity which was characterized by phenotypical complementation of the S. cerevisiae mutant. Involved in glucosinolate biosynthesis. |
| AT4G11890 | Encodes a receptor-like cytosolic kinase ARCK1. Negatively controls abscisic acid and osmotic stress signal transduction. |
| AT4G11930 | hypothetical protein;(source:Araport11) |
| AT4G11950 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT4G12030 | Required for the biosynthesis of methionine-derived glucosinolates. Involved in the transport of 2-keto acids between chloroplasts and the cytosol. |
| AT4G12065 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT4G12080 | AT-hook motif nuclear-localized protein 1;(source:Araport11) |
| AT4G12100 | Cullin family protein;(source:Araport11) |
| AT4G12120 | member of KEULE Gene Family |
| AT4G12160 | pseudogene of Ribosomal protein S4;(source:Araport11) |
| AT4G12200 | transposable_element_gene;(source:Araport11);similar to polyprotein [Oryza sativa] (GB:BAB03249.1);(source:TAIR10) |
| AT4G12370 | F-box/kelch-repeat protein;(source:Araport11) |
| AT4G12420 | Encodes a protein of unknown function involved in directed root tip growth. It is a member of 19-member gene family and is distantly related structurally to the multiple-copper oxidases ascorbate oxidase and laccase, though it lacks the copper-binding domains. The protein is glycosylated and GPI-anchored. It is localized to the plasma membrane and the cell wall. The gene is expressed most strongly in expanding tissues. |
| AT4G12423 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.8e-26 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT4G12460 | OSBP(oxysterol binding protein)-related protein 2B;(source:Araport11) |
| AT4G12470 | Encodes AZI1 (AZELAIC ACID INDUCED 1). Involved in the priming of salicylic acid induction and systemic immunity triggered by pathogen or azelaic acid. Targeting if AZI1 to chloroplasts is increased during SAR induction and that localization requires the PRR domain.It is involved in the uptake and movement of the azelaic acid signal. AZI1 uses a previously undescribed variant of the signal anchor proteins mechanism to target plastids. AZI1 uses a bipartite N-terminal signature: a non-cleavable TMD that anchors the protein to membranes, followed by a proline rich region with features that are shared with bona fide chloroplastic transit peptides. flg22 MAMP treatment strongly induces AZI1/EARLI1 protein levels and increases their relative enrichment in the plastid fraction. |
| AT4G12545 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G12617 | B3 domain protein;(source:Araport11) |
| AT4G12690 | DUF868 family protein (DUF868);(source:Araport11) |
| AT4G12730 | AF333971 Arabidopsis thaliana fasciclin-like arabinogalactan-protein 2 (Fla2) mRNA, complete cds. Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT4G12735 | Encodes a peroxisomal protein. |
| AT4G12740 | HhH-GPD base excision DNA repair family protein;(source:Araport11) |
| AT4G12930 | hypothetical protein;(source:Araport11) |
| AT4G12940 | hypothetical protein;(source:Araport11) |
| AT4G13100 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G13180 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G13240 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT4G13260 | Encodes YUC2. Catalyzes conversion of IPA (indole-3-pyruvic acid) to IAA (indole-3-acetic acid) in auxin biosynthesis pathway. |
| AT4G13265 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
| AT4G13266 | PGG domain containing transmembrane protein.Functions in the stigma to prevent interspecies pollen from forming pollen tubes. |
| AT4G13345 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
| AT4G13420 | Encodes a protein of the KUP/HAK/KT potassium channel class that is upregulated in the roots by K levels. |
| AT4G13440 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G13480 | Member of the R2R3 factor gene family. |
| AT4G13494 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGAGAGCAACAAGACAUAAU |
| AT4G13590 | Chloroplast manganese transporter required for chloroplast manganese homeostasis and photosynthetic function. |
| AT4G13611 | Pseudogene of AT3G56530; ANAC064 (Arabidopsis NAC domain containing protein 64); transcription factor |
| AT4G13620 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. The mRNA is cell-to-cell mobile. |
| AT4G13680 | hypothetical protein (DUF295);(source:Araport11) |
| AT4G13750 | Encodes NO VEIN (NOV), a plant-specific nuclear factor required for leaf vascular development, cellular patterning and stem cell maintenance in the root meristem, as well as for cotyledon outgrowth and separation. nov mutations affect many aspects of auxin-dependent development without directly affecting auxin perception. |
| AT4G13770 | Encodes a cytochrome p450 enzyme that catalyzes the initial conversion of aldoximes to thiohydroximates in the synthesis of glucosinolates not derived from tryptophan. Also has a role in auxin homeostasis. |
| AT4G13810 | receptor like protein 47;(source:Araport11) |
| AT4G13830 | DnaJ-like protein (J20); nuclear gene |
| AT4G13840 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT4G13890 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT4G13930 | Encodes a serine hydroxymethyltransferase maximally expressed in root |
| AT4G13965 | F-box/FBD/LRR protein;(source:Araport11) |
| AT4G14060 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT4G14225 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT4G14240 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
| AT4G14260 | hypothetical protein (DUF295);(source:Araport11) |
| AT4G14320 | Zinc-binding ribosomal protein family protein;(source:Araport11) |
| AT4G14350 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT4G14365 | hypothetical protein;(source:Araport11) |
| AT4G14368 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT4G14390 | Ankyrin repeat family protein;(source:Araport11) |
| AT4G14440 | encodes a cytosolic delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation |
| AT4G14580 | CBL-interacting protein kinase |
| AT4G14650 | hypothetical protein;(source:Araport11) |
| AT4G14723 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT4G14740 | FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT4G14750 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G14760 | kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT4G14785 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT4G14870 | Encodes a component of the thylakoid-localized Sec system involved in the translocation of cytoplasmic proteins into plastid. The mRNA is cell-to-cell mobile. |
| AT4G15040 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT4G15060 | FBD, F-box/LRR protein;(source:Araport11) |
| AT4G15100 | serine carboxypeptidase-like 30;(source:Araport11) |
| AT4G15150 | glycine-rich protein;(source:Araport11) |
| AT4G15200 | Actin nucleation factor that directs the formation of actin cables in pollen tubes. Involved in cytoplasmic streaming and polarized growth in pollen tubes. |
| AT4G15210 | cytosolic beta-amylase expressed in rosette leaves and inducible by sugar. RAM1 mutants have reduced beta amylase in leaves and stems. |
| AT4G15233 | ABC-2 and Plant PDR ABC-type transporter family protein;(source:Araport11) |
| AT4G15248 | B-box type zinc finger family protein;(source:Araport11) |
| AT4G15280 | UDP-glucosyl transferase 71B5;(source:Araport11) |
| AT4G15300 | cytochrome P450, family 702, subfamily A, polypeptide 2;(source:Araport11) |
| AT4G15320 | encodes a gene similar to cellulose synthase |
| AT4G15330 | cytochrome P450, family 705, subfamily A, polypeptide 1;(source:Araport11) |
| AT4G15350 | member of CYP705A |
| AT4G15380 | member of CYP705A |
| AT4G15396 | cytochrome P450, family 702, subfamily A, polypeptide 6;(source:Araport11) |
| AT4G15417 | RNAse II-like 1;(source:Araport11) |
| AT4G15420 | Ubiquitin fusion degradation UFD1 family protein;(source:Araport11) |
| AT4G15430 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
| AT4G15450 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
| AT4G15530 | Encodes a dual-targeted protein believed to act as a pyruvate, orthophosphate dikinase. These enzymes are normally associated with C4 photosynthesis which does not occur in Arabidopsis. However, PPDK may play a role in remobilizing nitrogen during leaf senescence in Arabidopsis. The product of the long transcript (.1 gene model) was shown to be targeted to the chloroplast, whereas the shorter transcript (no targeting sequence) accumulates in the cytosol. The two proteins were also found to be expressed in slightly different tissues. |
| AT4G15550 | UDP-glucose:indole-3-acetate beta-D-glucosyltransferase |
| AT4G15650 | kinase-like protein;(source:Araport11) |
| AT4G15715 | Proteinase inhibitor I25, cystatin, conserved region;(source:Araport11) |
| AT4G15740 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT4G15760 | Encodes a protein with similarity to monooxygenases that are known to degrade salicylic acid (SA). |
| AT4G15802 | Encodes a protein with similarity to heat shock factor binding proteins. Involved in negative regulation of heat shock response. Becomes nuclear localized upon heat treatment. |
| AT4G15980 | ProPME pectin methylesterase |
| AT4G15990 | hypothetical protein;(source:Araport11) |
| AT4G16150 | CATMA5 is a transcriptional activator. It acts in the cold response pathway, it can bind to and activate the expression of DREB1 genes. |
| AT4G16155 | dihydrolipoamide dehydrogenase;(source:Araport11) |
| AT4G16200 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT4G16230 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G16350 | Calcium sensor protein. Binds CIPK14. |
| AT4G16460 | zinc finger CCCH domain protein;(source:Araport11) |
| AT4G16680 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G16740 | Encodes an (E,E)-alpha-farnesene synthase in the Col ecotype of Arabidopsis. This enzyme can also catalyze the formation of (E)-beta-ocimene as well as trace amounts of myrcene and other related compounds in vitro. The cytosolic localization of the protein may make it favor (E,E)-alpha-farnesene biosynthesis because the precursor of this product, FPP, is primarily cytosolic. Transcript levels for this gene increase in response to treatment with the jasmonic acid mimic coronalon or in response to the insect Plutella xylostella. TPS03 transcripts can also be detected in flowers. A similar protein from the C24 ecotype with one amino acid change (S267F) has a different substrate specificity. |
| AT4G16745 | Exostosin family protein;(source:Araport11) |
| AT4G16760 | Encodes a medium to long-chain acyl-CoA oxidase. Catalyzes the first step of fatty acid beta-oxidation. Involved in jasmonate biosynthesis. Gene expression is induced by wounding, drought stress, abscisic acid, and jasmonate. |
| AT4G16790 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G16820 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT4G16920 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G16935 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 3.3e-16 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G16990 | disease resistance protein (TIR-NBS class);(source:Araport11) |
| AT4G17080 | Histone H3 K4-specific methyltransferase SET7/9 family protein;(source:Araport11) |
| AT4G17160 | RAB GTPase homolog B1A;(source:Araport11) |
| AT4G17210 | weak chloroplast movement under blue light protein (DUF827);(source:Araport11) |
| AT4G17250 | transmembrane protein;(source:Araport11) |
| AT4G17260 | Lactate/malate dehydrogenase family protein;(source:Araport11) |
| AT4G17470 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G17660 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G17670 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT4G17700 | hypothetical protein;(source:Araport11) |
| AT4G17710 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT4G17713 | Encodes a defensin-like (DEFL) family protein. |
| AT4G17780 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G17785 | Encodes a putative transcription factor (MYB39) involved in the regulation of suberin biosynthetic genes. |
| AT4G17900 | PLATZ transcription factor family protein;(source:Araport11) |
| AT4G17990 | hypothetical protein;(source:Araport11) |
| AT4G18050 | P-glycoprotein 9;(source:Araport11) |
| AT4G18080 | transmembrane protein;(source:Araport11) |
| AT4G18110 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G18340 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G18350 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
| AT4G18425 | transmembrane protein, putative (DUF679);(source:Araport11) |
| AT4G18450 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT4G18540 | transmembrane protein;(source:Araport11) |
| AT4G18550 | DSEL is cytosolic acylhydrolase that shows prefential lipase activity against the sn-1 position of several classes of lipids, including 1,3-diacylglycerols and 1-monoacylglycerols. Overexpression of DSEL leads to increased peroxisome and oil body levels in cotyledons and reduced beta-oxidation activity in seedlings. |
| AT4G18630 | hypothetical protein (DUF688);(source:Araport11) |
| AT4G18770 | MYB98 is a member of the R2R3-MYB gene family, the members of which likely encode transcription factors. Within an ovule, MYB98 is expressed exclusively in the synergid cells, and mutations in this gene affect the female gametophyte specifically. myb98 female gametophytes are affected in two unique features of the synergid cell, pollen tube guidance and the filiform apparatus, but are otherwise normal. This suggests that MYB98 controls the development of specific features within the synergid cell during female gametophyte development. MYB98 also is expressed in trichomes and endosperm. Homozygous myb98 mutants exhibit no sporophytic defects, including trichome and endosperm defects. |
| AT4G18780 | Encodes a member of the cellulose synthase family involved in secondary cell wall biosynthesis. Mutants have abnormal xylem formation, reduced cellulose content, and enhanced drought and osmotic stress tolerance. Mediates resistance towards bacterial pathogens via ABA. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling. |
| AT4G18920 | histone acetyltransferase (DUF1264);(source:Araport11) |
| AT4G19045 | Member of a conserved family of proteins. Functions redundantly with MOB1A to regulate cell proliferation and JA metabolism. |
| AT4G19050 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT4G19160 | transglutaminase family protein;(source:Araport11) |
| AT4G19230 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. CYP707A1 appears to play an important role in determining the ABA levels in dry seeds. Gene involved in postgermination growth. Overexpression of CYP707A1 leads to a decrease in ABA levels and a reduction in after-ripening period to break dormancy. |
| AT4G19360 | SCD6 protein-like protein;(source:Araport11) |
| AT4G19370 | chitin synthase, putative (DUF1218);(source:Araport11) |
| AT4G19410 | Pectinacetylesterase family protein;(source:Araport11) |
| AT4G19420 | Pectinacetylesterase family protein;(source:Araport11) |
| AT4G19440 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G19452 | pseudogene of F-box family protein |
| AT4G19460 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G19520 | disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G19580 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT4G19633 | pseudogene of heat shock factor related protein |
| AT4G19770 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
| AT4G19810 | ChiC encodes a Class V chitinase that is a part of glycoside hydrolase family 18 based on CAZy groupings. It appears to primarily act as an exochitinase in vitro where it predominantly cleaves a chitobiose (GlcNAc)2 residue from the non-reducing end of a chitin oligosaccharide. However, it shows some minor endochitinase activity in vitro, as well. A putative 24 amino-acid signal peptide may direct this protein to the secretory system and it has been detected in cell wall apoplastic fluid. RT-PCR experiments demonstrate that ChiC transcript levels are increased in response to abscisisc acid, jasmonic acid, and NaCl stress. Microarray results also suggest that transcript levels rise in response to osmotic stress, two fungal pathogens, a bacterial pathogen, and the elicitor flagellin. The mRNA is cell-to-cell mobile. |
| AT4G19820 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
| AT4G19850 | encodes a protein similar to phloem protein 2 in cucumber. a member of a large gene family. |
| AT4G19910 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT4G19970 | nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT4G19980 | hypothetical protein;(source:Araport11) |
| AT4G20040 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G20080 | Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G20140 | Encodes GASSHO1 (GSO1), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO1 and a homolog GSO2 (At5g44700) are required for the formation of a normal epidermal surface during embryogenesis. Necessary for localizing CASPARIAN STRIP DOMAIN PROTEINS (CASPs) - major players of endodermal differentiation - into an uninterrupted, ring-like domain. |
| AT4G20160 | golgin family A protein;(source:Araport11) |
| AT4G20170 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT4G20190 | hypothetical protein;(source:Araport11) |
| AT4G20220 | Reverse transcriptase (RNA-dependent DNA polymerase);(source:Araport11) |
| AT4G20280 | Encodes TAF11, a putative TBP-associated factor (TBP: TATA binding protein). |
| AT4G20420 | Tapetum specific protein TAP35/TAP44;(source:Araport11) |
| AT4G20440 | small nuclear ribonucleoprotein associated protein B;(source:Araport11) |
| AT4G20800 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G20820 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G20840 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
| AT4G20860 | involved in the generation of H2O2 from reduced compounds |
| AT4G20880 | ethylene-responsive nuclear protein / ethylene-regulated nuclear protein (ERT2);(source:Araport11) |
| AT4G21020 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT4G21130 | similar to man and yeast U3-55K genes, involved in processing of pre-ribosomal RNA. |
| AT4G21192 | Cytochrome c oxidase biogenesis protein Cmc1-like protein;(source:Araport11) |
| AT4G21200 | Encodes a protein with gibberellin 2-oxidase activity which acts specifically on C-20 gibberellins. |
| AT4G21230 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G21250 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT4G21260 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT4G21350 | Encodes a U-box/ARM repeat protein required fore self-incompatibility. |
| AT4G21380 | encodes a putative receptor-like serine/threonine protein kinases that is similar to Brassica self-incompatibility (S) locus. Expressed in root. Shoot expression limited to limited to the root-hypocotyl transition zone and at the base of lateral roots as well as in axillary buds, and pedicels. |
| AT4G21420 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.9e-06 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
| AT4G21490 | NAD(P)H dehydrogenase B3;(source:Araport11) |
| AT4G21630 | Subtilase family protein;(source:Araport11) |
| AT4G21640 | Subtilase family protein;(source:Araport11) |
| AT4G21650 | Subtilase family protein;(source:Araport11) |
| AT4G21680 | Encodes a nitrate transporter (NRT1.8). Functions in nitrate removal from the xylem sap. Mediates cadmium tolerance. |
| AT4G21760 | beta-glucosidase 47;(source:Araport11) |
| AT4G21770 | Pseudouridine synthase family protein;(source:Araport11) |
| AT4G21840 | methionine sulfoxide reductase B8;(source:Araport11) |
| AT4G21950 | hypothetical protein;(source:Araport11) |
| AT4G21970 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT4G22010 | SKU5 similar 4;(source:Araport11) |
| AT4G22066 | Pseudogene of AT5G66830; F-box family protein |
| AT4G22080 | root hair specific 14;(source:Araport11) |
| AT4G22090 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G22100 | beta glucosidase 2;(source:Araport11) |
