AT1G01046 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUUCUUCUACUUCUUGCACA |
AT1G01070 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
AT1G01120 | Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis. |
AT1G01130 | CBL-interacting Serine/Threonine-kinase;(source:Araport11) |
AT1G01140 | Encodes a CBL-interacting protein kinase with similarity to SOS2 |
AT1G01150 | Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
AT1G01180 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G01190 | cytochrome P450, family 78, subfamily A, polypeptide 8;(source:Araport11) |
AT1G01220 | Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis. |
AT1G01260 | bHLH13 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH14 and bHLH17 to negatively regulate jasmonate responses. |
AT1G01305 | hypothetical protein;(source:Araport11) |
AT1G01320 | Encodes REDUCED CHLOROPLAST COVERAGE 1 (REC1) a protein with similarity to the FLOURY locus in maize. Located in the nucleus and cytosol. Contributes to establishing the size of the chloroplast compartment. |
AT1G01380 | ETC1 is involved in trichome and root hair patterning in Arabidopsis. |
AT1G01390 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT1G01410 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT1G01430 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers.Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT1G01480 | a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family, isolated from a flower-specific cDNA library. |
AT1G01490 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT1G01500 | Erythronate-4-phosphate dehydrogenase family protein;(source:Araport11) |
AT1G01510 | Encodes a homolog of human CtBP. Mutant has longer and thicker leaves than wild type. Involved in controlling polar cell expansion in the leaf width direction. It has been shown to localize to cytosolic stress granules and is involved in their formation. |
AT1G01520 | RVE3 is one of eleven homologous MYB-like transcription factors in Arabidopsis and a member of the RVE8 clade. Plays a minor role in clock regulation. |
AT1G01540 | Protein kinase superfamily protein;(source:Araport11) |
AT1G01550 | Encodes a protein with no functionally characterized domains that to prevent the synthesis of a novel substance that moves from the root to the shoot, where it modifies shoot growth by interfering with auxin signaling. Synthesis and delivery of this substance requires neither phloem nor endodermis. |
AT1G01580 | Encodes the low-iron-inducible ferric chelate reductase responsible for reduction of iron at the root surface. It is likely to be the major Fe(III) chelate reductase in Arabidopsis iron metabolism. Coordinately regulated with IRT1, the major transporter responsible for high-affinity iron uptake from the soil, at both transcriptional and posttranscriptional levels. Steady state mRNA levels are regulated by several metals. Its transcription is regulated by FIT1. |
AT1G01590 | Encodes a ferric-chelate reductase that is expressed at extremely low levels in Fe deficiency-induced seedlings. |
AT1G01600 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly at highest level in mature stems and flowers. |
AT1G01610 | bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly and is functionally redundant with GPAT8. |
AT1G01630 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT1G01660 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT1G01695 | Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11) |
AT1G01700 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT1G01780 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. The mRNA is cell-to-cell mobile. |
AT1G01820 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
AT1G01830 | ARM repeat superfamily protein;(source:Araport11) |
AT1G02020 | nitroreductase family protein;(source:Araport11) |
AT1G02070 | zinc ion-binding protein;(source:Araport11) |
AT1G02250 | Encodes a member of the NAC family of transcription factors. ANAC005 contains sequences specifying both nuclear and plasma membrane targeting. Overexpression results in increased xylem differentiation suggesting ANAC005 promotes xylem formation. |
AT1G02335 | Encodes a plasodesmata-located protein involved in regulating primary root growth by controlling phloem-mediated allocation of resources between the primary and lateral root meristems. |
AT1G02400 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins but not C20 gibberellins. |
AT1G02450 | NIMIN1 modulates PR gene expression according the following model: NPR1 forms a ternary complex with NIMIN1 and TGA factors upon SAR induction that binds to a positive regulatory cis-element of the PR-1 promoter, termed LS7. This leads to PR-1 gene induction. NIMIN1 decreases transcriptional activation, possibly through its EAR motif, which results in fine-tuning of PR-1 gene expression. |
AT1G02460 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G02470 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT1G02520 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. The mRNA is cell-to-cell mobile. |
AT1G02530 | P-glycoprotein 12;(source:Araport11) |
AT1G02540 | hypothetical protein;(source:Araport11) |
AT1G02570 | transmembrane protein;(source:Araport11) |
AT1G02575 | transmembrane protein;(source:Araport11) |
AT1G02580 | Encodes the imprinted gene MEA that belongs to Polycomb Repressive Complex 2 (PRC2) and has a SET domain for methyltransferase activity and is involved in the stable transcriptional silencing of target genes. It negatively regulates seed development in the absence of fertilization. Mutations in this locus result in embryo lethality. MEA is imprinted in the endosperm. The maternal allele is expressed and the paternal allele is silent. MEA is controlled by DEMETER (DME), a DNA glycosylase required to activate MEA expression, and METHYLTRANSFERASE I (MET1), which maintains CG methylation at the MEA locus. MEA is involved in the negative regulation of its own imprinted gene expression; the effect is not only allele-specific but also dynamically regulated during seed development. In the ovule, the MEA transcripts are accumulated at their highest level before fertilization and gradually decrease after fertilization |
AT1G02610 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT1G02630 | Nucleoside transporter family protein;(source:Araport11) |
AT1G02640 | encodes a protein similar to a beta-xylosidase located in the extracellular matrix. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
AT1G02650 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G02700 | GATA transcription factor-like protein;(source:Araport11) |
AT1G02720 | Encodes a protein with putative galacturonosyltransferase activity. |
AT1G02730 | Encodes a gene similar to cellulose synthase. Knock-out mutant has reduced growth, reduced xylan level and reduced xylan synthase activity in stems.It's expression is cell cycle dependent and it appears to function in cell plate formation. |
AT1G02790 | encodes a exopolygalacturonase. |
AT1G02830 | Ribosomal L22e protein family;(source:Araport11) |
AT1G02850 | beta glucosidase 11;(source:Araport11) |
AT1G02860 | Encodes a ubiquitin E3 ligase with RING and SPX domains that is involved in mediating immune responses and mediates degradation of PHT1s at plasma membranes. Targeted by MIR827. Ubiquitinates PHT1;3, PHT1;2, PHT1;1/AtPT1 and PHT1;4/AtPT2. |
AT1G02900 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. Mediates Ca2+-dependent signaling. Regulates the splicing of flowering genes and exerts an opposite effect on the flowering time compared with FER. |
AT1G02950 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
AT1G02960 | kinetochore protein;(source:Araport11) |
AT1G02980 | encodes an Arabidopsis cullin |
AT1G03010 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT1G03020 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
AT1G03050 | Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane. |
AT1G03055 | Encodes the ortholog of rice D27. It is plastid-localized and is required for the inhibition of secondary bud outgrowth and operates on a nonmobile precursor upstream of MAX1 in the SL biosynthesis pathway. |
AT1G03120 | responsive to abscisic acid 28;(source:Araport11) |
AT1G03170 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
AT1G03230 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G03300 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
AT1G03310 | Encodes a protein with strong similarity to isoamylase (EC:3.2.1.68) however lacks critical residues known to be important for activity. Appears to co localize with ISA1 in the chloroplast isoamylase complex. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. It has been postulated that AtISA2 interacts with AtISA1 to form the Iso1 complex. |
AT1G03320 | hypothetical protein;(source:Araport11) |
AT1G03360 | Encodes a core subunit of the RNA exosome required for the processing of rRNA, several snoRNA and the degradation of aberrant transcripts. |
AT1G03390 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT1G03440 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT1G03445 | encodes a serine?threonine protein phosphatase with an N-terminal Kelch-repeat domain, which is nuclear localized and expressed preferentially in elongating cells. Genetic evidence suggest that this gene plays a redundant role (along with other members of the same gene family) in modulating growth in response to brassinosteroid. |
AT1G03457 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G03490 | NAC domain containing protein 6;(source:Araport11) |
AT1G03515 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT1G03520 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT1G03580 | pseudogene of MATH domain/coiled-coil protein;(source:Araport11) |
AT1G03590 | Protein phosphatase 2C family protein;(source:Araport11) |
AT1G03620 | ELMO/CED-12 family protein;(source:Araport11) |
AT1G03660 | Ankyrin-repeat containing protein;(source:Araport11) |
AT1G03670 | Ankyrin repeat containing protein |
AT1G03730 | pyrroline-5-carboxylate reductase;(source:Araport11) |
AT1G03740 | Protein kinase superfamily protein;(source:Araport11) |
AT1G03850 | Encodes glutaredoxin ATGRXS13, required to facilitate Botrytis cinerea infection of Arabidopsis thaliana plants. Sylvain La Camera et al (2011, PMID:21756272) reported a third splice variant in addition to the two annotated in TAIR10. It is a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
AT1G03880 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
AT1G03920 | Protein kinase family protein;(source:Araport11) |
AT1G03935 | snoRNA;(source:Araport11) |
AT1G03950 | vacuolar protein sorting-associated protein 2.3;(source:Araport11) |
AT1G03970 | encodes a basic leucine zipper G-box binding factor that can bind to G-box motifs only as heterodimers with GBF2 or GBF3. A single amino acid change can confer G-box binding as homodimers. |
AT1G03990 | Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11) |
AT1G04090 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
AT1G04100 | Auxin induced gene, IAA10 (IAA10). |
AT1G04110 | Initially identified as a mutation affecting stomatal development and distribution. Encodes a protein similar to serine proteases. |
AT1G04120 | encodes a high-affinity inositol hexakisphosphate transporter that plays a role in guard cell signaling and phytate storage. It is a member of MRP subfamily / ABC transporter subfamily C. |
AT1G04170 | protein synthesis initiation factor eIF2 gamma The mRNA is cell-to-cell mobile. |
AT1G04180 | YUCCA 9;(source:Araport11) |
AT1G04200 | dyggve-melchior-clausen syndrome protein;(source:Araport11) |
AT1G04240 | SHY2/IAA3 regulates multiple auxin responses in roots. It is induced rapidly by IAA, and has been shown to be phosphorylated by oat phytochrome A in vitro. |
AT1G04250 | Transcription regulator acting as repressor of auxin-inducible gene expression. Auxin-inducible AUX/IAA gene. Short-lived nuclear protein with four conserved domains. Domain III has homology to beta alpha alpha dimerization and DNA binding domains. Involved in auxin signaling and is a positive modulator of natural leaf senescence. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. |
AT1G04350 | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
AT1G04360 | RING/U-box superfamily protein;(source:Araport11) |
AT1G04380 | encodes a protein similar to a 2-oxoglutarate-dependent dioxygenase |
AT1G04390 | BTB/POZ domain-containing protein;(source:Araport11) |
AT1G04400 | Blue light receptor mediating blue-light regulated cotyledon expansion and flowering time. Positive regulator of the flowering-time gene CONSTANS. This gene possesses a light-induced CNT2 N-terminal homodimerisation domain.Involved in blue-light induced stomatal opening. Involved in triggering chromatin decondensation. An 80-residue motif (NC80) is sufficient to confer CRY2's physiological function. It is proposed that the PHR domain and the C-terminal tail of the unphosphorylated CRY2 form a "closed" conformation to suppress the NC80 motif in the absence of light. In response to blue light, the C-terminal tail of CRY2 is phosphorylated and electrostatically repelled from the surface of the PHR domain to form an "open" conformation, resulting in derepression of the NC80 motif and signal transduction to trigger photomorphogenic responses. Cry2 phosphorylation and degradation both occur in the nucleus.The life-time of cry2 signaling state in situ (in planta) is about 16 min. |
AT1G04440 | Member of CKL gene family (CKL-C group). |
AT1G04450 | Encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). It interacts with Rop1 and is involved in pollen tube growth and function, and exocytosis in the pollen tube tip. The protein most similar to RIC1 (family subgroup III). Gene is expressed predominantly in inflorescence and flower tissue. Interacts with ROP1 to modulate calcium ion influxes required to generate tip-focused calcium gradients.It |
AT1G04457 | Pseudogene of AT2G33450; 50S ribosomal protein L28, chloroplast (CL28) |
AT1G04490 | hypothetical protein (DUF3527);(source:Araport11) |
AT1G04500 | CCT motif family protein;(source:Araport11) |
AT1G04520 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. |
AT1G04530 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT1G04570 | Similar to plastid solute transporters. |
AT1G04580 | Encodes aldehyde oxidase AAO4 preferentially expressed in developing seeds. |
AT1G04670 | hypothetical protein;(source:Araport11) |
AT1G04710 | EC2.3.1.16 thiolase. Its transcript levels change after inducing MUTE expression in a mute background. |
AT1G04720 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
AT1G04770 | SDI2 is a member of a small family of TPR proteins in Arabidopsis. Like SDI1 it is induced by low sulfer and appears to play a role in negative regulation of glucosinolate biosynthesis. |
AT1G04870 | Encodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts. |
AT1G04910 | O-fucosyltransferase family protein;(source:Araport11) |
AT1G04920 | Encodes a sucrose-phosphate synthase whose activity is stimulated by Glc-6-P and inhibited by Pi. |
AT1G04950 | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant. |
AT1G04970 | Encodes one of the two LBP/BPI related proteins (AT1G04970/LBR-1, AT3G20270/LBR-2) that bind to LPS directly and regulate PR1 expression. Putative BPI/LBP family protein. |
AT1G04990 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT1G05000 | Encodes an atypical dual-specificity phosphatase. |
AT1G05010 | Encodes 1-aminocyclopropane-1-carboxylate oxidase |
AT1G05020 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
AT1G05040 | UBA-like domain protein;(source:Araport11) |
AT1G05085 | hypothetical protein;(source:Araport11) |
AT1G05150 | Calcium-binding tetratricopeptide family protein;(source:Araport11) |
AT1G05160 | Encodes an ent-kaurenoic acid hydroxylase, a member of the CYP88A cytochrome p450 family. |
AT1G05220 | Transmembrane protein 97, Putative;(source:Araport11) |
AT1G05260 | Encodes a cold-inducible cationic peroxidase that is involved in the stress response. In response to low temperature, RCI3 transcripts accumulate in the aerial part and in roots of etiolated seedlings but only in roots of light-grown seedlings. The mRNA is cell-to-cell mobile. |
AT1G05270 | TraB family protein;(source:Araport11) |
AT1G05300 | member of Fe(II) transporter isolog family |
AT1G05320 | myosin heavy chain, embryonic smooth protein;(source:Araport11) |
AT1G05360 | KMS2 encode a endoplasmic reticulum protein involved in the early secretory pathway. |
AT1G05385 | Encodes a Psb27 homolog involved in photosystem II biogenesis. |
AT1G05430 | Hypothetical protein, expression induced by Al. |
AT1G05460 | Encodes a protein with similarity to RNA helicases. Mutants are defective in post-transcriptional gene silencing. |
AT1G05510 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
AT1G05560 | A UDP-glucose transferase localized in the phragmoplast. It has been co-purified with the callose synthase complex and may transfer UDP-glucose from sucrose synthase to the callose synthase and thus help form a substrate channel for the synthesis of callose at the forming cell plate. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. UGT1 encodes a protein with glucosyltransferase activity with high sequence homology to UGT2 (AT1G05530). It belongs to an UGT subfamily that binds UDP-glucose but not UDP-glucuronate, UDP-galactose, or UDP-rhamnose as the glycosyl donor. UGT1 was shown to be able to use abscisic acid as glycosylation substrate in the presence of UDP-glucose. UGT1/UGT75B1 catalyzes the formation of the p-aminobenzoate-glucose ester in vitro and in vivo. It appears to be the enzyme predominantly responsible for pABA-Glc formation in Arabidopsis based on assays in leaves, flowers, and siliques. |
AT1G05570 | Encodes a callose synthase 1 catalytic subunit . Member of Glycosyltransferase Family- 48. |
AT1G05610 | Encodes the small subunit of ADP-glucose pyrophosphorylase. The small subunit is the catalytic isoform responsible for ADP-glucose pyrophosphorylase activity. The presence of the small subunit is required for large subunit stability. Two isoforms of the small subunit (ApS1 and ApS2) have been described. ApS2 is a minor small subunit isoform present in all plant tissues tested. |
AT1G05615 | B3 domain protein (DUF313);(source:Araport11) |
AT1G05620 | Encodes a cytosolic inosine nucleoside hydrolase. It forms a heterocomplex with NSH1 with almost two orders of magnitude higher catalytic efficiency for xanthosine hydrolysis than observed for NSH1 alone. Transcript levels for this gene are elevated in older leaves suggesting that it may play a role in purine catabolism during senescence. |
AT1G05680 | Encodes a UDP-glucosyltransferase, UGT74E2, that acts on IBA (indole-3-butyric acid) and affects auxin homeostasis. The transcript and protein levels of this enzyme are strongly induced by H2O2 and may allow integration of ROS (reactive oxygen species) and auxin signaling. This enzyme can also transfer glycosyl groups to several compounds related to the explosive TNT when this synthetic compound is taken up from the environment. |
AT1G05700 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
AT1G05750 | Encodes a pentatricopeptide repeat protein required for editing of rpoA and clpP chloroplast transcripts. |
AT1G05780 | Vacuolar ATPase assembly integral membrane protein VMA21-like domain-containing protein;(source:Araport11) |
AT1G05785 | Got1/Sft2-like vescicle transport protein family;(source:Araport11) |
AT1G05800 | Encodes a galactolipase. Located in the chloroplast. Involved in the initial step of jasmonic acid biosynthesis. Expressed in vegetative tissues and is necessary for the biosynthesis of basal-level JAs in vegetative tissues. |
AT1G05820 | SIGNAL PEPTIDE PEPTIDASE-LIKE 5;(source:Araport11) |
AT1G05880 | Encodes ARI12 (ARIADNE 12). ARI12 belongs to a family of `RING between RING fingers' (RBR) domain proteins with E3 ligase activity. Expression of ARI12 is induced by UV-B exposure. |
AT1G05890 | RING/U-box superfamily protein;(source:Araport11) |
AT1G05920 | B3 domain protein (DUF313);(source:Araport11) |
AT1G05940 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. |
AT1G05960 | ARM repeat superfamily protein;(source:Araport11) |
AT1G05990 | EF hand calcium-binding protein family;(source:Araport11) |
AT1G06020 | Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). |
AT1G06030 | Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). |
AT1G06040 | Encodes salt tolerance protein (STO) which confers salt tolerance to yeast cells. Fully complements calcineurin deficient yeast but does not encode a phosphoprotein phosphatase. Sequence has similarities to CONSTANS. STO co-localizes with COP1 and plays a role in light signaling.STO transcript levels are regulated by photoperiod and phtyohormones. STO competes with FLC in the regulation of floral transition genes SOC1 and FT. |
AT1G06080 | Encodes a protein homologous to delta 9 acyl-lipid desaturases of cyanobacteria and acyl-CoA desaturases of yeast and mammals. expression down-regulated by cold temperature. It is involved in the desaturation of VLCFAs to make monounsaturated VLCFAs. |
AT1G06130 | glyoxalase 2-4;(source:Araport11) |
AT1G06135 | transmembrane protein;(source:Araport11) |
AT1G06140 | Encodes MEF3 (mitochondrial editing factor 3), a PPR (pentatricopeptide repeat) protein of the E domain subclass. Functions in mitochondrial RNA editing. |
AT1G06148 | hypothetical protein;(source:Araport11) |
AT1G06170 | Encodes a bHLH transcription factor that together with bHLH010 and bHLH091 is important for the normal transcriptome of the developing Arabidopsis anther, possibly by forming a feed-forward loop with DYT1. Recognizes the TCATGTGC box to activate the expression of target genes, including ATA20, EXL4, and MEE48. |
AT1G06180 | member of MYB3R- and R2R3- type MYB- encoding genes |
AT1G06225 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT1G06270 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G06280 | LOB domain-containing protein 2;(source:Araport11) |
AT1G06340 | Plant Tudor-like protein;(source:Araport11) |
AT1G06350 | Fatty acid desaturase family protein;(source:Araport11) |
AT1G06370 | pseudogene of Alg9-like mannosyltransferase family;(source:Araport11) |
AT1G06420 | DNA ligase-like protein;(source:Araport11) |
AT1G06450 | Deadenylase. |
AT1G06490 | Encodes Callose Synthase 7 (CalS7), a phloem-specific callose synthase responsible for callose deposition in developing sieve elements during phloem formation and in mature phloem induced by wounding. |
AT1G06520 | sn-glycerol-3-phosphate 2-O-acyltransferase. Expressed in flower buds and siliques. Homozygous mutant plants are male sterile. |
AT1G06540 | hypothetical protein;(source:Araport11) |
AT1G06590 | anaphase-promoting complex subunit;(source:Araport11) |
AT1G06650 | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase The mRNA is cell-to-cell mobile. |
AT1G06670 | nuclear DEIH-box helicase (NIH) encoding a putative RNA and/or DNA helicase homologous to a group of nucleic acid helicases from the DEAD/H family with nuclear DEIH-box helicase (NIH) distinct N- and C-terminal regions that differ from animal DEIH proteins The mRNA is cell-to-cell mobile. |
AT1G06760 | winged-helix DNA-binding transcription factor family protein;(source:Araport11) |
AT1G06770 | Encodes a C3HC4 RING-domain-containing ubiquitin E3 ligase capable of interacting with DREB2A. The DRIP1-GFP fusion protein is nuclear-localized. DRIP1 seems to be involved in regulating stress-related transcriptional changes and drought tolerance. |
AT1G06840 | Homomultimers interact with cytoplasmic signaling molecule PBL27, resulting in herbivory resistance, in an ethylene-dependent manner. |
AT1G06890 | UXT3 is a member of the NST-KT subfamily of nucleotide/sugar transporters. It is localized to the golgi and functions as a UDP-Xyl transporter. |
AT1G06920 | Encodes OFP4, a member of the plant specific ovate family proteins. Members of this family have been shown to bind to KNOX and BELL- like TALE class homeodomain proteins. OFP4 interacts with KNAT7 to regulate secondary cell wall formation. |
AT1G06923 | transcription repressor OFP17-like protein;(source:Araport11) |
AT1G06970 | member of Putative Na+/H+ antiporter family |
AT1G06980 | PADRE protein |
AT1G07000 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT1G07050 | FITNESS encodes a protein with a single CCT domain and belongs to the CCT motif family genes (CMF). FITNESS acts upstream JUB1 thereby controlling H2O2 levels. FITNESS has a role in cellular redox homeostasis controlling H2O2 levels, due to changes in enzymes, metabolites and transcripts related to ROS detoxification. |
AT1G07051 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCACUCCUCUUCUUCUUGAUG |
AT1G07060 | hypothetical protein;(source:Araport11) |
AT1G07120 | CHUP1-like protein;(source:Araport11) |
AT1G07220 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
AT1G07330 | dentin sialophosphoprotein;(source:Araport11) |
AT1G07340 | sugar transporter 2;(source:Araport11) |
AT1G07390 | receptor like protein 1;(source:Araport11) |
AT1G07430 | Encodes a member of the group A protein phosphatase 2C (PP2C) family that is responsible for negatively regulating seed dormancy. |
AT1G07460 | Concanavalin A-like lectin family protein;(source:Araport11) |
AT1G07500 | SMR5 is a member of the SIAMESE-RELATED Cyclin-Dependent Kinase Inhibitor family. It is induced by ROS/oxidative stress. |
AT1G07520 | GRAS family transcription factor;(source:Araport11) |
AT1G07530 | Encodes a member of the GRAS family of transcription factors. The protein interacts with the TGA2 transcription factor and affects the transcription of stress-responsive genes. The protein is found in the nucleus and is also exported to the cytoplasm. |
AT1G07540 | Arabidopsis thaliana telomere-binding protein, putative (At1g07540) |
AT1G07570 | Protein kinase capable of phosphorylating tyrosine, serine, and threonine residues |
AT1G07610 | one of the five metallothioneins (MTs) genes identified in Arabidopsis. MTs are cysteine-rich proteins required for heavy metal tolerance. The mRNA is cell-to-cell mobile. |
AT1G07630 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
AT1G07650 | Leucine-rich repeat receptor-like kinase with extracellular malectin-like domain, which possesses cell death induction activity in plant leaves. |
AT1G07702 | snoRNA;(source:Araport11) |
AT1G07725 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT1G07747 | Encodes a Protease inhibitor/seed storage/LTP family protein |
AT1G07750 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT1G07810 | Encodes an ER-type Ca2+-pumping ATPase. The mRNA is cell-to-cell mobile. |
AT1G07850 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
AT1G07900 | LOB domain-containing protein 1;(source:Araport11) |
AT1G07920 | GTP binding Elongation factor Tu family protein;(source:Araport11) |
AT1G07990 | SIT4 phosphatase-associated family protein;(source:Araport11) |
AT1G08010 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT1G08040 | trimethylguanosine synthase (DUF707);(source:Araport11) |
AT1G08100 | Encodes a high-affinity nitrate transporter. |
AT1G08125 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G08135 | cation/H+ exchanger 6B;(source:Araport11) |
AT1G08140 | member of Putative Na+/H+ antiporter family |
AT1G08160 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT1G08180 | cyclin-dependent kinase inhibitor;(source:Araport11) |
AT1G08200 | Encodes a putative UDP-D-apiose/UPD-D-xylose synthetase. |
AT1G08230 | Codes for a H+-driven, high affinity gamma-aminobutyric acid (GABA) transporter. Localized at the plasma membrane. In planta, AtGAT1 expression was highest in flowers and under conditions of elevated GABA concentrations such as wounding or senescence. |
AT1G08310 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G08315 | ARM repeat superfamily protein;(source:Araport11) |
AT1G08320 | bZIP transcription factor family protein;(source:Araport11) |
AT1G08340 | Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11) |
AT1G08440 | aluminum activated malate transporter family protein;(source:Araport11) |
AT1G08465 | Member of the YABBY family of Arabidopsis proteins involved in the abaxial cell fate specification in lateral organs |
AT1G08500 | early nodulin-like protein 18;(source:Araport11) |
AT1G08510 | Encodes an acyl-acyl carrier protein thioesterase. Hydrolyzes primarily saturated acyl-ACPs with chain lengths that vary between 8 and 18 carbons. Involved in saturated fatty acid synthesis. Nuclear-encoded, plastid-targeted globular protein that is functional as dimer. |
AT1G08620 | Member of family of Jumonji C (JmjC)-containing demethylases, its catalytic domain exhibits both H3K4 and H3K9 demethylation activities. Together with MMD1 promotes in male meiocytes gene expression in an H3K9me3-dependent manner and thereby contributes to meiotic chromosome condensation. |
AT1G08630 | Encodes a threonine aldolase, involved in threonine degradation to glycine. Primarily expressed in seeds and seedlings. |
AT1G08640 | Encodes a choloroplast membrane protein CJD1 (Chloroplast J-like Domain 1). Predicted to contain a transit peptide, three transmembrane domains and an N-terminal J-like domain. Influences fatty acid composition of chloroplast lipids. |
AT1G08650 | Encodes a phosphoenolpyruvate carboxylase kinase that is expressed at highest levels in leaves. Expression is induced by light. The mRNA is cell-to-cell mobile. |
AT1G08730 | Encodes a class XI myosin that is involved in organelle motility, actin organization, and optimal growth of pollen tubes. |
AT1G08735 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.3e-87 P-value blast match to Q9SLM0 /314-478 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT1G08760 | CORD2 is a member of a novel and plant specific family of microtubule associated proteins. CORD1 binds microtubules via a conserved protein domain shared among family members. CORD functions may overlap;cord1 / cord2 mutants have defects in secondary cell wall pit morphology. |
AT1G08800 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
AT1G08830 | Encodes a cytosolic copper/zinc superoxide dismutase CSD1 that can detoxify superoxide radicals. Its expression is affected by miR398-directed mRNA cleavage. Regulated by biotic and abiotic stress. Activation of CSD1 in the cytoplasm involves both a CCS-dependent and -independent pathway. |
AT1G08840 | Encodes a homolog of human and yeast DNA2. Mutants have increased sensitivity to DNA damage stress. |
AT1G08890 | Major facilitator superfamily protein;(source:Araport11) |
AT1G08910 | Encodes an SP-RING domain containing protein that functions in sumolaytion and is involved in positive regulation of sulfur metabolism and stress response. |
AT1G08920 | Encodes ESL1, a transporter for monosaccharides. |
AT1G09000 | NPK1-related protein kinase 1S |
AT1G09050 | arginine-glutamic acid dipeptide repeat protein;(source:Araport11) |
AT1G09060 | JMJ24 is a nuclear localized JmjC domain containing protein. It has been shown to bind to transcribed regions AtSN1 and solo LTR and the promoter of SDC. JMJ24 appears to regulate basal levels of transcription of silenced loci in part by controlling methylation in heterochromatic regions. |
AT1G09070 | SRC2 specifically binds the peptide PIEPPPHH, and moves from ER to a vacuole fraction where it gets internalized. Involved in Protein Storage Vacuole targeting. The mRNA is cell-to-cell mobile. |
AT1G09080 | Heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
AT1G09110 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
AT1G09155 | phloem protein 2-B15;(source:Araport11) |
AT1G09160 | Protein phosphatase 2C family protein;(source:Araport11) |
AT1G09170 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
AT1G09176 | transmembrane protein;(source:Araport11) |
AT1G09190 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G09195 | Ppx-GppA phosphatase;(source:Araport11) |
AT1G09210 | Encodes one of three Arabidopsis calreticulins.Post-transcriptionally regulates together with CRT1 VAMP721/722 levels under ER stress. |
AT1G09245 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT1G09260 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G09300 | Encodes a mitochondrial protease ICP55. Alters the stability of proteins by removal of a single amino acid from their sequence. |
AT1G09310 | ABA responsive trichome formation regulator. |
AT1G09370 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G09380 | nodulin MtN21-like transporter family protein |
AT1G09390 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G09400 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
AT1G09410 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
AT1G09460 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT1G09530 | Transcription factor interacting with photoreceptors phyA and phyB. Forms a ternary complex in vitro with G-box element of the promoters of LHY, CCA1. Acts as a negative regulator of phyB signalling. It degrades rapidly after irradiation of dark grown seedlings in a process controlled by phytochromes. Does not play a significant role in controlling light input and function of the circadian clockwork. Binds to G- and E-boxes, but not to other ACEs. Binds to anthocyanin biosynthetic genes in a light- and HY5-independent fashion. PIF3 function as a transcriptional activator can be functionally and mechanistically separated from its role in repression of PhyB mediated processes. |
AT1G09540 | Encodes putative transcription factor. Mutants lack of mucilage extrusion from the seeds during imbibition. Reduced quantities of mucilage are deposited during the development of the seed coat epidermis in myb61 mutants. Expressed in guard cells,loss of function mutations show an increase in stomatal pore opening suggesting a role in ABA independent regulation of stomatal pore size. |
AT1G09560 | Encodes a plasodesmata-located protein involved in regulating primary root growth by controlling phloem-mediated allocation of resources between the primary and lateral root meristems. The mRNA is cell-to-cell mobile. |
AT1G09570 | Light-labile cytoplasmic red/far-red light photoreceptor involved in the regulation of photomorphogenesis. It exists in two inter-convertible forms: Pr and Pfr (active) and functions as a dimer.The N terminus carries a single tetrapyrrole chromophore, and the C terminus is involved in dimerization. It is the sole photoreceptor mediating the FR high irradiance response (HIR). Major regulator in red-light induction of phototropic enhancement. Involved in the regulation of de-etiolation. Involved in gravitropism and phototropism. Requires FHY1 for nuclear accumulation. |
AT1G09575 | Mitochondrial calcium channel. |
AT1G09610 | glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11) |
AT1G09650 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G09660 | RNA-binding KH domain-containing protein;(source:Araport11) |
AT1G09680 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G09700 | Encodes a nuclear dsRNA binding protein. Involved in mRNA cleavage. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin. |
AT1G09720 | Member of NET domain family of actin binding proteins. Paralog of At3g22790 (NET2A). |
AT1G09810 | evolutionarily conserved C-terminal region 11;(source:Araport11) |
AT1G09812 | multidrug resistance protein;(source:Araport11) |
AT1G09820 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT1G09850 | Arabidopsis thaliana papain-like cysteine peptidase |
AT1G09870 | histidine acid phosphatase family protein;(source:Araport11) |
AT1G09880 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
AT1G09930 | oligopeptide transporter |
AT1G09940 | Encodes glutamyl-tRNA reductase. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins |
AT1G09960 | low affinity (10mM) sucrose transporter in sieve elements (phloem) |
AT1G09970 | RLK7 belongs to a leucine-rich repeat class of receptor-likekinase (LRR-RLKs). It is involved in the control of germination speed and the tolerance to oxidant stress. The mRNA is cell-to-cell mobile. |
AT1G10040 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G10060 | encodes a mitochondrial branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. |
AT1G10070 | Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. Involved in cell wall development. |
AT1G10090 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
AT1G10130 | Encodes a golgi localized P2A-type Ca2+ ATPase involved in Mn nutrition and homeostasis. |
AT1G10140 | Uncharacterized conserved protein UCP031279;(source:Araport11) |
AT1G10190 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT1G10200 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. |
AT1G10210 | Encodes ATMPK1. Kinase is activated by wounding. |
AT1G10290 | involved in trafficking from the trans-Golgi Network to the central vacuole. The mRNA is cell-to-cell mobile. |
AT1G10300 | GTPase involved in HA - and ABA-mediated signaling pathways, particularly during defense respnses to pathogens. A truncated version of NOG1-2 has been detected in Col-0, Ler-0, Rsch-4 ecotypes. Functions similarly to the paralogous gene NOG1-1. |
AT1G10330 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G10380 | Putative membrane lipoprotein;(source:Araport11) |
AT1G10385 | Vps51/Vps67 family (components of vesicular transport) protein;(source:Araport11) |
AT1G10400 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G10417 | Encodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens. |
AT1G10455 | B3 DNA-binding domain protein;(source:Araport11) |
AT1G10460 | germin-like protein (GLP7) |
AT1G10480 | Encodes a zinc finger protein containing only a single zinc finger that acts downstream of ZFP6 in regulating trichome development by integrating GA and cytokinin signaling. |
AT1G10490 | GNAT acetyltransferase (DUF699);(source:Araport11) |
AT1G10530 | PADRE protein |
AT1G10540 | nucleobase-ascorbate transporter 8;(source:Araport11) |
AT1G10560 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
AT1G10600 | associated molecule with the SH3 domain of STAM 2;(source:Araport11) |
AT1G10610 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G10620 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT1G10650 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
AT1G10670 | One of the three genes encoding subunit A of the trimeric protein ATP Citrate Lyase. Antisense ACLA-1 plants cause a reduction in cytosolic acetyl-CoA metabolism and have upregulation of stress-related genes and down-regulation of primary metabolism and growth genes, suggesting the mutation restricts normal growth and developmental processes and puts the plant into a state of stress. |
AT1G10680 | P-glycoprotein 10;(source:Araport11) |
AT1G10690 | cyclin-dependent kinase inhibitor;(source:Araport11) |
AT1G10740 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G10750 | carboxyl-terminal peptidase, putative (DUF239);(source:Araport11) |
AT1G10760 | Encodes an α-glucan, water dikinase required for starch degradation. Involved in cold-induced freezing tolerance. Mutations that eliminate the GWD protein or affect the dikinase domain of the enzyme dramatically reduce both the amount of phosphate in the amylopectin and the rate of starch degradation. Mature leaves of these mutants accumulate amounts of starch up to seven times greater than those in wild-type leaves. NMR analysis of the mutants, suggests that the gene is specifically involved in the phosphorylation of the glucosyl residues of starch at the C6 position. |
AT1G10810 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT1G10820 | hypothetical protein (DUF3755);(source:Araport11) |
AT1G10865 | cytochrome C oxidase assembly factor;(source:Araport11) |
AT1G10870 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD4 belongs to the Class 1, together with AGD1, AGD2, and AGD3. |
AT1G10890 | arginine/glutamate-rich 1 protein;(source:Araport11) |
AT1G10960 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT1G10980 | Lung seven transmembrane receptor family protein;(source:Araport11) |
AT1G11030 | pre-tRNA tRNA-Arg (anticodon: TCG);(source:Araport11, TAIR10) |
AT1G11070 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G11110 | LisH and RanBPM domains containing protein;(source:Araport11) |
AT1G11130 | Encodes an atypical receptor-like kinase protein with a predicted extracellular domain of six leucine-rich repeats and an intracellular serine-threonine kinase domain expressed throughout the developing root but whose kinase activity is not essential for its function in vivo. Regulates expression of GLABRA2, CAPRICE, WEREWOLF, and ENHANCER OF GLABRA3. Required for floral organ shape, the development of the outer integument of ovules, and stem development. Regulates cell shape and cell division planes in the L2 layer of floral meristems and the L1-derived outer integument of ovules. Controls specification of epidermal root hairs. Participates in the coordination of cell morphogenesis between cell layers during floral development. |
AT1G11145 | hypothetical protein (DUF674);(source:Araport11) |
AT1G11160 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
AT1G11170 | lysine ketoglutarate reductase trans-splicing-like protein (DUF707);(source:Araport11) |
AT1G11210 | cotton fiber protein, putative (DUF761);(source:Araport11) |
AT1G11230 | transmembrane protein, putative (DUF761);(source:Araport11) |
AT1G11265 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.4e-253 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT1G11310 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO2 belongs to the clade IV, with AtMLO3, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in roots, in vascular system of cotyledons and young leaves,and in fruit abscission zone; it was not expressed in anthers and pollen, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). mlo resistance in A. thaliana does not involve the signaling molecules ethylene, jasmonic acid or salicylic acid, but requires a syntaxin, glycosyl hydrolase and ABC transporter. It is a novel virulence target of the P. syringae type III secreted effector HopZ2. |
AT1G11330 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G11340 | G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11) |
AT1G11380 | PLAC8 family protein;(source:Araport11) |
AT1G11410 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G11420 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. |
AT1G11440 | hypothetical protein;(source:Araport11) |
AT1G11520 | pliceosome associated protein-like protein;(source:Araport11) |
AT1G11570 | NTF2-like protein;(source:Araport11) |
AT1G11572 | Encodes a Plant thionin family protein |
AT1G11608 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT1G11620 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G11690 | BRANCHLESS TRICHOME-like protein;(source:Araport11) |
AT1G11710 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G11720 | Encodes a starch synthase that in addition to its role in starch biosynthesis also has a negative regulatory function in the biosynthesis of transient starch. The protein apparently contains a starch-binding domain (SBD). |
AT1G11770 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
AT1G11810 | Paternally expressed gene. |
AT1G11850 | transmembrane protein;(source:Araport11) |
AT1G11860 | T-protein is the aminomethyltransferase of the glycine cleavage multienzyme system GCS. |
AT1G11915 | wall-associated receptor kinase galacturonan-binding protein;(source:Araport11) |
AT1G11940 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT1G11950 | Transcription factor jumonji (jmjC) domain-containing protein;(source:Araport11) |
AT1G11960 | Calcium channel that is phosphorylated by BIK1 in the presence of PAMPS and required for stomatal immunity. |
AT1G11980 | ubiquitin-related protein 3;(source:Araport11) |
AT1G11990 | O-fucosyltransferase family protein;(source:Araport11) |
AT1G12040 | encodes a a chimeric leucine-rich repeat/extensin protein that regulates root hair morphogenesis and elongation. Null mutants develop root hairs that frequently abort, swell, or branch. Gene is expressed in root hair cells and protein is specifically localized in the wall of the hair proper. The mRNA is cell-to-cell mobile. |
AT1G12050 | Encodes a fumarylacetoacetase that converts fumarylacetoacetate to acetoacetate and fumarate and is likely to be involved in tyrosine catabolism. |
AT1G12080 | Vacuolar calcium-binding protein-like protein;(source:Araport11) |
AT1G12090 | extensin-like protein (ELP) |
AT1G12110 | Encodes NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is expressed in guard cells and function in stomatal opening. Mutants have less transpiration and are more tolerant to drought. Expressed in lateral roots. Involved in nitrate signaling which enables the plant root system to detect and exploit nitrate-rich soil patches. Comparing to the wild type, the mutant displays a strongly decreased lateral root proliferation phenotype in nitrate rich patches on growth medium. Affects flowering time via interaction with the FLC dependent flowering pathway to influence its target gene FT. |
AT1G12140 | Encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates. It is a suppressor of the bp mutant phenotype. |
AT1G12180 | 14.7 kDa heat shock-like protein;(source:Araport11) |
AT1G12211 | hypothetical protein;(source:Araport11) |
AT1G12240 | Encodes a vacuolar invertase betaFruct4. betaFruct4 is transported from the endoplasmic reticulum through the intermediate compartments as a membrane protein. The N-terminal cytoplasmic domain contains multiple sequence motifs that are involved at various stages in the trafficking of betaFruct4 from the ER to the central vacuole. The mRNA is cell-to-cell mobile. |
AT1G12244 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT1G12260 | Encodes a NAC-domain transcription factor that is expressed in developing xylem. Over expression of this protein causes ectopic secondary cell wall growth. Complements some of the cell wall defects seen in SND1/NST1 double mutants. |
AT1G12280 | Encodes a NB-LRR protein SUMM2 involved in defense response to bacterium. |
AT1G12320 | ankyrin repeat/KH domain protein (DUF1442);(source:Araport11) |
AT1G12330 | cyclin-dependent kinase-like protein;(source:Araport11) |
AT1G12340 | Cornichon family protein;(source:Araport11) |
AT1G12360 | encodes a Sec1 protein and expressed throughout the plant. physically interacts with Syntaxin1 and is required for cytokinesis. |
AT1G12370 | encodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele |
AT1G12380 | hypothetical protein;(source:Araport11) |
AT1G12390 | Cornichon family protein;(source:Araport11) |
AT1G12420 | ACT domain repeat 8;(source:Araport11) |
AT1G12430 | Encodes the kinesin-like protein PAK has an Armadillo motif tail and is involved in guard cell development in Arabidopsis (from Genbank record AF159052).However, no defect in stomatal complexes has been observed in loss of function mutations. It accumulates at the preprophase band (PPB) in a cell-cycle and microtubule-dependent manner and is most highly expressed in cells where the placement of the division plane (early embryogenesis, stomatal lineages) is critical. |
AT1G12460 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G12480 | Encodes a membrane protein with 10 predicted transmembrane helices. SLAC1 is a multispanning membrane protein expressed predominantly in guard cells that plays a role in regulating cellular ion homeostasis and S-type anion currents. SLAC1 is important for normal stomatal closure in response to a variety of signals including elevated CO2, ozone, ABA, darkness, and humidity. SLAC1:GFP localizes to the plasma membrane. |
AT1G12560 | Member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Containing a conserved root hair-specific cis-element RHE. Expressed specifically in root hair cell and involved in root hair elongation. |
AT1G12570 | Ortholog of maize IPE1 gene which is involved in pollen exine development. |
AT1G12590 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
AT1G12600 | UDP-N-acetylglucosamine (UAA) transporter family;(source:Araport11) |
AT1G12640 | Encodes a lysophosphatidylcholine acyltransferase (LPCAT). Participates in the Lands cycle in developing seeds. |
AT1G12680 | phosphoenolpyruvate carboxylase-related kinase 2;(source:Araport11) |
AT1G12710 | This gene is predicted to encode a protein with a PP2 domain. This domain in present in lectins found in squash and cucumber, suggesting that this protein could potentially have carbohydrate binding capabilities. |
AT1G12730 | GPI transamidase subunit PIG-U;(source:Araport11) |
AT1G12740 | encodes a protein with cytochrome P450 domain |
AT1G12780 | Encodes a UDP-glucose epimerase that catalyzes the interconversion of the sugar nucleotides UDP-glucose UDP-galactose via a UDP-4-keto-hexose intermediate. Responsive to stress. |
AT1G12855 | F-box family protein;(source:Araport11) |
AT1G12870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G12890 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
AT1G12930 | Ran effector. |
AT1G12990 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT1G13000 | transmembrane protein, putative (DUF707);(source:Araport11) |
AT1G13050 | proline-rich receptor-like kinase;(source:Araport11) |
AT1G13070 | putative cytochrome P450 |
AT1G13080 | cytochrome P450 monooxygenase |
AT1G13090 | putative cytochrome P450 |
AT1G13100 | putative cytochrome P450 |
AT1G13130 | Cellulase (glycosyl hydrolase family 5) protein;(source:Araport11) |
AT1G13140 | member of CYP86C |
AT1G13145 | pseudogene of expressed protein;(source:Araport11) |
AT1G13150 | member of CYP86C |
AT1G13170 | OSBP(oxysterol binding protein)-related protein 1D;(source:Araport11) |
AT1G13180 | Mutant has defect in trichome cell expansion and actin organization resulting in a distorted trichome phenotype. |
AT1G13195 | RING/U-box superfamily protein;(source:Araport11) |
AT1G13200 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G13230 | Encodes a leucine-rich repeat protein pii-2. Located in the endoplasmic reticulum/plasma membrane continuum in Arabidopsis roots. Required for growth promotion and enhanced seed production mediated by the endophytic fungus Piriformospora indica in Arabidopsis. |
AT1G13240 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
AT1G13250 | Encodes a protein with putative galacturonosyltransferase activity. |
AT1G13260 | Encodes an AP2/B3 domain transcription factor which is upregulated in response to low temperature. It contains a B3 DNA binding domain. It has circadian regulation and may function as a negative growth regulator. The mRNA is cell-to-cell mobile. |
AT1G13290 | Encodes a putative zinc finger protein (C2H2 family, type IIIA, subclass A1d) that has a WIP domain. Seedlings with mutations in DOT5 have a misaligned venation defect in their leaves and cotyledons. Additional developmental abnormalities, such as elongated petioles and aberrant phyllotaxy suggest that DOT5 is required for normal shoot and root development. |
AT1G13300 | Encodes a nuclear localized member of the GARP family of transcription factors. Involved in nitrate/phosphate signaling in roots. It is transcriptionally regulated by nitrate and post transcriptionally by phosphate and functions to integrate these two nutrient signaling pathways in the root. HRS1 and HHO2 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance. |
AT1G13310 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
AT1G13360 | hypothetical protein;(source:Araport11) |
AT1G13380 | sodium/hydrogen exchanger (DUF1218);(source:Araport11) |
AT1G13410 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G13430 | Encodes a sulfotransferase. Unlike the related ST4A protein (At2g14920), in vitro experiements show that this enzyme does not act brassinosteroids. ST4C is expressed in the roots and transcript levels rise in response to cytokinin treatment. |
AT1G13448 | Natural antisense transcript overlaps with AT1G13450;(source:Araport11) |
AT1G13470 | hypothetical protein (DUF1262);(source:Araport11) |
AT1G13485 | hypothetical protein;(source:Araport11) |
AT1G13490 | hypothetical protein (DUF1262);(source:Araport11) |
AT1G13500 | hypothetical protein (DUF1262);(source:Araport11) |
AT1G13520 | hypothetical protein (DUF1262);(source:Araport11) |
AT1G13580 | Encodes a ceramide synthase that together with LOH1 is essential for production of ceramides containing Very Long Chain Fatty acid VLCFA-Ceramides(mainly C 22 to 26). |
AT1G13590 | Encodes a phytosulfokine-alpha (PSK) precursor, a unique plant peptide growth factor first described in Asparagus. |
AT1G13600 | basic leucine-zipper 58;(source:Araport11) |
AT1G13605 | Encodes a defensin-like (DEFL) family protein. |
AT1G13608 | Encodes a defensin-like (DEFL) family protein. |
AT1G13609 | Encodes a defensin-like (DEFL) family protein. |
AT1G13620 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
AT1G13630 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G13635 | DNA glycosylase superfamily protein;(source:Araport11) |
AT1G13640 | Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11) |
AT1G13670 | hypothetical protein;(source:Araport11) |
AT1G13700 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
AT1G13710 | Encodes the cytochrome P450 CYP78A5 monooxygenase. Contributes to the generation of a growth-stimulating signal distinct from the classical phytohormones that prevents proliferation arrest, promoting organ growth. In ovules it is required for megagametogenesis, maternal control of seed size and restricting megaspore mother cell fate to a single cell. |
AT1G13740 | Encodes a member of a small plant-specific gene family whose members interact with ABI5 and appear to be involved in mediating stress responses. AFP2 mutants affect a number of ABA mediated processes such as germination and response to osmotic and sugar stress. AFP2 nuclear localization is stress dependent. |
AT1G13755 | Encodes a defensin-like (DEFL) family protein. |
AT1G13760 | hypothetical protein;(source:Araport11) |
AT1G13780 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT1G13800 | Encodes a PPR (pentatricopeptide repeat motif) protein that is essential for the initiation of zygotic embryogenesis. |
AT1G13830 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT1G13840 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
AT1G13860 | Encodes QUASIMODO2 LIKE1 (QUL1), a paralog of QUASIMODO2 (QUA2). AT1G78240 (QUA2), AT1G13860 (QUL1) and AT2G03480 (QUL2) form a clade with a possible role in plant vasculature development. |
AT1G13880 | ELM2 domain-containing protein;(source:Araport11) |
AT1G13920 | Remorin family protein;(source:Araport11) |
AT1G13970 | beta-hexosaminidase (DUF1336);(source:Araport11) |
AT1G13990 | plant/protein;(source:Araport11) |
AT1G14020 | O-fucosyltransferase family protein;(source:Araport11) |
AT1G14040 | Encodes a PHO1 homologue that is upregulated in response to Zn deficiency and is involved in Pi homeostasis in response to Zn deficiency. The mRNA is cell-to-cell mobile. |
AT1G14048 | GCK domain-containing protein;(source:Araport11) |
AT1G14080 | Encodes an alpha-(1,2)-fucosyltransferase. |
AT1G14120 | DAO2 is an IAA oxidase expressed in root caps. it is a member of a family of dioxygenase and 2OG Fe(II) oxygenase domain and DAO domain containing proteins. It is expressed specifically in root cap cells and does not appear to be the major IAA oxidase in planta. |
AT1G14130 | DAO1 is an IAA oxidase expressed in many different plant parts. it is a member of a family of dioxygenase and 2OG Fe(II) oxygenase domain and DAO domain containing proteins. It appears to be the major IAA oxidase in planta and major contributor to IAA degradation. |
AT1G14160 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT1G14200 | E3 ligase involved in the regulation of the homeostasis of sensor NLR immune receptors. |
AT1G14210 | Ribonuclease T2 family protein;(source:Araport11) |
AT1G14240 | GDA1/CD39 nucleoside phosphatase family protein;(source:Araport11) |
AT1G14250 | GDA1/CD39 nucleoside phosphatase family protein;(source:Araport11) |
AT1G14260 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT1G14270 | CAAX amino terminal protease family protein;(source:Araport11) |
AT1G14280 | Encodes phytochrome kinase substrate 2. PKS proteins are critical for hypocotyl phototropism. Forms a complex with Phot1, Phot2 and NPH3. |
AT1G14300 | ARM repeat superfamily protein;(source:Araport11) |
AT1G14310 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G14340 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
AT1G14360 | UDP-galactose transporter 3;(source:Araport11) |
AT1G14370 | Encodes protein kinase APK2a. Protein is N-myristoylated. |
AT1G14390 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G14410 | Encodes a homolog of the potato p24 protein. Binds single strand telomeric repeats. Negatively regulates telomerase activity and telomere length. |
AT1G14455 | hypothetical protein;(source:Araport11) |
AT1G14510 | Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7). |
AT1G14518 | other_RNA;(source:Araport11) |
AT1G14530 | tobamovirus multiplication-like protein (DUF1084);(source:Araport11) |
AT1G14630 | XRI1-like protein;(source:Araport11) |
AT1G14650 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein;(source:Araport11) |
AT1G14670 | Endomembrane protein 70 protein family;(source:Araport11) |
AT1G14686 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
AT1G14687 | homeobox protein 32;(source:Araport11) |
AT1G14700 | purple acid phosphatase 3;(source:Araport11) |
AT1G14710 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G14720 | member of Glycoside Hydrolase Family 16 |
AT1G14740 | Encodes a PHD-finger protein that, with TTA1, is redundantly required for MP-dependent embryonic root meristem initiation. |
AT1G14760 | Encodes a novel Arabidopsis KNOX gene that encodes a MEINOX domain but lacks the homeodomain and interacts with TALE-class homeodomain proteins to modulate their activities |
AT1G14770 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT1G14780 | MAC/Perforin domain-containing protein;(source:Araport11) |
AT1G14830 | Encodes a dynamin-like protein that is involved in mitochondrial morphogenesis and pollen development. Protein is localized as speckles in the cytoplasm, partially co-localizes with mitochondrial markers, cell plate of dividing cells, and the tip of root hairs, root cap cells, and expanding part of trichoblasts. |
AT1G14880 | PLANT CADMIUM RESISTANCE 1;(source:Araport11) |
AT1G14940 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT1G14970 | O-fucosyltransferase family protein;(source:Araport11) |
AT1G15100 | Encodes a putative RING-H2 finger protein RHA2a. |
AT1G15200 | protein-protein interaction regulator family protein;(source:Araport11) |
AT1G15215 | Encodes SHH1, a homeodomain protein required for DNA methylation. It is an atypical RNA-directed DNA methylation component, and functions in transcriptional silencing through both DNA methylation-dependent and -independent pathways. |
AT1G15290 | Encodes REDUCED CHLOROPLAST COVERAGE 3 (REC3). Contributes to establishing the size of the chloroplast compartment. |
AT1G15340 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
AT1G15385 | cotton fiber protein;(source:Araport11) |
AT1G15450 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT1G15520 | ABC transporter family involved in ABA transport and resistance to lead. Localizes to plasma membrane. Upregulated by lead. Expressed in leaves, flowers, stomata and roots. |
AT1G15560 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 3.8e-130 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G15570 | A2-type cyclin. Negatively regulates endocycles and acts as a key regulator of ploidy levels in Arabidopsis endoreduplication. Interacts physically with CDKA;1. Expressed preferentially in trichomes and young developing tissues. |
AT1G15580 | auxin induced protein |
AT1G15670 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB1, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. |
AT1G15680 | F-box family protein;(source:Araport11) |
AT1G15750 | Encodes a protein with several WD40 repeats at the C-terminus and predicted protein-protein interaction domains at the N-terminus. Together with the TOPLESS-RELATED PROTEINS (TPRs), it is thought to be involved in transcriptional repression of root-promoting genes in the top half of the embryo during the transition stage of embryogenesis. It can also interact with IAA12 through the EAR domain of IAA12 and the CTLH domain of TPL. The ability of IAA12 to repress transcription is diminished in a tpl-1 mutant background. |
AT1G15760 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
AT1G15770 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
AT1G15772 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
AT1G15850 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G15900 | transmembrane protein;(source:Araport11) |
AT1G15920 | Deadenylase. |
AT1G15950 | Encodes a cinnamoyl CoA reductase. Involved in lignin biosynthesis. The mRNA is cell-to-cell mobile. |
AT1G15960 | member of Nramp2 family |
AT1G15980 | encodes a novel subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in cyclic electron flow around photosystem I to produce ATP. |
AT1G15990 | Encodes a plasma membrane localized member of the cyclic nucleotide gated channel (CNGC) family that is essential for male reproductive fertility. |
AT1G16060 | Encodes ADAP, an AP2-domain protein that interacts with ARIA. ADAP is a positive regulator of the ABA response and is also involved in regulating seedling growth. |
AT1G16110 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. It has been shown to be localized to the cell wall. |
AT1G16120 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
AT1G16130 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
AT1G16140 | Encodes a predicted WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
AT1G16160 | WAK-like kinase The mRNA is cell-to-cell mobile. |
AT1G16170 | ephrin-A3 protein;(source:Araport11) |
AT1G16210 | coiled-coil protein;(source:Araport11) |
AT1G16225 | Target SNARE coiled-coil domain protein;(source:Araport11) |
AT1G16320 | plant/protein (DUF2358);(source:Araport11) |
AT1G16330 | core cell cycle genes |
AT1G16370 | organic cation/carnitine transporter 6;(source:Araport11) |
AT1G16380 | member of Putative Na+/H+ antiporter family |
AT1G16420 | Encodes a metacaspase (cysteine-type endopeptidase) that is involved in promoting programmed cell death in response to hydrogen peroxide (H2O2), UV light, and methyl viologen (MV). Transcript levels rise in response to UV-C, H2O2, and MV. In vitro assays demonstrate that this enzyme has a preference for cleaving after an arginine residue, and it has a pH optimum of 8.0. |
AT1G16440 | Member of AGC VIIIa Kinase gene family. Invovled in the maintenance of (p)ppGpp level to accustom plastidial gene expression to darkness. |
AT1G16470 | Encodes 20S proteasome subunit PAB1 (PAB1). |
AT1G16480 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G16489 | Natural antisense transcript overlaps with AT1G16490;(source:Araport11) |
AT1G16490 | Member of the R2R3 factor gene family. |
AT1G16515 | transmembrane protein;(source:Araport11) |
AT1G16530 | ASYMMETRIC LEAVES 2-like 9;(source:Araport11) |
AT1G16560 | Per1-like family protein;(source:Araport11) |
AT1G16570 | Encodes a encodes a putative UDP-glycosyltransferase superfamily protein belonging to the glycosyltransferase (GT) family 33 that is localized to the endoplasmic reticulum. Loss of function alleles are male sterile, with pollen tubes bursting after germination. Loss of function also causes increased callose deposition in the female gametophyte, pollen tube overgrowth and reduced transmission. |
AT1G16650 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G16680 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G16705 | p300/CBP acetyltransferase-related protein-like protein;(source:Araport11) |
AT1G16710 | Encodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC12 acetylation of the H3 or H4 peptides, suggesting that HAC12 can acetylate any of several lysines present in the peptides. |
AT1G16720 | Encodes HCF173, a protein with weak similarities to the superfamily of the short-chain dehydrogenases/reductases. HCF173 is involved in the initiation of translation of the psbA mRNA and binds a specific site in the 5' UTR of psbA mRNA. Mutants shows a high chlorophyll fluorescence phenotype (hcf) and are severely affected in the accumulation of PSII subunits. The protein HCF173 is localized in the chloroplast, where it is mainly associated with the membrane system and is part of a higher molecular weight complex with psbA mRNA as a component of this complex. |
AT1G16740 | Ribosomal protein L20;(source:Araport11) |
AT1G16760 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT1G16770 | hypothetical protein;(source:Araport11) |
AT1G16860 | Plasma membrane-localized proteins that negatively regulate cellulose synthesis by inhibiting the exocytosis of CESAs. |
AT1G16900 | Encodes the Arabidopsis ortholog of the yeast/human ALG9 catalyzing the luminal addition of two alpha-1,2 Man residues in assembling Glc3Man9GlcNAc2. |
AT1G16905 | Curculin-like (mannose-binding) lectin family protein;(source:Araport11) |
AT1G16950 | transmembrane protein;(source:Araport11) |
AT1G16960 | Ubiquitin domain-containing protein;(source:Araport11) |
AT1G16980 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active but no trehalose phosphatase (TPP)-like domain. |
AT1G17000 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active but no trehalose phosphatase (TPP)-like domain. |
AT1G17010 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT1G17020 | Encodes a novel member of the Fe(II)/ascorbate oxidase gene family; senescence-related gene. |
AT1G17080 | Ribosomal protein L18ae family;(source:Araport11) |
AT1G17130 | DUF572 domain protein involved in alternative splicing. |
AT1G17145 | RING/U-box superfamily protein;(source:Araport11) |
AT1G17160 | RBSK is a plastid localized ribokinase involved in nucleoside metabolism. It is the only member of this gene family in Arabidopsis. |
AT1G17170 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). It is involved in the detoxification of the environmental pollutant 2,4,6-trinitrotoluene. Arabidopsis plants over-expressing At1g17170 were more resistant to TNT, removed more TNT from sterile and soil-based media, and had reduced levels of glutathione when grown in the presence of TNT. |
AT1G17180 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). Detoxification of the environmental pollutant 2,4,6-trinitrotoluene. Arabidopsis plant over-expressing At1g17180 were more resistant to TNT, removed more TNT from sterile and soil-based media, and had reduced levels of glutathione when grown in the presence of TNT. |
AT1G17220 | Encodes a chloroplast localized protein with similarity to translation initiation factor 2. Can complement loss of INFB in E.coli suggesting FUG1 does function as a translation initiation factor in vivo. Identified as a suppressor of the leaf variegation mutant var2-6. Suppression is only seen in hypomorphs as complete loss of function alleles are embryo lethal. The mRNA is cell-to-cell mobile. |
AT1G17235 | This gene is predicted to encode a small protein with a DVL domain found in the DVL / RTFL protein family. Over-expression analyses using truncated versions of a related family member, ROT4, suggest that the DVL / RTF domain is involved in regulating cell proliferation. |
AT1G17250 | receptor like protein 3;(source:Araport11) |
AT1G17270 | O-fucosyltransferase family protein;(source:Araport11) |
AT1G17310 | MADS-box transcription factor family protein;(source:Araport11) |
AT1G17340 | Phosphoinositide phosphatase family protein;(source:Araport11) |
AT1G17345 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G17360 | LOW protein: protein phosphatase 1 regulatory subunit-like protein;(source:Araport11) |
AT1G17380 | jasmonate-zim-domain protein 5;(source:Araport11) |
AT1G17400 | Protein of unknown function. Similar to LAZY1, a gene required or gravitropic response in shoots and roots. Involved in determining lateral root branch angle. |
AT1G17420 | LOX3 encode a Lipoxygenase. Lipoxygenases (LOXs) catalyze the oxygenation of fatty acids (FAs). |
AT1G17430 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G17440 | Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. The gene product is an EIN3-interacting TFIID transcription factor required for proper ethylene response, including ERF1 induction. Loss of function mutants show enhanced response to ethylene. Located in nucleus and expressed throughout the plant. Required for ERF1 expression. Cytokinin-hypersensitive 1 (CKH1) mutants are characterized by rapidly growing calli with a green color at low levels of cytokinins, which are insufficient to induce such cytokinin responses in wild-type explants. It is hypothesized that CKH1 acts as a negative regulator of cytokinin signaling in Arabidopsis. |
AT1G17480 | Transient expression of Pro35S:GFP-IQD7 in leaves of N. benthamiana alters microtubule organization, in patterns similar to Pro35S:GFP-IQD8 and Pro35S:GFP-IQD6.Member of IQ67 (CaM binding) domain containing family. |
AT1G17580 | Encodes a member of the type XI myosin protein family involved in organelle trafficking and overall plant development. |
AT1G17590 | Binds directly to CCAAT cis-elements in the promoters of multiple MIR156 genes and inhibits the juvenile-to adult transition by activating transcription of these MIR156s. |
AT1G17600 | SOC3 is a TIR-NB-leucine-rich repeat (TNL) protein.Mutants suppress loss of chs2 phenotype of auto-activation of immunity. When the TIR domain of SOC3 interacts with CHS2 the binding results in temperature activation of cell death, the suppressors inhibit this interaction. |
AT1G17610 | TN-type protein that controls temperature-dependent growth and defense responses .Mutant accumulates steryl-esters at low temperatures and shows temperature dependent activation of defense responses.. |
AT1G17620 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT1G17630 | Encodes a PPR protein involved in mitochondrial functioning. Mutants suppress cell wall defects caused by C17 chemical inhibitor. Mutants are defective in cytochrome c maturation and activation of mitochondrial retrograde signalling. |
AT1G17700 | prenylated RAB acceptor 1.F1;(source:Araport11) |
AT1G17710 | Encodes a phosphoethanolamine/phosphocholine phosphatase. It is likely to be involved in the liberation of inorganic phosphate from intracellular sources. Expression is upregulated in the shoot of cax1/cax3 mutant. |
AT1G17744 | hypothetical protein;(source:Araport11) |
AT1G17760 | Encodes a homolog of the mammalian protein CstF77, a polyadenylation factor subunit. RNA 3′-end?processing factor of antisense FLC transcript. Mediates silencing of the floral repressor gene FLC. Member of CstF complex. |
AT1G17770 | Encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. A paternally expressed imprinted gene. |
AT1G17780 | ATG8A/F interacting protein containing a WxxL LIR motif at the C terminus which is essential for interaction with ATG8. Stress (abiotic or biotic) results in the formation of ATG8- and ATI3-labeled punctate structures, likely reflecting increased formation of ATG8-labeled phagophores or autophagosomes. ATI3 proteins probably act as selective autophagy receptors that target specific cellular components during the plant stress response. ATI3 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
AT1G17840 | Encodes a plasma membrane-localized ATP-binding cassette transporter, that is required for cutin transport to the extracellular matrix. The mRNA is cell-to-cell mobile. |
AT1G17910 | Wall-associated kinase family protein;(source:Araport11) |
AT1G17930 | Mobile domain protein involved in silencing of transposable elements. Loss of function affects shoot and root meristem maintenance. Interacts and functions with MAIL1 and PP7L in gene silencing. |
AT1G17940 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
AT1G17950 | putative transcription factor: R2R3-MYB transcription family |
AT1G17960 | Threonyl-tRNA synthetase;(source:Araport11) |
AT1G18130 | Class II aaRS and biotin synthetases superfamily protein;(source:Araport11) |
AT1G18140 | putative laccase, a member of laccase family of genes (with 17 members in Arabidopsis). |
AT1G18150 | Encodes mitogen-activated protein kinase 8 (MPK8). MPK8 connects protein phosphorylation, Ca2+, and ROS in the wound-signaling pathway. |
AT1G18191 | Pseudogene of AT1G18200; AtRABA6b (Arabidopsis Rab GTPase homolog A6b); GTP binding |
AT1G18270 | ketose-bisphosphate aldolase class-II family protein;(source:Araport11) |
AT1G18330 | EARLY-PHYTOCHROME-RESPONSIVE1 |
AT1G18350 | MAP kinase kinase7. Member of plant mitogen-activated protein kinase kinase group D. Negative regulator of polar auxin transport. Overexpression leads to activation of basal and systemic acquired resistance. |
AT1G18360 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G18382 | Natural antisense transcript overlaps with AT1G18380;(source:Araport11) |
AT1G18390 | Serine/Threonine kinase family catalytic domain protein;(source:Araport11) |
AT1G18400 | Encodes the brassinosteroid signaling component BEE1 (BR-ENHANCED EXPRESSION 1). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
AT1G18410 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G18490 | 2-aminoethanethiol dioxygenase, putative (DUF1637);(source:Araport11) |
AT1G18610 | Galactose oxidase/kelch repeat superfamily protein, induced by calcium. |
AT1G18620 | Member of a small gene family in Arabidopsis. Quadruple mutants in this family display defects in cell elongation. |
AT1G18700 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT1G18710 | Member of the R2R3 factor gene family. Promotes seed longevity (viability of seed over time.) Expressed in the chalazal seed coat. Overexpresion enhances resistance of seed to deterioration (PMID:32519347). |
AT1G18790 | RWP-RK domain-containing protein;(source:Araport11) |
AT1G18810 | phytochrome kinase substrate-like protein;(source:Araport11) |
AT1G18835 | Encodes a small zinc finger protein whose overexpression induces ectopic meristem formation on leaf margins. |
AT1G18840 | Member of IQ67 (CaM binding) domain containing family. |
AT1G18860 | member of WRKY Transcription Factor; Group II-b |
AT1G18879 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AUCAGUUUCUUGUUCGUUUCA |
AT1G18910 | E3 ubiquitin ligase that functions redundantly in the root with BTSL1 to negatively regulate iron uptake. |
AT1G18950 | DDT domain superfamily;(source:Araport11) |
AT1G18960 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
AT1G18970 | Encodes a germin-like protein with possible oxalate oxidase activity (based on GenBank record). |
AT1G18980 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT1G19010 | hypothetical protein;(source:Araport11) |
AT1G19020 | Modulates defense against bacterial pathogens and tolerance to oxidative stress. |
AT1G19040 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
AT1G19086 | hypothetical protein;(source:Araport11) |
AT1G19100 | Encodes a member of the conserved Microrchidia (MORC) adenosine triphosphatase (ATPase) family, predicted to catalyze alterations in chromosome superstructure. Required for heterochromatin condensation and gene silencing. |
AT1G19115 | Member of the IGT gene family. |
AT1G19160 | F-box family protein;(source:Araport11) |
AT1G19170 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G19200 | cyclin-dependent kinase, putative (DUF581);(source:Araport11) |
AT1G19230 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
AT1G19240 | transmembrane protein;(source:Araport11) |
AT1G19260 | Encodes a ceramide synthase that uses very-long- chain fatty acyl-CoA and trihydroxy LCB substrates. |
AT1G19310 | RING/U-box superfamily protein;(source:Araport11) |
AT1G19320 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT1G19330 | Evening-expressed key component of Sin3-HDAC complex, which bind directly to the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and PSEUDO-RESPONSE REGULATOR 9 (PRR9) promoters and catalyze histone 3 (H3) deacetylation at the cognate regions to repress expression, allowing the declining phase of their expression at dusk. |
AT1G19340 | Methyltransferase MT-A70 family protein;(source:Araport11) |
AT1G19360 | Encodes an arabinosyltransferase that modifies extensin proteins in root hair cells. |
AT1G19390 | Wall-associated kinase family protein;(source:Araport11) |
AT1G19410 | FBD / Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT1G19420 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G19470 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G19510 | RAD-like 5;(source:Araport11) |
AT1G19530 | Direct target of RGA, plays an essential role in GA-mediated tapetum and pollen development. |
AT1G19560 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G19610 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
AT1G19620 | transmembrane protein;(source:Araport11) |
AT1G19640 | Encodes a S-adenosyl-L-methionine:jasmonic acid carboxyl methyltransferase that catalyzes the formation of methyljasmonate from jasmonic acid. Its expression is induced in response to wounding or methyljasmonate treatment. |
AT1G19690 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G19710 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G19715 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT1G19770 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. The mRNA is cell-to-cell mobile. |
AT1G19780 | Encodes a member of the cyclic nucleotide gated channel (CNGC) family that is essential for male reproductive fertility. |
AT1G19800 | Encodes a permease-like protein involved in lipid transfer from the ER to the chloroplast, more specifically, transfer of phosphatidate across the chloroplast inner membrane. Mutant leaves accumulate trigalactosyldiacylglycerol, triacylglycerol and phosphatidate. Chloroplast lipids are altered in their fatty acid composition and as a consequence the development of chloroplasts in the mutants are impacted. The mutant seeds has a higher abortion rate. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
AT1G19810 | pseudogene of cell division cycle 48C;(source:Araport11) |
AT1G19835 | TCS1 encodes a coiled-coil domain protein that binds to microtubules and co-localizes with the cortical microtubules. Mutants have defects in trichome branching and hypocotyl elongation. TCS1 interacts with ZWI and appears to be involved in microtubule assembly. |
AT1G19840 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G19850 | Encodes a transcription factor (IAA24) mediating embryo axis formation and vascular development. Similar to AUXIN RESPONSIVE FACTOR 1 (ARF1) shown to bind to auxin responsive elements (AREs), and to the maize transcriptional activator VIVIPAROUS 1( VP1). In situ hybridization shows expression in provascular tissue of embryos, the emerging shoot primordia, then is restricted to provascular tissue, and in the root central vascular cylinder. |
AT1G19870 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
AT1G19940 | glycosyl hydrolase 9B5;(source:Araport11) |
AT1G19960 | Unknown gene, expression decreased in response to Mn and increased by cytokinin. |
AT1G19990 | nucleolin;(source:Araport11) |
AT1G20000 | Encodes TAF11b, a putative TBP-associated factor (TBP: TATA binding protein). |
AT1G20020 | Encodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the stroma The mRNA is cell-to-cell mobile. |
AT1G20080 | Encodes a synaptotagmin localized on the Golgi apparatus and that regulates protein secretion via the unconventional protein transport from the cytosol to the extracellular matrix in plant cells. |
AT1G20090 | Member of the Rho GTPase family. Functions to organize the microtubular cytoskeleton in combination with RIC1 and RIC4. These interactions affect pavement cell morphogenesis and pollen tube growth. ROP2 expression is stimulated by brassinosteroid treatment. Inhibit light-induced stomatal opening. The mRNA is cell-to-cell mobile. |
AT1G20100 | DNA ligase-like protein;(source:Araport11) |
AT1G20180 | transmembrane protein (DUF677);(source:Araport11) |
AT1G20190 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT1G20200 | PAM domain (PCI/PINT associated module) protein;(source:Araport11) |
AT1G20220 | Alba DNA/RNA-binding protein;(source:Araport11) |
AT1G20260 | One of three genes encoding the vacuolar ATP synthase subunit B1. The protein binds to and co-localizes with F-actin, bundles F-actin to form higher-order structure, and stabilizes actin filaments in vitro. The mRNA is cell-to-cell mobile. |
AT1G20300 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G20320 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G20350 | mitochondrial inner membrane translocase |
AT1G20360 | F-box family protein;(source:Araport11) |
AT1G20440 | Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. Cold regulated gene, amino acid sequence homology with Group II LEA (late embryogenesis abundant) proteins. Also responds to osmotic stress, ABA, dehydration and inhibits e.coli growth while overexpressed. COR47 and RAB18 double overexpressor plants are cold tolerant. Regulated by heat shock. |
AT1G20490 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT1G20500 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT1G20520 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
AT1G20530 | girdin (DUF630 and DUF632);(source:Araport11) |
AT1G20540 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G20550 | O-fucosyltransferase family protein;(source:Araport11) |
AT1G20620 | Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen. The mRNA is cell-to-cell mobile. |
AT1G20640 | Plant regulator RWP-RK family protein;(source:Araport11) |
AT1G20657 | Pseudogene of AT3G61340; F-box family protein |
AT1G20690 | SWI-SNF-related chromatin binding protein;(source:Araport11) |
AT1G20696 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. The mRNA is cell-to-cell mobile. |
AT1G20700 | Encodes WOX14, a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Functions in the shoot meristem organizing center to maintain the stem cells in an undifferentiated state. WOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation. |
AT1G20710 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
AT1G20720 | RAD3-like DNA-binding helicase protein;(source:Araport11) |
AT1G20735 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G20740 | transport/golgi organization-like protein (DUF833);(source:Araport11) |
AT1G20750 | RAD3-like DNA-binding helicase protein;(source:Araport11) |
AT1G20770 | coiled-coil protein;(source:Araport11) |
AT1G20790 | F-box family protein;(source:Araport11) |
AT1G20795 | F-box family protein;(source:Araport11) |
AT1G20810 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT1G20830 | Encodes MCD1 (MULTIPLE CHLOROPLAST DIVISION SITE 1). Determines the site of chloroplast division in concert with MinD (AT5G24020). |
AT1G20850 | Cysteine peptidase. Enzyme activity detected in leaf. |
AT1G20875 | hypothetical protein;(source:Araport11) |
AT1G20900 | Encodes an AT hook domain containing protein that acts redundantly with SOB3 to modulate hypocotyl growth inhibition in response to light. |
AT1G20940 | F-box family protein;(source:Araport11) |
AT1G20950 | Phosphofructokinase family protein;(source:Araport11) |
AT1G20960 | Similar to DEAD/DExH box ATP-dependent RNA helicase . Required for proper splicing of FLC. Mutants have reduced FLC levels and are early flowering. |
AT1G20970 | calponin-like domain protein;(source:Araport11) |
AT1G20980 | Encodes a nuclear plant-specific protein with features characteristic of a transcriptional regulator, including a nuclear localization signal sequence, a plant-specific DNA binding domain (the SBP box), and a protein interaction motif (ankyrin repeats). It unctions as a transcriptional regulator that plays a role not only in sensitivity to FB1, but also in the development of normal plant architecture. The mRNA is cell-to-cell mobile. |
AT1G20990 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G21000 | PLATZ transcription factor family protein;(source:Araport11) |
AT1G21010 | PADRE proteinup-regulated after infection by S. sclerotiorun. |
AT1G21060 | Serine/Threonine-kinase, putative (Protein of unknown function, DUF547);(source:Araport11) |
AT1G21090 | Cupredoxin superfamily protein;(source:Araport11) |
AT1G21100 | O-methyltransferase family protein;(source:Araport11) |
AT1G21120 | O-methyltransferase family protein;(source:Araport11) |
AT1G21130 | O-methyltransferase family protein;(source:Araport11) |
AT1G21140 | The gene encodes nodulin-like1 whose transcript abundance was repressed under conditions of Fe-deficient growth. |
AT1G21170 | Exocyst complex component SEC5;(source:Araport11) |
AT1G21210 | cell wall-associated ser/thr kinase involved in cell elongation and lateral root development |
AT1G21220 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-26 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G21240 | encodes a wall-associated kinase The mRNA is cell-to-cell mobile. |
AT1G21245 | Protein kinase superfamily protein;(source:Araport11) |
AT1G21250 | Encodes a cell wall-associated kinase that interacts with AtGRP3 and may function as a signaling receptor of extracellular matrix component such as oligogalacturonides. The mRNA is cell-to-cell mobile. |
AT1G21260 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.4e-23 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G21330 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G40680.1);(source:TAIR10) |
AT1G21340 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
AT1G21400 | Thiamin diphosphate-binding fold (THDP-binding) superfamily protein;(source:Araport11) |
AT1G21420 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
AT1G21430 | Flavin-binding monooxygenase family protein;(source:Araport11) |
AT1G21460 | Nodulin MtN3 family protein;(source:Araport11) |
AT1G21470 | hypothetical protein;(source:Araport11) |
AT1G21480 | Exostosin family protein;(source:Araport11) |
AT1G21500 | hypothetical protein;(source:Araport11) |
AT1G21510 | TPRXL;(source:Araport11) |
AT1G21525 | Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167. Virus-induced small peptide composed of 71 amino acids, which harbor a ubiquitin-interacting motif that mediates interaction with autophagy-related protein 8. Small peptide receptor functioning in the crosstalk between selective autophagy and RNA silencing. |
AT1G21529 | DRIR is a 755 nt long non coding RNA. Over-expression results in plants with increased salt and drought tolerance and ABA sensitivity. DRIR probably regulates the accumulation of genes involved in drought stress response. DRIR likely acts as a regulator of drought stress responsive gene expression. |
AT1G21530 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT1G21640 | Encodes a protein with NAD kinase activity. The protein was also shown to bind calmodulin. |
AT1G21660 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G21695 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G21738 | hypothetical protein;(source:Araport11) |
AT1G21760 | This gene is predicted to encode an F-box protein that is evolutionarily conserved between Arabidopsis and other eukaryotes including S.cerevisiae and humans. It may play a role in regulating translation under conditions of temperature stress. FBP7 transcript levels are increased at high and low temperatures. The mRNA is cell-to-cell mobile. |
AT1G21850 | SKU5 similar 8;(source:Araport11) |
AT1G21900 | Encodes an ER-localized p24 protein. Interacts with p24beta2 at ER export sites for ER exit and coupled transport to the Golgi apparatus. Once in the Golgi, p24delta5 interacts very efficiently with the COPI machinery for retrograde transport back to the ER. |
AT1G21925 | Encodes a Plant thionin family protein |
AT1G21950 | transmembrane protein;(source:Araport11) |
AT1G21973 | Encodes a Plant thionin family protein [pseudogene] |
AT1G21980 | Type I phosphatidylinositol-4-phosphate 5-kinase. Preferentially phosphorylates PtdIns4P. Induced by water stress and abscisic acid in Arabidopsis thaliana. Expressed in procambial cells of leaves, flowers and roots. A N-terminal Membrane Occupation and Recognition Nexus (MORN)affects enzyme activity and distribution. |
AT1G21990 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT1G22030 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT1G22040 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G22050 | membrane-anchored ubiquitin-fold protein 6 precursor;(source:Araport11) |
AT1G22060 | sporulation-specific protein;(source:Araport11) |
AT1G22090 | hypothetical protein;(source:Araport11) |
AT1G22100 | Inositol-pentakisphosphate 2-kinase family protein;(source:Araport11) |
AT1G22150 | sulfate transporter Sultr1;3 |
AT1G22160 | senescence-associated family protein (DUF581);(source:Araport11) |
AT1G22170 | Phosphoglycerate mutase family protein;(source:Araport11) |
AT1G22180 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT1G22210 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G22220 | F-box family protein;(source:Araport11) |
AT1G22230 | nucleolar GTP-binding protein;(source:Araport11) |
AT1G22240 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT1G22280 | Encodes a phytochrome-associated protein, PAPP2C (phytochrome-associated protein phosphatase type 2C). PAPP2C interacts in the nucleus with phyA (phytochrome A) and phyB. Functions as a regulator of phytochrome-interacting factor PIF3 by dephosphorylating phytochromes in the nucleus. |
AT1G22290 | 14-3-3 family protein;(source:Araport11) |
AT1G22340 | UDP-glucosyl transferase 85A7;(source:Araport11) |
AT1G22400 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G22440 | Zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
AT1G22460 | O-fucosyltransferase family protein;(source:Araport11) |
AT1G22470 | Hypothetical protein;(source:Araport11). Target of SR45. |
AT1G22490 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G22540 | Major facilitator superfamily protein;(source:Araport11) |
AT1G22550 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
AT1G22560 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.4e-20 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G22570 | Major facilitator superfamily protein;(source:Araport11) |
AT1G22580 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 32%25 identity and 1.1e-13 P-value to GP|21952510|gb|AAM82604.1|AF525305_2|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10) |
AT1G22600 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
AT1G22610 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT1G22640 | MYB-type transcription factor (MYB3) that represses phenylpropanoid biosynthesis gene expression |
AT1G22650 | Plant neutral invertase family protein;(source:Araport11) |
AT1G22660 | Polynucleotide adenylyltransferase family protein;(source:Araport11) |
AT1G22670 | Protease-associated (PA) RING/U-box zinc finger family protein;(source:Araport11) |
AT1G22700 | Encodes a TPR protein with homology to Ycf37 from Synechocystis that is localized to the thylakoid membrane and is involved in photosystem I biogenesis. |
AT1G22710 | Encodes for a high-affinity transporter essential for phloem loading and long-distance transport. A major sucrose transporter, AtSUC2 can also transport a wide range of physiological and synthetic glucose conjugates with both α- or β-linkage. |
AT1G22740 | GTP-binding protein Rab7 |
AT1G22750 | transmembrane protein;(source:Araport11) |
AT1G22840 | Encodes cytochrome c. Contains two site II (TGGGCC/T) elements, which interact with a TCP-domain transcription factor, and a downstream internal telomeric repeat, and are required for expression of the Cytc-1 gene. Promoter directs preferential expression in root and shoot meristems and in anthers. Double mutants with CYTC-2 accumulate starch during the day, have delayed growth and development and reduced GA and DELLA proteins linking cellular metabolism and GA homeostasis. |
AT1G22900 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT1G22920 | AJH1 encodes a protein similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Encodes a subunit of the COP9 complex that is involved in protein deneddylation. Plants with mutations in CSN5A and CSN5B have a de-etiolated phenotype. Required for the recovery of AUX/IAA repressor levels following recurrent heat stress to regulate auxin homeostasis. |
AT1G22930 | T-complex protein 11;(source:Araport11) |
AT1G22985 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
AT1G23000 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT1G23010 | Encodes a protein with multicopper oxidase activity. Located in ER. Function together with LPR2 (AT1G71040) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
AT1G23020 | Encodes a ferric chelate reductase whose transcription is regulated by FIT1. Expressed in the root, shoot, flower and cotyledon. |
AT1G23030 | Encodes a plant U-Box protein that is capable of binding and ubiquitinating a variety of targets including MYC2,LRR1,KIN and acting as an E3 ligase. Regulates a number of physiological hormonal and environment al responses via selective degradation of targets.Unlike PUB10, its closest homolog in Arabidopsis, it does not appear to play a major role in the MeJA-mediated response. |
AT1G23037 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT1G23050 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G23060 | hypothetical protein;(source:Araport11) |
AT1G23070 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
AT1G23080 | Encodes a novel component of auxin efflux that is located apically in the basal cell and is involved during embryogenesis in setting up the apical-basal axis in the embryo. It is also involved in pattern specification during root development. In roots, it is expressed at lateral and basal membranes of provascular cells in the meristem and elongation zone, whereas in the columella cells it coincides with the PIN3 domain. Plasma membrane-localized PIN proteins mediate a saturable efflux of auxin. PINs mediate auxin efflux from mammalian and yeast cells without needing additional plant-specific factors. The action of PINs in auxin efflux is distinct from PGPs, rate-limiting, specific to auxins and sensitive to auxin transport inhibitors. PINs are directly involved of in catalyzing cellular auxin efflux. |
AT1G23090 | Encodes AST91 mRNA for sulfate transporter. |
AT1G23130 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT1G23150 | hypothetical protein;(source:Araport11) |
AT1G23170 | Involved in cell wall modifications resulting in resistance to the biotroph Hpa. |
AT1G23180 | ARM repeat superfamily protein;(source:Araport11) |
AT1G23200 | ProPME pectin methyl esterase involved in embryo development. |
AT1G23201 | GCK domain protein;(source:Araport11) |
AT1G23205 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G23230 | Mediator tail subunit, involved in transcriptional regulation. Mediator Complex Subunit, interacts with MED2, MED5, MED16 in the Regulation of Phenylpropanoid Biosynthesis. |
AT1G23250 | Caleosin-related family protein |
AT1G23270 | hypothetical protein;(source:Araport11) |
AT1G23300 | MATE efflux family protein;(source:Araport11) |
AT1G23310 | Identified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway. |
AT1G23330 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G23380 | homeodomain transcription factor KNAT6, belonging to class I of KN transcription factor family (which also includes KNAT1 and KNAT2). Expression is increased in as and bop1 leaf mutants. |
AT1G23390 | A kelch domain-containing F-box protein. Its N terminus contains a typical F-box motif but its C-terminal domain only consists of one predicted kelch motif. Predicted to be stu Interacts with chalcone synthase CHS to mediate CHS ubiquitination and degradation. |
AT1G23410 | cytosolic ribosomal protein gene, part of eS31 family |
AT1G23440 | Peptidase C15, pyroglutamyl peptidase I-like protein;(source:Araport11) |
AT1G23510 | OBP32pep protein;(source:Araport11) |
AT1G23520 | hypothetical protein (DUF220);(source:Araport11) |
AT1G23550 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Its transcript level is up-regulated by tunicamycin (N-linked glycosylation inhibitor causing ER stress). |
AT1G23570 | hypothetical protein (DUF220);(source:Araport11) |
AT1G23580 | transmembrane protein, putative (Domain of unknown function DUF220);(source:Araport11) |
AT1G23590 | OBP32pep protein, putative (Domain of unknown function DUF220);(source:Araport11) |
AT1G23600 | OBP32pep protein, putative (Domain of unknown function DUF220);(source:Araport11) |
AT1G23610 | hypothetical protein;(source:Araport11) |
AT1G23710 | hypothetical protein (DUF1645);(source:Araport11) |
AT1G23730 | beta carbonic anhydrase 3;(source:Araport11) |
AT1G23740 | AOR is an alkenal/one oxidoreductase that acts on compounds with unsaturated alpha,beta-carbonyls. The activity of this enzyme with a number of substrates, including acrolein and 3-buten-2-one, was demonstrated in vitro using a truncated form of the protein that lacked approximately 80 of the first amino acids. This protein appears to localize to the chloroplast where it likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation. |
AT1G23760 | Encodes aromatic rich glycoprotein JP630. |
AT1G23770 | F-box family protein;(source:Araport11) |
AT1G23790 | dicer-like protein (DUF936);(source:Araport11) |
AT1G23810 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
AT1G23830 | transmembrane protein;(source:Araport11) |
AT1G23870 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. The mRNA is cell-to-cell mobile. |
AT1G23910 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT1G24030 | Protein kinase superfamily protein;(source:Araport11) |
AT1G24100 | Encodes a UDP-glucose:thiohydroximate S-glucosyltransferase, involved in glucosinolate biosynthesis |
AT1G24110 | Peroxidase superfamily protein;(source:Araport11) |
AT1G24150 | Encodes a group I formin. Localized to cell junctions. Polymerizes actin. Binds profilin. Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. FORMIN4 is a spatial feedback element in a multi-layered, temporally defined sequence of cytoskeletal response, contributing to the distribution of actin filaments at the dynamic cell wall appositions boundary and to the outcomes of pre-invasion defense. |
AT1G24200 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
AT1G24212 | pseudogene of paired amphipathic helix repeat-containing protein |
AT1G24220 | paired amphipathic helix repeat-containing protein;(source:Araport11) |
AT1G24256 | hypothetical protein;(source:Araport11) |
AT1G24260 | Member of the MADs box transcription factor family. SEP3 is redundant with SEP1 and 2. Flowers of SEP1/2/3 triple mutants show a conversion of petals and stamens to sepals.SEP3 forms heterotetrameric complexes with other MADS box family members and binds to the CArG box motif. |
AT1G24270 | hypothetical protein;(source:Araport11) |
AT1G24320 | Six-hairpin glycosidases superfamily protein;(source:Araport11) |
AT1G24400 | High-affinity transporter for neutral and acidic amino acids, expressed in tapetum tissue of anthers. Transport of 1-Aminocyclopropane-1-carboxylic acid (ACC). |
AT1G24405 | hypothetical protein;(source:Araport11) |
AT1G24420 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT1G24430 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT1G24470 | Encodes one of the two Arabidopsis homologues to YBR159w encoding a S. cerevisiae beta-ketoacyl reductase (KCR), which catalyzes the first reduction during VLCFA (very long chain fatty acids, >18 carbon) elongation: KCR1 (At1g67730), KCR2 (At1g24470). Complementation of the yeast ybr159Delta mutant demonstrated that the two KCR proteins are divergent and that only AtKCR1 can restore heterologous elongase activity similar to the native yeast KCR gene. |
AT1G24485 | ER protein carbohydrate-binding protein;(source:Araport11) |
AT1G24530 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G24540 | member of CYP86C |
AT1G24570 | transmembrane protein, putative (DUF707);(source:Araport11) |
AT1G24575 | DEAD-box ATP-dependent RNA helicase-like protein;(source:Araport11) |
AT1G24580 | RING/U-box superfamily protein;(source:Araport11) |
AT1G24590 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and LEAFY PETIOLE. This gene functions in the regeneration of shoots in tissue culture, probably through transcriptional regulation of CUC1. May also be involved in activation of the cell cycle via CycD1;1. |
AT1G24600 | hypothetical protein;(source:Araport11) |
AT1G24640 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-37 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G24650 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G24706 | Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. Mutations in THO have severe developmental defects and affect the production of several different classes of small RNAs indicating a broader role in small RNA biosynthesis. |
AT1G24764 | Member of the MAP70 protein family. |
AT1G25240 | ENTH/VHS/GAT family protein;(source:Araport11) |
AT1G25275 | Thionin-like gene involved in resistance against the beet cyst nematode (Heterodera schachtii). |
AT1G25300 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT1G25310 | basic helix-loop-helix (bHLH) DNA-binding family protein;(source:Araport11) |
AT1G25330 | Encodes CESTA, a positive regulator of brassinosteroid biosynthesis. |
AT1G25340 | putative transcription factor (MYB116) |
AT1G25370 | hypothetical protein (DUF1639);(source:Araport11) |
AT1G25425 | CLAVATA3/ESR-RELATED 43;(source:Araport11) |
AT1G25450 | Encodes KCS5, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT1G25540 | Encodes a nuclear protein that acts in a phyB pathway (but downstream of phyB) and induces flowering in response to suboptimal light conditions. PFT1 promotes flowering in CO dependent and independent pathways and integrates several environmental stimuli, such as light quality and JA-dependent defenses. Mutants are hypo-responsive to far-red and hyper-responsive to red light and flower late under long day conditions. Also shown to be a Mediator subunit regulating jasmonate-dependent defense. |
AT1G25550 | Member of HHO/HRS GARP type transcriptional repressor family. Involved in Pi uptake and Pi starvation signaling. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
AT1G25570 | Di-glucose binding protein with Leucine-rich repeat domain-containing protein;(source:Araport11) |
AT1G26130 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
AT1G26190 | TTM2 is a triphosphate tunnel metalloenzyme that displays pyrophosphatase activity.It contains both a uridine kinase (UK) domain and CYTH domain. TTM2 is involved in negative regulation defense response to pathogens (PMID:28733390). |
AT1G26200 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
AT1G26240 | Proline-rich extensin-like family protein;(source:Araport11) |
AT1G26270 | Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11) |
AT1G26290 | hypothetical protein;(source:Araport11) |
AT1G26320 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
AT1G26390 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G26410 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G26430 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
AT1G26450 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT1G26570 | UDP-glucose dehydrogenase 1;(source:Araport11) |
AT1G26600 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. |
AT1G26610 | C2H2-like zinc finger protein;(source:Araport11) |
AT1G26640 | Encodes a cytosolic isopentenyl phosphate kinase that plays an important role in regulating the formation of both MVA (mevalonic acid) and MEP (methylerythritol phosphate) pathway-derived terpenoid compounds by controlling the ratio of IP/DMAP to IPP/DMAPP. IPP and DMAPP are the universal C5 building blocks of all natural terpenoids. IPK enhances terpenoid formation by returning IP/DMAP to the terpenoid biosynthetic network. |
AT1G26680 | transcriptional factor B3 family protein;(source:Araport11) |
AT1G26690 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT1G26700 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO14 belongs to the clade I, with AtMLO4 and AtMLO11. The gene is expressed during early seedling growth, in developing primary root, and particularly in root tips of 10-day old seedlings; it was not expressed in leaves or flowers, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT1G26730 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT1G26770 | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
AT1G26790 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
AT1G26796 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT1G26797 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT1G26799 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT1G26800 | MPSR1 is cytoplasmic E3 ligase that senses misfolded proteins independently of chaperones and targets those proteins for degradation via the 26S proteasome. Involved in the regulation of the homeostasis of sensor NLR immune receptors. |
AT1G26850 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G26870 | NAC-domain protein. Expressed in root cap stem cells, where it promotes periclinal root cap-forming divisions. Involved in a regulatory feedback loop with SMB. FEZ activates SMB in hte root cap daughter cells soon after division, and SMB in turn represses FEZ expression in these cells, thereby preventing further stem cell divisions. |
AT1G26890 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT1G26900 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G26921 | hypothetical protein;(source:Araport11) |
AT1G26930 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G26970 | Protein kinase superfamily protein;(source:Araport11) |
AT1G27000 | GRIP/coiled-coil protein, putative (DUF1664);(source:Araport11) |
AT1G27008 | transmembrane protein;(source:Araport11) |
AT1G27040 | Major facilitator superfamily protein;(source:Araport11) |
AT1G27050 | Encodes a protein with a RNA recognition motif. Previously annotated as ATHB54, a homeodomain leucine zipper (HD-Zip) family protein. In the TAIR10 genome release (2010), this locus was split into two loci: AT1G27045 (containing homeodomain and leucine zipper domains) and AT1G27050 (containing a RNA recognition motif). AT1G27045 is now named ATHB54. Note that Affymetrix ATH1 Probe Set linked to symbol ATHB54 is in fact directed against the product of the AT1G27050 locus (the mRNA coding for the RNA-recognition-motif protein). |
AT1G27060 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT1G27080 | Encodes a protein with low-affinity nitrate transporter activity that is expressed in the vascular tissue of the funiculus and the silique. This plasma membrane-localized enzyme is predicted to have 12 transmembrane domains. Plants lacking NRT1.6 have reduced levels of nitrate in their seeds and have increased levels of early embryonic developmental defects and seed abortion. |
AT1G27090 | glycine-rich protein;(source:Araport11) |
AT1G27100 | Actin cross-linking protein;(source:Araport11) |
AT1G27110 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G27140 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT1G27170 | transmembrane receptors / ATP binding protein;(source:Araport11) |
AT1G27190 | Activated by TCP8/14/15/22, involved in modulation of GA-dependent stamen filament elongation. |
AT1G27250 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
AT1G27260 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
AT1G27270 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
AT1G27285 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G27290 | transmembrane protein;(source:Araport11) |
AT1G27370 | In conjunction with SPL11 and SPL2, SPL10 redundantly controls proper development of lateral organs in association with shoot maturation in the reproductive phase. SPL2, SPL10, and SPL11, suppress root regeneration with age by inhibiting wound-induced auxin biosynthesis. SPL10 also controls lamina shape during vegetative development. |
AT1G27440 | IRX10 was identified as MUCI69 in a reverse genetic screen for MUCILAGE-RELATED genes. Mutations in this gene did not disrupt mucilage properties, likely due to the presence of the functionally redundant IRX10-L. |
AT1G27500 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G27670 | transmembrane protein;(source:Araport11) |
AT1G27690 | lipase, putative (DUF620);(source:Araport11) |
AT1G27720 | TBP-associated factor 4B;(source:Araport11) |
AT1G27730 | Related to Cys2/His2-type zinc-finger proteins found in higher plants. Compensated for a subset of calcineurin deficiency in yeast. Salt tolerance produced by ZAT10 appeared to be partially dependent on ENA1/PMR2, a P-type ATPase required for Li+ and Na+ efflux in yeast. The protein is localized to the nucleus, acts as a transcriptional repressor and is responsive to chitin oligomers. Also involved in response to photooxidative stress. |
AT1G27740 | Basic helix-loop-helix (bHLH) transcription factor that is sufficient to promote postmitotic cell growth in root-hair cells. RSL4 is a direct transcriptional target of RHD6 |
AT1G27770 | Encodes a chloroplast envelope Ca2+-ATPase with an N-terminal autoinhibitor. |
AT1G27850 | Encodes a microtubule-associated protein involved in cortical microtubule organization during leaf development. |
AT1G27860 | hypothetical protein (DUF626);(source:Araport11) |
AT1G27890 | Deadenylase. |
AT1G27920 | microtubule-associated protein 65-8;(source:Araport11) |
AT1G27930 | Arabinogalactan methylesterase,involved in arabinogalactan glucuronic acid methylation. Interacts with eIF3. |
AT1G27940 | P-glycoprotein 13;(source:Araport11) |
AT1G27980 | Encodes an ER-localized sphingoid long-chain base-1-phosphate lyase involved in the dehydration stress response. |
AT1G28010 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
AT1G28020 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G28030 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT1G28040 | RING/U-box superfamily protein;(source:Araport11) |
AT1G28080 | RING finger protein;(source:Araport11) |
AT1G28090 | Polynucleotide adenylyltransferase family protein;(source:Araport11) |
AT1G28100 | hypothetical protein;(source:Araport11) |
AT1G28110 | serine carboxypeptidase-like 45;(source:Araport11) |
AT1G28120 | Deubiquitinase with preference towards M1 and K48 linkages. |
AT1G28130 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. |
AT1G28135 | hypothetical protein;(source:Araport11) |
AT1G28160 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
AT1G28180 | DEAD-box ATP-dependent RNA helicase-like protein;(source:Araport11) |
AT1G28190 | PADRE protein up-regulated after infection by S. sclerotiorum. |
AT1G28210 | DnaJ homolog AtJ1 (atj) |
AT1G28220 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
AT1G28230 | Encodes a transporter that transports purines,cytokinins and other adenine derivatives. Expressed in the leaf hydathodes where it may be involved in re-uptake of cytokinins during guttation. |
AT1G28250 | transmembrane protein;(source:Araport11) |
AT1G28260 | Telomerase activating protein Est1;(source:Araport11) |
AT1G28300 | Transcription factor that contains a B3 domain, a DNA-binding motif unique to plants and characteristic of several transcription factors. Plays critical roles both early and late during embryo development. LEC2 RNA accumulates primarily during seed development. LEC2 is required for the maintenance of suspensor morphology, specification of cotyledon identity, progression through the maturation phase, and suppression of premature germination. It establishes a cellular environment sufficient to initiate embryo development - ectopic, postembryonic expression of LEC2 in transgenic plants induces the formation of somatic embryos and other organ-like structures and often confers embryonic characteristics to seedlings and to reproductive and vegetative organs of mature plants. |
AT1G28306 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT1G28320 | Mutants in this gene are defective in the processing of pre-glyoxysomal malate dehydrogenase (pre-gMDH) to gMDH. |
AT1G28323 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.9e-140 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT1G28327 | E3 ubiquitin-protein ligase;(source:Araport11) |
AT1G28335 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT1G28350 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
AT1G28360 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ERF12). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. Regulates floral development. |
AT1G28380 | This gene is predicted to encode a protein involved in negatively regulating salicylic acid-related defense responses and cell death programs. nsl1 mutants develop necrotic lesions spontaneously and show other features of a defense response, such as higher levels of SA and disease resistance-related transcripts, in the absence of a biotic stimulus. The NSL1 protein is predicted to have a MACPF domain, found in proteins that form a transmembrane pore in mammalian immune responses. NSL1 transcript levels do not appear to change in response to biotic stresses, but are elevated by cycloheximide in seedlings, and by sodium chloride in roots. The mRNA is cell-to-cell mobile. |
AT1G28430 | member of CYP705A |
AT1G28440 | HAESA-like 1;(source:Araport11) |
AT1G28470 | NAC domain containing protein 10;(source:Araport11) |
AT1G28490 | Encodes SYP61, one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. SYP61 and SYP121 coordinate the trafficking of plasma membrane aquaporin PIP2;7 to modulate the cell membrane water permeability. |
AT1G28520 | VOZ transcription factor which acts as positive regulator of several salt-responsive genes. Functionally redundant in salt stress with VOZ2. |
AT1G28570 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
AT1G28580 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G28590 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G28591 | Pseudogene of AT1G28610; GDSL-motif lipase, putative |
AT1G28600 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G28610 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G28620 | pseudogene of GDSL-like Lipase/Acylhydrolase superfamily protein;(source:Araport11) |
AT1G28640 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G28650 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G28660 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G28670 | Arabidopsis thaliana lipase |
AT1G28685 | Natural antisense transcript overlaps with AT1G28680;(source:Araport11) |
AT1G28690 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G28695 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
AT1G28700 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
AT1G28720 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT1G28760 | Encodes an orthlog of the Xenopus inner nuclear membrane (INM) protein Nemp1/TMEM194A. |
AT1G28860 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT1G29000 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT1G29010 | verprolin;(source:Araport11) |
AT1G29020 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT1G29025 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT1G29041 | hypothetical protein;(source:Araport11) |
AT1G29050 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT1G29080 | Papain family cysteine protease;(source:Araport11) |
AT1G29090 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT1G29100 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT1G29110 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT1G29140 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT1G29150 | specifically interacts with FUS6/COP11 via the C-terminal domain of FUS6/COP11 and associates with an ATPase subunit of the 19S proteasome regulatory complex, AtS6A. The mRNA is cell-to-cell mobile. |
AT1G29160 | Encodes a DOF transcription factor involved in seed coat development. Regulates PRX2 and PRX25, involved in seed longevity. |
AT1G29170 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
AT1G29200 | O-fucosyltransferase family protein;(source:Araport11) |
AT1G29220 | transcriptional regulator family protein;(source:Araport11) |
AT1G29230 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.20), which has also been reported as a member of the CBL-interacting protein kinases (CIPK18). |
AT1G29240 | transcription initiation factor TFIID subunit, putative (DUF688);(source:Araport11) |
AT1G29290 | Group II CEP family member; binds to vascular tissue independently of CEPR1 or CRA2. |
AT1G29300 | intracellular protein transporter, putative (DUF641);(source:Araport11) |
AT1G29310 | SecY protein transport family protein;(source:Araport11) |
AT1G29320 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G29340 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity. It is required for cell death and full resistance specified by Arabidopsis RPM1 and RPS4 resistance proteins against Pseudomonas syringae pv tomato. The mRNA is cell-to-cell mobile. |
AT1G29380 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT1G29390 | Integral membrane protein in the inner envelope of chloroplasts. Provide freezing tolerance. |
AT1G29395 | Integral membrane protein in the inner envelope of chloroplasts. Provide freezing tolerance. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. involved in response to salt tolerance |
AT1G29400 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML5 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. Among mei2-like genes, AML5 is the transcript with highest frequency of alternative splicing. Expression was detected during embryo development (heart and torpedo stage) and in vegetative and floral apices. |
AT1G29430 | SAUR762 expression is induced during pollination and expressed in pollen tubes. SAUR62 likely functions in translation of proteins required for pollen tube development/function. |
AT1G29460 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G29465 | transmembrane protein;(source:Araport11) |
AT1G29475 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-91 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT1G29480 | hypothetical protein;(source:Araport11) |
AT1G29490 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G29510 | This locus was referred to as SAUR68 in PMID:17948056 but the nomenclature should be SAUR67. |
AT1G29520 | AWPM-19-like family protein;(source:Araport11) |
AT1G29540 | LOW protein: protein BOBBER-like protein;(source:Araport11) |
AT1G29560 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT1G29570 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT1G29580 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
AT1G29600 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT1G29620 | Cytochrome C oxidase polypeptide VIB family protein;(source:Araport11) |
AT1G29630 | 5-3 exonuclease family protein;(source:Araport11) |
AT1G29650 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-28 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G29660 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G29690 | Encodes a protein containing a domain with significant homology to the MACPF (membrane attack complex and perforin) domain of complements and perforin proteins that are involved in innate immunity in animals. Transgenic cad1-1 mutant plants show lesions seen in the hypersensitive response, as well as a spontaneous activation of expression of pathogenesis-related genes and leading to a 32-fold increase in salicylic acid (SA). CAD1 is postulated to act as a negative regulator controlling SA-mediated pathway of programmed cell death in plant immunity. |
AT1G29710 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G29715 | pseudogene of Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
AT1G29720 | Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth. |
AT1G29730 | Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth. |
AT1G29740 | Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth. |
AT1G29760 | Membrane protein involved in lipid droplet biogenesis primarily in pollen. The interaction motif on SEIPIN2 for VAP27-1 is restricted to the N-terminal 30 amino acids that contain an FFAT motif. |
AT1G29770 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G29840 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G29870 | tRNA synthetase class II (G, H, P and S) family protein;(source:Araport11) |
AT1G29890 | Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Has high similarity to RWA2 whose mutant displays reduced acetylation. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. |
AT1G29910 | member of Chlorophyll a/b-binding protein family |
AT1G29920 | Encodes lhcb1.1 a component of the LHCIIb light harvesting complex associated with photosystem II. |
AT1G29930 | Subunit of light-harvesting complex II (LHCII),which absorbs light and transfers energy to the photosynthetic reaction center. The mRNA is cell-to-cell mobile. |
AT1G29940 | Encodes a subunit of RNA polymerase 1 (aka RNA polymerase A). |
AT1G29962 | AGAMOUS-like 64;(source:Araport11) |
AT1G30000 | alpha-mannosidase 3;(source:Araport11) |
AT1G30040 | Encodes a gibberellin 2-oxidase that acts on C-19 gibberellins. AtGA2OX2 expression is responsive to cytokinin and KNOX activities. |
AT1G30050 | tropomyosin;(source:Araport11) |
AT1G30080 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT1G30090 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G30100 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
AT1G30110 | Encodes a ppGpp pyrophosphohydrolase. |
AT1G30120 | Encodes a putative plastid pyruvate dehydrogenase E1 beta subunit that is distinct from the mitochondrial pyruvate dehydrogenase E1 beta subunit. |
AT1G30130 | DUF1365 family protein;(source:Araport11) |
AT1G30150 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 2.2e-24 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
AT1G30170 | Hypothetical protein (DUF295) of unknown function. |
AT1G30180 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.5e-115 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G30190 | cotton fiber protein;(source:Araport11) |
AT1G30210 | TCP family protein involved in heterochronic regulation of leaf differentiation. |
AT1G30250 | hypothetical protein;(source:Araport11) |
AT1G30270 | Arabidopsis thaliana CBL-interacting protein kinase 23. CIPK23 serves as a positive regulator of the potassium transporter AKT1 by directly phosphorylating AKT1. CIPK23 is activated by the binding of two calcineurin B-like proteins, CBL1 and CBL9. The mRNA is cell-to-cell mobile. |
AT1G30310 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.6e-19 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G30320 | Remorin family protein;(source:Araport11) |
AT1G30350 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G30360 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
AT1G30370 | Encodes a mitochondria-localized class III phospholipase A1 that plays a role in seed viability. |
AT1G30400 | glutathione S-conjugate transporting ATPase (AtMRP1) mRNA. An ABCC-type arsenite-phytochelatin transporter. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
AT1G30410 | member of MRP subfamily |
AT1G30420 | member of MRP subfamily |
AT1G30440 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT1G30455 | cyclin/Brf1-like TBP-binding domain-containing protein;(source:Araport11) |
AT1G30460 | Encodes AtCPSF30, the 30-KDa subunit of cleavage and polyadenylation specificity factor. AtCPSF30 is a probable processing endonuclease. Nucleus-localized RNA binding protein capable of interacting with itself and with calmodulin. Its RNA-binding activity is inhibited by calmodulin in a calcium-dependent fashion. |
AT1G30500 | nuclear factor Y, subunit A7;(source:Araport11) |
AT1G30515 | GATA zinc finger protein;(source:Araport11) |
AT1G30560 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). |
AT1G30590 | RNA polymerase I specific transcription initiation factor RRN3 protein;(source:Araport11) |
AT1G30610 | Pentatricopeptide repeat protein .Mutations in this locus result in embryo lethality due to defects in chloroplast development. Embryo shape at seed maturity is globular. |
AT1G30620 | encodes a type-II membrane protein that catalyzes 4-epimerization of UDP-D-Xylose to UDP-L-Arabinose in vitro, the nucleotide sugar used by glycosyltransferases in the arabinosylation of cell wall polysaccharides and wall-resident proteoglycans. |
AT1G30640 | Protein kinase family protein;(source:Araport11) |
AT1G30660 | A truncated version of Twinkle that retains only the DNA primase domain. |
AT1G30670 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G30680 | Twinkle is a dual localized (mitochondria and chloroplast) DNA primase-helicase. It synthesizes RNA primers from a 5′ -(G/C)GGA-3′ template, where the last two 3' nucleotides are cryptic. Mitochondrial protein involved in DNA replication which binds to DNA polymerases, Pol1A and Pol1B. |
AT1G30700 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G30710 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G30720 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G30750 | TPRXL;(source:Araport11) |
AT1G30755 | elongation factor G, putative (DUF668);(source:Araport11) |
AT1G30757 | transmembrane protein;(source:Araport11) |
AT1G30760 | Encodes a BBE-like enzyme that acts in monolignol metabolism by catalyzing the oxidation of aromatic allylic alcohols, such as coumaryl-, sinapyl-, and coniferyl alcohol, to the corresponding aldehydes. The mRNA is cell-to-cell mobile. |
AT1G30780 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT1G30790 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G30820 | Cytidine triphosphate synthase. |
AT1G30825 | Involved in trichome maturation. mutant displays enlarged trichomes |
AT1G30830 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT1G30835 | Member of Sadhu non-coding retrotransposon family The mRNA is cell-to-cell mobile. |
AT1G30845 | cell growth defect protein;(source:Araport11) |
AT1G30850 | root hair specific 4;(source:Araport11) |
AT1G30860 | RING/U-box superfamily protein;(source:Araport11) |
AT1G30880 | hypothetical protein;(source:Araport11) |
AT1G30900 | VACUOLAR SORTING RECEPTOR 6;(source:Araport11) |
AT1G30910 | Molybdenum cofactor sulfurase family protein;(source:Araport11) |
AT1G30925 | F-box/associated interaction domain protein;(source:Araport11) |
AT1G30935 | Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT1G30940 | pseudogene of F-box family protein;(source:Araport11) |
AT1G30945 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G30950 | Required for the proper identity of the floral meristem. Involved in establishing the whorled pattern of floral organs, in the control of specification of the floral meristem, and in the activation of APETALA3 and PISTILLATA. UFO is found at the AP3 promoter in a LFY-dependent manner, suggesting that it works with LFY to regulate AP3 expression. UFO may also promote the ubiquitylation of LFY. |
AT1G30960 | Ortholog of ERA (E. coli RAS-like protein)-related GTPase (ERG). Mitochondrial protein that associates with 18sRNA. Heterozygous mutants segregate for embryo lethality inherited as a sporphytic maternal effect. Increased ROS in the mutant ovule suggests a heritable mitochondrial defect results in lethality. |
AT1G30972 | Encodes a Plant thionin family protein |
AT1G31040 | ORE15 is a nuclear localized member of the PLATZ family of transcription factors. Based on over expression and loss of function phenotypes, ORE15 functions in regulation of leaf cell proliferation and senescence. |
AT1G31070 | Encodes a protein that functions as an N-acetylglucosamine-1-phosphate uridylyltransferase that catalyzes the formation of UDP-N-acetylglucosamine (UDP-GlcNAc). This is an essential precursor for glycolipid and glycoprotein synthesis and is also used for regulatory protein modification in signaling pathways. The enzyme can also catalyze the reverse reaction using both UDP-GlcNAc and the less common UDP-N-acetylgalactosamine as substrates. |
AT1G31080 | F-box family protein;(source:Araport11) |
AT1G31093 | pseudogene of calcium-dependant protein kinase |
AT1G31130 | polyadenylate-binding protein 1-B-binding protein;(source:Araport11) |
AT1G31140 | Encodes a B-sister MADS-box protein, GORDITA which is specific to the Brassicaceae. GOA is the most closely related paralog of ABS. GOA represses fruit growth and contributes to integument development. Over-expression of GOA results in disorganized floral structure and addition of carpel-like features to sepals. |
AT1G31150 | K-box region protein (DUF1985);(source:Araport11) |
AT1G31163 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT1G31170 | encodes a cysteine-sulfinic acid reductase (sulfiredoxin - EC 1.8.98.2) capable of reducing overoxidized plastidic 2-Cys-Prx involved in peroxide detoxification and response to oxidative stress |
AT1G31173 | Encodes a microRNA that targets ARF family members ARF6 and ARF8. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAAGCUGCCAGCAUGAUCUGG |
AT1G31175 | cytochrome C oxidase biogenesis Cmc1-like protein;(source:Araport11) |
AT1G31230 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
AT1G31250 | proline-rich family protein;(source:Araport11) |
AT1G31260 | member of Fe(II) transporter isolog family |
AT1G31290 | ARGONAUTE 3;(source:Araport11) |
AT1G31300 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
AT1G31310 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G31370 | Ubiquitin-specific protease family C19-related protein;(source:Araport11) |
AT1G31380 | TRAF-like family protein;(source:Araport11) |
AT1G31420 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots. |
AT1G31450 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G31470 | Major facilitator superfamily protein;(source:Araport11) |
AT1G31490 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT1G31500 | HESP identified based on similarity to nocturnins and presence circadian regulatory elements in the promoter. It functions as a Mg(II) dependent poly(A) exoribonuclease.It is under circadian regulation and expressed at night. Knockdowns affect the regulation of circadian genes CCA1 and TOC1. |
AT1G31520 | hypothetical protein;(source:Araport11) |
AT1G31530 | Deadenylase. |
AT1G31550 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G31580 | Encodes cell wall protein. ECS1 is not a Xcc750 resistance gene, but the genetic data indicate that ECS1 is linked to a locus influencing resistance to Xcc750. The mRNA is cell-to-cell mobile. |
AT1G31630 | AGAMOUS-like 86;(source:Araport11) |
AT1G31670 | Copper amine oxidase family protein;(source:Araport11) |
AT1G31710 | Copper amine oxidase family protein;(source:Araport11) |
AT1G31720 | chitin synthase, putative (DUF1218);(source:Araport11) |
AT1G31760 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
AT1G31780 | Encodes a component of the oligomeric Golgi (COG) complex. Found in pollen golgi apparatus. Loss of function results in defects in pollen tube growth resulting in lack of transmission through the pollen. |
AT1G31812 | Acyl-CoA-binding protein. Bind acyl-CoA esters and protect acyl-CoAs from degradation by microsomal acyl-hydrolases. Plays a role in determining seed oil content. |
AT1G31830 | Encodes POLYAMINE UPTAKE TRANSPORTER 2, an amino acid permease family protein. |
AT1G31850 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G31860 | encodes a bifunctional protein that has phosphoribosyl-ATP pyrophosphohydrolase (PRA-PH) and phosphoribosyl-AMP cyclohydrolase (PRA-CH) activities. |
AT1G31870 | Ortholog of yeast BUD13 RES complex protein. Functions in pre mRNA processing of RNAs expressed in embryos. |
AT1G31885 | NOD26-like intrinsic protein 3;(source:Araport11) |
AT1G31910 | GHMP kinase family protein;(source:Araport11) |
AT1G31935 | Has been identified as a translated small open reading frame by ribosome profiling. |
AT1G31960 | hypothetical protein;(source:Araport11) |
AT1G31970 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT1G31983 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT1G31990 | transmembrane protein;(source:Araport11) |
AT1G32030 | plant-specific B3-DNA-binding domain protein (DUF313);(source:Araport11) |
AT1G32090 | early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
AT1G32100 | Encodes a pinoresinol reductase involved in lignan biosynthesis. Expressed strongly in roots and less strongly in stems. Shows specificity for pinoresinol and not lariciresinol. |
AT1G32150 | Encodes a G group bZIP transcription factor family member that can bind cis elements with an ACGT core, such as G-box, Hex, C-box and As-1. The protein is localized in the nucleus and can homodimerize and can heterodimerize with other G group members. |
AT1G32160 | beta-casein (DUF760);(source:Araport11) |
AT1G32172 | other_RNA;(source:Araport11) |
AT1G32180 | encodes a gene similar to cellulose synthase |
AT1G32200 | Encodes a chloroplast glycerol-3-phosphate acyltransferase.Involved in the biosynthesis of chloroplast phosphatidylglycerol. |
AT1G32230 | Encodes a protein belonging to the (ADP-ribosyl)transferase domain-containing subfamily of WWE protein-protein interaction domain protein family. Superoxide radicals are necessary and sufficient to propagate cell death or lesion formation in rcd1 mutants. Without stress treatment, RCD1 is localized in the nucleus. Under high salt or oxidative stress, RCD1 is found not only in the nucleus but also in the cytoplasm. The mRNA is cell-to-cell mobile. |
AT1G32240 | Encodes a member of the KANADI family of putative transcription factors. Together with KAN1, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN1 and KAN4 appears to regulate the proper localization of PIN1 in early embryogenesis. |
AT1G32250 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT1G32270 | member of SYP2 Gene Family |
AT1G32310 | Encodes a plant-specific negative regulator of the APC/C complex. It is expressed during embryogenesis and early plant development and plays a key role in organ size control. Mutants are defective in mitosis I of pollen development, resulting in pollen without sperm nuclei. |
AT1G32320 | member of MAP Kinase Kinase |
AT1G32337 | hypothetical protein;(source:Araport11) |
AT1G32361 | Putative RING-H2 finger protein ATL1F precursor. |
AT1G32390 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
AT1G32460 | hypothetical protein;(source:Araport11) |
AT1G32470 | Single hybrid motif superfamily protein;(source:Araport11) |
AT1G32510 | NAC domain containing protein 11;(source:Araport11) |
AT1G32520 | TLDc domain protein;(source:Araport11) |
AT1G32540 | Encodes a protein with 3 plant-specific zinc finger domains that acts as a positive regulator of cell death. |
AT1G32600 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT1G32640 | Encodes a MYC-related transcriptional activator with a typical DNA binding domain of a basic helix-loop-helix leucine zipper motif. Binds to an extended G-Box promoter motif and interacts with Jasmonate ZIM-domain proteins. MYC2 interacts with EIN3 and EIL1 to repress hook curvature and resistance to Botrytis cinera.Its transcription is induced by dehydration stress, ABA treatment and blue light via CRY1. Negative regulator of blue light-mediated photomorphogenic growth and blue and far-red-light-regulated gene expression. Positive regulator of lateral root formation. Regulates diverse JA-dependent functions. Negatively regulates Trp metabolism and biosynthesis of Trp-derived secondary metabolites. Positively regulates flavonoid biosynthesis, resistance to insects, and response to oxidative stress. Regulates other transcription factors, and negatively regulates its own expression. For example it binds to and regulates the expression of NST1. Its stability is modulated by PUB10 through polyubiquitination. |
AT1G32680 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G35880.1);(source:TAIR10) |
AT1G32700 | PLATZ transcription factor family protein;(source:Araport11) |
AT1G32730 | electron carrier/iron ion-binding protein;(source:Araport11) |
AT1G32763 | Encodes a defensin-like (DEFL) family protein. |
AT1G32780 | GroES-like zinc-binding dehydrogenase family protein;(source:Araport11) |
AT1G32790 | RNA-binding protein, putative, similar to RNA-binding protein GB:CAB40027 GI:4539439 from (Arabidopsis thaliana).Member of a family of PAB2 binding domain proteins. |
AT1G32850 | ubiquitin-specific protease 11;(source:Araport11) |
AT1G32860 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT1G32870 | Expression in rosette leaves is activated by high concentration of boron. |
AT1G32880 | ARM repeat superfamily protein;(source:Araport11) |
AT1G32890 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-37 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT1G32910 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT1G32920 | hypothetical protein;(source:Araport11) |
AT1G32928 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
AT1G32930 | Galactosyltransferase family protein;(source:Araport11) |
AT1G32960 | Subtilase family protein;(source:Araport11) |
AT1G32970 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
AT1G32975 | hypothetical protein;(source:Araport11) |
AT1G32980 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
AT1G33010 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G33020 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G33030 | O-methyltransferase family protein;(source:Araport11) |
AT1G33055 | hypothetical protein;(source:Araport11) |
AT1G33060 | NAC 014;(source:Araport11) |
AT1G33170 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G33220 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT1G33230 | TMPIT-like protein;(source:Araport11) |
AT1G33240 | Encodes a plant transcriptional activator that contains two separate, but similar, trihelix DNA-binding domains, similar to GT-2. Gene is expressed in all aerial parts of the plant, with higher level of expression in siliques. At-GTL2 was thought to be a duplicated copy of this gene but is likely to be a cloning artefact, the result of a chimeric clone. Regulates ploidy-dependent cell growth in trichome. |
AT1G33265 | Encodes a chloroplast membrane-localized fatty acid exporter that plays a critical roles in transporting plastid fatty acids for TAG biosynthesis during seed and embryo development. |
AT1G33290 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G33320 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT1G33340 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
AT1G33350 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G33380 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.1e-10 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G33400 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT1G33440 | Major facilitator superfamily protein;(source:Araport11) |
AT1G33470 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G33490 | E3 ubiquitin-protein ligase;(source:Araport11) |
AT1G33500 | tropomyosin;(source:Araport11) |
AT1G33530 | F-box family protein;(source:Araport11) |
AT1G33540 | serine carboxypeptidase-like 18;(source:Araport11) |
AT1G33600 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT1G33640 | hypothetical protein;(source:Araport11) |
AT1G33670 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT1G33700 | Beta-glucosidase, GBA2 type family protein;(source:Araport11) |
AT1G33710 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT1G33720 | cytochrome P450, family 76, subfamily C, polypeptide 6;(source:Araport11) |
AT1G33730 | cytochrome P450, family 76, subfamily C, polypeptide 5;(source:Araport11) |
AT1G33740 | pseudogene of TCP-1/cpn60 chaperonin family protein;(source:Araport11) |
AT1G33785 | pseudogene of photosynthetic electron transfer B;(source:Araport11) |
AT1G33790 | jacalin lectin family protein;(source:Araport11) |
AT1G33800 | Encodes a glucuronoxylan(GX)-specific 4-O-methyltransferase responsible for methylating GlcA residues in GX. Reduced methylation of GX ingxmt1-1 plants is correlated with altered lignin composition. The mRNA is cell-to-cell mobile. |
AT1G33813 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.8e-39 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT1G33820 | hypothetical protein;(source:Araport11) |
AT1G33840 | LURP-one-like protein (DUF567);(source:Araport11) |
AT1G33910 | One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance. |
AT1G33930 | One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance. |
AT1G33950 | Avirulence induced gene (AIG1) family protein;(source:Araport11) |
AT1G33960 | Identified as a gene that is induced by avirulence gene avrRpt2 and RPS2 after infection with Pseudomonas syringae pv maculicola strain ES4326 carrying avrRpt2 |
AT1G33970 | IAN9 is a member of a small family of proteins. It's expression is repressed upon pathogen infection and loss of function mutants show increased resistance to bacterial pathogens. |
AT1G34050 | Ankyrin repeat family protein;(source:Araport11) |
AT1G34060 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT1G34070 | Copia-like polyprotein/retrotransposon;(source:Araport11) |
AT1G34100 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
AT1G34110 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
AT1G34140 | polyadenylate-binding protein, putative / PABP, putative, non-consensus splice donor TA at exon 1; similar to polyadenylate-binding protein (poly(A)-binding protein) from (Triticum aestivum) GI:1737492, (Nicotiana tabacum) GI:7673355, {Arabidopsis thaliana} SP:P42731; contains InterPro entry IPR000504: RNA-binding region RNP-1 (RNA recognition motif) (RRM). Only member of the class IV PABP family. |
AT1G34160 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G34180 | NAC domain containing protein 16;(source:Araport11) |
AT1G34220 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
AT1G34260 | Encodes a protein that is predicted to act as a phosphatidylinositol-3P 5-kinase, but, because it lacks a FYVE domain, it is unlikely to be efficiently targeted to membranes containing the porposed phosphatidylinositol-3P substrate. Therefore, its molecular function remains unknown. The mRNA is cell-to-cell mobile. |
AT1G34290 | receptor like protein 5;(source:Araport11) |
AT1G34310 | auxin response factor 12;(source:Araport11) |
AT1G34355 | Encodes PS1 (Parallel Spindle 1). Mutations in PS1 lead to diploid male spores, diploid pollen grains, and spontaneous triploid plants in the next generation. Female meiosis is not affected in the mutants. |
AT1G34420 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
AT1G34470 | magnesium transporter, putative (DUF803);(source:Araport11) |
AT1G34480 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G34490 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
AT1G34500 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
AT1G34530 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 7.8e-116 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G34540 | member of CYP94D |
AT1G34550 | transmembrane protein (DUF616);(source:Araport11) |
AT1G34570 | Essential protein Yae1, N-terminal;(source:Araport11) |
AT1G34575 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G34580 | Major facilitator superfamily protein;(source:Araport11) |
AT1G34650 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
AT1G34660 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.1e-114 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
AT1G34750 | Protein phosphatase 2C family protein;(source:Araport11) |
AT1G34760 | Encodes a 14-3-3 protein. Binds H+-ATPase in response to blue light. |
AT1G34790 | Encodes a zinc finger protein; involved in photomorphogenesis, flavonoid biosynthesis, flower and seed development. |
AT1G34904 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-90 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
AT1G35050 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-61 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
AT1G35115 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.1e-168 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT1G35170 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
AT1G35183 | zinc finger, C3HC4 type (RING finger) protein;(source:Araport11) |
AT1G35200 | pseudogene of Ribosomal protein L4/L1 family;(source:Araport11) |
AT1G35210 | hypothetical protein;(source:Araport11) |
AT1G35230 | Encodes arabinogalactan-protein (AGP5). The mRNA is cell-to-cell mobile. |
AT1G35310 | MLP-like protein 168;(source:Araport11) |
AT1G35330 | RING/U-box superfamily protein;(source:Araport11) |
AT1G35340 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
AT1G35350 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT1G35360 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.5e-38 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT1G35420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G35430 | transmembrane protein;(source:Araport11) |
AT1G35440 | cyclin T1;(source:Araport11) |
AT1G35460 | Encodes a bHLH transcription factor involved in CFL1-mediated regulation of cuticle development. Overexpression leads to abnormal cuticle development. |
AT1G35465 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-27 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G35467 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT1G35470 | Encodes a homologue of human RanBPM that belongs to the uncharacterized family of plant SPRY, LisH, CTLH and CRA domain-containing proteins. |
AT1G35530 | Encodes FANCM, a highly conserved helicase that functions as a major factor limiting meiotic crossover formation. It is not directly involved in the repair of DNA lesions but suppresses spontaneous somatic homologous recombination via a RecQ helicase (At-RECQ4A)-independent pathway. |
AT1G35535 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-252 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G35570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
AT1G35580 | CINV1 / A/N-InvG is an alkaline/neutral invertase that breaks sucrose down into fructose and glucose (GH100). The exact localization of CINV1 remains under investigation but there is evidence that fluorescently-tagged CINV1 localizes to the cytoplasm. atinvg mutants have reduced root growth, reduced invertase activity, and increased expression of antioxidant genes under basal conditions. The levels of CINV1 / A/N-InvG transcripts rise in response to a hydrogen peroxide treatment. The protein has been shown to interact with PIP5K9. |
AT1G35670 | Encodes a Ca(2+)-dependent, calmodulin-independent protein kinase that is rapidly induced by drought and high-salt stress but not by low-temperature stress or heat stress. Positive regulator of ABA signaling. Phosphorylates ABA responsive transcription factors ABF1 and ABF4. |
AT1G35680 | Encodes a chloroplast ribosomal protein L21 that is required for chloroplast development and embryogenesis. The mRNA is cell-to-cell mobile. |
AT1G35710 | kinase family with leucine-rich repeat domain-containing protein;(source:Araport11) |
AT1G35730 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT1G35740 | pseudogene of glucan synthase-like 9;(source:Araport11) |
AT1G35750 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT1G35780 | N-lysine methyltransferase;(source:Araport11) |
AT1G35790 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.3e-42 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G35830 | VQ motif-containing protein;(source:Araport11) |
AT1G35860 | TOC75 pseudogene due to a 5.4-kb gypsy/Ty3-related retrotransposon inserted at the 5' end of the gene |
AT1G35910 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G36060 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.Overexpression results in increased drought tolerance and vitrified leaves. Binds to DRE/GCC promoter elements and activates expression of aquaporin genes AtTIP1;1, AtTIP2;3, and AtPIP2;2. |
AT1G36070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G36105 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.7e-33 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT1G36110 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.2e-59 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT1G36160 | Encodes acetyl-CoA carboxylase. Mutant displays uncoordinated cell divisions which are enhanced by cytokinins. Mutant also has aberrant organization of the apical region in the embryo and abnormal root and shoot development and is deficient in freezing tolerance after cold acclimation. Essential for very long chain fatty acid elongation. The mRNA is cell-to-cell mobile. |
AT1G36180 | acetyl-CoA carboxylase 2 (ACC2) The mRNA is cell-to-cell mobile. |
AT1G36190 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 8.5e-119 P-value blast match to At1g36190.1/92-340 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G36220 | pseudogene of seryl-tRNA synthetase / serine-tRNA ligase;(source:Araport11) |
AT1G36260 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 4.2e-91 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G36300 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-218 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G36360 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.4e-39 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G36406 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.1e-26 P-value blast match to O80466 /172-336 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT1G36420 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 0.00011 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT1G36440 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains Pfam profile PF03384: Drosophila protein of unknown function, DUF287;(source:TAIR10) |
AT1G36510 | Nucleic acid-binding proteins superfamily;(source:Araport11) |
AT1G36670 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G37050.1);(source:TAIR10) |
AT1G36730 | Translation initiation factor IF2/IF5;(source:Araport11) |
AT1G36880 | pseudogene of FAR1-related sequence 5;(source:Araport11) |
AT1G36933 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.2e-15 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
AT1G36936 | transposable_element_gene;(source:Araport11);pseudogene, similar to Putative copia-type polyprotein, blastp match of 43%25 identity and 2.1e-28 P-value to GP|15209144|gb|AAK91877.1|AC091665_3|AC091665 Putative copia-type polyprotein {Oryza sativa};(source:TAIR10) |
AT1G36960 | hypothetical protein;(source:Araport11) |
AT1G37080 | transposable_element_gene;(source:Araport11);similar to DNA binding [Arabidopsis thaliana] (TAIR:AT4G01980.1);(source:TAIR10) |
AT1G37120 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 8.3e-14 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G37140 | Amember of mei2-like gene family; phylogenetic analysis revealed that it belongs to the fourth clade of mei2-like proteins, with conserved C-terminal RNA recognition motif (RRM) only. MCT1 expression is increased in the presence of ABA and RNAi suppression showed increased germination rates in the presence of ABA. |
AT1G37150 | Although HCS2 is predicted to encode a biotin protein ligase / holocarboxylase synthetase (HCS), hcs2 mutants do not show a decrease in HCS activity. A dual-targeted HCS1 (At2g25710) might account for the HCS activity observed in multiple subcellular compartments in Arabidopsis. |
AT1G38185 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-21 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G38430 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 9.8e-109 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G38440 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 6.0e-121 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G40104 | hypothetical protein;(source:Araport11) |
AT1G41760 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 7.1e-11 P-value blast match to GB:226407 retrotransposon del1-46 (Gypsy_Ty3-element) (Lilium henryi);(source:TAIR10) |
AT1G41830 | SKU5-similar 6;(source:Araport11) |
AT1G41835 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-96 P-value blast match to GB:BAA22288 pol polyprotein (Ty1_Copia-element) (Oryza australiensis)GB:BAA22288 polyprotein (Ty1_Copia-element) (Oryza australiensis)gi|2443320|dbj|BAA22288.1| polyprotein (RIRE1) (Oryza australiensis) (Ty1_Copia-element);(source:TAIR10) |
AT1G41860 | transposable_element_gene;(source:Araport11);contains InterPro domain Retrotransposon gag protein;(source:TAIR10) |
AT1G42120 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
AT1G42240 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G42310 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G42350 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.1e-102 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G42400 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G35090.1);(source:TAIR10) |
AT1G42480 | TLR4 regulator/MIR-interacting MSAP protein;(source:Araport11) |
AT1G42490 | pseudogene of glutamate dehydrogenase 2;(source:Araport11) |
AT1G42550 | Encodes a plant-specific protein of unknown function that appears to be conserved among angiosperms. The mRNA is cell-to-cell mobile. |
AT1G42560 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO9 belongs to the clade III, with AtMLO5, AtMLO7, AtMLO8, and AtMLO10. The gene is expressed during early seedling growth, in cotyledon vascular system, in flowers (with strong expression in anthers) in siliques and fruit abscission zone; not expressed in roots, or in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT1G42700 | hypothetical protein;(source:Araport11) |
AT1G42703 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-08 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
AT1G42970 | Encodes chloroplast localized glyceraldehyde-3-phosphate dehydrogenase that can use both NADH and NADPH to reduce 1,3-diphosphate glycerate. It forms A2B2 heterotetramers with GapA forms of the GADPH enzyme. These complexes are active in the light under reducing conditions, but show reduced NADPH-dependent activity in response to oxidized thioredoxins and increased NAD(H)/NADP(H) ratios due to the formation of inactive A8B8 hexadecamers. The mRNA is cell-to-cell mobile. |
AT1G42980 | Actin-binding FH2 (formin homology 2) family protein;(source:Araport11) |
AT1G42990 | bZIP60 consists of a bZIP DNA binding domain followed by a putative transmembrane domain. bZIP60 mRNA is upregulated by the addition of ER stress inducers, tunicamycin (inhibitor of N-linked glycosylation), DTT (inhibitor of disulfide bond formation) and azetin-2-carboxylate (proline analog perturbing protein structure). Upon ER stress, bZIP60 mRNA is spliced by IRE1A and IRE1B to produce bZIP60-S, an active transcription factor without the transmembrane domain. bZIP60-U, a product of unspliced form of bZIP60 mRNA, is localized at the ER membrane and bZIP60-S is localized in the nucleus. |
AT1G43000 | PLATZ transcription factor family protein;(source:Araport11) |
AT1G43010 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G43020 | electron protein, putative (Protein of unknown function, DUF547);(source:Araport11) |
AT1G43030 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.1e-109 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT1G43040 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G43130 | like COV 2;(source:Araport11) |
AT1G43171 | B3 domain protein;(source:Araport11) |
AT1G43575 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-34 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT1G43580 | Sphingomyelin synthetase family protein;(source:Araport11) |
AT1G43630 | plant/protein (DUF793);(source:Araport11) |
AT1G43640 | Member of TLP family of tubby like proteins that also contain an F-Box. |
AT1G43650 | nodulin MtN21-like transporter family protein |
AT1G43670 | Encodes a fructose-1,6-bisphosphatase. This enzyme, in addition to catalyzing the formation of fructose-6-phosphate for sucrose biosynthesis, appears to play a role in fructose-mediated signaling that is independent of its enzymatic activity. atcfbp-1/fins1 mutants have reduced photosynthetic rates, elevated levels of starch and reduced levels of sucrose during the day. Although the protein is expected to be cytosolic, a GFP-tagged version localizes to the cytoplasm and the nucleus. The mRNA is cell-to-cell mobile. |
AT1G43700 | Encodes a VirE2-interacting protein. VIP1 mediates nuclear translocation of VirE2 via its amino half, and interacts with histone H2A via it carboxyl half. Involved in osmosensory response. The mRNA is cell-to-cell mobile. |
AT1G43715 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-130 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT1G43775 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-147 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT1G43780 | serine carboxypeptidase-like 44;(source:Araport11) |
AT1G43781 | Pseudogene of AT1G53790; F-box family protein |
AT1G43785 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.7e-174 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT1G43790 | tracheary element differentiation-related 6;(source:Araport11) |
AT1G43810 | hypothetical protein;(source:Araport11) |
AT1G43835 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 2.7e-63 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
AT1G43886 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.3e-165 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT1G43895 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
AT1G43910 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G44080 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
AT1G44130 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G44160 | HSP40/DnaJ peptide-binding protein;(source:Araport11) |
AT1G44170 | Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. It is also able to oxidize beta-unsaturated aldehydes, but not aromatic aldehydes. Activity of ALDH3H1 is NAD +-dependent. |
AT1G44180 | Peptidase M20/M25/M40 family protein;(source:Araport11) |
AT1G44191 | Encodes a ECA1 gametogenesis related family protein |
AT1G44224 | Encodes a ECA1 gametogenesis related family protein |
AT1G44382 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT1G44414 | zinc-ribbon domain protein;(source:Araport11) |
AT1G44542 | Cyclase family protein;(source:Araport11) |
AT1G44575 | Encoding PSII-S (CP22), a ubiquitous pigment-binding protein associated with photosystem II (PSII) of higher plants. Involved in nonphotochemical quenching rather than in photosynthesis. Mutant has a normal violaxanthin cycle but has a limited capacity of quenching singlet excited chlorophylls and is tolerant to lipid peroxidation. |
AT1G44750 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
AT1G44760 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT1G44800 | Encodes Siliques Are Red 1 (SIAR1). Functions as a bidirectional amino acid transporter that is crucial for the amino acid homeostasis of siliques. Member of nodulin MtN21-like transporter family. |
AT1G44830 | Encodes a nuclear-localized member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. Overexpression in cultured cells results in an increase in pectin deposition.ERF014 differentially regulates responses to bacterial and fungal pathogens. |
AT1G44920 | transmembrane protein;(source:Araport11) |
AT1G44941 | hypothetical protein;(source:Araport11) |
AT1G45000 | AAA-type ATPase family protein;(source:Araport11) |
AT1G45010 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
AT1G45015 | MD-2-related lipid recognition domain-containing protein;(source:Araport11) |
AT1G45050 | member of ubiquitin-conjugating E2-proteins |
AT1G45063 | copper ion binding / electron carrier protein;(source:Araport11) |
AT1G45110 | Tetrapyrrole (Corrin/Porphyrin) Methylase;(source:Araport11) |
AT1G45130 | beta-galactosidase 5;(source:Araport11) |
AT1G45140 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.4e-37 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G45145 | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. |
AT1G45150 | alpha-1,6-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase;(source:Araport11) |
AT1G45180 | RING/U-box superfamily protein;(source:Araport11) |
AT1G45190 | downregulated in DIF1 18;(source:Araport11) |
AT1G45191 | beta-glucosidase related protein, similar to beta-glucosidase GI:3820531 from (Pinus contorta); contains Pfam profile: PF00232 Glycosyl hydrolase family 1 |
AT1G45207 | Remorin family protein;(source:Araport11) |
AT1G45243 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G45545 | WEAK CHLOROPLAST MOVEMENT UNDER BLUE LIGHT-like protein (DUF827);(source:Araport11) |
AT1G45616 | receptor like protein 6;(source:Araport11) |
AT1G45688 | CC1 is a plant specific gene that interacts with with the cellulose synthase complex and microtubules. It appears to play a role in localizing CESA to the membrane, microtuble dynamics , particularly during salt stress. |
AT1G46048 | pseudogene of hypothetical protein;(source:Araport11) |
AT1G46192 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 7.4e-69 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G46264 | Encodes SCHIZORIZA, a member of Heat Shock Transcription Factor (Hsf) family. Functions as a nuclear factor regulating asymmetry of stem cell divisions. |
AT1G46480 | Encodes WOX4, a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. This protein also contains an acidic domain approximately 10 residues upstream of the WUS box. Part of the TDIF-TDR-WOX4 signaling pathway that plays a crucial role in the maintenance of the vascular meristem organization during secondary growth. WOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation. |
AT1G46552 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.6e-184 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G46768 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.1). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.9 and RAP2.10. |
AT1G46840 | F-box family protein;(source:Araport11) |
AT1G46912 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT1G46984 | F-box family protein;(source:Araport11) |
AT1G47128 | Cysteine proteinase precursor-like protein/ dehydration stress-responsive gene (RD21). Has been shown to have peptide ligase activity and protease activity in vitro. RD21 is involved in immunity to the necrotrophic fungal pathogen Botrytis cinerea.Activity detected in root, leaf, flower and cell culture. |
AT1G47200 | WPP family members contains an NE targeting domain. This domain, called the WPP domain after a highly conserved Trp-Pro-Pro motif, is necessary for NE targeting of WPP1. RNAi suppression of WPP2 resulted in reduced mitotic activity. |
AT1G47220 | Cyclin A3;(source:Araport11) |
AT1G47240 | Encodes a member of the NRAMP2 gene family of metal ion transporters that is required for root growth at low Mn conditions. NRAMP2 is mainly localized to TGN and has influx transport activity of Mn in yeast. Mutation of NRAMP2 impaired root growth, although there was greater Mn retention in the roots under Mn-deficient conditions. |
AT1G47250 | Encodes 20S proteasome subunit PAF2 (PAF2). |
AT1G47265 | hypothetical protein;(source:Araport11) |
AT1G47271 | Cystathionine beta-synthase (CBS) family protein;(source:Araport11) |
AT1G47290 | Encodes an enzyme with 3β-hydroxysteroid dehydrogenase/C4-decarboxylase activity in vitro. The activity of the enzyme was determined using microsomal extracts of yeast overexpressing the Arabidopsis gene. Cytosolic fractions failed to be associated to the activity, leading to the speculation that the enzyme is membrane-bound. |
AT1G47317 | Encodes a defensin-like (DEFL) family protein. |
AT1G47340 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G47350 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT1G47370 | RBA1 variant in Ag0 background is a TIR-only receptor protein that binds to the bacterial type III effector protein HopBA. The Col-0 variant, which is not expressed, is likely a psuedogene and more highly methylated than the Ag0 variant which is expressed. |
AT1G47380 | Protein phosphatase 2C family protein;(source:Araport11) |
AT1G47389 | transmembrane protein;(source:Araport11) |
AT1G47510 | Encodes a phosphatidylinositol polyphosphate 5-phosphatase. It can dephosphorylate PI(4,5)P2, PI(3,5)P2, and PI(3,4,5)P3, but, it is not active against PI(5)P or the water soluble inositol(1,4,5)P3 or inositol(1,3,4,5)P4. The transcript levels for this gene rise in response to auxin, ABA, and JA. |
AT1G47530 | MATE efflux family protein;(source:Araport11) |
AT1G47550 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. It binds phosphoinositide lipids. |
AT1G47570 | RING/U-box superfamily protein;(source:Araport11) |
AT1G47578 | Redundant octanoyltransferase involved in fatty acid synthesis. |
AT1G47590 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.Previously annotated as pseudogene, evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT1G47603 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
AT1G47625 | pseudogene of seven transmembrane domain protein |
AT1G47705 | pseudogene of F-box/RNI/FBD-like domain protein;(source:Araport11) |
AT1G47710 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
AT1G47760 | AGAMOUS-like 102;(source:Araport11) |
AT1G47770 | Beta-galactosidase related protein;(source:Araport11) |
AT1G47780 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G47840 | Encodes a putative hexokinase. |
AT1G47880 | pseudogene of receptor like protein 6;(source:Araport11) |
AT1G47885 | Ribonuclease inhibitor;(source:Araport11) |
AT1G47890 | receptor like protein 7;(source:Araport11) |
AT1G47940 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G47960 | Plant cell wall (CWI) and vacuolar invertases (VI) play important roles in carbohydrate metabolism, stress responses and sugar signaling. This protein may inhibit their activity. |
AT1G47980 | desiccation-like protein;(source:Araport11) |
AT1G47990 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins. AtGA2OX4 expression is responsive to cytokinin and KNOX activities. |
AT1G48000 | Encodes a putative transcription factor (MYB112). |
AT1G48180 | target of trans acting-siR480/255 protein;(source:Araport11) |
AT1G48220 | Protein kinase superfamily protein;(source:Araport11) |
AT1G48230 | Nucleotide/sugar transporter family protein |
AT1G48250 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G35400.1);(source:TAIR10) |
AT1G48260 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.21), which has also been reported as a member of the CBL-interacting protein kinases (CIPK17). |
AT1G48270 | encodes a protein similar to G-coupled receptor with 7 transmembrane regions. Overexpression studies suggest this gene is involved in dormancy and flowering. Reduction of expression results in decreased sensitivity to cytokinin. |
AT1G48280 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G48300 | Cytosolic iron-sulfur protein with a [2Fe-2S] cluster which synthesizes triacylglycerol (DGAT activity). |
AT1G48340 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G48360 | Encodes a FAN1 homolog that is involved in interstrand crosslink repair. FAN1 appears to act in in a different pathway from MUS81 but in similar pathway with RECQ4A, RAD5A and MFH1. |
AT1G48380 | Encodes a novel nuclear protein required for root hair initiation and ploidy-dependent cell growth. Its sequence has similarity to the C-terminal domain of mammalian DNA topo IIalpha. Shows in vitro DNA binding activity and is likely to be part of the topo VI complex by binding to subunit A. |
AT1G48400 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT1G48405 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
AT1G48410 | Encodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus. |
AT1G48422 | Encodes a defensin-like (DEFL) family protein. |
AT1G48450 | alanine-tRNA ligase, putative (DUF760);(source:Araport11) |
AT1G48480 | Arabidopsis thaliana receptor-like protein kinase (RKL1) gene |
AT1G48490 | Protein kinase which together with IREH1 plays an important role in controlling root skewing and maintaining the microtubule network. |
AT1G48510 | Encodes one of two Arabidopsis mitochondrial proteins similar to human SURF1 which is known to be involved in cytochrome c oxidase assembly. Mutations result in defects in hypocotyl elongation and changes in GA homeostasis. |
AT1G48520 | Encodes Glu-tRNA(Gln) amidotransferase subunit B (from Genbank record AF239836). |
AT1G48530 | proteasome inhibitor-like protein;(source:Araport11) |
AT1G48540 | Outer arm dynein light chain 1 protein;(source:Araport11) |
AT1G48610 | AT hook motif-containing protein;(source:Araport11) |
AT1G48630 | Encodes a protein with similarity to mammalian RACKs. RACKs function to shuttle activated protein kinase C to different subcellular sites and may also function as a scaffold through physical interactions with other proteins. RACK1B has no phenotype on its own and probably acts redundantly with RACK1A and RACK1C. |
AT1G48640 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT1G48660 | Auxin-responsive GH3 family protein;(source:Araport11) |
AT1G48670 | auxin-responsive GH3 family protein;(source:Araport11) |
AT1G48745 | hypothetical protein;(source:Araport11) |
AT1G48810 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.2e-46 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G48830 | Ribosomal protein S7e family protein;(source:Araport11) |
AT1G48870 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G48900 | Signal recognition particle, SRP54 subunit protein;(source:Araport11) |
AT1G48953 | hypothetical protein;(source:Araport11) |
AT1G48970 | NagB/RpiA/CoA transferase-like superfamily protein;(source:Araport11) |
AT1G48980 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT1G48990 | Oleosin family protein;(source:Araport11) |
AT1G49000 | transmembrane protein;(source:Araport11) |
AT1G49005 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. |
AT1G49010 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
AT1G49032 | hypothetical protein;(source:Araport11) |
AT1G49050 | Encodes a member of the aspartyl protease family. Interacts with BAGP1 and BAG6 and appears to be required for cleavage of BAG6 as BAG6 is not cleaved in APCB1 mutant backgrounds. |
AT1G49100 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G49110 | hypothetical protein;(source:Araport11) |
AT1G49180 | protein kinase family protein;(source:Araport11) |
AT1G49190 | member of Response Regulator: B- Type |
AT1G49200 | RING/U-box superfamily protein;(source:Araport11) |
AT1G49240 | Member of a subclass of actins composed of ACT2 and ACT8. Its mRNA is strongly expressed in strongly expressed in leaves, roots, stems, flowers, pollen, and siliques. However, protein expression, assayed by a ACT8:GUS fusion reporter, is very low in pollen. |
AT1G49250 | ATP-dependent DNA ligase;(source:Araport11) |
AT1G49260 | mechanosensitive ion channel-like protein;(source:Araport11) |
AT1G49270 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT1G49280 | pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10) |
AT1G49290 | Paternally expressed gene that is localized around the sperm nuclei of pollen. PEG2 acts as a sponge for siRNA854 during endosperm development, this action is necessary to induce triploid seed abortion. |
AT1G49310 | transmembrane protein;(source:Araport11) |
AT1G49350 | PsiMP Glycosylase (PUMY) that hydrolyzes PsiMP to uracil and ribose-5-phosphate. Acts together with PUMY in the peroxisome to prevent toxic pseudouridine monophosphate accumulation. Acts together with the a pseudouridine kinase PUKI in the peroxisome to prevent toxic pseudouridine monophosphate accumulation. |
AT1G49390 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT1G49430 | Encodes a long chain acyl-CoA synthetase that catalyzes the synthesis of omega-hydroxy fatty acyl-CoA intermediates in the pathway to cutin synthesis. Required for repression of lateral root formation. |
AT1G49450 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G49470 | transmembrane epididymal protein (DUF716);(source:Araport11) |
AT1G49520 | SWIB complex BAF60b domain-containing protein;(source:Araport11) |
AT1G49530 | encodes a mitochondria-targeted geranylgeranyl pyrophosphate synthase |
AT1G49560 | Homeodomain-like superfamily protein;(source:Araport11) |
AT1G49570 | Peroxidase superfamily protein;(source:Araport11) |
AT1G49580 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
AT1G49610 | F-box family protein;(source:Araport11) |
AT1G49620 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Binds to D type cyclins and may inhibit cell cycle. |
AT1G49720 | Identified as a protein that binds to abscisic acid response elements. May mediate transcriptional regulation of ABA responses. |
AT1G49730 | Protein kinase superfamily protein;(source:Araport11) |
AT1G49740 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
AT1G49750 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT1G49770 | Encodes a member of the basic helix loop helix family of transcription factors. Loss of RGE1 function causes shriveled seeds that contain small embryos. The cuticle in the embryos does not develop normally, possible due to the adeherence of the endosperm to the developing embryo. RGE1 is expressed in the endosperm surrounding region which directly surrounds the developing embryo, however it exerts its effect non autonomously- in the developing embryo. Mutant seedlings are extremely sensitive to desiccation due to the abnormal cuticle. Together with ICE1, ZOU determines primary seed dormancy depth independently of their joint role in endosperm development. |
AT1G49800 | Homolog of PIP1. |
AT1G49850 | RING/U-box superfamily protein;(source:Araport11) |
AT1G49880 | Encodes Erv1, a component of the mitochondrial intermembrane space assembly machinery involved in the import pathway of the small intermembrane space proteins. It contains a Cys-X-Cys shuttle disulfide and oxidizes thioredoxin in vitro. Flavoenzyme-encoding gene. |
AT1G49900 | C2H2 type zinc finger transcription factor family;(source:Araport11) |
AT1G49960 | Xanthine/uracil permease family protein;(source:Araport11) |
AT1G49975 | photosystem I reaction center subunit N;(source:Araport11) |
AT1G49990 | F-box family protein;(source:Araport11) |
AT1G50020 | tubulin alpha-6 chain;(source:Araport11) |
AT1G50040 | formin-like protein, putative (DUF1005);(source:Araport11) |
AT1G50070 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
AT1G50080 | ribonuclease;(source:Araport11) |
AT1G50090 | D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein;(source:Araport11) |
AT1G50100 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
AT1G50120 | Encodes a Golgi-localized protein which regulates pollen tube growth. Required for TGN formation and Golgi structure maintenance. |
AT1G50140 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G50190 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G50200 | Alanyl-tRNA synthetase;(source:Araport11) |
AT1G50210 | pseudogene of NB-ARC domain-containing disease resistance protein;(source:Araport11) |
AT1G50220 | B3 domain protein;(source:Araport11) |
AT1G50280 | BTB/POZ protein that forms a complex with CUL3a. Involved in repression of ABA responses. |
AT1G50330 | pseudogene of methylesterase PCR A;(source:Araport11) |
AT1G50370 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
AT1G50390 | pfkB-like carbohydrate kinase family protein;(source:Araport11) |
AT1G50420 | Encodes a scarecrow-like protein (SCL3) Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay). |
AT1G50450 | Saccharopine dehydrogenase;(source:Araport11) |
AT1G50460 | Involved in glucose-ethylene crosstalk. |
AT1G50470 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT1G50480 | 10-formyltetrahydrofolate synthetase (THFS) mRNA, complete The mRNA is cell-to-cell mobile. |
AT1G50490 | Encodes one of two ubiquitin-conjugating enzymes belonging to the E2-C gene family (the other being UBC19). Transcript is always found in diving cells, but also in other non-dividing cells. |
AT1G50575 | Putative lysine decarboxylase family protein;(source:Araport11) |
AT1G50580 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G50590 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT1G50610 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G50630 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
AT1G50680 | AP2/B3 transcription factor family protein;(source:Araport11) |
AT1G50700 | Member of Calcium Dependent Protein Kinase. Mediates Strigolactone-Induced Stomatal Closure |
AT1G50732 | transmembrane protein;(source:Araport11) |
AT1G50840 | DNA Polymerase gamma2. Dual targeting to mitochondria and plastids due to alternative translation initiation. |
AT1G50870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G50900 | Encodes GDC1 (Grana Deficient Chloroplast 1), an ankyrin domain containing protein required fro chloroplast thylakoid grana formation. The mRNA is cell-to-cell mobile. |
AT1G50930 | Serine/Threonine-kinase;(source:Araport11) |
AT1G50970 | Membrane trafficking VPS53 family protein;(source:Araport11) |
AT1G51000 | hypothetical protein;(source:Araport11) |
AT1G51030 | hypothetical protein;(source:Araport11) |
AT1G51050 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT1G51080 | golgin family A protein;(source:Araport11) |
AT1G51110 | localized to chloroplasts |
AT1G51130 | δ-kleisin component of the SMC5/6 complex, possibly involved in synaptonemal complex formation. |
AT1G51150 | Encodes a putative DegP protease. |
AT1G51170 | Encodes an active AGC VIII protein kinase that interacts with the putative transcription factor ATS and regulates planar growth during integument development in the ovule. Mutants exhibit ectopic growth in filaments and petals, as well as aberrant embryogenesis. |