| AT4G22190 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT4G22250 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G22485 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT4G22490 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G22505 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G22590 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G22600 | Encodes a protein involved in involved in the formation of the pollen surface apertures. It acts late in aperture formation by excluding specific membrane domains from exine deposition. |
| AT4G22730 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G22758 | PPR containing protein;(source:Araport11) |
| AT4G22790 | Encodes a plasma membrane localized MATE type transporter that is involved in CO2 signaling during stomatal aperture regulation. RHC1 regulates HT1 which phosphorylates OST1, a kinase that regulates the SLAC1 anion channel and thus stomatal closing. |
| AT4G22900 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT4G22980 | molybdenum cofactor sulfurase-like protein;(source:Araport11) |
| AT4G23030 | MATE efflux family protein;(source:Araport11) |
| AT4G23130 | Encodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) |
| AT4G23160 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23200 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23210 | Encodes a Cysteine-rich receptor-like kinase (CRK13). Overexpression of CRK13 leads to hypersensitive response cell death, and induces defense against pathogens by causing increased accumulation of salicylic acid. |
| AT4G23240 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23250 | cysteine-rich receptor-like protein kinase 17;(source:Araport11) |
| AT4G23260 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23310 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23320 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23340 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G23364 | Pseudogene of AT4G23340; oxidoreductase, 2OG-Fe(II) oxygenase family protein |
| AT4G23500 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G23510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G23515 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT4G23550 | Encodes WRKY DNA-binding protein 29 (WRKY29). The mRNA is cell-to-cell mobile. |
| AT4G23690 | Encodes a homodimeric all-beta dirigent protein in the superfamily of calycins. Dirigent proteins impart stereoselectivity on the phenoxy radical coupling reaction yielding optically active lignans from two molecules of coniferyl alcohol. |
| AT4G23700 | member of Putative Na+/H+ antiporter family |
| AT4G23750 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Monopteros target gene. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT4G23800 | Encodes a protein containing three copies of the HMG (high mobility group)-box domain. The two Arabidopsis 3xHMG-box proteins are: AT4G11080 (3xHMG-box1) and AT4G23800 (3xHMG-box2). Interacts with mitotic and meiotic chromosomes. |
| AT4G23960 | F-box family protein;(source:Araport11) |
| AT4G23980 | Encodes auxin response factor 9 (ARF9). The mRNA is cell-to-cell mobile. |
| AT4G24000 | encodes a protein similar to cellulose synthase |
| AT4G24010 | encodes a protein similar to cellulose synthase |
| AT4G24015 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G24050 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G24060 | Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis. |
| AT4G24100 | Protein kinase superfamily protein |
| AT4G24110 | NADP-specific glutamate dehydrogenase;(source:Araport11) |
| AT4G24120 | Member of a small family of oligopeptide transporters similar to the yellow stripe locus of maize (ZmYS1). |
| AT4G24140 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G24150 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in shoot and flower. |
| AT4G24160 | Encodes a soluble lysophosphatidic acid acyltransferase with additional triacylglycerol lipase and phosphatidylcholine hydrolyzing enzymatic activities. Plays a pivotal role in maintaining the lipid homeostasis by regulating both phospholipid and neutral lipid levels. |
| AT4G24170 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT4G24250 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO13 belongs to the clade II, with ATMLO1 and ATMLO15. The gene is expressed during early seedling growth, in root and cotyledon vascular system, in pollen and also in placenta of developing siliques, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT4G24300 | Peptidase C50, separase;(source:Araport11) |
| AT4G24320 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT4G24480 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G24510 | Encodes a component of the fatty acid elongation machinery required for C28 to C30 fatty acid elongation. It does not require the acyltransferase catalytic site for biological function. |
| AT4G24670 | Encodes a protein with similarity to the TAA1 trytophan aminotransferase involved in IAA biosynthesis. Double mutant analyses suggest that this protein is involved in regulating many aspects of plant growth and development from embryogenesis to flower formation and plays a role in ethylene-mediated signaling.TAR2 is required for reprogramming root architecture in response to low nitrogen conditions. |
| AT4G24840 | oligomeric golgi complex subunit-like protein;(source:Araport11) |
| AT4G24910 | glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11) |
| AT4G24973 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT4G24977 | Pseudogene of AT4G24972; TPD1 (TAPETUM DETERMINANT 1) |
| AT4G24980 | nodulin MtN21-like transporter family protein |
| AT4G25000 | Predicted to be secreted protein based on signalP prediction. Involved in starch mobilization. Mutants are defective in alpha-amylase activity. (Note: AMY1 has been found in the literature to be referred to as AMY3, which is not to be confused with AMY3/At1g69830). |
| AT4G25070 | caldesmon-like protein;(source:Araport11) |
| AT4G25080 | Encodes a protein with methyltransferase activity responsible for the methylation of magnesium protoporphyrin IX. Mutants defective in this gene are affected in chlorophyll biosynthesis and show a reduction in the accumulation of a number of major thylakoid-associated proteins including components of PSI (LHCI), PSII (LHCII, D1, CP43) and the cytochrome b6f complex (Cytf). By contrast, no significant changes were detected for the proteins of the stroma and the chloroplast envelope. |
| AT4G25090 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
| AT4G25220 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). |
| AT4G25300 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G25330 | SAWADEE protein;(source:Araport11) |
| AT4G25390 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G25433 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
| AT4G25434 | nudix hydrolase homolog 10;(source:Araport11) |
| AT4G25560 | LAF1 is a R2R3-MYB transcription factor and positive regulator of the phyA photoresponse. Interaction of LAF1 with HFR1 stabilize the proteins against ubiquitination by COP1(AT2G32950) and subsequent degrations. Mutants have an elongated hypocotyl specifically under far-red light but retain wild-type responses to other light wavelengths. |
| AT4G25570 | Encodes cytochrome b561. |
| AT4G25740 | RNA binding Plectin/S10 domain-containing protein;(source:Araport11) |
| AT4G25750 | ABC-2 type transporter family protein;(source:Araport11) |
| AT4G25800 | Calmodulin-binding protein;(source:Araport11) |
| AT4G25930 | DUF295 domain containing protein. |
| AT4G25940 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT4G25960 | P-glycoprotein 2;(source:Araport11) |
| AT4G25970 | Encodes the major form of the two non-mitochondrail phosphatidylserine decarboxylase. Located at the ER. The mRNA is cell-to-cell mobile. |
| AT4G25990 | chloroplast import apparatus CIA2-like. CIA2 is a transcription factor which upregulates chloroplast translocon genes |
| AT4G26055 | transmembrane protein;(source:Araport11) |
| AT4G26170 | ET1 is a DNA and Zinc binding domain containing protein involved in DNA methylation. |
| AT4G26180 | Encodes a mitochondrial CoA transporter. |
| AT4G26200 | Member of a family of proteins in Arabidopsis that encode 1-Amino-cyclopropane-1-carboxylate synthase, an enzyme involved in ethylene biosynthesis. Not expressed in response to IAA. |
| AT4G26320 | arabinogalactan protein 13;(source:Araport11) |
| AT4G26330 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT4G26470 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G26483 | nicotianamine synthase;(source:Araport11) |
| AT4G26490 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT4G26560 | Encodes calcineurin B-like protein 7 (CBL7).Interacts with and modulates the activity of the PM ATPase AHA2. |
| AT4G26570 | member of AtCBLs (Calcineurin B-like Calcium Sensor Proteins) |
| AT4G26590 | oligopeptide transporter |
| AT4G26640 | member of WRKY Transcription Factor; Group I |
| AT4G26740 | Encodes caleosin, a 27-kDa protein found within seed lipid bodies. Gene is expressed preferentially in the embryo, has similarity to a rice ABA-responsive gene, EFA27. Catalyze hydroperoxide-dependent mono-oxygenation reactions. Require calcium for peroxygenase activity. Probably deeply buried in lipid droplets or microsomes. |
| AT4G26770 | Phosphatidate cytidylyltransferase family protein;(source:Araport11) |
| AT4G26890 | Member of MEKK subfamily. Involved in wound response signaling. Interacts with At5g40440, and activates At1g59580. |
| AT4G26980 | RNI-like superfamily protein;(source:Araport11) |
| AT4G27110 | COBRA-like protein 11 precursor;(source:Araport11) |
| AT4G27190 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT4G27290 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G27300 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G27410 | Encodes a NAC transcription factor induced in response to desiccation. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response. |
| AT4G27420 | ABC-2 type transporter family protein;(source:Araport11) |
| AT4G27440 | light-dependent NADPH:protochlorophyllide oxidoreductase B The mRNA is cell-to-cell mobile. |
| AT4G27570 | Encodes a UDP-glycosyltransferase that contributes to cold, salt and drought stress tolerance via modulating anthocyanin accumulation. |
| AT4G27585 | Encodes a stomatin-like protein that is present in a mitochondrial membrane-bound 3 MDa protein complex and is involved in the assembly of mitochondrial respiratory supercomplexes. There is an observed increase in abundance of respiratory complex III2 in SLP1 single and double knockout mutants. The protein is not redundant with Arabidopsis SLP2 (At5g54100). |
| AT4G27660 | hypothetical protein;(source:Araport11) |
| AT4G27700 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT4G27720 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G27940 | manganese tracking factor for mitochondrial SOD2;(source:Araport11) |
| AT4G27950 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT4G27970 | Encodes a protein with ten predicted transmembrane helices. The SLAH2 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. But, it is not expressed in guard cells and cannot complement a slac1-2 mutant suggesting that it performs a different function. SLAH2:GFP localizes to the plasma membrane. |
| AT4G28090 | SKU5 similar 10;(source:Araport11) |
| AT4G28140 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. Regulated by heat shock. |
| AT4G28300 | Encodes a protein with 13.6% proline amino acids that is predicted to localize to the cell wall. The mRNA is cell-to-cell mobile. |
| AT4G28370 | Encodes an E3 ubiquitin ligase that is involved in plant cell wall modification, seed mucilage extrusion, and controls the degree of pectin methylesterification in seed mucilage. fly1 mutant seeds release more compact mucilage capsules and detached outer tangential primary walls when hydrated in water. Fly1 is located in the endomembrane system, likely localized in late endosome/multivesicular bodies/prevacular compartment. It has been shown to ubiquitinate proteins in conjunction with UBA1 and UBC8. |
| AT4G28395 | related to lipid transfer proteins |
| AT4G28420 | Tyrosine transaminase family protein;(source:Araport11) |
| AT4G28430 | Reticulon family protein;(source:Araport11) |
| AT4G28460 | Activates immune responses through RECEPTOR-LIKE KINASE7 (RLK7). Induces stomatal closure is dependent on RLK7 and the transcription of genes involved in SA production and SA-dependent stomatal closure. SA promotes the flg22-induced expression of PIP1 preligand, prePIP1. |
| AT4G28510 | prohibitin 1 (Atphb1) |
| AT4G28700 | ammonium transporter 1;(source:Araport11) |
| AT4G28720 | Auxin biosynthetic gene regulated by RVE1. Overexpression leads to suppression of bri1 phenotype. |
| AT4G28815 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G28890 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G29020 | glycine-rich protein;(source:Araport11) |
| AT4G29030 | Putative membrane lipoprotein;(source:Araport11) |
| AT4G29090 | Ribonuclease H-like superfamily protein;(source:Araport11) |
| AT4G29120 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
| AT4G29180 | root hair specific 16;(source:Araport11) |
| AT4G29230 | NAC domain protein involved in negative regulation of flowering. |
| AT4G29450 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G29560 | fanconi anemia group E protein FANCE protein;(source:Araport11) |
| AT4G29654 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G29690 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT4G29700 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT4G29720 | polyamine oxidase 5;(source:Araport11) |
| AT4G29750 | CRS1 / YhbY (CRM) domain-containing protein;(source:Araport11) |
| AT4G29840 | threonine synthase |
| AT4G29905 | hypothetical protein;(source:Araport11) |
| AT4G29970 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G30030 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G30040 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G30080 | Involved in root cap cell differentiation. Gene expression is regulated by mir160.Located in the nucleus. |
| AT4G30120 | encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc |
| AT4G30140 | Member of the GDSL lipase/esterase family of proteins that functions as cutinase. Expressed in pollen and at the zone of lateral root emergence. |
| AT4G30170 | Peroxidase family protein;(source:Araport11) |
| AT4G30210 | Encodes NADPH-cytochrome P450 reductase that catalyzes the first oxidative step of the phenylpropanoid general pathway. The mRNA is cell-to-cell mobile. |
| AT4G30220 | small nuclear ribonucleoprotein F;(source:Araport11) |
| AT4G30230 | hypothetical protein;(source:Araport11) |
| AT4G30250 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G30270 | encodes a protein similar to endo xyloglucan transferase in sequence. It is also very similar to BRU1 in soybean, which is involved in brassinosteroid response. |
| AT4G30300 | member of NAP subfamily |
| AT4G30420 | nodulin MtN21-like transporter family protein |
| AT4G30440 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. |
| AT4G30480 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808). Interacts with Hsp90/Hsp70 as co-chaperone. |
| AT4G30662 | hypothetical protein;(source:Araport11) |
| AT4G30760 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT4G30770 | Putative membrane lipoprotein;(source:Araport11) |
| AT4G30872 | other_RNA;(source:Araport11) |
| AT4G30910 | Cytosol aminopeptidase family protein;(source:Araport11) |
| AT4G30960 | Encodes CBL-interacting protein kinase 6 (CIPK6). Required for development and salt tolerance. The mRNA is cell-to-cell mobile. |
| AT4G30990 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G31020 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G31080 | Encodes one of two LUNAPARK proteins in Arabidopsis. Both LNPA and LNPB are predominantly distributed throughout the ER, but not preferentially localized at the three-way junctions. Mutation of both LNPA and LNPB together caused the cortical ER to develop poor ER cisternae and a less dense tubular network. E3 ligase involved in degradation of RHD3 to maintain a tubular ER network. |
| AT4G31320 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G31398 | Natural antisense transcript overlaps with AT4G31400;(source:Araport11) |
| AT4G31470 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT4G31615 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
| AT4G31630 | Transcriptional factor B3 family protein;(source:Araport11) |
| AT4G31670 | ubiquitin-specific protease 18;(source:Araport11) |
| AT4G31680 | Transcriptional factor B3 family protein;(source:Araport11) |
| AT4G31770 | Encodes a RNA lariat debranching enzyme required for embryogenesis. |
| AT4G31810 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
| AT4G31830 | transmembrane protein;(source:Araport11) |
| AT4G31900 | chromatin remodeling factor;(source:Araport11) |
| AT4G31910 | Encodes an acyltransferase that can modify brassinosteroids (BRs) by acylation and may modulate endogenous BR levels. |
| AT4G31940 | The gene encodes a cytochrome P450 enzyme, CYP82C. It is involved in the early Fe deficiency response.CYP82C4 hydroxylates fraxetin to generate sideretin (5-hydroxyfraxetin). Fraxetin and sideretin are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil.The mRNA is cell-to-cell mobile. |
| AT4G31950 | member of CYP82C |
| AT4G31970 | Functions in the biosynthesis of 4-hydroxy indole-3-carbonyl nitrile (4-OH-ICN), a cyanogenic phytoalexin in Arabidopsis. CYP82C2 acts as a hydroxylase on indole-3-carbonyl nitrile to generate 4-OH-ICN. |
| AT4G32030 | hypothetical protein;(source:Araport11) |
| AT4G32060 | Encodes an EF-hand protein with homology to constituents of the mitochondrial Ca2+ uniporter machinery in mammals. MICU binds Ca2+ and localizes to the mitochondria in Arabidopsis. It is a negative regulator of mitochondrial calcium uptake. Mutants display elevated matrix calcium at steady state and modified calcium transient kinetics in vivo. |
| AT4G32080 | hypothetical protein;(source:Araport11) |
| AT4G32500 | Encodes AKT5, a member of the Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT4G32510 | HCO3- transporter family;(source:Araport11) |
| AT4G32540 | Mutant has elevated levels of free IAA in dominant mutant allele; Flavin Monooxygenase-Like Enzyme; Auxin Biosynthesis |
| AT4G32580 | Thioredoxin superfamily protein;(source:Araport11) |
| AT4G32650 | Encodes KAT3, a member of the Shaker family of voltage-gated potassium channel subunits. Does not form functional potassium channel on its own. Involved in down-regulating AKT1 and KAT1 channel activity by forming heteromers with AKT1 or KAT1. The Shaker family K+ ion channels include five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inwardly rectifying conductance): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT4G32670 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT4G32810 | Encodes a protein with similarity to carotenoid cleaving deoxygenases, the enzymes that cleave beta-carotene. Involved in the production of a graft transmissable signal to suppress axillary branching. Protein is localized to chloroplast stroma and expressed primarily in root tip. Mutants in the gene exhibit increased shoot branching, and light-dependent defects in hook opening and hypocotyl/root elongation. Only upregulated by auxin in the root and hypocotyl, and this is not required for the inhibition of shoot branching. |
| AT4G32880 | member of homeodomain-leucine zipper family, acting as a differentiation-promoting transcription factor of the vascular meristems. |
| AT4G33050 | Encodes a calmodulin-binding protein involved in stomatal movement. |
| AT4G33070 | Thiamine pyrophosphate dependent pyruvate decarboxylase family protein;(source:Araport11) |
| AT4G33230 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G33330 | Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. |
| AT4G33467 | hypothetical protein;(source:Araport11) |