AT1G51190 | Encodes a member of the AINTEGUMENTA-like (AIL) subclass of the AP2/EREBP family of transcription factors and is essential for quiescent center (QC) specification and stem cell activity. It is a key effector for establishment of the stem cell niche during embryonic pattern formation. It is transcribed in response to auxin accumulation and is dependent on auxin response transcription factors. |
AT1G51210 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G51260 | ACYL-COA:1-ACYLGLYCEROL-3-PHOSPHATE ACYLTRANSFERASE, PUTATIVE SIMILAR TO ACYL-COA:1-ACYLGLYCEROL-3-PHOSPHATE ACYLTRANSFERASE GI:4583544 FROM [BRASSICA NAPUS] |
AT1G51290 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G51350 | ARM repeat superfamily protein;(source:Araport11) |
AT1G51355 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
AT1G51390 | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU4 than to NFU1,2, and 3. Targeted to the mitochondrion. The mRNA is cell-to-cell mobile. |
AT1G51410 | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), apple tree, PIR:T16995; NOT a cinnamyl-alcohol dehydrogenase |
AT1G51440 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
AT1G51460 | ABCG13 encodes a member of the ATP-binding cassette (ABC) transporter family protein. Mutants show defects in petal elongation resulting in a folded petal phenotype. |
AT1G51480 | disease resistance protein (CC-NBS-LRR class) family protein;(source:Araport11) |
AT1G51500 | Encodes an ABC transporter involved in cuticular wax biosynthesis. Lines carrying recessive mutations in this locus have weakly glaucous stem surface, and relative elevated secondary alcohols and ketones. |
AT1G51520 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G51540 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G51580 | RNA-binding KH domain-containing protein;(source:Araport11) |
AT1G51620 | Protein kinase superfamily protein;(source:Araport11) |
AT1G51630 | O-fucosyltransferase family protein;(source:Araport11) |
AT1G51645 | Natural antisense transcript overlaps with AT1G51640;(source:Araport11) |
AT1G51650 | ATP synthase epsilon chain;(source:Araport11) |
AT1G51680 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. In addition to 4-coumarate, it also converts ferulate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, ferulic acid, caffeic acid and 5-OH-ferulic acid. At4CL1 was unable to use sinapic acid as substrate. |
AT1G51700 | Encodes dof zinc finger protein (adof1). The mRNA is cell-to-cell mobile. |
AT1G51710 | Ubiquitin-specific protease 6 (UBP6). Deubiquinating enzyme. Interacts with calmodulin. |
AT1G51730 | Ubiquitin-conjugating enzyme family protein;(source:Araport11) |
AT1G51745 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
AT1G51750 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.6e-20 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G51760 | encodes a member of the six Arabidopsis IAA-amino acid conjugate hydrolase subfamily and conjugates and conjugates IAA-Ala in vitro. Gene is expressed most strongly in roots, stems, and flowers. The mRNA is cell-to-cell mobile. |
AT1G51780 | encodes a member of the six Arabidopsis IAA-amino acid conjugate hydrolase subfamily and conjugates and is very similar to IAR3. |
AT1G51790 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G51800 | The gene encodes a putative member of the LRR-RLK protein family. Expressin and mutant analysis revealed that it contributes to the interaction between Arabidopsis and Hyaloperonospora arabidopsidis. and The mRNA is cell-to-cell mobile. |
AT1G51802 | Encodes a defensin-like (DEFL) family protein. |
AT1G51805 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G51810 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G51860 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G51870 | protein kinase family protein;(source:Araport11) |
AT1G51880 | root hair specific 6;(source:Araport11) |
AT1G51890 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G51900 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
AT1G51910 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G51940 | Encodes a LysM-containing receptor-like kinase. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. Based on protein sequence alignment analysis, it has a typical RD signaling domain in its catalytic loop and possesses autophosphorylation activity.It is required for the suppression of defense responses in absence of pathogen infection or upon abscisic acid treatment. Loss-of-function mutants display enhanced resistance to Botrytis cinerea and Pectobacterium carotovorum. Its expression is repressed by pathogen infection and biological elicitors and is induced abscisic acid.Expression is strongly repressed by elicitors and fungal infection, and is induced by the hormone abscisic acid (ABA). Insertional mutants show increased expression of PHYTOALEXIN-DEFICIENT 3 (PAD3), enhanced resistance to Botrytis cinerea and Pectobacterium carotovorum infection and reduced physiological responses to ABA, suggesting that LYK3 is important for the cross-talk between signaling pathways activated by ABA and pathogens (PMID:24639336). |
AT1G51950 | indole-3-acetic acid inducible 18;(source:Araport11) |
AT1G51965 | Encodes ABA Overly-Sensitive5 (ABO5), a pentatricopeptide repeat protein required for cis-splicing of mitochondrial nad2 intron 3. Involved in response to abscisic acid. |
AT1G51990 | O-methyltransferase family protein;(source:Araport11) |
AT1G52000 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT1G52050 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT1G52060 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT1G52140 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
AT1G52150 | Member of the class III HD-ZIP protein family. Contains homeodomain and leucine zipper domain. Critical for vascular development and negatively regulates vascular cell differentiation. |
AT1G52155 | transmembrane protein;(source:Araport11) |
AT1G52185 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:TAGAATGCTATTGTAATCCAG |
AT1G52190 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
AT1G52191 | Thioesterase superfamily protein;(source:Araport11) |
AT1G52210 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-186 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G52220 | Thylakoid membrane localized protein that interacts with other CURT family proteins. Oligomerization is associated with grana thylakoid curavature. |
AT1G52230 | Phosphorylation of this protein is dependent on calcium. The mRNA is cell-to-cell mobile. |
AT1G52240 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily . |
AT1G52280 | RAB GTPase homolog G3D;(source:Araport11) |
AT1G52315 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
AT1G52325 | Initiation factor eIF-4 gamma, MA3;(source:Araport11) |
AT1G52330 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT1G52343 | Similar to GET2, transmembrane protein that interacts with GET1. |
AT1G52360 | Coatomer, beta subunit;(source:Araport11) |
AT1G52390 | hypothetical protein;(source:Araport11) |
AT1G52400 | encodes a member of glycosyl hydrolase family 1, located in inducible ER bodies which were formed after wounding, required in inducible ER body formation The mRNA is cell-to-cell mobile. |
AT1G52410 | Contains a novel calcium-binding repeat sequence. Binds TSK in vitro. Localizes to small cytoplasmic vesicles in interphase cells. In cells synchronized for cell division, TSA1 and TSK relocalize to ends of spindle microtubules that are ahead of separating chromatids during metaphase and anaphase of mitosis. May be involved in mitosis together with TSK. Expressed preferentially in the flower and shoot apex. Can form multimers. The mRNA is cell-to-cell mobile. |
AT1G52415 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G52430 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT1G52440 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G52450 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT1G52490 | F-box/associated interaction domain protein;(source:Araport11) |
AT1G52520 | FAR1-related sequence 6;(source:Araport11) |
AT1G52540 | Protein kinase superfamily protein;(source:Araport11) |
AT1G52550 | transmembrane protein;(source:Araport11) |
AT1G52560 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT1G52565 | cytochrome P450 family protein;(source:Araport11) |
AT1G52590 | Putative thiol-disulfide oxidoreductase DCC;(source:Araport11) |
AT1G52618 | hypothetical protein;(source:Araport11) |
AT1G52620 | Mitochondrial pentatricopeptide repeat protein required for stabilizing nad1 transcripts. |
AT1G52660 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G52680 | late embryogenesis abundant protein-related / LEA protein-like protein;(source:Araport11) |
AT1G52695 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G52696 | Pseudogene of AT1G52695; phospholipase/carboxylesterase family protein |
AT1G52780 | PII, uridylyltransferase (DUF2921);(source:Araport11) |
AT1G52790 | encodes a putative oxidoreductase, 2OG-Fe(II) oxygenase family protein, similar to GS-AOP loci (GI:16118889, GI:16118887, GI:16118891, GI:16118893); contains PF03171 2OG-Fe(II) oxygenase superfamily domain |
AT1G52810 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT1G52855 | hypothetical protein;(source:Araport11) |
AT1G52860 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT1G52880 | Transcription factor with a NAC domain. Homologous to the petunia gene NAM which is required for the development of the shoot. Expressed in the embryo. |
AT1G52910 | fiber (DUF1218);(source:Araport11) |
AT1G52920 | Encodes a plasma membrane?localized ABA receptor, which interacts with the Gαβγ complex. It has been postulated that the binding of ABA to GCR2 results in the release of the G protein and dissociation of the heterotrimeric complex into Gα and the Gβγ dimer to activate downstream ABA effectors and to trigger the ABA responses. |
AT1G52940 | Encodes a purple acid phosphatase that is induced under prolonged phosphate (Pi) starvation and is required for maintaining basal resistance against Pseudomonas syringae and Botrytis cinerea. |
AT1G53010 | RING/U-box superfamily protein;(source:Araport11) |
AT1G53020 | Cognate nuclear E2 enzyme that interacts with the RFA4 E3 ligase and forms UBC26-RFA4-Receptor complexes in nuclear speckles. |
AT1G53050 | Protein kinase superfamily protein;(source:Araport11) |
AT1G53060 | Legume lectin family protein;(source:Araport11) |
AT1G53070 | Legume lectin family protein;(source:Araport11) |
AT1G53090 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA4 (and SPA3) predominantly regulates elongation growth in adult plants. |
AT1G53130 | Encodes GRIM REAPER (GRI), involved in the regulation of cell death induced by extracellular ROS (reactive oxygen species). Secreted into the extracellular space. |
AT1G53163 | membrane-associated kinase regulator;(source:Araport11) |
AT1G53170 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
AT1G53180 | hypothetical protein;(source:Araport11) |
AT1G53190 | Encodes a RING-type E3 ligase that positively regulates CIN-like TCP activity to promote leaf development by mediating the degradation of the TCP repressor TIE1. |
AT1G53250 | histone-lysine N-methyltransferase, H3 lysine-79 specific-like protein;(source:Araport11) |
AT1G53260 | hypothetical protein;(source:Araport11) |
AT1G53270 | ABC-2 type transporter family protein;(source:Araport11) |
AT1G53300 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. The mRNA is cell-to-cell mobile. |
AT1G53320 | Member of plant TLP family. TLP7 is tethered to the PM but detaches upon stimulus and translocates to the nucleus. Has DNA binding activity but lacks conservation of the transcription activation domain. |
AT1G53330 | encodes a member of the pentatricopeptide repeat (PPR) gene family. T-DNA insertion mutants had a complex phenotypic expression, ranging from embryo lethal to seedling lethal, to just subtle changes. |
AT1G53360 | F-box/associated interaction domain protein;(source:Araport11) |
AT1G53380 | hypothetical protein (DUF641);(source:Araport11) |
AT1G53410 | pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10) |
AT1G53420 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
AT1G53430 | Probable LRR receptor-like ser/thr-protein kinase; Commonly-enriched candidate LPS-interacting PM-associated proteins for both LPS chemotypes subsequent to the polymyxin B affinity chromatography strategy. |
AT1G53440 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
AT1G53470 | mechanosensitive channel of small conductance-like 4;(source:Araport11) |
AT1G53540 | Member of the class I small heat-shock protein (sHSP) family, which accounts for the majority of sHSPs in maturing seeds |
AT1G53550 | F-box family protein;(source:Araport11) |
AT1G53560 | Ribosomal protein L18ae family;(source:Araport11) |
AT1G53580 | Mononuclear Fe(II)-containing member of the b-lactamase fold superfamily. ETHE1 is homodimeric in solution, exhibits low-level esterase activity, and specifically binds a single Fe(II) atom in the active site. |
AT1G53590 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT1G53610 | transmembrane protein;(source:Araport11) |
AT1G53625 | hypothetical protein;(source:Araport11) |
AT1G53640 | transmembrane protein;(source:Araport11) |
AT1G53650 | RNA-binding protein, putative, similar to RNA-binding protein GB:AAA86641 GI:1174153 from (Arabidopsis thaliana).Contains PAB2 domain which facilitates binding to PABC proteins. |
AT1G53660 | Nucleotide/sugar transporter family protein |
AT1G53690 | Protein of unknown function that is homologous to At5g41010, which encodes a non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB12. |
AT1G53700 | The WAG1 and its homolog, WAG2 each encodes a protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
AT1G53705 | putative aminoacyl-tRNA ligase;(source:Araport11) |
AT1G53708 | ROTUNDIFOLIA like 9;(source:Araport11) |
AT1G53760 | K+-H+ exchange-like protein;(source:Araport11) |
AT1G53820 | RING/U-box superfamily protein;(source:Araport11) |
AT1G53850 | Encodes alpha5 subunit of 20s proteosome involved in protein degradation and RNA degradation. |
AT1G53930 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT1G53970 | GDSL esterase/lipase-like protein;(source:Araport11) |
AT1G53990 | Contains lipase signature motif and GDSL domain. The mRNA is cell-to-cell mobile. |
AT1G54000 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G54010 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G54035 | pseudogene of epithiospecifier protein |
AT1G54040 | Epithiospecifier protein, interacts with WRKY53. Involved in pathogen resistance and leaf senescence. |
AT1G54070 | Dormancy/auxin associated family protein;(source:Araport11) |
AT1G54095 | DUF1677 family protein, putative (DUF1677);(source:Araport11) |
AT1G54115 | Involved in cation (Na and K) homeostasis. |
AT1G54130 | This gene appears to be at least partially redundant with RSH2 (At3g14050). Guanosine tetraphosphate synthesized by RSH2/RSH3 (and CRSH At3g17470) to an unknown extent can repress chloroplast gene expression, and also reduce chloroplast size. Involved in the maintenance of the (p)ppGp level to accustom plastidial gene expression to darkness. |
AT1G54150 | Encodes a chloroplast-localized putative RING-type ubiquitin E3 ligase. |
AT1G54160 | Encodes a member of the CCAAT-binding transcription factor (CBF-B/NF-YA) family. Expression is upregulated in response to ABA and drought. This regulation appears to be mediated by MIR169A which is downregulated in response to drought. NFYA5 is a target of MIR169A. Loss of function mutations are hypersensitive to drought. |
AT1G54170 | ataxin-2-related, similar to SCA2 (GI:1770390) (Homo sapiens); similar to ataxin-2 (GI:3005020) (Mus musculus). Member of a family of PAM2 motif containing proteins. |
AT1G54200 | DNA mismatch repair Msh6-like protein;(source:Araport11) |
AT1G54220 | Encodes a subunit of the mitochondrial pyruvate dehydrogenase complex. |
AT1G54230 | Winged helix-turn-helix transcription repressor DNA-binding protein;(source:Araport11) |
AT1G54350 | ABC transporter family protein;(source:Araport11) |
AT1G54410 | Encodes a KS-type dehydrin can reduce the formation of reactive oxygen species (ROS) from Cu. |
AT1G54445 | Encodes a defensin-like (DEFL) family protein. |
AT1G54490 | Involved in the ethylene response. XRN4 does not appear to regulate ethylene signaling via an RNA-INDUCED SILENCING COMPLEX-based RNA silencing mechanism but acts by independent means. Endogenous suppressor of posttranscriptional gene silencing. The mRNA is cell-to-cell mobile. |
AT1G54510 | Encodes AtNEK1, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
AT1G54560 | Encodes a class XI myosin that is involved in organelle motility, actin organization, and optimal growth of pollen tubes. |
AT1G54600 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT1G54640 | F-box family protein-like protein;(source:Araport11) |
AT1G54740 | FANTASTIC four-like protein (DUF3049);(source:Araport11) |
AT1G54790 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G54850 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT1G54890 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
AT1G54940 | Encodes a xylan glucuronosyltransferase. |
AT1G54980 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G55010 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
AT1G55020 | lipoxygenase, a defense gene conferring resistance Xanthomonas campestris The mRNA is cell-to-cell mobile. |
AT1G55030 | RNI-like superfamily protein;(source:Araport11) |
AT1G55035 | pseudogene of importin alpha isoform 1;(source:Araport11) |
AT1G55050 | hypothetical protein;(source:Araport11) |
AT1G55070 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G55120 | Encodes a protein with fructan exohydrolase (FEH) activity acting on levan-type fructans (6-FEH, levanase). The enzyme does not have invertase activity. |
AT1G55130 | Encodes an Arabidopsis Transmembrane nine (TMN) protein. Transmembrane nine (TM9) proteins are localized in the secretory pathway of eukaryotic cells and are involved in cell adhesion and phagocytosis. |
AT1G55160 | WAS/WASL-interacting family protein;(source:Araport11) |
AT1G55175 | hypothetical protein;(source:Araport11) |
AT1G55180 | member of C2-PLD. subfamily Represents a phospholipase D (PLD) gene with four exons, hence it is a member of the alpha class. Its amino acid sequence is quite different from other PLDs, therefore it might possess unique structural and/or catalytic properties. |
AT1G55190 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
AT1G55205 | hypothetical protein;(source:Araport11) |
AT1G55210 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT1G55240 | proteinase inhibitor I4, serpin (DUF716);(source:Araport11) |
AT1G55265 | DUF538 family protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
AT1G55270 | SAGL1 is a member of a small family of KELCH domain containing proteins. Loss of function mutants show increased lignin and anthocyanin production suggesting a role in regulation of phenylpropanoid biosynthesis. |
AT1G55330 | Encodes a putative arabinogalactan-protein (AGP21). |
AT1G55340 | hypothetical protein (DUF1639);(source:Araport11) |
AT1G55350 | Similar to maize DEK1, a gene encoding a membrane protein of the calpain gene superfamily required for aleurone cell development in the endosperm of maize grains. A key component of the embryonic L1 cell-layer specification pathway. It localizes to membranes and undergoes intramolecular autolytic cleavage events that release the calpain domain into the cytoplasm. |
AT1G55365 | hypothetical protein;(source:Araport11) |
AT1G55370 | NDH-dependent cyclic electron flow 5;(source:Araport11) |
AT1G55430 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G55510 | branched-chain alpha-keto acid decarboxylase E1 beta |
AT1G55530 | RING/U-box superfamily protein;(source:Araport11) |
AT1G55550 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G55560 | SKU5 similar 14;(source:Araport11) |
AT1G55570 | SKU5 similar 12;(source:Araport11) |
AT1G55580 | Encodes a member of the GRAS family of putative transcriptional regulators. It is involved in the initiation of axillary meristems during both the vegetative and reproductive growth phases and functions upstream of REV and AXR1 in the regulation of shoot branching. |
AT1G55600 | member of WRKY Transcription Factor; Group I. It has WRKY domain at its N terminal end and zinc-finger like motif. |
AT1G55610 | mutant has Altered vascular cell differentiation; LRR Receptor Kinase |
AT1G55660 | FOF2, is the F-box protein family. Overexpression of FOF2 results in delayed transitions to flowering under both LD and SD conditions.FOF2 expression is induced by ABA during seed germination where it acts through ABI3 and ABI5 to modulate germination. |
AT1G55670 | Encodes subunit G of photosystem I, an 11-kDa membrane protein that plays an important role in electron transport between plastocyanin and PSI and is involved in the stability of the PSI complex. PSI-G subunit is bound to PSI-B and is in contact with Lhca1. The protein inserts into thylakoids by a direct or "spontaneous" pathway that does not involve the activities of any known chloroplast protein-targeting machinery. PSI-G appears to be directly or indirectly involved in the interaction between Photosystem I and plastocyanin. |
AT1G55690 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT1G55700 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G55720 | member of Low affinity calcium antiporter CAX2 family |
AT1G55730 | member of Low affinity calcium antiporter CAX2 family |
AT1G55740 | seed imbibition 1;(source:Araport11) |
AT1G55760 | Expression induced under NaCl, mannitol, ABA and indole-3-acetic acid (IAA) treatment. |
AT1G55770 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G55830 | coiled-coil protein;(source:Araport11) |
AT1G55850 | encodes a protein similar to cellulose synthase The mRNA is cell-to-cell mobile. |
AT1G55880 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
AT1G55900 | component of a translocase in the mitochondrial inner membrane |
AT1G55920 | Encodes a chloroplast/cytosol localized serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. The mRNA is cell-to-cell mobile. |
AT1G55940 | cytochrome P450 family protein;(source:Araport11) |
AT1G56020 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
AT1G56030 | RING/U-box protein;(source:Araport11) |
AT1G56040 | HEAT/U-box protein;(source:Araport11) |
AT1G56060 | CYSTM3 is a mitochondrial protein that is induced by salt stress and is a negative regulator of salt stress. |
AT1G56080 | NAI1 interacting protein, involved in ER body formation. |
AT1G56090 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G56150 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G56220 | Dormancy/auxin associated family protein;(source:Araport11) |
AT1G56230 | enolase (DUF1399);(source:Araport11) |
AT1G56242 | Natural antisense transcript overlaps with AT1G56240;(source:Araport11) |
AT1G56250 | Encodes an F-box protein that can functionally replace VirF, regulating levels of the VirE2 and VIP1 proteins via a VBF-containing SCF complex. It is thought to be involved in DNA integration and T-DNA degradation. |
AT1G56260 | Required for the maintenance of stem cells through a reduction in DNA damage. |
AT1G56290 | CwfJ-like family protein;(source:Araport11) |
AT1G56300 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G56310 | DEDDy-type 3′ -> 5′ exoribonuclease involved in miRNA degradation. |
AT1G56400 | F-box family protein;(source:Araport11) |
AT1G56410 | encodes a heat shock protein whose gene expression is induced by heat and dehydration. |
AT1G56430 | Encodes a protein with nicotianamine synthase activity. |
AT1G56500 | Encodes a thylakoid membrane protein with thioredoxin-like and beta-propeller domains located in the lumen and a haloacid-dehalogenase domain exposed to the chloroplast stroma. The protein's role may be to prevent formation of a slowly reversible form of antenna quenching, thereby maintaining the efficiency of light harvesting. The mRNA is cell-to-cell mobile. |
AT1G56520 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G56540 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G56560 | A/N-InvA is a neutral invertase that breaks sucrose down into fructose and glucose. It is member of the larger family of alkaline/neutral invertases (GH100). GFP-tagged A/N-InvA localizes to the mitochondria. atinva mutants have reduced root growth, reduced invertase activity, and increased expression of antioxidant genes under basal conditions. The levels of A/N-InvA transcripts rise in response to a hydrogen peroxide treatment. |
AT1G56580 | Encodes SMALLER WITH VARIABLE BRANCHES (SVB), a protein with a conserved domain of unknown function (DUF538). The trichomes of the SVB mutants are smaller and exhibit branches of variable length and number. ABA responsive trichome formation regulator. |
AT1G56590 | Involved in vesicle trafficking between the trans -Golgi network and vacuoles. |
AT1G56612 | Natural antisense transcript overlaps with AT1G56610;(source:Araport11) |
AT1G56650 | Encodes a putative MYB domain containing transcription factor involved in anthocyanin metabolism and radical scavenging. Essential for the sucrose-mediated expression of the dihydroflavonol reductase gene. Auxin and ethylene responsiveness of PAP1 transcription is lost in myb12 mutants. Interacts with JAZ proteins to regulate anthocyanin accumulation. |
AT1G56670 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G56710 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G57550 | Low temperature and salt responsive protein family;(source:Araport11) |
AT1G57560 | Member of the R2R3 factor gene family. |
AT1G57565 | SWI-SNF-related chromatin binding protein;(source:Araport11) |
AT1G57580 | F-box family protein;(source:Araport11) |
AT1G57590 | Pectinacetylesterase family protein;(source:Araport11) |
AT1G57650 | ATP binding protein;(source:Araport11) |
AT1G57660 | Translation protein SH3-like family protein;(source:Araport11) |
AT1G57670 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
AT1G57690 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT1G57720 | Translation elongation factor EF1B, gamma chain;(source:Araport11) |
AT1G57750 | Encodes a CYP96A15, midchain alkane hydroxylase, involved in cuticular wax biosynthesis. |
AT1G57777 | Encodes a ECA1 gametogenesis related family protein |
AT1G57790 | F-box family protein;(source:Araport11) |
AT1G57810 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 29%25 identity and 1.1e-12 P-value to GP|21952510|gb|AAM82604.1|AF525305_2|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10) |
AT1G57820 | Encodes a 645-amino acid methylcytosine-binding protein with a PHD domain, two RING finger domains, and an SRA domain that is involved in centromere heterochromatinization. This protein functions as an E3 ubiquitin ligase in vitro. The protein has been shown to bind to methylated cytosines of CG, CNG and CNN motifs via its SRA domain but has a preference for the former. It plays a role in the establishment/maintenance of chromatin structure during cell division and is localized in the nucleus. Plants over-expressing VIM1/ORTH2 show an inhibition in root growth and a delay in flowering. Both over-expression of GFP:ORTH2 and loss of ORTH2/VIM1 lead to decreased levels of DNA methylation. GFP:ORTH2 over-expressers also have increased levels of FWA transcripts. |
AT1G57840 | pseudogene of Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G57850 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
AT1G57870 | shaggy-like kinase 42;(source:Araport11) |
AT1G57990 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
AT1G58040 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-28 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT1G58050 | RNA helicase family protein;(source:Araport11) |
AT1G58070 | WALLIN is an actin binding protein involved in ROP11 mediated xylem pit patterning. |
AT1G58090 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G58120 | hypothetical protein;(source:Araport11) |
AT1G58130 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT1G58150 | phosphoglycerate kinase;(source:Araport11) |
AT1G58190 | receptor like protein 9;(source:Araport11) |
AT1G58200 | A member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity. |
AT1G58210 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It colocalizes with filamentous actin and is localized to the plasma membrane. |
AT1G58220 | Plays an essential role in organ development by regulating cell expansion either directly by affecting cell wall architecture and/or cytoplasmic growth or indirectly through the ethylene and/or ABA signaling pathways.DRMY1 is Involved in regulating floral organ development, especially ensuring organ size robustness (PMID:32451448). |
AT1G58230 | binding protein;(source:Araport11) |
AT1G58235 | hypothetical protein;(source:Araport11) |
AT1G58245 | Encodes a Plant thionin family protein |
AT1G58265 | Cytochrome P450 superfamily protein;(source:Araport11) |
AT1G58270 | ZW9 mRNA, complete cds The mRNA is cell-to-cell mobile. |
AT1G58280 | Phosphoglycerate mutase family protein;(source:Araport11) |
AT1G58290 | Encodes a protein with glutamyl-tRNA reductase (GluTR) activity, catalyzing the NADPH-dependent reduction of Glu-tRNA(Glu) to glutamate 1-semialdehyde (GSA) with the release of free tRNA(Glu). It is involved in the early steps of chlorophyll biosynthesis. |
AT1G58300 | Encodes a member (HO4) of the heme oxygenase family. |
AT1G58330 | transcription factor-like protein;(source:Araport11) |
AT1G58340 | Encodes a plant MATE (multidrug and toxic compound extrusion) transporter that is localized to the Golgi complex and small organelles and is involved in determining the rate of organ initiation. It is also involved in iron homeostasis when plants are under osmotic stress. |
AT1G58350 | Putative serine esterase family protein;(source:Araport11) |
AT1G58360 | Encodes AAP1 (amino acid permease 1), a neutral amino acid transporter expressed in seeds. Functions in amino acid uptake into embryos. The transporter also functions in acquisition of glutamate and neutral amino acids by the root. |
AT1G58370 | Encodes a protein with xylanase activity. |
AT1G58380 | Ribosomal protein S5 family protein;(source:Araport11) |
AT1G58470 | Encodes an mRNA-binding protein that contains two RNA recognition motifs (RRMs) and is expressed in proliferating tissues. Preferentially binds UUAGG, GUAGG and/or UUAGU. Loss of function of RBP1 causes decreased root length. |
AT1G58561 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.8e-219 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT1G58602 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
AT1G59453 | B-block-binding subunit of TFIIIC protein;(source:Araport11) |
AT1G59500 | encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. |
AT1G59520 | Encodes CW7. |
AT1G59530 | basic leucine-zipper 4;(source:Araport11) |
AT1G59550 | This locus is annotated as a protein-coding gene in TAIR10. Based on communication with Jean-Luc GALLOIS (April 2013), this gene is re-annotated as a UBX domain-containing pseudogene. Note that the Map Detail Image on the locus detial page and in GBrowse will not be updated until after the next genome release. |
AT1G59620 | Encodes CW9. |
AT1G59650 | Encodes CW14. |
AT1G59660 | Encodes a protein with similarity to mammalian nucleoporin Nup98.Its expression is upregulated in mutants that are NUP deficient. Nucleoportin which redundantly inhibits flowering together with Nup98a through multiple pathways including clock, photoperiod, and age pathways. Gates flowering in a CONSTANS (CO)-independent mode and bypasses the CO checkpoint in photoperiodic signaling and integrated signals from multiple pathways to directly target FLOWERING LOCUS T (FT) for flowering control. |
AT1G59675 | F-box family protein;(source:Araport11) |
AT1G59720 | Pentatricopeptide Repeat Protein containing the DYW motif. Required for editing of multiple plastid transcripts. Endonuclease activity. |
AT1G59722 | hypothetical protein;(source:Araport11) |
AT1G59725 | DNAJ heat shock family protein;(source:Araport11) |
AT1G59740 | Major facilitator superfamily protein;(source:Araport11) |
AT1G59750 | Encodes a member of the auxin response factor family. ARFs bind to the cis element 5'-TGTCTC-3' ARFs mediate changes in gene expression in response to auxin. ARF's form heterodimers with IAA/AUX genes. ARF1 enhances mutant phenotypes of ARF2 and may act with ARF2 to control aspects of maturation and senescence.ARF1:LUC and 3xHA:ARF1 proteins have a half-life of ~3-4 hours and their degradation is reduced by proteasome inhibitors. 3xHA:ARF1 degradation is not affected by a pre-treatment with IAA. A nuclear-targeted fusion protein containing the middle region of ARF1 linked to LUC:NLS has a similar half-life to the full-length ARF1:LUC construct. The degradation of 3xHA:ARF1 is not affected in an axr6-3 mutant grown at room temperature, although the degradation of AXR2/IAA7 is slowed under these conditions. |
AT1G59760 | Encodes MTR4, a putative RNA helicase and exosome co-factor. Required for proper rRNA biogenesis and development. |
AT1G59790 | Cullin family protein;(source:Araport11) |
AT1G59810 | AGL50 MADS box gene. |
AT1G59860 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT1G59870 | ATP binding cassette transporter. Localized to the plasma membrane in uninfected cells. In infected leaves, the protein concentrated at infection sites. Contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration in a salicylic acid?dependent manner. Required for mlo resistance. Has Cd transporter activity (Cd2+ extrusion pump) and contributes to heavy metal resistance. The mRNA is cell-to-cell mobile. |
AT1G59880 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
AT1G59920 | MADS-box family protein;(source:Araport11) |
AT1G59940 | Type A response regulator highly similar to bacterial two-component response regulators. Rapidly induced by cytokinin. Involved in red-light signaling. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
AT1G59980 | ARG1-like 2;(source:Araport11) |
AT1G60010 | PADRE protein down-regulated after infection by S. sclerotiorun. |
AT1G60030 | nucleobase-ascorbate transporter 7;(source:Araport11) |
AT1G60050 | nodulin MtN21-like transporter family protein |
AT1G60060 | Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11) |
AT1G60080 | 3-5-exoribonuclease family protein;(source:Araport11) |
AT1G60095 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT1G60110 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT1G60120 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.3e-38 P-value blast match to GB:226407 retrotransposon del1-46 (Gypsy_Ty3-element) (Lilium henryi);(source:TAIR10) |
AT1G60160 | Member of the KT/KUP/HAK family of proton-coupled potassium transporters which have potential effect on cellular expansion. |
AT1G60190 | Encodes PUB19, a plant U-box armadillo repeat protein. Involved in salt inhibition of germination together with PUB18. The mRNA is cell-to-cell mobile. |
AT1G60200 | RBM25 is an alternative splicing factor involved in mediation of abiotic stress response and ABA response. Its expression is modulated by a variety of stressors and it in turn appears to affect the ratio of splice variants of stress responsive genes such as HAB1.2/HAB1.1. |
AT1G60240 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
AT1G60250 | B-box zinc finger family protein;(source:Araport11) |
AT1G60260 | beta glucosidase 5;(source:Araport11) |
AT1G60270 | beta glucosidase 6;(source:Araport11) |
AT1G60280 | NAC domain containing protein 23;(source:Araport11) |
AT1G60300 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
AT1G60320 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
AT1G60330 | pseudogene of Chalcone-flavanone isomerase family protein;(source:Araport11) |
AT1G60340 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
AT1G60350 | NAC domain containing protein 24;(source:Araport11) |
AT1G60360 | RING/U-box superfamily protein;(source:Araport11) |
AT1G60390 | polygalacturonase 1;(source:Araport11) |
AT1G60410 | A paternally expressed imprinted gene. |
AT1G60420 | Reduce transmission through pollen. The mRNA is cell-to-cell mobile. |
AT1G60470 | Predicted to encode a galactinol synthase. |
AT1G60490 | Encodes a phosphatidylinositol 3-kinase that is expressed in most plant tissues. Defects in VPS34 affect a number of cellular processes. Loss of function mutations are not transmitted through the male gametophyte due to defects in microgametogenesis therefore it is difficult to assess the effects of loss of VPS34 function in the whole plant. Involved in salt-stress responses. |
AT1G60500 | Dynamin related protein 4C;(source:Araport11) |
AT1G60510 | pseudogene of Dynamin related protein 4C;(source:Araport11) |
AT1G60520 | pseudogene of Dynamin related protein 4A;(source:Araport11) |
AT1G60530 | Dynamin related protein 4A;(source:Araport11) |
AT1G60560 | SWIM zinc finger family protein;(source:Araport11) |
AT1G60590 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G60600 | Encodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport. |
AT1G60625 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT1G60640 | stress response protein;(source:Araport11) |
AT1G60660 | member of Cytochromes b5 |
AT1G60680 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT1G60700 | SMAD/FHA domain-containing protein;(source:Araport11) |
AT1G60750 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT1G60783 | cyclin-dependent kinase inhibitor SMR2-like protein;(source:Araport11) |
AT1G60800 | Encodes one of a group of LRR-RLKs, designated as CLAVATA3 INSENSITIVE RECEPTOR KINASES (CIKs), that act as co-receptors and have essential roles in regulating CLV3-mediated stem cell homeostasis. |
AT1G60850 | DNA-directed RNA polymerase family protein;(source:Araport11) |
AT1G60980 | gibberellin 20-oxidase 4;(source:Araport11) |
AT1G60985 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT1G60989 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT1G60990 | Encodes a chloroplast-localized COG0354 protein that requires folate for its function in Fe/S cluster biogenesis. |
AT1G61050 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
AT1G61060 | F-box family protein;(source:Araport11) |
AT1G61070 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
AT1G61090 | hypothetical protein;(source:Araport11) |
AT1G61095 | hypothetical protein;(source:Araport11) |
AT1G61130 | serine carboxypeptidase-like 32;(source:Araport11) |
AT1G61160 | retrotransposon gag;(source:Araport11) |
AT1G61170 | hypothetical protein;(source:Araport11) |
AT1G61215 | Bromodomain protein with a DNA binding motif |
AT1G61260 | cotton fiber (DUF761);(source:Araport11) |
AT1G61270 | Involved in transport of 1-Aminocyclopropane-1-carboxylic acid (ACC). |
AT1G61290 | member of SYP12 Gene Family |
AT1G61330 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT1G61350 | ARM repeat superfamily protein;(source:Araport11) |
AT1G61360 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G61390 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G61400 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G61420 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G61440 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G61460 | G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11) |
AT1G61490 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G61500 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G61520 | PSI type III chlorophyll a/b-binding protein (Lhca3*1) The mRNA is cell-to-cell mobile. |
AT1G61560 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in roots and lateral root primordia, in flower and fruit abscission zone, in vascular system of cotyledons, young leaves and petals, in mature rosette leaves, in anthers, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT1G61563 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT1G61575 | Serine/Threonine kinase;(source:Araport11) |
AT1G61600 | DUF1262 family protein (DUF1262);(source:Araport11) |
AT1G61610 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G61660 | Encodes a transcriptional activator that regulates the expression of genes by binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT1G61667 | serine protease, putative (Protein of unknown function, DUF538);(source:Araport11) |
AT1G61710 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G61730 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
AT1G61732 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCUAAGUCUUCUAUUGAUGUU |
AT1G61740 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
AT1G61770 | J domain protein. The mRNA is cell-to-cell mobile. |
AT1G61795 | PAK-box/P21-Rho-binding family protein;(source:Araport11) |
AT1G61810 | beta-glucosidase 45;(source:Araport11) |
AT1G61820 | beta glucosidase 46;(source:Araport11) |
AT1G61830 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G61850 | Encodes a non-specific lipase that hydrolyzes phospholipids as well as galactolipids, at both sn-1 and sn-2 positions. Involved in basal jasmonic acid biosynthesis by releasing the precursor fatty acid from membrane lipids. Mutant plants were impacted in resistance to fungus B. cinerea. |
AT1G61860 | Protein kinase superfamily protein;(source:Araport11) |
AT1G61880 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT1G61890 | MATE efflux family protein;(source:Araport11) |
AT1G61940 | Member of TLP family |
AT1G61950 | member of Calcium Dependent Protein Kinase |
AT1G61960 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT1G61980 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT1G62035 | Encodes a microRNA that targets several SCL family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGAGCCGUGCCAAUAUCACG. Pri-mRNA coordinates for MIR171c (converted to TAIR10 based on PMID19304749): Chr1: 22930427-22929567 (reverse), length: 861 bp; exon coordinates: exon 1: 22930427 to 22930342, exon 2: 22930233 to 22930047, exon 3: 22929839 to 22929567; mature miRNA and miRNA* are located on exon 1. |
AT1G62045 | ankyrin repeat protein;(source:Araport11) |
AT1G62090 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G62120 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT1G62160 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
AT1G62170 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
AT1G62180 | encodes a adenosine 5'-phosphosulfate reductase, involved in sulfate assimilation. Is a major effect locus for natural variation of shoot sulfate content in Arabidopsis. |
AT1G62210 | hypothetical protein;(source:Araport11) |
AT1G62220 | transmembrane protein;(source:Araport11) |
AT1G62225 | transmembrane protein;(source:Araport11) |
AT1G62280 | Encodes a protein with ten predicted transmembrane helices. The SLAH1 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. Although it is not expressed in guard cells, it can complement a slac1-2 mutant suggesting that it performs a similar function. SLAH1:GFP localizes to the plasma membrane. |
AT1G62290 | Saposin-like aspartyl protease family protein;(source:Araport11) |
AT1G62300 | Encodes a transcription factor WRKY6. Regulates Phosphate1 (Pho1) expression in response to low phosphate (Pi) stress. |
AT1G62305 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT1G62320 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
AT1G62340 | Subtilisin-like serine protease required for epidermal surface formation in embryos and juvenile plants |
AT1G62360 | Class I knotted-like homeodomain protein that is required for shoot apical meristem (SAM) formation during embryogenesis and for SAM function throughout the lifetime of the plant. Functions by preventing incorporation of cells in the meristem center into differentiating organ primordia. It has also been shown to have a role in the specification of flower meristem identity. |
AT1G62370 | RING/U-box superfamily protein;(source:Araport11) |
AT1G62380 | Encodes a protein similar to 1-aminocyclopropane-1-carboxylic oxidase (ACC oxidase). Expression of the AtACO2 transcripts is affected by ethylene. |
AT1G62400 | Protein kinase involved in regulation of stomatal aperture in response to CO2. |
AT1G62420 | DUF506 family protein (DUF506);(source:Araport11) |
AT1G62430 | Encodes a CDP-diacylglycerol synthase, involved in phospholipid biosynthesis. |
AT1G62480 | Vacuolar calcium-binding protein-like protein;(source:Araport11) |
AT1G62520 | sulfated surface-like glycoprotein;(source:Araport11) |
AT1G62530 | hypothetical protein (DUF863);(source:Araport11) |
AT1G62540 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
AT1G62550 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to non-LTR retroelement reverse transcriptase-like protein GI:9758853 from (Arabidopsis thaliana);(source:TAIR10) |
AT1G62560 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
AT1G62570 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
AT1G62630 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
AT1G62640 | 3-ketoacyl-acyl carrier protein synthase III (KAS III) |
AT1G62650 | pseudogene of P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G62660 | Glycosyl hydrolases family 32 protein;(source:Araport11) |
AT1G62680 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G62690 | hypothetical protein;(source:Araport11) |
AT1G62700 | Encodes a NAC-domain transcription factor. Expressed in the vascular tissue. |
AT1G62710 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteases that is expressed specifically in seeds and is essential for the proper processing of storage proteins. |
AT1G62780 | dimethylallyl, adenosine tRNA methylthiotransferase;(source:Araport11) |
AT1G62800 | Encodes aspartate aminotransferase (Asp4). |
AT1G62810 | Encodes COPPER AMINE OXIDASE1 (CuAO1). Contributes to abscisic acid- and polyamine-induced nitric oxide biosynthesis and abscisic acid signal transduction. |
AT1G62820 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT1G62835 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT1G62840 | ankyrin repeat/KH domain protein (DUF1442);(source:Araport11) |
AT1G62870 | hypothetical protein;(source:Araport11) |
AT1G62880 | Cornichon family protein;(source:Araport11) |
AT1G62940 | encodes an acyl-CoA synthetase, has in vitro activity towards medium- to long-chain fatty acids and their hydroxylated derivatives. Expressed in the tapetum. Involved in pollen wall exine formation. Null mutants were devoid of pollen grains at anther maturity and were completely male sterile. |
AT1G62950 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
AT1G62970 | SDJ3 functions partially redundantly with SDJ1 and SDJ2 and interacts with SUVH1 and SUVH3 to form a SUVH-SDJ complex. The complex binds promoters with DNA methylation and mediates transcriptional activation of promoter methylated genes. |
AT1G62981 | transmembrane protein, putative (DUF1191);(source:Araport11) |
AT1G62990 | Encodes a homeodomain transcription factor of the Knotted family. May be involved in secondary cell wall biosynthesis. Mutants have moderately irregular xylem development. Expression of this gene is upregulated by SND1 and MYB46. |
AT1G63000 | nucleotide-rhamnose synthase/epimerase-reductase;(source:Araport11) |
AT1G63030 | encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (DDF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. Overexpression of this gene results in the reduction of gibberellic acid biosynthesis. This gene is expressed in all tissues examined, but most abundantly expressed in rosette leaves and stems. Overexpression of DDF1, a putative paralog of this gene, also reduces gibberellic acid biosynthesis and makes the plants more tolerant to high-salinity levels. |
AT1G63050 | Encodes a lysophosphatidylcholine acyltransferase (LPCAT). Participates in the Lands cycle in developing seeds. Involved in triacylglycerol biosynthesis. |
AT1G63060 | ribosome biogenesis NEP1-like protein;(source:Araport11) |
AT1G63090 | phloem protein 2-A11;(source:Araport11) |
AT1G63100 | Transcription factor belonging to the GRAS family which controls the mitotic cell cycle and division plane orientation. |
AT1G63105 | hypothetical protein;(source:Araport11) |
AT1G63120 | AtRBL2 has been identified as a rhomboid protein involved in regulated intramembrane proteolysis (RIP). The enzyme has the proteolytic activity and substrate specificity comparable to the Drosophila Rho-1 protein. |
AT1G63170 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
AT1G63180 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in pollen development. |
AT1G63190 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT1G63200 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT1G63205 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT1G63220 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT1G63295 | Remorin family protein;(source:Araport11) |
AT1G63310 | hypothetical protein;(source:Araport11) |
AT1G63340 | Flavin-containing monooxygenase family protein;(source:Araport11) |
AT1G63350 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
AT1G63440 | The Arabidopsis P-type ATPase HMA5 is involved in Cu detoxification. hma5 mutant plants exhibit Cu hypersensitivity, which is especially dramatic in roots where HMA5 is mostly expressed. |
AT1G63450 | Encodes a xyloglucan-specific galacturonosyltransferase (XUT1) that forms the beta-d-galactosyluronic acid-(1->2)-alpha-d-xylosyl linkage. |
AT1G63460 | Encodes GPX8 (glutathione peroxidase 8). Involved in the suppression of oxidative damages in nucleus and cytosol. The mRNA is cell-to-cell mobile. |
AT1G63480 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT1G63530 | hypothetical protein;(source:Araport11) |
AT1G63540 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G63570 | Receptor-like protein kinase-related family protein;(source:Araport11) |
AT1G63600 | Receptor-like protein kinase-related family protein;(source:Araport11) |
AT1G63630 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G63650 | Mutant has reduced trichomes, anthocyanin, and seed coat mucilage and abnormally patterned stomates. Mutants are defective in jasmonate-induced anthocyanin accumulation. Encodes a bHLH Transcription Factor 1. The protein is functionally redundant with GL3 and TT8 and interacts with TTG1, the myb proteins GL1, PAP1 and 2, CPC and TRY, and it will form heterodimers with GL3. Expression in N (non-hair cell forming) cell layers is negatively regulated by WER. Expression in H cells (hair cell forming) is promoted by CPC/TRY. |
AT1G63690 | SIGNAL PEPTIDE PEPTIDASE-LIKE 2;(source:Araport11) |
AT1G63720 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G63750 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G63760 | pseudogene of RING/U-box superfamily protein;(source:Araport11) |
AT1G63800 | ubiquitin-conjugating enzyme 5;(source:Araport11) |
AT1G63855 | Putative methyltransferase family protein;(source:Araport11) |
AT1G63860 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G63870 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G63910 | member of MYB3R- and R2R3- type MYB- encoding genes |
AT1G63950 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT1G63980 | D111/G-patch domain-containing protein;(source:Araport11) |
AT1G64020 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
AT1G64035 | pseudogene of serpin 2;(source:Araport11) |
AT1G64060 | Interacts with AtrbohD gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. |
AT1G64065 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT1G64070 | Encodes a TIR-NBS-LRR class of disease resistance protein effective against Leptosphaeria maculans. |
AT1G64090 | Reticulan like protein B3;(source:Araport11) |
AT1G64100 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
AT1G64107 | Encodes a defensin-like (DEFL) family protein. |
AT1G64110 | Target promoter of the male germline-specific transcription factor DUO1. |
AT1G64150 | Encodes an integral thylakoid membrane protein that is required for normal operation of oxygen-evolving complex (as evidenced by oxygen evolution rates) and for manganese incorporation. PAM71 belongs to a small gene family in Arabidopsis comprising five members. PAM71 is well conserved in the green lineage and shares homology with putative Ca2+/H+ exchangers from yeast (Saccharomyces cerevisiae) (GDT1) and human (Homo sapiens) (TMEM165). |
AT1G64160 | Encodes a dirigent protein involved in the synthesis of (-)pinoresinol. Dirigent proteins impart stereoselectivity on the phenoxy radical coupling reaction yielding optically active lignans from two molecules of coniferyl alcohol. |
AT1G64170 | member of Putative Na+/H+ antiporter family |
AT1G64180 | intracellular protein transport protein USO1-like protein;(source:Araport11) |
AT1G64195 | Encodes a defensin-like (DEFL) family protein. |
AT1G64255 | MuDR family transposase;(source:Araport11) |
AT1G64290 | F-box protein-like protein;(source:Araport11) |
AT1G64295 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT1G64300 | Protein kinase family protein;(source:Araport11) |
AT1G64320 | myosin heavy chain-like protein;(source:Araport11) |
AT1G64330 | myosin heavy chain-like protein;(source:Araport11) |
AT1G64350 | seh1-like protein |
AT1G64360 | SAQR is a clade specific protein present in single copy in Arabidopsis.It's expression is increased during light induced oxidative stress ,drought stress and also during senescence. Promoter contains two AGL15 binding sites. |
AT1G64380 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
AT1G64385 | transmembrane protein;(source:Araport11) |
AT1G64390 | glycosyl hydrolase 9C2;(source:Araport11) |
AT1G64440 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Mutants in RHD1 have abnormally shaped root hairs with a bulbous region at the base. Allelic to REB1 encoding a UDP-D-glucose 4-epimerase involved in cell wall biosynthesis.Involved in growth and cell wall carbohydrate biosynthesis. |
AT1G64540 | F-box/FBD-like domains containing protein;(source:Araport11) |
AT1G64560 | pseudogene of S-adenosylmethionine-dependent methyltransferase/rRNA (adenine-N6,N6-)-dimethyltransferase/rRNA methyltransferase |
AT1G64570 | Homeodomain-like superfamily protein;(source:Araport11) |
AT1G64600 | copper ion binding / methyltransferase;(source:Araport11) |
AT1G64620 | Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis. |
AT1G64625 | Encodes a plant-specific basic helix-loop-helix (bHLH) protein that is required for normal meiotic entry and the establishment of meiotic synchrony. It plays a role in xylem differentiation downstream of auxin. |
AT1G64660 | Encodes a functional methionine gamma-lyase, a cytosolic enzyme catalyzes the degradation of methionine into methanethiol, alpha-ketobutyrate and ammonia. The catabolism of excess methionine is important to methionine homeostasis. The mRNA is cell-to-cell mobile. |
AT1G64680 | beta-carotene isomerase D27;(source:Araport11) |
AT1G64690 | Encodes BRANCHLESS TRICHOME (BLT) involved in trichome development. A large portion of the internal amino acid sequence of BLT is predicted to form a coiled-coil domain. BLT mutants form branchless trichomes with blunt tips. |
AT1G64700 | PADRE protein up-regulated after infection by S. sclerotiorun. |
AT1G64770 | encodes a novel subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in cyclic electron flow around photosystem I to produce ATP. |
AT1G64780 | encodes an ammonium transporter protein believed to act as a high affinity transporter. It is expressed in the root, primarily in endodermal and cortical cells, and contributes to ammonium uptake in the root. |
AT1G64830 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G64840 | LOW protein: F-box/kelch-repeat protein (DUF295);(source:Araport11) |
AT1G64860 | Subunit of chloroplast RNA polymerase, confers the ability to recognize promoter sequences on the core enzyme |
AT1G64880 | Ribosomal protein S5 family protein;(source:Araport11) |
AT1G64910 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G64950 | member of CYP89A The mRNA is cell-to-cell mobile. |
AT1G64980 | Encodes a putative nucleotide-diphospho-sugar transferase required for pollen germination and tube growth. |
AT1G65010 | Encodes a microtubule-associated protein. Putative role in flower development. Comparison of SALK_061426C to Columbia wild type in normal lighting and under low light of 33 micromoles per meter-squared per second resulted in a trend toward earlier bolting in the mutant under low light (P=0.055) (Ann Stapleton and Patrick Pridgen, 2009, personal communication). |
AT1G65032 | COMPLEX 1 LYR-like protein;(source:Araport11) |
AT1G65050 | TRAF-like superfamily protein;(source:Araport11) |
AT1G65060 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. mRNA levels are not induced in response to wounding or to fungal infection by P. parasitica. mRNA is expressed in flowers, to a lesser degree in mature leaves and siliques and marginally in seedling roots and bolting stems of mature plants. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, ferulic acid, cinnamic acid and 5-OH-ferulic acid. At4CL3 was unable to use sinapic acid as substrate. |
AT1G65110 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT1G65120 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT1G65130 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT1G65140 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT1G65150 | TRAF-like family protein;(source:Araport11) |
AT1G65160 | ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT1G65170 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT1G65190 | Protein kinase superfamily protein;(source:Araport11) |
AT1G65230 | transmembrane protein, putative (DUF2358);(source:Araport11) |
AT1G65240 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G65300 | Encodes PHERES2, a homolog of PHERES1. PHERES1 and PHERES2 are both target genes of the FIS Polycomb group complex but only PHERES1 is regulated by genomic imprinting, which is likely caused by the presence of repeat sequences in the proximity of the PHERES1 locus. |
AT1G65330 | Type I MADS-box protein, regulated by MEA and FIE, expressed transiently after fertilization in embryo and endosperm. |
AT1G65360 | Encodes AGL23, a Type I MADS-box gene that controls female gametophyte development and the biogenesis of organelles during embryo development. |
AT1G65365 | pseudogene of WALL ASSOCIATED KINASE (WAK)-LIKE 10;(source:Araport11) |
AT1G65390 | Phloem Protein2 family gene encoding a two-domain protein containing predicted lectin and Toll/Interleukin-1 receptor domains, which is induced upon spider mite attack and improves the ability to defend against T. urticae by participating in the tight regulation of hormonal cross talk upon mite feeding. |
AT1G65430 | IBR domain-containing protein;(source:Araport11) |
AT1G65470 | Chromatin Assembly Factor-1 (CAF-1) p150 subunit. Mutants have reduced heterochromatin content. In Arabidopsis, the three CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1, respectively. Mutations in FAS1 or FAS2 lead to increased frequency of homologous recombination and T-DNA integration in Arabidopsis. |
AT1G65480 | FT, together with LFY, promotes flowering and is antagonistic with its homologous gene, TERMINAL FLOWER1 (TFL1). Together with TSF, it plays an antagonistic role to TFL1 in the determination of inflorescence meristem identity. FT is expressed in leaves and is induced by long day treatment. Either the FT mRNA or protein is translocated to the shoot apex where it induces its own expression. Recent data suggests that FT protein acts as a long-range signal. FT is a target of CO and acts upstream of SOC1. |
AT1G65481 | transmembrane protein;(source:Araport11) |
AT1G65483 | hypothetical protein;(source:Araport11) |
AT1G65490 | Secreted peptide which functions in plant growth and pathogen defense. |
AT1G65500 | Secreted peptide which functions in plant growth and pathogen defense. |
AT1G65560 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
AT1G65570 | Encodes a glycosyl hydrolase 28 (GH28) family polygalacturonase (PG) protein. Involved in root cap development. |
AT1G65585 | pseudogene of Ribonuclease H-like superfamily protein;(source:Araport11) |
AT1G65590 | Encodes a protein with beta-hexosaminidase activity. Located on the plasma membrane. |
AT1G65610 | Six-hairpin glycosidases superfamily protein;(source:Araport11) |
AT1G65620 | required for formation of a symmetric flat leaf lamina, encodes a member of a family of proteins characterized by cysteine repeats and a leucine zipper; involved in KNOX gene regulation. Acts together with ASL1 in proximal-distal symmetry determination. Forms a complex with AS1 that binds to the BP promoter and leads to silencing of BP. |
AT1G65630 | Encodes a putative DegP protease. |
AT1G65642 | pseudogene of F-box family protein |
AT1G65670 | a member of the cytochrome P450 gene family. molecular function unknown. |
AT1G65680 | member of BETA-EXPANSINS. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT1G65690 | Encodes NHL6 (NDR1/HIN1-like 6). Plays an important role in the abiotic stresses-induced ABA signaling and biosynthesis, particularly during seed germination and early seedling development. |
AT1G65750 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.9e-18 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G65770 | Encodes AMR1 (Ascorbic acid Mannose Pathway Regulator 1). Coordinately and negatively regulates the mannose/L-galactose ascorbic acid biosynthetic pathway in response to developmental and environmental cues. |
AT1G65800 | Encodes a putative receptor-like serine/threonine protein kinases that is similar to brassica self-incompatibility (S) locus. expressed in specifically in cotyledons, leaves, and sepals, in correlation with the maturation of these structures. Together with AtPUB9, it is required for auxin-mediated lateral root development under phosphate-starved conditions. The mRNA is cell-to-cell mobile. |
AT1G65810 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G65860 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates |
AT1G65875 | pseudogene of AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT1G65880 | Encodes a benzoate-CoA ligase. Involved in the biosynthesis of benzoyloxyglucosinolate in Arabidopsis seeds. |
AT1G65890 | acyl activating enzyme 12;(source:Araport11) |
AT1G65910 | NAC domain containing protein 28;(source:Araport11) |
AT1G65920 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
AT1G65970 | thioredoxin-dependent peroxidase 2 |
AT1G65980 | thioredoxin-dependent peroxidase |
AT1G66010 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT1G66030 | Encodes a protein with cytochrome P450 domain. Probable psuedogene. |
AT1G66060 | hypothetical protein (DUF577);(source:Araport11) |
AT1G66090 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
AT1G66110 | hypothetical protein (DUF577);(source:Araport11) |
AT1G66130 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G66140 | Encodes a zinc finger protein containing only a single zinc finger. |
AT1G66150 | Receptor-like transmembrane kinase I (TMK1); key regulator in auxin signaling. High auxin and TMK1 play essential and positive roles in ABA signaling through regulating ABA INSENSITIVE 1 and 2 (ABI1/2). Inhibits the phosphatase activity of ABI2 by direct phosphorylation of threonine 321 (T321), a conserved phosphorylation site in ABI2 proteins, whose phosphorylation status is important for both auxin and ABA responses. |
AT1G66160 | CYS, MET, PRO, and GLY protein 1;(source:Araport11) |
AT1G66190 | hypothetical protein;(source:Araport11) |
AT1G66200 | encodes a cytosolic glutamate synthetase, this enzyme has low affinity with substrate ammonium |
AT1G66210 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
AT1G66220 | Subtilase family protein;(source:Araport11) |
AT1G66230 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
AT1G66250 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT1G66280 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT1G66360 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT1G66400 | Encodes a calmodulin-like protein. Regulates nitric oxide levels and transition to flowering. |
AT1G66420 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
AT1G66430 | Encodes one of the several Arabidopsis fructokinases. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). Important for seed oil accumulation and vascular development. |
AT1G66440 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G66450 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G66460 | Protein kinase superfamily protein;(source:Araport11) |
AT1G66470 | ROOT HAIR DEFECTIVE6;(source:Araport11) |
AT1G66480 | Involved in chloroplast avoidance movement under intermediate and high light intensities; PADRE protein up-regulated after infection by S. sclerotiorun. |
AT1G66490 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G66500 | Pre-mRNA cleavage complex II;(source:Araport11) |
AT1G66540 | Cytochrome P450 superfamily protein;(source:Araport11) |
AT1G66600 | A member of WRKY Transcription Factor; Group III. Involved in the regulation of plant responses to ABA and drought stress. |
AT1G66660 | Protein with RING/U-box and TRAF-like domain;(source:Araport11) |
AT1G66710 | pseudogene of S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G66720 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G66750 | Encodes a CDK-activating kinase that interacts with SPT5, a regulator of transcription and histone methylation. |
AT1G66760 | MATE efflux family protein;(source:Araport11) |
AT1G66780 | MATE efflux family protein;(source:Araport11) |
AT1G66810 | Encodes a tandem CCCH zinc finger (TZF) protein that can bind DNA and RNA, function as a transcriptional activator, and is involved in secondary wall biosynthesis. |
AT1G66820 | glycine-rich protein;(source:Araport11) |
AT1G66830 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G66852 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT1G66855 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT1G66860 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
AT1G66870 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT1G66900 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G66920 | Protein kinase superfamily protein;(source:Araport11) |
AT1G66930 | Protein kinase superfamily protein;(source:Araport11) |
AT1G66940 | kinase-like protein;(source:Araport11) |
AT1G66950 | Encodes a plasma membrane-localized ABC transporter. Confers tolerance to herbicide paraquat. |
AT1G66960 | Terpenoid cyclases family protein;(source:Araport11) |
AT1G66970 | Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family. |
AT1G66990 | pseudogene of suppressor of npr1-1 constitutive 4;(source:Araport11) |
AT1G67000 | Protein kinase superfamily protein;(source:Araport11) |
AT1G67010 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
AT1G67020 | transmembrane protein;(source:Araport11) |
AT1G67025 | wall-associated receptor kinase carboxy-terminal protein;(source:Araport11) |
AT1G67050 | membrane-associated kinase regulator;(source:Araport11) |
AT1G67070 | Encodes a protein with phosphomannose isomerase activity that is involved in synthesis of ascorbic acid. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
AT1G67090 | Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Functions to yield sufficient Rubisco content for leaf photosynthetic capacity. |
AT1G67105 | other_RNA;(source:Araport11) |
AT1G67110 | cytochrome P450, family 735, subfamily A, polypeptide 2;(source:Araport11) |
AT1G67120 | Represents a homolog of the yeast MDN gene, which encodes a non-ribosomal protein involved in the maturation and assembly of the 60S ribosomal subunit. In Arabidopsis, it is essential for female gametogenesis progression. |
AT1G67130 | F-box family protein;(source:Araport11) |
AT1G67150 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT1G67170 | Coiled coil domain protein required for phase separation of FCA. |
AT1G67190 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT1G67220 | histone acetyltransferase of the CBP family 2;(source:Araport11) |
AT1G67230 | Encodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
AT1G67238 | other_RNA;(source:Araport11) |
AT1G67240 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.5e-23 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT1G67250 | Proteasome maturation factor UMP1;(source:Araport11) |
AT1G67260 | Encodes protein with TCP (TB1,CYC,PCF) domain which is likely to be involved in DNA binding and protein-protein interactions. Based on genome analysis, there is a 9-member gene family that possesses this domain in Arabidopsis. Orthologue of Antirrhinum gene CYCLOIDEA. |
AT1G67270 | Zinc-finger domain of monoamine-oxidase A repressor R1 protein;(source:Araport11) |
AT1G67300 | Major facilitator superfamily protein;(source:Araport11) |
AT1G67310 | Calmodulin-binding transcription activator protein with CG-1 and Ankyrin domain;(source:Araport11) |
AT1G67328 | Natural antisense transcript overlaps with AT1G67330;(source:Araport11) |
AT1G67340 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
AT1G67390 | F-box family protein;(source:Araport11) |
AT1G67400 | ELMO/CED-12 family protein;(source:Araport11) |
AT1G67410 | Exostosin family protein;(source:Araport11) |
AT1G67470 | Protein kinase superfamily protein;(source:Araport11) |
AT1G67500 | Encodes the catalytic subunit of DNA polymerase zeta.Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS). |
AT1G67510 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G67520 | lectin protein kinase family protein;(source:Araport11) |
AT1G67530 | ARM repeat superfamily protein;(source:Araport11) |
AT1G67560 | PLAT/LH2 domain-containing lipoxygenase family protein;(source:Araport11) |
AT1G67635 | phosphatidylinositol 4-kinase gamma-like protein;(source:Araport11) |
AT1G67645 | pseudogene of F-box protein (DUF295);(source:Araport11) |
AT1G67650 | SRP72 RNA-binding domain-containing protein;(source:Araport11) |
AT1G67660 | Restriction endonuclease, type II-like superfamily protein;(source:Araport11) |
AT1G67700 | multidrug resistance protein;(source:Araport11) |
AT1G67710 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Affects ABA-JA crosstalk. |
AT1G67720 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G67740 | PsbY precursor (psbY) mRNA. This single nuclear gene is imported into the chloroplasts where it is processed into two integral membrane proteins with identical topology (PsbY-1 and PsbY-2). The protein appears to bind manganese. Important for the redox control of cytochrome b559. |
AT1G67800 | Copine (Calcium-dependent phospholipid-binding protein) family;(source:Araport11) |
AT1G67820 | Protein phosphatase 2C family protein;(source:Araport11) |
AT1G67830 | Encodes a protein with α-fucosidase activity. The activity was assessed on 2'-fucosyl-lactitol. AtFXG1 was able to remove the t-fucosyl residues of XXFG xyloglucan oligosaccharides. |
AT1G67855 | hypothetical protein;(source:Araport11) |
AT1G67865 | hypothetical protein;(source:Araport11) |
AT1G67900 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT1G67910 | hypothetical protein;(source:Araport11) |
AT1G67970 | member of Heat Stress Transcription Factor (Hsf) family |
AT1G67990 | Encodes a tapetum-specific O-methyltransferase. In vitro enzyme assay indicated activity with caffeoyl-CoA, caffeoyl glucose, chlorogenic acid and polyamine conjugates. RNAi mutants had impaired silique development and seed setting. |
AT1G68050 | Encodes FKF1, a flavin-binding kelch repeat F box protein, is clock-controlled, regulates transition to flowering. Forms a complex with GI on the CO promoter to regulate CO expression. |
AT1G68060 | Encodes a microtubule associated protein (MAP70-1). Expressed in all tissues. |
AT1G68090 | Encodes a calcium-binding protein annexin (AnnAt5). Plays a vital role in pollen development via Ca2+ dependent membrane trafficking. |
AT1G68110 | An ENTH (Epsin NH2 terminal homology)/ANTH/VHS superfamily protein with adenylate cyclase activity and a role in clathrin assembly and endocytosis. |
AT1G68140 | zinc finger/BTB domain protein, putative (DUF1644);(source:Araport11) |
AT1G68150 | member of WRKY Transcription Factor; Group II-b The mRNA is cell-to-cell mobile. |
AT1G68190 | B-box zinc finger family protein;(source:Araport11) |
AT1G68200 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT1G68220 | aerobic coproporphyrinogen-III oxidase (DUF1218);(source:Araport11) |
AT1G68230 | Reticulon family protein;(source:Araport11) |
AT1G68240 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G68250 | hypothetical protein;(source:Araport11) |
AT1G68320 | putative transcription factor: R2R3-MYB transcription family. Involved in regulation of phosphate starvation responses and gibberellic acid biosynthesis. |
AT1G68330 | membrane-associated kinase regulator;(source:Araport11) |
AT1G68350 | cotton fiber protein;(source:Araport11) |
AT1G68370 | DnaJ-like protein with homology to coiled coils found in cytoskeleton-interacting proteins. |
AT1G68390 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT1G68400 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
AT1G68420 | Class II aaRS and biotin synthetases superfamily protein;(source:Araport11) |
AT1G68440 | Transmembrane protein;(source:Araport11). Expression induced by abiotic stressors such as ABA, drought, heat, light, NaCl, osmotic stress and wounding. |
AT1G68450 | VQ motif-containing protein;(source:Araport11) |
AT1G68460 | Encodes a putative adenylate isopentenyltransferase. It catalyzes the formation of isopentenyladenosine 5'-monophosphate (iPMP) from AMP and dimethylallylpyrophosphate (DMAPP), but it has a lower Km for ADP and likely works using ADP or ATP in plants. It is involved in cytokinin biosynthesis. |
AT1G68470 | Exostosin family protein;(source:Araport11) |
AT1G68480 | Encodes a putative zinc finger transcription factor that is necessary for proper lateral organ shape and is sufficient to induce the proliferation of lateral organ tissue. Together with NUB, it is involved in stamen and carpel development. |
AT1G68490 | translocase subunit seca;(source:Araport11) |
AT1G68500 | hypothetical protein;(source:Araport11) |
AT1G68530 | Encodes KCS6, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT1G68620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G68630 | PLAC8 family protein;(source:Araport11) |
AT1G68660 | ClpS1 is a member of the caseionolytic proteinase S family of N-recognins. It is involved in proteolysis in the chloroplast stroma. An arginine residue (Arg50) controls low-affinity substrate binding. |
AT1G68690 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT1G68710 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
AT1G68720 | Encodes the chloroplastic A-to-I tRNA editing enzyme. |
AT1G68730 | Zim17-type zinc finger protein;(source:Araport11) |
AT1G68735 | Encodes a defensin-like (DEFL) family protein. |
AT1G68740 | Encodes PHO1;H1, a member of the PHO1 family. Involved in inorganic phosphate (Pi) transport and homeostasis. Complements pho1 mutation. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
AT1G68750 | Encodes one of four Arabidopsis phosphoenolpyruvate (PEP) carboxylase proteins. But, it is more similar to bacterial PEP carboxylase than plant PEP carboxylase. Efforts to express this enzyme and to demonstrate its enzymatic activity in E.coli failed. |
AT1G68765 | Encodes a small protein of 77 amino acids. Loss of function mutations are defective in the process of ethylene independent floral organ abscission. Although the mutants have a normal appearing abscission zone, the floral organs do not abscisce. The peptide appears to be secreted and may function as a ligand. Arabidopsis 35S:IDA lines constitutively overexpressing IDA exhibit earlier abscission of floral organs, showing that the abscission zones are responsive to IDA soon after the opening of the flowers. In addition, ectopic abscission was observed at the bases of the pedicel, branches of the inflorescence, and cauline leaves. The silique valves also dehisced prematurely. |
AT1G68780 | RNI-like superfamily protein;(source:Araport11) |
AT1G68790 | Member of small gene family in Arabidopsis containing 4 members (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
AT1G68795 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT1G68800 | Encodes a TCP transcription factor, closely related to teosinte branched1, arrests axillary bud development and prevents axillary bud outgrowth. Transcription level and mutant phenotype are weaker than its homolog BRC1 (At3G18550). |
AT1G68810 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G68825 | ROTUNDIFOLIA like 15;(source:Araport11) |
AT1G68840 | Rav2 is part of a complex that has been named `regulator of the (H+)-ATPase of the vacuolar and endosomal membranes' (RAVE) The mRNA is cell-to-cell mobile. |
AT1G68845 | hypothetical protein;(source:Araport11) |
AT1G68850 | Peroxidase superfamily protein;(source:Araport11) |
AT1G68880 | basic leucine-zipper 8;(source:Araport11) |
AT1G68910 | Encodes one of the WPP domain-interacting proteins (WIT1/AT5G11390, WIT2/AT1G68910) required for RanGAP nuclear envelope association in root tip cells. Ran GTPase plays essential roles in multiple cellular processes, including nucleocytoplasmic transport, spindle formation, and postmitotic nuclear envelope reassembly. The cytoplasmic Ran GTPase activating protein RanGAP is critical to establish a functional RanGTP/RanGDP gradient across the nuclear envelope and is associated with the outer surface of the nuclear envelope in metazoan and higher plant cells. Arabidopsis thaliana RanGAP association with the root tip nuclear envelope requires a family of likely plant-specific nucleoporins combining coiled-coil and transmembrane domains (CC-TMD) and WPP domain-interacting proteins (WIPs). WIT1 and WIT2 have been identified as a second family of CC-TMD proteins, structurally similar, yet clearly distinct from the WIP family, that is required for RanGAP nuclear envelop association in root tip cells. |
AT1G68930 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
AT1G68970 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
AT1G69030 | BSD domain-containing protein;(source:Araport11) |
AT1G69070 | nucleolar-like protein;(source:Araport11) |
AT1G69080 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT1G69120 | Floral homeotic gene encoding a MADS domain protein homologous to SRF transcription factors. Specifies floral meristem and sepal identity. Required for the transcriptional activation of AGAMOUS. Interacts with LEAFY.Binds to promoter and regulates the expression of flowering time genes SVP, SOC1 and AGL24. |
AT1G69160 | suppressor;(source:Araport11) |
AT1G69170 | Encodes SPL6. Required for the resistance mediated by the TIR-NB-LRR RPS4 against Pseudomonas syringae carrying the avrRps4 effector. Transcriptome analysis indicates that SPL6 positively regulates a subset of defense genes. |
AT1G69190 | encodes a bifunctional cytosolic hydroxymethyldihydropterin pyrophosphokinase/ dihydropteroate synthase (HPPK/DHPS)that is involved in tetrahydrofolate biosynthesis and is responsive to oxidative stress. |
AT1G69220 | Encodes serine/threonine kinase 1 (SIK1), a Hippo homolog. Regulates cell proliferation and cell expansion. |
AT1G69240 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco but no enzymatic activity has been identified for this protein. |
AT1G69252 | other_RNA;(source:Araport11) |
AT1G69260 | ABI five binding protein;(source:Araport11) |
AT1G69270 | RPK1 is a leucine-rich receptor-like kinase located in the plasma membrane which is upregulated by abscisic acid, dehydration, high salt, low temperature, but not by other plant hormones. RPK1 knock-out and antisense plants show an ABA-insensitive phenotype. RPK1 plays a role in ABA-controlled cell proliferation and is a regulator of the ABA signal transduction pathway. Overexpression of the LRR domain has a dominant negative effect on RPK1. Mutations in RPK1 uncouple cotyledon anlagen and primordia by modulating epidermal cell shape and polarity. |
AT1G69310 | Encodes WRKY57, a member of the WRKY Transcription Factor. Activation of WRKY57 confers drought tolerance. |
AT1G69320 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT1G69360 | T-box transcription factor, putative (DUF863);(source:Araport11) |
AT1G69420 | DHHC-type zinc finger family protein;(source:Araport11) |
AT1G69430 | Son of sevenless protein;(source:Araport11) |
AT1G69440 | Encodes ARGONAUTE7, a member of the ARGONAUTE family, characterised by the presence of PAZ and PIWI domains. Involved in the regulation of developmental timing. Required for the accumulation of TAS3 ta-siRNAs but not for accumulation of miR171, miR173, miR390 or mi391. Localized in mature rosette leaves and floral buds. |
AT1G69460 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT1G69480 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT1G69485 | Ribosomal L32p protein family;(source:Araport11) |
AT1G69490 | Encodes a member of the NAC transcription factor gene family. It is expressed in floral primordia and upregulated by AP3 and PI. Its expression is associated with leaf senescence. The mRNA is cell-to-cell mobile. |
AT1G69500 | Encodes a cytochrome P450, designated CYP704B1. Expressed in the developing anthers. Essential for pollen exine development. Mutations in CYP704B1 result in impaired pollen walls that lack a normal exine layer and exhibit a characteristic striped surface, termed zebra phenotype. Heterologous expression of CYP704B1 in yeast cells demonstrated that it catalyzes omega-hydroxylation of long-chain fatty acids, implicating these molecules in sporopollenin synthesis. |
AT1G69510 | cAMP-regulated phosphoprotein 19-related protein;(source:Araport11) |
AT1G69523 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G69526 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G69530 | Member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
AT1G69540 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. |
AT1G69550 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
AT1G69570 | CDF5 is a circadian regulated transcript that is antiphasic with respect to its natural antisense transcript (NAT) FLORE (AT1G69572).CDF5 transcript accumulation delays flowering. CDF5 links circadian oscillation and photoperiodism. |
AT1G69572 | Circadian regulated lncRNA, natural antisense gene of CDF5 (AT1G69570). Displays antiphasic expression pattern in relation to CDF5 expression (PMID:28758689). |
AT1G69580 | Homeodomain-like superfamily protein;(source:Araport11) |
AT1G69588 | Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini |
AT1G69620 | putative 60S ribosomal protein L34 The mRNA is cell-to-cell mobile. |
AT1G69630 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT1G69680 | ran guanine nucleotide release factor, putative (Mog1/PsbP/DUF1795-like photosystem II reaction center PsbP family protein);(source:Araport11) |
AT1G69710 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
AT1G69720 | Encodes a member (HO3) of the heme oxygenase family. |
AT1G69730 | Wall-associated kinase family protein;(source:Araport11) |
AT1G69770 | Encodes a chromomethylase involved in methylating cytosine residues at non-CG sites. Involved in preferentially methylating transposon-related sequences, reducing their mobility. CMT3 interacts with an Arabidopsis homologue of HP1 (heterochromatin protein 1), which in turn interacts with methylated histones. Involved in gene silencing. |
AT1G69790 | Protein kinase superfamily protein;(source:Araport11) |
AT1G69810 | member of WRKY Transcription Factor; Group II-b |
AT1G69820 | Note that conflicting nomenclature exists in the literature: At1g69820 is named as GGT4 in Plant J. 2007 Mar 49(5):878-88; and as GGT3 in Plant Physiol. 2007 Aug 144(4):1715-32. |
AT1G69840 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
AT1G69850 | Encodes an inducible component of low-affinity nitrate uptake. mRNA found primarily in root hairs and the epidermis of roots. It also acts as an ABA importer at the site of ABA biosynthesis and is important for the regulation of stomatal aperture in inflorescence stems. |
AT1G69860 | Major facilitator superfamily protein;(source:Araport11) |
AT1G69870 | Encodes a low affinity nitrate transporter NRT1.7. Expressed in phloem. Responsible for source-to-sink remobilization of nitrate. The mRNA is cell-to-cell mobile. |
AT1G69880 | thioredoxin H-type 8;(source:Araport11) |
AT1G69910 | Protein kinase superfamily protein;(source:Araport11) |
AT1G69920 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT1G69935 | Encodes a nuclear localized serine-arginine-aspartate-rich protein that acts as a negative regulator of photomorphogenesis. |
AT1G69960 | type 2A serine/threonine protein phosphatase (PP2A) mRNA, positive regulators of SPCH and thus stomatal production. |
AT1G69970 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can not replace CLV3 function in vivo. |
AT1G69990 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G70020 | transmembrane protein, putative (DUF1163);(source:Araport11) |
AT1G70110 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT1G70120 | transmembrane protein, putative (DUF1163);(source:Araport11) |
AT1G70130 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT1G70150 | zinc ion binding protein;(source:Araport11) |
AT1G70170 | Matrix metalloprotease. Expression induced by fungal and bacterial pathogens. Mutants are late flowering with early senescence. |
AT1G70185 | other_RNA;(source:Araport11) |
AT1G70200 | Encodes a RNA-Binding Protein RBD1. Promotes chilling tolerance through 23S rRNA processing. |
AT1G70210 | Encodes a D-type cyclin that physically interacts with CDC2A. Its expression is upregulated early during germination. |
AT1G70260 | Encodes an endoplasmic reticulum (ER)-localized nodulin MtN21-like transporter family protein that negatively regulates resistance against biotrophic pathogens but not the necrotrophic pathogen, B. cinerea, possibly by regulating ROS production, cell death and PR1 expression. |
AT1G70280 | NHL domain-containing protein;(source:Araport11) |
AT1G70290 | Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants. |
AT1G70300 | potassium transporter |
AT1G70350 | hypothetical protein;(source:Araport11) |
AT1G70370 | Polygalacturonase involved in cell wall modification. |
AT1G70390 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G70400 | NOSIC domain protein;(source:Araport11) |
AT1G70420 | DNA ligase-like protein, putative (DUF1645);(source:Araport11) |
AT1G70430 | Protein kinase superfamily protein;(source:Araport11) |
AT1G70470 | transmembrane protein;(source:Araport11) |
AT1G70480 | Protein residing in the chloroplast outer membrane, has channel-like properties facilitating the export of the jasmonate precursor 12-oxophytodienoic acid (OPDA) from the chloroplast. |
AT1G70520 | Encodes a cysteine-rich receptor-like protein kinase located to the plasma membrane. Involved in regulating microbe-associated molecular pattern-triggered ROS production and stress induced callose deposition at the plasmodesmata in roots. Required for MAMP-triggered responses and resistance to Pseudomonas syringae pv. tomato 118 DC3000 . |
AT1G70530 | Encodes a cysteine-rich receptor-like protein kinase. |
AT1G70540 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G70550 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT1G70560 | TAA1 is involved in the shade-induced production of indole-3-pyruvate (IPA), a precursor to IAA, a biologically active auxin. It is also involved in regulating many aspects of plant growth and development from embryogenesis to flower formation and plays a role in ethylene-mediated signaling. This enzyme can catalyze the formation of IPA from L-tryptophan. Though L-Trp is expected to be the preferred substrate in vivo, TAA1 also acts as an aminotransferase using L-Phe, L-Tyr, L-Leu, L-Ala, L-Met, and L-Gln. Lines carrying mutations in this gene are unaffected by auxin transporter inhibitor NPA. Double mutant analysis and exogenous auxin treatment suggest that this gene is required for auxin signaling during lateral root and root meristem development. The activity of TAA1 can be controlled by phosphorylation of residue T101, which, when phosphorylated results in loss of activity. TAA1 is a target of TMK4. |
AT1G70600 | Ribosomal protein L18e/L15 superfamily protein;(source:Araport11) |
AT1G70630 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
AT1G70690 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
AT1G70700 | JAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. The mRNA is cell-to-cell mobile. |
AT1G70730 | Encodes a cytosolic phosphoglucomutase (PGM). Two Arabidopsis PGM proteins (AT1G70730/PGM2 and AT1G23190/PGM3) have high sequence similarities and redundant functions. Mature plants possessing a single cPGM allele had a major reduction in cPGM activity. Whereas pgm2 and pgm3 single mutants are undistinguishable from the wild type, loss of both PGM2 and PGM3 severely impairs male and female gametophyte development. |