| AT4G33495 | A member of the RPD gene family - there are13 annotated genes and one EST encoding RPD1-like proteins in Arabidopsis. Shows no homology to any protein of known function. Abundant expression found in the shoot apex and the root. rpd1 mutant is a temperature-sensitive mutant isolated on the basis of the impairment in adventitious roots formation in hypocotyl region. Also, disruption of the RPD1 gene by a T-DNA insertion caused embryogenesis arrest at the globular to transition stages. This phenotype is consistent with the hypothesized function of RPD1 in the maintenance of active cell proliferation. |
| AT4G33590 | transmembrane protein;(source:Araport11) |
| AT4G33650 | Encodes a protein with high sequence similarity to the dynamin superfamily. Among those members ADL2 was most closely related to Dnm1p of yeast and likely a member of the Vps1p subfamily. Widely expressed in various tissues with highest expression in flower tissues. Localizes to the chloroplast, mitochondrion and peroxisome. Involved in peroxisome and mitochondria fission in combination with DRP3B. |
| AT4G33770 | Inositol pyrophosphate kinase. Catalyzes the phosphorylation of phytic acid (InsP6) to the symmetric InsP7 isomer 5-InsP7. |
| AT4G33810 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G33820 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G33840 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
| AT4G33850 | Pseudogene of AT4G33850; glycosyl hydrolase family 10 protein |
| AT4G33900 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G33970 | Pollen expressed protein required for pollen tube growth.Along with other members of the LRX family, itnteracts with RALF4 to control pollen tube growth and integrity. Loss of function results in premature pollen tube rupture and reduced fertility. |
| AT4G34120 | Encodes a single cystathionine beta-Synthase domain-containing protein. Modulates development by regulating the thioredoxin system. The mRNA is cell-to-cell mobile. |
| AT4G34131 | UDP-glucosyl transferase 73B3;(source:Araport11) |
| AT4G34138 | UDP-glucosyl transferase 73B1;(source:Araport11) |
| AT4G34380 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT4G34440 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT4G34450 | Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation. |
| AT4G34480 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT4G34490 | CYCLASE ASSOCIATED PROTEIN |
| AT4G34520 | Encodes KCS18, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT4G34580 | Encodes COW1 (can of worms1), a phosphatidylinositol transfer protein essential for root hair tip growth. The N-terminus of the COW1 protein is 32% identical to an essential phosphatidylinositol transfer protein (PITP), the yeast Sec14 protein (sec14p) while the C-terminus is 34.5% identical to a late nodulin of Lotus japonicus, Nlj16. Expression of COW1 complements the growth defect associated with Sec14p dysfunction in yeast. GFP fused to the COW1 protein specifically accumulates at the site of root hair outgrowth. |
| AT4G34710 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1. |
| AT4G34920 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT4G34930 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT4G34940 | Armadillo repeat protein. One of a family of four in Arabidopsis. Located in the nucleus and cytoplasm of pollen vegetative cells, and in the cytoplasm of egg cells. Involved in the signaling network controlling tip growth and actin organization in the pollen tube. |
| AT4G34950 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G34970 | A member of actin polymerizing factors (ADFs)family, ADF9 primarily functions as an actin bundling protein. |
| AT4G35000 | Encodes a microsomal ascorbate peroxidase APX3. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. The APX3 protein interacts with AKR2 (ankyrin-containing protein that interacts with AFT1) and AFT1, a 14-3-3 protein. |
| AT4G35025 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G35030 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G35060 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G35120 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G35150 | O-methyltransferase family protein;(source:Araport11) |
| AT4G35160 | Encodes a cytosolic N-acetylserotonin O-methyltransferase that can convert N-acetylserotonin to melatonin and serotonin to 5-methoxytryptamine in the process of melatonin synthesis. It does not have caffeic acid O- methyltransferase activity. |
| AT4G35220 | Cyclase family protein;(source:Araport11) |
| AT4G35250 | HCF244 is a member of the atypical short-chain dehydrogenase/reductase superfamily, a modified group, which has lost enzyme activity.HCF244 interacts with unknown partners in a 200-400 kD membrane associated complex. |
| AT4G35280 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT4G35295 | homoserine kinase, putative / HSK;(source:Araport11) |
| AT4G35380 | Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking. |
| AT4G35390 | AT-hook protein of GA feedback 1;(source:Araport11) |
| AT4G35410 | Clathrin adaptor complex small chain family protein;(source:Araport11) |
| AT4G35460 | NADPH-dependent thioredoxin reductase 1 (NTR1. Similar to E.coli NTR and has conserved NADPH binding domains. |
| AT4G35655 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
| AT4G35680 | selection/upkeep of intraepithelial T-cells protein;(source:Araport11) |
| AT4G35810 | 2-oxoglutarate-dependent dioxygenase |
| AT4G35980 | hypothetical protein;(source:Araport11) |
| AT4G36030 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT4G36060 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G36070 | member of Calcium Dependent Protein Kinase |
| AT4G36170 | hypothetical protein;(source:Araport11) |
| AT4G36220 | encodes ferulate 5-hydroxylase (F5H). Involved in lignin biosynthesis. |
| AT4G36230 | transmembrane protein;(source:Araport11) |
| AT4G36250 | Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures. |
| AT4G36260 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Encodes protein with a single zinc finger motif and a members of a small gene family of putative transcription factors in which the SHORT INTERNODES (SHI) gene is found. STY2/STY1 double mutants showed defective style, stigma as well as serrated leaves. |
| AT4G36350 | purple acid phosphatase 25;(source:Araport11) |
| AT4G36390 | Methylthiotransferase;(source:Araport11) |
| AT4G36420 | Ribosomal protein L12 family protein;(source:Araport11) |
| AT4G36430 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G36460 | transmembrane protein;(source:Araport11) |
| AT4G36540 | Encodes the brassinosteroid signaling component BEE2 (BR-ENHANCED EXPRESSION 2). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT4G36580 | AAA-type ATPase family protein;(source:Araport11) |
| AT4G36670 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G36690 | Regulates flowering time and displays a redundant role in pollen tube growth together with AtU2AF65b. |
| AT4G36730 | member of a gene family encoding basic leucine zipper proteins (GBFs) which bind the G-box |
| AT4G36770 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G36850 | PQ-loop repeat family protein / transmembrane family protein;(source:Araport11) |
| AT4G36930 | Encodes a transcription factor of the bHLH protein family. Mutants have abnormal, unfused carpels and reduced seed dormancy. |
| AT4G37010 | Encodes a member of the Centrin family. Mutants are hypersensitive to UV and prone to UV induced DNA damage. Based on sequence similarity and mutant phenotype CEN2 is thought to be involved in nucelotide excision repair/DNA repair. |
| AT4G37030 | membrane protein;(source:Araport11) |
| AT4G37040 | encodes a methionine aminopeptidase |
| AT4G37050 | Patatin-related phospholipase A. Expressed in the floral gynaecium and is induced by abscisic acid (ABA) or phosphate deficiency in roots. |
| AT4G37235 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G37250 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G37310 | member of CYP81H |
| AT4G37320 | member of CYP81D |
| AT4G37330 | member of CYP81D |
| AT4G37420 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT4G37590 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
| AT4G37650 | Involved in radial organization of the root and shoot axial organs. Essential for normal shoot gravitropism. The protein moves in a highly specific manner from the cells of the stele in which it is synthesized outward. Movement requires sequences within the GRAS and VHIID domains. SHORT-ROOT forms a network in combination with JACKDAW, BLUEJAY AND SCARECROW to regulate tissue patterning through asymmetric cell division. The ground tissue lineage remains in shortroot mutant, while it is progressively lost in the triple mutant bluejay jackdaw scarecrow and double mutant jackdaw scarecrow. In addition, ground tissue basal identity remains in shortroot mutant while it is defective in the quadruple mutant bluejay jackdaw magpie nutcracker. |
| AT4G37705 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.5e-203 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT4G37710 | VQ motif-containing protein;(source:Araport11) |
| AT4G37760 | squalene epoxidase 3;(source:Araport11) |
| AT4G37770 | Encodes an auxin inducible ACC synthase. |
| AT4G37840 | Encodes a putative hexokinase. |
| AT4G37910 | mitochondrial heat shock protein 70-1;(source:Araport11) |
| AT4G38120 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G38180 | FAR1-related sequence 5;(source:Araport11) |
| AT4G38190 | encodes a gene similar to cellulose synthase |
| AT4G38552 | Natural antisense transcript overlaps with AT4G38550;(source:Araport11) |
| AT4G38590 | putative beta-galactosidase (BGAL14 gene) |
| AT4G38600 | encodes a member of HECT ubiquitin protein ligase family that is involved in trichome cell morphogenesis. Mutants in this gene exhibit supernumerary trichome branches and increased DNA content. |
| AT4G38690 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT4G38781 | hypothetical protein;(source:Araport11) |
| AT4G38850 | mRNA is rapidly induced by auxin and is very short-lived. Has been used as a reporter gene in studying auxin mutants. |
| AT4G38860 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G38940 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G38970 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT4G39000 | glycosyl hydrolase 9B17;(source:Araport11) |
| AT4G39010 | Cellulase involved in cell wall modification during valve dehiscence. |
| AT4G39020 | SH3 domain-containing protein;(source:Araport11) |
| AT4G39030 | Encodes an orphan multidrug and toxin extrusion transporter. Essential component of salicylic acid-dependent signaling for disease resistance. Member of the MATE-transporter family. Expression induced by salicylic acid. Mutants are salicylic acid-deficient. |
| AT4G39080 | Vacuolar proton ATPase subunit VHA-a isoform 3. Localized in the tonoplast. The mRNA is cell-to-cell mobile. |
| AT4G39180 | encodes a protein that complements the function of a sec14(ts) mutant of S. cerevisiae |
| AT4G39290 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G39340 | Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion. |
| AT4G39360 | hypothetical protein;(source:Araport11) |
| AT4G39400 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction. BRI1 ligand is brassinolide which binds at the extracellular domain. Binding results in phosphorylation of the kinase domain which activates the BRI1 protein leading to BR responses. Residue T-1049 and either S-1044 or T-1045 were essential for kinase function in vitro and normal BRI1 signaling in planta. The structure of BRI1 ligand-binding domain has been determined at 2.5A resolution. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. BRI1 appears to be involved in the autonomous pathway that regulates the transition to flowering, primarily through its effects on FLC expression levels, as uncovered by double mutant analyses. This most likely occurs as a result of BRI1-dependent effects on histone acetylation, but not histone triMeH3K4 methylation, at the FLC locus. The mRNA is cell-to-cell mobile. |
| AT4G39490 | member of CYP96A |
| AT4G39610 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT4G39650 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in the apoplast of young siliques (within the ovules of the carpel) and is involved in the degradation of glutathione. The encoded enzyme also acts as part of a GSH pumping gamma-glutamyl cycle in this tissue and may also be involved in gamma-glutamyl amino acid formation. |
| AT4G39670 | Member of the glycolipid transfer protein (GLTP) superfamily, shuttles ceramide-1-phosphate (C1P) between membranes. |
| AT4G39740 | Encodes HCC2, one of the two Arabidopsis genes (HCC1 and HCC2) resulting from a duplication with homology to the SCO proteins involved in copper insertion during cytochrome c oxidase (COX) assembly in other organisms. HCC2, which lacks the cysteines and histidine putatively involved in copper binding, functions in copper sensing and redox homeostasis. |
| AT4G39780 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT4G39800 | ** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT4G39840 | cell wall integrity/stress response component-like protein;(source:Araport11) |
| AT4G39850 | Encodes a peroxisomal protein of the ATP binding cassette (ABC) transporter class (PMP subfamily) with significant identity to the human X-linked adrenoleukodystrophy protein (ALDP). The gene product promotes germination and represses embryo dormancy. ABI3, ABA1, FUS3 and LEC1 are epistatic to this gene. Mutants accumulate fatty acyl CoA suggesting a defect in uptake of fatty acyl CoA into the peroxisome. |
| AT4G39860 | hematological/neurological-like protein;(source:Araport11) |
| AT4G39940 | adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete The mRNA is cell-to-cell mobile. |
| AT4G40000 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G01010 | retinal-binding protein;(source:Araport11) |
| AT5G01030 | enolase, putative (DUF3527);(source:Araport11) |
| AT5G01070 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT5G01100 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G01150 | hypothetical protein (DUF674);(source:Araport11) |
| AT5G01180 | Encodes a dipeptide transporter expressed in pollen and ovules during early seed development. GFP-tagged PTR5 localizes to the plasma membrane. |
| AT5G01250 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
| AT5G01260 | Carbohydrate-binding-like fold;(source:Araport11) |
| AT5G01320 | Thiamine pyrophosphate dependent pyruvate decarboxylase family protein;(source:Araport11) |
| AT5G01360 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).The dwarf phenotype can only be seen in tbl3 tbl31 esk1 triple mutant. tbl3 and tbl31 are specifically involved in 3-O-monoacetylation of xylan. |
| AT5G01380 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G01445 | hypothetical protein;(source:Araport11) |
| AT5G01490 | Encodes a cation/proton antiporter, a member of low affinity calcium antiporter CAX2 family. Involved in root development under metal stress. |
| AT5G01520 | Encodes a cytosolic RING-type E3 ubiquitin (Ub) ligase that is critical for ABA and high salinity responses during germination. AtAIRP2 and SDIR1 likely play a combinatory role in ABA signaling and the response to high salt in Arabidopsis. |
| AT5G01540 | Encodes LecRKA4.1, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. Positively regulates pattern-triggered immunity. |
| AT5G01550 | Encodes LecRKA4.2, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. |
| AT5G01690 | member of Putative Na+/H+ antiporter family |
| AT5G01930 | Encodes a endo-beta-mannanase involved in seed germination. |
| AT5G02090 | hypothetical protein;(source:Araport11) |
| AT5G02110 | Encodes CYCLIN D7;1. Overexpression of CYCD7;1 induces cell proliferation and cell enlargement in the embryo and endosperm leading to overgrowth. |
| AT5G02130 | SSR1 encodes a tetratricopeptide repeat- containing protein localized in mitochondria. It is involved in root development, possibly by through effects on auxin transport. In ssr1 mutants, the expression PIN genes and trafficking of PIN2 is altered which in turn affects distribution of auxin in the roots. |
| AT5G02140 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT5G02170 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G02180 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G02210 | GCK domain-containing protein;(source:Araport11) |
| AT5G02260 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT5G02340 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G02385 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT5G02390 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT5G02400 | Encodes a protein with similarity to the POL locus which is a novel protein phosphatase 2C. Ubiquitously expressed. No phenotype observed in homozygous null mutant background. |
| AT5G02600 | Encodes a phloem mobile metal binding protein necessary for phloem function and root meristem maintenance. |
| AT5G02660 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (DUF627 and DUF629);(source:Araport11) |
| AT5G02750 | Encodes an E3 ligase, SHOOT GRAVITROPISM9. Modulates the interaction between statoliths and F-Actin in gravity sensing. |
| AT5G02880 | encodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT5G03000 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G03020 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G03030 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G03170 | Encodes FLA11, a member of fasciclin-like arabinogalactan proteins (FLAs) containing a cell adhesion fasciclin (FAS) domain. Mutations result in altered stem biomechanics with reduced tensile strength and reduced tensile modulus of elasticity, as well as altered cell wall architecture and composition, with increased cellulose microfibril angle, reduced arabinose, galactose and cellulose content. |
| AT5G03435 | Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT5G03455 | Encodes a homolog of yeast cell cycle regulator CDC25. It has a sole catalytic domain and devoid of the N-terminal regulatory region found in the human CDC25 and is capable of reducing the mitotic cell length of transformed fission yeast. Non-plant CDC25 proteins have been shown to do this. However, the gene is more or less constant, regardless of whether the tissue examined contained proliferative cells. Also described as having arsenate reductase activity involved in arsenate resistance. |
| AT5G03495 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G03500 | Encodes together with its paralog MED7A a subunit of the middle module of the transcriptional co-regulator Mediator complex. Regulates genes required for normal development of etiolated seedlings. |
| AT5G03550 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT5G03580 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G03620 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT5G03680 | Recessive mutations are defective in organ initiation and orientation in the second whorl. This gene encodes a trihelix transcription factor whose expression is limited to margins of floral and vegetative organs. Overexpression and double mutant analyses suggest that this gene is involved in limiting lateral growth of organs. |
| AT5G03750 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT5G03810 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G03858 | Pseudogene of AT5G03960; IQD12 (IQ-domain 12); calmodulin binding protein |
| AT5G03920 | F-box protein;(source:Araport11) |
| AT5G04000 | hypothetical protein;(source:Araport11) |
| AT5G04150 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. |
| AT5G04200 | Encodes a putative metacaspase. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
| AT5G04230 | Member of Phenylalanine ammonialyase (PAL) gene family. Differs significantly from PAL1 and PAL2 and other sequenced plant PAL genes. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
| AT5G04267 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G04275 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AGAAUCUUGAUGAUGCUGCAU. Pri-mRNA coordinates for MIR172b (converted to TAIR10 based on PMID19304749): Chr5: 1188916-1187500 (reverse), length: 1417 bp; exon coordinates: exon 1: 1188916 to 1188742, exon 2: 1188623 to 1188583, exon 3: 1188383 to 1188133, exon 4: 1187852 to 1187500; mature miRNA and miRNA* are located on exon 3. |
| AT5G04310 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G04390 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT5G04400 | NAC domain protein;(source:Araport11) |
| AT5G04440 | RAP release 2, galactose-binding-like domain protein, putative (DUF1997);(source:Araport11) |
| AT5G04510 | Encodes 3-phosphoinositide-dependent protein kinase that contains pleckstrin homology domain and binds 3-phosphoinositides. It activates the protein kinase AGC2-1 in a phosphatidic acid dependent manner. Phosphorylates S6K1. Interacts with PID, and transphosphorylation by PDK1 increases PID autophosphorylation. The mRNA is cell-to-cell mobile. |
| AT5G04530 | Encodes KCS19, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT5G04550 | type-1 restriction enzyme mjaxp r protein (DUF668);(source:Araport11) |
| AT5G04670 | Polycomb related protein that is part of a protein complex involved in histone deacetylation and heterochromatin silencing. |
| AT5G04680 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G04690 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G04700 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G04780 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G04890 | Specifically restricts the long-distance movement of tobacco etch potyvirus (TEV) without involving either hypersensitive cell death or systemic acquired resistance. Multidomain protein containing an N-terminal region with high similarity to plant small heat shock proteins (HSPs). |
| AT5G04895 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT5G04980 | DNAse I-like superfamily protein;(source:Araport11) |
| AT5G05025 | Encodes a Pollen Ole e I allergen and extensin family protein [pseudogene] |
| AT5G05070 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT5G05140 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT5G05160 | Encodes a receptor-like kinase that activates secondary growth, the production of secondary vascular tissues. |
| AT5G05220 | hypothetical protein;(source:Araport11) |
| AT5G05250 | hypothetical protein;(source:Araport11) |
| AT5G05280 | Encodes a RING-finger E3 ligase protein that controls anther dehiscence by positively regulating the expression of DAD1 in the jasmonic acid biosynthesis pathway. |
| AT5G05340 | Encodes a protein with sequence similarity to peroxidases that is involved in lignin biosynthesis. Loss of function mutations show abnormal development of xylem fibers and reduced levels of lignin biosynthetic enxymes. |
| AT5G05470 | Encodes an eIF2alpha homolog that can be phosphorylated by GCN2 in vitro. |
| AT5G05480 | Peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase A protein;(source:Araport11) |
| AT5G05540 | small RNA degrading nuclease 2;(source:Araport11) |
| AT5G05560 | Encodes a subunit of the Arabidopsis thaliana E3 ubiquitin ligase complex that plays a synergistic role with APC4 both in female gametogenesis and in embryogenesis. |
| AT5G05640 | nucleoprotein-like protein;(source:Araport11) |
| AT5G05730 | ASA1 encodes the alpha subunit of anthranilate synthase, which catalyzes the rate-limiting step of tryptophan synthesis. ASA1 is induced by ethylene, and forms a link between ethylene signalling and auxin synthesis in roots. |
| AT5G05760 | A SNARE protein (ortholog of syntaxin 5), a membrane fusion machine component involved in cytokinesis |
| AT5G05850 | Encodes PIRL1, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen. |
| AT5G05870 | UDP-glucosyl transferase 76C1;(source:Araport11) |
| AT5G05880 | Encodes a nicotinate-N-glycosyltransferase. |
| AT5G05890 | Encodes a nicotinate-N-glycosyltransferase. |
| AT5G05910 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G05940 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT5G06170 | sucrose symporter with hight affinity for sucrose (K0.5=0.066 +/- 0.025mM), that can also transport a wide range of glucosides. |
| AT5G06278 | pseudogene of abscisic acid-responsive HVA22 family protein |
| AT5G06330 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G06440 | polyketide cyclase/dehydrase/lipid transport superfamily protein;(source:Araport11) |
| AT5G06470 | Glutaredoxin family protein;(source:Araport11) |
| AT5G06520 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT5G06530 | Encodes ABCG22, an ABC transporter gene. Mutation results in increased water transpiration and drought susceptibility. |
| AT5G06610 | DUF620 domain protein. In xylem cells BRD1 is expressed in the secondary wall pit boundaries. BRD1 interacts with and appears to be necessary to recruit WALLIN to the plasma membrane. |
| AT5G06720 | Encodes a peroxidase with diverse roles in the wound response, flower development, and syncytium formation. |
| AT5G06730 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G06740 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G06760 | Encodes LEA4-5, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. Most of the diverse set of LEA proteins can be grouped according to properties such as high hydrophilicity and high content of glycine or other small amino acids in what has been termed hydrophilins. LEA4-5 protects enzyme activities from the adverse effects induced by freeze-thaw cycles in vitro. |
| AT5G06780 | Emsy N Terminus (ENT)/ plant Tudor-like domains-containing protein;(source:Araport11) |
| AT5G06790 | cotton fiber protein;(source:Araport11) |
| AT5G06850 | Encodes an endoplasmic reticulum protein that is involved in the transport of the florigen FT from companion cells to sieve elements, thus affecting FT transport through the phloem to the SAM. |
| AT5G06905 | member of CYP712A |
| AT5G06920 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT5G06930 | nucleolar-like protein;(source:Araport11) |
| AT5G07060 | Encodes MAC5C, homologous to MAC5A. MAC5A is a component of the MOS4-associated complex (MAC) that contributes to snc1- mediated autoimmunity. Homologues include AT1G07360 (MAC5A), AT2G29580 (MAC5B) and AT5G07060 (MAC5C). MAC5A and MAC5B are more closely related to each other than to MAC5C. |
| AT5G07090 | Ribosomal protein S4 (RPS4A) family protein;(source:Araport11) |
| AT5G07120 | Encodes sorting nexin SNX2b. SNX2b is peripherally associated with membranes. Involved in vesicular trafficking from endosomes to the vacuole. |
| AT5G07260 | START (StAR-related lipid-transfer) lipid-binding domain-containing protein;(source:Araport11) |
| AT5G07290 | AML4 A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML4 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM14. AML4 is expressed during embryo development (heart and torpedo stage) and in vegetative and floral apices. |
| AT5G07600 | Oleosin family protein;(source:Araport11) |
| AT5G07640 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G07650 | Actin-binding FH2 protein;(source:Araport11) |
| AT5G07690 | Encodes a putative transcription factor (MYB29) that acts as a negative regulator of mitochondrial stress responses. |
| AT5G07760 | formin homology 2 domain-containing protein / FH2 domain-containing protein;(source:Araport11) |
| AT5G07800 | Flavin-binding monooxygenase family protein;(source:Araport11) |
| AT5G07840 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G07850 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G07910 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G08000 | Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and binds callose. |
| AT5G08141 | Part of complex with ENO2 which mediates secondary metabolism, affecting seed size and weight. |
| AT5G08150 | Encodes SOB5. Activation tagging lines accumulated higher level of cytokinin. |
| AT5G08250 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT5G08260 | serine carboxypeptidase-like 35;(source:Araport11) |
| AT5G08270 | C5orf35;(source:Araport11) |
| AT5G08370 | Member of Glycoside Hydrolase Family 27 (GH27)that functions as an α-galactosidase. |
| AT5G08600 | U3 ribonucleoprotein (Utp) family protein;(source:Araport11) |
| AT5G08790 | induced by wounding, belongs to a large family of putative transcriptional activators with NAC domain. |
| AT5G09220 | member of AAAP family The mRNA is cell-to-cell mobile. |
| AT5G09420 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G09550 | GDP dissociation inhibitor family protein / Rab GTPase activator family protein;(source:Araport11) |
| AT5G09560 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT5G09570 | Twin CX9C domain protein. Induced by low phosphate or iron, drought and heat stress. Loss of both At12cys-1 and At12cys-2 lead to enhanced tolerance to drought and light stress and increased anti-oxidant capacity. |
| AT5G09770 | Ribosomal protein L17 family protein;(source:Araport11) |
| AT5G09805 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
| AT5G09820 | Encodes fibrillin 5 (FBN5). Located in chloroplast stroma. Essential for plastoquinone-9 biosynthesis. Stimulates enzymatic activity of solanesyl diphosphate synthases (SPS) 1 and 2 through binding to solanesyl moiety. Two splicing variants, named FBN5-A shorter one and FBN5-B longer one. FBN5-B is the protein detected in chloroplast stroma. Involved in plastoquinone biosynthesis. |
| AT5G10090 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G10110 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
| AT5G10180 | Encodes a low-affinity sulfate transporter expressed in the root cap and central cylinder, where it is induced by sulfur starvation. Expression in the shoot vascular system is not induced by sulfur starvation. |
| AT5G10270 | Encodes CDKC;1, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. |
| AT5G10340 | F-box family protein;(source:Araport11) |
| AT5G10380 | Encodes a RING finger domain protein with E3 ligase activity that is localized to the lipid rafts of the plasma membrane. Expression is increased in response to fungal pathogen. May be involved in regulation of programmed cell death by facilitating degredation of regulation of PDC activators. The mRNA is cell-to-cell mobile. |
| AT5G10520 | ROP binding protein kinases 1;(source:Araport11) |
| AT5G10660 | calmodulin-binding protein-like protein;(source:Araport11) |
| AT5G10690 | pentatricopeptide (PPR) repeat-containing protein / CBS domain-containing protein;(source:Araport11) |
| AT5G10730 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G10760 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G10790 | Encodes a ubiquitin-specific protease. |
| AT5G11050 | Member of R2R3-MYB transcription factor gene family. |
| AT5G11060 | A member of Class II KN1-like homeodomain transcription factors (together with KNAT3 and KNAT5), with greatest homology to the maize knox1 homeobox protein. Expression regulated by light. Detected in all tissues examined, but most prominent in leaves and young siliques. Transient expression of GFP translational fusion protein suggests bipartite localization in nucleus and cytoplasm. KNAT4 promoter activity showed cell-type specific pattern along longitudinal root axis; GUS expression pattern started at the elongation zone, predominantly in the phloem and pericycle cells, extending to endodermis toward the base of the root. |
| AT5G11070 | hypothetical protein;(source:Araport11) |
| AT5G11090 | serine-rich protein-like protein;(source:Araport11) |
| AT5G11100 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT5G11130 | Exostosin family protein;(source:Araport11) |
| AT5G11140 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT5G11250 | Encodes an atypical TIR-NBS-LRR protein that is involved in stress responses. Loss of function alleles overproduce stress hormones JA,SA, ABA, and ET. |
| AT5G11350 | Deadenylase. |
| AT5G11412 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G11490 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
| AT5G11530 | Involved in regulating reproductive development |
| AT5G11540 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
| AT5G11730 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G11830 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G11840 | YCF36, putative (DUF1230);(source:Araport11) |
| AT5G11920 | Encodes a protein with fructan exohydrolase (FEH) activity acting on both inulin and levan-type fructans (1- and 6-FEH). The enzyme does not have invertase activity. |
| AT5G11990 | proline-rich family protein;(source:Araport11) |
| AT5G12100 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT5G12180 | member of Calcium Dependent Protein Kinase |
| AT5G12300 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT5G12420 | WSD7 can function in vitro as wax ester synthase but does not appear to be essential for cuticular wax biosynthesis. |
| AT5G13130 | Member of the microrchidia protein family which have been described as epigenetic regulators and plant immune mediators, contains a hallmark GHKL-type ATPase domain in N-terminus. Possible role in the development of reproductive tissues. |
| AT5G13140 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT5G13170 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
| AT5G13180 | Encodes a NAC domain transcription factor that interacts with VND7 and negatively regulates xylem vessel formation. |
| AT5G13181 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G13210 | Uncharacterized conserved protein UCP015417, vWA;(source:Araport11) |
| AT5G13350 | Auxin-responsive GH3 family protein;(source:Araport11) |
| AT5G13548 | Pseudogene of AT3G12600; ATNUDT16 (Arabidopsis thaliana Nudix hydrolase homolog 16); hydrolase |
| AT5G13580 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). Phloem-expressed and plasma membrane-localized jasmonate transporter which together with JAT4 and GLR3.3 involved in regulating long-distance translocation of JA, which is important for driving the loading, translocation of JA in the phloem pathway by a self-propagation mode, contributing to wound-induced systemic response/resistance. |
| AT5G13680 | A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1?ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. Mutants have no ncm5U (5-carbamoylmethyluridine). |
| AT5G13700 | Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants). |
| AT5G13730 | Encodes sigma 4 factor, involved in regulating the activity of the plastid-encoded RNA polymerase PEP. Regulates the overall quantity of NDH complexes and thus influences NDH activity. |
| AT5G14020 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT5G14210 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G14300 | prohibitin 5;(source:Araport11) |
| AT5G14470 | GHMP kinase family protein;(source:Araport11) |
| AT5G14490 | NAC domain containing protein 85;(source:Araport11) |
| AT5G14495 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT5G14580 | polyribonucleotide nucleotidyltransferase;(source:Araport11) |
| AT5G14590 | Isocitrate/isopropylmalate dehydrogenase family protein;(source:Araport11) |
| AT5G14602 | methyltransferase-like protein;(source:Araport11) |
| AT5G14640 | shaggy-like kinase 13;(source:Araport11) |
| AT5G14730 | Unknown protein, expression induced by IDL7 and stress. |
| AT5G14740 | Encodes a beta carbonic anhydrase likely to be localized in the cytoplasm. Expression of its mRNA is seen in etiolated seedlings and points to a possible nonphotosynthetic role for this isoform. |
| AT5G14860 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G14870 | Encodes a member of the cyclic nucleotide gated channel family that is asymmetrically localized to the plasma membrane at the growing tip of the pollen tube and is involved in pollen tube growth and pollen tube guidance to ovules. It likely directly transduces a cNMP signal into an ion flux that can produce a localized signal capable of regulating the pollen tip-growth machinery. Also functions as a Ca2+ permeable channel. |
| AT5G14890 | potassium transporter;(source:Araport11) |
| AT5G14990 | WPP domain associated protein;(source:Araport11) |
| AT5G14995 | Encodes a ECA1 gametogenesis related family protein |
| AT5G15090 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. Purified VDAC3 is shown to have voltage-dependent anion channel activity. |
| AT5G15100 | Encodes an auxin transporter with a strong expression in a male gametophyte. Mutant studies reveal a role for auxin transport in regulating pollen development and function. It acts together with PIN5. |
| AT5G15110 | Pectate lyase family protein;(source:Araport11) |
| AT5G15120 | 2-aminoethanethiol dioxygenase, putative (DUF1637);(source:Araport11) |
| AT5G15250 | Encodes an FtsH protease that is localized to the chloroplast. AtFtsH6 is involved in the degradation of both Lhcb3 and Lhcb1 during senescence and high-light acclimation. |
| AT5G15310 | Member of the R2R3 factor gene family; MIXTA-like transcription factor that controls trichome maturation and cuticle formation. |
| AT5G15390 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
| AT5G15770 | Encodes a putative glucose-6-phosphate acetyltransferase that is likely involved in UDP-N-acetylglucosamine biosynthesis. A GFP:GNA1 fusion protein localizes to the endoplasmic reticulum. |
| AT5G15845 | Natural antisense transcript overlaps with AT5G15850;(source:Araport11) |
| AT5G15850 | Homologous to the flowering-time gene CONSTANS. |
| AT5G15900 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G16023 | Encodes a plant peptide that could be involved in the coordination of socket cell development in wild-type plants. |
| AT5G16090 | RAD23 UV excision repair family protein;(source:Araport11) |
| AT5G16100 | RWP-RK domain protein;(source:Araport11) |
| AT5G16350 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
| AT5G16400 | Encodes an f-type thioredoxin (Trx-f2) localized in chloroplast stroma. |
| AT5G16410 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G16470 | zinc finger (C2H2 type) family protein;(source:Araport11) |
| AT5G16500 | Encodes a receptor-like cytoplasmic kinase localized in the membrane of pollen tube tip regions that controls micropylar pollen tube guidance in Arabidopsis. |
| AT5G16590 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G16720 | caldesmon-like protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT5G16900 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G16930 | AAA-type ATPase family protein;(source:Araport11) |
| AT5G17010 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G17220 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). Mutants display no pigments on leaves and stems. Likely to function as a carrier to transport anthocyanin from the cytosol to tonoplasts. |
| AT5G17250 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT5G17260 | NAC domain containing protein 86;(source:Araport11) |
| AT5G17310 | UDP-glucose pyrophosphorylase 2;(source:Araport11) |
| AT5G17330 | Encodes one of two isoforms of glutamate decarboxylase. The mRNA is cell-to-cell mobile. |
| AT5G17340 | Putative membrane lipoprotein;(source:Araport11) |
| AT5G17410 | Spc97 / Spc98 family of spindle pole body (SBP) component;(source:Araport11) |
| AT5G17490 | Encodes a DELLA subfamily member that acts as a negative regulator of GA signaling and as a coactivator of ABI3 to promote seed storage protein biosynthesis during the seed maturation stage. |
| AT5G17580 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT5G17590 | Putative membrane lipoprotein;(source:Araport11) |
| AT5G17600 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G17630 | Phosphate translocator family member which resides in the plastid inner envelope membrane. Retrieves excessive pentose phosphates from the extra-plastidial space and makes them available to the plastids. |
| AT5G17720 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G17730 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G17740 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G17830 | Plasma-membrane choline transporter family protein;(source:Araport11) |
| AT5G17900 | microfibrillar-associated protein-like protein;(source:Araport11) |
| AT5G17970 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G18000 | Encodes VERDANDI (VDD), a putative transcription factor belonging to the reproductive meristem (REM) family. VDD is a direct target of the MADS domain ovule identity complex. Mutation in VDD affects embryo sac differentiation. |