AT1G70750 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
AT1G70820 | phosphoglucomutase, putative / glucose phosphomutase;(source:Araport11) |
AT1G70960 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G70970 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G71000 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G71002 | Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUCGUUGUCUGUUCGACCUU. Regulates flavonoid-specific MYB transcription factor genes resulting in resistance to pathogen infection. |
AT1G71015 | PADRE protein. |
AT1G71030 | Encodes a putative myb family transcription factor. In contrast to most other myb-like proteins its myb domain consists of a single repeat. A proline-rich region potentially involved in transactivation is found in the C-terminal part of the protein. Its transcript accumulates mainly in leaves. |
AT1G71040 | Encodes LPR2. Function together with LPR1 (AT1G23010) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
AT1G71110 | transmembrane protein;(source:Araport11) |
AT1G71120 | Contains lipase signature motif and GDSL domain. |
AT1G71140 | MATE transporter that can export the antibiotic norfloxacin. |
AT1G71200 | bHLH160 transcription factor. Induced by copper deficiency and seems to mediate copper uptake along with SPL7. Alternative splicing variant in response to MeJa treatment has potential novel function where it can dimerize but not bind DNA, resulting in a function opposite of the primary isoform. |
AT1G71300 | Vps52 / Sac2 family;(source:Araport11) |
AT1G71360 | Encodes a member of the mid-SUN subfamily of SUN-domain proteins that is localized to both the nuclear envelope and the ER. It is involved in early seed development and nuclear morphology. |
AT1G71370 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT1G71380 | cellulase 3;(source:Araport11) |
AT1G71390 | receptor like protein 11;(source:Araport11) |
AT1G71400 | Encodes a CLAVATA2 (CLV2)-related gene. Complements the clv2 mutant when expressed under the control of the CLV2 promoter. The mRNA is cell-to-cell mobile. |
AT1G71440 | Encodes tubulin-folding cofactor E. Mutant embryos consist of one or a few grossly enlarged cells, surrounded by an endosperm that fails to cellularize and contains a few big nuclei. |
AT1G71680 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT1G71690 | glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11) |
AT1G71696 | Encodes a Putative Zn2+ carboxypeptidase, 4 splice variants have been identified but not characterized for different functions and/or expression patterns.SOL1 isolated as a suppressor of root- specific overexpression of CLE19, a clavata3 like gene. sol1 partially suppresses the short root phenotype caused by CLE19 overexpression. |
AT1G71697 | Encodes choline kinase. mRNA levels are increased in response to wounding. The mRNA is cell-to-cell mobile. |
AT1G71700 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
AT1G71710 | DNAse I-like superfamily protein;(source:Araport11) |
AT1G71770 | Encodes a Class I polyA-binding protein. Expressed in floral organs. Binds polyA sepharose in vitro. |
AT1G71790 | Encodes a heterodimeric actin binding protein composed of an alpha and a beta sumunit. Stabilizes actin filament cytoskeleton by capping. |
AT1G71800 | RNA 3′-end?processing factor of antisense FLC transcript. Mediates silencing of the floral repressor gene FLC. Member of CstF complex. |
AT1G71820 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
AT1G71880 | Sucrose transporter gene induced in response to nematodes; member of Sucrose-proton symporter family. The mRNA is cell-to-cell mobile. |
AT1G71890 | Encodes a sucrose transporter that is expressed in the endosperm. Mutants have delayed accumulation of fatty acids and embryo maturation. |
AT1G71940 | SNARE associated Golgi protein family;(source:Araport11) |
AT1G71980 | RMR2 is a secretory pathway protein localized to the trans-golgi network. It belongs to a family of vacuolar sorting receptors. If forms heterodimers with RMR1. |
AT1G72000 | Plant neutral invertase family protein;(source:Araport11) |
AT1G72100 | late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11) |
AT1G72150 | novel cell-plate-associated protein that is related in sequence to proteins involved in membrane trafficking in other eukaryotes The mRNA is cell-to-cell mobile. |
AT1G72180 | Encodes a leucine-rich repeat receptor kinase that functions as a receptor for CEP1 peptide. Mediates nitrate uptake signaling. |
AT1G72190 | D-isomer specific 2-hydroxyacid dehydrogenase family protein;(source:Araport11) |
AT1G72220 | RING/U-box superfamily protein;(source:Araport11) |
AT1G72260 | Encodes a thionin which is a cysteine rich protein having antimicrobial properties. Thi2.1 is expressed in response to a variety of pathogens and induced by ethylene and jasmonic acid. Belongs to the plant thionin (PR-13) family with the following members: At1g66100, At5g36910, At1g72260, At2g15010, At1g12663, At1g12660. |
AT1G72270 | Encodes IDAP1. Acts together with IDAP2 and IDM1 to regulate active DNA demethylation. |
AT1G72300 | Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of PSY1. PSY1 is an 18-aa tyrosine-sulfated glycopeptide encoded by AT5G58650 that promotes cellular proliferation and expansion. |
AT1G72310 | Encodes a putative RING-H2 zinc finger protein ATL3 (ATL3). |
AT1G72350 | MADS-box transcription factor family protein;(source:Araport11) |
AT1G72410 | COP1-interacting protein-like protein;(source:Araport11) |
AT1G72430 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G72440 | Encodes SLOW WALKER2 (SWA2), a NOC1/Mak21 homologue. Essential for coordinated cell cycle progression during female gametophyte development. |
AT1G72460 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G72470 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT1G72480 | Lung seven transmembrane receptor family protein;(source:Araport11) |
AT1G72510 | DUF1677 family protein (DUF1677);(source:Araport11) |
AT1G72530 | Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
AT1G72590 | Encodes a polyphenol reductase. |
AT1G72610 | germin-like protein (GLP1) |
AT1G72620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G72640 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G72700 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
AT1G72760 | Protein kinase superfamily protein;(source:Araport11) |
AT1G72770 | mutant has ABA hypersensitive inhibition of seed germination; Protein Phosphatase 2C; regulates the activation of the Snf1-related kinase OST1 by abscisic acid. The mRNA is cell-to-cell mobile. |
AT1G72800 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G72810 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
AT1G72880 | Survival protein SurE-like phosphatase/nucleotidase;(source:Araport11) |
AT1G72900 | Toll-Interleukin-Resistance (TIR) domain-containing protein;(source:Araport11) |
AT1G72980 | LOB domain-containing protein 7;(source:Araport11) |
AT1G73020 | anoctamin-like protein;(source:Araport11) |
AT1G73040 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT1G73130 | ATG8A/F interacting protein containing a WxxL LIR motif at the C terminus which is essential for interaction with ATG8. Stress (abiotic or biotic) results in the formation of ATG8- and ATI3-labeled punctate structures, likely reflecting increased formation of ATG8-labeled phagophores or autophagosomes. ATI3 proteins probably act as selective autophagy receptors that target specific cellular components during the plant stress response. ATI3 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
AT1G73160 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G73165 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can replace CLV3 function in vivo. |
AT1G73180 | Eukaryotic translation initiation factor eIF2A family protein;(source:Araport11) |
AT1G73190 | Moves to the Protein Storage Vacuole in a Golgi independent manner |
AT1G73210 | hypothetical protein (DUF789);(source:Araport11) |
AT1G73220 | Encodes Organic Cation Transporter 1 (OCT1), likely to be involved in polyamine transport. |
AT1G73310 | serine carboxypeptidase-like 4;(source:Araport11) |
AT1G73320 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G73330 | encodes a plant-specific protease inhibitor-like protein whose transcript level in root disappears in response to progressive drought stress. The decrease in transcript level is independent from abscisic acid level. |
AT1G73340 | ADTO1 is required for the activation of systemic acquired resistance. |
AT1G73360 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. It is involved in trichome branching. The transcription factor directly upregulates the expression of several cell-wall-loosening protein genes and reveals the important role that these target genes play in coordinating cell-wall extensibility with root development. |
AT1G73370 | Encodes a protein with sucrose synthase activity (SUS6). |
AT1G73430 | COG3 is a component of a putative conserved oligomeric Golgi (COG) complex that is thought to be involved in tethering of retrograde intra Golgi vesicles. In mutant pollen,golgi appear abnormal. It is required for proper deposition of cell wall materials in pollen tube growth. When homozygotes can be produced (by complementing the defect in pollen), the plants are embryo lethal suggesting an essential function. COG3 interacts with several other putative COG components. |
AT1G73440 | calmodulin-like protein;(source:Araport11) |
AT1G73480 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G73490 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G73500 | member of MAP Kinase Kinase family. Autophosphorylates and also phosphorylates MPK3 and MPK6. Independently involved in ethylene and calmalexin biosynthesis. Induces transcription of ACS2, ACS6, ERF1, ERF2, ERF5, ERF6, CYP79B2, CYP79B3, CYP71A13 and PAD3. |
AT1G73580 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT1G73590 | Encodes an auxin efflux carrier involved in shoot and root development. It is involved in the maintenance of embryonic auxin gradients. Loss of function severely affects organ initiation, pin1 mutants are characterised by an inflorescence meristem that does not initiate any flowers, resulting in the formation of a naked inflorescence stem. PIN1 is involved in the determination of leaf shape by actively promoting development of leaf margin serrations. In roots, the protein mainly resides at the basal end of the vascular cells, but weak signals can be detected in the epidermis and the cortex. Expression levels and polarity of this auxin efflux carrier change during primordium development suggesting that cycles of auxin build-up and depletion accompany, and may direct, different stages of primordium development. PIN1 action on plant development does not strictly require function of PGP1 and PGP19 proteins. |
AT1G73680 | Encodes an alpha dioxygenase. Recombinant protein catalyzes the conversion of a wide range of fatty acids into 2(R)-hydroperoxy derivatives. |
AT1G73687 | Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUUGGAUUGAAGGGAGCUCUA. Functions redundantly with MIR159B. Plants that are doubly mutated for MIR159AB have curled leaves and reduced stature. Pri-mRNA coordinates for MIR159a (converted to TAIR10 based on PMID19304749): Chr1: 27713700-27712893 (reverse), length: 808 bp; exon coordinates: exon 1: 27713700 to 27712893, mature miRNA and miRNA* are located on exon 1. |
AT1G73690 | cyclin dependent kinase activator CDKD;1. Nuclear localization. Involved in cell cycle regulation and cell differentiation. |
AT1G73760 | RING/U-box superfamily protein;(source:Araport11) |
AT1G73790 | Encodes a gamma-tubulin complex protein that plays a role in gamma-tubulin complex localization, spindle stability and chromosomal segregation. |
AT1G73805 | Encodes SAR Deficient 1 (SARD1), a key regulator for ICS1 (Isochorismate Synthase 1) induction and salicylic acid (SA) synthesis. |
AT1G73850 | DNA ligase (DUF1666);(source:Araport11) |
AT1G73860 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G73870 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
AT1G73875 | Deadenylase. |
AT1G73950 | Transmembrane Fragile-X-F-associated protein;(source:Araport11) |
AT1G73960 | Member of TFIID complex. |
AT1G73965 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. |
AT1G74000 | encodes a protein similar to strictosidine synthase, which is involved in the production of monoterpene indole alkaloids. This gene belongs to a family of 13 members in Arabidopsis. |
AT1G74010 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT1G74040 | Encodes an active Arabidopsis isopropylmalate synthase IPMS2. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS2 can be compensated by a second isopropylmalate synthase gene IPMS1 (At1g18500). |
AT1G74090 | encodes a desulfoglucosinolate sulfotransferase, involved in the final step of glucosinolate core structure biosynthesis. Has a broad-substrate specificity with preference with methionine-derived desulfoglucosinolates. |
AT1G74100 | encodes a desulfoglucosinolate sulfotransferase, involved in the final step of glucosinolate core structure biosynthesis. Has a broad-substrate specificity with different desulfoglucosinolates, the best substrate is indole-3-methyl-dsGS, followed by benzyl-dsGS. Expression was induced by wounding, jasmonate and ethylene stimulates. |
AT1G74110 | member of CYP78A |
AT1G74220 | homeobox-like protein;(source:Araport11) |
AT1G74240 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT1G74320 | encodes a choline kinase, whose expression is induced by high salt and mannitol. |
AT1G74410 | RING/U-box superfamily protein;(source:Araport11) |
AT1G74440 | Similar to MPH1, can complement mph1-1 salt sensitivity phenotype. |
AT1G74458 | transmembrane protein;(source:Araport11) |
AT1G74470 | Encodes for a multifunctional protein with geranylgeranyl reductase activity shown to catalyze the reduction of prenylated geranylgeranyl-chlorophyll a to phytyl-chlorophyll a (chlorophyll a) and free geranylgeranyl pyrophosphate to phytyl pyrophosphate. The mRNA is cell-to-cell mobile. |
AT1G74480 | RWP-RK domain-containing protein;(source:Araport11) |
AT1G74500 | Encodes a basic helix/loop/helix transcription factor that acts downstream of MP in root initiation. TMO7 protein moves to the hypophysis and to vascular cells, contributing to MP-dependent root formation. Promotes the correct definition of the hypophysis cell division plane. |
AT1G74520 | Part of the AtHVA22a family. Protein expression is ABA- and stress-inducible. |
AT1G74550 | Encodes a tricoumaroylspermidine meta-hydroxylase that participates in the formation of N1,N5-di(hydroxyferuloyol)- N10-sinapoylspermidine, an important constituent of pollen. This gene appears to be expressed in young flower buds and inflorescence tips with notably high levels of expression in the tapetum and pollen. It is also expressed in root tips. |
AT1G74640 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G74670 | Gibberellin-regulated family protein;(source:Araport11) |
AT1G74680 | Exostosin family protein;(source:Araport11) |
AT1G74720 | Encodes a putative transmembrane protein carrying four C(2) domains, suggesting that QKY may function in membrane trafficking in a Ca(2+)-dependent fashion. Mutant analysis shows that this gene is involved in organ development. |
AT1G74770 | zinc ion binding protein;(source:Araport11) |
AT1G74810 | HCO3- transporter family;(source:Araport11) |
AT1G74820 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT1G74870 | RING/U-box superfamily protein;(source:Araport11) |
AT1G74910 | KONJAC1 is imilar to sugar pyrophosphorylases but has an insertion of 2 AA in the pyrophosphorylase consensus motif that is highly conserved in GMPPs. It lacks GDP-mannose pyrophosphorylase activity but can simulate the GDP-mannose pyrophosphorylase activity of VTC1. |
AT1G74940 | cyclin-dependent kinase, putative (DUF581);(source:Araport11) |
AT1G74990 | RING/U-box superfamily protein;(source:Araport11) |
AT1G75030 | encodes a PR5-like protein |
AT1G75040 | Thaumatin-like protein involved in response to pathogens. mRNA level of the PR-5 gene (At1g75040)is significantly changed after cutting the inflorescence stem indicating the existence of a network of signal transducing pathways as other stress-regulated genes (At5g01410, At3g17800, At1g29930)do not response to the treatment. The mRNA is cell-to-cell mobile. |
AT1G75060 | Evening-expressed key component of Sin3-HDAC complex, which bind directly to the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and PSEUDO-RESPONSE REGULATOR 9 (PRR9) promoters and catalyze histone 3 (H3) deacetylation at the cognate regions to repress expression, allowing the declining phase of their expression at dusk. |
AT1G75070 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT1G75090 | DNA glycosylase superfamily protein;(source:Araport11) |
AT1G75100 | Contains a J-domain at the C-terminus which is similar to the J-domain of auxilin, a clathrin-uncoating factor in cow, yeast and worm. Arabidopsis contains 6 other proteins similar to auxilin. Expressed in leaves and stems, but not in roots. Localized in the cytoplasm. Required for the chloroplast accumulation response, but not for the avoidance response. No molecular function known. Influences the composition of photosynthetic pigments, the efficiency of photosynthesis, and the CO2 uptake rate. Positive effect on water use efficiency (WUE) by reducing stomatal aperture and water vapor conductance; involved in the fine-tuning of H2O2 foliar levels, antioxidant enzymes activities and cell death after UV-C photooxidative stress. |
AT1G75190 | hypothetical protein;(source:Araport11) |
AT1G75200 | flavodoxin family protein / radical SAM domain-containing protein;(source:Araport11) |
AT1G75210 | HAD-superfamily hydrolase, subfamily IG, 5-nucleotidase;(source:Araport11) |
AT1G75220 | Encodes a vacuolar glucose exporter that is induced in response to factors that activate vacuolar glucose pools like darkness, heat stress and wounding and repressed during conditions that trigger glucose accumulation in the vacuole like cold stress and external sugar supply. |
AT1G75260 | oxidoreductases, acting on NADH or NADPH;(source:Araport11) |
AT1G75261 | Pseudogene of AT4G39230; isoflavone reductase, putative |
AT1G75290 | encodes a protein whose sequence is similar to an isoflavone reductase |
AT1G75380 | Encodes a nuclease involved in ABA-mediated callose deposition. It has been shown to interact with JAZ proteins, binds to a jasmonic acid-responsive element (JARE) and repress AtJMT expression. |
AT1G75400 | RING/U-box superfamily protein;(source:Araport11) |
AT1G75410 | BEL1-like homeodomain 3 (BLH3) |
AT1G75430 | BEL1-like homeodomain 11;(source:Araport11) |
AT1G75440 | ubiquitin-conjugating enzyme 16;(source:Araport11) |
AT1G75460 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
AT1G75500 | An Arabidopsis thaliana homolog of Medicago truncatula NODULIN21 (MtN21). The gene encodes a plant-specific, predicted integral membrane protein and is a member of the Plant-Drug/Metabolite Exporter (P-DME) family (Transporter Classification number: TC 2.A.7.3) and the nodulin MtN21-like transporter family. |
AT1G75510 | Transcription initiation factor IIF, beta subunit;(source:Araport11) |
AT1G75520 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis.SRS5 is a positive regulator of photomorphogenesis. |
AT1G75530 | Forkhead-associated (FHA) domain-containing protein;(source:Araport11) |
AT1G75540 | Encodes a B-box zinc finger transcription factor BBX21 (also named STH2/salt tolerance homolog2 and LHUS/long hypocotyl under shade). Interacts with COP1 to control de-etiolation. Also genetically interacts with COP1 to regulate shade avoidance. The mRNA is cell-to-cell mobile. |
AT1G75590 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G75600 | Histone superfamily protein;(source:Araport11) |
AT1G75630 | vacuolar H+-pumping ATPase 16 kD proteolipid (ava-p) mRNA, The mRNA is cell-to-cell mobile. |
AT1G75690 | Thylakoid Thiol/Disulfide-Modulating Protein. |
AT1G75700 | HVA22-like protein G;(source:Araport11) |
AT1G75730 | hypothetical protein;(source:Araport11) |
AT1G75760 | ER lumen protein retaining receptor family protein;(source:Araport11) |
AT1G75800 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT1G75840 | Belongs to the plant-specific ROP group of Rho GTPases; localized to the plasma membrane of tips of root hairs; involved in polar growth control. The mRNA is cell-to-cell mobile. |
AT1G75860 | DNA ligase;(source:Araport11) |
AT1G75930 | member of Lipase proteins |
AT1G76030 | One of three genes encoding the vacuolar ATP synthase subunit B1. This subunit was shown to interact with the gene product of hexokinase1 (ATHXK1). This interaction, however, is solely restricted to the nucleus. The protein binds to and co-localizes with F-actin, bundles F-actin to form higher-order structure, and stabilizes actin filaments in vitro. The mRNA is cell-to-cell mobile. |
AT1G76040 | member of Calcium Dependent Protein Kinase |
AT1G76050 | Pseudouridine synthase family protein;(source:Araport11) |
AT1G76080 | Encodes a thioredoxin like protein. Localizes to the chloroplast and is redistributed to the chloroplast envelope under heat stress. It is involved in non host resistance and thermotolerance. |
AT1G76090 | Encodes S-adenosyl-methionine-sterol-C-methyltransferase, an enzyme in the sterol biosynthetic pathway. |
AT1G76110 | HMG (high mobility group) box protein with ARID/BRIGHT DNA-binding domain-containing protein;(source:Araport11) |
AT1G76150 | Encodes a monofunctional enoyl-CoA hydratase 2, involved in the degradation of even cis-unsaturated fatty acids, gene expression is enhanced during the first 2 days of germination, as well as in senescent leaves. |
AT1G76160 | SKU5 similar 5;(source:Araport11) |
AT1G76180 | Encodes a dehydrin protein whose expression is induced early on in response to dehydration stress. This gene's expression to cold occurs in two waves, with early induction occurring within 1 h and secondary induction occurring 5 h after the beginning of cold stress. Expression is also induced in response to ABA but not in response to 2,4-D, BA, and GA3. ERD14 protein is capable of binding Ca2+, especially when the protein is phosphorylated. |
AT1G76190 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G76210 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
AT1G76240 | DUF241 domain protein (DUF241);(source:Araport11) |
AT1G76250 | transmembrane protein;(source:Araport11) |
AT1G76280 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G76300 | snRNP core protein SMD3;(source:Araport11) |
AT1G76310 | core cell cycle genes |
AT1G76350 | Plant regulator RWP-RK family protein;(source:Araport11) |
AT1G76370 | Protein kinase superfamily protein;(source:Araport11) |
AT1G76390 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT1G76430 | Encodes Pht1;9, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
AT1G76460 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G76490 | Encodes a 3-hydroxy-3-methylglutaryl coenzyme A reductase, which is involved in melavonate biosynthesis and performs the first committed step in isoprenoid biosynthesis. Expression is activated in dark in leaf tissue but not controlled by light in the root (confine The mRNA is cell-to-cell mobile. |
AT1G76500 | Encodes an AT hook domain containing protein. Identified in a screen of activation tagged lines that suppress the long-hypocotyl phenotype of a weak phyB allele. Affects cell elongation in the hypocotyl and leaves.Acts redundantly with ESC to modulate hypocotyl growth inhibition in response to light |
AT1G76540 | Encodes a cyclin-dependent protein kinase involved in regulation of the G2/M transition of the mitotic cell cycle. Specifically binds to the cyclin CYCD4;1, expressed in shoot meristem, young leaves and vascular tissue during the G2/M phase. Required for proper organization of the shoot apical meristem and for hormone signaling. |
AT1G76560 | CP12 domain-containing protein 3;(source:Araport11) |
AT1G76580 | Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein;(source:Araport11) |
AT1G76590 | PLATZ transcription factor family protein;(source:Araport11) |
AT1G76620 | Serine/Threonine-kinase, putative (Protein of unknown function, DUF547);(source:Araport11) |
AT1G76630 | SKI3 encodes a cytplasmically localized component of the SKI complex which is involved in exosome mediated RNA decay. |
AT1G76650 | calmodulin-like 38;(source:Araport11) |
AT1G76680 | Encodes a member of an alpha/beta barrel fold family of FMN-containing oxidoreductases. One of the closely related 12-oxophytodienoic acid reductases. This enzyme is not expected to participate in jasmonic acid biosynthesis because during in vitro assays, it shows very little activity with the naturally occurring OPDA isomer. Shows activity towards 2,4,6-trinitrotoluene. Expressed predominately in root. Up-regulated by senescence and jasmonic acid. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. Predicted to be a cytosolic protein. |
AT1G76690 | Encodes one of the closely related 12-oxophytodienoic acid reductases. This enzyme is not expected to participate in jasmonic acid biosynthesis because during in vitro assays, it shows very little activity with the naturally occurring OPDA isomer. Shows activity towards 2,4,6-trinitrotoluene. Expressed predominately in root. Predicted to be a cytosolic protein. |
AT1G76705 | calmodulin binding protein;(source:Araport11) |
AT1G76728 | transmembrane protein;(source:Araport11) |
AT1G76760 | Encodes a y-type thioredoxin (Trx-y1) localized in chloroplast stroma. |
AT1G76770 | HSP20-like chaperone |
AT1G76780 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT1G76790 | Encodes a protein with similarity to N-acetylserotonin O-methyltransferase (ASMT) but it does not have ASMT activity in vitro. |
AT1G76830 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G76870 | transcription factor;(source:Araport11) |
AT1G76890 | encodes a plant trihelix DNA-binding protein |
AT1G76892 | Natural antisense transcript overlaps with AT1G76890;(source:Araport11) |
AT1G76900 | Member of plant TLP family. Contains terminal F-box domain, interacts with ASK proteins. Tethered to the PM. |
AT1G76920 | F-box family protein;(source:Araport11) |
AT1G76950 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
AT1G76965 | Encodes a Protease inhibitor/seed storage/LTP family protein |
AT1G76970 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT1G76980 | patatin-like phospholipase domain protein;(source:Araport11) |
AT1G76990 | ACT domain repeat 3;(source:Araport11) |
AT1G77010 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G77020 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT1G77080 | MADS domain protein - flowering regulator that is closely related to FLC. Deletion of this locus in Nd ecotype is correlated with earlier flowering in short days suggesting function as a negative regulator of flowering. |
AT1G77095 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.8e-14 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G77120 | Catalyzes the reduction of acetaldehyde using NADH as reductant. Requires zinc for activity. Dimer. Anaerobic response polypeptide (ANP). Fermentation. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. The mRNA is cell-to-cell mobile. |
AT1G77145 | transmembrane protein, putative (DUF506);(source:Araport11) |
AT1G77150 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G77210 | AtSTP14 belongs to the family of sugar transport proteins (AtSTPs)in volved in monosaccharide transport. Heterologous expression in yeast revealed that AtSTP14 is the transporter specifc for galactose and does not transport other monosaccharides such as glucose or fructose. |
AT1G77220 | LAZ1H1 is a DUF300 that is localized to the tonoplast. Along with LAZ1 it appears to play a role in maintaining the structural integrity of vacuoles and regulating BR signaling by modulating downstream subcellular distribution of BAK1. |
AT1G77230 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G77240 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT1G77260 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G77290 | Glutathione S-transferase family protein;(source:Araport11) |
AT1G77320 | Mutant is defective in meiosis and produces abnormal microspores. Encodes a BRCT-domain-containing protein that could be specific to the meiotic cell cycle and that plays a crucial role in some DNA repair events independent of SPO11 DSB recombination repair. |
AT1G77340 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G77380 | Amino acid permease which transports basic amino acids. |
AT1G77410 | beta-galactosidase 16;(source:Araport11) |
AT1G77450 | NAC domain transcriptional regulator that is induced by ROS in roots where it regulates the expression of downstream genes such as MYB30. |
AT1G77480 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G77510 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. This protein has been shown to be an attenuator of D1 synthesis, modulating photoinhibition in a light-regulated manner. |
AT1G77530 | O-methyltransferase family protein;(source:Araport11) |
AT1G77550 | tubulin-tyrosine ligase;(source:Araport11) |
AT1G77570 | Winged helix-turn-helix transcription repressor DNA-binding. Expressed in pollen and mutants show enlarged pollen grain nucleoli. |
AT1G77580 | filament-like protein (DUF869);(source:Araport11) |
AT1G77660 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT1G77690 | Encodes an auxin influx carrier LAX3 (Like Aux1) that promotes lateral root emergence. Auxin-induced expression of LAX3 in turn induces a selection of cell-wall-remodelling enzymes, which are likely to promote cell separation in advance of developing lateral root primordia. |
AT1G77720 | Encodes a predicted protein kinase based on sequence similarity. |
AT1G77730 | Pleckstrin homology (PH) domain superfamily protein;(source:Araport11) |
AT1G77760 | Encodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. Similar to molybdopterin oxidoreductases at the N-terminus, and to FAD/NAD-binding cytochrome reductases at the C-terminus. Cofactors: FAD, heme iron (cytochrome B-557), and molybdenum-pterin. |
AT1G77765 | transmembrane protein;(source:Araport11) |
AT1G77770 | forkhead box protein, putative (DUF1644);(source:Araport11) |
AT1G77840 | Translation initiation factor IF2/IF5;(source:Araport11) |
AT1G77885 | hypothetical protein;(source:Araport11) |
AT1G77890 | One of a pair of paralogs (the other is AT4G08540)that is a subunit of the lass III phosphatidylinositol 3-kinase (PI3K) complex but is not essential for PI3P biosynthesis. |
AT1G77910 | transmembrane protein;(source:Araport11) |
AT1G77920 | bZIP transcription factor family protein;(source:Araport11) |
AT1G77930 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G77932 | FANTASTIC four protein, putative (DUF3049);(source:Araport11) |
AT1G77940 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
AT1G77980 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL66 is expressed in pollen.It forms heterodimers with other MICK family members (AGL104). Involved in late stages of pollen development and pollen tube growth. |
AT1G78000 | Encodes a sulfate transporter that can restore sulfate uptake capacity of a yeast mutant lacking sulfate transporter genes. |
AT1G78010 | tRNA modification GTPase;(source:Araport11) |
AT1G78030 | hypothetical protein;(source:Araport11) |
AT1G78050 | phosphoglycerate/bisphosphoglycerate mutase;(source:Araport11) |
AT1G78070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G78080 | Encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family (RAP2.4). The protein contains one AP2 domain. Role in mediating light and ethylene signaling. The mRNA is cell-to-cell mobile. |
AT1G78090 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
AT1G78095 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 5.0e-45 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT1G78100 | F-box family protein;(source:Araport11) |
AT1G78110 | nucleolar GTP-binding protein;(source:Araport11) |
AT1G78120 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT1G78130 | Major facilitator superfamily protein;(source:Araport11) |
AT1G78140 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G78160 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT1G78230 | Outer arm dynein light chain 1 protein;(source:Araport11) |
AT1G78240 | Encodes TSD2 (TUMOROUS SHOOT DEVELOPMENT2), a putative methyltransferase with an essential role in cell adhesion, anthocyanin accumulation, and coordinated plant development. |
AT1G78265 | Natural antisense transcript overlaps with AT1G78270;(source:Araport11) |
AT1G78290 | encodes a member of SNF1-related protein kinase (SnRK2) family whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress and dehydration. |
AT1G78320 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT1G78340 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT1G78370 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT1G78390 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
AT1G78400 | PGX2 is a cell wall protein that codes for a polygalacturonase. |
AT1G78420 | Activates the latent peptidases DA1, DAR1 and DAR2 by mono-ubiquitination at multiple sites. Subsequently, these activated peptidases destabilize various positive regulators of growth. |
AT1G78430 | Encodes RIP2 (ROP interactive partner 2), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants). |
AT1G78450 | SOUL heme-binding family protein;(source:Araport11) |
AT1G78490 | member of CYP708A family. The mRNA is cell-to-cell mobile. |
AT1G78500 | Encodes a protein with pentacyclic triterpene synthase activity. In addition to the compounds lupeol, α-amyrin and bauerenol, this enzyme was also shown to produce two seco-triterpenes: α- and β-seco-amyrin. |
AT1G78520 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT1G78580 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain but no trehalose phosphatase (TPP)-like domain. ATTPS1 is able to complement yeast tps1 mutants in vivo. The gene product modulates cell growth but not cell differentiation by determining cell wall deposition and cell division. The N-terminal domain of TPS1 has a nuclear localization signal and an autoinhibitory function. The C-terminal domain is important for catalytic fidality of TPS1 and for appropriate signaling of the sucrose status by trehalose 6-phosphate levels in the plant (10.1105/tpc.19.00837). |
AT1G78590 | Encodes a NADH kinase which can synthesize NADPH from NADH; also utilizes NAD+ as substrate although NADH is the preferred substrate. |
AT1G78600 | light-regulated zinc finger protein 1;(source:Araport11) |
AT1G78620 | integral membrane protein (Protein of unknown function DUF92, transmembrane);(source:Araport11) |
AT1G78640 | B3 domain protein;(source:Araport11) |
AT1G78670 | gamma-glutamyl hydrolase 3;(source:Araport11) |
AT1G78720 | SecY protein transport family protein;(source:Araport11) |
AT1G78730 | FBD, F-box, Skp2-like and Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT1G78820 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11) |
AT1G78900 | Encodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology. The mRNA is cell-to-cell mobile. |
AT1G78940 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT1G78950 | Terpenoid cyclases family protein;(source:Araport11) |
AT1G78955 | Encodes a cyclase that generates predominantly a monocyclic triterpene alcohol. The product is 97% camelliol, 2% achilleol A and 0.2% beta-amyrin. Achilleol is an isomer of camelliol C with a 4-methylenecyclohexanol ring system. |
AT1G78970 | Lupeol synthase. Converts oxidosqualene to multiple triterpene alcohols and a triterpene diols. This conversion proceeds through the formation of a 17β-dammarenyl cation. |
AT1G78980 | STRUBBELIG-receptor family 5;(source:Araport11) |
AT1G78990 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT1G79030 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G79080 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G79110 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
AT1G79130 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G79150 | binding protein;(source:Araport11) |
AT1G79160 | filamentous hemagglutinin transporter;(source:Araport11) |
AT1G79190 | ARM repeat superfamily protein;(source:Araport11) |
AT1G79240 | pre-tRNA tRNA-Arg (anticodon: CCG);(source:Araport11, TAIR10) |
AT1G79250 | AGC kinase 1.7;(source:Araport11) |
AT1G79320 | Encodes a putative metacaspase. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
AT1G79330 | Metacaspase AtMCPb2/AMC6. Caspase family protein. Arginine/lysine-specific cysteine protease activity. Induces apoptosis in yeast. Contains Pfam domain, PF00656: ICE-like protease (caspase) p20 domain. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
AT1G79380 | Encodes a ubiquitin ligase that is an essential upstream modulator of JA signaling in response to various stimuli. |
AT1G79390 | centrosomal protein;(source:Araport11) |
AT1G79400 | member of Putative Na+/H+ antiporter family |
AT1G79410 | organic cation/carnitine transporter5;(source:Araport11) |
AT1G79420 | C-type mannose receptor (DUF620);(source:Araport11) |
AT1G79430 | Encodes gene product that is required for several aspects of phloem development in the root: (1) the specific divisions organizing the phloem pole, (2) sieve element differentiation and (3) the expression of a companion-specific gene. Mutant has a defect in the organization of phloem poles in the root. apl seedlings have a short, determinate root with only occasional lateral branches. |
AT1G79470 | Aldolase-type TIM barrel family protein;(source:Araport11) |
AT1G79480 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT1G79500 | Encodes a protein with 3-deoxy-8-phosphooctulonate synthase (KDOP synthase) activity which is involved in the biosynthesis of KDO, a component of cell wall rhamnogalacturonan II. |
AT1G79570 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
AT1G79580 | NAC-domain protein. Involved in root cap development. Involved in a regulatory feedback loop with FEZ. FEZ activates SMB in hte root cap daughter cells soon after division, and SMB in turn represses FEZ expression in these cells, thereby preventing further stem cell divisions. |
AT1G79590 | Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. |
AT1G79610 | Encodes an endosomal Na(+)/H(+) antiporter: AT1G54370 (NHX5), AT1G79610 (NHX6). Double knockout nhx5 nhx6 showed reduced growth, with smaller and fewer cells and increased sensitivity to salinity. |
AT1G79620 | VRLK1 is a LRR kinase involved in switching between cell elongation and secondary cell wall thickening.VRLK1 is a member of a gene family that includes a small number of recently duplicated paralogs. |
AT1G79640 | Protein kinase superfamily protein;(source:Araport11) |
AT1G79670 | Encodes a receptor-like kinase that does not contain an extracellular leucine-rich repeat domain. A novel type of dominant disease-resistance protein that confers resistance to a broad spectrum of Fusarium races. |
AT1G79720 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G79730 | Encodes a PAF1 homolog that is involved in the control of flowering time by elevating FLC expression to a level that creates the vernalization-responsive, winter-annual habit. Yeast PAF1 is a component of a five-member complex that associates with RNA pol II and is thought to regulate gene expression by recruiting SET1 (a histone 3 Lys 4 [H3-K4] methyl transferase) to the initially transcribed [5'] regions of target chromatin. Mutants display reduced H3-K4 methylation in both FLC and FLM chromatin. Member of PAF-C complex. |
AT1G79820 | Major facilitator superfamily protein;(source:Araport11) |
AT1G79950 | Encodes a homologue of human Regulator of Telomere Elongation Helicase1 (RTEL1). Plays a central role in the preservation of genome stability. |
AT1G79960 | ovate family protein 14;(source:Araport11) |
AT1G80030 | Molecular chaperone Hsp40/DnaJ family protein;(source:Araport11) |
AT1G80050 | Encodes an adenosine phosphoribosyl transferase(E.C:2.4.2.7), a constitutively expressed enzyme involved in the one-step salvage of adenine to AMP. This isozyme has high affinity for cytokinins and is likely to be localized to the cytosol. |
AT1G80100 | AHP6 lacks the conserved histidine residue (Asn83 in AHP6b), which is required for phosphotransfer, present in the other AHPs. AHP6 does not appear to have phosphotransfer activity. Acts as an inhibitor of cytokinin signaling by interacting with the phosphorelay machinery. Expressed in developing protoxylem and associated pericycle cell files. Negative regulator of cytokinin signaling. Expression is down-regulated by cytokinins. There are two alternatively spliced genes for this locus, AHP6a and AHP6b, differing in the length of the first exon. In ahp6-2 seedlings, only the AHP6a transcript is present. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
AT1G80110 | phloem protein 2-B11;(source:Araport11) |
AT1G80120 | LURP-one-like protein (DUF567);(source:Araport11) |
AT1G80130 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G80150 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G80170 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G80240 | DUF642 gene |
AT1G80250 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT1G80260 | Spc97 / Spc98 family of spindle pole body (SBP) component;(source:Araport11) |
AT1G80320 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT1G80350 | encodes a p60 katanin protein that is expressed throughout the plant. Required for the specification of cell fates from early in development (in the meristem) through differentiation and for normal postmitotic organization of cortical microtubules into transverse arrays in root epidermis cells. Mutants display cytoskeletal defects. |
AT1G80360 | Encodes a methionine-specific aminotransferase that uses the ethylene biosynthetic intermediate methionine as an amino donor and the auxin biosynthetic intermediate indole-3-pyruvic acid as an amino acceptor to produce L-tryptophan and 2-oxo-4-methylthiobutyric acid. These actions allow VAS1 to coordinate both auxin and ethylene biosynthesis. It functions downstream of TAA1/SAV3 but upstream of YUCs to negatively modulate IAA biosynthesis directly by altering the 3-IPA pool. |
AT1G80370 | Encodes a A2-type cyclin. Contributes to the fine-tuning of local proliferation during plant development. |
AT1G80380 | encodes a glycerate kinase which catalyzes the last step of photorespiration C2 cycle. |
AT1G80390 | Member of a multigene family of Auxin responsive genes. |
AT1G80420 | Encodes a component of plant break excision repair and functions at several stages during active DNA demethylation in Arabidopsis. |
AT1G80430 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
AT1G80440 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB20, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. The mRNA is cell-to-cell mobile. |
AT1G80450 | VQ motif-containing protein;(source:Araport11) |
AT1G80470 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT1G80530 | Major facilitator superfamily protein;(source:Araport11) |
AT1G80540 | envelope glycoprotein B;(source:Araport11) |
AT1G80580 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
AT1G80590 | member of WRKY Transcription Factor; Group III |
AT1G80620 | S15/NS1, RNA-binding protein;(source:Araport11) |
AT1G80660 | H[+]-ATPase 9;(source:Araport11) |
AT1G80750 | Cytosolic ribosomal 60S subunit protein. |
AT1G80940 | Snf1 kinase interactor-like protein;(source:Araport11) |
AT1G80950 | Encodes an acyl-CoA: lysophosphatidylethanolamine acyltransferase with 16:0-CoA being the best acyl donor. Mutations adversely affect the growth of plants and result in decreased lipid content in roots and seeds. |
AT1G80960 | F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT2G01010 | rRNA;(source:Araport11) |
AT2G01023 | hypothetical protein;(source:Araport11) |
AT2G01120 | Origin Recognition Complex subunit 4. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with all ORC subunits except ORC1b. |
AT2G01130 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT2G01140 | Aldolase superfamily protein;(source:Araport11) |
AT2G01150 | Encodes a RING-H2 finger protein that is expressed in vascular tissue, root tips, embryos and pistils. |
AT2G01170 | Encodes a bidirectional amino acid transporter that can transport ala, arg, glu and lys, GABA but not pro with both export and import activity. Its expression is localized in the vascular tissues suggesting a function in amino acids export from the phloem into sink tissue. |
AT2G01180 | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves. |
AT2G01220 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
AT2G01275 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT2G01300 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
AT2G01330 | nucleotide binding protein;(source:Araport11) |
AT2G01372 | Pseudogene of AT3G13062 |
AT2G01440 | Encodes an ortholog of the bacterial RecG translocase, an organellar protein with multiple roles in mtDNA maintenance. The protein is targeted to mitochondria and plastids and is required for recombination-dependent repair and for suppression of ectopic recombination in mitochondria, most likely because of its role in recovery of stalled replication forks. |
AT2G01490 | Encodes a phytanoyl-CoA 2-hydroxylase (PAHX). The mRNA is cell-to-cell mobile. |
AT2G01505 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT2G01520 | Encodes a cis-cinnamic acid responsive gene that is a member of the major latex protein-like gene family and plays a role in promoting vegetative growth and delaying flowering. The mRNA is cell-to-cell mobile. |
AT2G01560 | Plant protein 1589 of unknown function;(source:Araport11) |
AT2G01650 | encodes a peripheral membrane protein that contains UBX domain and interacts with AtCDC48 in vitro and co-fractionates with membrane-associated but not soluble AtCDC48 in vivo. |
AT2G01660 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
AT2G01680 | Ankyrin repeat family protein;(source:Araport11) |
AT2G01710 | SDJ2 functions partially redundantly with SDJ1 and SDJ3 and interacts with SUVH1 and SUVH3 to form a SUVH-SDJ complex. The complex binds promoters with DNA methylation and mediates transcriptional activation of promoter methylated genes. |
AT2G01720 | Ribophorin I;(source:Araport11) |
AT2G01780 | Curculin-like (mannose-binding) lectin family protein;(source:Araport11) |
AT2G01810 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT2G01818 | PLATZ transcription factor family protein;(source:Araport11) |
AT2G01820 | Transmembrane kinase (TMK), member of the plant receptor-like kinase (RLK) family. TMKs are characterized by an extracellular leucine-rich-repeat (LRR) domain, a single transmembrane region and a cytoplasmic kinase domain. TMKs have been shown to act as critical modulators of cell expansion and cell proliferation. |
AT2G01830 | Histidine kinase: cytokinin-binding receptor that transduces cytokinin signals across the plasma membrane |
AT2G01850 | EXGT-A3 has homology to xyloglucan endotransglucosylases/hydrolases (XTHs). Mutants in this gene show a lesion mimic phenotype associated with leaf maturation and a reduction in the number of tertiary veins. Individual tracheary elements in the mutants are shorter, but phloem transport activity is not severely affected. EXGT-A3 plays a role in xyloglucan degradation in the differentiating tracheary elements of rosette leaves. The mRNA is cell-to-cell mobile. |
AT2G01870 | transmembrane protein;(source:Araport11) |
AT2G01880 | PEP complex component. |
AT2G01890 | Encodes a purple acid phosphatase (PAP) belonging to the low molecular weight plant PAP group. |
AT2G01910 | Binds microtubules. Induces a crisscross mesh of microtubules, not bundles. Not involved in microtubule polymerization nor nucleation. Localizes to mitochondria. The mRNA is cell-to-cell mobile. |
AT2G01920 | ENTH/VHS/GAT family protein;(source:Araport11) |
AT2G01930 | BASIC PENTACYSTEINE1 (BPC1) is a regulator of the homeotic Arabidopsis thaliana gene SEEDSTICK (STK), which controls ovule identity. BPC1 induces conformational changes by cooperative binding to purine-rich elements present in the STK regulatory sequence. STK is upregulated in bpc1 mutant.Along with BPC2, BPC1 binds to the promoter of and represses GALS1 thereby reducing beta 1,4- galactan accumulation. |
AT2G01940 | Encodes a transcription factor that, together with IDD14 and IDD16, regulates auxin biosynthesis and transport and thus aerial organ morphogenesis and gravitropic responses. May be involved in an early event in shoot gravitropism such as gravity perception and/or a signaling process subsequent to amyloplast sedimentation as a putative transcription factor in gravity-perceptive cells. |
AT2G01950 | Encodes a leucine rich repeat receptor kinase and associated with provascular/procambial cells. Similar to BRI, brassinosteroid receptor protein. |
AT2G01960 | Member of TETRASPANIN family |
AT2G01980 | Encodes a plasma membrane-localized Na+/H+ antiporter SOS1. Functions in the extrusion of toxic Na+ from cells and is essential for plant salt tolerance. Has 12 predicted transmembrane domains in the N-terminal region and a long cytoplasmic tail of approx. 700 aa at the C-terminal side. SOS1 interacts through its predicted cytoplasmic tail with RCD1, a regulator of oxidative-stress responses, suggesting that SOS1 might function in oxidative-stress tolerance. |
AT2G02010 | glutamate decarboxylase 4;(source:Araport11) |
AT2G02020 | Major facilitator superfamily protein;(source:Araport11) |
AT2G02030 | F-box family protein;(source:Araport11) |
AT2G02050 | NADH-ubiquinone oxidoreductase B18 subunit;(source:Araport11) |
AT2G02061 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
AT2G02070 | RAVEN is part of the network regulated by BLJUEJAY, JACKDAW, SACRECROW and SHORT-ROOT to regulate root tissue patterning through cell lineage specification and asymmetric cell division. RAVEN is directly activated by SHORT-ROOT and directly repressed by JACKDAW. |
AT2G02080 | C2H2 BIRD transcription factor family. |
AT2G02100 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. The mRNA is cell-to-cell mobile. |
AT2G02148 | PPR containing protein;(source:Araport11) |
AT2G02170 | Remorin family protein;(source:Araport11) |
AT2G02220 | Encodes a protein interacting with phytosulfokine, a five amino acid sulfated peptide (YIYTQ). Contains dual guanylate cyclase and kinase catalytic activities that operate in vivo. |
AT2G02230 | phloem protein 2-B1;(source:Araport11) |
AT2G02240 | F-box family protein;(source:Araport11) |
AT2G02250 | phloem protein 2-B2;(source:Araport11) |
AT2G02270 | pseudogene of phloem protein 2-B2;(source:Araport11) |
AT2G02300 | phloem protein 2-B5;(source:Araport11) |
AT2G02340 | phloem protein 2-B8;(source:Araport11) |
AT2G02350 | encodes a protein containing an F-box domain and physically interacts with SCF subunit SKP1/ASK1. The protein also exhibits similarity in sequence to phloem protein 2 (PP2) from cucumber. |
AT2G02370 | SNARE associated Golgi protein family;(source:Araport11) |
AT2G02380 | Encodes glutathione transferase belonging to the zeta class of GSTs. Naming convention according to Wagner et al. (2002). |
AT2G02430 | pseudogene of Arginyl-tRNA synthetase;(source:Araport11) |
AT2G02450 | NAC domain containing protein 35;(source:Araport11) |
AT2G02560 | Arabidopsis thaliana homolog of human CAND1 (cullin-associated and neddylation-dissociated). Putative similarity to TBP-interacting protein TIP120. Ubiquitously expressed in plant tissues throughout development. T-DNA insertion mutant plants were completely sterile and resistant to sirtinol and auxin, but not to gibberellins or brassinolide. Displayed developmental phenotypes similar to those of axr1, namely, short petioles, downwardly curling leaves, shorter inflorescence. Required for SCF function and appears to modulate SCF complex cycling. Physically interacts with CUL1. The mRNA is cell-to-cell mobile. |
AT2G02580 | member of CYP71B |
AT2G02590 | small multi-drug export protein;(source:Araport11) |
AT2G02660 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT2G02700 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G02720 | Pectate lyase family protein;(source:Araport11) |
AT2G02740 | Encodes a homolog of the potato p24 protein. It shares the conserved KGKAAL domain, a putative DNA-binding domain, with potato p24 and is localized to the plastid and not the nucleus. |
AT2G02770 | 4-phosphopantetheinyl transferase domain protein;(source:Araport11) |
AT2G02780 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G02790 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
AT2G02800 | Encodes protein kinase APK2b. |
AT2G02810 | Encodes a multitransmembrane hydrophobic protein that functions as transporter of UDP-galactose and UDP-glucose into the Golgi. Localized in the ER. Involved in the unfolded protein response, a mechanism that controls proper protein folding in the ER. |
AT2G02830 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-37 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT2G02860 | encodes a sucrose transporter in sieve elements and a number of sink tissues and cell types. Gene expression is induced by wounding. |
AT2G02880 | mucin-like protein;(source:Araport11) |
AT2G02890 | F-box family protein;(source:Araport11) |
AT2G02900 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT2G02910 | transmembrane protein (DUF616);(source:Araport11) |
AT2G02950 | Encodes a basic soluble protein which can independently bind to either PHYA or PHYB, regardless of whether the phytochromes are in the Pr or Pfr state. PKS1 can be phosphorylated by oat phyA in vitro in a light regulated manner. It is postulated to be a negative regulator of phyB signalling. |
AT2G02960 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT2G02980 | Encodes a chloroplast RNA editing factor. |
AT2G03010 | hypothetical protein (DUF577);(source:Araport11) |
AT2G03060 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL30 is expressed in pollen.It forms heterodimers with other MICK family members. |
AT2G03090 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
AT2G03110 | putative RNA-binding protein;(source:Araport11) |
AT2G03120 | homologous to Signal Peptide Peptidases (SPP), required for pollen development and pollen germination. No homozygotes could be recovered from a T-DNA insertion mutant. The mRNA is cell-to-cell mobile. |
AT2G03160 | SKP1-like 19;(source:Araport11) |
AT2G03190 | one of SKP1 homologs. Gene is expressed specifically in the silique. |
AT2G03200 | Atypical aspartic protease which modulates lateral root development. |
AT2G03210 | member of Glycosyltransferase Family- 37 |
AT2G03240 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT2G03250 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT2G03260 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT2G03280 | O-fucosyltransferase family protein;(source:Araport11) |
AT2G03340 | Encodes WRKY DNA-binding protein 3 (WRKY3). |
AT2G03410 | Mo25 family protein;(source:Araport11) |
AT2G03420 | hypothetical protein;(source:Araport11) |
AT2G03440 | Induced at the transcriptional level by Pseudomonas syringae pv. tomato infection. |
AT2G03450 | purple acid phosphatase 9;(source:Araport11) |
AT2G03460 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT2G03470 | ELM2 domain-containing protein;(source:Araport11) |
AT2G03500 | Encodes a nuclear localized member of the MYB family of transcriptional regulators that is involved in negative regulation of flowering. It is expressed in vascular tissues and at low levels in the shoot apex during the transition to flowering. Loss of function mutations are early flowering.EFM is involved in the autonomous, thermosensory and GA pathways and expression is directly regulated by SVP. EFM interacts with JMJD5 to repress FT expression. |
AT2G03505 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT2G03520 | Encodes AtUPS4, a member of the Arabidopsis ureide permease family. |
AT2G03550 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G03565 | hypothetical protein;(source:Araport11) |
AT2G03590 | Encodes a member of a class of allantoin transporters. |
AT2G03630 | suppressor SRP40-like protein;(source:Araport11) |
AT2G03690 | Ubiquinone biosynthesis protein COQ4 homolog. |
AT2G03720 | Involved in root hair development |
AT2G03740 | Late embryogenesis abundant protein. Associates with and stabilizes membranes as part of cryoprotective response. |
AT2G03750 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G03760 | Encodes a brassinosteroid sulfotransferase. In vitro experiements show that this enzyme has a preference for 24-epibrassinosteroids, particularly 24-epicathasterone, but does not act on castasterone and brassinolide. It also shows sulfating activity toward flavonoids. It is differentially expressed during development, being more abundant in young seedlings and actively growing cell cultures. Expression is induced in response to salicylic acid and methyl jasmonate and bacterial pathogens. |
AT2G03770 | Encodes a sulfotransferase with sulfating activity toward flavonoids, specifically kaempferol. |
AT2G03800 | encodes a D-aminoacyl-tRNA deacylase. Involved in detoxification of D-aminoacyl-tRNA. Mutants also show ethanol-hypersensitive phenotype. |
AT2G03810 | 18S pre-ribosomal assembly protein gar2-like protein;(source:Araport11) |
AT2G03840 | TET13 encodes a member of the TETRASPANIN gene family that is expressed in the hypophysis, QC, root stem cells, lateral root primordia and is involved in primary root growth and lateral root development. |
AT2G03850 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
AT2G03870 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
AT2G03880 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G03890 | Phosphoinositide kinase which undergo autophosphorylation and phosphorylate serine/threonine residues of protein substrates. Contains phosphoinositide 3/4-kinase and ubiquitin-like domains. The mRNA is cell-to-cell mobile. |
AT2G03913 | Encodes a defensin-like (DEFL) family protein. |
AT2G03915 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT2G03970 | transposable_element_gene;(source:Araport11);pseudogene, similar to SAE1-S9-protein, blastp match of 33%25 identity and 1.2e-17 P-value to GP|4760708|dbj|BAA77394.1||AB012866 SAE1-S9-protein {Brassica rapa};(source:TAIR10) |
AT2G03980 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT2G04030 | Encodes a chloroplast-targeted 90-kDa heat shock protein located in the stroma involved in red-light mediated deetiolation response and crucial for protein import into the chloroplast stroma. Mutants are resistant to chlorate, have elongated hypocotyls in light, and affect the expression of NR2, CAB, and RBCS but NOT NR1 and NiR. |
AT2G04032 | zinc transporter 7 precursor;(source:Araport11) |
AT2G04035 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to (GB:AC005508);(source:TAIR10) |
AT2G04036 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 2.6e-169 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
AT2G04039 | NdhV is loosely associated with the NDH complex and is required for stabilizing NDH subcomplexes A and E. |
AT2G04045 | Encodes a defensin-like (DEFL) family protein. |
AT2G04047 | Encodes a defensin-like (DEFL) family protein. |
AT2G04050 | MATE efflux family protein;(source:Araport11) |
AT2G04070 | Expression in rosette leaves is activated by high concentration of boron. |
AT2G04110 | pseudogene of expressed protein;(source:Araport11) |
AT2G04160 | isolated from differential screening of a cDNA library from auxin-treated root culture. encodes a protein similar to subtilisin-like serine protease which is believed to be active outside the plant cell. |
AT2G04170 | TRAF-like family protein;(source:Araport11) |
AT2G04190 | TRAF-like family protein;(source:Araport11) |
AT2G04220 | DUF868 family protein (DUF868);(source:Araport11) |
AT2G04250 | pseudogene of ribonuclease H;(source:Araport11) |
AT2G04260 | pseudogene of P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11) |
AT2G04290 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.1e-36 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G04300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G04350 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT2G04400 | Acts during tryptophan biosynthesis controlled by ERF109. |
AT2G04425 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G04450 | Encodes a protein with NADH pyrophosphatase activity. Although this protein was also shown to have ADP-ribose diphosphatase activity in vitro, mutant analyses suggest that NUDX6 is involved in NADH metabolism in vivo. |
AT2G04495 | transmembrane protein;(source:Araport11) |
AT2G04500 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G04530 | Encodes a protein with RNAse Z activity suggesting a role in tRNA processing. Protein contains a signal sequence for import into the chloroplast. |
AT2G04550 | Encodes a protein phosphatase that interacts with MPK12, but not with other MAP kinases. It can dephosphorylate a dually phosphorylated MPK12 in vitro and can inactivate MPK12 in vivo. ibr5 mutants have reduced sensitivity to auxin and abscisic acid. IBR5 promotes auxin responses, including auxin-inducible transcription, differently than the TIR1 auxin receptor and without destabilizing Aux/IAA repressor proteins. It plays a role in male gametophyte development, auxin and TCP growth regulatory pathways. Regulates leaf serrations development via modulation of the expression of PIN1. |
AT2G04560 | transferases, transferring glycosyl groups;(source:Araport11) |
AT2G04580 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10) |
AT2G04590 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-28 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT2G04620 | Encodes a Zn transporter that localizes to the Golgi apparatus and forms a functional complex with AtMTP5t1 to transport Zn into the Golgi. |
AT2G04625 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to reverse transcriptase;(source:TAIR10) |
AT2G04675 | hypothetical protein;(source:Araport11) |
AT2G04790 | PTB domain engulfment adapter;(source:Araport11) |
AT2G04810 | F-box only protein (DUF295);(source:Araport11) |
AT2G04820 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.8e-214 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G04850 | Auxin-responsive family protein;(source:Araport11) |
AT2G04890 | Encodes a scarecrow-like protein (SCL21). Member of GRAS gene family. |
AT2G04900 | hypothetical protein;(source:Araport11) |
AT2G05025 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT2G05040 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.6e-200 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT2G05050 | Protein phosphatase 2C family protein;(source:Araport11) |
AT2G05060 | Protein kinase superfamily protein;(source:Araport11) |
AT2G05070 | Encodes Lhcb2.2. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus. |
AT2G05090 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G37080.1);(source:TAIR10) |
AT2G05100 | Lhcb2.1 protein encoding a subunit of the light harvesting complex II. Member of a gene family with high degree of sequence similarity. Initially LHCB2.3 was considered as a separate gene but appears to be an allele of LHCB2.1. |
AT2G05110 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.6e-51 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G05117 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT2G05120 | Nucleoporin, Nup133/Nup155-like protein;(source:Araport11) |
AT2G05160 | CCCH-type zinc fingerfamily protein with RNA-binding domain-containing protein;(source:Araport11) |
AT2G05210 | Encodes AtPOT1a, an accessory factor for telomerase required for positive telomere length regulation. Note on nomenclature: different names have been given to Arabidopsis POT-like genes (Kuchar and Fajkus, 2004; Shakirov et al, 2005; Tani and Murata, 2005). According to a unifying nomenclature (Surovtseva et al, 2007), At2g05210 (previously named AtPOT1) is designated AtPOT1a, while At5g06310 (previously named AtPOT2) is designated AtPOT1b. |
AT2G05280 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.4e-30 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G05320 | beta-1,2-N-acetylglucosaminyltransferase II;(source:Araport11) |
AT2G05350 | hypothetical protein;(source:Araport11) |
AT2G05360 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT2G05380 | glycine-rich protein 3 short isoform (GRP3S) mRNA, complete The mRNA is cell-to-cell mobile. |
AT2G05410 | MATH domain/coiled-coil protein;(source:Araport11) |
AT2G05420 | TRAF-like family protein;(source:Araport11) |
AT2G05430 | Ubiquitin-specific protease family C19-related protein;(source:Araport11) |
AT2G05440 | GLYCINE RICH PROTEIN 9;(source:Araport11) |
AT2G05441 | Annotated as unknown pseudogene.Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT2G05490 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.4e-88 P-value blast match to Q9SL18 /349-510 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT2G05518 | other_RNA;(source:Araport11) |
AT2G05580 | Glycine-rich protein family;(source:Araport11) |
AT2G05620 | Involved in electron flow in Photosystem I. Essential for photoprotection. |
AT2G05635 | DEAD helicase |
AT2G05640 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, low similarity to SP|Q9UUA2 DNA repair and recombination protein pif1, mitochondrial precursor {Schizosaccharomyces pombe};(source:TAIR10) |
AT2G05642 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT2G05690 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.9e-45 P-value blast match to O22273 /233-373 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT2G05730 | pseudogene of DNA (cytosine-5-)-methyltransferase family protein;(source:Araport11) |
AT2G05740 | pseudogene of DNA (cytosine-5-)-methyltransferase family protein;(source:Araport11) |
AT2G05750 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 2.9e-126 P-value blast match to GB:AAA66266 unknown protein ORF1 transposable element En-1 (CACTA-element) (Zea mays);(source:TAIR10) |
AT2G05760 | Xanthine/uracil permease family protein;(source:Araport11) |
AT2G05840 | Encodes 20S proteasome subunit PAA2 (PAA2). |
AT2G05910 | LURP-one-like protein (DUF567);(source:Araport11) |
AT2G05914 | Potential natural antisense gene, locus overlaps with AT2G05915 |
AT2G05920 | Subtilase family protein;(source:Araport11) |
AT2G05940 | Encodes a receptor-like cytoplasmic kinase that phosphorylates the host target RIN4, leading to the activation of a plant innate immune receptor RPM1. |
AT2G05950 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G32050.1);(source:TAIR10) |
AT2G05960 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.2e-200 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT2G05970 | F-box protein (DUF295);(source:Araport11) |
AT2G06020 | Homeodomain-like superfamily protein;(source:Araport11) |
AT2G06025 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT2G06050 | Encodes a 12-oxophytodienoate reductase that is required for jasmonate biosynthesis. Mutants are male sterile and defective in pollen dehiscence. Shows activity towards 2,4,6-trinitrotoluene. CFA-Ile, CFA-Leu, CFA-Val, CFA-Met and CFA-Ala can restore the fertility of opr3 plants by inducing filament elongation and anther dehiscence. |
AT2G06060 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.7e-05 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G06080 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 38%25 identity and 7.7e-40 P-value to GP|21952510|gb|AAM82604.1|AF525305_2|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10) |
AT2G06200 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in root, shoot and flower |
AT2G06210 | Encodes a yeast CTR9 homolog that is involved in the control of flowering time by elevating FLC expression to a level that creates the vernalization-responsive, winter-annual habit. Yeast CTR9 is a component of a five-member PAF1 complex that associates with RNA pol II and is thought to regulate gene expression by recruiting SET1 (a histone 3 Lys 4 [H3-K4] methyl transferase) to the initially transcribed [5'] regions of target chromatin. Mutants display reduced H3-K4 methylation in both FLC and FLM chromatin. Member of PAF-C complex. |
AT2G06260 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.0e-28 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT2G06500 | hAT family dimerization domain-containing protein;(source:Araport11) |
AT2G06760 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.4e-38 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
AT2G06770 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.7e-15 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT2G06780 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.8e-17 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G06822 | Pseudogene of AT2G06822 |
AT2G06840 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-184 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G06845 | Beta-galactosidase related protein;(source:Araport11) |
AT2G06880 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.5e-55 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT2G06908 | hypothetical protein;(source:Araport11) |
AT2G06910 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 4.3e-100 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
AT2G06920 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 7.7e-13 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G06922 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-20 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT2G06925 | Encodes a secretory phospholipase A2 enzyme, which specifically hydrolyzes the sn-2 position of phospholipids. The enzyme has a preference towards linoleoyl acyl chain over palmitoyl acyl chain. It also has a slight preference for phosphatidylcholine over phosphatidylethanolamine. |
AT2G06930 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-233 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G06940 | pseudogene of Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G06950 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-243 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT2G06980 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT2G06985 | pseudogene of Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G06990 | Encodes a putative DExH-box RNA helicase that acts redundantly with HEN1, HUA1, and HUA2 in the specification of floral organ identity in the third whorl. |
AT2G07000 | hypothetical protein;(source:Araport11) |
AT2G07020 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT2G07040 | Pollen receptor kinase. Coexpression of AtPRK2a with AtRopGEF12 resulted in isotropic pollen tube growth. |
AT2G07070 | transposable_element_gene;(source:Araport11) |
AT2G07090 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43920.1);(source:TAIR10) |
AT2G07150 | transposable_element_gene;(source:Araport11);pseudogene, similar to P0707D10.17, blastp match of 27%25 identity and 3.3e-12 P-value to GP|13603432|dbj|BAB40159.1||AP002910 P0707D10.17 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT2G07160 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.2e-44 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G07213 | Natural antisense transcript overlaps with AT2G07215;(source:Araport11) |
AT2G07360 | TPLATE-associated SH3 domain containing protein. |
AT2G07440 | two-component responsive regulator-related / response regulator protein-like protein;(source:Araport11) |
AT2G07530 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 4.4e-17 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT2G07540 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 7.8e-90 P-value blast match to gb|AAL06421.1|AF378079_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10) |
AT2G07560 | H[+]-ATPase 6;(source:Araport11) |
AT2G07640 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G07680 | Encodes ABCC13/MRP11, a member of the multidrug resistance associated protein MRP/ABCC subfamily. Its expression is induced by gibberellic acid and downregulated by naphthalene acetic acid, abscisic acid, and zeatin. |
AT2G07687 | Cytochrome c oxidase, subunit III;(source:Araport11) |
AT2G07690 | Member of the minichromosome maintenance complex, involved in DNA replication initiation. Abundant in proliferating and endocycling tissues. Localized in the nucleus during G1, S and G2 phases of the cell cycle, and are released into the cytoplasmic compartment during mitosis. Binds chromatin. |
AT2G07700 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.7e-21 P-value blast match to GB:226407 retrotransposon del1-46 (Gypsy_Ty3-element) (Lilium henryi);(source:TAIR10) |
AT2G07716 | pseudogene of Sec-independent periplasmic protein translocase;(source:Araport11) |
AT2G07811 | pseudogene of mitochondrial protein |
AT2G07981 | hypothetical protein;(source:Araport11) |
AT2G08986 | hypothetical protein;(source:Araport11) |
AT2G09795 | Natural antisense transcript overlaps with AT2G09800. Has been identified as a translated small open reading frame by ribosome profiling. |
AT2G09860 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.1e-47 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G09890 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, PIF1 family of mitochondrial helicases;(source:TAIR10) |
AT2G09990 | Ribosomal protein S5 domain 2-like superfamily protein;(source:Araport11) |
AT2G10253 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT2G10260 | Ulp1 protease family protein;(source:Araport11) |
AT2G10430 | pseudogene of hypothetical protein;(source:Araport11) |
AT2G10450 | 14-3-3 family protein;(source:Araport11) |
AT2G10530 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.9e-42 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
AT2G10535 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G10589 | pseudogene of splicing factor 3A subunit;(source:Araport11) |
AT2G10610 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-162 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT2G10710 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to MURA transposase of maize Mutator transposon;(source:TAIR10) |
AT2G10800 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.9e-92 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT2G10820 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.8e-34 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
AT2G10850 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43970.1);(source:TAIR10) |
AT2G11000 | Encodes a non-functional Arabidopsis homolog of the yeast protein MAK10, a component of the N-terminal acetyltransferase complex C. Mutant plants have normal photosynthesis as well as growth rates and pigmentation comparable to wild type. |
AT2G11140 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.0e-71 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT2G11190 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-90 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
AT2G11220 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-16 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT2G11235 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.6e-94 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT2G11345 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT4G04130.1);(source:TAIR10) |
AT2G11530 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.4e-24 P-value blast match to Q9SI25 /181-349 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT2G11623 | Plant protein 1589 of unknown function;(source:Araport11) |
AT2G11640 | transposable_element_gene;(source:Araport11);pseudogene, replication protein A1;(source:TAIR10) |
AT2G11690 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 4.8e-34 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
AT2G11778 | transmembrane protein;(source:Araport11) |
AT2G11810 | MGD3 is the major enzyme for galactolipid metabolism during phosphate starvation. Does not contribute to galactolipid synthesis under P1-sufficient conditions. |
AT2G11850 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, PIF1 family of mitochondrial helicases;(source:TAIR10) |
AT2G11880 | None;(source:Araport11) |
AT2G11891 | hypothetical protein;(source:Araport11) |
AT2G11950 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.9e-158 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT2G11990 | pseudogene of AGAMOUS-like 57;(source:Araport11) |
AT2G12160 | pseudogene of Transcriptional factor B3 family protein;(source:Araport11) |
AT2G12170 | hypothetical protein;(source:Araport11) |
AT2G12320 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32169.1);(source:TAIR10) |
AT2G12385 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT2G12390 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 1.5e-186 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
AT2G12400 | plasma membrane fusion protein;(source:Araport11) |
AT2G12475 | Encodes a defensin-like (DEFL) family protein. |
AT2G12480 | serine carboxypeptidase-like 43;(source:Araport11) |
AT2G12646 | Plant AT-rich sequence and zinc-binding transcription factor (PLATZ) family protein which plays central role in mediating RGF1 signalling. Controls root meristem size through ROS signalling. |
AT2G12650 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-38 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G12670 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.9e-29 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G12855 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.4e-13 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT2G12890 | pseudogene of Class-II DAHP synthetase family protein;(source:Araport11) |
AT2G12905 | hypothetical protein;(source:Araport11) |
AT2G13080 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.7e-183 P-value blast match to GB:AAD11615 prpol (gypsy_Ty3-element) (Zea mays);(source:TAIR10) |
AT2G13116 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G13146 | Pseudogene of AT2G12905 |
AT2G13175 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.5e-34 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G13274 | Pseudogene of AT2G13150; transcription factor |
AT2G13300 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.8e-11 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT2G13335 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 9.7e-06 P-value blast match to GB:BAA84457 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902444|dbj|BAA84457.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
AT2G13360 | Encodes a peroxisomal photorespiratory enzyme that catalyzes transamination reactions with multiple substrates. It is involved in photorespiration. |
AT2G13420 | Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT2G13460 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.0e-35 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G13500 | Ta11-like non-LTR retrotransposon;(source:Araport11) |
AT2G13510 | Ta11-like non-LTR retrotransposon;(source:Araport11) |
AT2G13547 | hypothetical protein;(source:Araport11) |
AT2G13570 | nuclear factor Y, subunit B7;(source:Araport11) |
AT2G13580 | pseudogene of hypothetical protein;(source:Araport11) |
AT2G13590 | pseudogene of Ta11-like non-LTR retrotransposon;(source:Araport11) |
AT2G13610 | ABC-2 type transporter family protein;(source:Araport11) |
AT2G13620 | member of Putative Na+/H+ antiporter family |
AT2G13680 | Responsible for the synthesis of callose deposited at the primary cell wall of meiocytes, tetrads and microspores. Required for exine formation during microgametogenesis and for pollen viability. Highest expression in meiocytes, tetrads, microspores and mature pollen. |
AT2G13690 | PRLI-interacting factor;(source:Araport11) |
AT2G13706 | Pseudogene of AT4G15975; zinc finger (C3HC4-type RING finger) family protein |
AT2G13720 | putative DNA topoisomerase;(source:Araport11) |
AT2G13810 | ALD1 is a L-lysine alpha-aminotransferase. It is part of the pipecolic acid biosynthetic pathway, where it catalyzes the biochemical conversion of lysine to epsilon-amino-alpha-ketocaproic acid (KAC) which is subject to subsequent transamination, cyclization and isomerization to form 2,3-dehydropipecolic acid. |
AT2G14060 | encodes a protein whose sequence is similar to SAM:salicylic acid carboxyl methyltransferase (SAMT) (GI:6002712)(Clarkia breweri) and to SAM:benzoic acid carboxyl methyltransferase (BAMT)(GI:9789277)(Antirrhinum majus) |
AT2G14070 | wound-responsive protein-like protein;(source:Araport11) |
AT2G14090 | pseudogene of F-box/RNI-like superfamily protein;(source:Araport11) |
AT2G14190 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 8.5e-177 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT2G14200 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.0e-133 P-value blast match to gb|AAO73523.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT2G14210 | MADS box gene, transcription factor |
AT2G14247 | Expressed protein;(source:Araport11) |
AT2G14370 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.2e-116 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT2G14440 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G14500 | F-box family protein;(source:Araport11) |
AT2G14510 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G14520 | CBS domain protein (DUF21);(source:Araport11) |
AT2G14535 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-19 P-value blast match to GB:CAA37925 orf 3 (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G14540 | serpin 2;(source:Araport11) |
AT2G14550 | pseudogene of RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G14570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G48290.1);(source:TAIR10) |
AT2G14605 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.9e-29 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
AT2G14620 | xyloglucan endotransglucosylase/hydrolase 10;(source:Araport11) |
AT2G14640 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.5e-119 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
AT2G14670 | sucrose-proton symporter 8;(source:Araport11) |
AT2G14680 | myosin heavy chain-like protein;(source:Araport11) |
AT2G14690 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
AT2G14700 | hypothetical protein;(source:Araport11) |
AT2G14710 | F-box family protein;(source:Araport11) |
AT2G14830 | Ist1p;(source:Araport11) |
AT2G14835 | RING/U-box superfamily protein;(source:Araport11) |
AT2G14850 | SPT module subunit, interacts with HAG1. |
AT2G14960 | encodes a protein similar to IAA-amido synthases. Lines carrying an insertion in this gene are hypersensitive to auxin. |
AT2G15012 | Pseudogene of AT4G00416; MBD3 (methyl-CpG-binding domain 3); DNA binding |
AT2G15045 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT4G08860.1);(source:TAIR10) |
AT2G15080 | receptor like protein 19;(source:Araport11) |
AT2G15090 | Encodes KCS8, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). The mRNA is cell-to-cell mobile. |
AT2G15120 | pseudogene of Plant basic secretory protein (BSP) family protein;(source:Araport11) |
AT2G15300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G15325 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
AT2G15330 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to reverse transcriptase;(source:TAIR10) |
AT2G15380 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.1e-29 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G15390 | Encodes an alpha-(1,2)-fucosyltransferase. |
AT2G15480 | UDP-glucosyl transferase 73B5;(source:Araport11) |
AT2G15500 | RNA-binding protein;(source:Araport11) |
AT2G15510 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.0e-20 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G15530 | RING/U-box superfamily protein;(source:Araport11) |
AT2G15535 | low-molecular-weight cysteine-rich 10;(source:Araport11) |
AT2G15580 | RING/U-box superfamily protein;(source:Araport11) |
AT2G15610 | hypothetical protein (DUF1685);(source:Araport11) |
AT2G15630 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G15640 | F-box family protein;(source:Araport11) |
AT2G15660 | AGAMOUS-like 95;(source:Araport11) |
AT2G15670 | transmembrane protein;(source:Araport11) |
AT2G15680 | Encodes a calmodulin-like protein. |
AT2G15730 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G15740 | Member of a small family of zinc finger containing putative transcription factors.Similar to GAZ. |
AT2G15760 | calmodulin-binding protein (DUF1645);(source:Araport11) |
AT2G15765 | pseudogene of F-box/RNI-like superfamily protein;(source:Araport11) |
AT2G15815 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G26350.1);(source:TAIR10) |
AT2G15830 | hypothetical protein;(source:Araport11) |
AT2G15840 | pseudogene of hypothetical protein;(source:Araport11) |
AT2G15850 | pseudogene of non-LTR retroelement reverse transcriptase;(source:Araport11) |
AT2G15890 | Encodes CBP1, a regulator of transcription initiation in central cell-mediated pollen tube guidance. |
AT2G15910 | CSL zinc finger domain-containing protein;(source:Araport11) |
AT2G16010 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G07630.1);(source:TAIR10) |
AT2G16050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G16060 | Encodes a class 1 nonsymbiotic hemoglobin induced by low oxygen levels with very high oxygen affinity. It is not likely to be a hemoglobin transporter because of its extremely high affinity for oxygen. Overexpression impairs cold stress-induced nitric oxide (NO) production. |
AT2G16120 | polyol/monosaccharide transporter 1;(source:Araport11) |
AT2G16130 | polyol/monosaccharide transporter 2;(source:Araport11) |
AT2G16145 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:GGTTCGTACGTACACTGTTCA |
AT2G16210 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
AT2G16230 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT2G16260 | pseudogene of glycine-rich RNA-binding protein |
AT2G16270 | transmembrane protein;(source:Araport11) |
AT2G16300 | F-box family protein;(source:Araport11) |
AT2G16310 | pseudogene of endoplasmatic reticulum retrieval protein 1B;(source:Araport11) |
AT2G16340 | hypothetical protein;(source:Araport11) |
AT2G16360 | 40S ribosomal protein S25;(source:Araport11) |
AT2G16367 | Encodes a defensin-like (DEFL) family protein. |
AT2G16380 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT2G16385 | CAF1 is a peptide hormone expressed in the root stele that specifically binds the endodermis-expressed leucine-rich repeat receptor kinase GASSHO1 (GSO1)/SCHENGEN3 and its homolog, GSO2. Together with CAF2 it is required for formation of the casparian band. |
AT2G16405 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G16440 | Regulates DNA replication via interaction with BICE1 and MCM7. |
AT2G16450 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G16460 | coiled-coil 90B-like protein (DUF1640);(source:Araport11) |
AT2G16505 | Encodes a Maternally expressed gene (MEG) family protein. Expressed in pollen and involved in pollen-stigma interaction. |
AT2G16520 | RING/U-box protein with C6HC-type zinc finger protein;(source:Araport11) |
AT2G16535 | Encodes a Maternally expressed gene (MEG) family protein |
AT2G16660 | Major facilitator superfamily protein;(source:Araport11) |
AT2G16690 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G41570.1);(source:TAIR10) |
AT2G16700 | Encodes actin depolymerizing factor 5 (ADF5). |
AT2G16710 | Iron-sulfur cluster biosynthesis family protein;(source:Araport11) |
AT2G16720 | Encodes a member of MYB3R- and R2R3- type MYB- encoding gene family that acts as a repressor of flavonol biosynthesis. AtMYB7 gene expression is induced by salt treatment. |
AT2G16730 | putative beta-galactosidase (BGAL13 gene) |
AT2G16740 | ubiquitin-conjugating enzyme 29;(source:Araport11) |
AT2G16750 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT2G16760 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT2G16800 | Encodes a nuclear-encoded chloroplast protein that plays an important role in vegetative growth, female gametogenesis, and embryogenesis likely by mediating chloroplast integrity and development. |
AT2G16810 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G16840 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-06 P-value blast match to GB:AAC64917 gag-pol polyprotein (Ty1_Copia-element) (Glycine max);(source:TAIR10) |
AT2G16860 | GCIP-interacting family protein;(source:Araport11) |
AT2G16905 | pseudogene of MATE efflux family protein;(source:Araport11) |
AT2G16970 | Major facilitator superfamily protein;(source:Araport11) |
AT2G16990 | Major facilitator superfamily protein;(source:Araport11) |
AT2G17000 | Mechanosensitive ion channel family protein;(source:Araport11) |
AT2G17010 | MSL8 encodes a protein with similarity to mechano-sensitive channel proteins. MSL8 is expressed specifically in pollen and germinating pollen tubes.It regulates pollen germination and is needed to maintain cellular integrity during pollen hydration and germination. |
AT2G17030 | Encodes a SKP1/ASK-interacting protein. |
AT2G17036 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
AT2G17040 | Member of the NAC transcription factor family and more specifically, the ONAC022 subfamily. Involved in leaf and inflorescence stem morphogenesis. The mRNA is cell-to-cell mobile. |
AT2G17043 | hypothetical protein;(source:Araport11) |
AT2G17050 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
AT2G17060 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT2G17090 | Encodes a N-myrystolylated plasma membrane associated member of the RLCK II family of IRAK/Pelle-like kinases that regulates the MAPK pathway that promotes the elongation of the Arabidopsis zygote and the development of its basal daughter cell into the extra-embryonic suspensor. SSP transcripts are produced in mature pollen but are not translated until delivery to the zygote and the endosperm after fertilization, exerting a paternal effect on embryonic development. The primary role of its kinase domain may lie in protein binding rather than in catalysis as key residues of the active site are absent. |
AT2G17110 | DNA-directed RNA polymerase subunit beta, putative (DUF630 and DUF632);(source:Araport11) |
AT2G17130 | Encodes a regulatory subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase. |
AT2G17160 | Interleukin-1 receptor-associated kinase 4 protein;(source:Araport11) |
AT2G17170 | Protein kinase superfamily protein;(source:Araport11) |
AT2G17180 | Target promoter of the male germline-specific transcription factor DUO1. |
AT2G17200 | Encodes a ubiquitin receptor protein that specifically associates with PEX2 and PEX12. |
AT2G17210 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G17220 | Encodes a putative serine/threonine-specific protein kinase kin3. Protein is N-myristoylated. |
AT2G17250 | Encodes a nucleolar protein that is a ribosome biogenesis co-factor. Mutants display aberrant RNA processing and homozygous embryos arrest in the globular stage of development. |
AT2G17270 | Encodes a mitochondrial phosphate transporter. Modulates plant responses to salt stress. |
AT2G17300 | hypothetical protein;(source:Araport11) |
AT2G17310 | Encodes an F-Box protein that regulates a novel induced defense response independent of both salicylic acid and systemic acquired resistance |
AT2G17380 | Encodes clathrin assembly protein AP19. The mRNA is cell-to-cell mobile. |
AT2G17442 | hypothetical protein;(source:Araport11) |
AT2G17450 | Encodes a putative RING-H2 finger protein RHA3a. |
AT2G17460 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 5.5e-22 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT2G17470 | Encodes ALMT6, a member of the aluminum-activated malate transporter family. |
AT2G17477 | Pseudogene of AT3G22350; F-box family protein |
AT2G17490 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.3e-199 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT2G17500 | Auxin efflux carrier family protein;(source:Araport11) |
AT2G17520 | Encodes a endoribonuclease/protein kinase IRE1-like protein that is predicted to form a type I transmembrane protein structure and contain kinase/endoribonuclease domains at their C-terminal halves. The transcript levels for several ER-stress responsive genes, including six protein disulfide isomerases (PDIs), BiP2, and AtbZIP60 are not affected in ire1-2 null mutants. The mRNA is cell-to-cell mobile. |
AT2G17540 | hypothetical protein;(source:Araport11) |
AT2G17580 | Encodes a bacterial-type poly(A) polymerase, AGS1. |
AT2G17600 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G17630 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT2G17670 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G17695 | outer envelope protein;(source:Araport11) |
AT2G17710 | Big1;(source:Araport11) |
AT2G17723 | Encodes a defensin-like (DEFL) family protein. |
AT2G17730 | Intrinsic thylakoid membrane protein that fixes RPOTmp on the stromal side of the thylakoid membrane. |
AT2G17740 | VACUOLELESS GAMETOPHYTES (VLG) as a DC1 domain containing protein that is found in the endomembrane system. It is essential for both female and male gametophyte development. |
AT2G17750 | Intrinsic thylakoid membrane protein that fixes RPOTmp on the stromal side of the thylakoid membrane. |
AT2G17760 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT2G17780 | Encodes a mechanosensitive channel candidate MCA2. The three-dimensional structure of MCA2 was reconstructed and appears to comprise a small transmembrane region and large cytoplasmic region. |
AT2G17785 | zinc-binding protein-like protein;(source:Araport11) |
AT2G17790 | Encodes a protein with similarity to yeast VPS35 which encodes a component of the retromer involved in retrograde endosomal transport. Mutants partially suppress the loss of VTI11 function in Arabidopsis and restores gravitropism in the double mutant. The mRNA is cell-to-cell mobile. |
AT2G17820 | Encodes a member of the histidine kinase family. |
AT2G17830 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G17840 | Identified as drought-inducible gene by differential hybridization. Upregulated by high light, drought, cold and salt stress determined by microarray analysis. |
AT2G17845 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G17850 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
AT2G17880 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT2G17890 | Encodes a member of Calcium Dependent Protein Kinase. Protein is N-myristoylated. Localizes to the plasma membrane. Localizes to the chloroplast when the myristoylation motif is mutated. |
AT2G17910 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.8e-42 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT2G17920 | nucleic acid binding / zinc ion binding protein;(source:Araport11) |
AT2G17950 | Homeobox gene controlling the stem cell pool. Expressed in the stem cell organizing center of meristems. Required to keep the stem cells in an undifferentiated state. Regulation of WUS transcription is a central checkpoint in stem cell control. The size of the WUS expression domain controls the size of the stem cell population through WUS indirectly activating the expression of CLAVATA3 (CLV3) in the stem cells and CLV3 repressing WUS transcription through the CLV1 receptor kinase signaling pathway. Repression of WUS transcription through AGAMOUS (AG) activity controls stem cell activity in the determinate floral meristem. Binds to TAAT element core motif. WUS is also involved in cell differentiation during anther development. Responds to CMV infection and represses virus accumulation in the meristem central and peripheral zones; inhibits viral protein synthesis by repressing the expression of plant S-adenosyl-L-methionine?dependent methyltransferases, which are involved in ribosomal RNA processing and ribosome stability. |
AT2G17960 | hypothetical protein;(source:Araport11) |
AT2G18000 | TBP-associated factor 14;(source:Araport11) |
AT2G18010 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT2G18060 | Encodes a NAC-domain transcription factor that is expressed in developing vessels and protoxylem. Along with other members of this family, VND1 appears to regulate the development of genes required for secondary cell wall biosynthesis. |
AT2G18110 | Translation elongation factor EF1B/ribosomal protein S6 family protein;(source:Araport11) |
AT2G18140 | Peroxidase superfamily protein;(source:Araport11) |
AT2G18150 | Peroxidase superfamily protein;(source:Araport11) |
AT2G18180 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT2G18190 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G18193 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G18196 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT2G18200 | transmembrane protein;(source:Araport11) |
AT2G18260 | member of SYP11 Gene Family |
AT2G18300 | DNA-binding bHLH protein involved in positive regulation of cell elongation and proliferation and, negative control of plant immunity.One component of PRE-IBH1-HBI1 tripartite module. |
AT2G18330 | AAA-type ATPase family protein;(source:Araport11) |
AT2G18340 | late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11) |
AT2G18350 | homeobox protein 24;(source:Araport11) |
AT2G18380 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT2G18450 | Nuclear encoded mitochondrial flavoprotein subunit of succinate dehydrogenase complex . |
AT2G18460 | like COV 3;(source:Araport11) |
AT2G18470 | Proline-rich extensin-like receptor kinase 4. Functions at an early stage of ABA signalling inhibiting primary root cell elongation by perturbing Ca2+ homeostasis. |
AT2G18480 | Major facilitator superfamily protein;(source:Araport11) |
AT2G18490 | GAZ is a nuclear localized transcriptional activator that is regulated (decreased) by GA and ABA levels. GAZ is expressed in the root stele and may function non-cell autonomously to effect hormone mediated control of ground tissue maturation. |
AT2G18500 | ovate family protein 7;(source:Araport11) |
AT2G18510 | Essential gene (embryo lethal) that is similar to component of splicosome. Regulates embryonic pattern formation through Pol II-Mediated transcription of WOX2 an PIN7 (DOI:10.1016/j.isci.2019.09.004). JANUS positively regulates PLT1 expression in the root meristem by recruiting RNA polymerase II (Pol II) to PLT1 and by interacting with PLT1. Nuclear accumulation of JANUS in root meristem depends on IMB4. (DOI:10.1105/tpc.20.00108 ) |
AT2G18540 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT2G18550 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
AT2G18570 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT2G18600 | Ubiquitin-conjugating enzyme family protein;(source:Araport11) |
AT2G18640 | Encodes an endoplasmic reticulum-targeted geranylgeranyl pyrophosphate synthase |
AT2G18660 | Encodes PNP-A (Plant Natriuretic Peptide A). PNPs are a class of systemically mobile molecules distantly related to expansins; their biological role has remained elusive. PNP-A contains a signal peptide domain and is secreted into the extracellular space. Co-expression analyses using microarray data suggest that PNP-A may function as a component of plant defence response and SAR in particular, and could be classified as a newly identified PR protein. It is stress responsive and can enhance its own expression. |
AT2G18690 | transmembrane protein;(source:Araport11) |
AT2G18700 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. |
AT2G18710 | Encodes a component of the thylakoid-localized Sec system involved in the translocation of cytoplasmic proteins into plastid. |
AT2G18721 | hypothetical protein;(source:Araport11) |
AT2G18750 | Calmodulin-binding protein;(source:Araport11) |
AT2G18780 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G18820 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.7e-38 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G18850 | SET domain-containing protein;(source:Araport11) |
AT2G18860 | Syntaxin/t-SNARE family protein;(source:Araport11) |
AT2G18876 | Encodes a microtubule-associated protein. |
AT2G18880 | vernalization5/VIN3-like protein;(source:Araport11) |
AT2G18890 | RLCK VI_A class kinase which activity is regulated by Rho-of-plants (ROP) GTPases. Controls seedling and plant growth in parallel with gibberrellin. |
AT2G18900 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G18910 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT2G18960 | Encodes a plasma membrane proton ATPase. Mutants have a reduced ability to close their stomata in response to drought and are affected in stomatal but not seed responsiveness to ABA. The mRNA is cell-to-cell mobile. |
AT2G18969 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
AT2G18970 | hypothetical protein;(source:Araport11) |
AT2G19060 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
AT2G19070 | encodes a protein whose sequence is similar to anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (gi:2239091). BAHD acyltransferase. Uses hydroxycinnamoyl CoAs, including caffeoyl/feruoyl/p-coumaroyl/sinapoyl-CoA as acyl donors to fully substitute the N1, N5, and N10 positions of spermidine. |
AT2G19080 | metaxin-like protein;(source:Araport11) |
AT2G19100 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.2e-33 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT2G19110 | Encodes a protein with similarity to Zn ATPase. Can rescue Zn deficiency in yeast and Cd resistance, suggesting a role in Zn and Cd transport. The mRNA is cell-to-cell mobile. |
AT2G19140 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-09 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT2G19160 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT2G19170 | Encodes a novel subtilisin-like serine protease. |
AT2G19180 | hypothetical protein;(source:Araport11) |
AT2G19200 | pseudogene of hypothetical protein (DUF626);(source:Araport11) |
AT2G19210 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
AT2G19220 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
AT2G19290 | hypothetical protein;(source:Araport11) |
AT2G19310 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT2G19330 | Encodes PIRL6, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
AT2G19350 | transmembrane protein (DUF872);(source:Araport11) |
AT2G19410 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT2G19460 | DUF3511 domain protein (DUF3511);(source:Araport11) |
AT2G19580 | Member of TETRASPANIN family |
AT2G19630 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G19640 | ASH1-related protein 2;(source:Araport11) |
AT2G19650 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G19740 | Ribosomal protein L31e family protein;(source:Araport11) |
AT2G19755 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.2e-08 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT2G19800 | Encodes a myo-inositol oxygenase family gene. |
AT2G19806 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 1.2e-19 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
AT2G19810 | Encodes Oxidation-related Zinc Finger 1 (OZF1), a plasma membrane protein involved in oxidative stress. |
AT2G19820 | LOB domain-containing protein 9;(source:Araport11) |
AT2G19870 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
AT2G19880 | Encodes Glucosylceramide synthase (GCS) which catalyzes the final step in glucosylceramide (GlcCer) synthesis by transferring a glucosyl residue from UDP-Glc to the ceramide backbone. |
AT2G19890 | hypothetical protein;(source:Araport11) |
AT2G19910 | RNA-dependent RNA polymerase family protein;(source:Araport11) |
AT2G19950 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC1 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (558-715 aa) portion of the protein. |
AT2G20000 | Required for cell division and cell differentiation in meristems. Encodes a homolog of the CDC27 subunit of the anaphase-promoting complex (APC). Unlike other CDC27 homologs in Arabidopsis, its transcription is cell cycle regulated. Strong hbt mutants give rise to seedlings that lack an anatomically recognizable quiescent center and differentiated columella root cap cells, the cell types derived from the wild-type hypophysis. Furthermore, they have no mitotically active root meristem and lack a differentiated lateral root cap. |
AT2G20010 | Gls protein (DUF810);(source:Araport11) |
AT2G20030 | RING/U-box superfamily protein;(source:Araport11) |
AT2G20050 | protein phosphatase 2C and cyclic nucleotide-binding/kinase domain-containing protein;(source:Araport11) |
AT2G20080 | hypothetical protein;(source:Araport11) |
AT2G20100 | Together with PFA1 and PFA3 governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT2G20110 | Tesmin/TSO1-like CXC domain-containing protein which is a transcriptional repressor of genes required for maintenance of DNA methylation, including MET1, CMT3, DDM1, KYP and VIMs. Functions redundantly with its paralogue TCX5 in repressing the expression of these genes. |
AT2G20180 | Encodes a novel Myc-related bHLH transcription factor that has transcriptional activation activity in the dark. It is a key negative regulator of phytochrome-mediated seed germination and acts by inhibiting chlorophyll biosynthesis, light-mediated suppression of hypocotyl elongation and far-red light-mediated suppression of seed germination, and promoting negative gravitropism in hypocotyls. Light reduces this activity in a phy-dependent manner. The protein preferentially interacts with the Pfr forms of Phytochrome A (PhyA) and Phytochrome B (PhyB), is physically associated with APRR1/TOC1 and is degraded in red (R) and far-red (FR) light through the ubiquitin (ub)-26S proteasome pathway to optimize photomorphogenic development in Arabidopsis. It also negatively regulates GA3 oxidase expression. |
AT2G20190 | Encodes a microtubule-associated protein that is involved in both cell division and cell expansion. It likely promotes microtubule stability. |
AT2G20270 | Thioredoxin superfamily protein;(source:Araport11) |
AT2G20290 | member of Myosin-like proteins |
AT2G20350 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT2G20360 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G20362 | transmembrane protein;(source:Araport11) |
AT2G20370 | Encodes a xyloglucan galactosyltransferase located in the membrane of Golgi stacks that is involved in the biosynthesis of fucose. It is also involved in endomembrane organization. It is suggested that it is a dual-function protein that is responsible for actin organization and the synthesis of cell wall materials. The mRNA is cell-to-cell mobile. |
AT2G20495 | Serine/Threonine-kinase;(source:Araport11) |
AT2G20510 | One of two loci encoding the TIM44 subunit of the mitochondrial inner membrane translocase complex. TIM44 subunit is the part of the complex that hydrolyzes ATP to provide energy for protein translocation to the inner membrane. |
AT2G20520 | fasciclin-like arabinogalactan-protein 6 (Fla6). Possibly involved in embryogenesis and seed development. |
AT2G20560 | DNAJ heat shock family protein;(source:Araport11) |
AT2G20625 | hypothetical protein (DUF626);(source:Araport11) |
AT2G20630 | PP2C induced by AVRRPM1;(source:Araport11) |
AT2G20670 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
AT2G20690 | A synthetic gene encoding the catalytic domain of the Arabidopsis thaliana gene At2g20690 was recombinant expressed in E. coli demonstrating the molecular function of riboflavin synthase. The mRNA is cell-to-cell mobile. |
AT2G20720 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G20724 | Annotated as pseudogene of unknown protein.Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 . |
AT2G20770 | Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor.GCL2 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase. |
AT2G20790 | clathrin adaptor complexes medium subunit family protein;(source:Araport11) |
AT2G20800 | NAD(P)H dehydrogenase B4;(source:Araport11) |
AT2G20880 | Encodes ERF53, a drought-induced transcription factor. Belongs to the AP2/ERF superfamily, and has a highly conserved AP2 domain. Regulates drought-responsive gene expressions by binding to the GCC box and/or dehydration-responsive element (DRE) in the promoter of downstream genes. Overexpression of AtERF53 driven by the CaMV35S promoter resulted in an unstable drought-tolerant phenotype in T2 transgenic plants. Involved in heat shock response. |
AT2G20921 | hypothetical protein;(source:Araport11) |
AT2G20970 | lipid-binding protein;(source:Araport11) |
AT2G20993 | Pseudogene of AT2G21045 |
AT2G21050 | Encodes LAX2 (LIKE AUXIN RESISTANT), a member of the AUX1 LAX family of auxin influx carriers. Required for the establishment of embryonic root cell organization. |
AT2G21060 | Glycine-rich protein (AtGRP2b). Also named as CSP4 (cold shock domain protein 4) containing a well conserved cold shock domain (CSD) and glycine-rich motifs interspersed by two retroviral-like CCHC zinc fingers. AtCSP4 is expressed in all tissues but accumulates in reproductive tissues and those undergoing cell divisions. Overexpression of AtCSP4 reduces silique length and induces embryo lethality. |
AT2G21070 | This gene is predicted to an encode a nuclear-localized protein that is involved in regulating the period of circadian rhythms without affecting their amplitude or robustness. FIONA1 seems to act as a central oscillator-associated component, but its transcript levels are not regulated in a circadian or light-dependent manner. FIONA1 also appears to be involved in photoperiod-dependent flowering. |
AT2G21080 | Ras guanine nucleotide exchange factor K;(source:Araport11) |
AT2G21210 | Putative auxin-regulated protein whose expression is downregulated in response to chitin oligomers. |
AT2G21220 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT2G21300 | ATP binding microtubule motor family protein;(source:Araport11) |
AT2G21385 | Encodes a chloroplast stroma localized protein that is found only in the green plant lineage. It is involved in assembly of the chloroplast ATP synthase complex. |
AT2G21410 | Vacuolar proton ATPase subunit VHA-a isoform 2. Localized in the tonoplast. Required for efficient nutrient storage but not for sodium accumulation. |
AT2G21420 | E3 ubiquitin ligases, member of the RING between RING fingers (RBR)-type RSL1/RFA family, key regulator of ABA receptor stability in root and leaf tissues, targeting ABA receptors for degradation in different subcellular locations. |
AT2G21430 | Papain family cysteine protease;(source:Araport11) |
AT2G21440 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G21480 | BUSP2 plays a smaller role than BUSP1 in pollen tube growth. bups1/2 double mutants have reduced feritlity due to premature rupture of pollen tubes before they reach the ovule but single busp2 mutants are fertile. BUSP2 interacts with RALF4/19 peptide ligands and ANX1/2 receptors. BUPS/ANX signaling may regulate and promote pollen tube growth. |
AT2G21500 | RING/U-box superfamily protein;(source:Araport11) |
AT2G21510 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT2G21530 | SMAD/FHA domain-containing protein;(source:Araport11) |
AT2G21540 | SEC14-like 3;(source:Araport11) |
AT2G21550 | One of three DRTS genes, this is the most divergent one.THY3/DRTS3 is preferentially expressed in the shoot apex, stipules and root caps. |
AT2G21560 | nucleolar-like protein;(source:Araport11) |
AT2G21640 | Encodes a protein of unknown function that is a marker for oxidative stress response.Expression in rosette leaves is activated by high concentration of boron. |
AT2G21680 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT2G21720 | ArgH (DUF639);(source:Araport11) |
AT2G21740 | Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion. |
AT2G21750 | Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion. |
AT2G21770 | cellulose synthase, related to CESA6. |
AT2G21780 | hypothetical protein;(source:Araport11) |
AT2G21830 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G21860 | violaxanthin de-epoxidase-like protein;(source:Araport11) |
AT2G21900 | member of WRKY Transcription Factor; Group II-c |
AT2G21910 | member of CYP96A |
AT2G21940 | Encodes a shikimate kinase. Its transcripts appear to be expressed most highly in mature embryos and senescing leaves, and its transcript levels rise during heat stress and recovery. It is believed to be localized to the chloroplast. |
AT2G21980 | HAUS augmin-like complex subunit;(source:Araport11) |
AT2G22040 | Encodes a homolog of LST8 (Lethal with Sec Thirteen 8/G protein b subunit-like (LST8/GbL). |
AT2G22050 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT2G22055 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. This gene is contained within a highly AT-rich repetitive sequence region. |
AT2G22060 | galactose oxidase/kelch repeat protein;(source:Araport11) |
AT2G22080 | transmembrane protein;(source:Araport11) |
AT2G22125 | Encodes a protein involved in cell elongation in root and anther filaments. Mutants have greater cell volumes in root tissues and have additive phenotypes with other cell expansion mutants such as those carrying mutations in COB, QUI and POM1 loci. POM2/CSI1 promotes Cellulose Synthase and microtubule co-alignment. The mRNA is cell-to-cell mobile. |
AT2G22140 | Forms a complex with MUS81 that functions as endonuclease in DNA recombination and repair processes. |
AT2G22150 | pseudogene of TRAF-like family protein;(source:Araport11) |
AT2G22180 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT2G22200 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
AT2G22210 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.1e-19 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G22240 | ** Referred to as MIPS1 in Mitsuhashi et al 2008. Myo-inositol-1-phosphate synthase isoform 2. Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
AT2G22250 | Encodes a prokaryotic-type plastidic aspartate aminotransferase with glutamate/aspartate-prephenate aminotransferase (PAT) activity. |
AT2G22270 | hematological/neurological-like protein;(source:Araport11) |
AT2G22300 | Encodes a putative CAM binding transcription factor. Loss of function mutations show enhanced resistance to fungal and bacterial pathogens suggesting that CAMTA functions to suppress defense responses.It acts in the cold response pathway, it can bind to and activate the expression of DREB1 genes. |
AT2G22330 | Encodes a cytochrome P450. Involved in tryptophan metabolism. Converts Trp to indole-3-acetaldoxime (IAOx), a precursor to IAA and indole glucosinolates. The mRNA is cell-to-cell mobile. |
AT2G22335 | pseudogene of cytochrome P450 family protein |
AT2G22426 | hypothetical protein;(source:Araport11) |
AT2G22460 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT2G22470 | Encodes arabinogalactan-protein (AGP2). |
AT2G22475 | Encodes GL2-expression modulator (GEM). Involved in the spatial control of cell division, patterning and differentiation of Arabidopsis root epidermal cells. GEM interacts with CDT1, a DNA replication protein and TTG1 (TRANSPARENT TESTA GLABRA1), a WD40-repeat protein involved in GL2-dependent cell fate decision. GEM seems to participate in the maintenance of a repressor histone H3 epigenetics status of the GL2 and CPC (CAPRICE) promoters. |
AT2G22500 | Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470). |
AT2G22510 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT2G22530 | Alkaline-phosphatase-like family protein;(source:Araport11) |
AT2G22560 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
AT2G22600 | RNA-binding KH domain-containing protein;(source:Araport11) |
AT2G22620 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
AT2G22630 | Encodes a MADs domain containing protein involved in promoting flowering. Loss of function mutations show delayed flowering in long days and reduced levels of LFY and AP1 expression. |
AT2G22640 | Component of the WAVE protein complex which act as activators of ARP2/3 complex involved in actin nucleation. Required for trichome morphogenesis. Required for accumulation of SCAR1 protein in vivo. Selectively stabilizes SCAR2. |
AT2G22680 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT2G22780 | encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
AT2G22790 | hypothetical protein;(source:Araport11) |
AT2G22810 | key regulatory enzyme in the biosynthesis of the plant hormone ethylene. ACS4 is specifically induced by indoleacetic acid (IAA). |
AT2G22830 | squalene epoxidase 2;(source:Araport11) |
AT2G22860 | Phytosulfokine 2 precursor, coding for a unique plant peptide growth factor. The mRNA is cell-to-cell mobile. |
AT2G22890 | Kua-ubiquitin conjugating enzyme hybrid localization domain-containing protein;(source:Araport11) |
AT2G22955 | Natural antisense transcript overlaps with AT2G22960;(source:Araport11) |
AT2G22960 | Encodes a putative flavonol-phenylacyltransferase. Some accessions (e.g. C24) contain a full length protein that produces high levels of saiginols compared to Col which is non producing. The producer strains also appear to be more resistant to UV-B irradiation. |
AT2G22990 | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose. |
AT2G23000 | serine carboxypeptidase-like 10;(source:Araport11) |
AT2G23010 | serine carboxypeptidase-like 9;(source:Araport11) |
AT2G23050 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
AT2G23060 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT2G23096 | Encodes a prolyl 4-hydroxylase that modifies the extensin proteins in root hair cells. |
AT2G23170 | encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. |
AT2G23180 | member of CYP96A |
AT2G23220 | member of CYP81D |
AT2G23230 | Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
AT2G23240 | AtMT4b is a member of Type 4 metallothionein (MT) genes. It is involved in the early develoment of the embryo and in the accumulation of metal ions especially Zn in the seeds. |
AT2G23270 | Encoding a precursor protein of a secreted peptide that is responsive to flg22 stimulus. Finetuning role in modulation of immunity through the regulation of SA and JA biosynthesis and signalling pathways. |
AT2G23290 | Member of the R2R3 factor gene family. |
AT2G23300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G23310 | Encodes AtRER1C1, a Golgi membrane protein involved in returning the molecules that are exported from the endoplasmic reticulum (ER) to the Golgi apparatus back to the ER (a mechanism known as retrieval). There are two Arabidopsis homologues of AtRERC1: AtRER1A and AtRER1B. |
AT2G23380 | Similar to the product of the Polycomb-group gene Enhancer of zeste. Catalytic component of the PRC2 complex.Required for stable repression of AG and AP3. Putative role in cell fate determination. Involved in the control of leaf morphogenesis. mutants exhibit curled, involute leaves. AGAMOUS and APETALA3 are ectopically expressed in the mutant. |
AT2G23400 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
AT2G23420 | nicotinate phosphoribosyltransferase 2;(source:Araport11) |
AT2G23430 | Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. |
AT2G23440 | transmembrane protein;(source:Araport11) |
AT2G23450 | Protein kinase superfamily protein;(source:Araport11) |
AT2G23460 | encodes a novel G-alpha protein that shares similarity to plant, yeast, and animal G-alpha proteins at the C-terminus. It contains an N-terminus that is as large as the C-terminus, is a member of a small family, and is expressed in all tissues examined, including roots, leaves, stems, flowers, and fruits. |
AT2G23470 | DUF647 domain containing protein. Mutants are male sterile with defects in endothecium, tapetum and stamen maturation. |
AT2G23520 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT2G23600 | Encodes a protein shown to have carboxylesterase activity, methyl salicylate esterase activity, methyl jasmonate esterase activity, and methyl IAA esterase activity in vitro. MES2 appears to be involved in MeSA hydrolysis in planta. This protein does not act on MeGA4, or MEGA9 in vitro and has been show to be capable of hydrolyzing methyl ester nicotinate back to nicotinate. |
AT2G23610 | Encodes a protein shown to have carboxylesterase activity, methyl IAA esterase activity, and methyl jasmonate esterase activity in vitro. This protein does not act on methyl salicylate, MeGA4, or MEGA9 in vitro. |
AT2G23620 | Encodes a protein shown to have carboxylesterase activity, methyl salicylate esterase activity, methyl jasmonate esterase activity, and methyl IAA esterase activity in vitro. MES1 appears to be involved in MeSA hydrolysis in planta. Expression of MES1 can restore systemic acquired resistance in SAR-deficient tobacco plants. This protein does not act on MeGA4, or MEGA9 in vitro. |
AT2G23630 | SKU5 similar 16;(source:Araport11) |
AT2G23660 | LOB domain-containing protein 10;(source:Araport11) |
AT2G23680 | Cold acclimation protein WCOR413 family;(source:Araport11) |
AT2G23710 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G09370.1);(source:TAIR10) |
AT2G23755 | transmembrane family 220 helix protein;(source:Araport11) |
AT2G23760 | Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw2 and saw1 may act redundantly to repress BP in leaves. Regulates together with BLH2 demethylesterification of homogalacturonan in seed mucilage. |
AT2G23770 | Encodes a putative LysM-containing receptor-like kinase LYK4. Shares overlapping function with LYK5 in mediating chitin-triggered immune responses. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain. |
AT2G23800 | encodes an endoplasmic reticulum-targeted geranylgeranyl pyrophosphate synthase |
AT2G23810 | Member of TETRASPANIN family |
AT2G23820 | Metal-dependent phosphohydrolase;(source:Araport11) |
AT2G23830 | PapD-like superfamily protein;(source:Araport11) |
AT2G23834 | hypothetical protein;(source:Araport11) |
AT2G23850 | pseudogene of uricase / urate oxidase / nodulin 35;(source:Araport11) |
AT2G23870 | pseudogene of Terpenoid cyclases family protein;(source:Araport11) |
AT2G23945 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT2G23985 | hypothetical protein;(source:Araport11) |
AT2G24060 | SUPPRESSOR OF VARIEGATION9 (SVR9),encodes a chloroplast-localized prokaryotic type translation initiation factor 3. Mutant plants shows both chloroplast development defect, and a series of leaf developmental abnormalities including more serrated leaf margin, disorganized mesophyll cells, and altered cotyledon venation patterns. |
AT2G24070 | QWRF motif protein (DUF566);(source:Araport11) |
AT2G24080 | F-box protein (DUF295);(source:Araport11) |
AT2G24090 | Ribosomal protein L35;(source:Araport11) |
AT2G24110 | pseudogene of ribosomal protein S11-beta;(source:Araport11) |
AT2G24130 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
AT2G24140 | myosin-J heavy chain-like protein (Protein of unknown function, DUF593);(source:Araport11) |
AT2G24160 | pseudogene of receptor like protein 37;(source:Araport11) |
AT2G24165 | pseudogene of receptor like protein 30;(source:Araport11) |
AT2G24190 | Encodes an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. In addition, this enzyme can reduce methylglyoxal in vitro. It is believed that this enzyme localizes to the cytosol like the closely related protein encoded by AT3G61220. |
AT2G24210 | terpene synthase 10;(source:Araport11) |
AT2G24230 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G24270 | Encodes a protein with non-phosphorylating NADP-dependent glyceraldehyde-3-phosphate dehydrogenase activity. The activity of the enzyme was determined from leaf extracts; the enzyme has not been purified to confirm activity. |
AT2G24310 | TPRXL;(source:Araport11) |
AT2G24330 | Encodes one of two LUNAPARK proteins in Arabidopsis. Both LNPA and LNPB are predominantly distributed throughout the ER, but not preferentially localized at the three-way junctions. Mutation of both LNPA and LNPB together caused the cortical ER to develop poor ER cisternae and a less dense tubular network. E3 ligase involved in degradation of RHD3 to maintain a tubular ER network. |
AT2G24340 | sequence-specific DNA binding transcription factor;(source:Araport11) |
AT2G24360 | STYK serine threonine kinase that phosphorylates several oil body proteins including OLE1 and CLO4/CAL4. |
AT2G24370 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT2G24390 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
AT2G24420 | DNA repair ATPase-like protein;(source:Araport11) |
AT2G24430 | NAC domain containing protein 38;(source:Araport11) |
AT2G24460 | C3HC4-type RING finger protein;(source:Araport11) |
AT2G24470 | filament-like protein (DUF869);(source:Araport11) |
AT2G24510 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT2G24520 | plasma membrane H+-ATPase;(source:Araport11) |
AT2G24530 | Member of SAGA complex, SPT modulu subunit, interacts with HAG1. |
AT2G24560 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT2G24570 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
AT2G24580 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
AT2G24590 | Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
AT2G24650 | B3 domain-containing protein REM13;(source:Araport11) |
AT2G24696 | transcriptional factor B3 family protein;(source:Araport11) |
AT2G24700 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
AT2G24710 | member of Putative ligand-gated ion channel subunit family |
AT2G24720 | member of Putative ligand-gated ion channel subunit family |
AT2G24730 | pseudogene of Ribosomal protein L4/L1 family;(source:Araport11) |
AT2G24740 | Encodes a SU(VAR)3-9 homolog, a SET domain protein (Homology Subgroup V; Orthology Group 1). Known SET domain proteins are involved in epigenetic control of gene expression. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. This protein is a putative histone methyltransferase (predicted to methylate H3K9/20) related to the the Drosophila Su(var)3-9 and mammalian G9a proteins. |
AT2G24748 | pseudogene of transcriptional factor B3 family protein |
AT2G24760 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.9e-16 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G24761 | pseudogene of self-incompatibility protein-related protein |
AT2G24762 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
AT2G24791 | Pseudogene of AT5G18880; glucose transmembrane transporter |
AT2G24800 | Peroxidase superfamily protein;(source:Araport11) |
AT2G24945 | transmembrane protein;(source:Araport11) |
AT2G25040 | pseudogene of casein lytic proteinase B4;(source:Araport11) |
AT2G25050 | actin-binding FH2 (formin 2) family protein;(source:Araport11) |
AT2G25060 | early nodulin-like protein 14;(source:Araport11) |
AT2G25070 | Protein phosphatase 2C family protein;(source:Araport11) |
AT2G25095 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC. Pri-mRNA coordinates for MIR156a (converted to TAIR10 based on PMID19304749): Chr2: 10677064-10673957 (reverse), length: 3108 bp; exon coordinates: exon 1: 10677064 to 10676955, exon 2: 10676613 to 10676366, exon 3: 10674380 to 10674338, exon 4: 10674245 |
AT2G25100 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT2G25120 | Bromo-adjacent homology (BAH) domain-containing protein;(source:Araport11) |
AT2G25130 | ARM repeat superfamily protein;(source:Araport11) |
AT2G25140 | Encodes ClpB4, which belongs to the Casein lytic proteinase/heat shock protein 100 (Clp/Hsp100) family. Targeted to the mitochondrion, also referred to as ClpB-m. Transcripts of ClpB4 accumulate dramatically at high temperatures, suggesting that it may be involved in response to heat stress. |
AT2G25180 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical.The retention of leaf water content, maintenance of cell membrane stability, and enhancement of anthocyanin biosynthesis were found to contribute to the enhanced drought tolerance of the arr1,10,12 triple mutant. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
AT2G25185 | Encodes a defensin-like (DEFL) family protein. |
AT2G25190 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
AT2G25200 | hypothetical protein (DUF868);(source:Araport11) |
AT2G25220 | Protein kinase superfamily protein;(source:Araport11) |
AT2G25240 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11). Involved in stress response regulated cell death. |
AT2G25260 | Hyp O-arabinosyltransferase-like protein;(source:Araport11) |
AT2G25270 | transmembrane protein;(source:Araport11) |
AT2G25290 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT2G25300 | Encodes a hydroxyproline O-galactosyltransferase. |
AT2G25310 | ER membrane protein complex subunit-like protein (DUF2012);(source:Araport11) |
AT2G25360 | RING/U-box superfamily protein;(source:Araport11) |
AT2G25380 | pseudogene of zinc finger protein-related |
AT2G25409 | hypothetical protein;(source:Araport11) |
AT2G25430 | AP180 N-terminal homology domain, TPLATE complex protein involved in clathrin-mediated endocytosis. |
AT2G25440 | receptor like protein 20;(source:Araport11) |
AT2G25460 | EEIG1/EHBP1 protein amino-terminal domain protein;(source:Araport11) |
AT2G25470 | receptor like protein 21;(source:Araport11) |
AT2G25500 | Inosine triphosphate pyrophosphatase family protein;(source:Araport11) |
AT2G25520 | Drug/metabolite transporter superfamily protein;(source:Araport11) |
AT2G25530 | AFG1-like ATPase family protein;(source:Araport11) |
AT2G25540 | cellulose synthase |
AT2G25565 | C3HC4-type RING finger protein;(source:Araport11) |
AT2G25600 | Encodes SPIK, a member of the Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mutant plants have impaired pollen-tube growth. |
AT2G25605 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
AT2G25620 | Encodes DBP1, a member of the DBP factors (DNA-binding protein phosphatases) featuring sequence-specific DNA-binding and protein phosphatase activity. DBP1 is involved in plant-potyvirus interactions. Loss-of-function of DBP1 renders resistance to potyviruses. Negatively regulates drought and salt tolerance through altering leaf surface permeability. |
AT2G25660 | Translocon at the inner-envelope membrane of chloroplasts which binds to the outer-membrane channel TOC75. |
AT2G25680 | Encodes a high-affinity molybdate transporter. Mutant has reduced concentrations of molybdate in roots and shoots, and reduced shoot and root length when growing on Mo-limited medium. |
AT2G25730 | zinc finger FYVE domain protein;(source:Araport11) |
AT2G25735 | hypothetical protein;(source:Araport11) |
AT2G25770 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT2G25780 | hypothetical protein (DUF1677);(source:Araport11) |
AT2G25790 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
AT2G25810 | tonoplast intrinsic protein 4;(source:Araport11) |
AT2G25930 | Encodes a nuclear protein that is expressed rhythmically and interacts with phytochrome B to control plant development and flowering through a signal transduction pathway. Required component of the core circadian clock regardless of light conditions. |
AT2G25950 | PITH domain protein (DUF1000);(source:Araport11) |
AT2G25975 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.1e-14 P-value blast match to GB:CAA26446 ORF2 (Ty1_Copia-element) (Drosophila melanogaster);(source:TAIR10) |
AT2G26010 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
AT2G26030 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT2G26120 | glycine-rich protein;(source:Araport11) |
AT2G26130 | Encodes a RING-type zinc finger ubiquitin ligase involved in seed longevity.Gain of function (35S promoter) increases, and loss of function decreases, seed longevity. |
AT2G26135 | RING/U-box protein with C6HC-type zinc finger;(source:Araport11) |
AT2G26170 | Encodes a protein with similarity to thromboxane-A synthase, member of the CYP711A cytochrome P450 family. MAX1 is a specific repressor of vegetative axillary buds generated by the axillary meristem. Expressed in vascular traces in the rosette stem and axillary buds throughout plant development. Mutants have increased axillary branches. Along with MAX3,4 thought to mediate control of shoot branching via synthesis of a signal molecule which is transported over long distance mediated by MAX2. cDNA supports the existence of the longer transcript predicted for this locus, no cDNA isolated for shorter transcript. MAX1 downregulates 11 genes involved in flavonoid pathway (CHS, CHI, F3H, F3'H, FLS, DFR, ANS, UFGT, RT, AAC and GST). |
AT2G26210 | Ankyrin repeat family protein;(source:Araport11) |
AT2G26240 | Transmembrane proteins 14C;(source:Araport11) |
AT2G26280 | smr (Small MutS Related) domain-containing protein |
AT2G26300 | Encodes an alpha subunit of a heterotrimeric GTP-binding protein. The active GTP-bound form of GPA1 binds to the GTG1 and GTG2 abscisic acid (ABA) receptors and appears to affect their GTPase and GTP-binding activity, and hence, ABA binding abilities. GPA1 is a positive regulator in ABA-mediated inhibition of stomatal opening. Plants with recessive mutant alleles have complex phenotypes including: reduced brassinolide response, reduced cell divisions, round leaves, short hypocotyls. It is likely to be involved in the signaling events that trigger unfolded protein response-associated cell death. GPA1 is also involved in sugar signaling. The mRNA is cell-to-cell mobile. |
AT2G26390 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11). Involved in stress response regulated cell death. |
AT2G26400 | Encodes a protein predicted to belong to the acireductone dioxygenase (ARD/ARD?)family. |
AT2G26410 | Member of IQ67 (CaM binding) domain containing family. |
AT2G26440 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT2G26450 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT2G26460 | Encodes SMU2, a protein involved in RNA splicing. |
AT2G26480 | UDP-glucosyl transferase 76D1;(source:Araport11) |
AT2G26490 | JGB contains seven WD40 repeats and is highly conserved in flowering plants. Overexpression inhibits pollen germination. suggesting JGB is a negative regulator of pollen germination |
AT2G26500 | cytochrome b6f complex subunit (petM);(source:Araport11) |
AT2G26530 | Pheromone receptor-like protein involved in the early elicitor signaling events which occur within minutes and include ion fluxes across the plasma membrane, activation of MPKs and the formation of ROS related to PGPS1 and WRKY33. |
AT2G26540 | Encodes a uroporphyrinogen-III synthase involved in tetrapyrrole biosynthesis. The protein localizes to the chloroplast. Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
AT2G26580 | plant-specific transcription factor YABBY family protein;(source:Araport11) |
AT2G26590 | regulatory particle non-ATPase 13;(source:Araport11) |
AT2G26600 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT2G26650 | Encodes AKT1, a member of the Shaker family inward rectifying potassium channel predominantly expressed in predominantly in root hairs and root endodermis. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
AT2G26670 | Encodes a plastid heme oxygenase necessary for phytochrome chromophore biosynthesis and for coupling the expression of some nuclear genes to the functional state of the chloroplast. |
AT2G26680 | FkbM family methyltransferase;(source:Araport11) |
AT2G26690 | Major facilitator superfamily protein;(source:Araport11) |
AT2G26695 | Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11) |
AT2G26700 | Member of AGC VIIIa Kinase gene family. Encodes PID2, a homolog of PID. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
AT2G26710 | Encodes a member of the cytochrome p450 family that serves as a control point between multiple photoreceptor systems and brassinosteroid signal transduction. Involved in brassinolide metabolism. Mediates response to a variety of light signals including hypocotyl elongation and cotyledon expansion. |
AT2G26730 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G26740 | Encodes a soluble epoxide hydrolase whose expression is induced by auxin and water stress. |
AT2G26750 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G26760 | Cyclin B1;(source:Araport11) |
AT2G26780 | ARM repeat superfamily protein;(source:Araport11) |
AT2G26790 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G26800 | Mutant has increased seed ile, leu and val as well as his and arg. |
AT2G26830 | Encodes a member of a small family of choline/ethanolamine kinases that is localized to the plasma membrane. Homozygous loss of function alleles are embryo lethal. Overexpression results in altered phospholipid levels suggesting a critical role in phospholipid biosynthesis. |
AT2G26882 | Natural antisense transcript overlaps with AT2G26880;(source:Araport11) |
AT2G26900 | Sodium Bile acid symporter family;(source:Araport11) |
AT2G26930 | Encodes a 4-(cytidine 5'-phospho)-2-C-methyl-D-erithritol kinase. |
AT2G26940 | C2H2-type zinc finger family protein;(source:Araport11) |
AT2G26950 | Member of the R2R3 factor gene family. |
AT2G26960 | Member of the R2R3 factor gene family.Expressed in microspores and required for progression into pollen mitosis I. |
AT2G26980 | encodes a serine-threonine protein kinase whose expression increases in response to abscisic acid, cold, drought, high salt, and wounding conditions. The gene is expressed in developing seeds and seedlings. Lines carrying a T-DNA insertions have reduced germination efficiency and expression of cold, high-salt, and abscisic acid marker genes are altered, but not drought-response markers. |
AT2G26990 | Represses photomorphogenesis and induces skotomorphogenesis in the dark. |
AT2G27000 | member of CYP705A |
AT2G27010 | member of CYP705A |
AT2G27035 | Has been classified as a stellacyanin. Has also been classified as an early nodulin-like protein (ENODL), because it does not have a His residue involved in Cu binding. ENODLs are proteins having one plastocyanin-like (PCNL) domain lacking the amino acid residues necessary for Cu binding. |
AT2G27060 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G27110 | FAR1-related sequence 3;(source:Araport11) |
AT2G27120 | Encodes a protein with similarity to DNA polymerase epsilon catalytic subunit. Based on yeast two hybrid analysis, not predicted to be a subunit of the DNA polymerase epsilon complex. No phenotype observed in homozygous mutant embryos or plants but in combination with TIL1-1/til1-1 heterozygotes arrest earlier than til1 homozygotes suggesting TIL2 functions redundantly with TIL1. |
AT2G27130 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT2G27140 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT2G27180 | hypothetical protein;(source:Araport11) |
AT2G27220 | BEL1-like homeodomain 5;(source:Araport11) |
AT2G27229 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G27230 | Encodes a nuclear-localized transcriptional activator with weak sequence similarity to basic helix-loop-helix(bHLH)-domain proteins. It promotes the production of stele cells in root meristems and is required to establish and maintain the normal vascular cell number and pattern in primary and lateral roots. |
AT2G27285 | nuclear speckle splicing regulatory-like protein (DUF2040);(source:Araport11) |
AT2G27300 | NTL8 is a membrane-associated NAC transcription factor that binds both TRY and TCL1. Overexpression results in fewer trichomes. |
AT2G27310 | F-box family protein;(source:Araport11) |
AT2G27315 | egg cell-secreted-like protein (DUF1278);(source:Araport11) |
AT2G27330 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G27350 | Encodes an otubain-like histone deubiquitinase involved in chromatin modification and regulation of plant gene expression. |
AT2G27380 | Encodes an extensin like gene involved in seed germination. |
AT2G27410 | B3 domain protein, putative (DUF313);(source:Araport11) |
AT2G27420 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT2G27430 | ARM repeat superfamily protein;(source:Araport11) |
AT2G27440 | pseudogene of rac GTPase activating protein |
AT2G27480 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT2G27490 | AT2G27490 encodes dephospho-CoA kinase. The molecular function was shown to phosphorylate the ribosyl moiety forming CoA. |
AT2G27500 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT2G27505 | FBD-like domain family protein;(source:Araport11) |
AT2G27520 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G27580 | Regulated by heat shock. |
AT2G27680 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT2G27690 | Encodes a CYP94C1. Has highest omega-hydroxylase activity with 9,10-epoxystearic acid, while also metabolized lauric acid (C12:0) and C18 unsaturated fatty acids. Gene expression is induced in response to wounding and jasmonic acid treatment. |
AT2G27710 | 60S acidic ribosomal protein family;(source:Araport11) |
AT2G27730 | copper ion binding protein;(source:Araport11) |
AT2G27750 | Surfeit locus protein 6;(source:Araport11) |
AT2G27760 | Encodes tRNA isopentenyltransferase, similar to yeast MOD5. |
AT2G27770 | DUF868 family protein (DUF868);(source:Araport11) |
AT2G27790 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G27820 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
AT2G27830 | hypothetical protein;(source:Araport11) |
AT2G27840 | Belongs to the plant specific HD2 type proteins; similar to nucleolar Zea mays histone deacetylase; HD2-p39 |
AT2G27880 | AGO5.Required for antiviral RNA silencing.Confers resistance to Potato virus X. |
AT2G27900 | coiled-coil protein;(source:Araport11) |
AT2G27920 | serine carboxypeptidase-like 51;(source:Araport11) |
AT2G27930 | PLATZ transcription factor family protein;(source:Araport11) |
AT2G27990 | Encodes a BEL1-like homeobox gene that functions together with PNY in meristem maintenance by regulating the allocation process during vegetative and reproductive development. Both gene products are required for the competence of the SAM to respond properly to floral inductive signals. |
AT2G28056 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AGAAUCUUGAUGAUGCUGCAU. Pri-mRNA coordinates for MIR172a (converted to TAIR10 based on PMID19304749): Chr2: 11943611-11941515 (reverse), length: 2097 bp; exon coordinates: exon 1: 11943611 to 11942837, exon 2: 11942688 to 11942600, exon 3: 11941905 to 11941515; mature miRNA and miRNA* are located on exon 1. |
AT2G28060 | Component of the regulatory subunit of SNF1-related protein kinase. As part of the regulatory complex it binds maltose which promotes kinase activity. |
AT2G28070 | ABC-2 type transporter family protein;(source:Araport11) |
AT2G28080 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT2G28085 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT2G28090 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT2G28130 | NSE5 subunit of the SMC5/6 complex. |
AT2G28140 | enabled-like protein (DUF1635);(source:Araport11) |
AT2G28150 | DUF966 domain containing protein, expressed during embryogenesis. |
AT2G28160 | Encodes a putative transcription factor that regulates iron uptake responses. mRNA is detected in the outer cell layers of the root and accumulates in response to iron deficiency. The expression of many iron-regulated genes is dependent on FIT1. It specifically regulates FRO2 at the level of mRNA accumulation and IRT1 at the level of protein accumulation.Similar to FER in tomato and is a regulator of iron uptake. It is post-transcriptionally controlled. |
AT2G28190 | Encodes a chloroplastic copper/zinc superoxide dismutase CSD2 that can detoxify superoxide radicals. Its expression is affected by miR398-directed mRNA cleavage. Activation depends totally on CCS. Overexpression of a miR398-resistant form of CSD2 leads to more dramatic improvements in stress (hight light, Cu2+ and methyl viologen) tolerance than overexpression of wild-type CSD2. The mRNA is cell-to-cell mobile. |
AT2G28200 | C2H2-type zinc finger family protein;(source:Araport11) |
AT2G28250 | Protein kinase superfamily protein;(source:Araport11) |
AT2G28260 | member of Cyclic nucleotide gated channel family |
AT2G28270 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G28280 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G28315 | UXT1 is a member of the NST-KT subfamily of nucleotide/sugar transporters. It is localized to the golgi and ER. UXT1 functions as a UDP-Xyl transporter. The mRNA is cell-to-cell mobile. |
AT2G28320 | Pleckstrin homology (PH) and lipid-binding START domains-containing protein;(source:Araport11) |
AT2G28350 | Involved in root cap cell differentiation. |
AT2G28390 | SAND family protein;(source:Araport11) |
AT2G28400 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT2G28420 | Vicinal oxygen chelate (VOC) superfamily member. |
AT2G28426 | hypothetical protein;(source:Araport11) |
AT2G28460 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G28490 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT2G28500 | LOB domain-containing protein 11;(source:Araport11) |
AT2G28510 | DOF transcription factor with a conserved zinc finger (ZF) DNA-binding domain. |
AT2G28520 | Vacuolar proton ATPase subunit VHA-a isoform 1. Localized in the trans-Golgi network. The mRNA is cell-to-cell mobile. |
AT2G28560 | Encodes a protein of the RAD51B family involved in double stranded DNA repair. Homozygous mutant plants show increased sensitivity to mitomycin which induces DS breaks. |
AT2G28570 | hypothetical protein;(source:Araport11) |
AT2G28580 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT2G28590 | Protein kinase superfamily protein;(source:Araport11) |
AT2G28610 | Encodes a homeodomain containing protein that regulates lateral axis-dependent development of Arabidopsis flowers and is required for cell proliferation. It is expressed in a restricted number of L1 cells at the lateral regions of flower primordia, floral organ primordia, and young leaf primordia. |
AT2G28640 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT2G28650 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT2G28660 | Chloroplast-targeted copper chaperone protein;(source:Araport11) |
AT2G28680 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT2G28690 | TOX high mobility group box protein, putative (DUF1635);(source:Araport11) |
AT2G28710 | C2H2-type zinc finger family protein;(source:Araport11) |
AT2G28720 | Histone superfamily protein;(source:Araport11) |
AT2G28725 | forkhead box protein G1;(source:Araport11) |
AT2G28760 | Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase. |
AT2G28770 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
AT2G28780 | P-hydroxybenzoic acid efflux pump subunit;(source:Araport11) |
AT2G28810 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
AT2G28830 | Encodes a U-box E3 ubiquitin ligase involved in ubiquitination of pattern recognition receptor FLS2.pub12/pub13 double mutants enhanced chitin-induced ROS production and callose deposition suggesting they function redundantly to negatively regulate immune response to fungal elicitor. |
AT2G28840 | Putative E3 Ub protein ligase; regulates thermoresponsive hypocotyl growth through mediating degradation of the thermosensor ELF3. |
AT2G28870 | cyclin-dependent kinase inhibitor SMR1-like protein;(source:Araport11) |
AT2G28890 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
AT2G28900 | Encodes AtOEP16, a 16-KDa plastid outer membrane protein involved in plastid import of protochlorophyllide oxidoreductase A. Predominantly expressed in leaves and is also inducible by cold treatment. |
AT2G28920 | RING/U-box superfamily protein;(source:Araport11) |
AT2G28930 | protein kinase 1B;(source:Araport11) |
AT2G28960 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G28970 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G28990 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G29010 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G29040 | Exostosin family protein;(source:Araport11) |
AT2G29090 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. This gene predominantly accumulates in dry seeds and is up-regulated immediately following imbibition. CYP707A2 appears to play a major role in the rapid decrease in ABA levels during early seed imbibition. |
AT2G29100 | member of Putative ligand-gated ion channel subunit family |
AT2G29110 | member of Putative ligand-gated ion channel subunit family |
AT2G29120 | member of Putative ligand-gated ion channel subunit family |
AT2G29125 | ROTUNDIFOLIA like 2;(source:Araport11) |
AT2G29130 | Putative laccase, knockout mutant had reduced root elongation under PEG-induced dehydration.miR397b regulates root lignin deposition by regulating LACCASE2 expression during drought and phosphate deficiency. |
AT2G29160 | pseudogene of senescence-associated gene 13;(source:Araport11) |
AT2G29180 | transmembrane protein;(source:Araport11) |
AT2G29220 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT2G29250 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT2G29280 | pseudogene of tropinone reductase;(source:Araport11) |
AT2G29300 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G29350 | Encodes a senescence associated protein required for resistance against fungal pathogens. Negative regulator of defense against bacterial pathogens. Induced by ROS. Required for defense against ROS and fungal pathogens most likely by activating anthocyanin biosynthesis. |
AT2G29360 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G29410 | member of Zinc transporter (ZAT) family |
AT2G29440 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT2G29450 | Encodes a member of the TAU glutathione S-transferase gene family. Gene expression is induced by exposure to auxin, pathogen and herbicides. Naming convention according to Wagner et al. (2002) |
AT2G29460 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). Role in the degradation of H2O2 to water using glutathione as electron donor |
AT2G29480 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT2G29490 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT2G29525 | Inositol phosphorylceramide synthase |
AT2G29590 | Thioesterase superfamily protein;(source:Araport11) |
AT2G29610 | pseudogene of the F-box protein family, contains Pfam profile PF00646: F-box domain |
AT2G29620 | dentin sialophosphoprotein;(source:Araport11) |
AT2G29660 | zinc finger (C2H2 type) family protein;(source:Araport11) |
AT2G29720 | Encodes CTF2B. |
AT2G29740 | UDP-glucosyl transferase 71C2;(source:Araport11) |
AT2G29760 | Encodes a chloroplast RNA editing factor. |
AT2G29770 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT2G29790 | Encodes a Maternally expressed gene (MEG) family protein [pseudogene] |
AT2G29800 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT2G29810 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT2G29820 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT2G29860 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT2G29870 | Aquaporin-like superfamily protein;(source:Araport11) |
AT2G29930 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT2G29940 | pleiotropic drug resistance 3;(source:Araport11) |
AT2G29950 | Member of a small family of proteins containing DUF1313 domain. Involved in flowering time. |
AT2G29960 | encodes a cyclophilin protein that exhibits peptidylprolyl cis/trans-isomerase and protein refolding activities that were sensitive to cyclosporin A. The protein interacts with GNOM in vitro and is localized to both the cytosolic and membrane fractions. The gene is expressed in the developing embryo. |
AT2G29970 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. The mRNA is cell-to-cell mobile. |
AT2G29980 | Endoplasmic reticulum enzyme responsible for the synthesis of 18:3 fatty acids from phospholipids. Uses cytochrome b5 as electron donor. |
AT2G29990 | alternative NAD(P)H dehydrogenase 2;(source:Araport11) |
AT2G30010 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT2G30060 | Pleckstrin homology (PH) domain superfamily protein;(source:Araport11) |
AT2G30070 | Encodes a high affinity potassium transporter. |
AT2G30080 | member of Fe(II) transporter isolog family. Gene expression is not regulated by iron, copper, or zinc deficiency or excess. |
AT2G30090 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT2G30105 | LRR/ubiquitin-like domain protein;(source:Araport11) |
AT2G30170 | Encodes a chloroplast PP2C phosphatase that is required for efficient dephosphorylation of PSII proteins and involved in light acclimation.Loss of function enhances immunity to bacterial pathogens. |
AT2G30220 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT2G30230 | 6,7-dimethyl-8-ribityllumazine synthase;(source:Araport11) |
AT2G30240 | Encodes a plasma membrane localized potassium transporter. |
AT2G30250 | member of WRKY Transcription Factor; Group I. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. |
AT2G30280 | Encodes RDM4, a transcriptional regulator functioning in RNA-directed DNA methylation and plant development. |
AT2G30290 | VACUOLAR SORTING RECEPTOR 2;(source:Araport11) |
AT2G30300 | Major facilitator superfamily protein;(source:Araport11) |
AT2G30310 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT2G30330 | Putative homolog of mammalian BLOC-1 Subunit 1. Protein - protein interaction with BLOS2 and also with SNX1.Located in endomembrane system and hypothesized to be involved in endomembrane transport. |
AT2G30360 | Encodes a SOS2-like protein kinase that is a member of the CBL-interacting protein kinase family.Loss of function mutants show a decrease in sensitivity to high pH.Phosphorylates AHA2, a plasma membrane H+ ATPase.This phosphorylation appears to regulate the activity of the proton transporter. |
AT2G30370 | Encodes a small, potentially secreted protein that acts as an inhibitor of stomatal production though likely not through direct interaction with the TMM receptor. It is homologous to known stomatal regulators EPF1 and EPF2. Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
AT2G30380 | MYB family transcription factor;(source:Araport11) |
AT2G30390 | Encodes one of two ferrochelatase genes in Arabidopsis. Ferrochelatase is the terminal enzyme of heme biosynthesis. FC-II is speculated to operate in photosynthetic cytochromes. |
AT2G30395 | Member of the plant specific ovate protein family of unknown function. |
AT2G30400 | ovate family protein 2;(source:Araport11) |
AT2G30410 | mutant has embryo defect; enlarged embryo cells and endosperm nuclei; Tubulin Folding Cofactor A |
AT2G30430 | hypothetical protein;(source:Araport11) |
AT2G30490 | Encodes a cinnamate-4-hydroxylase. Mutations in this gene impact phenylpropanoid metabolism, growth and development. |
AT2G30520 | Encodes a phototropin-interacting NRL protein that is an early signaling component in the phototrophic response and is essential for the phototropin-mediated chloroplast accumulation response but is not involved in the chloroplast avoidance response or stomatal opening. |
AT2G30530 | zinc finger CCCH domain protein;(source:Araport11) |
AT2G30540 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
AT2G30550 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
AT2G30560 | Needs to be reannotated and split into two genes, AtEAL2 and AtEAL3, both encoding maize Ebb apparatus 1-like proteins. The current predicted structure is not well supported (T8, one *). The predicted proteins can be found in doi.org/10.1007/s00425-005-0174-z |
AT2G30580 | Encodes a C3HC4 RING-domain-containing ubiquitin E3 ligase capable of interacting with DREB2A. DRIP2 seems to be involved in regulating stress-related transcriptional changes and drought tolerance. |
AT2G30590 | Encodes WRKY DNA-binding protein 21 (WRKY21). |
AT2G30600 | BTB/POZ domain-containing protein;(source:Araport11) |
AT2G30640 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
AT2G30660 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
AT2G30670 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G30750 | Putative cytochrome P450; together with CYP71A13 produces dihydrocamalexic acid (DHCA), the precursor to the defense-related compound camalexin, which accumulates in the intercellular space and contributes to the resistance of mature Arabidopsis to P. syringae without directly inhibiting bacterial growth. |
AT2G30790 | Encodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution. |
AT2G30800 | Has RNA or DNA helicase activity and expressed specifically in tapetum and vascular tissue. First identified member of a new group of the mle helicase group of the DEAH family. |
AT2G30820 | aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit;(source:Araport11) |
AT2G30850 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT2G30880 | Pleckstrin homology (PH) domain-containing protein;(source:Araport11) |
AT2G30900 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT2G30910 | actin-related protein C1A;(source:Araport11) |
AT2G30940 | Protein kinase superfamily protein;(source:Araport11) |
AT2G30942 | Encodes a 56-amino acid polypeptide with low but significant similarity to human small subunit of serine palmitoyltransferase that localizes to the ER and physically interacts with and greatly stimulates the activity of LCB1/LCB2 heterodimer ser palmitoyltransferase complex. |
AT2G30960 | myosin-M heavy chain-like protein;(source:Araport11) |
AT2G30970 | ASPARTATE AMINOTRANSFERASE 1 |
AT2G31018 | hypothetical protein;(source:Araport11) |
AT2G31020 | OSBP(oxysterol binding protein)-related protein 1A;(source:Araport11) |
AT2G31060 | elongation factor family protein;(source:Araport11) |
AT2G31080 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.3e-49 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G31081 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT2G31110 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT2G31130 | hypothetical protein;(source:Araport11) |
AT2G31141 | hypothetical protein;(source:Araport11) |
AT2G31180 | Member of the R2R3 factor gene family. |
AT2G31250 | Glutamyl-tRNA reductase family protein;(source:Araport11) |
AT2G31260 | Involved in autophagy, the process of vacuolar bulk degradation of cytoplasmic components. Mutant shows accelerated bolting and senescence. |
AT2G31300 | putative ARP2/3 protein complex subunit p41 |
AT2G31340 | embryo defective 1381;(source:Araport11) |
AT2G31345 | transmembrane protein;(source:Araport11) |
AT2G31370 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
AT2G31380 | a B-box zinc finger protein that interacts with COP1. contains a novel 11 amino acid motif at the C-terminus (also found at the N-terminus of HY5) that is involved in the COP1 interaction. |
AT2G31410 | coiled-coil protein;(source:Araport11) |
AT2G31440 | Encodes a gamma-secretase subunit. Associates with other subunits in intracellular membrane compartments. |
AT2G31460 | B3 domain protein, putative (DUF313);(source:Araport11) |
AT2G31470 | Encodes a F-Box protein DOR (Drought tolerance Repressor) functionally as an inhibitory factor for abscisic acid-induced stomatal closure under drought stress. |
AT2G31500 | member of Calcium Dependent Protein Kinase |
AT2G31570 | glutathione peroxidase GPx |
AT2G31580 | ICA1 is a nuclear localized member of the tRNA(His) guanylyl transferase superfamily. Loss of function alleles show increased sensitivity to growth at high temperatures defects in cell cycle progression and DNA repair. |
AT2G31660 | SAD2 (super sensitive to ABA and drought 2) encodes an importin beta-domain family protein likely to be involved in nuclear transport in ABA signaling. Subcellular localization of GFP-tagged SAD2 showed a predominantly nuclear localization, consistent with a role for SAD2 in nuclear transport. Mutation of SAD2 in Arabidopsis alters abscisic acid sensitivity. SAD2 was ubiquitously expressed at low levels in all tissues except flowers. SAD2 expression was not induced by ABA or stress. Loss of function mutations in SAD2 exhibit increased tolerance for UV stress, increased production of UV protective secondary metabolites and suppression of nuclear localization of MYB4 (a repressor of UV stress response genes). Regulates microRNA activity. Defective trichome activity. |
AT2G31690 | encodes a triacylglycerol lipase located in plastoglobuli and involved in the degradation of triacylglycerol. It also has impact on leaf senescence and maintaining the structural integrity of thylakoids. |
AT2G31700 | transmembrane protein;(source:Araport11) |
AT2G31725 | FAM136A-like protein (DUF842);(source:Araport11) |
AT2G31730 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT2G31760 | RING/U-box superfamily protein;(source:Araport11) |
AT2G31770 | RING/U-box superfamily protein;(source:Araport11) |
AT2G31780 | RING/U-box superfamily protein;(source:Araport11) |
AT2G31820 | Ankyrin repeat family protein;(source:Araport11) |
AT2G31850 | hypothetical protein;(source:Araport11) |
AT2G31860 | pseudogene of poly(ADP-ribose) glycohydrolase 2;(source:Araport11) |
AT2G31862 | B3 domain protein;(source:Araport11) |
AT2G31865 | poly(ADP-ribose) glycohydrolase 2;(source:Araport11) |
AT2G31870 | The gene encodes a poly(ADPribose) glycohydrolase (PARG1). Mutant analysis suggests that PARG1 plays a role in abiotic stress responses and DNA repair. Loss of function mutants accumulate poly(ADPribose) and have increased cell death when treated with bleomycin. |
AT2G31902 | Natural antisense transcript overlaps with AT2G31900;(source:Araport11) |
AT2G31940 | oxidoreductase/transition metal ion-binding protein;(source:Araport11) |
AT2G31960 | encodes a protein similar to callose synthase |
AT2G31980 | PHYTOCYSTATIN 2;(source:Araport11) |
AT2G31981 | hypothetical protein;(source:Araport11) |
AT2G31990 | Exostosin family protein;(source:Araport11) |
AT2G32020 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT2G32050 | cell cycle control-like protein (DUF572);(source:Araport11) |
AT2G32100 | ovate family protein 16;(source:Araport11) |
AT2G32130 | intracellular protein transporter, putative (DUF641);(source:Araport11) |
AT2G32150 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT2G32160 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT2G32179 | Natural antisense transcript overlaps with AT2G32180;(source:Araport11) |
AT2G32200 | cysteine-rich/transmembrane domain A-like protein;(source:Araport11) |
AT2G32235 | hypothetical protein;(source:Araport11) |
AT2G32260 | phosphorylcholine cytidylyltransferase;(source:Araport11) |
AT2G32270 | A member of Zrt- and Irt-related protein (ZIP) family. transcript is induced in response to zinc deficiency in the root. also response to iron deficiency. |
AT2G32290 | beta-amylase 6;(source:Araport11) |
AT2G32295 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT2G32310 | CCT motif family protein;(source:Araport11) |
AT2G32315 | Natural antisense transcript overlaps with AT2G32310;(source:Araport11) |
AT2G32320 | Interacts genetically with its homolog ICA1; alters growth and flowering time plasticity in relation to temperature. Mutants display effects on growth, flowering and plant development, and ploidy level depending on ambient temperature (effects specific at >27C). |
AT2G32350 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT2G32360 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT2G32415 | Polynucleotidyl transferase, ribonuclease H fold protein with HRDC domain-containing protein;(source:Araport11) |
AT2G32430 | Galactosyltransferase family protein;(source:Araport11) |
AT2G32460 | Member of the R2R3 factor gene family. |
AT2G32470 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT2G32490 | pseudogene of 3'-5' exonuclease domain-containing protein |
AT2G32500 | Stress responsive alpha-beta barrel domain protein;(source:Araport11) |
AT2G32510 | Member of MEKK subfamily involved in wound and JA induced signaling.Interacts with At5g40440, and activates At1g59580. |
AT2G32530 | encodes a gene similar to cellulose synthase |
AT2G32540 | encodes a gene similar to cellulose synthase The mRNA is cell-to-cell mobile. |
AT2G32550 | Cell differentiation, Rcd1-like protein;(source:Araport11) |
AT2G32590 | condensin complex subunit;(source:Araport11) |
AT2G32610 | encodes a gene similar to cellulose synthase |
AT2G32620 | encodes a gene similar to cellulose synthase |
AT2G32645 | B3 domain protein, putative (DUF313);(source:Araport11) |
AT2G32660 | receptor like protein 22;(source:Araport11) |
AT2G32680 | NLP20 LRR receptor protein involved in PAMP mediated immunity. |
AT2G32700 | Encodes a WD40 repeat and LUFS domain containing protein that is similar to LUG. Interacts physically with SEUSS and likely functions as part of a repressor complex that represses AG. Involved in cell wall modifications necessary for mucilage extrusion and mediates aluminium sensitivity through PECTIN METHYLESTERASE46-modulated root cell wall pectin methylesterification. |
AT2G32710 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI). A member of seven KRP genes found in Arabidopsis thaliana. Negative regulator of cell division. Expressed in actively dividing cells. |
AT2G32740 | galactosyltransferase 13;(source:Araport11) |
AT2G32750 | Exostosin family protein;(source:Araport11) |
AT2G32770 | purple acid phosphatase 13;(source:Araport11) |
AT2G32785 | Encodes a Rapid ALkalinization Factor (RALF) family protein |
AT2G32800 | protein kinase family protein;(source:Araport11) |
AT2G32810 | putative beta-galactosidase |
AT2G32820 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
AT2G32830 | Encodes Pht1;5, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
AT2G32835 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT2G32870 | TRAF-like family protein;(source:Araport11) |
AT2G32880 | TRAF-like family protein;(source:Araport11) |
AT2G32905 | B3 domain protein, putative (DUF313);(source:Araport11) |
AT2G32930 | Encodes a zinc finger protein. |
AT2G32960 | Encodes an atypical dual-specificity phosphatase. |
AT2G32970 | G1/S-specific cyclin-E protein;(source:Araport11) |
AT2G32980 | HAUS augmin-like complex subunit;(source:Araport11) |
AT2G33000 | ubiquitin-associated (UBA)/TS-N domain-containing protein-like protein;(source:Araport11) |
AT2G33020 | receptor like protein 24;(source:Araport11) |
AT2G33070 | Encodes a nitrile-specifier protein NSP2. NSP2 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. |
AT2G33090 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
AT2G33160 | Gene structure annotation for AT2G33160.1 is inaccurate in TAIR10, see PMID:23709666 and Comments field on the locus page for updated annotation. |
AT2G33170 | Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11) |
AT2G33190 | F-box only protein (DUF295);(source:Araport11) |
AT2G33205 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
AT2G33230 | Encodes a flavin monooxygenase gene which belongs to the tryptophan-dependent auxin biosynthetic pathway and enhances drought resistance. |
AT2G33233 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G33255 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT2G33270 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. |
AT2G33280 | Major facilitator superfamily protein;(source:Araport11) |
AT2G33300 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
AT2G33310 | Auxin induced gene, IAA13 (IAA13). |
AT2G33320 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT2G33330 | Encodes a plasmodesmal protein that affects the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
AT2G33350 | CCT motif family protein;(source:Araport11) |
AT2G33370 | Ribosomal protein L14p/L23e family protein;(source:Araport11) |
AT2G33385 | actin-related protein C2B;(source:Araport11) |
AT2G33420 | hypothetical protein (DUF810);(source:Araport11) |
AT2G33430 | Encodes a multiple organellar RNA editing factor, a chloroplast protein which is required for the maturation of the plastid ribosomal RNAs and is essential for chloroplast differentiation.Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
AT2G33435 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G33470 | glycolipid transfer protein 1;(source:Araport11) |
AT2G33480 | NAC domain containing protein 41;(source:Araport11) |
AT2G33490 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT2G33500 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
AT2G33530 | serine carboxypeptidase-like 46;(source:Araport11) |
AT2G33550 | Homeodomain-like superfamily protein;(source:Araport11) |
AT2G33585 | subtilisin-like protease;(source:Araport11) |
AT2G33650 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT2G33680 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G33690 | Late embryogenesis abundant protein, group 6;(source:Araport11) |
AT2G33700 | Encodes a putative protein phosphatase 2C that positively regulates salt tolerance in abscisic acid-dependent manner. |
AT2G33707 | Encodes a defensin-like (DEFL) family protein. |
AT2G33710 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
AT2G33720 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT2G33750 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
AT2G33775 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT2G33780 | VQ motif-containing protein;(source:Araport11) |
AT2G33796 | FBD-like domain family protein;(source:Araport11) |
AT2G33800 | Encodes SCABRA1 (SCA1), a nuclear gene encoding a plastid-type ribosomal protein that functions
as a structural component of the 70S plastid ribosome. The sca1-rps5 allele exhibits defects in plastid 16SrRNA processing and a resulting decrease in accumulation of photosynthetic proteins. Loss-of-function mutations enhance the polarity defects of the as2 mutants. |
AT2G33830 | Negative regulator of local and systemic acquired resistance; target of FLD for activation of SAR. |
AT2G33845 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT2G33850 | Stigmatic factor that plays a role during the early post-pollination stages. |
AT2G33855 | transmembrane protein;(source:Araport11) |
AT2G33860 | ettin (ett) mutations have pleiotropic effects on Arabidopsis flower development, causing increases in perianth organ number, decreases in stamen number and anther formation, and apical-basal patterning defects in the gynoecium. The ETTIN gene encodes a protein with homology to DNA binding proteins which bind to auxin response elements. ETT transcript is expressed throughout stage 1 floral meristems and subsequently resolves to a complex pattern within petal, stamen and carpel primordia. ETT probably functions to impart regional identity in floral meristems that affects perianth organ number spacing, stamen formation, and regional differentiation in stamens and the gynoecium. During stage 5, ETT expression appears in a ring at the top of the floral meristem before morphological appearance of the gynoecium, consistent with the proposal that ETT is involved in prepatterning apical and basal boundaries in the gynoecium primordium. It is a target of the ta-siRNA tasiR-ARF. ETT is also a target of AP2; integrateing the functions of AGAMOUS and APETALA2 in floral meristem determinacy. Positive regulation of drought stress response genes. |
AT2G33880 | Encodes a protein with similarity to WUS type homeodomain protein. Required for meristem growth and development and acts through positive regulation of WUS. Loss of function phenotypes include embryo lethality, hyponastic cotyledons, reduced root development and smaller meristems. Phenotypes can be rescued by addition of sucrose in the growth media. Overexpression can partially rescue the triple mutant cytokinin receptor phenotype suggesting HB-3 is a downstream effector of cytokinin signaling. |
AT2G34000 | RING/U-box superfamily protein;(source:Araport11) |
AT2G34010 | verprolin;(source:Araport11) |
AT2G34020 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT2G34030 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT2G34070 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TBL37 expression is regulated by MYC2 and activated in response to JA. |
AT2G34080 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT2G34090 | maternal effect embryo arrest 18;(source:Araport11) |
AT2G34120 | Cytochrome C oxidase polypeptide VIB family protein;(source:Araport11) |
AT2G34123 | Encodes a defensin-like (DEFL) family protein. |
AT2G34140 | CDF4 is member of the group II DOF transcription factor family is involved in regulation of differentiation root columella cells. It is a direct target of the transcriptional repressor WOX5. CDF4 itself is a transcriptional repressor that appears to repress root columella stem cell identity. Ectopic expression of CDF leads to premature differentiation of root columella cells. |
AT2G34170 | hypothetical protein (DUF688);(source:Araport11) |
AT2G34180 | Encodes CBL-interacting protein kinase 13 (CIPK13). |
AT2G34186 | hypothetical protein;(source:Araport11) |
AT2G34210 | Transcription elongation factor Spt5;(source:Araport11) |
AT2G34220 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (DUF627 and DUF629);(source:Araport11) |
AT2G34240 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (Protein with domains of unknown function DUF627 and DUF632);(source:Araport11) |
AT2G34270 | hypothetical protein;(source:Araport11) |
AT2G34280 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G34300 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT2G34330 | LOW protein: protein BOBBER-like protein;(source:Araport11) |
AT2G34350 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
AT2G34357 | ARM repeat superfamily protein;(source:Araport11) |
AT2G34360 | MATE efflux family protein;(source:Araport11) |
AT2G34380 | Membrane protein involved in lipid droplet biogenesis primarily in pollen. The interaction between VAP27-1 and SEIPIN3 requires the N-terminal 25 amino acids of SEIPIN3 that contain an FFAT motif. |
AT2G34490 | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze the conversion of both 24-epi-campesterol and β-sitosterol to brassicasterol and stigmasterol, respectively, in the presence of NADPH. |
AT2G34500 | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze in the presence of NADPH the conversion of β-sitosterol to stigmasterol, but not that of 24-epi-campesterol to brassicasterol (unlike CYP710A2). |
AT2G34510 | Protein of unknown function, DUF642. Found in cellulose enriched cell wall fractions. |
AT2G34530 | transmembrane protein;(source:Araport11) |
AT2G34540 | hypothetical protein;(source:Araport11) |
AT2G34580 | cytomegalovirus UL139 protein;(source:Araport11) |
AT2G34600 | Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators. |
AT2G34610 | cotton fiber protein;(source:Araport11) |
AT2G34620 | Mitochondrial transcription termination factor family member. |
AT2G34630 | Encodes a geranyl diphosphate synthase. RNAi lines are dwarf. T-DNA knock-out lines are embryo lethal. |
AT2G34655 | hypothetical protein;(source:Araport11) |
AT2G34670 | benzoyl-CoA reductase subunit C, putative (DUF630 and DUF632);(source:Araport11) |
AT2G34710 | Dominant PHB mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. Has overlapping functions with PHAVOLUTA, REVOLUTA and CORONA. |
AT2G34740 | protein phosphatase 2C family protein;(source:Araport11) |
AT2G34790 | Encodes a BBE-like enzyme that acts in monolignol metabolism by catalyzing the oxidation of aromatic allylic alcohols, such as coumaryl-, sinapyl-, and coniferyl alcohol, to the corresponding aldehydes. |
AT2G34820 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT2G34835 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.6e-32 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT2G34880 | JMJ15 is a novel H3K4 demethylase that regulates genes involved in flowering and response to stress. It is also a maternally expressed, imprinted gene. |
AT2G34890 | Cytidine triphosphate synthase. |
AT2G34910 | root hair specific protein;(source:Araport11) |
AT2G34920 | RING/U-box superfamily protein;(source:Araport11) |
AT2G34930 | disease resistance family protein / LRR family protein;(source:Araport11) |
AT2G34940 | VACUOLAR SORTING RECEPTOR 5;(source:Araport11) |
AT2G35080 | ATP binding / aminoacyl-tRNA ligase/ nucleotide binding protein;(source:Araport11) |
AT2G35110 | Component of the WAVE protein complex which act as activators of ARP2/3 complex involved in actin nucleation. Required for trichome morphogenesis. Mutant displays distorted trichomes, a phenotype that can be phenocopied by treatment of WT plants with actin-interacting drugs. Its ER localization is independent of upstream SPK1 activation signaling and the physical association with the WAVE/SCAR Regulatory complex binding partner SRA1. ER-localized NAP1 has little colocalization with actin and represent the inactive pool of NAP1 in these cell types. |
AT2G35150 | Encodes EXORDIUM LIKE 7. |
AT2G35200 | DUF740 family protein;(source:Araport11) |
AT2G35260 | CAAX protease self-immunity protein;(source:Araport11) |
AT2G35270 | Direct target of AGAMOUS. Regulates patterning and differentiation of reproductive organs. |
AT2G35280 | F-box family protein;(source:Araport11) |
AT2G35360 | ubiquitin family protein;(source:Araport11) |
AT2G35380 | Peroxidase superfamily protein;(source:Araport11) |
AT2G35382 | snoRNA;(source:Araport11) |
AT2G35390 | Phosphoribosyltransferase family protein;(source:Araport11) |
AT2G35420 | RING/U-box superfamily protein;(source:Araport11) |
AT2G35430 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT2G35470 | ribosome maturation factor;(source:Araport11) |
AT2G35480 | envelope glycoprotein;(source:Araport11) |
AT2G35520 | Defender against death (DAD family) protein;(source:Araport11) |
AT2G35570 | pseudogene of Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
AT2G35585 | cystic fibrosis transmembrane conductance regulator;(source:Araport11) |
AT2G35600 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
AT2G35615 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT2G35680 | Encodes a phosphatidylglycerophosphate (PGP) phosphatase involved in the synthesis of plastidial Phosphatidylglycerol (PG) in conjunction with PGPP1 and PTPMT2 in root. PTPMT1 levels were higher in node, cauline leaf, and flower than in root, leaf, and stem. |
AT2G35710 | Nucleotide-diphospho-sugar transferases superfamily protein;(source:Araport11) |