| AT5G18090 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G18130 | transmembrane protein;(source:Araport11) |
| AT5G18150 | Methyltransferase-related protein;(source:Araport11) |
| AT5G18160 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G18170 | Encodes the 43 kDa alpha-subunit of the glutamate dehydrogenase with a putative mitochondrial transit polypeptide and NAD(H)- and alpha-ketoglutarate-binding domains. Mitochondrial localization confirmed by subcellular fractionation. Combines in several ratios with GDH2 protein (GDH-beta) to form seven isoenzymes. Catalyzes the cleavage of glycine residues. May be involved in ammonia assimilation under conditions of inorganic nitrogen excess. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells. |
| AT5G18190 | Casein kinase involved in phosphorylation and ubiquination of RYR/PYLs, resulting in negative regulation of ABA response.Also annotated as MUT9-LIKE kinase that functions as H3-T3 specific histone kinase. |
| AT5G18270 | NAC domain containing protein 87;(source:Araport11) |
| AT5G18300 | NAC domain containing protein 88;(source:Araport11) |
| AT5G18450 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT5G18520 | Encodes a candidate G-protein Coupled Receptor that is involved in the regulation of root growth by bacterial N-acyl-homoserine lactones (AHLs) and plays a role in mediating interactions between plants and microbes. The mRNA is cell-to-cell mobile. |
| AT5G18540 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT5G18580 | fass mutants have aberrant cell shapes due to defects in arrangement of cortical microtubules. Encodes a protein highly conserved in higher plants and similar in its C-terminal part to B' regulatory subunits of type 2A protein phosphatases. Interacts with an Arabidopsis type A subunit of PP2A in the yeast two-hybrid system. |
| AT5G18661 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G18730 | DNAJ heat shock amino-terminal domain protein;(source:Araport11) |
| AT5G18810 | encodes an SC35-like splicing factor of 28 kD localized to the nuclear specks. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT5G18850 | Low-density receptor-like protein;(source:Araport11) |
| AT5G18860 | Encodes a purine nucleoside hydrolase active in the apoplast. It might play a role in salvaging extracellular ATP. NSH3 transcript levels rise in response to jasmonic acid and wounding. |
| AT5G18890 | Inosine-uridine preferring nucleoside hydrolase family protein;(source:Araport11) |
| AT5G18910 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G18980 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G19030 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G19110 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G19170 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT5G19260 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
| AT5G19280 | kinase associated protein phosphatase composed of three domains: an amino-terminal signal anchor, a kinase interaction (KI) domain, and a type 2C protein phosphatase catalytic region |
| AT5G19300 | methyltransferase C9orf114 protein;(source:Araport11) |
| AT5G19310 | Encodes CHR23. Overexpression results in increased variability of growth and gene expression. |
| AT5G19550 | Nitrogen metabolism. Major cytosolic isoenzyme controlling aspartate biosynthesis in the light. The mRNA is cell-to-cell mobile. |
| AT5G19610 | GNOM-like 2;(source:Araport11) |
| AT5G19630 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G19650 | Transcriptional repressor of KNOX family transcription factors. Encodes pluripotency and stemness, upregulated in LRP cells. |
| AT5G19700 | Encodes a MATE transporter involved in leaf senescence and iron homeostasis. |
| AT5G19730 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G19780 | Encodes an isoform of alpha tubulin. Closely related to adjacent gene TUA3 suggesting recent duplication. The mRNA is cell-to-cell mobile. |
| AT5G19820 | Encodes an importin that transports HYL1, a component of the microprocessor, from the cytoplasm to the nucleus to constitute functional microprocessor, thereby affecting miRNA processing. Knockdown amiR mutants significantly reduced nuclear portion of HYL1 protein and correspondingly compromised the pri-miRNA processing in the nucleus.KETCH1 may protect RPs from the 26S proteasome-mediated degradation. |
| AT5G20310 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT5G20370 | serine-rich protein-like protein;(source:Araport11) |
| AT5G20430 | Mob1/phocein family protein;(source:Araport11) |
| AT5G20440 | Mob1/phocein family protein;(source:Araport11) |
| AT5G20470 | Encodes a headless derivative of myosin XI-K, which likely arose from a partial duplication of the XI-K gene and is developmentally regulated. |
| AT5G20650 | Encodes COPT5, a member of copper transporter family and functionally complements a high affinity copper transporter mutant in yeast. Plays an important role in the plant response to environmental copper scarcity, probably by remobilizing copper from prevacuolar vesicles, which could act as internal stores or recycling vesicles to provide the metal cofactor to key copper-dependent processes such as photosynthesis. |
| AT5G20690 | PRK6 is pollen specific receptor kinase that functions as a receptor for the pollen attractant LURE1 in pollen tube guidance. It is localized to the tip the pollen tube and becomes asymmetrically distributed towards the source of the LURE1 signal prior to pollen tube growth reorientation. |
| AT5G20700 | senescence-associated family protein, putative (DUF581);(source:Araport11) |
| AT5G20830 | Encodes a protein with sucrose synthase activity (SUS1). |
| AT5G20960 | Encodes aldehyde oxidase AA01. |
| AT5G20970 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT5G21050 | hyccin;(source:Araport11) |
| AT5G21080 | Uncharacterized protein;(source:Araport11) |
| AT5G21125 | hypothetical protein;(source:Araport11) |
| AT5G21160 | Encodes a protein with sequence similarity to mRNA binding proteins from humans. LARP1a is involved in mRNA degradation in response to heat stress. Upon heat stress LARP1a interacts with XRN4 and appears to be responsible for addressing XRN4 to the polysome. LARP1/XRN4 double mutants are impaired in thermotolerance and lower levels of heat induced RNA turnover. |
| AT5G21482 | This gene used to be called AtCKX5. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. Enzyme assays show preference for N6 -(2-isopentenyl)adenine 9-glucoside substrate. |
| AT5G21940 | hybrid signal transduction histidine kinase M-like protein;(source:Araport11) |
| AT5G22010 | Encodes RFC1, the largest subunit of replication factor C. Mediates genomic stability and transcriptional gene silencing. |
| AT5G22180 | hypothetical protein;(source:Araport11) |
| AT5G22310 | trichohyalin-like protein;(source:Araport11) |
| AT5G22390 | FANTASTIC four-like protein (DUF3049);(source:Araport11) |
| AT5G22410 | root hair specific 18;(source:Araport11) |
| AT5G22470 | PARP3 is one of three canonical PARPs in Arabidopsis. |
| AT5G22550 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT5G22620 | encodes a putative 2-carboxy-D-arabinitol 1-phosphate phosphatase |
| AT5G22730 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G22800 | A locus involved in embryogenesis. Mutations in this locus result in embryo lethality. |
| AT5G22870 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G22900 | member of Putative Na+/H+ antiporter family |
| AT5G22910 | member of Putative Na+/H+ antiporter family |
| AT5G22930 | enabled-like protein (DUF1635);(source:Araport11) |
| AT5G22960 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G22980 | serine carboxypeptidase-like 47;(source:Araport11) |
| AT5G23190 | cytochrome P450 CYP86B1, nuclear gene for chloroplast product. CYP86B1 is a very long chain fatty acid hydroxylase specifically involved in polyester monomer biosynthesis during the course of plant development. |
| AT5G23270 | Membrane localized sucrose transporter. |
| AT5G23360 | GRAM domain-containing protein / ABA-responsive protein-like protein;(source:Araport11) |
| AT5G23413 | pseudogene of HMG-box (high mobility group) DNA-binding family protein;(source:Araport11) |
| AT5G23510 | hypothetical protein;(source:Araport11) |
| AT5G23665 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
| AT5G23730 | Encodes REPRESSOR OF UV-B PHOTOMORPHOGENESIS 2 (RUP2). Functions as a repressor of UV-B signaling. |
| AT5G23920 | transmembrane protein;(source:Araport11) |
| AT5G23960 | Encodes a sesquiterpene synthase involved in generating all of the group A sesquiterpenes found in the Arabidopsis floral volatile blend. Strongly expressed in the stigma. |
| AT5G23970 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G23990 | Encodes a ferric chelate reductase that is expressed at low levels in roots,shoots and flowers, but not cotyledons. |
| AT5G24010 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G24040 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT5G24070 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G24080 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G24105 | Encodes a putative arabinogalactan-protein (AGP41). |
| AT5G24160 | squalene monooxygenase 6;(source:Araport11) |
| AT5G24180 | Lipase class 3-related protein;(source:Araport11) |
| AT5G24200 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G24205 | other_RNA;(source:Araport11) |
| AT5G24210 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G24270 | encodes a calcium sensor that is essential for K+ nutrition, K+/Na+ selectivity, and salt tolerance. The protein is similar to calcineurin B. Lines carrying recessive mutations are hypersensitive to Na+ and Li+ stresses and is unable to grow in low K+. The growth defect is rescued by extracellular calcium. |
| AT5G24290 | Vacuolar iron transporter (VIT) family protein;(source:Araport11) |
| AT5G24330 | Encodes a SET-domain protein, a H3K27 monomethyltransferases required for chromatin structure and gene silencing. Regulates heterochromatic DNA replication. Contains a PCNA-binding domain. ATXR6 accumulates preferentially during the late G1 or S phase, suggesting that it plays a role in cell-cycle regulation or progression. |
| AT5G24380 | closest Arabidopsis homolog of Zea maize metal-phytosiderophore/metal-nicotianamine transporter ZmYS1 |
| AT5G24430 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
| AT5G24450 | Transcription factor IIIC, subunit 5;(source:Araport11) |
| AT5G24640 | hypothetical protein;(source:Araport11) |
| AT5G24790 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
| AT5G24825 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: CAGCCAAGGAUGACUUGCCGG |
| AT5G24879 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G24890 | stress response NST1-like protein;(source:Araport11) |
| AT5G24900 | Member of CYP714A. Encodes one of the two tandemly duplicated gene pair ELA1 (CYP714A1) and ELA2 (CYP714A2), homologs of the rice cytochrome P450 monooxygenase gene EUI1. Double mutation of ELA1 and ELA2 results in increased biomass and enlarged organs. |
| AT5G24940 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G24950 | putative cytochrome P450 |
| AT5G25140 | putative cytochrome P450 |
| AT5G25160 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT5G25280 | serine-rich protein-like protein;(source:Araport11) |
| AT5G25305 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 9.2e-51 P-value blast match to Tat4-1 reverse transcriptase (from Dan Voytas http://www.public.iastate.edu/~voytas) (Gypsy_Ty3-family)T24H24-Lys reverse transcriptase (from Dan Voytas http://www.public.iastate.edu/~voytas) (Gypsy_Ty3-family);(source:TAIR10) |
| AT5G25320 | ACT-like superfamily protein;(source:Araport11) |
| AT5G25340 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G25370 | member of C2-PLD subfamily. Analyses on the gene structures/sequences, overall amino acid sequences, and domain structures indicate that PLDalpha3 is most closely related to other two PLDalphas than to other PLDs. Phylogenetic analysis has not identified a true ortholog for PLDalpha3. Involved in hyperosmotic response. |
| AT5G25400 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT5G25430 | HCO3- transporter family;(source:Araport11) |
| AT5G25440 | Receptor like kinase involved in HopZ1a effector triggered immunity. Interacts with ZAR1. Localization to membrane is dependent on N-terminal myristoylation domain. |
| AT5G25470 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G25500 | exosome complex exonuclease;(source:Araport11) |
| AT5G25530 | DNAJ heat shock family protein;(source:Araport11) |
| AT5G25840 | DUF1677 family protein (DUF1677);(source:Araport11) |
| AT5G25850 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G25880 | The malic enzyme (EC 1.1.1.40) encoded by the ATNADP-ME3 is presumably cytosolic and restricted in its expression by both developmental and cell-specific signals. |
| AT5G25930 | kinase family with leucine-rich repeat domain-containing protein;(source:Araport11) |
| AT5G25955 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.7e-17 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G25980 | Myrosinase (thioglucoside glucohydrolase) gene involved in glucosinoloate metabolism. The mRNA is cell-to-cell mobile. |
| AT5G26040 | Class III RPD3 type protein. Encodes HDA2, a member of the histone deacetylase family proteins. |
| AT5G26080 | proline-rich family protein;(source:Araport11) |
| AT5G26100 | hypothetical protein;(source:Araport11) |
| AT5G26150 | protein kinase family protein;(source:Araport11) |
| AT5G26250 | Sugar transporter expressed strongly in pollen and pollen tubes. |
| AT5G26260 | TRAF-like family protein;(source:Araport11) |
| AT5G26300 | TRAF-like family protein;(source:Araport11) |
| AT5G26330 | Cupredoxin superfamily protein;(source:Araport11) |
| AT5G26660 | myb domain protein 86;(source:Araport11) |
| AT5G26692 | Encodes a Plant thionin family protein |
| AT5G26717 | Encodes a Plant thionin family protein |
| AT5G26930 | Encodes a member of the GATA factor family of zinc finger transcription factors. Controls lateral root founder cell specification. |
| AT5G26950 | AGAMOUS-like 93;(source:Araport11) |
| AT5G27010 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G27070 | AGAMOUS-like 53;(source:Araport11) |
| AT5G27095 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G27130 | AGAMOUS-like 39;(source:Araport11) |
| AT5G27140 | NOP56-like pre RNA processing ribonucleoprotein;(source:Araport11) |
| AT5G27150 | Encodes a vacuolar sodium/proton antiporter involved in salt tolerance, ion homeostasis, and leaf development. The mRNA is cell-to-cell mobile. |
| AT5G27210 | Protein of unknown function, transmembrane-40;(source:Araport11) |
| AT5G27230 | Frigida-like protein;(source:Araport11) |
| AT5G27310 | Transcription factor IIS family protein;(source:Araport11) |
| AT5G27510 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G27800 | Class II aminoacyl-tRNA and biotin synthetases superfamily protein;(source:Araport11) |
| AT5G27830 | Folate receptor family protein;(source:Araport11).Expression correlates with increase in bound folate in planta. |
| AT5G27870 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G27940 | WPP domain protein 3;(source:Araport11) |
| AT5G28000 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT5G28050 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
| AT5G28080 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. |
| AT5G28145 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.1e-195 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT5G28190 | transmembrane protein;(source:Araport11) |
| AT5G28210 | mRNA capping enzyme family protein;(source:Araport11) |
| AT5G28285 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 9.8e-101 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
| AT5G28310 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G28470 | Encodes a member of the nitrate/peptide NTR/PTR family of transporters is required for accumulation and transport of pollen-specific flavonol 3-O-sophorosides, characterized by a glycosidic β-1,2-linkage, to the pollen surface of Arabidopsis. |
| AT5G28510 | beta glucosidase 24;(source:Araport11) |
| AT5G28520 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT5G28524 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 8.8e-34 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
| AT5G28570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G12725.1);(source:TAIR10) |
| AT5G28620 | kinase C-like protein;(source:Araport11) |
| AT5G28637 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.1e-23 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G28646 | Encodes a novel protein. The wvd2 gain-of-function mutant has impaired cell expansion and root waving, and changed root skewing. |
| AT5G28680 | Receptor-like kinase required for maintenance of pollen tube growth. Display polar localization at the plasma membrane of the pollen tube tip. |
| AT5G28690 | carboxylate clamp-TPR protein (DUF1685);(source:Araport11) |
| AT5G28776 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.6e-199 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT5G28885 | hypothetical protein;(source:Araport11) |
| AT5G28894 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-23 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT5G28927 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 3.9e-45 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
| AT5G28935 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.0e-48 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G28960 | alpha-(1,6)-fucosyltransferase;(source:Araport11) |
| AT5G29024 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 7.1e-05 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT5G29029 | transposable_element_gene;(source:Araport11);pseudogene, similar to Putative copia-type polyprotein, blastp match of 46%25 identity and 3.0e-30 P-value to GP|15209144|gb|AAK91877.1|AC091665_3|AC091665 Putative copia-type polyprotein {Oryza sativa};(source:TAIR10) |
| AT5G29060 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G29090 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G33131.1);(source:TAIR10) |
| AT5G29210 | hypothetical protein;(source:Araport11) |
| AT5G29560 | caleosin-related family protein;(source:Araport11) |
| AT5G29562 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.8e-228 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT5G30269 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-141 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT5G31032 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-35 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT5G31122 | transposable_element_gene;(source:Araport11);pseudogene, similar to Putative copia-type polyprotein, blastp match of 56%25 identity and 1.5e-39 P-value to GP|15209144|gb|AAK91877.1|AC091665_3|AC091665 Putative copia-type polyprotein {Oryza sativa};(source:TAIR10) |
| AT5G32900 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.6e-05 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT5G32925 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.0e-105 P-value blast match to GB:AAA66266 unknown protein ORF1 transposable element En-1 (CACTA-element) (Zea mays);(source:TAIR10) |
| AT5G32975 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative transposase, similar to En/Spm-like transposon protein, putative;(source:TAIR10) |
| AT5G33240 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42980.1);(source:TAIR10) |
| AT5G33285 | transposable_element_gene;(source:Araport11);pseudogene, similar to Hypothetical protein with similarity to putative Ac-like transposases, similar to Ac-like transposase;(source:TAIR10) |
| AT5G33290 | Acts as a xylogalacturonan xylosyltransferase within the XGA biosynthesis pathway. Involved in pectin biosynthesis. |
| AT5G33340 | Encodes a protein with aspartic protease activity (also known as aspartate-type endopeptidase activity). Overexpression of the gene was shown to lead to salicylic acid (SA)-mediated disease resistance upon exposure to the pathogen Pseudomonas syringae. Moreover, overexpression of this gene led to the upregulation of two pathogenesis-related genes PR1 and PR2. This upregulation was no longer observed in transgenic lines expressing the bacterial NahG gene encoding a hydroxylase suppressing SA accumulation. |