AT2G35760 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT2G35770 | serine carboxypeptidase-like 28;(source:Araport11) |
AT2G35860 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
AT2G35890 | member of Calcium Dependent Protein Kinase |
AT2G35900 | Mal d 1-associated protein;(source:Araport11) |
AT2G35930 | Encodes a cytoplasmically localized U-box domain containing E3 ubiquitin ligase that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
AT2G35945 | Natural antisense transcript overlaps with AT2G35940;(source:Araport11) |
AT2G35950 | embryo sac development arrest 12;(source:Araport11) |
AT2G35990 | Putative lysine decarboxylase family protein;(source:Araport11) |
AT2G36020 | HVA22-like protein J;(source:Araport11) |
AT2G36080 | Encodes a plant-specific B3 DNA-binding domain transcription factor. Has transcription repressor activity. |
AT2G36180 | EF hand calcium-binding protein family;(source:Araport11) |
AT2G36190 | cwINV4 appears to function as a cell wall-localized invertase (that can catalyze the hydrolysis of sucrose into fructose and glucose) based on the phenotype of cwinv4 mutants. cwINV4 transcripts are expressed at high levels in lateral and median nectaries and this enzyme plays an important role in nectar production. Also expressed in ovary placenta and appears to play a role linking sugar sensing to ovule intitiation. |
AT2G36240 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
AT2G36250 | Encodes one of two FtsZ proteins, tubulin-like proteins, in Arabidopsis. It is involved in chloroplast division. |
AT2G36270 | Encodes a member of the basic leucine zipper transcription factor family, involved in ABA signalling during seed maturation and germination. The Arabidopsis abscisic acid (ABA)-insensitive abi5 mutants have pleiotropic defects in ABA response, including decreased sensitivity to ABA inhibition of germination and altered expression of some ABA-regulated genes. Comparison of seed and ABA-inducible vegetative gene expression in wild-type and abi5-1 plants indicates that ABI5 regulates a subset of late embryogenesis-abundant genes during both developmental stages. Responsible for reducing cadmium uptake, mediated by interaction with MYB49 . |
AT2G36307 | Has been identified as a translated small open reading frame by ribosome profiling. |
AT2G36325 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT2G36350 | Member of AGC VIIIa Kinase gene family. |
AT2G36355 | RAB6-interacting golgin (DUF662);(source:Araport11) |
AT2G36440 | hypothetical protein;(source:Araport11) |
AT2G36470 | DUF868 family protein, putative (DUF868);(source:Araport11) |
AT2G36490 | A repressor of transcriptional gene silencing. Functions by demethylating the target promoter DNA. Interacts physically with RPA2/ROR1. In the ros1 mutants, an increase in methylation is observed in a number of gene promoters. Among the loci affected by ros1, a few (RD29A and At1g76930) are affected in cytosine methylation in all sequence contexts (CpG, CpNpG or CpNpN), although many others are affected primarily in non-CpG contexts. The ros1 mutant is more susceptible to biotrophic pathogens and is repressed in its responsiveness of salyclic acid-dependent defence genes. |
AT2G36530 | Involved in light-dependent cold tolerance and encodes an enolase. Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. Affects seed size and weight by adjusting cytokinin content and forming ENO2-bZIP75 complex. |
AT2G36570 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G36590 | Encodes a proline transporter with affinity for gly betaine, proline, and GABA. Protein is expressed in leaves, flowers and siliques but to a much lesser extent in roots. |
AT2G36620 | RPL24A encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B (AT3G53020). |
AT2G36650 | CHUP1-like protein;(source:Araport11) |
AT2G36660 | polyadenylate-binding protein, putative / PABP, putative. Member of the class III family of PABP proteins. |
AT2G36690 | Protein belonging to the Fe-dependent 2-oxoglutarate dioxygenase superfamily, catalyzes the stereospecific hydration of GA12 to produce DHGA12, negatively regulates ABA sensitivity during germination, phototrophic establishment and seedling development. |
AT2G36695 | hypothetical protein;(source:Araport11) |
AT2G36700 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G36710 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G36720 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
AT2G36740 | DNA binding protein SWC2;(source:Araport11) |
AT2G36790 | The At2g36790 gene encodes a UDP-glucose:flavonol-3-O-glycoside-7-O-glucosyltransferase (UGT73C6)attaching a glucosyl residue to the 7-O-position of the flavonols kaempferol, quercetin and their 3-O-glycoside derivatives. |
AT2G36800 | Encodes a DON-Glucosyltransferase. The UGT73C5 glucosylates both brassinolide and castasterone in the 23-O position. The enzyme is presumably involved in the homeostasis of those steroid hormones hence regulating BR activity. Transgenic plants overexpressing UGT73C5 show a typical BR-deficient phenotype. |
AT2G36810 | Specifically involved in gravity perception and/or gravity signal transduction for the shoot gravitropic response. Effects gravitropism only in inflorescence stems but normal in both hypocotyls and roots. |
AT2G36815 | mid region of cactin;(source:Araport11) |
AT2G36830 | Encodes a tonoplast intrinsic protein, which functions as water channel. It has also been shown to be able to facilitate the transport of urea and hydrogen peroxide. Highly expressed in vascular tissues of the root, stem, cauline leaves and flowers but not in the apical meristems. The mRNA is cell-to-cell mobile. |
AT2G36870 | Encodes a xyloglucan endotransglycosylase/hydrolase. Protein sequence and phylogenetic analysis indicates that this enzyme resides in Group III-A of the XTH family, with high similarity to Tropaeolum majus (nasturtium) xyloglucanase 1 (TmNXG1). By sequence similarity to XTH31 (At3g44990) and in vivo analysis, likely to exhibit predominant xyloglucan endo-hydrolase activity (EC 3.2.1.151) with only limited potential to act as a xyloglucan endo-transglycosylase (EC 2.4.1.207). |
AT2G36900 | member of Membrin Gene Family |
AT2G36950 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT2G36980 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G36985 | Encodes ROTUNDIFOLIA4, a member of the seed plant-specific family of small peptides, RTFL (ROT FOUR LIKE), characterised by the presence of a 29-amino acid domain: RTF. Expressed in shoot apices, young leaves and flowers. Involved in controlling polarity-dependent cell proliferation. |
AT2G37010 | member of NAP subfamily |
AT2G37025 | TRF-like 8;(source:Araport11) |
AT2G37030 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT2G37040 | Encodes PAL1, a phenylalanine ammonia-lyase. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
AT2G37070 | Encodes a microtubule-associated protein track growing microtubule plus ends. |
AT2G37080 | Encodes RIP2 (ROP interactive partner 2), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants). |
AT2G37110 | PLAC8 family protein;(source:Araport11) |
AT2G37120 | S1FA-like DNA-binding protein;(source:Araport11) |
AT2G37150 | RING/U-box superfamily protein;(source:Araport11) |
AT2G37210 | Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At5g11950. |
AT2G37220 | Encodes a chloroplast RNA binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
AT2G37260 | Encodes a protein similar to WRKY transcription factors that is expressed in the seed integument and endosperm. Mutants are defective in proanthocyanidin synthesis and seed mucilate deposition. Seeds are yellow colored. Seed size is also affected; seeds are reduced in size but only when the mutant allele is transmitted through the female parent.Loss of function alleles are associated with a reduction in interploidy lethality. |
AT2G37280 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
AT2G37290 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT2G37300 | transmembrane protein;(source:Araport11) |
AT2G37330 | Encodes an ABC transporter-like protein, without an ATPase domain, required for aluminum (Al) resistance/tolerance and may function to redistribute accumulated Al away from sensitive tissues in order to protect the growing root from the toxic effects of Al. |
AT2G37340 | encodes an RS-containing Zinc knuckle protein with molecular mass of 33kDa that is localized to nuclear specks. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
AT2G37360 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
AT2G37370 | centrosomal protein of 135 kDa-like protein;(source:Araport11) |
AT2G37390 | Chloroplast-targeted copper chaperone protein;(source:Araport11) |
AT2G37430 | Encodes a member of the zinc finger family of transcriptional regulators. It is expressed in many root tips, primary roots, cotyledons and hypocotyl. The protein is localized to the nucleus. Overexpression of ZAT11 causes increased root growth and increased sensitivity to nickel ions. The mRNA is cell-to-cell mobile. |
AT2G37435 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT2G37440 | DNAse I-like superfamily protein;(source:Araport11) |
AT2G37450 | nodulin MtN21-like transporter family protein |
AT2G37460 | nodulin MtN21-like transporter family protein |
AT2G37470 | Histone superfamily protein;(source:Araport11) |
AT2G37520 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
AT2G37540 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G37590 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
AT2G37640 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
AT2G37650 | GRAS family transcription factor;(source:Araport11) |
AT2G37660 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G37720 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT2G37790 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT2G37800 | cysteine/histidine-rich C1 domain protein;(source:Araport11) |
AT2G37840 | Protein kinase superfamily protein;(source:Araport11) |
AT2G37890 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT2G37910 | cation/hydrogen exchanger, putative (CHX21);(source:Araport11) |
AT2G37940 | Inositol phosphorylceramide synthase 2;(source:Araport11) |
AT2G37950 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT2G37960 | myosin-M heavy protein;(source:Araport11) |
AT2G37970 | Encodes a cytosolic heme binding protein(cHBP)that can reversibly bind tetrapyrroles including heme, protoporphyrin IX and Mg-protoporphyrin IX dimethyl ester with distinct binding affinities. |
AT2G38010 | Neutral/alkaline non-lysosomal ceramidase;(source:Araport11) |
AT2G38080 | LAC4 appears to have laccase activity based on enzyme assays performed using lac4 mutants. These mutants also have reduced levels of lignin. LAC4 is expressed in vascular bundles and fibers and likely contributes to lignin biosynthesis, and hence cell wall biosynthesis, there. lac4/irx12 mutants have a mild irregular xylem phenotype. |
AT2G38090 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
AT2G38100 | Encodes a nitrate transporter that is involved in nitrogen accumulation in embryos. |
AT2G38110 | bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly. |
AT2G38120 | Encodes an auxin influx transporter. AUX1 resides at the apical plasma membrane of protophloem cells and at highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning. Shoot supplied ammonium targets AUX1 and inhibits lateral root emergence. The mRNA is cell-to-cell mobile. |
AT2G38140 | plastid-specific ribosomal protein 4 (PSRP4) mRNA, complete The mRNA is cell-to-cell mobile. |
AT2G38150 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
AT2G38170 | Encodes a high affinity vacuolar calcium antiporter. The residue His 338 is critical to Ca2+ transport activity. Disruption of CAX1 reduces manganese and zinc of shoot tissue and results in a decrease in the activity of vacuolar V-type proton ATPase. |
AT2G38250 | Homeodomain-like superfamily protein;(source:Araport11) |
AT2G38255 | hypothetical protein (DUF239);(source:Araport11) |
AT2G38260 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT2G38270 | Encodes protein homologous to CXIP1. CXIP1 is a PICOT domain containing protein interacts with CAX1, a high capacity calcium transporter. However, CXP2 does not interact with CAX1 and only moderately activates another calcium transporter CAX4. |
AT2G38320 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).TBL34 are required only for xylan 3-O-monoacetylation and 2,3-di-O-acetylation. This biochemical phenotype can be observed in tbl34 esk1, double mutant and tbl34 tbl35 esk1 triple mutants. |
AT2G38325 | Encodes a microRNA that targets the TAS3 family of tasiRNA-generating transcripts. Cleavage of TAS3 transcripts by miR390 initiates processing of these transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AAGCUCAGGAGGGAUAGCGCC |
AT2G38340 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
AT2G38365 | endonuclease/glycosyl hydrolase;(source:Araport11) |
AT2G38370 | weak chloroplast movement under blue light protein (DUF827);(source:Araport11) |
AT2G38400 | alanine:glyoxylate aminotransferase 2 homolog (AGT3) mRNA, |
AT2G38410 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT2G38450 | Sel1 repeat protein;(source:Araport11) |
AT2G38465 | hypothetical protein;(source:Araport11) |
AT2G38490 | member of AtCIPKs |
AT2G38500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT2G38530 | Involved in lipid transfer between membranes and plays a role in maintaining the integrity of the cuticle-cell wall interface. Belongs to a family of Lipid transfer proteins. Sequence similarity to other plant/Arabidopsis LPT genes but highest similarity to LPT1. Stress and pathogen-inducible motifs found in the upstream region. Expressed in flower, leaves and siliques but absent in roots. Predicted to be a member of PR-14 pathogenesis-related protein family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
AT2G38570 | hypothetical protein;(source:Araport11) |
AT2G38580 | Mitochondrial ATP synthase D chain-related protein;(source:Araport11) |
AT2G38590 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G38630 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G38646 | hypothetical protein;(source:Araport11) |
AT2G38670 | Encodes a mitochondrial ethanolamine-phosphate cytidylyltransferase, involved in phosphatidylethanolamine (PE) biosynthesis. |
AT2G38680 | 5-nucleotidase / magnesium ion binding protein;(source:Araport11) |
AT2G38720 | microtubule-associated protein 65-5;(source:Araport11) |
AT2G38750 | Annexins are a family of calcium dependent membrane binding proteins though to be involved in Golgi mediated secretion. This is one of four annexins identified in Arabidopsis. |
AT2G38760 | Annexins are calcium binding proteins that are localized in the cytoplasm. When cytosolic Ca2+ increases, they relocate to the plasma membrane. The mRNA is cell-to-cell mobile. |
AT2G38790 | hypothetical protein;(source:Araport11) |
AT2G38800 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
AT2G38820 | DNA-directed RNA polymerase subunit beta-beta protein, putative (DUF506);(source:Araport11) |
AT2G38840 | Guanylate-binding family protein;(source:Araport11) |
AT2G38860 | Encodes protease I (pfpI)-like protein YLS5. |
AT2G38900 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860. |
AT2G38905 | Low temperature and salt responsive protein family;(source:Araport11) |
AT2G38910 | member of Calcium Dependent Protein Kinase |
AT2G38920 | SPX (SYG1/Pho81/XPR1) domain-containing protein / zinc finger (C3HC4-type RING finger) protein-like protein;(source:Araport11) |
AT2G38940 | Encodes Pht1;4, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
AT2G38950 | Transcription factor jumonji (jmj) family protein / zinc finger (C5HC2 type) family protein;(source:Araport11) |
AT2G39000 | Encodes a chloroplast localized n-acetyltransfefase involved in N-terminal protein amino acid acetylation. |
AT2G39010 | plasma membrane intrinsic protein 2E;(source:Araport11) |
AT2G39040 | Peroxidase superfamily protein;(source:Araport11) |
AT2G39050 | Encodes a nucleocytoplasmic lectin that is capable of binding carbohydrates. It is involved in ABA mediated stomatal movement and increased expression is correlated with increased resistance to Pseudomonas syringae. |
AT2G39110 | Protein kinase superfamily protein;(source:Araport11) |
AT2G39130 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT2G39180 | CRINKLY4 related 2;(source:Araport11) |
AT2G39190 | member of ATH subfamily |
AT2G39250 | Encodes a AP2 domain transcription factor that can repress flowering. SNZ and its paralogous gene, SCHLAFMUTZE (SMZ), share a signature with partial complementarity to the miR172 microRNA, whose precursor is induced upon flowering. |
AT2G39300 | CAP-gly domain linker;(source:Araport11) |
AT2G39350 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
AT2G39360 | Protein kinase superfamily protein;(source:Araport11) |
AT2G39370 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
AT2G39435 | Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11) |
AT2G39470 | PsbP-like protein 2;(source:Araport11) |
AT2G39490 | F-box family protein;(source:Araport11) |
AT2G39510 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
AT2G39570 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. |
AT2G39650 | cruciferin (DUF506);(source:Araport11) |
AT2G39675 | Trans-acting siRNA1c primary transcript (TAS1c). Gb: AY922999 |
AT2G39690 | ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547);(source:Araport11) |
AT2G39705 | ROTUNDIFOLIA like 8;(source:Araport11) |
AT2G39725 | LYR family of Fe/S cluster biogenesis protein;(source:Araport11) |
AT2G39740 | Encodes HESO1 (HEN1 suppressor 1), a terminal nucleotidyl transferase that uridylates miRNAs and siRNAs at 3′ end. HESO1-mediated 3′ uridylation destabilizes small RNAs in hen1. |
AT2G39760 | Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). |
AT2G39780 | Encodes the main endoribonuclease activity in plant cells and localizes to the endoplasmic reticulum (ER), ER-derived structures, and vacuoles. It is essential for normal ribosomal RNA recycling. The mRNA is cell-to-cell mobile. |
AT2G39782 | hypothetical protein;(source:Araport11) |
AT2G39800 | encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. P5CS1 appears to be involved in salt stress responses related to proline accumulation, including protection from reactive oxidative species. P5CS1 appears to be present in different cells and/or different subcellular locations from P5CS2 in a tissue-dependent manner. |
AT2G39805 | Integral membrane Yip1 family protein;(source:Araport11) |
AT2G39820 | Translation initiation factor IF6;(source:Araport11) |
AT2G39830 | Essential for early phloem development and function, and for root system development.DAR2 is a member of a small (7 member) ubiquitin binding protein family. It appears to play a role in regulation of endoreduplication in leaf epidermal tissue. |
AT2G39850 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
AT2G39855 | plant/protein;(source:Araport11) |
AT2G39865 | transmembrane protein;(source:Araport11) |
AT2G39870 | hypothetical protein;(source:Araport11) |
AT2G39880 | Encodes a putative transcription factor (MYB25). |
AT2G39890 | Encodes a proline transporter with affinity for gly betaine, proline and GABA. Protein is expressed in the vascular tissue, specifically the phloem. |
AT2G39920 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
AT2G39930 | Encodes an isoamylase-type debranching enzyme. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. Mutants have reduced starch content and abnormally structured amylopectins and phytoglycogens. It has been postulated that AtISA1 interacts with AtISA2 to form the Iso1 complex. |
AT2G39960 | Microsomal signal peptidase 25 kDa subunit (SPC25);(source:Araport11) |
AT2G39980 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT2G39990 | translation initiation factor eIF2 p47 subunit homolog |
AT2G40004 | transmembrane protein;(source:Araport11) |
AT2G40060 | Encodes a clathrin that is localized to the cortical division zone and the cell plate and colocalizes with TPLATE during cell plate anchoring. The mRNA is cell-to-cell mobile. |
AT2G40070 | Encodes a microtubule-associated protein involved in cortical microtubule organization during leaf development. |
AT2G40085 | hypothetical protein;(source:Araport11) |
AT2G40090 | member of ATH subfamily |
AT2G40095 | Alpha/beta hydrolase related protein;(source:Araport11) |
AT2G40116 | Phosphoinositide-specific phospholipase C family protein;(source:Araport11) |
AT2G40120 | Protein kinase superfamily protein;(source:Araport11) |
AT2G40130 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. |
AT2G40140 | zinc finger (CCCH-type) family protein;(source:Araport11) |
AT2G40170 | Encodes a group 1 LEA gene that is activated by direct binding of ABI5 to its promoter and is involved in response to ABA. Is required for normal seed development. Involved in regulating the timing of desiccation tolerance and rate of water loss during seed maturation. |
AT2G40180 | Encodes PP2C5, a member of the PP2C family phosphatases. PP2C5 acts as a MAPK phosphatase that positively regulates seed germination, stomatal closure and ABA-inducible gene expression. |
AT2G40200 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT2G40230 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT2G40250 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
AT2G40270 | Protein kinase family protein;(source:Araport11) |
AT2G40320 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). Chemical evidence for function comes from xylan NMR analysis. Secondary wall thickening phenotype can be only observed in double or triple mutant with esk1. |
AT2G40330 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
AT2G40350 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
AT2G40360 | Encodes BOP1, an ortholog of Block of cell proliferation (BOP) protein. A T-DNA null allele of the BOP1 gene is lethal, and a 50% decrease in transcript accumulation is sufficient to cause severe developmental defects linked to defective cell division. |
AT2G40390 | neuronal PAS domain protein;(source:Araport11) |
AT2G40400 | Encodes a chloroplast localized protein of unknown function that is involved in regulation of chloroplast development. |
AT2G40450 | BTB/POZ domain-containing protein;(source:Araport11) |
AT2G40470 | LOB-domain containing protein. Involved in regulation of xylem differentiation- acts as a regulator of VND7 which is a master regulator of xylem cell differentiation. |
AT2G40560 | Protein kinase superfamily protein;(source:Araport11) |
AT2G40620 | Basic leucine zipper transcription factor. Localizes from cytoplasm to the nucleus under heat stress. |
AT2G40630 | Uncharacterized conserved protein (UCP030365);(source:Araport11) |
AT2G40670 | response regulator 16 |
AT2G40711 | hypothetical protein;(source:Araport11) |
AT2G40730 | kinase family with ARM repeat domain-containing protein;(source:Araport11) |
AT2G40765 | transmembrane protein;(source:Araport11) |
AT2G40810 | yeast autophagy-like protein;(source:Araport11) |
AT2G40815 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT2G40820 | stomatal closure actin-binding-like protein;(source:Araport11) |
AT2G40850 | phosphoinositide 4-kinase gamma 1;(source:Araport11) |
AT2G40880 | Encodes a protein with cysteine proteinase inhibitor activity. Overexpression increases tolerance to abiotic stressors (i.e.salt,osmotic, cold stress). The mRNA is cell-to-cell mobile. |
AT2G40890 | encodes coumarate 3-hydroxylase (C3H), a P450-dependent monooxygenase. Involved in lignin biosynthesis and flavonoid biosynthesis. Also affects the biosynthesis of coumarins such as scopoletin and scopolin as a branching-out-pathway from the phenylpropanoid acid level. |
AT2G40910 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G40925 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G40970 | Homeodomain-like superfamily protein;(source:Araport11) |
AT2G40990 | DHHC-type zinc finger family protein;(source:Araport11) |
AT2G41150 | plant/protein;(source:Araport11) |
AT2G41170 | F-box family protein;(source:Araport11) |
AT2G41220 | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression is most abundant in root. The mRNA is cell-to-cell mobile. |
AT2G41240 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT2G41250 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT2G41260 | Late-embryogenesis-abundant gene. Involved in the acquisition of desiccation tolerance during late phase of embryogenesis. |
AT2G41290 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
AT2G41300 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
AT2G41330 | Glutaredoxin family protein;(source:Araport11) |
AT2G41360 | galactose oxidase/kelch repeat protein;(source:Araport11) |
AT2G41390 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT2G41415 | Encodes a Maternally expressed gene (MEG) family protein |
AT2G41445 | agamous-like MADS-box protein;(source:Araport11) |
AT2G41451 | glycosyltransferase-like protein;(source:Araport11) |
AT2G41473 | F-box family protein;(source:Araport11) |
AT2G41475 | Embryo-specific protein 3, (ATS3);(source:Araport11) |
AT2G41480 | Encodes a cationic cell-wall-bound peroxidase homolog that is involved in the lignification of cell walls. Regulated by COG1, involved in seed longevity. |
AT2G41510 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins.Acts on zeatin 9-riboside-50-triphosphate substrate. |
AT2G41560 | Encodes a calmodulin-regulated Ca(2+)-ATPase that improves salt tolerance in yeast. Localized to the vacuole. Lesion mimic phenotype when mutation in the gene is combined with a mutation in ACA11. Lesion mimic phenotype of double knockout can be suppressed by nutritional supplements that increase anion levels (e.g. 15 mM Nitrate, Chloride, or Phosphate). |
AT2G41600 | Mitochondrial glycoprotein family protein;(source:Araport11) |
AT2G41610 | Transmembrane protein from a plant specific gene family. Overexpression causes abnormal cell wall composition and defects in cell growth. |
AT2G41630 | Encodes a transcription factor, TFIIB1, that plays important roles in pollen tube growth, guidance, and reception as well as endosperm development and is partially functionally different from AtTFIIB2 and AtTFIIB3/AtpBRP2. |
AT2G41640 | Glycosyltransferase family 61 protein;(source:Araport11) |
AT2G41680 | Encodes a NADPH thioredoxin reductase involved in chloroplast protection against oxidative damage. |
AT2G41705 | Encodes a fluoride export protein. |
AT2G41740 | Encodes a protein with high homology to animal villin. |
AT2G41745 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, blastp match of 28%25 identity and 4.7e-24 P-value to GP|20279456|gb|AAM18736.1|AC092548_14|AC092548 putative reverse transcriptase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT2G41750 | Involved in posttranscriptional modification of tRNA. Can form acp3U20b on a tRNA expressed in yeast cells. The aspartate and tryptophan residues in the DXTW motif of this protein are required for modification activity. Required for the acp3U20a modification of cytosolic tRNA. |
AT2G41780 | hypothetical protein;(source:Araport11) |
AT2G41790 | Insulinase (Peptidase family M16) family protein;(source:Araport11) |
AT2G41830 | Uncharacterized protein;(source:Araport11) |
AT2G41860 | member of Calcium Dependent Protein Kinase |
AT2G41880 | Guanylate kinase. Involved in nucleotide metabolism. |
AT2G41890 | curculin-like (mannose-binding) lectin family protein / PAN domain-containing protein;(source:Araport11) |
AT2G41900 | AtOXS2 specifcally entered the nuclear under salt stress. Te specifc nuclear localization of AtOXS2 could play a role in salt tolerance at the molecular level. Tese results implied that AtOXS2 might target some downstream cis-elements which are required for salt stress responses |
AT2G41910 | Protein kinase superfamily protein;(source:Araport11) |
AT2G41945 | Encodes a novel protein found only in plants. RED1 has two isoforms RED1.1 and RED1.2. It is localized to the nucleus. Loss of function mutants are embryo lethal but can be rescued before desiccation by embryo culture. |
AT2G41970 | Encodes MRI, a plasma membrane-localized member of the RLCK-VIII subfamily. Preferentially expressed in both pollen tubes and root hairs. mri-knockout mutants display spontaneous pollen tube and root-hair bursting. |
AT2G42000 | AtMT4a is a member of Type 4 metallothionein (MT) genes. It is involved in the early develoment of the embryo and in the accumulation of metal ions especially Zn in the seeds. |
AT2G42190 | rho GTPase-activating gacO-like protein;(source:Araport11) |
AT2G42200 | Encodes a putative transcriptional regulator that is involved in the vegetative to reproductive phase transition. Expression is regulated by MIR156b. SPL activity nonautonomously inhibits initiation of new leaves at the shoot apical meristem. |
AT2G42280 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT2G42300 | Together with bHLH60 associates with phytochrome interacting factor 7 to regulate hypocotyl elongation. |
AT2G42320 | nucleolar protein gar2-like protein;(source:Araport11) |
AT2G42400 | VOZ transcription factor which acts as positive regulator of several salt-responsive genes. Functionally redundant in salt stress with VOZ1. |
AT2G42450 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G42460 | MATH domain/coiled-coil protein;(source:Araport11) |
AT2G42470 | TRAF-like family protein;(source:Araport11) |
AT2G42480 | MATH domain/coiled-coil protein;(source:Araport11) |
AT2G42550 | Protein kinase superfamily protein;(source:Araport11) |
AT2G42560 | Late embryogenesis protein. Based on in vitro studies, likely plays a role in stablizing membranes in response to freezing stress. |
AT2G42610 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
AT2G42620 | The mutations at MAX2 cause increased hypocotyl and petiole elongation in light-grown seedlings. Positional cloning identifies MAX2 as a member of the F-box leucine-rich repeat family of proteins. MAX2 is identical to ORE9, a proposed regulator of leaf senescence. Involved in positive regulation of light responses. The mRNA is cell-to-cell mobile. |
AT2G42650 | Ribosomal protein L1p/L10e family;(source:Araport11) |
AT2G42720 | FBD, F-box, Skp2-like and Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT2G42730 | F-box/FBD/LRR protein;(source:Araport11) |
AT2G42750 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT2G42835 | Natural antisense transcript overlaps with AT2G42830;(source:Araport11) |
AT2G42850 | cytochrome P450, family 718;(source:Araport11) |
AT2G42870 | Encodes PHYTOCHROME RAPIDLY REGULATED1 (PAR1), an atypical basic helix-loop-helix (bHLP) protein. Closely related to PAR2 (At3g58850). Up regulated after simulated shade perception. Acts in the nucleus to control plant development and as a negative regulator of shade avoidance response. Functions as transcriptional repressor of auxin-responsive genes SAUR15 (AT4G38850) and SAUR68 (AT1G29510). |
AT2G42880 | member of MAP Kinase |
AT2G42890 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML2 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. AML2 is expressed during early embryo development (heart and torpedo stage) and predominantly in vegetative organs; no significant accumulation was detected in floral apices. |
AT2G42900 | Plant basic secretory protein (BSP) family protein;(source:Araport11) |
AT2G42920 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT2G42930 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT2G42950 | Magnesium transporter CorA-like family protein;(source:Araport11) |
AT2G42960 | Protein kinase superfamily protein;(source:Araport11) |
AT2G42990 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT2G43000 | Encodes a NAC transcription factor induced by hydrogen peroxide (H2O2). Involved in senescence. Over expression of the gene strongly delays senescence and enhances tolerance to various abiotic stresses. |
AT2G43010 | Isolated as a semidominant mutation defective in red -light responses. Encodes a nuclear localized bHLH protein that interacts with active PhyB protein. Negatively regulates phyB mediated red light responses. Involved in shade avoidance response. Protein abundance is negatively regulated by PhyB.Involved in the regulation of response to nutrient levels. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
AT2G43050 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT2G43060 | ILI1 binding bHLH 1;(source:Araport11) |
AT2G43120 | Encodes a member of the functionally diverse cupin protein superfamily that is involved in susceptibility to the bacterial plant pathogen Ralstonia solanacearum. It stabilizes the papain-like cysteine protease XCP2. The mRNA is cell-to-cell mobile. |
AT2G43130 | encodes a protein belonging to the Rab/Ypt family of small GTPases, which are implicated in intracellular vesicular traffic. |
AT2G43140 | bHLH129 is a nuclear localized basic helix loop helix protein. It has been shown to function as a transcriptional repressor. Overexpression of bHLH129 regulates root elongation and ABA response. |
AT2G43150 | Proline-rich extensin-like family protein;(source:Araport11) |
AT2G43160 | Involved in plant trans-Golgi network (TGN) transport. |
AT2G43180 | Phosphoenolpyruvate carboxylase family protein;(source:Araport11) |
AT2G43230 | Member of cytosolic ABA receptor kinases; interacts with ABA receptors RCAR11-14. Positively regulates germination, seedling architecture and root growth in response to ABA. |
AT2G43240 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT2G43255 | O-acyltransferase WSD1-like protein;(source:Araport11) |
AT2G43261 | transmembrane protein;(source:Araport11) |
AT2G43290 | Calmodulin-like MSS3.Encodes an endomembrane localized member of the CML subfamily VII. Contains a canonical CaM domain and unique N-terminal extension that distinguishes it from other members of the subfamily. |
AT2G43340 | hypothetical protein (DUF1685);(source:Araport11) |
AT2G43390 | hypothetical protein;(source:Araport11) |
AT2G43450 | hypothetical protein;(source:Araport11) |
AT2G43470 | zinc finger CCCH domain protein, putative (DUF3755);(source:Araport11) |
AT2G43590 | Chitinase family protein;(source:Araport11) |
AT2G43610 | Chitinase family protein;(source:Araport11) |
AT2G43680 | Member of IQ67 (CaM binding) domain containing family. |
AT2G43700 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT2G43710 | Encodes a stearoyl-ACP desaturase, involved in fatty acid desaturation. The ssi2 mutants have increased 18:0 and reduced 18:1 fatty acids. Exogenous application of glycerol to wild type plants mimics the ssi2 mutant phenotype. The altered 18:1 fatty acid content in the ssi2 mutants has an impact on SA- and JA-mediated defense signaling. ssi2 mutants resulted in hyper-resistance to green peach aphid and antibiosis activity in petiole exudates. Redundant Δ9 stearoyl-ACP desaturase gene which together with AAD1 and AAD5 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with AAD1, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase. |
AT2G43730 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT2G43745 | jacalin lectin-like protein;(source:Araport11) |
AT2G43820 | Encodes a nicotinate-O-glycosyltransferase. Induced by Salicylic acid, virus, fungus and bacteria. Also involved in the tryptophan synthesis pathway. Independent of NPR1 for their induction by salicylic acid. UGT74F1 transfers UDP:glucose to salicylic acid (forming a glucoside (SAG) and a glucose ester (SGE)), benzoic acid, and anthranilate in vitro. UGT74F2 shows a weak ability to catalyze the formation of the p-aminobenzoate-glucose ester in vitro. But, UGT75B1 appears to be the dominant pABA acylglucosyltransferase in vivo based on assays in leaves, flowers, and siliques. |
AT2G43840 | UGT74F1 transfers UDP:glucose to salicylic acid (forming a glucoside), benzoic acid, quercetin, and athranilate in vitro. UGT74F1 shows a weak ability to catalyze the formation of the p-aminobenzoate-glucose ester in vitro. But, UGT75B1 appears to be the dominant pABA acylglucosyltransferase in vivo based on assays in leaves, flowers, and siliques. The true biological substrate(s) of UGT74F1 are not known, but mutant plants lacking UGT74F1 have a decreased level of salicylate glucoside. |
AT2G43860 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G43865 | hypothetical protein;(source:Araport11) |
AT2G43880 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G43890 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G43900 | Encodes a 5-inositol-phosphate phosphatase, that, in vitro, shows activity against IP(1,4,5). |
AT2G43910 | HARMLESS TO OZONE LAYER 1;(source:Araport11) |
AT2G43930 | Protein kinase superfamily protein;(source:Araport11) |
AT2G43932 | Pseudogene of AT2G43940; thiol methyltransferase, putative |
AT2G43940 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT2G43950 | Constitutes a peptide sensitive ion channel in chloroplast outer membranes. Accumulates in germinating seeds and developing embryos. |
AT2G43960 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
AT2G44000 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT2G44010 | hypothetical protein;(source:Araport11) |
AT2G44070 | NagB/RpiA/CoA transferase-like superfamily protein;(source:Araport11) |
AT2G44100 | GDP dissociation inhibitor involved in vesicular membrane traffic |
AT2G44110 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO15 belongs to the clade II, with ATMLO13 and ATMLO15. The gene is expressed during early seedling growth, in root tips and flower (papillae, anthers and pollen grains), as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT2G44120 | Ribosomal protein L30/L7 family protein;(source:Araport11) |
AT2G44130 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family. Component of SCF ubiquitin protein ligase, interacts with phenylalanine ammonia-lyase. AtKFB39 is a homolog of previously identified AtKFB50 (At3g59940) and specifically interacts with Arabidopsis PAL3 and PAL4 in vitro. In planta, together with AtKFB01, KFB20 and KFB50, it regulates PAL protein stability thus controlling phenylpropanoid biosynthesis . |
AT2G44140 | Autophagy protein |
AT2G44150 | Encodes a protein-lysine N-methyltransferase. Located in ER. |
AT2G44175 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT2G44195 | pre-mRNA splicing factor domain-containing protein;(source:Araport11) |
AT2G44200 | pre-mRNA splicing factor domain-containing protein;(source:Araport11) |
AT2G44220 | NEP-interacting protein (DUF239);(source:Araport11) |
AT2G44230 | hypothetical protein (DUF946);(source:Araport11) |
AT2G44255 | Natural antisense transcript overlaps with AT2G44260;(source:Araport11) |
AT2G44320 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
AT2G44340 | VQ18 is an ABA responsive gene and interacts with the ABI5 transcription factor. Along with its paralog VQ26, it is involved in negative regulation of ABA responses during early seedling development. |
AT2G44360 | ecotropic viral integration site protein;(source:Araport11) |
AT2G44370 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G44380 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G44390 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G44410 | RING/U-box superfamily protein;(source:Araport11) |
AT2G44430 | DNA-binding bromodomain-containing protein;(source:Araport11) |
AT2G44450 | beta glucosidase 15;(source:Araport11) |
AT2G44460 | Beta-glucosidase, major myrosinase which initiates sulfur reallocation by hydrolyzing particular GL species, conferring sulfur deficiency tolerance, especially during early development. |
AT2G44470 | beta glucosidase 29;(source:Araport11) |
AT2G44490 | Encodes a glycosyl hydrolase that localizes to peroxisomes and acts as a component of an inducible preinvasion resistance mechanism. Required for mlo resistance. The mRNA is cell-to-cell mobile. |
AT2G44500 | O-fucosyltransferase family protein;(source:Araport11) |
AT2G44530 | Phosphoribosyltransferase family protein;(source:Araport11) |
AT2G44560 | glycosyl hydrolase 9B11;(source:Araport11) |
AT2G44570 | glycosyl hydrolase 9B12;(source:Araport11) |
AT2G44580 | zinc ion binding protein;(source:Araport11) |
AT2G44590 | DYNAMIN-like 1D;(source:Araport11) |
AT2G44670 | senescence-associated family protein (DUF581);(source:Araport11) |
AT2G44680 | Encodes casein kinase II beta chain, a CK2 regulatory subunit. Nuclear-localized CKB4 protein exists in vivo as different isoforms, resulting from phosphorylation on serine residues. The phosphorylated isoforms are the preferred substrate for ubiquitination and degradation by the proteasome pathway. Involved in regulation of circadian clock. |
AT2G44700 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT2G44730 | Alcohol dehydrogenase transcription factor Myb/SANT-like family protein;(source:Araport11) |
AT2G44735 | transmembrane protein;(source:Araport11) |
AT2G44740 | cyclin p4;(source:Araport11) |
AT2G44750 | Encodes a thiamine pyrophosphokinase capable of producing thiamine pyrophosphate from free thiamine. |
AT2G44760 | dihydroorotate dehydrogenase (DUF3598);(source:Araport11) |
AT2G44770 | ELMO/CED-12 family protein;(source:Araport11) |
AT2G44780 | Encodes a Uclacyanin/Basic blue family protein [pseudogene] |
AT2G44790 | Encodes a uclacyanin, a protein precursor that is closely related to precursors of stellacyanins and a blue copper protein from pea pods. |
AT2G44830 | AGCVIII kinase involved in the pulse-induced first positive phototropism. Plasma-membrane-associated element of a molecular rheostat that modulates auxin flux through developing protophloem sieve elements (PPSEs) while interacting with BRX, thereby timing PPSE differentiation. Activates PIN-mediated auxin efflux. |
AT2G44840 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. The mRNA is cell-to-cell mobile. |
AT2G44890 | member of CYP704A |
AT2G44900 | ARABIDILLO-1 and its homolog, ARABIDILLO -2, are unique among Arabidopsis Arm-repeat proteins in having an F-box motif and fall into a phylogenetically distinct subgroup from other plant Arm-repeat proteins Similar to arm repeat protein in rice and armadillo/beta-catenin repeat family protein / F-box family protein in Dictyostelium. ARABIDILLO-1 promote lateral root development. Mutant plants form fewer lateral roots, while ARABIDILLO-1-overexpressing lines produce more lateral roots than wild-type seedlings. |
AT2G44910 | Encodes a homeodomain protein whose expression displays a dependence on phyB for both red and far-red light response. Also involved in the shade avoidance syndrome. |
AT2G44930 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT2G44940 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
AT2G44970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G44990 | More Axillary Branching; carotenoid cleavage dioxygenases. |
AT2G45040 | Matrixin family protein;(source:Araport11) |
AT2G45050 | Encodes a member of the GATA factor family of zinc finger transcription factors. A positive regulator of photomorphogenesis. |
AT2G45080 | cyclin p3;(source:Araport11) |
AT2G45120 | C2H2-like zinc finger protein;(source:Araport11) |
AT2G45150 | cytidinediphosphate diacylglycerol synthase 4;(source:Araport11) |
AT2G45160 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
AT2G45220 | Pectin methylesterase involved in pectin remodelling. Regulated by its PRO region that triggers PME activity in the resistance to Botrytis cinerea. |
AT2G45300 | encodes 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase involved in chorismate biosynthesis The mRNA is cell-to-cell mobile. |
AT2G45310 | UDP-D-glucuronate 4-epimerase |
AT2G45340 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G45406 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT2G45420 | LOB domain-containing protein 18;(source:Araport11) |
AT2G45460 | SMAD/FHA domain-containing protein;(source:Araport11) |
AT2G45480 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development. |
AT2G45490 | Encodes a member of a family of Ser/Thr kinases whose activities peak during cell division. Transcripts are abundant in tissues rich in dividing cells like roots and flowers but are low or absent in fully expanded leaves and stems. In interphase cells, the protein is predominantly nuclear. During mitosis, the protein associates with plant-specific cytoskeletal structures (preprophase band, phragmoplast, nascent cell plate) that are necessary for cytokinesis as well as with the microtubule spindle. The protein is concentrated in nuclear dots arranged around the nucleolus and the nuclear periphery in early prophase cells. |
AT2G45520 | coiled-coil protein;(source:Araport11) |
AT2G45530 | RING/U-box superfamily protein;(source:Araport11) |
AT2G45550 | Member of CYP76C family of cytochrome P450 enzymes.Has geraniol 9- or 8-hydroxylase activity. |
AT2G45560 | cytochrome P450 monooxygenase |
AT2G45570 | member of CYP76C |
AT2G45580 | cytochrome P450, family 76, subfamily C, polypeptide 3;(source:Araport11) |
AT2G45610 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G45650 | Sequence suggests this encodes a MADS-box transcription factor. Negatively regulates the FLC/MAF clade genes and positively regulates FT in Arabidopsis. |
AT2G45700 | sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
AT2G45720 | ARM repeat superfamily protein;(source:Araport11) |
AT2G45730 | eukaryotic initiation factor 3 gamma subunit family protein;(source:Araport11) |
AT2G45740 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. The mRNA is cell-to-cell mobile. |
AT2G45750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT2G45760 | encodes a protein that is similar to BONZAI1-binding protein BAP1. |
AT2G45800 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. |
AT2G45830 | downstream target of AGL15 2;(source:Araport11) |
AT2G45840 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
AT2G45850 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT2G45890 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Mutants exhibit longer root hairs under phosphate-deficient conditions. Involved in cell wall patterning. Encodes ROP activator, regulates the formation of ROP-activated domains; these in turn determine the pattern of cell wall pits. Forms a dimer that interacts with activated ROP11 in vivo, which could provide positive feedback for ROP activation. Required for periodic formation of secondary cell wall pits |
AT2G45910 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT2G45940 | hypothetical protein (DUF295);(source:Araport11) |
AT2G45980 | Encodes an Atg8-interacting protein that is partially associated with the ER during favorable growth conditions and becomes mainly associated with a spherical compartment that dynamically moves along the ER network. In stress induced plants, ATI1 is localized to a novel plastid associated bodies that are transported to vesicles, in what appears to be an autophagy dependent process. ATI1 interacts with number of other plastid proteins such as NPQ4 and APE1. |
AT2G46050 | E-PPR protein involved in mitochondrial RNA editing.It is involved in editing of the mitochondrial tatC transcript at site 581. |
AT2G46160 | RING/U-box superfamily protein;(source:Araport11) |
AT2G46170 | Reticulon family protein;(source:Araport11) |
AT2G46192 | other_RNA;(source:Araport11) |
AT2G46230 | PIN domain-like family protein;(source:Araport11) |
AT2G46250 | myosin heavy chain-like protein;(source:Araport11) |
AT2G46270 | encodes a bZIP G-box binding protein whose expression is induced by ABA. It has been shown to bind to Adh that contains the G-box and is induced by cold and water deprivation. GBF3 has been shown to be expressed mostly in the root and dark-grown leaves. GBF3 can act as homodimers and as heterodimers with GFB1, GBF2 and GBF4. In addition, GBF3!?s DNA binding activity is enhanced by GIP1, GPRI1 and GPRI2. |
AT2G46280 | Encodes a homolog of mammalian TGF-beta receptor interacting protein. Co-immunoprecipitates with BRI1 and can be phosphorylated in vitro by BRI1 at specific sites (Thr-14, Thr-89, and either Thr-197 or Ser-198). May therefore be a cytoplasmic BRI1 substrate and involved in brassinosteroid regulated plant growth and development.The encoded protein has two DWD motifs. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
AT2G46308 | transmembrane protein;(source:Araport11) |
AT2G46330 | Encodes arabinogalactan protein (AGP16). |
AT2G46370 | Encodes a jasmonate-amido synthetase that is a member of the GH3 family of proteins. JAR1 catalyzes the formation of a biologically active jasmonyl-isoleucine (JA-Ile) conjugate. JA-Ile promotes the interaction between JAZ1 and COI1 in the jasmonate signaling pathway. JAR1 localizes to the cytoplasm and is also a phytochrome A signaling component. JAR1 is an auxin-induced gene. Loss of function mutants are defective in a variety of responses to jasmonic acid. JAR1 has additional enzymatic activities in vitro, (e.g. the ability to synthesize adenosine 5'-tetraphosphate and other JA conjugates), but there are no data to show whether JAR1 catalyzes many of these reactions in vivo. JAR1 is involved in pathogen defense, sensitivity to ozone, and wound responses. |
AT2G46375 | hypothetical protein;(source:Araport11) |
AT2G46420 | helicase with zinc finger protein;(source:Araport11) |
AT2G46455 | OxaA/YidC-like membrane insertion protein;(source:Araport11) |
AT2G46480 | Encodes a protein with putative galacturonosyltransferase activity. |
AT2G46493 | RING/U-box superfamily protein;(source:Araport11) |
AT2G46494 | RING/U-box superfamily protein;(source:Araport11) |
AT2G46510 | Encodes a nuclear localized BLH domain containing transcriptional activator involved in response to ABA. Overexpression confers enhanced ABA responsiveness while loss of function mutants are ABA sensitive.bHLH17 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH13 and bHLH14 to negatively regulate jasmonate responses. |
AT2G46530 | auxin response factor 11;(source:Araport11) |
AT2G46600 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT2G46630 | serine/arginine repetitive matrix protein;(source:Araport11) |
AT2G46650 | member of Cytochromes b5 The mRNA is cell-to-cell mobile. |
AT2G46680 | encodes a putative transcription factor that contains a homeodomain closely linked to a leucine zipper motif. Transcript is detected in all tissues examined. Is transcriptionally regulated in an ABA-dependent manner and may act in a signal transduction pathway which mediates a drought response. |
AT2G46685 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. This particular miRNA is involved in the regulation of vascular development in inflorescence stems, primarily through the regulation of mRNA cleavage of the class III homeodomain-leucine zipper transcription factor ATHB15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC. Pri-mRNA coordinates for MIR166a (converted to TAIR10 based on PMID19304749): Chr2: 19175959-19177071 (forward), length: 1113 bp; exon coordinates: exon 1: 19175959 to 19176341, exon 2: 19176820 to 19177071; mature miRNA and miRNA* are located on exon 1. |
AT2G46700 | CDPK-related kinase 3;(source:Araport11) |
AT2G46710 | ROP (Rho of plant GTPases) family member Involved in cell wall patterning. Encodes ROP inactivator, regulates the formation of ROP-activated domains; these in turn determined the pattern of cell wall pits. Positively regulates pit formation, but negatively regulates pit size, required for periodic formation of secondary cell wall pits. |
AT2G46720 | Encodes KCS13, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT2G46760 | D-arabinono-1,4-lactone oxidase family protein;(source:Araport11) |
AT2G46780 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G46790 | Pseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR5 and PRR7 to regulate hypocotyl growth under photoperiodic conditions. |
AT2G46810 | MYC-type transcription factor which interacts with ICE1 and negatively regulates cold-responsive genes and cold tolerance. |
AT2G46820 | Encodes the P subunit of Photosystem I. About 25% of the TMP14 pool appeared to be phosphorylated, and this ratio is not affected by light. Contains seven phosphorylation sites on threonine residue and chloroplast targeting signal. Located in the proximity of PSI-L, -H and -O subunits. Forms oligomers with other members of CURT1 family to modulate grana structure. |
AT2G46850 | Protein kinase superfamily protein;(source:Araport11) |
AT2G46860 | Encodes a protein that might have inorganic pyrophosphatase activity. |
AT2G46880 | purple acid phosphatase 14;(source:Araport11) |
AT2G46940 | fold protein;(source:Araport11) |
AT2G46950 | cytochrome P450, family 709, subfamily B, polypeptide 2;(source:Araport11) |
AT2G46960 | member of CYP709B |
AT2G46970 | encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. |
AT2G46980 | Encodes ASY3, a coiled-coil domain protein that is required for normal meiosis. |
AT2G46995 | hypothetical protein;(source:Araport11) |
AT2G47010 | calcium/calcium/calmodulin-dependent Serine/Threonine-kinase;(source:Araport11) |
AT2G47030 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT2G47090 | zinc ion binding/nucleic acid binding protein;(source:Araport11) |
AT2G47130 | Encodes a short-chain dehydrogenase/reductase that is not involved in ABA biosynthesis but plays an important role in plant defense response to bacteria. |
AT2G47180 | GolS1 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS1 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS1 have increased tolerance to salt, chilling, and high-light stress. |
AT2G47200 | hypothetical protein;(source:Araport11) |
AT2G47260 | Encodes a member of WRKY Transcription Factor; Group I. Involved in nematode feeding site establishment and auxin mediated PIN polar localization in roots. Expression is induced by auxin. |
AT2G47310 | Functions in an antagonistic manner to its close homolog FCA. The SSF414N protein variant interacts more strongly with CUL1, a component of the E3 ubiquitination complex, than the SSF414D form, mediating differences in SSF protein degradation and FLC expression. |
AT2G47420 | Encodes a putative rRNA dimethyltransferase. |
AT2G47430 | Encodes a putative plasma membrane-bound hybrid histidine kinase and cytokinin sensor that is expressed within the female gametophyte. |
AT2G47450 | A component of the chloroplast signal recognition particle pathway that is involved in LHCP targeting. It is downregulated in response to high light. It recognizes the DPLG motif in Lhcb1. The mRNA is cell-to-cell mobile. |
AT2G47500 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
AT2G47520 | encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12. It plays a role in hypoxia-induced root slanting. |
AT2G47540 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT2G47580 | encodes spliceosomal protein U1A |
AT2G47590 | photolyase/blue light photoreceptor PHR2 (PHR2) mRNA, |
AT2G47740 | pre-tRNA tRNA-Gly (anticodon: CCC);(source:Araport11, TAIR10) |
AT2G47780 | Encodes a small rubber particle protein homolog. Plays dual roles as positive factors for tissue growth and development and in drought stress responses. |
AT2G47800 | Encodes a plasma membrane localized ATPase transporter involved in multidrug transport. The expression of this gene is upregulated by herbicide safeners such as benoxacor, fluxofenim and fenclorim. The mRNA is cell-to-cell mobile. |
AT2G47810 | nuclear factor Y, subunit B5;(source:Araport11) |
AT2G47820 | arginine-glutamic acid dipeptide repeat protein;(source:Araport11) |
AT2G47890 | Acts as a positive regulator of red light signaling; overexpression causes markedly shortened hypocotyls under various light states. Binds to the HY5 promoter to activate its transcription, while both BBX21 and HY5 associate with its promoter to positively regulate its expression. T |
AT2G47900 | Member of plant TLP family which differs in having an F box domain. Plasma membrane tethering is mediated by PIP2 binding domain. Under abiotic stress TLP3 detaches from the PM and translocates to the nucleus. Mutants are insensitive to ABA. |
AT2G47940 | Encodes DegP2 protease (DEGP2); nuclear gene for chloroplast product. |
AT2G47970 | Nuclear pore localization protein NPL4;(source:Araport11) |
AT2G48030 | DNAse I-like superfamily protein;(source:Araport11) |
AT2G48075 | hypothetical protein;(source:Araport11) |
AT2G48080 | oxidoreductase, 2OG-Fe(II) oxygenase family protein;(source:Araport11) |
AT2G48120 | The pale cress (pac) mutant affects chloroplast and leaf development; mutants are ABA-deficient and accumulate lower levels of carotenoids and chlorophyll compared to wild type. PAC binds 23srRNA and appears to be required for 50s ribosome assembly. Three alternative transcripts of this gene exist.PAC is essential for photoautotrophic growth and associates with psbK-psbI, ndhF, ndhD, and 23S ribosomal RNA in vivo(PMID:28805278) |
AT2G48150 | Encodes glutathione peroxidase. |
AT3G01015 | MDP60 is a member of the TPX2 protein family. It co-localizes with microtubules and appears to function to destabilize them during light mediated hypocotyl growth. |
AT3G01020 | Encodes a mitochondrial protein similar to E.coli IscU. In bacteria, IscU is a scaffold protein accepting sulfur and iron to build a transient Fe-S cluster,which is subsequently transferred to a target apoprotein. |
AT3G01030 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
AT3G01040 | Encodes a protein with putative galacturonosyltransferase activity. |
AT3G01050 | membrane-anchored ubiquitin-fold protein 1 precursor;(source:Araport11) |
AT3G01060 | lysine-tRNA ligase;(source:Araport11) |
AT3G01070 | early nodulin-like protein 16;(source:Araport11) |
AT3G01085 | Protein kinase superfamily protein;(source:Araport11) |
AT3G01150 | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination. |
AT3G01175 | transmembrane protein;(source:Araport11) |
AT3G01190 | Peroxidase superfamily protein;(source:Araport11) |
AT3G01290 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
AT3G01300 | Protein kinase superfamily protein;(source:Araport11) |
AT3G01311 | actin cross-linking protein, putative (DUF569);(source:Araport11) |
AT3G01319 | hypothetical protein;(source:Araport11) |
AT3G01322 | Encodes a ECA1 gametogenesis related family protein |
AT3G01324 | Encodes a ECA1 gametogenesis related family protein |
AT3G01325 | Expressed protein;(source:Araport11) |
AT3G01328 | Encodes a ECA1 gametogenesis related family protein |
AT3G01329 | Encodes a ECA1 gametogenesis related family protein |
AT3G01420 | Encodes an alpha-dioxygenase involved in protection against oxidative stress and cell death. Induced in response to Salicylic acid and oxidative stress. Independent of NPR1 in induction by salicylic acid. The mRNA is cell-to-cell mobile. |
AT3G01440 | Encodes a subunit of the NAD(P)H complex located in the chloroplast thylakoid lumen. |
AT3G01460 | Encodes a protein with a methyl-CpG-binding domain. Has sequence similarity to human MBD proteins. Involved in the modification of the FLC chromatin acetylation state to affect FLC expression. Mutants show an early flowering, and enhanced shoot branching phenotypes. |
AT3G01470 | Encodes a homeodomain leucine zipper class I (HD-Zip I) transcriptional activator involved in leaf and hypocotyl development. Its promoter is bound by PIF1 which likely regulates its expression. Its translation is regulated by a conserved upstream ORF (CPuORF33). |
AT3G01480 | Encodes a chloroplast cyclophilin functioning in the assembly and maintenance of photosystem II (PSII) supercomplexes. The mRNA is cell-to-cell mobile. |
AT3G01490 | Belongs to the Raf-like kinase subfamily of the mitogen-activated protein kinase kinase kinase (MAPKKK) family. Negatively regulates stomatal opening by negatively regulating plasma membrane H+-ATPase phosphorylation. |
AT3G01510 | Encodes a putative phosphatase, LSF1, required for normal starch turnover in leaves. |
AT3G01516 | transmembrane protein;(source:Araport11) |
AT3G01530 | Member of the R2R3 factor gene family.MYB57 interacts with JAZ proteins, and functions redundantly with MYB21 and MYB24 to regulate stamen development. Promote flavonol biosynthesis through regulation of FLS1 gene expression. |
AT3G01540 | RNA HELICASE DRH1 |
AT3G01630 | Major facilitator superfamily protein;(source:Araport11) |
AT3G01660 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G01670 | Encodes a protein localized to phloem filaments that is required for phloem filament formation. The mRNA is cell-to-cell mobile. |
AT3G01680 | Encodes a protein localized to phloem filaments that is required for phloem filament formation. The mRNA is cell-to-cell mobile. |
AT3G01705 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
AT3G01750 | Ankyrin repeat family protein;(source:Araport11) |
AT3G01790 | Ribosomal protein L13 family protein;(source:Araport11) |
AT3G01830 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT3G01840 | Encodes a putative LysM-containing receptor-like kinase. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. Based on protein sequence alignment analysis, it was determined to be a pseudo kinase since lack of the ATP-binding P-loop in the kinase domain. |
AT3G01850 | Aldolase-type TIM barrel family protein;(source:Araport11) |
AT3G01880 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
AT3G01900 | member of CYP94B |
AT3G01910 | Encodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite. |
AT3G01950 | peroxidase (DUF 3339);(source:Araport11) |
AT3G01990 | Member of a small family of ACT domain containing proteins in Arabidopsis. ACT domains are involved in amino acid binding. |
AT3G02100 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G02120 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G02125 | pinin-like protein;(source:Araport11) |
AT3G02130 | Encodes a receptor-like kinase RPK2 (also known as TOADSTOOL 2/TOAD2). Functions as a regulator of meristem maintenance. Mutants are insensitive to synthetic CLV3 peptide. Mutations in the RPK2 also result in stem cell expansion and increased number of floral organs, as seen in the other clv mutants. Forms homo-oligomers. |
AT3G02150 | a chloroplast trans-acting factor of the psbD light-responsive promoter.TCP gene involved in heterochronic control of leaf differentiation. |
AT3G02260 | Calossin-like protein required for polar auxin transport. Involved in regulating sugar response and C/N balance. |
AT3G02280 | Flavoenzyme-encoding gene. |
AT3G02300 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT3G02370 | tRNA-splicing endonuclease subunit;(source:Araport11) |
AT3G02410 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G02440 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT3G02480 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
AT3G02510 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT3G02550 | LOB domain-containing protein 41;(source:Araport11) |
AT3G02580 | Brassinosteroid biosynthetic enzyme, catalyzes delta7 sterol C-5 desaturation step. Mutant has dwarf phenotype. |
AT3G02590 | Fatty acid hydroxylase superfamily protein;(source:Araport11) |
AT3G02600 | Encodes phosphatidic acid phosphatase. Expressed during germination. |
AT3G02670 | Glycine-rich protein family;(source:Araport11) |
AT3G02690 | Nucleotide/sugar transporter family protein |
AT3G02700 | NC domain-containing protein-like protein;(source:Araport11) |
AT3G02715 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
AT3G02740 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G02800 | Encodes an atypical dual-specificity phosphatase. |
AT3G02810 | Encodes a receptor-like cytoplasmic kinase localized in the membrane of pollen tube tip regions that controls micropylar pollen tube guidance in Arabidopsis. |
AT3G02850 | Encodes SKOR, a member of Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mediates the delivery of K+ from stelar cells to the xylem in the roots towards the shoot. mRNA accumulation is modulated by abscisic acid. K+ gating activity is modulated by external and internal K+. Involved in response to low potassium. |
AT3G02875 | Hydrolyzes amino acid conjugates of the plant growth regulator indole-3-acetic acid (IAA), including IAA-Leu and IAA-Phe. Uses Mg and Co ions as cofactors. |
AT3G02940 | Encodes a putative transcription factor (MYB107). |
AT3G02970 | EXORDIUM like 6;(source:Araport11) |
AT3G03000 | Calmodulin like protein localized in the plant vacuolar compartment with a function of binding and modifying the activity of a tonoplast transporter (AtNHX1) from within the vacuole in a Ca+2- and pH-dependent manner |
AT3G03170 | hypothetical protein;(source:Araport11) |
AT3G03200 | NAC domain containing protein 45;(source:Araport11) |
AT3G03240 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G03270 | HRU1 is a hypoxia induced universal stress protein. It exists as two splice variants with AT3G03270.2 , which contains a putative dimerization domain, the predominant transcript found under anoxia. It is induced by RAP2.12. Subcellular localization is dynamic; under anoxia the localization of HRU1 shifts from cytoplasm to the plasma membrane. |
AT3G03440 | ARM repeat superfamily protein;(source:Araport11) |
AT3G03470 | P450 monooxygenase CYP89A9. Involved in NDCC accumulation during Arabidopsis leaf senescence. |
AT3G03480 | acetyl CoA:(Z)-3-hexen-1-ol acetyltransferase;(source:Araport11) |
AT3G03500 | TatD related DNase;(source:Araport11) |
AT3G03510 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT3G03570 | signal transducer, putative (DUF3550/UPF0682);(source:Araport11) |
AT3G03580 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G03610 | ELMO/CED-12 family protein;(source:Araport11) |
AT3G03640 | Encodes beta-glucosidase (GLUC). |
AT3G03650 | Exostosin family protein;(source:Araport11) |
AT3G03660 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
AT3G03740 | Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). |
AT3G03770 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G03773 | Encodes one of two isoforms of a co-chaperone of HSP90 that is required for root growth, in particular in the maintenance of the root meristem. It can be phosphorylated in vitro by human and maize CK2. |
AT3G03790 | ankyrin repeat family protein / regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT3G03800 | member of SYP13 Gene Family |
AT3G03852 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT3G03855 | Annotated as pseudogene of disease resistance protein.Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 . |
AT3G03870 | transmembrane protein;(source:Araport11) |
AT3G03880 | sterol O-acyltransferase, putative (DUF1639);(source:Araport11) |
AT3G03930 | kinase-like protein;(source:Araport11) |
AT3G03960 | TCP-1/cpn60 chaperonin family protein;(source:Araport11) |
AT3G04050 | Pyruvate kinase family protein;(source:Araport11) |
AT3G04060 | NAC046 is a member of the NAC domain containing family of transcription factors. It was identified in a screen for regulators of chlorophyll protein gene expression. Mutants in NAC046 have delayed senescence and increased CHL content suggesting a role in regulation of senescence and chlorophyll degradation. |
AT3G04070 | NAC domain containing protein 47;(source:Araport11) |
AT3G04080 | Encodes an Golgi-localized integral membrane enzyme with nucleoside diphosphate activity that when mutated in combination with ATAPY2 causes a complete inhibition of pollen germination.With respect to substrate specificity, APY1 shows the following preferences UTP>IDP>GDP. |
AT3G04110 | putative glutamate receptor (GLR1.1). Contains a functional cation - permeable pore domain. Involved in cellular cation homeostasis. |
AT3G04150 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT3G04184 | hypothetical protein;(source:Araport11) |
AT3G04200 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT3G04240 | Has O-linked N-acetyl glucosamine transferase activity. Similar to Arabidopsis SPY gene. |
AT3G04270 | two-component response regulator ARR22-like protein;(source:Araport11) |
AT3G04290 | Li-tolerant lipase 1;(source:Araport11) |
AT3G04330 | Kunitz family trypsin and protease inhibitor protein;(source:Araport11) |
AT3G04350 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
AT3G04370 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
AT3G04420 | NAC domain containing protein 48;(source:Araport11) |
AT3G04470 | Ankyrin repeat family protein;(source:Araport11) |
AT3G04545 | Encodes a defensin-like (DEFL) family protein. |
AT3G04590 | AHL proteins contain two conserved structural units, the AT-hook motif and DUF296 domain. |
AT3G04605 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
AT3G04620 | Target promoter of the male germline-specific transcription factor DUO1. |
AT3G04660 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G04670 | member of WRKY Transcription Factor; Group II-d |
AT3G04680 | Encodes a nuclear protein that functions in mRNA processing. Mutations in this gene cause embryo lethality and reduced transmission through the female gametophyte. Over-expression of a CLPS3:TAP protein changes the relative levels of two alternatively processed FCA transcripts. It also causes abnormal phyllotaxy and flower development, early flowering under long and short days, and increased levels of CUC1 and WUS expression. |
AT3G04715 | Based on qRT-PCR data, this annotated pseudogene is expressed and upregulated in response to infection with the yellow strain of Cucumber mosaic virus in C24 and Col-0. Exhibited higher levels of H3K27me3; H3K27me3 was significantly decreased (fourfold) in response to infection with CMV(Y). |
AT3G04750 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G04765 | Encodes a microRNA that targets ARF family members ARF6 and ARF8. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UAAGCUGCCAGCAUGAUCUUG |
AT3G04780 | Encodes a protein with little sequence identity with any other protein of known structure or function. Part of this protein shows a 42% sequence identity with the C-terminal domain of the 32-kD human thioredoxin-like protein. |
AT3G04830 | Protein prenylyltransferase superfamily protein;(source:Araport11) |
AT3G04900 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT3G04910 | Serine/threonine protein kinase, whose transcription is regulated by circadian rhythm. |
AT3G04960 | trichohyalin, putative (DUF3444);(source:Araport11) |
AT3G04990 | intracellular protein transporter;(source:Araport11) |
AT3G05010 | Encodes a candidate G-protein Coupled Receptor that is involved in the regulation of root growth by bacterial N-acyl-homoserine lactones (AHLs) and plays a role in mediating interactions between plants and microbes. |
AT3G05030 | Encodes a vacuolar K+/H+ exchanger essential for active K+ uptake at the tonoplast and involved in regulating stomatal closure. |
AT3G05040 | Encodes member of importin/exportin family. Involved in timing of shoot maturation. Involved in miRNA transport. Mutants flower early and have small, curled leaves and reduced abundance of certain miRNA species. |
AT3G05150 | Major facilitator superfamily protein;(source:Araport11) |
AT3G05155 | Major facilitator superfamily protein;(source:Araport11) |
AT3G05165 | Major facilitator superfamily protein;(source:Araport11) |
AT3G05170 | Phosphoglycerate mutase family protein;(source:Araport11) |
AT3G05180 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G05210 | encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10. |
AT3G05220 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT3G05260 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G05320 | Golgi localized protein with similarity to protein O-fucosyltransferases. Mutants show lower seed set/reduced fertility. Mutant pollen fails to compete with wild type due to the inability to penetrate the stigma-style boundary. |
AT3G05327 | Cyclin family protein;(source:Araport11) |
AT3G05330 | Encodes a protein with moderate sequence similarity to the maize microtubule-binding protein TANGLED1. A single base-pair deletion (-A) at position Chr3:1519176 in Columbia relative to the Landsberg erecta and Achkarren-2 ecotype (see ESTs DR378436 and CB26450) introduces a frame-shift and premature termination codon. The protein encoded from the Columbia gene is truncated by 29 amino acids relative to the Landsberg erecta and Achkarren-2 encoded proteins. Involved in the identification of the division plane during mitosis amd cytokinesis |
AT3G05340 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G05345 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT3G05350 | Metallopeptidase M24 family protein;(source:Araport11) |
AT3G05360 | receptor like protein 30;(source:Araport11) |
AT3G05370 | receptor like protein 31;(source:Araport11) |
AT3G05390 | S-adenosyl-L-methionine-dependent methyltransferase;(source:Araport11) |
AT3G05460 | sporozoite surface protein-like protein;(source:Araport11) |
AT3G05470 | Actin-binding FH2 (formin homology 2) family protein;(source:Araport11) |
AT3G05480 | Involved in the regulation of DNA damage repair and homologous recombination. |
AT3G05490 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT3G05530 | Encodes RPT5a (Regulatory Particle 5a), one of the six AAA-ATPases of the proteasome regulatory particle. Essential for gametophyte development. In Arabidopsis, the RPT5 subunit is encoded by two highly homologous genes, RPT5a and RPT5b. RPT5a and RPT5b show accession-dependent functional redundancy. In Wassilewskija (Ws) accession: mutant alleles of RPT5a displayed 50% pollen lethality, indicating that RPT5a is essential for male gametophyte development. In the Columbia (Col) accession, a rpt5a mutant allele did not display such a phenotype because the RPT5b Col allele complements the rpt5a defect in the male gametophyte, whereas the RPT5b Ws allele does not. Double rpt5a rpt5b mutants in Col background showed a complete male and female gametophyte lethal phenotype. The mRNA is cell-to-cell mobile. |
AT3G05540 | Encodes TCTP2, a homolog of Translationally Controlled Tumor Protein. Enhances in vitro plant regeneration. |
AT3G05560 | Ribosomal L22e protein family;(source:Araport11) |
AT3G05570 | dipeptide transport ATP-binding protein;(source:Araport11) |
AT3G05580 | Encodes a Type One Protein Phosphatase that acts as a nucleocytoplasmic negative regulator of tip growth. Mutants affect pollen germination, pollen tube growth, and root hair growth. It acts genetically downstream of ANX1 (AT3G04690) and ANX2 (AT5G28680) and is functionally redundant with TOPP8 (AT5G27840). |
AT3G05590 | Encodes cytoplasmic ribosomal protein L18. |
AT3G05600 | Encodes a cytosolic epoxide hydrolase capable of acting on 9,10-epoxystearic acid and on 12,13- epoxyoctadec-9-enoic acid that is involved in the synthesis of poly-hydroxylated cutin monomers. |
AT3G05620 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT3G05630 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. Regulates vesicle trafficking. Required for auxin transport and distribution and hence auxin responses. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Plays a major role in phosphatidic acid production during phosphate deprivation. Induced upon Pi starvation in both shoots and roots. Involved in hydrolyzing phosphatidylcholine and phosphatidylethanolamine to produce diacylglycerol for digalactosyldiacylglycerol synthesis and free Pi to sustain other Pi-requiring processes. Does not appear to be involved in root hair patterning. Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
AT3G05640 | EGR1 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress.EGR1 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
AT3G05660 | receptor like protein 33;(source:Araport11) |
AT3G05685 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT3G05690 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. |
AT3G05710 | Encodes a member of SYP4 Gene Family that is a plant ortholog of the Tlg2/syntaxin16 Qa-SNARE. Together with SYP42, it regulates the secretory and vacuolar transport pathways in the post-Golgi network and maintains the morphology of the Golgi apparatus and TGN and is required for extracellular resistance responses to a fungal pathogen. |
AT3G05741 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT3G05746 | hypothetical protein;(source:Araport11) |
AT3G05750 | Encodes a member of the TRM superfamily, that plays a role in preprophase band formation during plant cell division and controls the robustness of the orientation of that cell division. |
AT3G05770 | hypothetical protein;(source:Araport11) |
AT3G05780 | Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins. |
AT3G05810 | IGR motif protein;(source:Araport11) |
AT3G05858 | hypothetical protein;(source:Araport11) |
AT3G05880 | Induced by low temperatures, dehydration and salt stress and ABA. Encodes a small (54 amino acids), highly hydrophobic protein that bears two potential transmembrane domains. |
AT3G05900 | neurofilament protein-like protein;(source:Araport11) |
AT3G05905 | Natural antisense transcript overlaps with AT3G05900;(source:Araport11) |
AT3G05910 | Pectinacetylesterase family protein;(source:Araport11) |
AT3G05935 | hypothetical protein;(source:Araport11) |
AT3G05936 | hypothetical protein;(source:Araport11) |
AT3G05940 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
AT3G05950 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT3G05960 | Encodes a hexose sugar transporter that is expressed in pollen. STP6 may play a role in providing sugars during late pollen maturation or pollen tube germination. |
AT3G05980 | hypothetical protein;(source:Araport11) |
AT3G05990 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT3G06010 | Encodes AtCHR12, a SNF2/Brahma-type chromatin-remodeling protein. AtCHR12 mediates temporary growth arrest in Arabidopsis upon perceiving environmental stress. |
AT3G06019 | hypothetical protein;(source:Araport11) |
AT3G06020 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
AT3G06035 | Glycoprotein membrane precursor GPI-anchored;(source:Araport11) |
AT3G06070 | hypothetical protein;(source:Araport11) |
AT3G06080 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT3G06090 | homolog of prePIP1 |
AT3G06125 | Unknown gene The mRNA is cell-to-cell mobile. |
AT3G06140 | Paralog of LOG2 (At3g09770), a ubiquitin ligase that regulates amino acid export. |
AT3G06145 | RING zinc finger protein;(source:Araport11) |
AT3G06180 | Ribosomal protein L34e superfamily protein;(source:Araport11) |
AT3G06210 | ARM repeat superfamily protein;(source:Araport11) |
AT3G06230 | member of MAP Kinase Kinase |
AT3G06240 | F-box family protein;(source:Araport11) |
AT3G06280 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT3G06300 | Encodes a prolyl-4 hydroxylase that can hydroxylate poly(L-proline)and other proline rich peptides, including those with sequences corresponding to those in arabinogalactan proteins and extensins. The mRNA is cell-to-cell mobile. |
AT3G06310 | Cox19-like CHCH family protein;(source:Araport11) |
AT3G06360 | Encodes an arabinogalactan-protein (AGP27). |
AT3G06370 | member of Sodium proton exchanger family |
AT3G06390 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT3G06410 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT3G06420 | Autophagy protein. |
AT3G06460 | ELO family protein containing a characteristic histidine motif which binds to AtCb5-B, interacts with AtBI-1 |
AT3G06470 | ELO family protein containing a characteristic histidine motif which binds to AtCb5-B, interacts with AtBI-1. Together with AtCb5-B interacts with KCR1, PAS2, and CER10, which are essential for the synthesis of VLCFAs. |
AT3G06483 | Pyruvate dehydrogenase kinase (PDK) specifically phosphorylates the E1α subunit of the pyruvate dehydrogenase complex (PDC) on a Ser residue using ATP as a phosphate donor. PDK is a unique type of protein kinase having a His-kinase-like sequence but Ser-kinase activity. Site-directed mutagenesis and structural analysis indicate that PDK belongs to the GHKL superfamily. |
AT3G06500 | Encodes an alkaline/neutral invertase which localizes in mitochondria. It may be modulating hormone balance in relation to the radicle emergence. Mutants display severely reduced shoot growth and reduced oxygen consumption. Mutant root development is not affected as reported for A/N-InvA mutant (inva) plants. The mRNA is cell-to-cell mobile. |
AT3G06530 | ARM repeat superfamily protein;(source:Araport11) |
AT3G06540 | Encodes a cytoplasmic Rab escort protein that preferentially binds the GDP-bound form of Rab and stimulates geranylgeranylation of various Rab GTPases in Arabidopsis extracts in vitro. |
AT3G06560 | Encodes a poly(A) polymerase. Located in the cytoplasm. |
AT3G06590 | Encodes RITF1, a bHLH transcription factor that regulates the transcription of several genes involved in the detoxification of reactive oxygen species generated by salt stress. |
AT3G06620 | PAS domain-containing protein tyrosine kinase family protein;(source:Araport11) |
AT3G06640 | PAS domain-containing protein tyrosine kinase family protein;(source:Araport11) |
AT3G06670 | SMEK1 forms a catalytically active complex with PP4 proteins. The complex has been shown to target and dephosphorylate HYL1 which in turn promotes miRNA biogenesis. Mutants have pleiotrophic phenotypes and decreased production of miRNA. SMEK1 accumulation is responsive to ABA. |
AT3G06720 | Encodes importin alpha involved in nuclear import. Protein interacts with Agrobacterium proteins VirD2 and VirE2. Is not individually essential for Agrobacterium-mediated root transformation, but when overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
AT3G06750 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G06778 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT3G06780 | glycine-rich protein;(source:Araport11) |
AT3G06880 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G06910 | Encodes a deSUMOylating enzyme. In vitro it has both peptidase activity and isopeptidase activity: it can cleave the C-terminal residues from SUMO to activate it for attachment to a target protein and it can also act on the isopeptide bond between SUMO and another protein. In vitro assays suggest that this enzyme is active against SUMO1 and SUMO2. It has weak activity with SUMO3 and cannot act on SUMO5. The N-terminal regulatory region of this protein is required for full activity. Suppresses growth during salt stress. |
AT3G07040 | Contains an N-terminal tripartite nucleotide binding site and a C-terminal tandem array of leucine-rich repeats. Confers resistance to Pseudomonas syringae strains that carry the avirulence genes avrB and avrRpm1. |
AT3G07070 | Protein kinase superfamily protein;(source:Araport11) |
AT3G07115 | pre-tRNA tRNA-Ser (anticodon: TGA);(source:Araport11, TAIR10) |
AT3G07130 | Encodes PAP15, a purple acid phosphatase with phytase activity. Expression of PAP15 is developmentally and temporally regulated, with strong expression at the early stages of seedling growth and pollen germination. The expression is also organ/tissue-specific, with strongest expression in the vasculature, pollen grains, and roots. Recombinant PAP protein exhibits broad substrate specificity with moderate phytase activity. PAP15 likely mobilizes phosphorus reserves in plants, particularly during seed and pollen germination. |
AT3G07195 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
AT3G07215 | other_RNA;(source:Araport11) |
AT3G07230 | wound-responsive protein-like protein;(source:Araport11) |
AT3G07250 | RNA-binding (RRM-RBD-RNP motif) domain nuclear transport factor 2 family protein;(source:Araport11) |
AT3G07260 | SMAD/FHA domain-containing protein;(source:Araport11) |
AT3G07273 | hypothetical protein;(source:Araport11) |
AT3G07310 | phosphoserine aminotransferase, putative (DUF760);(source:Araport11) |
AT3G07360 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
AT3G07510 | maternal effect embryo arrest protein;(source:Araport11) |
AT3G07540 | Actin-binding FH2 (formin homology 2) family protein;(source:Araport11) |
AT3G07570 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11) |
AT3G07620 | glycosyltransferase;(source:Araport11) |
AT3G07730 | hypothetical protein;(source:Araport11) |
AT3G07750 | 3-5-exoribonuclease family protein;(source:Araport11) |
AT3G07760 | Ortholog of Peach WEEP gene containing a sterile alpha motif. In peach, WEEP is responsible for pendulous branching phenotype. However in Arabidopsis no morphological branching defect has been observed in mutant lines. |
AT3G07800 | Encodes a thymidine kinase that salvages DNA precursors. |
AT3G07810 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G07820 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G07830 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G07880 | RhoGTPase GDP dissociation inhibitor (RhoGDI) that spatially restricts the sites of growth to a single point on the trichoblast. It regulates the NADPH oxidase RHD2/AtrbohC, which is required for hair growth. |
AT3G07930 | DNA glycosylase superfamily protein;(source:Araport11) |
AT3G07990 | serine carboxypeptidase-like 27;(source:Araport11) |
AT3G08010 | Encodes a chloroplast-localized protein ATAB2. ATAB2 is involved in the biogenesis of Photosystem I and II. ATAB2 has A/U-rich RNA-binding activity and presumably functions as an activator of translation with targets at PS I and PS II. |
AT3G08030 | The mRNA of this gene is expressed in viable seeds. Its detection in a dry seed lot has potential for use as a molecular marker for germination performance as absence of expression correlates with decreased germination. Encodes DUF642 cell wall protein. |
AT3G08040 | Encodes a member of the MATE (multidrug and toxin efflux family), expressed in roots but not shoots. Mutants accumulate excess iron, manganese and zinc, and express root Fe(III) chelatase activity even under iron sufficiency conditions. FRD3 is likely to function in root xylem loading of an iron chelator or other factor necessary for efficient iron uptake out of the xylem or apoplastic space and into leaf cells. |
AT3G08490 | delta-latroinsectotoxin-Lt1a protein;(source:Araport11) |
AT3G08500 | Encodes a putative R2R3-type MYB transcription factor (MYB83). |
AT3G08510 | Phosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol. It is involved in auxin biosynthesis and signaling, modulating development of both male and female gametophytes. It also regulates MAMP-triggered immunity by modulating ROS production. |
AT3G08560 | vacuolar H+-ATPase subunit E isoform 2;(source:Araport11) |
AT3G08570 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT3G08580 | mitochondrial ADP/ATP carrier |
AT3G08590 | Encodes a 2,3-biphosphoglycerate-independent phosphoglycerate mutase that is involved in pollen development and stomatal movement. |
AT3G08670 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
AT3G08680 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G08690 | ubiquitin-conjugating enzyme 11;(source:Araport11) |
AT3G08780 | BRISC complex subunit Abro1-like protein;(source:Araport11) |
AT3G08860 | Encodes a protein that is predicted to have beta-alanine aminotransferase activity. |
AT3G08880 | Encodes a kinetochore hub-protein that is required for chromosome segregation to ensure proper cell division and the maintenance of plant architecture. |
AT3G08900 | RGP3 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It is a reversibly autoglycosylated protein. Fluorescently-tagged RGP3 is found in the cytosol and associated with Golgi-like particles when expressed in tobacco leaves. An RGP3-YFP fusion protein under the control a native promoter can be found in the endosperm of Arabidopsis embryos during the linear and bent cotyledon stages of development. |
AT3G08947 | ARM repeat superfamily protein;(source:Araport11) |
AT3G08950 | Encodes HCC1, homologue of the copper chaperone SCO1 (synthesis of cytochrome c oxidase 1) from the yeast Saccharomyces cerevisiae. SCO1 encodes a mitochondrial protein that is essential for the correct assembly of complex IV in the respiratory chain. HCC1 is localized in the mitochondrion. A chimeric yeast Sco1-Arabidopsis HCC1 protein complements yeast Sco1 activity. Embryos of hcc1 mutants became arrested at various developmental stages, mostly at the heart stage. |
AT3G09010 | Protein kinase superfamily protein;(source:Araport11) |
AT3G09020 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
AT3G09032 | josephin-like protein;(source:Araport11) |
AT3G09140 | hypothetical protein (DUF674);(source:Araport11) |
AT3G09160 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G09210 | plastid transcriptionally active 13;(source:Araport11) |
AT3G09220 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
AT3G09240 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
AT3G09260 | Encodes beta-glucosidase.The major constituent of ER bodies. One of the most abundant proteins in Arabidopsis seedlings. Exist in an soluble (inactive) and non-soluble (active) form, most probably formed in a polymerization process. Involved in the mutualistic interaction between Arabidopsis and the endophytic fungus Piriformospora indica. |
AT3G09320 | DHHC-type zinc finger family protein;(source:Araport11) |
AT3G09330 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT3G09375 | pseudogene of eukaryotic initiation factor 4A-III;(source:Araport11) |
AT3G09385 | pseudogene of Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT3G09400 | Similar to POLTERGEIST (POL) protein phosphatase 2C. No phenotype observed in plants homozygous for a null allele. Ubiquitously expressed. |
AT3G09510 | Ribonuclease H-like superfamily protein;(source:Araport11) |
AT3G09520 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT3G09530 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT3G09550 | Ankyrin repeat family protein;(source:Araport11) |
AT3G09630 | Ribosomal protein L4/L1 family;(source:Araport11) |
AT3G09670 | PWWP domain protein involved in regulation of FLC and flowering time. |
AT3G09700 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT3G09720 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G09735 | S1FA-like DNA-binding protein;(source:Araport11) |
AT3G09760 | RING/U-box superfamily protein;(source:Araport11) |
AT3G09770 | Encodes a ubiquitin E3 ligase LOG2 (LOSS OF GDU2). Required for GLUTAMINE DUMPER1(GDU1)-induced amino secretion. |
AT3G09780 | CRINKLY4 related 1;(source:Araport11) |
AT3G09810 | Encodes a catalytic subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase |
AT3G09830 | Encodes a member of subfamily VIIa of the receptor-like cytoplasmic kinases (RLCKs). It contributes to pattern-triggered immunity in response to P. syringae. |
AT3G09870 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT3G09900 | RAB GTPase homolog E1E;(source:Araport11) |
AT3G09920 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) family member. Family members are key enzymes in the process of phosphatidylinositol signaling pathway and have essential functions in growth, development, and biotic and abiotic stresses responses in plants |
AT3G09922 | Encodes a gene product whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. |
AT3G09930 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G09950 | hypothetical protein;(source:Araport11) |
AT3G09970 | Encodes a cytosolic tyrosine phosphatase. |
AT3G09980 | Encodes ACIP1, a microtubules-associated protein required for bacterial immunity. The mRNA is cell-to-cell mobile. |
AT3G10000 | Homeodomain-like superfamily protein;(source:Araport11) |
AT3G10010 | Encodes a protein with DNA glycosylase activity that is involved in maintaining methylation marks. |
AT3G10060 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT3G10210 | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein;(source:Araport11) |
AT3G10240 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G10320 | MUCI21 is a GT61 protein required for the production of highly branched xylan in seed coat mucilage. MUCI21 likely decorates xylan with xylose side chains that seem to be necessary for pectin attachment to the seed surface. |
AT3G10340 | Encodes PAL4, a putative a phenylalanine ammonia-lyase. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
AT3G10350 | One of 3 GET paralogs in Arabidopsis. GET3b is a chloroplast localized protein with no obvious role in Tail Anchored (TA) protein insertion. |
AT3G10430 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G10450 | serine carboxypeptidase-like 7;(source:Araport11) |
AT3G10460 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT3G10480 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. It binds the NAC-binding site, the Mitochondrial Dysfunction Motif. |
AT3G10490 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. |
AT3G10500 | Encodes a transcriptional activator that is associated with the plasma membrane in a dormant form and is proteolytically cleaved to create a form that can enter the nucleus. It is thought to promote ROS production by binding directly to the promoters of genes encoding ROS biosynthetic enzymes during drought-induced leaf senescence. The mRNA is cell-to-cell mobile. |
AT3G10520 | Encodes a class 2 non-symbiotic hemoglobin. Over-expression of AHb2 in seeds led to a 40% increase in the total fatty acid content of developing and mature seeds in three subsequent generations. This was mainly due to an increase in the poly-unsaturated C18:2 (omega-6) linoleic and C18:3 (omega-3) alpha-linolenic acids. |
AT3G10525 | Encodes LGO (loss of giant cells from organs) required for endoreduplication in sepal giant cell formation. Giant cells in both leaves and sepals are absent in lgo mutants. LGO is a member of a plant specific cell cycle inhibitor family SIAMESE and was originally named as SMR1(SIAMESE RELATED 1). |
AT3G10540 | master regulator of AGC kinases |
AT3G10585 | Homeodomain-like superfamily protein;(source:Araport11) |
AT3G10590 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
AT3G10650 | Encodes a nucleoporin involved in mRNA export from the nucleus. It is also involved in the regulation of nuclear morphology. |
AT3G10660 | predicted to encode calcium-dependent protein kinase and is localized to the ER. Protein is myristoylated in a cell-free extract. Changing the proposed myristoylated site, G residue in the amino terminal, to A prevented the meristoylation . The G to A mutation decreased AtCPK2 membrane association by approximately 50%. |
AT3G10670 | Plastidic SufC-like ATP-binding cassette/ATPase essential for Arabidopsis embryogenesis. Involved in the biogenesis and/or repair of oxidatively damaged Fe?S clusters. Expressed in embryos and meristems. |
AT3G10680 | SLI1 is a heat shock like protein that is found in sieve elements, sieve plates and spherical bodies peripheral to the mitochondria. Mutants show increased phloem feeding by aphids and decreased heat tolerance. |
AT3G10700 | Encodes a GHMP kinase family protein that acts as a galacturonic acid-1-phosphate kinase that catalyzes the production of galacturonic acid-1-phosphate. This is a precursor of the important cell wall building block UDP-galacturonic acid. Based on gene trap line GT8007, the gene appears to be expressed in a petal and stamen-specific manner, between flower stages 8 to 11, however, later RT-qPCR analysis demonstrates that the transcript is present throughout the plant in all tissues tested. |
AT3G10710 | root hair specific 12;(source:Araport11) |
AT3G10730 | Encodes a member of the Sad1/UNC-84 (SUN)-domain proteins: AtSUN1(At5g04990), AtSUN2(AT3G10730). SUN domain proteins are part of the cytoskeletal-nucleoskeletal bridging complexes. AtSUN1 and AtSUN2 are localized to the nuclear envelope and are present as homomers and heteromers in vivo. |
AT3G10815 | RING/U-box superfamily protein;(source:Araport11) |
AT3G10820 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
AT3G10870 | Encodes a methyl IAA esterase. Methyl IAA is believed to be an inactive form of auxin that needs to be demethylated to exert a biological effect. MES17 does not act on methyl JA, MeSA, MeGA4, or MEGA9 in vitro. This gene is expressed in several tissues of seedlings and adult plants, with a higher relative level of expression in the seedling shoot apex and the adult stem. |
AT3G10890 | Encodes an endo beta mannanase that is localized to the apoplast and involved in glutathione mediated cadmium tolerance. |
AT3G10910 | RING/U-box superfamily protein;(source:Araport11) |
AT3G10980 | PLAC8 family protein;(source:Araport11) |
AT3G10986 | LURP-one-like protein (DUF567);(source:Araport11) |
AT3G10990 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT3G11020 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2B). The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A. |
AT3G11070 | Outer membrane OMP85 family protein;(source:Araport11) |
AT3G11080 | receptor like protein 35;(source:Araport11) |
AT3G11110 | RING/U-box superfamily protein;(source:Araport11) |
AT3G11165 | hypothetical protein;(source:Araport11) |
AT3G11170 | Chloroplastic enzyme responsible for the synthesis of 16:3 and 18:3 fatty acids from galactolipids, sulpholipids and phosphatidylglycerol. Uses ferredoxin as electron donor. Gene expression is induced by wounding in shoot and root. The wound-response in shoot is independent of jasmonic acid mediated pathway whereas the root response is mediated by jasmonic acid. The mRNA is cell-to-cell mobile. |
AT3G11200 | Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7). |
AT3G11210 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
AT3G11270 | Mov34/MPN/PAD-1 family protein;(source:Araport11) |
AT3G11280 | Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay). |
AT3G11285 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
AT3G11300 | hypothetical protein;(source:Araport11) |
AT3G11320 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT3G11330 | Encodes PIRL9, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen. |
AT3G11340 | Encodes a uridine diphosphate-dependent glucosyltransferase that conjugates isoleucic acid and modulates plant defense via glucosylation of N-hydroxypipecolic acid. |
AT3G11350 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G11380 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G11385 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G11397 | prenylated RAB acceptor 1.A3;(source:Araport11) |
AT3G11405 | hypothetical protein;(source:Araport11) |
AT3G11415 | other_RNA;(source:Araport11) |
AT3G11420 | beta-1,3-N-acetylglucosaminyltransferase lunatic protein, putative (DUF604);(source:Araport11) |
AT3G11430 | sn-glycerol-3-phosphate 2-O-acyltransferas, involved in the biosynthesis of suberin polyester. |
AT3G11440 | Member of the R2R3-MYB gene family. Similar to GA-induced Barley myb gene. May be induced during germination in response to GA. Double mutants with MYB33 are male sterile, showing defects in pollen development and anther development. Contains a binding site for miRNA159 and may be spatially regulated by this micro RNA. A highly conserved RNA secondary structure abuts the miR159 binding site which facilitates its regulation by miR159. The male sterile phenotype of the MYB33/MYB65 double mutant is light and temperature sensitive. Fertility can be restored with increased light intensity and lower temperatures. |
AT3G11470 | Encodes one of three splice variants. Differs in having CM in positions 88 and 89. The protein is localized to the mitochondria where it phosphopantetheinylates the mature apo mtACP isoforms. It is an essential gene as homozygous mutants cannot be recovered (embryo lethal). |
AT3G11490 | ROP (Rho of plant GTPases) family member Involved in cell wall patterning. Encodes ROP inactivator, regulates the formation of ROP-activated domains; these in turn determined the pattern of cell wall pits. Positively regulates pit formation, but negatively regulates pit size, required for periodic formation of secondary cell wall pits. |
AT3G11510 | Ribosomal protein S11 family protein;(source:Araport11) |
AT3G11550 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT3G11570 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT3G11580 | SOD7 encodes nuclear localized B3 DNA binding domain and a transcriptional repression motif. Belongs to the RAV gene family. Functions in regulation of seed size and binds to and represses KLU. Transcription repressor involved in regulation of inflorescence architecture. |
AT3G11590 | golgin family A protein;(source:Araport11) |
AT3G11591 | bric-a-brac protein;(source:Araport11) |
AT3G11600 | One of two plant specific paralogs of unknown function. Interacts with GL2. GIR1/GIR2 loss of function resembles gl2 lof mutations. |
AT3G11660 | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus. Localization of the gene product is similar to that of NHL3 (plasma membrane) but it is yet inconclusive. |
AT3G11673 | pseudogene of F-box family protein |
AT3G11700 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
AT3G11740 | LURP-one-like protein (DUF567);(source:Araport11) |
AT3G11773 | Thioredoxin superfamily protein;(source:Araport11) |
AT3G11780 | MD-2-related lipid recognition domain-containing protein / ML domain-containing protein;(source:Araport11) |
AT3G11840 | Encodes a U-box-domain-containing E3 ubiquitin ligase that acts as a negative regulator of PAMP-triggered immunity. |
AT3G11964 | Encodes a nucleolar protein that is a ribosome biogenesis co-factor. Mutants display aberrant RNA processing and female gametophyte development. |
AT3G11980 | Similar to fatty acid reductases. |
AT3G12110 | Encodes an actin that is expressed predominantly during reproductive development. |
AT3G12120 | Major enzyme responsible for the synthesis of 18:2 fatty acids in the endoplasmic reticulum. Contains His-rich motifs, which contribute to the interaction with the electron donor cytochrome b5. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
AT3G12140 | Agenet domain containing nucleosome binding protein. Binds H3K36 sites. |
AT3G12190 | golgin family A protein;(source:Araport11) |
AT3G12200 | Encodes AtNek7, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
AT3G12250 | basic leucine zipper transcription factor involved in the activation of SA-responsive genes. |
AT3G12320 | Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK4 in having affects on biomass accumulation and phototrophism. |
AT3G12420 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT3G12490 | Encodes a protein with cysteine proteinase inhibitor activity. Overexpression increases tolerance to abiotic stressors (i.e.salt,osmotic, cold stress). |
AT3G12540 | ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547);(source:Araport11) |
AT3G12550 | Belongs to a subgroup of SGS3-like proteins that act redundantly in RNA-directed DNA methylation: AT1G15910 (FDM1), AT4G00380 (FDM2), AT3G12550 (FDM3), AT1G13790 (FDM4), AT1G80790 (FDM5). |
AT3G12560 | Encodes a telomeric DNA-binding protein. |
AT3G12650 | transmembrane protein;(source:Araport11) |
AT3G12710 | DNA glycosylase superfamily protein;(source:Araport11) |
AT3G12720 | Member of the R2R3 factor gene family. |
AT3G12775 | ubiquitin-conjugating enzyme family protein;(source:Araport11) |
AT3G12820 | Member of the R2R3 factor gene family. |
AT3G12830 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT3G12840 | F-box/FBD-like domain protein;(source:Araport11) |
AT3G12850 | COP9 signalosome complex-related / CSN complex-like protein;(source:Araport11) |
AT3G12880 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT3G12890 | Encodes a protein belonging to a class of CCT (CONSTANS, CONSTANS-like, TOC1) domain proteins. The protein contains a 43 amino acid-long sequence with high homology to the CCT domain but does not have any B-box or GATA-type zinc finger domains. Functions as a transcriptional activator and regulates the expression of at least a subset of sugar-inducible genes. |
AT3G12900 | S8H hydroxylates scopoletin to generate fraxetin (8-hydroxyscopoletin). Fraxetin and its oxidized analog sideretin (5-hydroxyfraxetin) are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil.S8H hydroxylates scopoletin to generate fraxetin (8-hydroxyscopoletin). Fraxetin and its oxidized analog sideretin (5-hydroxyfraxetin) are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil. |
AT3G12920 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
AT3G12955 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT3G12960 | seed maturation protein;(source:Araport11) |
AT3G12980 | Encodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC5 acetylation of the H3 or H4 peptides, suggesting that HAC5 can acetylate any of several lysines present in the peptides. Di-acetylation of both lysines 9 and 14 on the H3 peptide significantly reduces the level of incorporated radioactive acetylation catalyzed by HAC5, indicating that HAC5 may acetylate either lysine 9 or lysine 14. The mRNA is cell-to-cell mobile. |
AT3G13000 | ubiquinone biosynthesis protein (Protein of unknown function, DUF547);(source:Araport11) |
AT3G13010 | hAT transposon superfamily protein;(source:Araport11) |
AT3G13065 | STRUBBELIG-receptor family 4;(source:Araport11) |
AT3G13100 | member of MRP subfamily |
AT3G13110 | Encodes a mitochondrial serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. |
AT3G13130 | transmembrane protein;(source:Araport11) |
AT3G13140 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G13160 | Ribosomal pentatricopeptide repeat protein |
AT3G13226 | regulatory protein RecX family protein;(source:Araport11) |
AT3G13228 | RING/U-box superfamily protein;(source:Araport11) |
AT3G13229 | kinesin-like protein (DUF868);(source:Araport11) |
AT3G13277 | other_RNA;(source:Araport11) |
AT3G13290 | varicose-like protein;(source:Araport11) |
AT3G13350 | HMG (high mobility group) box protein with ARID/BRIGHT DNA-binding domain-containing protein;(source:Araport11) |
AT3G13370 | formin-like protein;(source:Araport11) |
AT3G13390 | SKU5 similar 11;(source:Araport11) |
AT3G13400 | SKU5 similar 13;(source:Araport11) |
AT3G13460 | Physically interacts with CIPK1. ECT2 regulates the mRNA levels of the roteasome regulator PTRE1 and of several 20S proteasome subunits, resulting in enhanced 26S proteasome activity. YTHDF protein which togeteher with ECT3 and ECT4 is involved in cell proliferation during plant organogenesis. |
AT3G13480 | nuclear polyadenylated RNA-binding protein;(source:Araport11) |
AT3G13500 | hypothetical protein;(source:Araport11) |
AT3G13590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G13600 | calmodulin-binding family protein;(source:Araport11) |
AT3G13610 | Encodes a Fe(II)- and 2-oxoglutarate-dependent dioxygenase family gene F6'H1. Mutations in this gene compromise iron uptake and the production of fluorescent phenolics involved in Fe uptake. The mRNA is cell-to-cell mobile. |
AT3G13682 | Encodes a homolog of human Lysine-Specific Demethylase1. Involved in H3K4 methylation of target genes including the flowering loci FLC and FWA. |
AT3G13690 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT3G13700 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G13724 | Encodes a microRNA that targets CMT3. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGGUGGUGAUCAUAUAAGAU |
AT3G13730 | Encodes a cytochrome P-450 gene that is involved in brassinosteroid biosynthesis, most likely in the conversion step of teasterone (TE) to 3-dehydroteasterone (3DT), and/or 6-deoxoteasterone (6-deoxoTE) to 6-deoxo-3-dehydroteasterone (6-deoxo3DT); or the conversion of cathasterone (CT) to TE, and/or 6-deoxocathasterone (6-deoxoCT) to 6-deoxoTE. Recently, CYP90D1 was shown to catalyse the C-23 hydroxylation of several brassinosteroids (the enzyme has a broad specificity for 22-hydroxylated substrates). Member of the CYP90C CYP450 family. Similar to Cytochrome P450 90C1 (ROT3). |
AT3G13750 | beta-galactosidase, glycosyl hydrolase family 35 The mRNA is cell-to-cell mobile. |
AT3G13780 | SMAD/FHA domain-containing protein;(source:Araport11) |
AT3G13782 | Plants mutated in three ubiquitously expressed NAP1 genes (NAP1;1~NAP1;3) and organ-specifically expressed NAP1;4 gene show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. The NAP1 genes act synergistically with NRP genes in promoting somatic homologous recombination. |
AT3G13784 | cell wall invertase 5;(source:Araport11) |
AT3G13790 | Encodes a protein with invertase activity. |
AT3G13800 | Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11) |
AT3G13820 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G13830 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G13840 | GRAS family transcription factor;(source:Araport11) |
AT3G13855 | U6;(source:Araport11) |
AT3G13890 | Encodes a putative transcription factor (MYB26). Mutants produces fertile pollen but plants are sterile because anthers do not dehisce. The cellulosic secondary wall thickenings are not formed in the endothecium as they are in non-mutant plants. |
AT3G13910 | hypothetical protein (DUF3511);(source:Araport11) |
AT3G13920 | eukaryotic translation initiation factor 4A-1 |
AT3G13965 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT3G13980 | SKI/DACH domain protein;(source:Araport11) |
AT3G14000 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
AT3G14010 | hydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2. |
AT3G14020 | nuclear factor Y, subunit A6;(source:Araport11) |
AT3G14060 | hypothetical protein;(source:Araport11) |
AT3G14120 | nuclear pore complex protein;(source:Araport11) |
AT3G14130 | Aldolase-type TIM barrel family protein;(source:Araport11) |
AT3G14170 | CORD1 is a member of a novel and plant specific family of microtubule associated proteins. CORD1 binds microtubules via a conserved protein domain shared among family members. CORD functions may overlap;cord1 / cord2 mutants have defects in secondary cell wall pit morphology. |
AT3G14172 | GPI-anchored adhesin-like protein;(source:Araport11) |
AT3G14200 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT3G14205 | Phosphoinositide phosphatase family protein;(source:Araport11) |
AT3G14210 | A semidominant QTL which has an epistatic effect on the Epithiospecifier gene. Represses nitrile formation and favors isothiocyanate production during glucosinolate hydrolysis. The functional allele deters the insect herbivory T. ni. |
AT3G14240 | Subtilase family protein;(source:Araport11) |
AT3G14250 | RING/U-box superfamily protein;(source:Araport11) |
AT3G14270 | Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant. |
AT3G14280 | LL-diaminopimelate aminotransferase;(source:Araport11) |
AT3G14300 | pectinesterase family protein;(source:Araport11) |
AT3G14310 | encodes a pectin methylesterase, targeted by a cellulose binding protein (CBP) from the parasitic nematode Heterodera schachtii during parasitism. |
AT3G14340 | hypothetical protein;(source:Araport11) |
AT3G14350 | STRUBBELIG-receptor family 7;(source:Araport11) |
AT3G14360 | Lipid droplet-associated triacylglycerol lipase (TAG) involved in pollen tube growth. TAG is possibly a direct precursor for the synthesis of membrane lipids in pollen tubes. |
AT3G14370 | The WAG2 and its homolog, WAG1 each encodes protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
AT3G14380 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT3G14390 | Meso-diaminopimelate decarboxylase which catalyzes the decarboxylation of mesodiaminopimelate, the final reaction in the diaminopimelate L-lysine biosynthetic pathway. |
AT3G14395 | Protein Involved in the Regulation of Herbivore-Associated Signaling Pathways, affecting the expression of genes involved in biosynthesis and signaling of the jasmonic acid and salicylic acid hormones. |
AT3G14400 | Encodes a ubiquitin-specific protease. |
AT3G14410 | Nucleotide/sugar transporter family protein |
AT3G14440 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane. |
AT3G14450 | RNA-binding protein, putative, contains Pfam profile: PF00076 RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (2 copies). Contains PAM PABC binding domain. |
AT3G14452 | transmembrane protein;(source:Araport11) |
AT3G14490 | Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
AT3G14520 | Encodes a sesterterpene synthase responsible for the biosynthesis of the tricyclic sesterterpene (+)-thalianatriene with a 11-6-5 fused ring system. |
AT3G14580 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G14590 | Ca2+-dependent lipid-binding protein |
AT3G14595 | Ribosomal protein L18ae family;(source:Araport11) |
AT3G14710 | RNI-like superfamily protein;(source:Araport11) |
AT3G14720 | member of MAP Kinase The mRNA is cell-to-cell mobile. |
AT3G14760 | transmembrane protein;(source:Araport11) |
AT3G14770 | Nodulin MtN3 family protein;(source:Araport11) |
AT3G14810 | mechanosensitive channel of small conductance-like 5;(source:Araport11) |
AT3G14840 | Encodes LRR-RLK protein that is localized to the plasma membrane and is involved in regulation of plant innate immunity to microbes. LIK1 is phosphorylated by CERK1, a kinase involved in chitin perception. The mRNA is cell-to-cell mobile. |
AT3G14850 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT3G14855 | pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10) |
AT3G14940 | Encodes a cytosolic phosphoenolpyruvate carboxylase (PEPC) that has activity when expressed in E.coli. Its mRNA is most abundantly expressed in roots and siliques. PPC3 belongs to the plant-type PEPC family. It can form an enzymatically active complex with a castor bean ortholog of PPC4, which encodes a bacterial-type PEPC. The mRNA is cell-to-cell mobile. |
AT3G14950 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. |
AT3G14960 | Galactosyltransferase family protein;(source:Araport11) |
AT3G14970 | RING/U-box superfamily protein;(source:Araport11) |
AT3G14990 | Encodes a homolog of animal DJ-1 superfamily protein. In the A. thaliana genome, three genes encoding close homologs of human DJ-1 were identified AT3G14990 (DJ1A), AT1G53280 (DJ1B) and AT4G34020 (DJ1C). Among the three homologs, DJ1C is essential for chloroplast development and viability. It exhibits glyoxalase activity towards glyoxal and methylglyoxal. The mRNA is cell-to-cell mobile. |
AT3G15030 | Arabidopsis thaliana TCP family transcription factor. Regulated by miR319. Involved in heterchronic regulation of leaf differentiation. |
AT3G15040 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT3G15050 | Member of IQ67 (CaM binding) domain containing family. |
AT3G15060 | RAB GTPase homolog A1G;(source:Araport11) |
AT3G15080 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT3G15110 | transmembrane protein;(source:Araport11) |
AT3G15115 | serine/arginine repetitive matrix protein;(source:Araport11) |
AT3G15220 | Protein kinase superfamily protein;(source:Araport11) |
AT3G15270 | Encodes a member of the SPL (squamosa-promoter binding protein-like)gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. Contains the SBP-box, which encodes the SBP-domain, required and sufficient for interaction with DNA. It is involved in regulation of flowering and vegetative phase change. Its temporal expression is regulated by the microRNA miR156. The target site for the microRNA is in the 3'UTR. |
AT3G15280 | hypothetical protein;(source:Araport11) |
AT3G15300 | VQ motif-containing protein;(source:Araport11) |
AT3G15330 | pseudogene of the NLI interacting factor (NIF) protein family |
AT3G15340 | Encodes PPI2 (proton pump interactor 2), a homologue of PPI1, a protein that interacts with the plasma membrane H+ ATPase AHA1. |
AT3G15350 | G14 enzyme |
AT3G15354 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA3 (and SPA4) predominantly regulates elongation growth in adult plants. |
AT3G15370 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT3G15450 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
AT3G15490 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
AT3G15500 | Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3. The mRNA is cell-to-cell mobile. |
AT3G15510 | Note of caution: not to be confused with another protein (AtNAC6 locus AT5G39610) which on occasion has also been referred to as AtNAC2. |
AT3G15518 | hypothetical protein;(source:Araport11) |
AT3G15530 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G15540 | Primary auxin-responsive gene. Involved in the regulation stamen filaments development. |
AT3G15570 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT3G15590 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G15604 | hypothetical protein;(source:Araport11) |
AT3G15605 | nucleic acid binding protein;(source:Araport11) |
AT3G15700 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G15720 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G15770 | hypothetical protein;(source:Araport11) |
AT3G15840 | Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport. |
AT3G15860 | plant self-incompatibility protein S1 family protein;(source:Araport11) |
AT3G15960 | mismatched DNA binding / ATP binding protein;(source:Araport11) |
AT3G16030 | lectin protein kinase family protein;(source:Araport11) |
AT3G16050 | Encodes a protein with pyridoxal phosphate synthase activity whose transcripts were detected mostly in roots and accumulate during senescence. The protein was found in very low abundance, which prevented a specific localisation. |
AT3G16070 | LOW protein: ATP-dependent RNA helicase-like protein;(source:Araport11) |
AT3G16130 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT3G16140 | Encodes subunit H of photosystem I reaction center subunit VI. |
AT3G16180 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
AT3G16210 | F-box family protein;(source:Araport11) |
AT3G16290 | Strong interaction with TIC inner envelope protein translocon which consists of Tic20/Tic56/Tic100/Tic214(Ycf1)(DOI:10.1105/tpc.18.00357). |
AT3G16340 | Encodes a p-coumaryl alcohol exporter involved in lignin biosynthesis. |
AT3G16350 | MYB-like transcription factor involved in nitrate signaling trough regulation of CHL1. |
AT3G16370 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. The mRNA is cell-to-cell mobile. |
AT3G16390 | Encodes a nitrile-specifier protein NSP3. NSP3 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. The mRNA is cell-to-cell mobile. |
AT3G16415 | pseudogene of myrosinase-binding protein 2;(source:Araport11) |
AT3G16430 | Encodes a protein that increases the beta-glucosidase activities of three scopolin glucosidases in vitro. |
AT3G16490 | Member of IQ67 (CaM binding) domain containing family. |
AT3G16500 | phytochrome-associated protein 1 (PAP1) |
AT3G16510 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT3G16530 | Lectin like protein whose expression is induced upon treatment with chitin oligomers. |
AT3G16555 | F-box and associated interaction domains-containing protein;(source:Araport11).SON1 paralog. |
AT3G16560 | Protein phosphatase 2C family protein;(source:Araport11) |
AT3G16570 | Encodes RALF23, a member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. RALF23 is significantly downregulated by brassinolide treatment of seedlings. Overexpression of AtRALF23 impairs brassinolide-induced hypocotyls elongation, and mature overexpressing plants are shorter and bushier. RALF23 overexpression produces slower growing seedlings with roots that have reduced capacity to acidify the rhizosphere. |
AT3G16600 | SNF2 domain-containing protein / helicase domain-containing protein / zinc finger protein-like protein;(source:Araport11) |
AT3G16630 | Kinesin-13A localized to entire Golgi stacks. Involved in trichome development. |
AT3G16650 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G16660 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT3G16670 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT3G16680 | DNA binding / DNA-directed RNA polymerase;(source:Araport11) |
AT3G16720 | RING-H2 protein induced after exposure to chitin or inactivated crude cellulase preparations. The mRNA is cell-to-cell mobile. |
AT3G16770 | Encodes a member of the ERF (ethylene response factor) subfamily B-2 of the plant specific ERF/AP2 transcription factor family (RAP2.3). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12.It is localized to the nucleus and acts as a transcriptional activator through the GCC-box. It has been identified as a suppressor of Bax-induced cell death by functional screening in yeast and can also suppress Bax-induced cell death in tobacco plants. Overexpression of this gene in tobacco BY-2 cells confers resistance to H2O2 and heat stresses. Overexpression in Arabidopsis causes upregulation of PDF1.2 and GST6. It is part of the ethylene signaling pathway and is predicted to act downstream of EIN2 and CTR1, but not under EIN3. The mRNA is cell-to-cell mobile. |
AT3G16780 | Ribosomal protein L19e family protein;(source:Araport11) |
AT3G16810 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT3G16860 | COBRA-like protein 8 precursor;(source:Araport11) |
AT3G16880 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G16920 | Encodes a chitinase-like protein expressed predominantly in stems. Mutants accumulate ligning in etiolated hypocotyls. |
AT3G16950 | encodes a plastid lipoamide dehydrogenase, subunit of the pyruvate dehydrogenase complex which provides acetyl-CoA for de novo fatty acid biosynthesis. The gene is highly expressed in developing seeds. |
AT3G17000 | Group XIV ubiquitin-conjugating enzyme that functions negative regulation of drought stress. |
AT3G17010 | transcriptional factor B3 family protein, contains Pfam profile PF02362: B3 DNA binding domain. Activated by AGAMOUS ina a cal-1, ap1-1 background. Expressed in stamen primordia, the placental region of developing carpels and the ovary. |
AT3G17080 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT3G17110 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT3G17170 | Translation elongation factor EF1B/ribosomal protein S6 family protein;(source:Araport11) |
AT3G17180 | serine carboxypeptidase-like 33;(source:Araport11) |
AT3G17185 | Encodes a trans-acting siRNA (tasi-RNA) that regulates the expression of auxin response factor genes (ARF2, ARF4, ETT). One of 3 genomic loci that encode the TAS3 siRNA. Has been identified as a translated small open reading frame by ribosome profiling. |
AT3G17205 | ubiquitin protein ligase 6;(source:Araport11) |
AT3G17210 | Encodes a heat stable protein with antimicrobial and antifungal activity. |
AT3G17265 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G17270 | F-box/associated interaction domain protein;(source:Araport11) |
AT3G17280 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G17310 | Encodes DRM3 (Domains Rearranged Methyltransferase3), a catalytically mutated paralog of the cytosine methyltransferase DRM2. Despite being catalytically mutated, DRM3 is required for normal maintenance of non-CG DNA methylation, establishment of RNA-directed DNA methylation triggered by repeat sequences and accumulation of repeat-associated small RNAs. |
AT3G17360 | PHRAGMOPLAST ORIENTING KINESIN 1 is one of the two Arabidopsis homologs isolated in yeast two-hybrid screen for interaction partners of maize gene TANGLED1 (TAN1). Based on sequence homology in their motor domains, POK1 and POK2 belong to the kinesin-12 class which also includes the well-characterized group of phragmoplast-associated kinesins AtPAKRPs. Both kinesins are composed of an N-terminal motor domain throughout the entire C terminus and putative cargo binding tail domains. The expression domains for POK1 constructs were more limited than those for POK2; both are expressed in tissues enriched for dividing cells. The phenotype of pok1/pok2 double mutants strongly resembles that of maize tan1 mutants, characterized by misoriented mitotic cytoskeletal arrays and misplaced cell walls. |
AT3G17365 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G17420 | Serine/threonine protein kinase-like protein expressed in etiolated cotyledons and found in glyoxysomes. |
AT3G17500 | F-box family protein;(source:Araport11) |
AT3G17520 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
AT3G17540 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G17550 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT3G17570 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G17580 | SsrA-binding protein;(source:Araport11) |
AT3G17600 | Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA31 shares several residues with the conserved domain II region, believed to act as a degron in many of the rapidly degraded Aux/IAA family members. An IAA31 fusion protein is quite long-lived, but can be degraded more rapidly in the presence of auxin. Unlike many other family members, IAA31 transcript levels do not rise in response to auxin. Nevertheless, overexpression of IAA31 leads to defects in auxin-related processes such as gravitropism, root development, shoot development, and cotyledon vascular development. |
AT3G17609 | Encodes a homolog of HY5 (HYH). Involved in phyB signaling pathway. |
AT3G17640 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT3G17660 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes; AGD15 belongs to the class 4, together with AGD14. |
AT3G17675 | Encodes a Plantacyanin/Basic blue family protein |
AT3G17690 | member of Cyclic nucleotide gated channel family |
AT3G17700 | cyclic nucleotide-binding transporter 1, member of a family of cyclic nucleotide gated channels. The mRNA is cell-to-cell mobile. |
AT3G17730 | NAC domain containing protein 57;(source:Araport11) |
AT3G17760 | glutamate decarboxylase 5;(source:Araport11) |
AT3G17790 | Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
AT3G17820 | encodes a cytosolic glutamine synthetase, the enzyme has low affinity with substrate ammonium The mRNA is cell-to-cell mobile. |
AT3G17880 | Encodes a thioredoxin-like disulfide reductase. The protein interacts with the yeast Hsp70 protein Ssb2 in vitro. This interaction is sensitive to the redox status of the thioredoxin domain of AtTDX. |
AT3G17890 | hypothetical protein;(source:Araport11) |
AT3G17980 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT3G18020 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G18040 | Encodes a protein with similarity to MAP kinases (MAPK9).Expressed preferentially in guard cells and appears to be involved in reactive oxygen species mediated ABA signaling. |
AT3G18050 | GPI-anchored protein;(source:Araport11) |
AT3G18150 | RNI-like superfamily protein;(source:Araport11) |
AT3G18170 | Glycosyltransferase family 61 protein;(source:Araport11) |
AT3G18180 | Glycosyltransferase family 61 protein;(source:Araport11) |
AT3G18200 | nodulin MtN21-like transporter family protein |
AT3G18220 | Phosphatidic acid phosphatase (PAP2) family protein;(source:Araport11) |
AT3G18230 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT3G18280 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT3G18282 | hypothetical protein;(source:Araport11) |
AT3G18350 | Plant protein of unknown function (DUF639);(source:TAIR10) |
AT3G18370 | C2 domain-containing protein;(source:Araport11) |
AT3G18440 | Belongs to the aluminum-activated malate transporter family. Encodes a vacuolar malate channel. Expressed in all parts of plants. Almost exclusively expressed in mesophyll cells of leaves. The mRNA is cell-to-cell mobile. |
AT3G18450 | PLAC8 family protein;(source:Araport11) |
AT3G18480 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component, known as a golgin in mammals and yeast. A fluorescently-tagged version of CASP co-localizes with Golgi markers, and this localization appears to require the C-terminal (565?689aa) portion of the protein. The protein is inserted into a membrane in a type II orientation. |
AT3G18485 | Encodes a novel protein with no predicted membrane-spanning domains that is polymorphic among Arabidopsis accessions. The protein may modulate a metal transporter. Mutants are resistant to IAA-Leu, IAA-Phe, and the divalent metals cobalt and manganese but remain sensitive to free IAA; they are defective in lateral root formation and primary root elongation. |
AT3G18490 | Encodes ASPG1 (ASPARTIC PROTEASE IN GUARD CELL 1). Functions in drought avoidance through abscisic acid (ABA) signalling in guard cells. |
AT3G18518 | Member of a family of small polypeptides found only in angiosperm lineages.Contains a conserved 29 amino acid domain (RTF or DVL domain). |
AT3G18535 | |
AT3G18600 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G18610 | Encodes ATNUC-L2 (NUCLEOLIN LIKE 2). |
AT3G18620 | DHHC-type zinc finger family protein;(source:Araport11) |
AT3G18650 | AGAMOUS-like 103;(source:Araport11) |
AT3G18660 | Plants expressing an RNAi construct specifically targeting PGSIP1 was shown to have a dramatically reduced amount of starch. Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. |
AT3G18670 | Ankyrin repeat family protein;(source:Araport11) |
AT3G18680 | Encodes a functional UMP Kinase located in the plastid that binds to group II intron plastid transcription products. Mutants show decreased accumulation of target transcripts/proteins. |
AT3G18710 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
AT3G18720 | F-box family protein;(source:Araport11) |
AT3G18820 | RAB7 homolog, forms retromer complex with VPS35; ES17 prevents the retromer complex to endosome anchoring, resulting in retention of RABG3f. The interaction of RABG3f?VPS35 functinons as a checkpoint in the control of traffic toward the vacuole. |
AT3G18827 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: CUUCUUAAGUGCUGAUAAUGC |
AT3G18840 | LOW protein: PPR containing-like protein;(source:Araport11) |
AT3G18845 | Encodes a Protease inhibitor/seed storage/LTP family protein [pseudogene] |
AT3G18860 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT3G18870 | Mitochondrial transcription termination factor family member. |
AT3G18895 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:TAATGTGATGATGAACTGACC |
AT3G18900 | ternary complex factor MIP1 leucine-zipper protein;(source:Araport11) |
AT3G18910 | EIN2 targeting protein2;(source:Araport11) |
AT3G18950 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G18957 | hypothetical protein;(source:Araport11) |
AT3G18970 | Encodes a pentatricopeptide repeat protein (PPR) protein involved in mitochondrial mRNA editing. |
AT3G18990 | Required for vernalization. Essential for the complete repression of FLC in vernalized plants. Required for the methylation of histone H3 |
AT3G19002 | Natural antisense transcript overlaps with AT3G19000;(source:Araport11) |
AT3G19010 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT3G19050 | PHRAGMOPLAST ORIENTING KINESIN 2 is one of the two Arabidopsis homologs isolated in yeast two-hybrid screen for interaction partners of maize gene TANGLED1 (TAN1). Based on sequence homology in their motor domains, POK1 and POK2 belong to the kinesin-12 class which also includes the well-characterized group of phragmoplast-associated kinesins AtPAKRPs. Both kinesins are composed of an N-terminal motor domain throughout the entire C terminus and putative cargo binding tail domains. The expression domains for POK2 constructs were broader than those for POK1; both are expressed in tissues enriched for dividing cells. The phenotype of pok1/pok2 double mutants strongly resembles that of maize tan1 mutants, characterized by misoriented mitotic cytoskeletal arrays and misplaced cell walls. |
AT3G19055 | hypothetical protein;(source:Araport11) |
AT3G19085 | F-box/RNI/FBD-like domain protein;(source:Araport11) |
AT3G19090 | RNA-binding protein;(source:Araport11) |
AT3G19150 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type cyclins. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. KRP6 appears to be targeted for degradation by RHF1a and RHF2a to allow mitotic divisions during gametogenesis. In addition, KRP6 transcript levels rise prior to and drop following the meitotic divisions of gametogenesis. Elevated levels of KRP6 negatively affect plant development and fertility. |
AT3G19160 | Encodes cytokinin synthase. |
AT3G19180 | Encodes a chloroplast division factor located in the plastid inner envelope with its N-terminus exposed to the stroma. PARC6 influences FtsZ assembly and is required for recruitment of PDV1 during chloroplast division. |
AT3G19230 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT3G19240 | Together with DEM1 plays an essential role in cell division in plants, most likely through an interaction with RAN1. |
AT3G19260 | LAG1 homolog. Loss of function mutant is sensitive to AAL-toxin. LOH2 is presumed to function in sphingolipid metabolism. It encodes a ceramide synthase essential for production of LCFA-ceramides (mainly C16). Uses palmitoyl-CoA and dihydroxy LCB substrates. |
AT3G19270 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. |
AT3G19300 | Protein kinase superfamily protein;(source:Araport11) |
AT3G19310 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
AT3G19320 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT3G19360 | Zinc finger (CCCH-type) family protein;(source:Araport11) |
AT3G19370 | filament-like protein (DUF869);(source:Araport11) |
AT3G19380 | PUB25 and PUB26 are closely related paralogs that encode functional E3 ligases. They function in immune response pathway by targeting BIK1 for degradation. |
AT3G19390 | Granulin repeat cysteine protease family protein;(source:Araport11) |
AT3G19400 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT3G19430 | late embryogenesis abundant protein-related / LEA protein-like protein;(source:Araport11) |
AT3G19460 | Reticulon family protein;(source:Araport11) |
AT3G19480 | Encodes a stromal phosphoglycerate dehydrogenase with a high NAD(H)-specificity that is active in photosynthesizing chloroplasts and draws its substrate 3-PGA directly from the Calvin-Benson-Bassham cycle. |
AT3G19508 | complex 1 protein, LYR family protein;(source:Araport11) |
AT3G19530 | hypothetical protein;(source:Araport11) |
AT3G19540 | glutamyl-tRNA (Gln) amidotransferase subunit A (DUF620);(source:Araport11) |
AT3G19550 | glutamate racemase;(source:Araport11) |
AT3G19600 | Encodes a Ser-2-specific RNAPII CTD phosphatase with two tandem-repeated CTD phosphatase domains that belongs to the group III CTD phosphatase-like (CPL) family. It positively regulates ABA and drought responses. |
AT3G19610 | Member of a novel, plant specific family of microtubule associated proteins. |
AT3G19615 | beta-1,4-xylosidase;(source:Araport11) |
AT3G19620 | Glycosyl hydrolase family protein;(source:Araport11) |
AT3G19680 | hypothetical protein (DUF1005);(source:Araport11) |
AT3G19700 | Encodes leucine rich repeat (LRR) kinase. Iku2-3 identified in a screen for mutants with abnormal endosperm. Sporophytic recessive mutants have reduced embryo and endosperm size. Seed size is also reduced and the shape is abnormal suggesting an interaction between the endosperm and cell elongation in the integuments. |
AT3G19790 | hypothetical protein;(source:Araport11) |
AT3G19800 | Encodes the DUF177B version of the two DUF177 proteins in Arabidopsis. This version differs from DUF177A in containing a 23 aa insertion compared to the DUF177A sequence. |
AT3G19820 | Involved in the conversion of the early brassinosteroid precursor 24-methylenecholesterol to campesterol. Brassinosteroids affect cellular elongation. Mutants have dwarf phenotype. DWF1 is a Ca2+-dependent calmodulin-binding protein. |
AT3G19930 | Encodes a sucrose hydrogen symporter that is induced by wounding. The mRNA is cell-to-cell mobile. |
AT3G19940 | Encodes a hexose-H(+) symporter that catalyzes the high-affinity uptake of glucose, galactose and mannose that is induced under low-glucose conditions in pollen tubes. |
AT3G19960 | member of Myosin-like proteins |
AT3G19980 | Encodes catalytic subunit of serine/threonine protein phosphatase 2A. It can associate with phytochromes A and B in vitro. Mutant plants display an accelerated flowering phenotype.Acts antagonistically to SnRK2 to regulate ABI5 phosphorylation. It inteacts with NRP which results in tethering to endosomes leading to its degradation. |
AT3G20015 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G20020 | protein arginine methyltransferase 6;(source:Araport11) |
AT3G20030 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G20040 | Hexokinase;(source:Araport11) |
AT3G20083 | pseudogene of cytochrome P450;(source:Araport11) |
AT3G20090 | cytochrome P450, family 705, subfamily A, polypeptide 18;(source:Araport11) |
AT3G20155 | hypothetical protein;(source:Araport11) |
AT3G20170 | ARM repeat superfamily protein;(source:Araport11) |
AT3G20190 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G20200 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT3G20220 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT3G20270 | Encodes one of the two LBP/BPI related proteins (AT1G04970/LBR-1, AT3G20270/LBR-2) that bind to LPS directly and regulate PR1 expression. |
AT3G20280 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT3G20290 | Encodes AtEHD1, one of the Arabidopsis Eps15 homology domain proteins involved in endocytosis (AtEHD2, At4g05520). |
AT3G20300 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
AT3G20310 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-7). The protein contains one AP2 domain. Phosphorylated by PKS3 in vitro. Involved in ABA-mediated responses. Acts as a repressor of GCC box?mediated transcription together with AtSin3 and HDA19. |
AT3G20360 | TRAF-like family protein;(source:Araport11) |
AT3G20460 | Major facilitator superfamily protein;(source:Araport11) |
AT3G20470 | encodes a glycine-rich protein that is expressed more abundantly in immature seed pods than in stems and leaves. Expression is not detected in roots or flowers. |
AT3G20475 | Encodes MSH5, a homologue of the MutS-homolog family of genes required for normal levels of recombination in budding yeast, mouse and Caenorhabditis elegans. Involved in meiotic recombination. Required for the formation of Class I interference-sensitive crossovers. Transcripts of AtMSH5 are specific to reproductive tissues and expression of the protein is abundant during prophase I of meiosis. Involved in meiotic recombination. Required for the formation of Class I interference-sensitive crossovers. |
AT3G20500 | purple acid phosphatase 18;(source:Araport11) |
AT3G20510 | Encodes a member of the Tmemb_14 family that is predicted to be localized to the membranes of the secretory pathway. The mRNA is cell-to-cell mobile. |
AT3G20540 | Encodes an organellar DNA polymerase I that is also involved in double strand break repair. |
AT3G20541 | pseudogene of Ankyrin repeat family protein;(source:Araport11) |
AT3G20580 | COBRA-like protein 10 precursor;(source:Araport11) |
AT3G20630 | Encodes a ubiquitin-specific protease. Identical to TTN6. Loss of function mutations are embryo lethals, having development arrested at the preglobular/globular stage. Also involved in root responses to phosphate deficiency. |
AT3G20640 | Governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT3G20670 | Encodes HTA13, a histone H2A protein. |
AT3G20700 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT3G20720 | amino-terminal region of chorein;(source:Araport11) |
AT3G20750 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT3G20760 | Nse4, component of Smc5/6 DNA repair complex;(source:Araport11) |
AT3G20810 | JMJD5 encodes a protein which contains a jumonji-C (jmjC) domain. jmjd5 mutant plants have a short-period circadian phenotype. JMJD5 has histone demethylase activity and interacts with EFM to repress FT. |
AT3G20830 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
AT3G20840 | Encodes a member of the AINTEGUMENTA-like (AIL) subclass of the AP2/EREBP family of transcription factors and is essential for quiescent center (QC) specification and stem cell activity. It is a key effector for establishment of the stem cell niche during embryonic pattern formation. It is transcribed in response to auxin accumulation and is dependent on auxin response transcription factors. |
AT3G20850 | proline-rich family protein;(source:Araport11) |
AT3G20860 | Encodes a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
AT3G20940 | a member of A-type cytochrome P450 |
AT3G20975 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.6e-08 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT3G20980 | Gag-Pol-related retrotransposon family protein;(source:Araport11) |
AT3G20990 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.9e-07 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G20993 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT3G20997 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT3G21080 | ABC transporter-like protein;(source:Araport11) |
AT3G21090 | ABC-2 type transporter family protein;(source:Araport11) |
AT3G21110 | 5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole synthetase (PUR7, syn. SAICAR synthetase), catalyzes aspartate addition at the alpha-amino group to the growing purine backbone. |
AT3G21120 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G21130 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G21160 | Encodes an alpha-mannosidase I enzyme responsible for N-glycan maturation. |
AT3G21180 | one of the type IIB calcium pump isoforms. encodes an autoinhibited Ca(2+)-ATPase that contains an N-terminal calmodulin binding autoinhibitory domain. |
AT3G21190 | O-fucosyltransferase family protein;(source:Araport11) |
AT3G21200 | Encodes a soluble glutamyl-tRNA reductase (GluTR) binding protein that forms a ternary complex with FLU and GluTR. |
AT3G21210 | zinc ion binding protein;(source:Araport11) |
AT3G21220 | Encodes a mitogen-activated kinase kinase, dual specific protein kinase that is expressed in vegetative tissues and floral buds. Involved in innate immunity. This protein activates MPK3/MPK6 and early-defense genes redundantly with MKK4. In plants with both MKK5 and MKK4 levels reduced by RNAi plants, floral organs do not abscise suggesting a role for both proteins in mediating floral organ abscission.MKK5 is part of a positive feedback loop that regulates HAE expression in floral receptacles. |
AT3G21230 | The gene encodes a 4-coumarate coenzyme A ligase being able to use sinapate as substrate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, 5-OH-ferulic acid, ferulic acid and sinapic acid. At4CL5 was unable to use cinnamic acid as substrate. Knockout of At4CL5 (4cl5) revealed no effect on syringyl lignin content indicating that the activity observed does probably not occur in vivo. |
AT3G21240 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, ferulic acid, 5-OH-ferulic acid and cinnamic acid. At4CL2 was unable to use sinapic acid as substrate. |
AT3G21260 | Glycolipid transfer protein (GLTP) family protein;(source:Araport11) |
AT3G21320 | EARLY FLOWERING protein;(source:Araport11) |
AT3G21330 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT3G21340 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G21470 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT3G21560 | Encodes a protein with sinapic acid:UDP-glucose glucosyltransferase activity. Mutants defective in this gene are hyper-fluorescent (which accumulate in their trichomes a compound that is likely to be 3',5'-dimethoxynaringenin chalcone or sinapoyltriacetic acid lactone, potential products of the concerted action of 4-coumarate CoA ligase and chalcone synthase on sinapic acid). Also shown to be required for Arabidopsis nonhost resistance to the Asian soybean rust pathogen Phakopsora pachyrhizi. |
AT3G21570 | proline-rich nuclear receptor coactivator;(source:Araport11) |
AT3G21590 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
AT3G21630 | LysM receptor-like kinase, based on protein sequence alignment analysis, it has a typical RD signaling domain in its catalytic loop and possesses autophosphorylation activity. Involved in the perception and transduction of the chitin oligosaccharide elicitor. Located in the plasma membrane. CERK1 phosphorylates LIK1, a LLR-RLK that is involved in innate immunity, |
AT3G21670 | Major facilitator superfamily protein;(source:Araport11) |
AT3G21680 | hypothetical protein;(source:Araport11) |
AT3G21700 | Monomeric G protein. Expressed in root epidermal cells that are destined to become atrichoblasts. Also expressed during pollen development and in the pollen tube tip. |
AT3G21720 | Encodes a glyoxylate cycle enzyme isocitrate lyase (ICL) involved in salt tolerance. |
AT3G21755 | Natural antisense transcript overlaps with AT3G21760;(source:Araport11) |
AT3G21760 | Encodes HYR1, a UDP glycosyltransferase (UGT). HYR1 glucosylates hypostatin, an inhibitor of cell expansion in vivo to form a bioactive glucoside. |
AT3G21781 | Natural antisense transcript overlaps with AT3G21780;(source:Araport11) |
AT3G21791 | Pseudogene of AT3G21790; UDP-glucoronosyl/UDP-glucosyl transferase family protein |
AT3G21800 | UDP-glucosyl transferase 71B8;(source:Araport11) |
AT3G21810 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT3G21820 | histone-lysine N-methyltransferase ATXR2;(source:Araport11) |
AT3G21860 | SKP1-like 10;(source:Araport11) |
AT3G21880 | Encodes a substrate of the COP1/SPA E3 ubiquitin ligase. It is degraded in darkness and stabilized by white, red and blue light. Overexpression results in decreased apical dominance, increased branching and delayed flowering in long days. The latter phenotype is due to reduced levels of FT and dependent on the presence of CO (PMID:29187570). |
AT3G21890 | B-box type zinc finger family protein;(source:Araport11) |
AT3G21920 | cysteine-rich repeat secretory protein, putative (DUF26);(source:Araport11) |
AT3G22030 | Receptor protein kinase-like protein;(source:Araport11) |
AT3G22040 | cysteine-rich repeat secretory-like protein (DUF26);(source:Araport11) |
AT3G22072 | Natural antisense transcript overlaps with AT3G22070;(source:Araport11) |
AT3G22104 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT3G22110 | Encodes the alpha-3 subunit of 20s proteasome. |
AT3G22133 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase GB:AAC33226.1 from (Arabidopsis thaliana);(source:TAIR10) |
AT3G22136 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase GB:AAD22368 from (Arabidopsis thaliana);(source:TAIR10) |
AT3G22150 | Involved in RNA editing of plastid atpF and mitochondrial nad5. |
AT3G22190 | Member of IQ67 (CaM binding) domain containing family. |
AT3G22200 | Genetically redundant with POP3;mediates pollen tube guidance. Double mutants are self sterile; gamma-aminobutyrate transaminase subunit precursor; nuclear gene for mitochondrial product. Encodes gamma-aminobutyrate transaminase that uses pyruvate instead of alpha-ketoglutarate as cosubstrate. Mutations in POP2/HER1 render roots resistant to the inhibitory growth effects of the volatile organic compound E-2-hexenal implicated in plant defense. |
AT3G22270 | Topoisomerase II-associated protein PAT1;(source:Araport11) |
AT3G22290 | Endoplasmic reticulum vesicle transporter protein;(source:Araport11) |
AT3G22310 | Sequence similarity ot DEAD-box RNA helicases. Binds RNA and DNA. Involved in drought, salt and cold stress responses. The mRNA is cell-to-cell mobile. |
AT3G22340 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.2e-60 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G22350 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G22360 | encodes an alternative oxidase whose expression is limited to flowers and floral buds. |
AT3G22370 | Encodes AOX1a, an isoform of alternative oxidase that is expressed in rosettes, flowers, and root. The alternative oxidase of plant mitochondria transfers electrons from the ubiquinone pool to oxygen without energy conservations. It is regulated through transcriptional control and by pyruvate. Plays a role in shoot acclimation to low temperature. Also is capable of ameliorating reactive oxygen species production when the cytochrome pathway is inhibited. AOX1a also functions as a marker for mitochondrial retrograde response. The mRNA is cell-to-cell mobile. |
AT3G22400 | Encodes lipoxygenase5 (LOX5). LOX5 activity in roots facilitates green peach aphid colonization of Arabidopsis foliage by promoting green peach aphid feeding from sieve element and water consumption from xylem. |
AT3G22410 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT3G22415 | hypothetical protein;(source:Araport11) |
AT3G22420 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
AT3G22440 | FRIGIDA-like protein;(source:Araport11) |
AT3G22540 | hypothetical protein (DUF1677);(source:Araport11) |
AT3G22550 | NAD(P)H-quinone oxidoreductase subunit, putative (DUF581);(source:Araport11) |
AT3G22560 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT3G22600 | Glycosylphosphatidylinositol (GPI)-anchored LTPg protein, downregulated in syncytia induced by the beet cyst nematode Heterodera schachtii and root knot nematode Meloidogyne incognita. Infection with bacteria (Pseudomonas syringae) and fungi (Botrytis cinerea) leads to the induction of the gene in leaves. |
AT3G22630 | Encodes 20S proteasome beta subunit PBD1 (PBD1). |
AT3G22650 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G22720 | F-box/associated interaction domain protein;(source:Araport11) |
AT3G22723 | hypothetical protein;(source:Araport11) |
AT3G22730 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G22740 | homocysteine S-methyltransferase (HMT3) |
AT3G22770 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT3G22790 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It binds filamentous actin and is localized to the plasma membrane and plasmodesmata. |
AT3G22800 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT3G22820 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
AT3G22850 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
AT3G22886 | Encodes a microRNA that targets ARF family members ARF6 and ARF8. Essential for fertility of both ovules and anthers. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGAAGCUGCCAGCAUGAUCUA. Pri-mRNA coordinates for MIR167a (converted to TAIR10 based on PMID19304749): Chr3: 8108021-8108622 (forward), length: 602 bp; exon coordinates: exon 1: 8108021 to 8108622; mature miRNA and miRNA* are located on exon 1. |
AT3G22890 | encodes ATP sulfurylase, the first enzyme in the sulfate assimilation pathway of Arabidopsis. It may also participate in selenium metabolism. The mRNA is cell-to-cell mobile. |
AT3G22910 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
AT3G22920 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT3G22930 | Encodes a calmodulin-like protein. |
AT3G22961 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
AT3G22970 | hypothetical protein (DUF506);(source:Araport11) |
AT3G23010 | receptor like protein 36;(source:Araport11) |
AT3G23030 | auxin inducible gene expressed in the nucleus |
AT3G23050 | Transcription regulator acting as repressor of auxin-inducible gene expression. Plays role in the control of gravitropic growth and development in light-grown seedlings. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. Pseudomonas syringae type III effector AvrRpt2 stimulates AXR2 protein turnover. |
AT3G23070 | Encodes a CRM domain protein CFM3a, involved in group IIB intron splicing in chloroplasts. |
AT3G23090 | Member of the microtubule regulatory protein WVD2/WDL family WDL3 stabilizes cortical microtubules and is involved in light induced hypocotyl elongation. WDL3 is ubiquinated by COP1, leading to its degadation in the dark, |
AT3G23110 | receptor like protein 37;(source:Araport11) |
AT3G23120 | receptor like protein 38;(source:Araport11) |
AT3G23125 | Encodes a microRNA that targets the TAS1 and TAS2 families of tasiRNA-generating transcripts. Cleavage of TAS1 and TAS2 transcripts by miR173 initiates processing of these transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCGCUUGCAGAGAGAAAUCAC |
AT3G23130 | Flower-specific gene controlling the boundary of the stamen and carpel whorls. Similar to zinc finger transcription factors. Involved in shoot regenaration from root explants. |
AT3G23150 | Involved in ethylene perception in Arabidopsis The mRNA is cell-to-cell mobile. |
AT3G23160 | plant/protein (DUF668);(source:Araport11) |
AT3G23175 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
AT3G23190 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
AT3G23245 | hypothetical protein;(source:Araport11) |
AT3G23250 | Member of the R2R3 factor gene family. Key regulator of lignin biosynthesis in effector-triggered immunity |
AT3G23255 | tRNA dimethylallyltransferase;(source:Araport11) |
AT3G23270 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
AT3G23280 | Encodes a ubiquitin ligase that is a novel player in ethylene signaling involved in negatively regulating apical hook curvature, with alternative splicing controlling dual targeting to the nuclear and cytoplasmic compartments. |
AT3G23290 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
AT3G23310 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
AT3G23325 | Splicing factor 3B subunit 5/RDS3 complex subunit 10;(source:Araport11) |
AT3G23326 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCCCCUCUUUAGCUUGGAGAAG |
AT3G23360 | Protein phosphatase 2C family protein;(source:Araport11) |
AT3G23370 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G23380 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Interacts with Rop1 and is involved in pollen tube growth and function. Gene is expressed predominantly in inflorescence and flower tissue. |
AT3G23420 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G23430 | Encodes a protein with the mainly hydrophilic N-terminal and the C-terminal containing 6 potential membrane-spanning domains. The mutant is deficient in the transfer of phosphate from root epidermal and cortical cells to the xylem. Its expression is repressed by phosphate (Pi) in shoots, and transiently induced by phosphite (Phi) in roots and shoots. PHO is expressed in developing ovules and plays a role in the transfer of Ph from maternal tissues to filial tissues. |
AT3G23460 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G23480 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
AT3G23510 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
AT3G23530 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
AT3G23580 | Encodes one of the 3 ribonucleotide reductase (RNR) small subunit genes (RNR2A). Functionally redundant with the ribonucleotide reductase TSO2. mRNA was shown to specifically accumulate during the S-phase of the cell cycle in synchronized tobacco BY2 cells. Critical for cell cycle progression, DNA damage repair and plant development. |
AT3G23590 | Encodes a protein shown to physically associate with the conserved transcriptional coregulatory complex, Mediator, and is involved in the regulation of phenylpropanoid homeostasis. Acts redundantly with REF4/MED5b (At2g48110). Required for expression of some dark-upregulated genes. RFR1 is the MED5a subunit of the mediator complex. |
AT3G23605 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT3G23620 | BRIX domain containing protein, similar to RNA biogenesis factors in yeast. Binds rRNA and likely also functions in RNA biogenesis in Arabidopsis. Essential gene, mutants are embryo lethal and does not transmit well through the gametophyte. |
AT3G23630 | Encodes an isopentenyl transferase involved in cytokinin biosynthesis. |
AT3G23660 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
AT3G23710 | Tic22-like family protein;(source:Araport11) |
AT3G23727 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT3G23730 | xyloglucan endotransglucosylase/hydrolase 16;(source:Araport11) |
AT3G23760 | transferring glycosyl group transferase;(source:Araport11) |
AT3G23770 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT3G23800 | selenium-binding protein 3;(source:Araport11) |
AT3G23805 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT3G23820 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. The mRNA is cell-to-cell mobile. |
AT3G23840 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT3G23870 | magnesium transporter NIPA (DUF803);(source:Araport11) |
AT3G23880 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G23890 | Encodes a topoisomerase II that is highly expressed in young seedlings. The protein is localized in the nucleus and gene expression levels are increased in proliferative tissues. |
AT3G23930 | troponin T, skeletal protein;(source:Araport11) |
AT3G23950 | F-box protein family gene. |
AT3G23960 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G23990 | mitochondrial chaperonin HSP. assist in rapid assembly of the oligomeric protein structures in the mitochondria. |
AT3G24040 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT3G24065 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT3G24070 | Zinc knuckle (CCHC-type) family protein;(source:Araport11) |
AT3G24093 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
AT3G24140 | Encodes a basic helix-loop-helix transcription factor whose activity is required to promote differentiation of stomatal guard cells and to halt proliferative divisions in their immediate precursors. It fulfills its role through recruitment of the Arabidopsis Retinoblastoma homologue, RETINOBLASTOMA-RELATED (RBR). Both transcript and protein are expressed in and are required for halting divisions at the end of the stomatal lineage. It also has a role in the promotion of guard cell fate and in controlling the transition from guard mother cell to guard cell. Its transcript levels change after inducing MUTE expression in a mute background. |
AT3G24200 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
AT3G24210 | Ankyrin repeat family protein;(source:Araport11) |
AT3G24220 | A member of gene NCED-related gene family, encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
AT3G24230 | Pectate lyase family protein;(source:Araport11) |
AT3G24240 | RGFR1 is a leucine--rich repeat receptor kinase that, together with RGFR2 and RGFR3, binds ROOT GROWTH FACTORS and is required for establishing the gradient of PLETHORA1 and PLETHORA2 essential for proper root growth and development. |
AT3G24250 | glycine-rich protein;(source:Araport11) |
AT3G24255 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT3G24260 | paired amphipathic helix Sin3-like protein;(source:Araport11) |
AT3G24280 | small acidic protein 2;(source:Araport11) |
AT3G24300 | Encodes a plasma membrane localized ammonium transporter. |
AT3G24330 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT3G24360 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
AT3G24420 | DLK2 is a divergent member of the DWARF14 family. It's expression is dependent on D14 and KAI2 but it does not appear to play a role in stringolactone metabolism. |
AT3G24440 | Encodes Vernalization Insensitive 3-like 1 (VIL1). VIL1 is involved in the photoperiod and vernalization of Arabidopsis by regulating expression of the related floral repressors Flowering Locus C (FLC) and Flowering Locus M (FLM). VIL1, along with VIN3 (Vernalization Insensitive 3) is necessary for the chromatin modification to FLC and FLM. |
AT3G24450 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT3G24460 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
AT3G24465 | Encodes a Plant thionin family protein |
AT3G24490 | Alcohol dehydrogenase transcription factor Myb/SANT-like family protein;(source:Araport11) |
AT3G24495 | encodes a DNA mismatch repair homolog of human MutS gene, MSH6. There are four MutS genes in Arabidopsis, MSH2, MSH3, MSH6, and MSH7, which all act as heterodimers and bind to 51-mer duplexes. MSH2*MSH7 exhibit moderate affinity for a (T/G) substrate and weak binding of (+T), suggesting MSH2*MSH7 may be specialized for lesions/base mispairs not tested or for (T/G) mispairs in special contexts. |
AT3G24500 | One of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is specifically elevated in response to pathogen infection, salinity, drought, heat, hydrogen peroxide, and application of abscisic acid or salicylic acid. Constitutive expression enhances the tolerance of transgenic plants to various biotic and abiotic stresses. |
AT3G24530 | AAA-type ATPase family protein / ankyrin repeat family protein;(source:Araport11) |
AT3G24535 | hypothetical protein;(source:Araport11) |
AT3G24580 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G24615 | Encodes a Z43 snoRNA. Gb: AJ240080 |
AT3G24620 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT3G24640 | lyase;(source:Araport11) |
AT3G24650 | Homologous to the maize transcription factor Viviparous-1. Full length ABI3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of ABI3 requires the B3 DNA-binding domain and an activation domain. In addition to the known N-terminal-located activation domain, a second transcription activation domain was found in the B1 region of ABI3. ABI3 is essential for seed maturation. Regulator of the transition between embryo maturation and early seedling development. Putative seed-specific transcriptional activator. ABI3 is a central regulator in ABA signaling and is unstable in vivo. It interacts with and can by polyubiquitinated by AIP2 in vivo. Based on double mutant analyses, ABI3 interacts genetically with both FUS3 and LEC1 and is involved in controlling accumulation of chlorophyll and anthocyanins, sensitivity to abscisic acid, and expression of the members of the 12S storage protein gene family. In addition, both FUS3 and LEC1 regulate positively the abundance of the ABI3 protein in the seed. Alternative splicing of ABI3 is developmentally regulated by SUA (AT3G54230). |
AT3G24690 | hypothetical protein;(source:Araport11) |
AT3G24740 | cellulose synthase, putative (DUF1644);(source:Araport11) |
AT3G24750 | Encodes a member of the LAZY gene family that is expressed in the hypocotyl and the root |
AT3G24760 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT3G24770 | Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini. The C-terminal 12 amino acid sequence of CLE41 is identical to that of a dodeca peptide (TDIF, tracheary element differentiation inhibitory factor) isolated from Arabidopsis and functions as a suppressor of plant stem cell differentiation. TDIF sequence is also identical to the C-terminal 12 amino acids of CLE44 (At4g13195). The protein is expressed in the vascular system and is involved in axillary bud formation. The mRNA is cell-to-cell mobile. |
AT3G24780 | Uncharacterized conserved protein UCP015417, vWA;(source:Araport11) |
AT3G24810 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. |
AT3G24900 | receptor like protein 39;(source:Araport11) |
AT3G24929 | hypothetical protein;(source:Araport11) |
AT3G25030 | RING/U-box superfamily protein;(source:Araport11) |
AT3G25050 | Encodes an endotransglucosylase that cleaves the beta-1,4-glucosidic linkage in amorphous cellulose and ligates the nascent reducing end to a non-reducing terminus of either cellulosic or xyloglucan oligosaccharide. Higher expression in flowers and in response to IAA treatment. |
AT3G25110 | Encodes a FatA acyl-ACP thioesterase |
AT3G25120 | Mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein;(source:Araport11) |
AT3G25170 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT3G25220 | immunophilin (FKBP15-1) |
AT3G25225 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G25250 | Arabidopsis protein kinase The mRNA is cell-to-cell mobile. |
AT3G25290 | Auxin-responsive family protein;(source:Araport11) |
AT3G25450 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.7e-211 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT3G25460 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G25470 | bacterial hemolysin-like protein;(source:Araport11) |
AT3G25480 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
AT3G25485 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.3e-49 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT3G25490 | Protein kinase family protein;(source:Araport11) |
AT3G25510 | disease resistance protein (TIR-NBS-LRR class) family protein;(source:Araport11) |
AT3G25550 | F-box family protein;(source:Araport11) |
AT3G25560 | NSP-interacting kinase 2;(source:Araport11) |
AT3G25570 | S-adenosylmethionine decarboxylase family member. |
AT3G25573 | transmembrane protein;(source:Araport11) |
AT3G25577 | hypothetical protein;(source:Araport11) |
AT3G25590 | micronuclear linker histone polyprotein-like protein;(source:Araport11) |
AT3G25597 | transmembrane protein;(source:Araport11) |
AT3G25600 | Calmodulin like protein. Paralog of CML15. |
AT3G25620 | ABC-2 type transporter family protein;(source:Araport11) |
AT3G25630 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 7.8e-20 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT3G25640 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT3G25650 | SKP1-like 15;(source:Araport11) |
AT3G25655 | Similar to Inflorescence Deficient in Abscission (IDA). Involved in floral organ abscission. |
AT3G25660 | Amidase family protein;(source:Araport11) |
AT3G25710 | Encodes a basic helix-loop-helix transcription factor that is expressed in the hypophysis-adjacent embryo cells, and is required and partially sufficient for MP-dependent root initiation. Involved in response to phosphate starvation. Negative regulator of root hair development, anthocyanin formation and Pi content. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
AT3G25717 | ROTUNDIFOLIA like 16;(source:Araport11) |
AT3G25719 | hypothetical protein;(source:Araport11) |
AT3G25720 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT3G25725 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.3e-213 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT3G25730 | ethylene response DNA binding factor 3;(source:Araport11) |
AT3G25740 | Encodes a plastid localized methionine aminopeptidase. Formerly called MAP1C, now called MAP1B. |
AT3G25760 | encodes allene oxide cyclase. One of four genes in Arabidopsis that encode this enzyme, which catalyzes an essential step in jasmonic acid biosynthesis. Gene expression is induced during senescence, a process that involves jasmonic acid signalling pathway. The mRNA is cell-to-cell mobile. |
AT3G25890 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. The mRNA is cell-to-cell mobile. |
AT3G25900 | Homocysteine S-methyltransferase family protein;(source:Araport11) |
AT3G25960 | Pyruvate kinase family protein;(source:Araport11) |
AT3G25980 | Encodes MAD2 (MITOTIC ARREST-DEFICIENT 2). May have the spindle assembly checkpoint protein functions conserved from yeast to humans. |
AT3G26010 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT3G26040 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT3G26050 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
AT3G26090 | Encodes AtRGS1, a putative membrane receptor for D-glucose. Also functions as a regulator of G-protein signaling. Has GTPase-accelerating activity. Regulates the activity of AtGPA1. Lines over-expressing the gene are more tolerant to dehydration and root elongation. These phenotypes are dependent on ABA. Nuclear localization of the protein is dependent on ABA. RGS1 endocytosis is induced by JA which promotes its dissociation from GPA1. |
AT3G26100 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT3G26120 | Similar to terminal ear1 in Zea mays. A member of mei2-like gene family; phylogenetic analysis revealed that TEL1 belongs to the third clade of mei2-like proteins (TEL clade), with conserved two N-terminal RNA recognition motifs (RRM), in addition to the C-terminal RRM, shared among all mei2-like proteins. |
AT3G26125 | encodes a protein with cytochrome P450 domain |
AT3G26140 | Cellulase (glycosyl hydrolase family 5) protein;(source:Araport11) |
AT3G26150 | putative cytochrome P450 |
AT3G26160 | putative cytochrome P450 |
AT3G26165 | putative cytochrome P450. |
AT3G26190 | putative cytochrome P450 |
AT3G26200 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
AT3G26210 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
AT3G26220 | cytochrome P450 monooxygenase |
AT3G26230 | putative cytochrome P450 |
AT3G26235 | hypothetical protein;(source:Araport11) |
AT3G26250 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G26265 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.1e-76 P-value blast match to Q9SLM0 /314-478 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT3G26270 | putative cytochrome P450 |
AT3G26280 | cytochrome P450 monooxygenase |
AT3G26290 | putative cytochrome P450 |
AT3G26295 | putative cytochrome P450. |
AT3G26300 | putative cytochrome P450 |
AT3G26320 | putative cytochrome P450 |
AT3G26330 | putative cytochrome P450 |
AT3G26340 | N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein;(source:Araport11) |
AT3G26350 | proline-rich receptor-like kinase;(source:Araport11) |
AT3G26380 | APSE is a member of the Glycoside Hydrolase (GH27) family that functions as a β-l-arabinopyranosidase. |
AT3G26390 | hypothetical protein;(source:Araport11) |
AT3G26440 | transmembrane protein, putative (DUF707);(source:Araport11) |
AT3G26470 | Powdery mildew resistance protein, RPW8 domain-containing protein;(source:Araport11) |
AT3G26480 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT3G26486 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G26490 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT3G26500 | Encodes PIRL2, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
AT3G26520 | gamma tonoplast intrinsic protein 2 (TIP2). expressed throughout the plant and transcript level is increased upon NaCl or ABA treatments. NaCl stress-sensitive yeast mutant strains exhibit more resistance to salt when expressing this protein. |
AT3G26530 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G08740.1);(source:TAIR10) |
AT3G26570 | low affinity phosphate transporter |
AT3G26600 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
AT3G26610 | Encodes an apoplast-localized polygalacturonase involved in cell elongation and flower development. |
AT3G26612 | Has been identified as a translated small open reading frame by ribosome profiling. |
AT3G26670 | magnesium transporter, putative (DUF803);(source:Araport11) |
AT3G26710 | cofactor assembly of complex C;(source:Araport11) |
AT3G26740 | transcripts are differentially regulated at the level of mRNA stability at different times of day controlled by the circadian clock. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. |
AT3G26742 | hypothetical protein;(source:Araport11) |
AT3G26744 | Encodes a MYC-like bHLH transcriptional activator that binds specifically to the MYC recognition sequences in the CBF3 promoter. It also binds to and inhibits the expression of ABI3. Mutants are defective in cold-regulated gene expression and ABA signaling druing seed germination.. Cold stress triggers protein degradation of nuclear GFPICE1 protein, and the RING finger protein HOS1 is required. Sumoylation of ICE1 controls CBF3/DREB1A expression and freezing tolerance. Together with ZOU, ICE1 determines primary seed dormancy depth independently of their joint role in endosperm development.ICE1 interacts with ABI5. Also members of the DELLA family, which repress ICE1 function. |
AT3G26780 | Encodes MEF14 (mitochondrial editing factor 14), a PPR (pentatricopeptide repeat proteins) protein required for RNA editing at site matR-1895 in mitochondria. The mRNA is cell-to-cell mobile. |
AT3G26790 | Transcriptional factor with high similarity to the B3 region of the VP1/ABI3-like proteins. Full length FUS3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of FUS3 requires the B3 DNA-binding domain and an activation domain. FUS3 specifies cotyledon identity. Regulator of gene expression during late embryogenesis. Involved in the control foliar organ identity in Arabidopsis by regulating the synthesis of two hormones, abscisic acid and gibberellin. FUS3 together with LEC1 positively regulate the abundance of the ABI3 protein in the seed. |
AT3G26800 | transmembrane protein;(source:Araport11) |
AT3G26805 | pseudogene of Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G26810 | Auxin F box protein, the dominant auxin receptor in roots. |
AT3G26820 | Esterase/lipase/thioesterase family protein;(source:Araport11) |
AT3G26830 | Mutations in pad3 are defective in biosynthesis of the indole derived phytoalexin camalexin. Encodes a cytochrome P450 enzyme that catalyzes the conversion of dihydrocamalexic acid to camalexin. The mRNA is cell-to-cell mobile. |
AT3G26840 | Encodes a protein with phytyl ester synthesis and diacylglycerol acyltransferase activities that is involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. |
AT3G26880 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT3G26900 | Encodes a protein with some sequence similarity to shikimate kinases, but a truncated form of this protein (lacking a putative N-terminal chloroplast transit peptide) does not have shikimate kinase activity in vitro. skl1-3 mutants have a variegated phenotype and skl1-8 mutants have an albino phenotype consistent with the observation of chloroplast defects in these mutants. |
AT3G26910 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G26930 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
AT3G26934 | hypothetical protein;(source:Araport11) |
AT3G26935 | DHHC-type zinc finger family protein;(source:Araport11) |
AT3G26940 | Receptor-like cytoplasmic kinase, RLCKVII subfamily. Overexpression causes abnormal differential and elongation growth after organ differentiation. |
AT3G26980 | membrane-anchored ubiquitin-fold protein 4 precursor;(source:Araport11) |
AT3G27000 | encodes a protein whose sequence is similar to actin-related proteins (ARPs) in other organisms. its transcript level is down regulated by light and is expressed in very low levels in all organs examined. |
AT3G27010 | Belongs to a TCP protein transcription factor family. Members of this family contain a predicted basic-helix-loop-helix domain involved in DNA binding. Related to rice PCF1 and PCF2 genes. Binds to the GCCCR element of CYCB1;1. Involved in regulation of expression of cell cycle control and ribosomal protein genes. |
AT3G27027 | GPI-anchored-like protein (DUF 3339);(source:Araport11) |
AT3G27030 | transmembrane protein;(source:Araport11) |
AT3G27050 | plant/protein;(source:Araport11) |
AT3G27070 | Form of TOM20, which is a component of the TOM complex, involved in transport of nuclear-encoded mitochondrial proteins |
AT3G27150 | Target gene of MIR2111-5p. |
AT3G27160 | GHS1 encodes plastid ribosomal protein S21 The mRNA is cell-to-cell mobile. |
AT3G27180 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G27220 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT3G27230 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G27280 | Part of protein complexes that are necessary for proficient mitochondrial function or biogenesis, thereby supporting cell division and differentiation in apical tissues |
AT3G27290 | RNI-like superfamily protein;(source:Araport11) |
AT3G27325 | hydrolases, acting on ester bond;(source:Araport11) |
AT3G27327 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.7e-320 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G27330 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT3G27331 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT3G27340 | Myb domain protein;(source:Araport11) |
AT3G27390 | transmembrane protein;(source:Araport11) |
AT3G27400 | Encodes a pectate lyase involved in response to nematodes. |
AT3G27430 | Encodes 20S proteasome beta subunit PBB1 (PBB1). |
AT3G27440 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
AT3G27540 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT3G27580 | D6PK family kinase involved in pulse-induced phototropism but also for time-dependent second positive phototropism, and continuous light-induced hypocotyl phototropism.D6PKL3 is polarly localized within the plasma membrane. It is involved in pollen aperture formation. The protein is localized within distinct regions of the pollen plasma membrane and mutants are also defective in pollen aperture formation. |
AT3G27620 | encodes an isoform of alternate oxidase. expressed in all tissues examined and expression is not induced by antimycin A, an inhibitor of complex III in the mitochondrial respiratory chain. |
AT3G27630 | SMR7 is a member of the SIAMESE-RELATED Cyclin-Dependent Kinase Inhibitor family. It is induced by ROS/oxidative stress. |
AT3G27650 | LOB domain-containing protein 25;(source:Araport11) |
AT3G27670 | A novel protein, did not show high similarity to any protein of known function; reveals a novel genetic connection between lipid synthesis and embryo development. Expressed in all tissues examined including leaves, flowers, roots, stems, and siliques, but accumulation levels were not correlated with the degree to which different organs appeared affected by the mutation. Mutant plants showed alterations in the cuticular wax profiles and embryo development. The mRNA is cell-to-cell mobile. |
AT3G27680 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT3G27730 | DNA helicase required for interference-sensitive meiotic crossover events. |
AT3G27750 | Encodes a pentatricopeptide repeat (PPR) protein required for the splicing of specific group II introns. Null alleles are embryo lethal. |
AT3G27770 | plant/protein;(source:Araport11) |
AT3G27785 | MYB118 encodes a myb transcription factor that represses endosperm maturation and, along with MYB115, regulates glucosinolate biosynthesis. |
AT3G27865 | snoRNA;(source:Araport11) |
AT3G27870 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
AT3G27880 | hypothetical protein (DUF1645);(source:Araport11) |
AT3G27900 | hypothetical protein (DUF1184);(source:Araport11) |
AT3G27940 | LOB domain-containing protein 26;(source:Araport11) |
AT3G27950 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G27960 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
AT3G27965 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.5e-26 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
AT3G28010 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G38037.1);(source:TAIR10) |
AT3G28020 | DNA-binding protein;(source:Araport11) |
AT3G28040 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