| AT5G33370 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. Mutants are defective in cuticle formation with reduced sepal cuticle ridge formation. |
| AT5G33533 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.9e-112 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
| AT5G34431 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G34839 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-09 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G34841 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 0.00011 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G34854 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-96 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT5G34864 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.3e-143 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT5G34867 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.7e-279 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT5G34868 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.1e-131 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G34870 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
| AT5G35111 | pseudogene of Peroxidase superfamily protein;(source:Araport11) |
| AT5G35160 | Endomembrane protein 70 protein family;(source:Araport11) |
| AT5G35200 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT5G35370 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT5G35410 | encodes a member of the CBL-interacting protein kinase family, is a regulatory component controlling plant potassium nutrition |
| AT5G35540 | transmembrane protein;(source:Araport11) |
| AT5G35640 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT5G35660 | Glycine-rich protein family;(source:Araport11) |
| AT5G35715 | encodes a protein with cytochrome P450 domain |
| AT5G35720 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.9e-12 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT5G35750 | Encodes histidine kinase AHK2. |
| AT5G35760 | Beta-galactosidase related protein;(source:Araport11) |
| AT5G35777 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-67 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G35780 | pseudogene of B3 domain protein (DUF313);(source:Araport11) |
| AT5G35800 | transposable_element_gene;(source:Araport11);pseudogene, similar to simiar to ribosomal protein, similar to unknown protein (gb|AAD32760.1);(source:TAIR10) |
| AT5G35950 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT5G35960 | Protein kinase family protein;(source:Araport11) |
| AT5G36150 | putative pentacyclic triterpene synthase 3;(source:Araport11) |
| AT5G36190 | F-box protein interaction domain protein;(source:Araport11) |
| AT5G36210 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G36296 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.6e-14 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G36970 | NDR1/HIN1-like protein, expression induced during incompatible response to a pathogen, expression is at least partly dependent on the salicylic acid signaling pathway |
| AT5G37080 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G05090.1);(source:TAIR10) |
| AT5G37130 | Protein prenylyltransferase superfamily protein;(source:Araport11) |
| AT5G37140 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G37160 | P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11) |
| AT5G37175 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT2G15750.1);(source:TAIR10) |
| AT5G37220 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G37250 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G37310 | Endomembrane protein 70 protein family;(source:Araport11) |
| AT5G37320 | hypothetical protein (DUF674);(source:Araport11) |
| AT5G37445 | pseudogene of hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G37450 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G37490 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G37500 | Encodes a guard cell outward potassium channel. Belongs to the Shaker family K+ channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mutants have increased water consumption and limited stomatal closure in response to abscisic and jasmonic acids. It forms a heteromeric K(out) channels with SKOR. The gene is expressed ubiquitously in root and the vasculature and guard cells of leaves. Expression is suppressed during agrobacterium-induced tumor formation and increased in response to water deprivation and cold. |
| AT5G37540 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G37550 | hypothetical protein;(source:Araport11) |
| AT5G37650 | hypothetical protein (DUF577);(source:Araport11) |
| AT5G37660 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT5G37730 | hypothetical protein;(source:Araport11) |
| AT5G37790 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G37860 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G37970 | SABATH family methyltransferase. |
| AT5G38005 | other_RNA;(source:Araport11) |
| AT5G38020 | encodes a protein whose sequence is similar to SAM:salicylic acid carboxyl methyltransferase (SAMT) (GI:6002712)(Clarkia breweri) and to SAM:benzoic acid carboxyl methyltransferase (BAMT)(GI:9789277)(Antirrhinum majus). SABATH family methyltransferase. |
| AT5G38130 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G38270 | F-box family protein;(source:Araport11) |
| AT5G38344 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT5G38460 | ALG6, ALG8 glycosyltransferase family;(source:Araport11) |
| AT5G38490 | B3 domain protein (DUF313);(source:Araport11) |
| AT5G38520 | CLD1 is involved in steady-state chlorophyll turnover; CLD1 dephytylates chlorophyll a, chlorophyll b, and pheophytin a in vitro; CLD1 and CHLG form a salvage cycle in recycling chlorophyll. Suppression of CLD1 expression results in reduced tolerance to moderately high temperature. |
| AT5G38550 | Jacalin lectin family protein gene |
| AT5G38610 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G38700 | cotton fiber protein;(source:Araport11) |
| AT5G38710 | Methylenetetrahydrofolate reductase family protein;(source:Araport11) |
| AT5G38800 | basic leucine-zipper 43;(source:Araport11) |
| AT5G38860 | Encodes BES1-INTERACTING MYC-LIKE 3 (BIM3), a PAR1 (PHYTOCHROME RAPIDLY REGULATED 1)-interacting protein that positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT5G38900 | Thioredoxin superfamily protein;(source:Araport11) |
| AT5G38960 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT5G38970 | Encodes a polypeptide involved in the C-6 oxidation of brassinosteroids. Heterologous expression of the protein in yeast conferred the ability to catalyze multiple reactions in which the C-6 position of 6-deoxocastasterone, 6-deoxotyphasterol, 3-dehydro-6-deoxoteasterone and 6-deoxoteasterone are oxidized. |
| AT5G39000 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT5G39010 | hypothetical protein;(source:Araport11) |
| AT5G39050 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. |
| AT5G39090 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G39230 | TFIIB zinc-binding protein;(source:Araport11) |
| AT5G39330 | transmembrane protein, putative (DUF1163);(source:Araport11) |
| AT5G39390 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G39400 | Calcium/lipid-binding (CaLB) phosphatase;(source:Araport11) |
| AT5G39420 | CDC2C;(source:Araport11) |
| AT5G39460 | F-box family protein;(source:Araport11) |
| AT5G39540 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT5G39610 | Encodes a NAC-domain transcription factor. Positively regulates aging-induced cell death and senescence in leaves. This gene is upregulated in response to salt stress in wildtype as well as NTHK1 transgenic lines although in the latter case the induction was drastically reduced. It was also upregulated by ABA, ACC and NAA treatment, although in the latter two cases, the induction occurred relatively late when compared with NaCl or ABA treatments. Note: this protein (AtNAC6) on occasion has also been referred to as AtNAC2, not to be confused with the AtNAC2 found at locus AT3G15510. |
| AT5G39620 | RAB GTPase homolog G1;(source:Araport11) |
| AT5G39690 | NAC domain containing protein 93;(source:Araport11) |
| AT5G39861 | pseudogene of receptor kinase 3;(source:Araport11) |
| AT5G39863 | pseudogene of receptor kinase 3;(source:Araport11) |
| AT5G40010 | Encodes a mitochondrial ATPase involved in seed and silique development. |
| AT5G40050 | F-box/FBD-like domains containing protein;(source:Araport11) |
| AT5G40070 | MADS-box family protein;(source:Araport11) |
| AT5G40170 | receptor like protein 54;(source:Araport11) |
| AT5G40260 | Encodes RPG1 (RUPTURED POLLEN GRAIN1), a member of the MtN3/saliva gene family. Crucial for exine pattern formation and cell integrity of microspores. |
| AT5G40300 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT5G40382 | Cytochrome c oxidase subunit Vc family protein;(source:Araport11) |
| AT5G40470 | RNI-like superfamily protein;(source:Araport11) |
| AT5G40590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G40680 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G40690 | histone-lysine N-methyltransferase trithorax-like protein;(source:Araport11) |
| AT5G40830 | Encodes an SAM‐dependent methyltransferase superfamily protein that has an N‐terminal transmembrane domain and a putative methyltransferase domain, DUF248, and is strongly expressed in the vasculature. Overexpression results in increased phloem and xylem in the plant. |
| AT5G40890 | Encodes a member of the voltage-dependent chloride channel. Also functions as a NO3-/H+ exchanger that serves to accumulate nitrate nutrient in vacuoles. Mutants homozygous for the T-DNA insertion mutation have reduced nitrate uptake capacity in high nitrate environment and exhibit hypersensitivity to chlorate. Role in cytosolic pH homeostasis. |
| AT5G41040 | Encodes a feruloyl-CoA transferase required for suberin synthesis. Has feruloyl-CoA-dependent feruloyl transferase activity towards substrates with a primary alcohol. |
| AT5G41090 | NAC domain containing protein 95;(source:Araport11) |
| AT5G41109 | hypothetical protein;(source:Araport11) |
| AT5G41110 | meiosis chromosome segregation family protein;(source:Araport11) |
| AT5G41120 | Esterase/lipase/thioesterase family protein;(source:Araport11) |
| AT5G41250 | Exostosin family protein;(source:Araport11) |
| AT5G41300 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT5G41310 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
| AT5G41320 | stress response NST1-like protein;(source:Araport11) |
| AT5G41401 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G41710 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 6.2e-18 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT5G41765 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT5G41780 | myosin heavy chain-like protein;(source:Araport11) |
| AT5G41800 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G41840 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G42053 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G42092 | Natural antisense transcript overlaps with AT5G42090;(source:Araport11) |
| AT5G42120 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G42210 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G42290 | transcription activator-like protein;(source:Araport11) |
| AT5G42323 | Pseudogene of AT1G06390; GSK1 (GSK3/SHAGGY-LIKE PROTEIN KINASE 1); kinase |
| AT5G42410 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G42470 | BRCA1-A complex subunit BRE-like protein;(source:Araport11) |
| AT5G42490 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT5G42505 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-23 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT5G42580 | a member of the cytochrome P450 family |
| AT5G42850 | Thioredoxin superfamily protein;(source:Araport11) |
| AT5G42870 | The PAH2 gene encodes a phosphatidate phosphohydrolase. Mutant analysis revealed its involvement in galactolipid synthesis pathway, and the membrane lipid remodeling. The pah1pah2 double-mutant showed enhanced Al-susceptibility under low-P conditions, but there was no significant differences in Al tolerance between pah1pah2 and wild type when they were grown in a solution containing 35 μM Pi. |
| AT5G42930 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G42950 | EXA1 is a GYF domain-containing gene of the SMY2 subgroup. Mutants exhibit resistance to potexviruses. |
| AT5G43060 | Peptidase, activity detected in extracts of root, leaf and cell culture. |
| AT5G43090 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G43110 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G43120 | ARM-repeat/Tetratricopeptide repeat (TPR)-like protein;(source:Araport11) |
| AT5G43175 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G43340 | Encodes Pht1;6, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT5G43360 | Encodes Pht1;3, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT5G43380 | encodes a type I serine/threonine protein phosphatase expressed in expressed in roots, rosettes and flowers. |
| AT5G43390 | plant/protein;(source:Araport11) |
| AT5G43455 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT5G43535 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT5G43590 | Acyl transferase/acyl hydrolase/lysophospholipase superfamily protein;(source:Araport11) |
| AT5G43700 | Auxin inducible protein similar to transcription factors. |
| AT5G43790 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G43840 | member of Heat Stress Transcription Factor (Hsf) family |
| AT5G43870 | FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT5G43920 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT5G44030 | Encodes a cellulose synthase involved in secondary cell wall biosynthesis. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling. The mRNA is cell-to-cell mobile. |
| AT5G44140 | prohibitin 7;(source:Araport11) |
| AT5G44160 | NUC is a member of the BIRD group of transcriptional regulators and is required for the formative divisions that pattern the root. the ground tissue into cortex and endodermis. |
| AT5G44240 | Expression is upregulated in the shoot of cax1/cax3 mutant. The mRNA is cell-to-cell mobile. |
| AT5G44300 | Dormancy/auxin associated family protein;(source:Araport11) |
| AT5G44310 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT5G44316 | Stabilizer of iron transporter SufD superfamily protein;(source:Araport11) |
| AT5G44375 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT5G44380 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44400 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44410 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44417 | pseudogene of FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44430 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT5G44440 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44540 | Tapetum specific protein TAP35/TAP44;(source:Araport11) |
| AT5G44550 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT5G44590 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G44680 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT5G44700 | Encodes GASSHO2 (GSO2), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO2 and a homolog GSO1 (At4g20140) are required for the formation of a normal epidermal surface during embryogenesis. |
| AT5G44740 | Y-family DNA polymerase. Catalyses translesion synthesis in response to UV damage. Functionally interacts with PCNA2. Has a ubiquitin binding motif. |
| AT5G44760 | C2 domain-containing protein;(source:Araport11) |
| AT5G44820 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT5G44870 | Encodes LAZ5, a TIR-class NB-LRR R protein of unknown pathogen specificity with sequence similarity to RPS4, an R protein conferring resistance to Pseudomonas syringae expressing the effector AvrRPS4. Overexpression of LAZ5 results in hypersensitive cell death (plants did not survive to set seeds). |
| AT5G44950 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G45085 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.2e-148 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10) |
| AT5G45120 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G45160 | Root hair defective 3 GTP-binding protein (RHD3);(source:Araport11) |
| AT5G45170 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G45220 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G45240 | Disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT5G45250 | RPS4 belongs to the Toll/interleukin-1 receptor (TIR)-nucleotide binding site (NBS)-Leu-rich repeat (LRR) class of disease resistance (R ) genes. Confers specific resistance to Pseudomonas syringae pv. tomato carrying the avirulence gene AvrRPS4. Produces alternative transcripts with truncated open reading frames. |
| AT5G45280 | Pectin acetylesterase involved in pectin remodelling. |
| AT5G45390 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). The mRNA is cell-to-cell mobile. |
| AT5G45510 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G45520 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G45550 | Encodes a gene product involved in both sporogenesis and gametogenesis and is required for the normal progression of megasporogenesis and microsporogenesis. Additional alleles were isolated in a screen for enhancers of PID and genetic analysis indicates a role for MOB1A in auxin mediated signaling. |
| AT5G45680 | Peptidyl-Prolyl Isomerase located in chloroplast thylakoid lumen The mRNA is cell-to-cell mobile. |
| AT5G45770 | receptor like protein 55;(source:Araport11) |
| AT5G45810 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.5), which has also been reported as a member of the CBL-interacting protein kinases (CIPK19). |
| AT5G45820 | Encodes a CBL-interacting serine/threonine protein kinase comprised of an N-terminal kinase catalytic domain similar to SNF1/AMPK and a unique C-terminal regulatory domain. |
| AT5G45830 | Encodes DOG1 (DELAY OF GERMINATION 1). A quantitative trait locus involved in the control of seed dormancy. Belongs to a novel plant-specific gene family whose members include: DOG1-like 1-4 (DOGL1-4, At4g18660, At4g18680, At4g18690, At4g18650 respectively) and DOG1. DOG1 expression is seed-specific. |
| AT5G45840 | Encodes a leucine-rich-repeat RLK that is localized to the plasma membrane of pollen tubes and functions with MIK1/2 as the male receptor of the pollen tube chemo-attractant LURE1.MDIS1 forms a complex with MIK1/2 and binds LURE1. |
| AT5G45850 | hypothetical protein (DUF688);(source:Araport11) |
| AT5G45990 | crooked neck protein, putative / cell cycle protein;(source:Araport11) |
| AT5G46040 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G46105 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT5G46160 | Ribosomal protein L14p/L23e family protein;(source:Araport11) |
| AT5G46200 | carboxyl-terminal proteinase-like protein (DUF239);(source:Araport11) |
| AT5G46315 | U6-29;(source:Araport11) |
| AT5G46330 | Encodes a leucine-rich repeat serine/threonine protein kinase that is expressed ubiquitously. FLS2 is involved in MAP kinase signalling relay involved in innate immunity. Essential in the perception of flagellin, a potent elicitor of the defense response. FLS2 is directed for degradation by the bacterial ubiquitin ligase AvrPtoB. The mRNA is cell-to-cell mobile. |
| AT5G46370 | Encodes AtTPK2 (KCO2), a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK2 is targeted to the vacuolar membrane. May form homomeric ion channels in vivo. |
| AT5G46460 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G46490 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G46500 | protein VARIATION IN COMPOUND TRIGGERED ROOT growth protein;(source:Araport11) |
| AT5G46510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G46530 | AWPM-19-like family protein;(source:Araport11) |
| AT5G46540 | P-glycoprotein 7;(source:Araport11) |
| AT5G46680 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT5G46690 | beta HLH protein 71;(source:Araport11) |
| AT5G46780 | VQ motif-containing protein;(source:Araport11) |
| AT5G46880 | homeobox-7;(source:Araport11) |
| AT5G47030 | Encodes the mitochondrial ATP synthase subunit delta. |
| AT5G47100 | member of AtCBLs (Calcineurin B-like Calcium Sensor Proteins. CBL9 interacts with and targets CIPK23 to the plasma membrane in vivo. |
| AT5G47120 | Encodes BI-1, a homolog of mammalian Bax inhibitor 1. Functions as an attenuator of biotic and abiotic types of cell death. Bax-induced cell death can be downregulated by ectopically expressing AtBI in planta. The mRNA is cell-to-cell mobile. |
| AT5G47150 | YDG/SRA domain-containing protein;(source:Araport11) |
| AT5G47360 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G47370 | homeobox-leucine zipper genes induced by auxin, but not by other phytohormones. Plays opposite roles in the shoot and root tissues in regulating auxin-mediated morphogenesis. |
| AT5G47460 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G47530 | Auxin-responsive family protein;(source:Araport11) |
| AT5G47850 | CRINKLY4 related 4;(source:Araport11) |
| AT5G47900 | heparan-alpha-glucosaminide N-acetyltransferase-like protein (DUF1624);(source:Araport11) |
| AT5G48030 | encodes a mitochondrially targeted DNAJ protein involved in female gametophyte development. |
| AT5G48060 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT5G48070 | putative xyloglucan endotransglycosylase/hydrolase, expressed primarily in the stele of mature non-elongating regions of both the main and the lateral root. Is expressed in lateral root primordia but expression ceases after lateral root begins to grow. Involved in cell proliferation in incised inflorescence stems. |
| AT5G48100 | Encodes a protein that is similar to laccase-like polyphenol oxidases. Involved in lignin and flavonoids biosynthesis. It has four conserved copper binding domains. Expressed in developing testa, where it colocalizes with the flavonoid end products proanthocyanidins and flavonols. Mutant plants exhibited a delay in developmentally determined browning of the testa, characterized by the pale brown color of seed coat. The tt10 mutant seeds accumulate more epicatechin monomers and more soluble proanthocyanidins than wild-type seeds. Flavonol composition was also affected in tt10 seeds, which exhibited a higher ratio of quercetin rhamnoside monomers versus dimers than wild-type seeds. |
| AT5G48130 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT5G48140 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G48205 | zinc ion binding protein;(source:Araport11) |
| AT5G48320 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G48410 | member of Putative ligand-gated ion channel subunit family |
| AT5G48412 | other_RNA;(source:Araport11) |
| AT5G48430 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G48510 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT5G48520 | Encodes AUGMIN subunit3 (AUG3), a homolog of animal dim gamma-tubulin 3/human augmin-like complex, subunit 3. Plays a critical role in microtubule organization during plant cell division. |
| AT5G48570 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G48650 | Negative regulator of defense response to Pseudomonas syringae pv. tomato through altered stomatal and apoplastic immunity. |
| AT5G48690 | ubiquitin-associated (UBA)/TS-N domain protein;(source:Araport11) |
| AT5G48710 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G48740 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G48840 | Encodes a pantothenate synthetase that appears to be located in the cytosol. This protein is expected to play a role in pantothenate (vitamin B5) biosynthesis. Analysis of the catalytic properties of this enzyme indicate that it might be able to synthesize adequate amounts of pantothenate even in the presence of low levels of pantoate. |
| AT5G48940 | RGFR2 is a leucine--rich repeat receptor kinase that, together with RGFR1 and RGFR3, binds ROOT GROWTH FACTORS and is required for establishing the gradient of PLETHORA1 and PLETHORA2 essential for proper root growth and development. |
| AT5G49138 | Natural antisense transcript overlaps with AT5G49130;(source:Araport11) |
| AT5G49160 | Encodes a cytosine methyltransferase MET1. Required for silencing of FWA paternal allele in endosperm. Two lines with RNAi constructs directed against DMT1 have reduced agrobacterium-mediated tumor formation. The mRNA is cell-to-cell mobile. |
| AT5G49240 | member of Response Regulator: Pseudo |
| AT5G49260 | hypothetical protein;(source:Araport11) |
| AT5G49270 | Involved in successfully establishing tip growth in root hairs. |
| AT5G49290 | receptor like protein 56;(source:Araport11) |
| AT5G49300 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT5G49301 | Pseudogene of AT5G49310; importin alpha-1 subunit, putative |
| AT5G49340 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G49350 | Glycine-rich protein family;(source:Araport11) |
| AT5G49480 | AtCP1 encodes a novel Ca2+-binding protein, which shares sequence similarities with calmodulins. The expression of AtCP1 is induced by NaCl. The mRNA is cell-to-cell mobile. |
| AT5G49610 | F-box family protein;(source:Araport11) |
| AT5G49660 | The gene encodes receptorlike kinase (RLK). Involved in the maintenance organization of cell files or cell morphology in conductive elements. Functions as a receptor for CEP1 peptide. Mediates nitrate uptake signaling. |
| AT5G49760 | Leucine rich receptor kinase. Encodes a receptor of extracellular reactive oxygen species. |
| AT5G49780 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G49970 | encodes the bifunctional pyridoxine (pyridoxamine) 5?-phosphate oxidase (PPOX)(EC 1.4.3.5) that is involved in the formation of pyridoxal 5'-phosphate (member of the vitamin B6 group). NAD(P)HX epimerase (AT5G49970) interconverts the two epimers of NAD(P)HX. |
| AT5G50300 | Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2). |
| AT5G50360 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G50375 | Converts pentacyclic cyclopropyl sterols to conventional tetracyclic sterols. CPI1 function during and just after division and support gravitropism by establishing polar PIN2 localization. Required for endocytosis of PIN2 |
| AT5G50790 | Encodes a member of the SWEET sucrose efflux transporter family proteins. Transcriptionally activated by long photoperiods; activation depends on FT and SOC1. The ectopic expression of SWEET10 causes early flowering and leads to higher levels of transcription of flowering-time related genes in the shoot apex. |
| AT5G50860 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G50960 | Highly similar to Saccharomyces cerevisiae NBP35, locus YGL091C. Cytosolic protein that homodimerizes and can assemble both 4Fe-4S - type and 2Fe-2S - type clusters on its amino terminal and carboxy therminal respectively. Null mutants are embryo lethal. |
| AT5G51020 | Encodes CRL (CRUMPLED LEAF), a protein localized in the outer envelope membrane of plastids. Mutation in this gene affects the pattern of cell division, cell differentiation and plastid division. |
| AT5G51110 | Encodes a protein involved in Rubisco assembly that also mediates Abscisic acid-dependent stress response. It is a ubiquitination target of the intracellular E3 ligase SDIR1. It selectively regulates the expression of the downstream basic region/leucine zipper motif transcription factor gene ABA-INSENSITIVE5, rather than ABA-RESPONSIVE ELEMENTS BINDING FACTOR3 (ABF3) or ABF4, to regulate ABA-mediated seed germination and the plant salt response. |
| AT5G51250 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G51260 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT5G51320 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42556.1);(source:TAIR10) |
| AT5G51330 | Encodes novel protein involved in sister chromatid cohesion and meiotic chromosome organization during both male and female meiosis. Gene has two alternate transcripts which produce two similar proteins, one 57 aa shorter than the other. |
| AT5G51360 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT5G51410 | LUC7 N terminus domain-containing protein;(source:Araport11) |
| AT5G51440 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT5G51470 | Auxin-responsive GH3 family protein;(source:Araport11) |
| AT5G51530 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT5G51800 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G51920 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT5G51930 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT5G52050 | MATE efflux family protein;(source:Araport11) |
| AT5G52055 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-30 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G52170 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT5G52250 | Encodes a transducin protein whose gene expression is induced by UV-B. This induction is reduced in hy5 mutant and may be a target of HY5 during UV-B response. Functions as a repressor of UV-B signaling. |
| AT5G52260 | Member of the R2R3 factor gene family. |
| AT5G52270 | SNARE-like superfamily protein;(source:Araport11) |
| AT5G52310 | cold regulated gene, the 5' region of cor78 has cis-acting regulatory elements that can impart cold-regulated gene expression The mRNA is cell-to-cell mobile. |
| AT5G52340 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G52350 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G52355 | pre-tRNA tRNA-Ser (anticodon: TGA);(source:Araport11, TAIR10) |
| AT5G52420 | transmembrane protein;(source:Araport11) |
| AT5G52450 | MATE efflux family protein;(source:Araport11) |
| AT5G52480 | RNI-like superfamily protein;(source:Araport11) |
| AT5G52490 | Fibrillarin family protein;(source:Araport11) |
| AT5G52520 | Encodes a chloroplast and mitochondria localized prolyl-tRNA synthetase. |
| AT5G52530 | dentin sialophosphoprotein-like protein;(source:Araport11) |
| AT5G52560 | Encodes a protein with UTP:sugar 1-phosphate uridylyltransferase activity, which has been shown to use a wide range of substrates including glucose-1-P, galactose-1-P, xylose-1-P, arabinose-1-P and glucuronate-1-P. The enzyme was shown to require Mg2+ or Mn2+ for activity. Mutations in USP can lead to a complete loss of male fertility. |
| AT5G52640 | Encodes a cytosolic heat shock protein AtHSP90.1. AtHSP90.1 interacts with disease resistance signaling components SGT1b and RAR1 and is required for RPS2-mediated resistance. The mRNA is cell-to-cell mobile. |
| AT5G52690 | Copper transport protein family;(source:Araport11) |
| AT5G52780 | Chloroplast NAD(P)H dehydrogenase complex assembly factor. |
| AT5G52860 | ABC-2 type transporter family protein;(source:Araport11) |
| AT5G52880 | F-box family protein;(source:Araport11) |
| AT5G52890 | AT hook motif-containing protein;(source:Araport11) |
| AT5G52930 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G52940 | DUF295 domain protein. |
| AT5G53030 | hypothetical protein;(source:Araport11) |
| AT5G53040 | Encodes GROUNDED (GRD), a putative RWP-RK-type transcription factor broadly expressed in early development. GRD promotes zygote elongation and basal cell fates. |
| AT5G53100 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G53230 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G53240 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G53250 | arabinogalactan protein 22;(source:Araport11) |
| AT5G53290 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT5G53300 | Encodes a ubiquitin conjugating enzyme. |
| AT5G53380 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
| AT5G53420 | Member of ASML2 family of CCT domain proteins.There is a preferential accumulation of RNA isoforms CCT101.1 and CCT101.2 in response to N-treatment, each isoform has different targets. |
| AT5G53430 | Homology Subgroup III; Orthology Group 2 - A putative histone methyltransferase (predicted to methylate H3K4) related to the Drosophila trithorax group proteins TRX and TRR and the yeast gene SET1. A plant line expressing an RNAi construct directed against this gene has reduced agrobacterium-mediated tumor formation. |
| AT5G53470 | Encodes an acyl-CoA binding protein that is localized to vesicles,and plasma membrane especially in epidermal cells of heart, torpedo and cotyledon stage embryos, cell wall of the seed coat. Northern blot analysis showed that the 1.4 kb ACBP1 mRNA was expressed in silique, root, stem, leaf and flower. |
| AT5G53510 | oligopeptide transporter |
| AT5G53520 | Encodes an oligopeptide transporter. Target promoter of the male germline-specific transcription factor DUO1. |
| AT5G53550 | YELLOW STRIPE like 3;(source:Araport11) |
| AT5G53592 | FBD-like domain family protein;(source:Araport11) |
| AT5G53635 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G53680 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G53700 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G53770 | Nucleotidyltransferase family protein;(source:Araport11) |
| AT5G53775 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.4e-39 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
| AT5G53780 | F-box protein, putative (DUF295);(source:Araport11) |
| AT5G53800 | nucleic acid-binding protein;(source:Araport11) |
| AT5G53820 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT5G53830 | VQ motif-containing protein;(source:Araport11) |
| AT5G53870 | early nodulin-like protein 1;(source:Araport11) |
| AT5G53890 | Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of phytosulfokine (PSK), which is a 5-aa tyrosine-sulfated peptide that primarily promotes cellular proliferation. |
| AT5G53960 | Mid-1-related chloride channel domain-containing protein;(source:Araport11) |
| AT5G54010 | Encodes a flavonoid 3-O-glucoside:2″-O-glucosyltransferase that determines pollen-specific flavonol structure. |
| AT5G54045 | pseudogene of UF3GT |
| AT5G54060 | Encodes a anthocyanin 3-O-glucoside: 2"-O-xylosyl-transferase involved in anthocyanin modification that converts cyanidin 3-O-glucoside to cyanidin 3-O-xylosyl(1->2)glucoside. Its preferred sugar donor is UDP-xylose. |
| AT5G54070 | A member of Heat Stress Transcription Factor (Hsf) family. Not responding to heat stress. Is regulated by the seed-specific transcription factor ABI3. In turn, it regulates other heat stress proteins including Hsp17.4-CI, Hsp17.7-CII and Hsp101 during seed maturation. |
| AT5G54100 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT5G54130 | Calcium-binding endonuclease/exonuclease/phosphatase family;(source:Araport11) |
| AT5G54190 | light-dependent NADPH:protochlorophyllide oxidoreductase A |
| AT5G54210 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G54230 | MYB49 transcription factor. Binds to and promotes expression of genes involved in cadmium accumulation. Interacts with ABI5 which acts as a repressor preventing MYB49 induced expression of target genes. |
| AT5G54240 | membrane lipoprotein lipid attachment site-like protein, putative (DUF1223);(source:Araport11) |
| AT5G54320 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G54330 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G54340 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT5G54370 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
| AT5G54390 | Encodes a 3'-phosphoadenosine-5'-phosphate (PAP) phosphatase that is sensitive to physiological concentrations of Na+. It does not also act as inositol polyphosphate 1-phosphatases, which other members of the HAL2-like family do. It is proposed that AHL acts in concert with sulphotransferases to prevent both the toxicity of PAP on RNA processing enzymes as well as the product inhibition of PAP on sulphate conjugation. The mRNA is cell-to-cell mobile. |
| AT5G54400 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G54450 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G54480 | hypothetical protein (DUF630 and DUF632);(source:Araport11) |
| AT5G54540 | Uncharacterized conserved protein (UCP012943);(source:Araport11) |
| AT5G54550 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G54560 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G54585 | hypothetical protein;(source:Araport11) |
| AT5G54640 | Isolated from T-DNA insertion line, the rat5 mutant is deficient in T-DNA integration. Encodes histone2A protein. |
| AT5G54730 | yeast autophagy 18 F-like protein;(source:Araport11) |
| AT5G54770 | Encodes a thiamine biosynthetic gene that has a dual function in thiamine biosynthesis and mitochondrial DNA damage tolerance. It appears to be involved in producing the thiazole portion of thiamine (vitamin B1). A crystal structure of the protein reveals that it forms a 2-ring homo-octamer. The mRNA is cell-to-cell mobile. |
| AT5G54910 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT5G54930 | AT hook motif-containing protein;(source:Araport11) |
| AT5G54990 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G55120 | Encodes a GDP-L-galactose phosphorylase, with similar biochemical properties as VTC2. |
| AT5G55150 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT5G55200 | Co-chaperone GrpE family protein;(source:Araport11) |
| AT5G55270 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G55320 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT5G55330 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT5G55420 | Encodes a Protease inhibitor/seed storage/LTP family protein [pseudogene] |
| AT5G55490 | Encodes a transmembrane domain containing protein that is expressed in pollen germ cells. |
| AT5G55780 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G55835 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAAAGAGAGCAC |
| AT5G55900 | Sucrase/ferredoxin-like family protein;(source:Araport11) |
| AT5G55940 | Uncharacterized protein family (UPF0172);(source:Araport11) |
| AT5G55980 | serine-rich protein-like protein;(source:Araport11) |
| AT5G55990 | Encodes a member of the Arabidopsis CBL (Calcineurin B-like Calcium Sensor) protein family. |
| AT5G56050 | late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G56110 | Encodes a member of the R2R3 MYB transcription factor gene family that is required for anther development by regulation tapetum development, callose dissolution and exine formation. It acts upstream of MS2. |
| AT5G56150 | ubiquitin-conjugating enzyme 30;(source:Araport11) |
| AT5G56200 | Encodes a transcription factor expressed in the female gametophyte. |
| AT5G56320 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT5G56350 | Pyruvate kinase family protein;(source:Araport11) |
| AT5G56390 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G56452 | FBD-like domain family protein;(source:Araport11) |
| AT5G56460 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G56470 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT5G56570 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G56630 | phosphofructokinase 7;(source:Araport11) |
| AT5G56770 | transcription repressor-like protein;(source:Araport11) |
| AT5G56820 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G56830 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.7e-14 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT5G56850 | hypothetical protein;(source:Araport11) |
| AT5G56880 | hypothetical protein;(source:Araport11) |
| AT5G56960 | basic helix-loop-helix (bHLH) DNA-binding family protein;(source:Araport11) |
| AT5G56990 | proteinase inhibitor I25, cystatin, motif protein;(source:Araport11) |
| AT5G57020 | Arabidopsis thaliana myristoyl-CoA:protein N-myristoyltransferase. |
| AT5G57060 | 60S ribosomal L18a-like protein;(source:Araport11) |
| AT5G57070 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G57080 | transmembrane protein;(source:Araport11) |
| AT5G57140 | purple acid phosphatase 28;(source:Araport11) |
| AT5G57160 | Encodes the Arabidopsis orthologue of the yeast and mammalian DNA ligase IV. Involved in the repair of DNA damage but, unlike in yeast, not required for T-DNA integration. Interacts with the Arabidopsis homologue of XRCC4. |
| AT5G57260 | putative cytochrome P450 |
| AT5G57345 | OXR is a single copy gene in Arabidopsis. It is localized to the ER. It is expressed throughout the plant and expression is induced in response to abiotic stress. While the function of OXR is unknown, overexpression results in increased abiotic stress tolerance and increased ascorbic acid content. |
| AT5G57420 | Belongs to auxin inducible gene family. |
| AT5G57490 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. |
| AT5G57510 | cotton fiber protein;(source:Araport11) |
| AT5G57540 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. |
| AT5G57570 | GCK domain-containing protein;(source:Araport11) |
| AT5G57590 | Encodes a bifunctional enzyme with both dethiobiotin synthetase and diaminopelargonic acid aminotransferase activities that is involved in biotin synthesis. |
| AT5G57620 | MYB36 is a transcriptional regulator that acts to promote differentiation of the endodermis during root development. It promotes the development the Casparian band in part by regulating the expression of genes involved in localizing lignin biosynthetic machinery to the Casparian band. MYB36 binds to and regulates the expression of factors involved in producing the Casparian band including CASP1, PER64, and ESB1. |
| AT5G57670 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G57720 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G57760 | hypothetical protein;(source:Araport11) |
| AT5G57770 | FORKED-LIKE family member, part of Group 2 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT5G57960 | GTP-binding protein, HflX;(source:Araport11) |
| AT5G58050 | Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family. |
| AT5G58070 | Encodes a temperature-induced lipocalin TIL1. Involved in thermotolerance. Peripherally associated with plasma membrane. |
| AT5G58210 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G58412 | Encodes a Plant thionin family protein |
| AT5G58460 | member of Putative Na+/H+ antiporter family |
| AT5G58580 | Encodes a functional E3 ligase that is involved in membrane trafficking and regulation of salt stress responses. It is localized to membranes including the plasma membrane, pre-vacuolar compartments and Golgi. |
| AT5G58610 | PHD finger transcription factor;(source:Araport11) |
| AT5G58640 | Selenoprotein, Rdx type;(source:Araport11) |
| AT5G58670 | phosphatidylinositol-specific phospholipase C is induced to a significant extent under various environmental stresses, such as dehydration, salinity, and low temperature. May play a role in secondary ABA response. There are two genes called ATPLC1, one corresponding to AT4g38530 and one corresponding ot AT5g58670 (this one). |
| AT5G58750 | Putative PRISE (progesterone 5β-reductase and/or iridoid synthase-like 1,4-enone reductases). |
| AT5G58770 | AtCPT7 synthesizes medium-chain polyprenols of approximately 55 carbons in length. The enzyme utlizes geranylgeranyl pyrophosphate (GGPP) and isopentenyl pyrophosphate (IPP) as substrates. The enzymatic product accumulates into plastdial membranes (DOI:10.1105/tpc.16.00796). |
| AT5G58820 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT5G58830 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT5G58840 | Subtilase family protein;(source:Araport11) |
| AT5G58850 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB119). |
| AT5G58890 | AGAMOUS-like 82;(source:Araport11) |
| AT5G58910 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G59000 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT5G59090 | subtilase 4.12;(source:Araport11) |
| AT5G59100 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT5G59110 | subtilisin-like serine protease-like protein;(source:Araport11) |
| AT5G59120 | SBT4.13 subtilase. Activity is inhibited by SPI-1. |
| AT5G59130 | Subtilase family protein;(source:Araport11) |
| AT5G59190 | subtilase family protein;(source:Araport11) |
| AT5G59340 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. WOX2 has a putative Zinc finger domain downstream of the homeodomain. Transcripts are expressed in the egg cell, the zygote and the apical cell lineage and are reduced in met3-1 early embryos. This gene is necessary for cell divisions that form the apical embryo domain. |
| AT5G59430 | Encodes a telomeric repeat binding protein with a DNA binding domain at its C terminus. The DNA binding domain has a preference for GGTTTAG sequences and at least five of these repeats are required for recognition by a nearly full-length TRP1 protein. |
| AT5G59450 | GRAS family transcription factor;(source:Araport11) |
| AT5G59570 | Encodes BOA (BROTHER OF LUX ARRHYTHMO), a component of the circadian clock. The mRNA is cell-to-cell mobile. |
| AT5G59580 | UDP-glucosyl transferase 76E1;(source:Araport11) |
| AT5G59600 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G59670 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G59680 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G59780 | Encodes a putative transcription factor (MYB59). In roots it is involved in K+/NO3- transport and expression of the NPF7.3 transporter. |
| AT5G59800 | Encodes a protein containing a methyl-CpG-binding domain that acts as an anti-silencing factor that prevent gene repression and DNA hypermethylation by tethering other anti-silencing factors to methylated DNA, which enables the function of DNA demethylases that in turn limit DNA methylation and prevent transcriptional gene silencing. |
| AT5G59820 | Encodes a zinc finger protein involved in high light and cold acclimation. Overexpression of this putative transcription factor increases the expression level of 9 cold-responsive genes and represses the expression level of 15 cold-responsive genes, including CBF genes. Also, lines overexpressing this gene exhibits a small but reproducible increase in freeze tolerance. Because of the repression of the CBF genes by the overexpression of this gene, the authors speculate that this gene may be involved in negative regulatory circuit of the CBF pathway. The mRNA is cell-to-cell mobile. |
| AT5G60010 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
| AT5G60020 | LAC17 appears to have laccase activity based on enzyme assays performed using lac17 mutants. Notably, these mutants appear to have a reduced deposition of G lignin units. LAC17 is expressed in interfascicular fibers and likely contributes to lignin biosynthesis, and hence, cell wall biosynthesis, there. |
| AT5G60060 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT5G60080 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G60110 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G60180 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G60190 | Encodes a protein that can cleave residues from the C-terminus of RUB1 to prepare it for conjugation to target proteins. |
| AT5G60200 | Encodes a Dof-type transcription factor. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT5G60350 | hypothetical protein;(source:Araport11) |
| AT5G60360 | Encodes a senescence-associated thiol protease. The mRNA is cell-to-cell mobile. |
| AT5G60490 | Encodes a member of fasciclin-like arabinogalactan proteins (FLAs) containing a cell adhesion fasciclin (FAS) domain. Mutations result in altered stem biomechanics with reduced tensile strength and reduced tensile modulus of elasticity, as well as altered cell wall architecture and composition, with increased cellulose microfibril angle, reduced arabinose, galactose and cellulose content. Possibly involved in embryogenesis and seed development. |
| AT5G60510 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
| AT5G60520 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
| AT5G60530 | Root tip expressed LEA protein involved in ribosome biogenesis. |
| AT5G60570 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G60710 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT5G60740 | ABC transporter family protein. Localizes to the growing tip of pollen tubes where it appears to be critical for localizing polyamines and reactive oxygen species. |
| AT5G60780 | member of High affinity nitrate transporter family |
| AT5G60790 | Member of GCN subfamily; essential for translation inhibition under cold stress through interacting with GCN2 to phosphorylate eukaryotic translation initiation factor 2. GCN1 regulated gens are involved in flower development, seed dormancy and seed development, response to osmotic stress, amino acid biosynthesis, photosynthesis, cell wall organization, protein transport and localization, lipid biosynthesis, transcription, macroautophagy, proteolysis and cell death. |
| AT5G60850 | Encodes a zinc finger protein. |
| AT5G60870 | Encodes a mitochondrial protein RUG3 that is required for accumulation of mitochondrial respiratory chain complex I. RUG3 is related to human REGULATOR OF CHROMOSOME CONDENSATION 1 (RCC1) and Arabidopsis UV-B RESISTANCE 8 (UVR8). |
| AT5G60900 | Encodes a receptor-like protein kinase. |
| AT5G61030 | Encodes a glycine-rich RNA binding protein that is involved in C-> U RNA editing in mitochondria. Gene expression is induced by cold. The mRNA is cell-to-cell mobile. |
| AT5G61050 | histone deacetylase-related / HD-like protein;(source:Araport11) |
| AT5G61090 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT5G61100 | PHD finger-containing protein. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
| AT5G61250 | Belongs to the plant glycoside hydrolase family 79. Encodes a protein with several posttranslational modification sites including O-β-GlcNAc attachment sites and serine-, threonine- and tyrosine-phosphorylation sites, suggesting that this protein is extensively modified posttranslationally. The protein is predicted (WoLF PSORT program) to be secreted. |
| AT5G61260 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
| AT5G61280 | Remorin family protein;(source:Araport11) |
| AT5G61350 | Encodes a membrane-localized receptor-like kinase that regulates root hair tip growth by maintaining cytoplasmic Ca2+ gradients. Knockouts of CAP1 produced more cytoplasmic NH4+ and ceased growth of root hairs on MS medium except when NH4+ was depleted; NH4+ depletion reestablished the Ca2+ gradient necessary for normal growth. The lower net NH4+ influx across the vacuolar membrane and relatively alkaline cytosolic pH of root hairs in cap1-1 relative to wild type implied that mutation of CAP1 results in more NH4+ accumulation in the cytoplasm. Furthermore, CAP1 functionally complemented npr1 kinase yeast mutant defective in high-affinity NH4+ uptake via MEP2, distinguishing CAP1 as a cytosolic modulator of NH4+ level that participates in NH4+ homeostasis-regulated root hair growth by modulating tip-focused cytoplasmic Ca2+ gradients. |
| AT5G61420 | Encodes a nuclear localized member of the MYB transcription factor family. Involved in positive regulation of aliphatic glucosinolate biosynthesis.Expression is induced by touch, wounding and glucose. |
| AT5G61560 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G61600 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture. |
| AT5G61620 | myb-like transcription factor family protein;(source:Araport11) |
| AT5G61700 | ABC2 homolog 16;(source:Araport11) |
| AT5G61710 | cotton fiber protein;(source:Araport11) |
| AT5G61720 | hypothetical protein (DUF1216);(source:Araport11) |
| AT5G61750 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT5G61800 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G61900 | Encodes a plasma-membrane localized, copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Mutants exhibit temperature-sensitive growth defects and increased hypersensitive response where permissive conditions are low temperature (22 degrees Celsius) and low humidity. Gene is expressed at 22 but not at 28 (restrictive condition) degrees. Lethality of double mutants with BON3 can be partially suppressed by SNC1. Double mutants show defects in development that are genetically separable from hypersensitive/cell death response. |
| AT5G62065 | Encodes a Protease inhibitor/seed storage/LTP family protein. Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT5G62100 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT5G62230 | Encodes a receptor-like kinase that, together with ER and ERL2 governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. It is important for maintaining stomatal stem cell activity and preventing terminal differentiation of the meristemoid into the guard mother cell. Along with erl2 functionally compensates for loss of erecta during integument development. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT5G62300 | Ribosomal protein S10p/S20e family protein;(source:Araport11) |
| AT5G62480 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT5G62490 | Part of the AtHVA22 family. Protein expression is ABA- and stress-inducible. |
| AT5G62520 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Up-regulated by NaCl. SRO5 and P5CDH (an overlapping gene in the antisense orientation) generate 24-nt and 21-nt siRNAs, which together are components of a regulatory loop controlling reactive oxygen species (ROS) production and stress response. |
| AT5G62627 | Encodes a defensin-like (DEFL) family protein. |
| AT5G62630 | hipl2 protein precursor;(source:Araport11) |
| AT5G62700 | encodes tubulin beta-2/beta-3 chain The mRNA is cell-to-cell mobile. |
| AT5G62720 | Integral membrane HPP family protein. Putative nitrate transporter. |
| AT5G62730 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G62820 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT5G62860 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT5G62865 | hypothetical protein;(source:Araport11) |
| AT5G62920 | Encodes a Type-A response regulator that is responsive to cytokinin treatment. Its C-ter domain is very short in comparison to other Arabidopsis ARRs (17 total). Arr6 protein is stabilized by cytokinin. |
| AT5G62940 | HCA2 induces the formation of interfascicular cambium and regulates vascular tissue development in the aerial parts of the plant. Evidence from both gain of function and dominant negative alleles. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT5G62960 | UDP-N-acetylglucosamine-N-acetylmuramyl-pyrophosphoryl-undecaprenol N-acetylglucosamine protein;(source:Araport11) |
| AT5G62970 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
| AT5G63087 | Encodes a Plant thionin family protein |
| AT5G63130 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G63160 | BTB and TAZ domain protein. Short-lived nuclear-cytoplasmic protein targeted for degradation by the 26S proteosome pathway. Acts redundantly with BT2 and BT3 during female gametophyte development. |
| AT5G63410 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G63450 | AtWRKY33 regulates root apoplastic barrier formation by controlling AtCYP94B1 leading to increased salt tolerance of Arabidopsis plants. Regulation by WRKY33 to control apoplastic barrier formation in roots to confer salt tolerance. |
| AT5G63600 | encodes a protein whose sequence is similar to flavonol synthase |
| AT5G63690 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT5G63700 | zinc ion binding / DNA binding protein;(source:Araport11) |
| AT5G63710 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G63720 | Encodes KOKOPELLI (KPL). kokopelli (kpl) mutants display frequent single-fertilization events indicating that KPL is involved in double fertilization. KPL and an inversely transcribed gene, ARIADNE14 (ARI14), which encodes a putative ubiquitin E3 ligase, generate a sperm-specific natural cis-antisense siRNA pair. In the absence of KPL, ARI14 RNA levels in sperm are increased and fertilization is impaired. |
| AT5G63810 | member of Glycoside Hydrolase Family 35 |
| AT5G63850 | Amino acid transporter whose expression is downregulated by dehydration. |
| AT5G63860 | UV-B-specific signaling component that orchestrates expression of a range of genes with vital UV-protective functions. Located in the nucleus and the cytosol. Associates with chromatin via histones. UV-B light promotes URV8 protein accumulation in the nucleus. UVR8 interaction with COP1 is negatively regulated by RUP1 and RUP2. |
| AT5G63900 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
| AT5G64000 | 3'(2'),5'-bisphosphate nucleotidase |
| AT5G64060 | NAC domain containing protein 103;(source:Araport11) |
| AT5G64190 | neuronal PAS domain protein;(source:Araport11) |
| AT5G64250 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT5G64420 | DNA polymerase V family;(source:Araport11) |
| AT5G64490 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G64650 | Ribosomal protein L17 family protein;(source:Araport11) |
| AT5G64667 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
| AT5G64740 | Encodes a cellulose synthase isomer. CESA6 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA6, along with CESA1 and CESA3 are present in the same plasma membrane complex for cellulose biosynthesis. CESA2 and CESA5 are related to CESA6, having partially redundant roles. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. The mRNA is cell-to-cell mobile. |
| AT5G64770 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
| AT5G64790 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G64830 | programmed cell death 2 C-terminal domain-containing protein;(source:Araport11) |
| AT5G64855 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
| AT5G65090 | Encodes a protein involved in root hair morphogenesis and tip growth. Required for restricting both the size of the root-hair initiation site and the width of the root hairs during the transition to tip growth, but, apparently, is not required for normal subsequent tip growth. |
| AT5G65100 | Ethylene insensitive 3 family protein;(source:Araport11) |
| AT5G65110 | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. |
| AT5G65130 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT5G65160 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G65330 | AGAMOUS-like 78;(source:Araport11) |
| AT5G65380 | MATE efflux family protein;(source:Araport11) |
| AT5G65660 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G65790 | Encodes a MYB family protein with N-terminal R2R3 DNA-binding domains involved in root development. |
| AT5G65800 | 1-aminocyclopropane-1-carboxylate synthase (ACS) is encoded by a multigene family consisting of at least five members whose expression is induced by hormones, developmental signals, and protein synthesis inhibition. |
| AT5G65990 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G66020 | Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. non-consensus AT donor splice site at exon 7, TA donor splice site at exon 10, AT acceptor splice at exon 13. |
| AT5G66052 | transmembrane protein;(source:Araport11) |
| AT5G66160 | Encodes a receptor homology region transmembrane domain, ring H2 motif protein involved in transport of storage proteins to protein storage vacuoles. Localized to endoplasmic reticulum and co-localizes with DIP positive vesicles and to the trans-golgi network when complexed with RMR2. |
| AT5G66260 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G66410 | Encodes a protein that functions in microtubule assembly. Plants with reduced levels of both PLP3a (At3g50960) and PLP3b show defects in cytokinesis, cortical microtubule array formation, oriented cell growth, and maintenance of proper ploidy. |
| AT5G66480 | bacteriophage N4 adsorption B protein;(source:Araport11) |
| AT5G66570 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO1 is the major isoform in the wild-type. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the membrane. The mRNA is cell-to-cell mobile. |
| AT5G66607 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G66660 | pectinesterase, putative (DUF677);(source:Araport11) |
| AT5G66670 | pectinesterase, putative (DUF677);(source:Araport11) |
| AT5G66790 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G66880 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. The mRNA is cell-to-cell mobile. |
| AT5G67090 | Encodes a subtilisin-like serine protease with in vitro protease activity. |
| AT5G67310 | member of CYP81G |
| AT5G67460 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G67540 | Arabinanase/levansucrase/invertase;(source:Araport11) |
| AT5G67570 | Encodes a pentratricopeptide repeat containing protein that is targeted to the chloroplast. Mutants have pale young leave and reduced accumulation of plastid encoded transcripts suggesting a role for DG1 in regulation of plastid gene expression. |
| AT5G67640 | hypothetical protein;(source:Araport11) |