AT3G28050 | nodulin MtN21-like transporter family protein |
AT3G28070 | nodulin MtN21-like transporter family protein |
AT3G28080 | nodulin MtN21-like transporter family protein |
AT3G28140 | RNA ligase/cyclic nucleotide phosphodiesterase family protein;(source:Araport11) |
AT3G28150 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. A putative xyloglucan O-acetyltransferase. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT3G28155 | hypothetical protein;(source:Araport11) |
AT3G28170 | hypothetical protein;(source:Araport11) |
AT3G28180 | encodes a gene similar to cellulose synthase The mRNA is cell-to-cell mobile. |
AT3G28190 | transmembrane protein;(source:Araport11) |
AT3G28193 | transmembrane protein;(source:Araport11) |
AT3G28200 | Peroxidase superfamily protein;(source:Araport11) |
AT3G28210 | Encodes a putative zinc finger protein (PMZ). |
AT3G28223 | F-box family protein;(source:Araport11) |
AT3G28310 | hypothetical protein (DUF677);(source:Araport11) |
AT3G28315 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-224 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT3G28340 | Encodes a protein with putative galacturonosyltransferase activity. |
AT3G28345 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
AT3G28350 | Pseudogene of AT3G28350; unknown protein |
AT3G28370 | spindle assembly checkpoint component;(source:Araport11) |
AT3G28380 | P-glycoprotein 17;(source:Araport11) |
AT3G28390 | P-glycoprotein 18;(source:Araport11) |
AT3G28400 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 4.6e-39 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
AT3G28412 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-08 P-value blast match to GB:AAC34906 reverse transcriptase (LINE-element) (Forficula auricularia);(source:TAIR10) |
AT3G28420 | Putative membrane lipoprotein;(source:Araport11) |
AT3G28455 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can not replace CLV3 function in vivo.CLE25 participates in long distance signaling in response to dehydration. It produces a graft transmissible signal from root to shoot that induces ABA synthesis and results in stomatal closure. The BAM1 and BAM3 receptor-kinases are likely receptors for CLE25 as they are required for this signaling. |
AT3G28470 | Member of the R2R3 factor gene family. Its E-box is critical for the DYT1- bHLH089 heterocomplex to bind to and activate its transcription. |
AT3G28490 | 2-oxoglutarate-dependent dioxygenase |
AT3G28510 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G28540 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G28550 | Proline-rich extensin-like family protein;(source:Araport11) |
AT3G28560 | BCS1 AAA-type ATPase;(source:Araport11) |
AT3G28570 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G28580 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G28590 | transmembrane protein;(source:Araport11) |
AT3G28600 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G28610 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G28670 | oxidoreductase, zinc-binding dehydrogenase family protein;(source:Araport11) |
AT3G28700 | NADH dehydrogenase ubiquinone complex I, assembly factor-like protein (DUF185);(source:Araport11) |
AT3G28730 | encodes a component of the FAcilitates Chromatin Transcription (FACT) complex, SSRP1. Along with STP16 binds to the promoter of FLC. |
AT3G28740 | Encodes a member of the cytochrome p450 family. Expression is upregulated in response to cis-jasmonate treatment. Overexpression induces synthesis of volatile compounds that affect chemical ecology and insect interactions. |
AT3G28770 | transmembrane protein, putative (DUF1216);(source:Araport11) |
AT3G28780 | transmembrane protein, putative (DUF1216);(source:Araport11) |
AT3G28790 | transmembrane protein, putative (DUF1216);(source:Araport11) |
AT3G28810 | mediator of RNA polymerase II transcription subunit-like protein, putative (DUF1216);(source:Araport11) |
AT3G28820 | mediator of RNA polymerase II transcription subunit-like protein, putative (DUF1216);(source:Araport11) |
AT3G28850 | Glutaredoxin family protein;(source:Araport11) |
AT3G28860 | Encodes a member of the ATP-binding cassette (ABC) transporter family that is involved in auxin transport and is involved in postembryonic organ separation. Also known as AtMDR11 and PGP19. Possibly regulates auxin-dependent responses by influencing basipetal auxin transport in the root. Acts upstream of phyA in regulating hypocotyl elongation and gravitropic response. Exerts nonredundant, partially overlapping functions with the ABC transporter encoded by AtPGP1. |
AT3G28880 | serine/threonine-protein phosphatase 6 regulatory ankyrin repeat subunit;(source:Araport11) |
AT3G28890 | receptor like protein 43;(source:Araport11) |
AT3G28917 | mini zinc finger 2;(source:Araport11) |
AT3G28920 | homeobox protein 34;(source:Araport11) |
AT3G28923 | Pseudogene of AT5G01080; beta-galactosidase |
AT3G28940 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
AT3G28980 | mediator of RNA polymerase II transcription subunit-like protein, putative (DUF1216);(source:Araport11) |
AT3G28985 | Encodes a ECA1 gametogenesis related family protein [pseudogene] |
AT3G29034 | transmembrane protein;(source:Araport11) |
AT3G29035 | Encodes a protein with transcription factor activity. Note: this protein (AT3G29035) on occasion has also been referred to as AtNAC3, not to be confused with the AtNAC3 found at locus AT3G15500. The mRNA is cell-to-cell mobile. |
AT3G29037 | Pseudogene of AT5G35760; beta-galactosidase |
AT3G29050 | receptor-like protein kinase-like protein;(source:Araport11) |
AT3G29060 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT3G29075 | glycine-rich protein;(source:Araport11) |
AT3G29153 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.3e-238 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT3G29156 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.9e-175 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G29160 | encodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It has also been shown to interact with the WD protein PDL1. |
AT3G29170 | transmembrane protein (DUF872);(source:Araport11) |
AT3G29180 | DUF1336 family protein (DUF1336);(source:Araport11) |
AT3G29185 | Encodes a chloroplast protein that interacts with the CF1β, γ, and ε subunits of the chloroplast ATP synthase and is required for assembly of its F1 module. The protein is comprised primarily of two β-barrels and acts as a chaperone orchestrating the early steps of the CF1 assembly pathway via specific interaction with the CF1 β, γ, and ε subunits. |
AT3G29200 | L-ascorbate peroxidase |
AT3G29255 | Putative pentacyclic triterpene synthase 7;(source:Araport11) |
AT3G29260 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G29265 | transposable_element_gene;(source:Araport11);similar to zinc knuckle (CCHC-type) family protein [Arabidopsis thaliana] (TAIR:AT5G32482.1);(source:TAIR10) |
AT3G29290 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G29300 | transmembrane protein;(source:Araport11) |
AT3G29320 | Encodes a plastidic alpha-glucan phosphorylase. In vitro, the enzyme has a preference for maltooligosaccharides, such as maltoheptaose. The mRNA is cell-to-cell mobile. |
AT3G29330 | zinc finger RNA-binding-like protein;(source:Araport11) |
AT3G29340 | zinc finger (C2H2 type) family protein;(source:Araport11) |
AT3G29360 | Encodes one of four UDP-glucose dehydrogenase UGD) genes. Mutation of this gene in combination with UGD3 leads to swollen plant cell walls and severe developmental defects associated with changes in pectic polysaccharides. |
AT3G29370 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
AT3G29400 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT3G29520 | pseudogene of hypothetical protein;(source:Araport11) |
AT3G29572 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G29575 | ABI five binding protein 3;(source:Araport11) |
AT3G29577 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.0e-133 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT3G29590 | At3g29590 (At5MAT) encodes a malonyl-CoA:anthocyanidin 5-O-glucoside-6"-O-malonyltransferase that is coordinately expressed with a epistatic 5-O-anthocyanidin glucosyltransferase (At4g14090). The enzyme is involved in the malonylation of anthocyanins in Arabidopsis. |
AT3G29618 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.5e-16 P-value blast match to Q9SI25 /181-349 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT3G29630 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G29639 | hypothetical protein;(source:Araport11) |
AT3G29670 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. The mRNA is cell-to-cell mobile. |
AT3G29725 | pseudogene of HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT3G29760 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT3G29770 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
AT3G29774 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.6e-07 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G29779 | transposable_element_gene;(source:Araport11);pseudogene, similar to SAE1-S9-protein, blastp match of 33%25 identity and 2.8e-14 P-value to GP|4760708|dbj|BAA77394.1||AB012866 SAE1-S9-protein {Brassica rapa};(source:TAIR10) |
AT3G29792 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-243 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT3G29800 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G29810 | During the course of seed coat epidermal cell differentiation, COBRA-LIKE 2 plays a role in cellulose deposition into mucilage secretory cells of Arabidopsis seeds. COBRA-LIKE 2 affects mucilage solubility and cellulosic ray formation. |
AT3G29830 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G29970 | B12D protein;(source:Araport11) |
AT3G30110 | pseudogene of DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
AT3G30145 | transposable_element_gene;(source:Araport11);pseudogene, putative helicase protein, blastp match of 39%25 identity and 7.7e-124 P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT3G30170 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.2e-51 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT3G30180 | Encodes a cytochrome p450 enzyme that catalyzes the last reaction in the production of brassinolide. It is capable of converting 6-deoxocastasterone into castasterone, a C-6 oxidation, as well as the further conversion of castasterone into brassinolide by a Baeyer-Villinger oxidation reaction at C-6, resulting in the formation of an unusual seven-membered lactone ring. The enzyme possesses high affinity for both C28- and C27-Brassinosteroids. The expression of the gene using a CYP85A2 promoter:LUC fusion construct was shown to be under circadian and light control. |
AT3G30212 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.6e-19 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT3G30213 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-53 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT3G30214 | pseudogene of transmembrane protein;(source:Araport11) |
AT3G30216 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains some similarity to polyproteins;(source:TAIR10) |
AT3G30230 | myosin heavy chain-like protein;(source:Araport11) |
AT3G30280 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT3G30290 | a member of cytochrome P450 gene family |
AT3G30320 | hypothetical protein;(source:Araport11) |
AT3G30335 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 2.2e-129 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
AT3G30350 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
AT3G30440 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT3G47260.1);(source:TAIR10) |
AT3G30510 | transposable_element_gene;(source:Araport11) |
AT3G30520 | heat shock protein;(source:Araport11) |
AT3G30530 | basic leucine-zipper 42;(source:Araport11) |
AT3G30580 | hypothetical protein;(source:Araport11) |
AT3G30630 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-300 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT3G30705 | transmembrane protein;(source:Araport11) |
AT3G30715 | transposable_element_gene;(source:Araport11);expressed protein;(source:TAIR10) |
AT3G30722 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 4.1e-24 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
AT3G30737 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, blastp match of 48%25 identity and 0. P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT3G30745 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.2e-26 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G30749 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 9.4e-205 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT3G30775 | Encodes a proline oxidase that is predicted to localize to the inner mitochondrial membrane, its mRNA expression induced by high levels of Al and by osmotic stress. The promoter contains an L-proline-inducible element. |
AT3G30790 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.0e-149 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
AT3G30805 | Class II aminoacyl-tRNA and biotin synthetases superfamily protein;(source:Araport11) |
AT3G30839 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-11 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G30841 | Cofactor-independent phosphoglycerate mutase;(source:Araport11) |
AT3G30842 | pleiotropic drug resistance 10;(source:Araport11) |
AT3G30875 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT3G31317 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.9e-32 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G31365 | transposable_element_gene;(source:Araport11);pseudogene, putative helicase, similar to putative helicase GB:AAD15468 GI:4263825 from (Arabidopsis thaliana);(source:TAIR10) |
AT3G31367 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.1e-71 P-value blast match to GB:226407 retrotransposon del1-46 (Gypsy_Ty3-element) (Lilium henryi);(source:TAIR10) |
AT3G31908 | pseudogene of Reticulon family protein;(source:Araport11) |
AT3G31915 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G31370.1);(source:TAIR10) |
AT3G31950 | nucleic acid-binding/zinc ion-binding protein;(source:Araport11) |
AT3G31970 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.3e-294 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
AT3G32031 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.0e-53 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT3G32040 | Chloroplast localized GFDP synthase. |
AT3G32043 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.2e-40 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G32240 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 4.9e-90 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G32360 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.8e-18 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
AT3G32383 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.7e-05 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT3G32389 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G32925 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.1e-13 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT3G32966 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G33055 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-282 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT3G33058 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-112 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT3G33070 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.8e-191 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT3G33124 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 6.5e-171 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT3G33130 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.9e-256 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT3G33163 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G33193 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.4e-232 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10) |
AT3G33520 | Encodes ACTIN-RELATED PROTEIN6 (ARP6), a putative component of a chromatin-remodeling complex. Required for both histone acetylation and methylation of the FLC chromatin in Arabidopsis. Along with PIE1 forms a complex to deposit modified histone H2A.Z at several loci within the genome. This modification alters the expression of the target genes (i.e. FLC, MAF4, MAF6). Incorporation of this variant histone into chromatin mediates the ambient temperature response. Located at specific regions of the nuclear periphery. Expression throughout plants shown by in-situ and immunolocalization methods. Mutants show defects in fertility, leaf, flower and inflorescence development and shorter flowering times. ARP6 also is involved in globally controlling developmental responses to ambient temperature through incorporation of variant histone H2A.Z into chromatin. |
AT3G33530 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT3G41768 | rRNA;(source:Araport11) |
AT3G41979 | 5.8SrRNA |
AT3G42090 | transposable_element_gene;(source:Araport11);contains domain LIN-9 RELATED (PTHR21689);(source:TAIR10) |
AT3G42130 | glycine-rich protein;(source:Araport11) |
AT3G42150 | transmembrane protein;(source:Araport11) |
AT3G42178 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-197 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT3G42180 | Exostosin family protein;(source:Araport11) |
AT3G42181 | transposable_element_gene;(source:Araport11) |
AT3G42190 | transposable_element_gene;(source:Araport11);similar to cysteine-type peptidase [Arabidopsis thaliana] (TAIR:AT3G42820.1);(source:TAIR10) |
AT3G42220 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.9e-166 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
AT3G42245 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-95 P-value blast match to GB:AAC64917 gag-pol polyprotein (Ty1_Copia-element) (Glycine max);(source:TAIR10) |
AT3G42250 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G48720.1);(source:TAIR10) |
AT3G42280 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.3e-71 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G42350 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G06095.1);(source:TAIR10) |
AT3G42386 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.5e-116 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10) |
AT3G42390 | hypothetical protein;(source:Araport11) |
AT3G42430 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G37045.1);(source:TAIR10) |
AT3G42434 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 8.5e-111 P-value blast match to gb|AAL06419.1|AF378075_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10) |
AT3G42460 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G05570.1);(source:TAIR10) |
AT3G42542 | Encodes a defensin-like (DEFL) family protein. |
AT3G42550 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G42553 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.6e-22 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT3G42570 | peroxidase family protein;(source:Araport11) |
AT3G42622 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 0. P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT3G42640 | H[+]-ATPase 8;(source:Araport11) |
AT3G42711 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.7e-08 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT3G42722 | pseudogene of the F-box protein family |
AT3G42766 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.1e-274 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
AT3G42790 | Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7). |
AT3G42794 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.2e-05 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT3G42798 | transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBb0043H09.1, similar to En/Spm-like transposon protein;(source:TAIR10) |
AT3G42800 | AF-like protein;(source:Araport11) |
AT3G42820 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10) |
AT3G42835 | transposable_element_gene;(source:Araport11);non-LTR retroelement reverse transcriptase -related, temporary automated functional assignment;(source:TAIR10) |
AT3G42850 | Mevalonate/galactokinase family protein;(source:Araport11)arabinokinase activity |
AT3G42880 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G42886 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-89 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT3G42890 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.4e-10 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G42960 | Arabidopsis homolog of TASSELSEED2. Expressed specifically in tapetal cells. |
AT3G43123 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
AT3G43170 | hypothetical protein;(source:Araport11) |
AT3G43180 | RING/U-box superfamily protein;(source:Araport11) |
AT3G43190 | Encodes a protein with sucrose synthase activity (SUS4). |
AT3G43210 | Encodes a kinesin TETRASPORE. Required for cytokinesis in pollen. In mutants, all four microspore nuclei remain within the same cytoplasm after meiosis. |
AT3G43220 | Phosphoinositide phosphatase family protein;(source:Araport11) |
AT3G43250 | coiled-coil protein (DUF572);(source:Araport11) |
AT3G43251 | Pseudogene of AT5G26880; tRNA/rRNA methyltransferase (SpoU) family protein |
AT3G43358 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.8e-69 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT3G43444 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.9e-293 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G43505 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT3G43510 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-11 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
AT3G43522 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative Ta11-like non-LTR retroelement protein;(source:TAIR10) |
AT3G43573 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.7e-27 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT3G43580 | Beta-galactosidase related protein;(source:Araport11) |
AT3G43622 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.7e-37 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G43670 | Copper amine oxidase family protein;(source:Araport11) |
AT3G43710 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT3G43720 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT3G43726 | transposable_element_gene;(source:Araport11);pseudogene, similar to P0703B11.15, blastp match of 44%25 identity and 1.3e-42 P-value to GP|18844826|dbj|BAB85296.1||AP003302 P0703B11.15 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT3G43750 | E3 ubiquitin ligases, member of the RING between RING fingers (RBR)-type RSL1/RFA family, are key regulators of ABA receptor stability in root and leaf tissues, targeting ABA receptors for degradation in different subcellular locations. |
AT3G43760 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
AT3G43770 | transposable_element_gene;(source:Araport11);similar to disease resistance protein (TIR-NBS-LRR class), putative [Arabidopsis thaliana] (TAIR:AT5G45230.1);(source:TAIR10) |
AT3G43800 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). The mRNA is cell-to-cell mobile. |
AT3G43820 | pseudogene of Copper amine oxidase family protein;(source:Araport11) |
AT3G43835 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.4e-26 P-value blast match to GB:NP_038604 L1 repeat, Tf subfamily, member 26 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G43850 | hypothetical protein;(source:Araport11) |
AT3G43870 | hypothetical protein;(source:Araport11) |
AT3G43890 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G43920 | Encodes a ribonuclease III family protein that is required for endogenous RDR2-dependent siRNA (but not miRNA) formation. |
AT3G43930 | BRCT domain-containing DNA repair protein;(source:Araport11) |
AT3G43950 | Protein kinase superfamily protein;(source:Araport11) |
AT3G43960 | Encodes a putative cysteine proteinase. Mutants exhibit shorter root hairs under phosphate-deficient conditions. |
AT3G44005 | pseudogene of Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT3G44090 | F-box family protein;(source:Araport11) |
AT3G44093 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.4e-162 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10) |
AT3G44100 | MD-2-related lipid recognition domain-containing protein;(source:Araport11) |
AT3G44110 | homologous to the co-chaperon DNAJ protein from E coli |
AT3G44150 | Expp1 protein;(source:Araport11) |
AT3G44170 | plant self-incompatibility protein S1 family protein;(source:Araport11) |
AT3G44175 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, similar to reverse transcriptase, putative;(source:TAIR10) |
AT3G44190 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
AT3G44200 | Encodes AtNek5, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.Interacts physically with plant kinesins ARK1 and ARK2. Mutants show defects in root epidermal cell morphology, trichome branching and other epidermal cell abnormalities suggesting a rol e in epidermal cell differentiation. NEK6 co-localizes with cortical microtubules. |
AT3G44220 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT3G44235 | transmembrane protein;(source:Araport11) |
AT3G44250 | putative cytochrome P450 |
AT3G44260 | Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses. |
AT3G44262 | pseudogene of subtilisin-like serine protease 2;(source:Araport11) |
AT3G44264 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-99 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT3G44280 | peptidyl-prolyl cis-trans isomerase G;(source:Araport11) |
AT3G44300 | Encodes an enzyme that catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (nitrile aminohydrolase, EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. Mutants have reduced sensitivity to IAN and are sensitive to IAA. This enzyme likely participates in other non-auxin-related metabolic pathways. The mRNA is cell-to-cell mobile. |
AT3G44310 | Mutants are resistant to indole-3-acetonitrile (IAN). NIT1 catalyzes the terminal activation step in indole-acetic acid biosynthesis. Predominantly expressed isoform of nitrilase isoenzyme family. Aggregation of NIT1 in cells directly abutting wound sites is one of the earliest events associated with wound and herbicide-induced cell death. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. It is also involved in the conversion of IAN to IAM (indole-3-acetamide) and other non-auxin-related metabolic processes. The mRNA is cell-to-cell mobile. |
AT3G44320 | This enzyme catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. It is the only one of the four Arabidopsis nitrilases whose mRNA levels are strongly induced when plants experience sulphur deprivation. This enzyme likely participates in other non-auxin-related metabolic pathways. |
AT3G44340 | homologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions. |
AT3G44350 | NAC domain containing protein 61;(source:Araport11) |
AT3G44370 | Member of the Oxa1 super family protein insertases. Involved in biogenesis of mitochondrial respiratory chain complex IV, specifically via membrane insertion of COX2. |
AT3G44410 | pseudogene of Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT3G44450 | Plant specific protein.BIC1 and BIC2 inhibit cryptochrome function by blocking blue light-dependent cryptochrome dimerization.Light activated transcription of BICs is mediated by cryptochromes. |
AT3G44510 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G44530 | Encodes a nuclear localized WD-repeat containing protein involved in negative regulation of knox gene expression via epigenetic mechanism of chromatin re-organization. It is a part of the HISTONE REGULATOR complex that deposits histones in a DNA synthesis-independent manner and affects both nucleosome occupancy and the maintenance of transcriptional silencing. Interacts physically and genetically with AS1. Expressed in meristem and leaf primordia. Homozygous mutants are embryo lethal. Phenotype of cosuppressed lines is variable but show effects on leaf development similar to as1/as2. |
AT3G44540 | Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. The mRNA is cell-to-cell mobile. |
AT3G44550 | Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. The mRNA is cell-to-cell mobile. |
AT3G44560 | fatty acid reductase 8;(source:Araport11) |
AT3G44590 | cytosolic ribosomal protein gene, part of bL12 family |
AT3G44600 | Cyclophilin71 is a WD40 domain cyclophilin, which functions in gene repression, organogenesis and meristem development. CYP71 physically interacts with histone H3. |
AT3G44610 | Kinase involved in the first positive phototropism and gravitropism. Phosphorylates serine residues in the cytoplasmic loop of PIN1 and shares phosphosite preferences with D6PK. Critical component for both hypocotyl phototropism and gravitropism, control tropic responses mainly through regulation of PIN-mediated auxin transport by protein phosphorylation. |
AT3G44630 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT3G44640 | transposable_element_gene;(source:Araport11);transposase IS4 family protein, contains Pfam profile: PF01609 transposase DDE domain;(source:TAIR10) |
AT3G44680 | Encodes HDA9 (a RPD3-like histone deacetylase). Functions in promoting the onset of leaf senescence.The hda9 mutant shows enhanced H3K9 acetylation levels,based on immunodetection using H3K9ac antibodies. Negatively controls gene expression in concert with interacting proteins POWERDRESS (PWR), HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENES 15 (HOS15), WRKY53, ELONGATED HYPOCOTYL 5 (HY5), ABA INSENSITIVE 4 (ABI4) and EARLY FLOWERING 3 (ELF3). Involved in mutual negative feedback regulation with WRKY53. Mutations lead to a mild early flowering phenotype under SD. |
AT3G44700 | transmembrane protein;(source:Araport11) |
AT3G44713 | hypothetical protein;(source:Araport11) |
AT3G44716 | hypothetical protein;(source:Araport11) |
AT3G44717 | Pseudogene of AT5G03495; nucleotide binding protein |
AT3G44720 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile. |
AT3G44730 | kinesin-like protein 1;(source:Araport11) |
AT3G44757 | pseudogene of transmembrane protein;(source:Araport11) |
AT3G44760 | transmembrane protein;(source:Araport11) |
AT3G44765 | other_RNA;(source:Araport11) |
AT3G44770 | transmembrane protein, putative (DUF626);(source:Araport11) |
AT3G44780 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT3G44810 | F-box family protein;(source:Araport11) |
AT3G44830 | Lecithin:cholesterol acyltransferase family protein;(source:Araport11) |
AT3G44840 | SABATH methyltransferase |
AT3G44860 | Encodes a farnesoic acid carboxyl-O-methyltransferase. The mRNA is cell-to-cell mobile. |
AT3G44900 | member of Putative Na+/H+ antiporter family |
AT3G44910 | member of Putative Na+/H+ antiporter family |
AT3G44920 | member of Putative Na+/H+ antiporter family |
AT3G44930 | member of Putative Na+/H+ antiporter family |
AT3G44935 | hypothetical protein;(source:Araport11) |
AT3G44940 | enabled-like protein (DUF1635);(source:Araport11) |
AT3G44950 | glycine-rich protein;(source:Araport11) |
AT3G44960 | shugoshin;(source:Araport11) |
AT3G44970 | Cytochrome P450 superfamily protein;(source:Araport11) |
AT3G44980 | hypothetical protein;(source:Araport11) |
AT3G45000 | SNF7 family protein;(source:Araport11) |
AT3G45010 | serine carboxypeptidase-like 48;(source:Araport11) |
AT3G45050 | transmembrane protein;(source:Araport11) |
AT3G45070 | Encodes a sulfotransferase with sulfating activity toward flavonoids. |
AT3G45120 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G17900.1);(source:TAIR10) |
AT3G45130 | lanosterol synthase 1;(source:Araport11) |
AT3G45150 | TCP domain protein 16;(source:Araport11) |
AT3G45180 | Ubiquitin like protein that appears to play a role in pre-mRNA splicing. |
AT3G45190 | SIT4 phosphatase-associated family protein;(source:Araport11) |
AT3G45210 | transcription initiation factor TFIID subunit (Protein of unknown function, DUF584);(source:Araport11) |
AT3G45220 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
AT3G45230 | Encodes the arabinogalactan protein core of plant cell wall proteoglycan that contains arabinogalactan and cell wall matrix glycan pectin and/or xylan domains. |
AT3G45240 | Encodes a geminivirus Rep interacting kinase (GRIK; GRIK1/AT3G45240, GRIK2/AT5G60550). GRIKs are SnRK1 (SNF1-related kinases) activating kinases. Both GRIKs specifically bind to the SnRK1 catalytic subunit and phosphorylate the equivalent threonine residue in its activation loop in vitro. Involved in resistance to S. sclerotiorum, fungal sRNA target. |
AT3G45252 | Encodes a ECA1 gametogenesis related family protein |
AT3G45275 | Encodes a ECA1 gametogenesis related family protein |
AT3G45280 | syntaxin of plants 72 (SYP72) |
AT3G45290 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO3 belongs to the clade IV, with AtMLO2, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in primary root and lateral root primordia, in fruit abscission zone, in vascular system of cotyledons and in trichomes of young leaves,; it was not expressed in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT3G45300 | Encodes isovaleryl-coenzyme a dehydrogenase. Mutants have increases in 12 seed free amino acids, accumulation of seed homomethionine and 3-isovaleroyloxypropyl-glucosinolate, with a concomitant decrease in seed 3-benzoyloxypropyl-glucosinolate. The mRNA is cell-to-cell mobile. |
AT3G45310 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT3G45330 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT3G45390 | LOW protein: L-type lectin-domain receptor kinase-like protein;(source:Araport11) |
AT3G45400 | exostosin family protein;(source:Araport11) |
AT3G45460 | IBR domain containing protein;(source:Araport11) |
AT3G45470 | IBR domain containing protein;(source:Araport11) |
AT3G45480 | RING/U-box protein with C6HC-type zinc finger;(source:Araport11) |
AT3G45500 | hypothetical protein;(source:Araport11) |
AT3G45510 | RING/U-box protein;(source:Araport11) |
AT3G45525 | RING/U-box protein with C6HC-type zinc finger protein;(source:Araport11) |
AT3G45540 | RING/U-box protein with C6HC-type zinc finger;(source:Araport11) |
AT3G45555 | RING/U-box protein;(source:Araport11) |
AT3G45560 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT3G45570 | RING/U-box protein with C6HC-type zinc finger domain-containing protein;(source:Araport11) |
AT3G45577 | tRNA-intron endonuclease;(source:Araport11) |
AT3G45600 | Member of TETRASPANIN family |
AT3G45610 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
AT3G45638 | other_RNA;(source:Araport11) |
AT3G45670 | Protein kinase superfamily protein;(source:Araport11) |
AT3G45680 | Major facilitator superfamily protein;(source:Araport11) |
AT3G45760 | Nucleotidyltransferase family protein;(source:Araport11) |
AT3G45780 | Blue-light photoreceptor. Contains a light activated serine-threonine kinase domain and LOV1 and LOV2 repeats. Mutants are defective in blue-light response. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT1 undergoes blue-light-dependent autophosphorylation. At least eight phosphorylation sites have been identified in PHOT1. Phosphorylation of serine851 in the activation loop of PHOT1 appears to be required for stomatal opening, chloroplast accumulation, leaf flattening, and phototropism, and phosphorylation of serine849 may also contribute to the regulation of these responses. Phosphorylation-dependent binding of 14-3-3 proteins to the Hinge1 region of PHOT1 appears to require serine350 and serine376. |
AT3G45790 | Protein kinase superfamily protein;(source:Araport11) |
AT3G45810 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
AT3G45830 | nuclear factor kappa-B-binding-like protein;(source:Araport11) |
AT3G45850 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G45851 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT3G45890 | Encodes RUS1 (root UVB sensitive 1), a protein that contains DUF647 (domain of unknown function 647), a domain highly conserved in eukaryotes. The primary root of rus1 is hypersensitive to very low-fluence-rate (VLF) UVB. |
AT3G45900 | Ribonuclease P protein subunit P38-like protein;(source:Araport11) |
AT3G45930 | Histone superfamily protein;(source:Araport11) |
AT3G45935 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT3G45940 | Glycosyl hydrolases family 31 protein;(source:Araport11) |
AT3G45965 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT3G45970 | member of EXPANSIN-LIKE. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) The mRNA is cell-to-cell mobile. |
AT3G45980 | Encodes a histone 2B (H2B) protein. This protein can be ubiquitinated in planta, and this modification depends on the HUB1 and HUB2 E3 ubiquitin ligases as well as the UBC1 and UBC2 E2 ubiquitin conjugating enzymes. Lysine 146 appears to be the site of the ubiquitin addition. |
AT3G46070 | C2H2-type zinc finger family protein;(source:Araport11) |
AT3G46080 | C2H2-type zinc finger family protein;(source:Araport11) |
AT3G46110 | DUF966 domain containing protein, expressed during embryogenesis. |
AT3G46130 | Encodes a putative transcription factor (MYB48) that functions to regulate flavonol biosynthesis primarily in cotyledons. |
AT3G46160 | Protein kinase superfamily protein;(source:Araport11) |
AT3G46260 | kinase-like protein;(source:Araport11) |
AT3G46340 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G46360 | transmembrane protein;(source:Araport11) |
AT3G46384 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
AT3G46385 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G46420 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G46500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT3G46530 | Confers resistance to the biotrophic oomycete, Peronospora parasitica. Encodes an NBS-LRR type R protein with a putative amino-terminal leucine zipper. Fungal protein ATR13 induces RPP13 gene expression and disease resistance. The mRNA is cell-to-cell mobile. |
AT3G46540 | ENTH/VHS family protein;(source:Araport11) |
AT3G46570 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT3G46580 | Protein containing a putative methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
AT3G46590 | Encodes a protein that specifically binds plant telomeric DNA (TTTAGGG)n repeats. Involved in bending DNA. Expressed throughout the plant with highest levels in flowers. |
AT3G46600 | GRAS family transcription factor;(source:Araport11) |
AT3G46616 | hypothetical protein;(source:Araport11) |
AT3G46620 | Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants. |
AT3G46630 | DCL protein (DUF3223);(source:Araport11) |
AT3G46640 | Encodes a myb family transcription factor with a single Myb DNA-binding domain (type SHAQKYF) that is unique to plants and is essential for circadian rhythms, specifically for transcriptional regulation within the circadian clock. LUX is required for normal rhythmic expression of multiple clock outputs in both constant light and darkness. It is coregulated with TOC1 and seems to be repressed by CCA1 and LHY by direct binding of these proteins to the evening element in the LUX promoter. The mRNA is cell-to-cell mobile. |
AT3G46650 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G46690 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G46710 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
AT3G46720 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G46730 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
AT3G46740 | Component of the translocon outer membrane (TOC) complex. Forms the outer envelope translocation channel (beta-barrel). Plays a role in preprotein conductance. Imported into chloroplast. Expressed in young dividing photosynthetic tissues. Knockout mutants are embryo lethal with arrested development at the two-cell stage. Knockout mutants have abnormal etioplasts. |
AT3G46760 | Protein kinase superfamily protein;(source:Araport11) |
AT3G46780 | plastid transcriptionally active 16;(source:Araport11) |
AT3G46800 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G46840 | Subtilase family protein;(source:Araport11) |
AT3G46850 | Subtilase family protein;(source:Araport11) |
AT3G46860 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860. |
AT3G46870 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G46890 | maternal effect embryo arrest protein;(source:Araport11) |
AT3G46910 | Cullin family protein;(source:Araport11) |
AT3G46930 | Encodes a Raf-Like Mitogen-Activated Protein Kinase Kinase Kinase Raf43. Required for tolerance to multiple abiotic stresses. |
AT3G46940 | DUTP-PYROPHOSPHATASE-LIKE 1;(source:Araport11) |
AT3G46990 | DUF740 family protein, putative (DUF740);(source:Araport11) |
AT3G47000 | Glycosyl hydrolase family protein;(source:Araport11) |
AT3G47030 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G47040 | Glycosyl hydrolase family protein;(source:Araport11) |
AT3G47050 | Glycosyl hydrolase family protein;(source:Araport11) |
AT3G47080 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G47090 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G47130 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT3G47150 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G47180 | RING/U-box superfamily protein;(source:Araport11) |
AT3G47200 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT3G47210 | hypothetical protein (DUF247);(source:Araport11) |
AT3G47230 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G12505.1);(source:TAIR10) |
AT3G47240 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G54926.1);(source:TAIR10) |
AT3G47290 | phosphatidylinositol-speciwc phospholipase C8;(source:Araport11) |
AT3G47295 | hypothetical protein;(source:Araport11) |
AT3G47330 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G09370.1);(source:TAIR10) |
AT3G47350 | Encodes a putative hydroxysteroid dehydrogenase (HSD). Genes that encode HSD include: At5g50600 and At5g50700 (HSD1), At3g47350(HSD2), At3g47360(HSD3), At5g50590 and At5g50690(HSD4), At5g50770(HSD6) (Plant Cell Physiology 50:1463). Two copies of HSD1 and HSD4 exist due to a gene duplication event. In Plant Physiology 145:87, At5g50690 is HSD7, At4g10020 is HSD5. |
AT3G47390 | Encodes a protein that is believed to function as a pyrimidine reductase involved in riboflavin and FAD biosynthesis. phs1 was identified as a photosensitive mutant that shows reduced growth, chloroplast developmental abnormalities, reduced chlorophyll levels, increased oxidative stress, reduced NADPH/NADP+ ratios, reduced photosystem I electron transport, and reduced photosynthetic protein levels under high light conditions. Many of these abnormal phenotypes likely arise from the reduction in the levels of FAD in the phs1 mutant. |
AT3G47400 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT3G47410 | hypothetical protein;(source:Araport11) |
AT3G47420 | Encodes a Pi starvation-responsive protein AtPS3. A member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
AT3G47440 | Encodes AtTIP5;1, functions as water and urea channels in pollen. Target promoter of the male germline-specific transcription factor DUO1. Essential target of gibberellins, promotes hypocotyl cell elongation under excess boron stress. |
AT3G47470 | Encodes a chlorophyll a/b-binding protein that is more similar to the PSI Cab proteins than the PSII cab proteins. The predicted protein is about 20 amino acids shorter than most known Cab proteins. |
AT3G47500 | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions. |
AT3G47540 | Chitinase family protein;(source:Araport11) |
AT3G47560 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G47610 | transcription regulator/ zinc ion binding protein;(source:Araport11) |
AT3G47620 | Encodes a transcription factor AtTCP14 that regulates seed germination. AtTCP14 shows elevated expression level just prior to germination. AtTCP14 is predominantly expressed in the vascular tissue of the embryo, and affects gene expression in radicles in a non-cell-autonomous manner. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
AT3G47630 | translocator assembly/maintenance protein;(source:Araport11) |
AT3G47650 | DnaJ/Hsp40 cysteine-rich domain superfamily protein;(source:Araport11) |
AT3G47660 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT3G47670 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT3G47720 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. |
AT3G47740 | member of ATH subfamily |
AT3G47750 | member of ATH subfamily |
AT3G47760 | ABC2 homolog 4;(source:Araport11) |
AT3G47780 | member of ATH subfamily The mRNA is cell-to-cell mobile. |
AT3G47790 | ABC2 homolog 7;(source:Araport11) |
AT3G47800 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
AT3G47870 | Required for normal cell division during pollen development. Mutant has extra cell in pollen of vegetative cell identity. Male gametophytic mutation. |
AT3G47875 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.1e-40 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G47940 | DNAJ heat shock family protein;(source:Araport11) |
AT3G47990 | SUGAR-INSENSITIVE 3;(source:Araport11) |
AT3G48000 | Encodes a putative (NAD+) aldehyde dehydrogenase. |
AT3G48010 | member of Cyclic nucleotide gated channel family |
AT3G48050 | Encodes a large protein with N-terminal bromo-adjacent homology (BAH) and transcription elongation factor S-II (TFS2N) domains and two C-terminal GW (glycine and tryptophan) repeats. It is nuclear and colocalizes with the processing-body component DCP1 in the cytoplasm. SOU is a component of the miRNA pathway and is involved in translational repression. |
AT3G48057 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUAGGUCGAGCUUCAUUGGA |
AT3G48080 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G48090 | Component of R gene-mediated disease resistance in Arabidopsis thaliana with homology to eukaryotic lipases. |
AT3G48110 | glycine-tRNA ligase |
AT3G48190 | Encodes a homolog of the human ATM gene, which is mutated in ataxia telangiectasia, a chromosome instability disorder. Suppresses leaf senescence triggered by DNA double-strand break through epigenetic control of senescence-associated genes. Characterization of mutants suggest a role homologous recombination for DNA damage repair in response to ionizing radiation as well as during meiosis. The protein has kinase domains and shows kinase activity in orthologs. There is also evidence that ATM might be involved in the telomerase-independent process known as Alternative Lengthening of Telomeres. |
AT3G48195 | Encodes a member of the Arabidopsis sorting nexin family. |
AT3G48209 | Encodes a Plant thionin family protein |
AT3G48210 | kinetochore protein;(source:Araport11) |
AT3G48220 | F-box protein;(source:Araport11) |
AT3G48235 | transposable_element_gene;(source:Araport11);pseudogene, similar to Hypothetical protein with similarity to putative Ac-like transposases, similar to Ac-like transposase;(source:TAIR10) |
AT3G48240 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT3G48250 | Encodes a pentatricopeptide repeat protein implicated in splicing of intron 1 of mitochondrial nad7 transcripts. |
AT3G48275 | pre-tRNA tRNA-Thr (anticodon: TGT);(source:Araport11, TAIR10) |
AT3G48280 | putative cytochrome P450 |
AT3G48300 | putative cytochrome P450 |
AT3G48330 | Encodes protein-L-isoaspartate methyltransferase. Important for maintaining viability as the seed ages. Involved in germination. |
AT3G48344 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT3G48400 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G48450 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
AT3G48470 | embryo defective 2423;(source:Araport11) |
AT3G48510 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
AT3G48523 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G48550 | SHOOT GRAVITROPISM-like protein;(source:Araport11) |
AT3G48580 | xyloglucan endotransglucosylase/hydrolase 11;(source:Araport11) |
AT3G48650 | pseudogene of pectinesterase;(source:Araport11) |
AT3G48720 | Encodes a hydroxycinnamoyl-CoA: v-hydroxy fatty acid transferase involved in cutin synthesis. Mutants are almost devoid of ferulic acid. |
AT3G48740 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
AT3G48745 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
AT3G48750 | A-type cyclin-dependent kinase. Together with its specific inhibitor, the Kip-related protein, KRP2 they regulate the mitosis-to-endocycle transition during leaf development. Dominant negative mutations abolish cell division. Loss of function phenotype has reduced fertility with failure to transmit via pollen. Pollen development is arrested at the second mitotic division. Expression is regulated by environmental and chemical signals. Part of the promoter is responsible for expression in trichomes. Functions as a positive regulator of cell proliferation during development of the male gametophyte, embryo and endosperm. Phosphorylation of threonine 161 is required for activation of its associated kinase. |
AT3G48760 | DHHC-type zinc finger family protein;(source:Araport11) |
AT3G48770 | ATP/DNA binding protein;(source:Araport11) |
AT3G48790 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT3G48850 | Encodes a mitochondrial phosphate transporter. Modulates plant responses to salt stress. |
AT3G48900 | Encodes one of two GEN1 homologs in Arabidopsis. It is a member of the class IV Rad2/XPG family of nucleases that processes Holliday junctions in a manner analogous to the HJ resolvases of phages, archaea, and bacteria. |
AT3G48940 | Remorin family protein;(source:Araport11) |
AT3G49010 | Encodes 60S ribosomal protein L13. Homolog of human breast basic conserved 1 (BBC1). |
AT3G49030 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT3G49040 | F-box/FBD/LRR protein;(source:Araport11) |
AT3G49055 | ATP-binding protein;(source:Araport11) |
AT3G49060 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT3G49070 | transmembrane protein, putative (DUF677);(source:Araport11) |
AT3G49110 | Class III peroxidase Perx33. Expressed in roots. Located in the cell wall. Involved in cell elongation. Expression activated by light. May play a role in generating H2O2 during defense response. The mRNA is cell-to-cell mobile. |
AT3G49140 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G49150 | F-box/FBD/LRR protein;(source:Araport11) |
AT3G49160 | Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
AT3G49190 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
AT3G49200 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
AT3G49220 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT3G49260 | IQ-domain 21;(source:Araport11) |
AT3G49270 | extensin-like protein;(source:Araport11) |
AT3G49300 | proline-rich family protein;(source:Araport11) |
AT3G49305 | transmembrane protein;(source:Araport11) |
AT3G49310 | Major facilitator superfamily protein;(source:Araport11) |
AT3G49330 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT3G49350 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT3G49450 | F-box protein involved in protein binding and ubiquitination; involved in male fertility. |
AT3G49480 | F-Box Gene regulated by Agrobacterium virulence protein VirD5 and essential for Agrobacterium-mediated plant transformation. |
AT3G49520 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G49550 | hypothetical protein;(source:Araport11) |
AT3G49630 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT3G49650 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G49680 | Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. |
AT3G49690 | Putative homolog of the Blind gene in tomato. Together with RAX1 and RAX3 belong to the class R2R3 MYB genes; encoded by the Myb-like transcription factor MYB84, regulates axillary meristem formation. |
AT3G49700 | encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family. Mutants produce elevated levels of ethylene as etiolated seedlings. |
AT3G49740 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G49800 | BSD domain-containing protein;(source:Araport11) |
AT3G49810 | Encodes a protein with E3 ubiquitin ligase activity that is involved in negative regulation of salt stress tolerance during germination. |
AT3G49832 | pseudogene of kelch repeat-containing F-box family |
AT3G49840 | Encodes an orthlog of the Xenopus inner nuclear membrane (INM) protein Nemp1/TMEM194A. |
AT3G49845 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
AT3G49890 | hypothetical protein;(source:Araport11) |
AT3G49910 | Translation protein SH3-like family protein;(source:Araport11) |
AT3G49925 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT3G49930 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
AT3G49940 | LOB domain-containing protein 38;(source:Araport11) |
AT3G49950 | GRAS family transcription factor;(source:Araport11) |
AT3G49960 | Its expression is enriched in root hair cells (compared to non-root hair cells) and this enrichment is associated with increase in the transcription-associated mark trimethylation of H3 lysine 4 (H3K4me3) and decrease in the Polycomb silencing-associated mark trimethylation of H3 lysine 27 (H3K27me3) in root hair cells relative to non-root hair cells. |
AT3G49970 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT3G50000 | Encodes the casein kinase II (CK2) catalytic subunit (alpha). |
AT3G50030 | ARM-repeat/Tetratricopeptide repeat (TPR)-like protein;(source:Araport11) |
AT3G50070 | Encode CYCD3;3, a CYCD3 D-type cyclin. Important for determining cell number in developing lateral organs. Mediating cytokinin effects in apical growth and development. |
AT3G50090 | Exonuclease family protein;(source:Araport11) |
AT3G50120 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT3G50150 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT3G50180 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT3G50190 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT3G50220 | Encode a DUF579 (domain of unknown function 579) containing protein essential for normal xylan synthesis and deposition in the secondary cell wall. |
AT3G50230 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G50240 | Encodes a kinesin-related protein. |
AT3G50250 | transmembrane protein;(source:Araport11) |
AT3G50270 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT3G50280 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT3G50290 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT3G50295 | pseudogene of Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G50300 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT3G50310 | Encodes a member of MEKK subfamily. Target promoter of the male germline-specific transcription factor DUO1. Involved in osmotic stress response via regulation of MPK6 activity. It also plays an important role in regulating cell division and cell elongation in the primary root meristematic and elongation areas. Mutants show defects in root microtubule organization.It phosphorylates MPK18 and MKK3.It is a positive regulator of ABA-induced stomatal closure that acts by phosphorylating MKK5. |
AT3G50330 | Encodes a bHLH transcription factor that is involved in transmitting tract and stigma development. Inhibits thermomorphogenesis. |
AT3G50340 | hypothetical protein;(source:Araport11) |
AT3G50376 | pseudogene of NLI interacting factor (NIF) family protein |
AT3G50380 | vacuolar protein sorting-associated protein, putative (DUF1162);(source:Araport11) |
AT3G50390 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G50400 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G50410 | Arabidopsis Dof protein containing a single 51-amino acid zinc finger DNA-binding domain, which may play an important roles in plant growth and development. |
AT3G50440 | Encodes a protein shown to have methyl jasmonate esterase activity in vitro. This protein does not act on methyl IAA, MeSA, MeGA4, or MEGA9 in vitro. |
AT3G50450 | Homolog of RPW8 |
AT3G50480 | Homolog of RPW8 |
AT3G50590 | WD40/YVTN repeat protein. |
AT3G50610 | DNA-directed RNA polymerase II subunit RPB1-like protein;(source:Araport11) |
AT3G50620 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G50625 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.1e-96 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
AT3G50660 | Encodes a 22α hydroxylase whose reaction is a rate-limiting step in brassinosteroid biosynthetic pathway. The protein is a member of CYP90B gene family. CLM is an epi-allele with small, compressed rosette, reduced internode length, and reduced fertility, appears in selfed ddm mutant plants possibly due to loss of cytosine methylation. Transcripts accumulate in actively growing tissues, and GUS expression is negatively regulated by brassinosteroids. Localized in the endoplasmic reticulum. The in vitro expressed protein can perform the C-22 hydroxylation of a variety of C27-, C28- and C29-sterols. Cholesterol was the best substrate, followed by campesterol. Sitosterol was a poor substrate. |
AT3G50665 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
AT3G50700 | zinc finger protein, similar to maize Indeterminate1 (ID1) |
AT3G50710 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT3G50740 | UGT72E1 is an UDPG:coniferyl alcohol glucosyltransferase which specifically glucosylates sinapyl- and coniferyl aldehydes. The enzyme is thought to be involved in lignin metabolism. |
AT3G50750 | BES1/BZR1 homolog 1;(source:Araport11) |
AT3G50760 | Encodes a protein with putative galacturonosyltransferase activity. The mRNA is cell-to-cell mobile. |
AT3G50780 | BTB/POZ domain protein;(source:Araport11) |
AT3G50800 | PADRE protein. |
AT3G50820 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO2 is the minor isoform in the wild-type. Mutants defective in this gene have been shown to be affected in the dephosphorylation of the D1 protein of PSII. |
AT3G50835 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
AT3G50840 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT3G50900 | hypothetical protein;(source:Araport11) |
AT3G50930 | Encodes a protein that is present in a homo-multimeric protein complex on the outer mitochondrial membrane and plays a role in cell death and amplifying salicylic acid signalling. The mRNA is cell-to-cell mobile. |
AT3G50940 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G50980 | dehydrin xero 1;(source:Araport11) |
AT3G51000 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G51050 | NERD1 is a single copy locus encoding a protein of unknown function that is localized to the nucleus. Single mutants show defects in root hair growth, root meristem function, cell elongation. NERD1 appears to act synergistically with the exocyst in root development. |
AT3G51060 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. STY1/STY2 double mutants showed defective style, stigma as well as serrated leaves. Binds to the promoter of YUC4 and YUC8 (binding site ACTCTAC) |
AT3G51080 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT3G51090 | coiled-coil 90B-like protein (DUF1640);(source:Araport11) |
AT3G51100 | altered inheritance of mitochondria protein;(source:Araport11) |
AT3G51110 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G51130 | transmembrane protein;(source:Araport11) |
AT3G51190 | Ribosomal protein L2 family;(source:Araport11) |
AT3G51220 | WEB family protein (DUF827);(source:Araport11) |
AT3G51230 | chalcone-flavanone isomerase family protein;(source:Araport11) |
AT3G51260 | 20S proteosomal alpha subunits. Interacts with SnRK, SKP1/ASK1 during proteasomal binding of an SCF ubiquitin ligase. |
AT3G51265 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT3G51290 | pyridoxal-phosphate-dependent serine hydroxymethyltransferase, putative (DUF632);(source:Araport11) |
AT3G51300 | Encodes a pollen-specific Rop GTPase, member of the Rho family of small GTP binding proteins that interacts with RIC3 and RIC4 to control tip growth in pollen tubes. These three proteins promote the proper targeting of exocytic vesicles in the pollen tube tip. ROP1 activity is regulated by the REN1 GTPase activator protein. |
AT3G51325 | RING/U-box superfamily protein;(source:Araport11) |
AT3G51340 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G51360 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G51370 | Protein phosphatase 2C family protein;(source:Araport11) |
AT3G51375 | Encodes a microRNA that targets several SCL family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAUUGAGCCGCGCCAAUAUC |
AT3G51400 | hypothetical protein (DUF241);(source:Araport11) |
AT3G51410 | hypothetical protein (DUF241);(source:Araport11) |
AT3G51460 | Encodes RHD4 (ROOT HAIR DEFECTIVE4), a phosphatidylinositol-4-phosphate phosphatase required for root hair development. The mRNA is cell-to-cell mobile. |
AT3G51480 | member of Putative ligand-gated ion channel subunit family |
AT3G51540 | mucin-5AC-like protein;(source:Araport11) |
AT3G51570 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT3G51580 | transmembrane protein;(source:Araport11) |
AT3G51590 | Encodes a member of the lipid transfer protein family. Proteins of this family are generally small (~9 kD), basic, expressed abundantly and contain eight Cys residues. The proteins can bind fatty acids and acylCoA esters and can transfer several different phospholipids. They are localized to the cell wall. The LTP12 promoter is active exclusively in the tapetum during the uninucleate microspore and bicellular pollen stages. Predicted to be a member of PR-14 pathogenesis-related protein family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
AT3G51600 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
AT3G51630 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. |
AT3G51660 | Chemokine-like MDL protein; modulate flowering time and innate immunity in plants. |
AT3G51680 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G51690 | DNA helicase homolog PIF1. |
AT3G51700 | PIF1 helicase;(source:Araport11) |
AT3G51730 | saposin B domain-containing protein;(source:Araport11) |
AT3G51750 | hypothetical protein;(source:Araport11) |
AT3G51760 | hypothetical protein (DUF688);(source:Araport11) |
AT3G51800 | putative nuclear DNA-binding protein G2p (AtG2) mRNA, |
AT3G51860 | cation exchanger 3;(source:Araport11) |
AT3G51870 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT3G51890 | Clathrin light chain protein;(source:Araport11) |
AT3G51910 | member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. |
AT3G51930 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G51960 | bZIP transcription factor induced by salt stress and promoted salt tolerance. Localized to the cytoplasm and nucleus under control conditions and targeted preferentially to the nucleus under salt stress |
AT3G52080 | encodes a cation:proton exchanger expressed in pollen |
AT3G52140 | Involved in regulating mitochondrial quality control. Regulates mitochondrial association time and thereby is involved in mitochondrial fusion. Mutants show unregulated autophagy and display transcriptomic markers of mitochondrial stress. Its activity can be modulated by Lys acetylation. |
AT3G52220 | leukocyte immunoglobulin-like receptor family A protein;(source:Araport11) |
AT3G52230 | hypothetical protein;(source:Araport11) |
AT3G52250 | Encodes a protein with a putative role in mRNA splicing. The mRNA is cell-to-cell mobile. |
AT3G52260 | Pseudouridine synthase family protein;(source:Araport11) |
AT3G52290 | Member of IQ67 (CaM binding) domain containing family. |
AT3G52320 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G52330 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT3G52350 | D111/G-patch domain-containing protein;(source:Araport11) |
AT3G52370 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
AT3G52430 | Encodes a lipase-like gene that is important for salicylic acid signaling and function in resistance (R) gene-mediated and basal plant disease resistance. PAD4 can interact directly with EDS1, another disease resistance signaling protein. Expressed at elevated level in response to green peach aphid (GPA) feeding, and modulates the GPA feeding-induced leaf senescence through a mechanism that doesn't require camalexin synthesis and salicylic acid (SA) signaling. Required for the ssi2-dependent heightened resistance to GPA. The mRNA is cell-to-cell mobile. |
AT3G52440 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
AT3G52450 | Encodes a cytoplasmically localized U-box domain E3 ubiquitin ligase protein that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
AT3G52460 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G52490 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. |
AT3G52510 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT3G52520 | hypothetical protein;(source:Araport11) |
AT3G52527 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-22 P-value blast match to GB:AAC02672 polyprotein (Ty1_Copia-element) (Arabidopsis arenosa);(source:TAIR10) |
AT3G52540 | ovate family protein 18;(source:Araport11) |
AT3G52565 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
AT3G52600 | Cell wall invertase expressed in flowers and ovary placental tissues. Reduced expression is correlated with decreased ovule production suggesting a link between sugar sensing and ovule initiation. |
AT3G52700 | hypothetical protein;(source:Araport11) |
AT3G52730 | ubiquinol-cytochrome C reductase UQCRX/QCR9-like family protein;(source:Araport11) |
AT3G52765 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT3G52770 | ZPR3 is a small-leucine zipper containing protein that is involved in the establishment of leaf polarity. |
AT3G52800 | A20/AN1-like zinc finger family protein;(source:Araport11) |
AT3G52820 | purple acid phosphatase 22;(source:Araport11) |
AT3G52850 | Encodes the Vacuolar Sorting Receptor-1 (VSR-1)/Epidermal Growth Factor Receptor-like protein1(VSR-1/ATELP1). Binds vacuolar targeting signals. Involved in sorting seed storage proteins into vacuoles. The mRNA is cell-to-cell mobile. |
AT3G52870 | IQ calmodulin-binding motif family protein;(source:Araport11) |
AT3G52900 | RAB6-interacting golgin (DUF662);(source:Araport11) |
AT3G52905 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT3G52920 | transcriptional activator (DUF662);(source:Araport11) |
AT3G52970 | member of CYP76G |
AT3G52980 | Zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein;(source:Araport11) |
AT3G52990 | Pyruvate kinase family protein;(source:Araport11) |
AT3G53010 | carbohydrate esterase, putative (DUF303);(source:Araport11) |
AT3G53040 | late embryogenesis abundant protein, putative / LEA protein;(source:Araport11) |
AT3G53060 | SKP1-like 6;(source:Araport11) |
AT3G53065 | D-galactoside/L-rhamnose binding SUEL lectin protein;(source:Araport11) |
AT3G53100 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G53150 | UDP-glucosyl transferase 73D1;(source:Araport11) |
AT3G53160 | UGT73C7 is induced by pathogen infection. It glycosylates p-coumaric acid and ferulic acid to modulate phenylpropanoid metabolism and induce innate immune response. |
AT3G53180 | Encodes a protein that is the product of a fusion gene with a C-terminal GSI like sequence and an N-terminal part sharing homology with nodulins. It self-assembles into oligomers and its expression is increased in response to flagellin treatment. The protein co-localizes with microtubules and binds gamma-tubulin. RNAi lines are affected in root morphogenesis. |
AT3G53190 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G53210 | nodulin MtN21-like transporter family protein |
AT3G53230 | CDC48 is induced upon oilseed rape mosaic tobamovirus infection and appears to be involved in controlling virus movement. |
AT3G53250 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT3G53280 | cytochrome P450 monooxygenase The mRNA is cell-to-cell mobile. |
AT3G53290 | missing N-term 80 AA not found between end of 71B5 and start of this sequence probably a pseudogene, from http://drnelson.utmem.edu/biblioD.html |
AT3G53305 | putative cytochrome P450 |
AT3G53330 | plastocyanin-like domain-containing protein;(source:Araport11) |
AT3G53350 | Encodes RIP3 (ROP interactive partner 3), a microtubule-binding protein that is anchored to the plasma membrane domains and promotes local microtubule disassembly, forming as specific pattern of secondary walls in xylem vessel cells. Localized at microtubules and interacts with the plant-specific kinesin AtKinesin-13A. |
AT3G53400 | peptide upstream protein;(source:Araport11) |
AT3G53410 | Paralog of LOG2 (At3g09770), a ubiquitin ligase that regulates amino acid export. |
AT3G53450 | Putative lysine decarboxylase family protein;(source:Araport11) |
AT3G53490 | valine-tRNA ligase;(source:Araport11) |
AT3G53530 | Chloroplast-targeted copper chaperone protein;(source:Araport11) |
AT3G53540 | afadin;(source:Araport11) |
AT3G53550 | FBD-like domain family protein;(source:Araport11) |
AT3G53590 | LRR receptor-like Serine/Threonine-kinase;(source:Araport11) |
AT3G53630 | hypothetical protein;(source:Araport11) |
AT3G53720 | member of Putative Na+/H+ antiporter family. Involved in the osmoregulation through K(+) fluxes and possibly pH modulation of an active endomembrane system in guard cells. |
AT3G53780 | RHOMBOID-like protein 4;(source:Araport11) |
AT3G53810 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT3G53820 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
AT3G53840 | Protein kinase superfamily protein;(source:Araport11) |
AT3G53990 | Encodes universal stress protein (USP). Functions as a molecular chaperone under heat shock and oxidative stress conditions. Chaperone activity and assembly into complexes is redox regulated. |
AT3G54000 | TIP41-like protein;(source:Araport11) |
AT3G54020 | Inositol phosphorylceramide synthase |
AT3G54030 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
AT3G54040 | PAR1 protein;(source:Araport11) |
AT3G54050 | Encodes a chloroplastic fructose 1,6-bisphosphate phosphatase. also known as HCEF1 (High Cyclic Electron Flow 1). hcef1 mutants have constitutively elevated electron flow (CEFI) and plants with antisense suppression of this enzyme have higher levels of net leaf photosynthesis and increased sucrose biosynthesis. The mRNA is cell-to-cell mobile. |
AT3G54100 | O-fucosyltransferase family protein;(source:Araport11) |
AT3G54110 | Member of Uncoupling protein PUMP2 family. Encodes a mitochondrial uncoupling protein AtUCP1 involved in maintain the redox poise of the mitochondrial electron transport chain to facilitate photosynthetic metabolism. Disruption of UCP1 results in a photosynthetic phenotype. Specifically there is a restriction in photorespiration with a decrease in the rate of oxidation of photorespiratory glycine in the mitochondrion. This change leads to an associated reduced photosynthetic carbon assimilation rate. The mRNA is cell-to-cell mobile. |
AT3G54130 | Josephin family protein;(source:Araport11) |
AT3G54140 | Encodes a di- and tri-peptide transporter that recognizes a variety of different amino acid combinations. GFP-tagged PTR1 localizes to the plasma membrane and has 8 to 11 predicted transmembrane domains. PTR1 is expressed in a number of different vascular tissues throughout the plant based on promoter:GUS expression analysis. ptr1 mutants have a lower dry weight than wild type plants when both are grown with Pro-Ala or Ala-Ala dipeptides as their nitrogen source, suggesting that PTR1 plays a role in dipeptide uptake in the roots. Furthermore N content of ptr1 mutants is lower than that of wild type plants when grown with Pro-Ala or a mixture of dipeptides as nitrogen source |
AT3G54150 | Encodes a DNA methyltransferase required for pollen exine formation and male fertility via the regulation of callose wall and primexine formation. |
AT3G54230 | Encodes a splicing factor SUA (suppressor of abi3-5), homologous to the human protein RBM5. Controls alternative splicing of the developmental regulator ABI3. |
AT3G54240 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G54280 | ROOT GROWTH DEFECTIVE 3;(source:Araport11) |
AT3G54290 | hemerythrin HHE cation-binding domain protein;(source:Araport11) |
AT3G54300 | Encodes a member of Synaptobrevin -like protein family. VAMP727 is a R-SNARE and interacts with SYP22/VTI11/SYP51. It is required for trafficking of storage proteins to the protein storage vacuoles (PSV) and also for PSV organization and biogenesis. Loss of function mutations have no phenotype but double mutants with SYP22 are embryo lethal. |
AT3G54390 | sequence-specific DNA binding transcription factor;(source:Araport11) |
AT3G54410 | hypothetical protein (DUF1163);(source:Araport11) |
AT3G54430 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
AT3G54440 | glycoside hydrolase family 2 protein;(source:Araport11) |
AT3G54520 | hypothetical protein;(source:Araport11) |
AT3G54590 | Encodes a hydroxyproline-rich glycoprotein. The mRNA is cell-to-cell mobile. |
AT3G54620 | bZIP transcription factor-like protein mRNA |
AT3G54700 | Encodes Pht1;7, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
AT3G54710 | Encodes a cyclin-dependent protein kinase. Involved in nuclear DNA replication and plastid division. |
AT3G54800 | Pleckstrin homology (PH) and lipid-binding START domains-containing protein;(source:Araport11) |
AT3G54810 | Encodes a protein containing a GATA type zinc finger domain that is expressed in the embryo axis and involved in germination. Mutants have a reduced rate of germination even when stratified. |
AT3G54826 | Zim17-type zinc finger protein;(source:Araport11) |
AT3G54900 | A.thaliana PICOT protein.It activates CAX1 gene Calcium transport activity.In other organisms, PICOT proteins appear to play a negative regulatory role in cellular stress responses. |
AT3G54930 | Protein phosphatase 2A regulatory B subunit family protein;(source:Araport11) |
AT3G54950 | Encodes pPLAIIIbeta, a member of the Group 3 patatin-related phospholipases. pPLAIIIbeta hydrolyzes phospholipids and galactolipids and additionally has acyl-CoA thioesterase activity. Alterations of pPLAIIIβ result in changes in lipid levels and composition. |
AT3G54960 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response. |
AT3G55000 | Encodes a protein of unknown function that is involved in cortical microtubule organization. Mutants exhibit abnormal cell growth and patterns of division. TON1A can functionally complement TON1B and their roles appear to be redundant in plants. Encodes a novel protein that is similar to human FOP and OFD1 centrosomal proteins. Localizes to the preprophase band, cytoplasm and cell cortex where it is probably associated with the cortical cytoskeleton. TON1A associates with plant centrins CEN1 and CEN2. |
AT3G55050 | Protein phosphatase 2C family protein;(source:Araport11) |
AT3G55080 | SET domain-containing protein;(source:Araport11) |
AT3G55090 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
AT3G55100 | ABC-2 type transporter family protein;(source:Araport11) |
AT3G55110 | ABC-2 type transporter family protein;(source:Araport11) |
AT3G55120 | Catalyzes the conversion of chalcones into flavanones. Required for the accumulation of purple anthocyanins in leaves and stems. Co-expressed with CHS. |
AT3G55130 | Encodes a vacuole localized protein of the ABC transporter White-Brown Complex (WBC) family. When overexpressed in planta, confers resistance to kanamycin. |
AT3G55150 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT3G55160 | THADA is an orphan gene in Arabidopsis thaliana. It is the only DUF2428 domain containing protein in the genome. |
AT3G55190 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G55240 | Overexpression leads to PEL (Pseudo-Etiolation in Light) phenotype. |
AT3G55252 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT3G55320 | P-glycoprotein 20;(source:Araport11) |
AT3G55370 | Encodes a nuclear localized Dof domain containing transcription factor expressed primarily in roots. Responsive to salicylic acid. Transgenic overexpressors have yellow leaves and short, defective roots. |
AT3G55420 | hypothetical protein;(source:Araport11) |
AT3G55430 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT3G55440 | Encodes triosephosphate isomerase. |
AT3G55450 | PBS1-like 1;(source:Araport11) |
AT3G55460 | encodes an SC35-like splicing factor that is localized to nuclear specks. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. The mRNA is cell-to-cell mobile. |
AT3G55510 | Encodes a regulator of floral determinacy in that interacts with both nucleolar and nucleoplasmic proteins. |
AT3G55512 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AGAAUCUUGAUGAUGCUGCAG |
AT3G55530 | Encodes an intracellular membrane localized protein with E3 ligase activity, found in the ER with the C-terminus facing the cytoplasm. It is involved in regulation of ABA signaling. Loss of function alleles show decreased sensitivity to ABA. Overexpression results in increased sensitivity to ABA. |
AT3G55550 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT3G55620 | Translation initiation factor IF6;(source:Araport11) |
AT3G55640 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT3G55646 | TPRXL;(source:Araport11) |
AT3G55650 | Pyruvate kinase family protein;(source:Araport11) |
AT3G55672 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT3G55700 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G55720 | replication factor C subunit, putative (DUF620);(source:Araport11) |
AT3G55760 | hypothetical protein;(source:Araport11) |
AT3G55780 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT3G55800 | Encodes the chloroplast enzyme sedoheptulose-1,7-bisphosphatase (SBPase), involved in the carbon reduction of the Calvin cycle. Increase in SBPase activity in transgenic lines accumulate up to 50% more sucrose and starch than wild-type. The mRNA is cell-to-cell mobile. |
AT3G55810 | Pyruvate kinase family protein;(source:Araport11) |
AT3G55840 | Hs1pro-1 protein;(source:Araport11) |
AT3G55880 | A gain-of-function mutant of SUE4 exhibited improved low sulphur tolerance. |
AT3G55920 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT3G55950 | CRINKLY4 related 3;(source:Araport11) |
AT3G55970 | One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
AT3G55980 | salt-inducible zinc finger 1;(source:Araport11) |
AT3G55990 | Encodes ESK1 (Eskimo1). A member of a large gene family of DUF231 domain proteins whose members encode a total of 45 proteins of unknown function. ESK1 functions as a negative regulator of cold acclimation. Mutations in the ESK1 gene provides strong freezing tolerance. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). The mRNA is cell-to-cell mobile. |
AT3G56030 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G56040 | UDP-glucose pyrophosphorylase 3;(source:Araport11) |
AT3G56050 | Protein kinase family protein;(source:Araport11) |
AT3G56060 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
AT3G56080 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G56090 | Encodes FERRITIN 3, AtFER3. Ferritins are a class of 24-mer multi-meric proteins found in all kingdoms of life. Function as the main iron store in mammals. Evidence suggests that Arabidopsis ferritins are essential to protect cells against oxidative damage, but they do not constitute the major iron pool. |
AT3G56100 | Protein kinase expressed in meristematic cells. Phosphorylates AGL24. |
AT3G56140 | DUF399 family protein, putative (DUF399 and DUF3411);(source:Araport11) |
AT3G56150 | member of eIF3c - eukaryotic initiation factor 3c |
AT3G56180 | LURP-one-like protein (DUF567);(source:Araport11) |
AT3G56220 | transcription regulator;(source:Araport11) |
AT3G56230 | BTB/POZ domain-containing protein;(source:Araport11) |
AT3G56275 | pseudogene of expressed protein;(source:Araport11) |
AT3G56277 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.6e-16 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT3G56280 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
AT3G56320 | PAP/OAS1 substrate-binding domain superfamily;(source:Araport11) |
AT3G56350 | Iron/manganese superoxide dismutase family protein;(source:Araport11) |
AT3G56360 | hypothetical protein;(source:Araport11) |
AT3G56380 | response regulator 17 |
AT3G56410 | hypothetical protein (DUF3133);(source:Araport11) |
AT3G56440 | yeast autophagy 18 D-like protein;(source:Araport11) |
AT3G56520 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
AT3G56530 | NAC domain containing protein 64;(source:Araport11) |
AT3G56580 | Encodes a functional E3 ubiquitin ligase involved in the dehydration stress response and regulation of proline biosynthesis. |
AT3G56600 | phosphatidylinositol 4-kinase gamma-like protein;(source:Araport11) |
AT3G56640 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
AT3G56690 | encodes a protein similar to ATPases and binds to calmodulin in vitro. This is a single-copy gene and is expressed in all tissues examined. |
AT3G56700 | Encodes a fatty-acyl-CoA reductase that is expressed in response to wounding. |
AT3G56705 | U2-6;(source:Araport11) |
AT3G56710 | Sig1 binding protein; interacts with Sig1R4. As well as Sig1, SibI is imported into chloroplasts and its expression is light-dependent in mature chloroplasts. |
AT3G56740 | ATI3A interacting protein containing a large N-terminal rhomboid-like transmembrane domain and a UBA domain at their C terminus, localized in the ER with an important role in plant heat tolerance. UBAC2 proteins may act as both cargo receptors and inducers of an ATI3-mediated selective autophagy pathway, where ATI3 and UBAC2 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
AT3G56760 | Protein kinase superfamily protein;(source:Araport11) |
AT3G56770 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT3G56790 | RNA splicing factor-like protein;(source:Araport11) |
AT3G56800 | encodes a calmodulin |
AT3G56930 | Protein S-acyl transferase 4 (PAT4). Mutants display defects in root hair elongation. Along with SCN1 , it may be involved in targeting of ROP2 to the plasma membrane. |
AT3G56940 | Encodes a putative ZIP protein with varying mRNA accumulation in leaves, stems and roots. Has a consensus carboxylate-bridged di-iron binding site. The mRNA is cell-to-cell mobile. |
AT3G56970 | Encodes a member of the basic helix-loop-helix transcription factor family protein. |
AT3G56980 | Encodes a member of the basic helix-loop-helix transcription factor protein. |
AT3G57000 | nucleolar essential protein-like protein;(source:Araport11) |
AT3G57010 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT3G57020 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT3G57040 | response regulator ARR9, A two-component response regulator-like protein with a receiver domain with a conserved aspartate residue and a possible phosphorylation site and at the N-terminal half. Appears to interact with histidine kinase like genes ATHP3 and ATHP2 |
AT3G57090 | Encodes a protein with similarity to yeast FIS proteins. These membrane anchored proteins bind DRP proteins and function during organelle division. FIS1B is expressed ubiquitously and appears to be involved in peroxisome division. |
AT3G57100 | transmembrane protein, putative (DUF677);(source:Araport11) |
AT3G57130 | Encodes BOP1. Contains Pfam domain, PF00023: Ankyrin repeat and Pfam domain, PF00651: BTB/POZ domain. Lines carrying recessive mutations exhibit a number of visible defects, most pronounced being ectopic outgrowths of in leaf petioles of rosette leaves. Along with BOP2, BOP1 is required for nectary development and formation of normal abscission zones.Forms homodimers and heterodimers with BOP2. Nuclear localization is required for activity which includes positive regulation of AS2 in leaves. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP1 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP1 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP1 expression is restricted to pedicel axils by BP and PNY. BOP1 promotes KNAT6 (At1g23380) expression.BOP1 Interacts with BIL1/BZR1 and Inhibits BIL1/BZR1 transport into the nucleus. |
AT3G57157 | Has been identified as a translated small open reading frame by ribosome profiling. |
AT3G57160 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
AT3G57210 | hypothetical protein;(source:Araport11) |
AT3G57240 | encodes a member of glycosyl hydrolase family 17 |
AT3G57250 | Emsy N Terminus (ENT) domain-containing protein;(source:Araport11) |
AT3G57260 | beta 1,3-glucanase |
AT3G57290 | Encodes a protein that is found in not only the eif3 complex but also in association with subunits of the COP9 signalosome. eIF3e appears to be subjected to proteasome-dependent degradation that requires the PCI domain of eIF3e. The level of eIF3e present in cells appears to affect the rate of translation. |
AT3G57340 | DnaJ heat shock amino-terminal domain protein (DUF1977);(source:Araport11) |
AT3G57380 | Glycosyltransferase family 61 protein;(source:Araport11) |
AT3G57400 | transmembrane protein;(source:Araport11) |
AT3G57410 | Encodes a protein with high homology to animal villin. VLN3 is a Ca2+-regulated villin involved in actin filament bundling. |
AT3G57460 | catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding protein;(source:Araport11) |
AT3G57510 | Encodes ADPG1, a polygalacturonase protein involved in silique and anther dihiscence. Loss of function mutations have reduced seed set, indehiscent fruit and reduced pollen shedding. Required for release of cell wall-derived PR elicitors. |
AT3G57540 | Remorin family protein;(source:Araport11) |
AT3G57550 | guanylate kinase |
AT3G57580 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G57620 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
AT3G57640 | Protein kinase superfamily protein;(source:Araport11) |
AT3G57650 | Encodes an endoplasmic reticulum localized protein with lysophosphatidyl acyltransferase activity. |
AT3G57680 | C-terminal peptidase |
AT3G57790 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G57800 | Together with bHLH48 associates with phytochrome interacting factor 7 to regulate hypocotyl elongation. |
AT3G57840 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT3G57870 | Encodes a SUMO ligase that directs the attachment of the small protein SUMO to target proteins via an isopeptide bond. This enzyme is localized to the nucleus and plants with reduced levels of this protein show higher sensitivity to ABA in root growth inhibition assays. It has high similarity to the yeast UBC9 SUMO ligase and is sometimes referred to by that name. |
AT3G57910 | D111/G-patch domain-containing protein;(source:Araport11) |
AT3G57920 | Encodes a putative transcriptional regulator that is involved in the vegetative to reproductive phase transition. Expression is regulated by MIR156b. |
AT3G57930 | rho GTPase-activating gacO-like protein;(source:Araport11) |
AT3G57950 | cotton fiber protein;(source:Araport11) |
AT3G57970 | Emsy N Terminus (ENT)/ plant Tudor-like domains-containing protein;(source:Araport11) |
AT3G58020 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT3G58040 | Encodes a RING finger domain containing protein that interacts with AtRAP2.2. The mRNA is cell-to-cell mobile. |
AT3G58060 | TP8 is a tonoplast localized member of CDF family of cation transporters. It functions in roots as an Mn transporter.MTP8 transports manganese into root vacuoles of iron-deficient plants and thereby prevents inhibition of iron deficiency-induced ferric chelate reductase by manganese. In seed embryos, MTP8 is responsible for manganese and iron enrichment in the subepidermal cell layer (particularly in vit1 mutant background.) |
AT3G58070 | Putative transcription factor, contains C2H2 domain, regulates aspects of shoot maturation in Arabidopsis thaliana. GIS loss-of-function mutations affect the epidermal differentiation of inflorescence organs, causing a premature decrease in trichome production on successive leaves, stem internodes, and branches. Overexpression has the opposite effect on trichome initiation and causes other heterochronic phenotypes, affecting flowering and juvenile?adult leaf transition and inducing the formation of rosette leaves on inflorescence stems. |
AT3G58140 | phenylalanyl-tRNA synthetase class IIc family protein;(source:Araport11) |
AT3G58210 | TRAF-like family protein;(source:Araport11) |
AT3G58230 | Ubiquitin-specific protease family C19-related protein;(source:Araport11) |
AT3G58240 | TRAF-like superfamily protein;(source:Araport11) |
AT3G58250 | TRAF-like family protein;(source:Araport11) |
AT3G58270 | phospholipase-like protein (PEARLI 4) with TRAF-like domain protein;(source:Araport11) |
AT3G58290 | TRAF-like superfamily protein;(source:Araport11) |
AT3G58300 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
AT3G58310 | cysteine-rich repeat secretory protein, putative (DUF26);(source:Araport11) |
AT3G58330 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
AT3G58347 | Pseudogene of AT3G58330 |
AT3G58350 | Encodes RTM3 (Restricted Tobacco etch potyvirus Movement), a protein belonging to a protein family of 29 members which has a meprin and TRAF homology (MATH) domain in its N-terminal region and a coiled-coil (CC) domain at its C-terminal end. There are at least three RTMs in Arabidopsis. RTM proteins might form a multiprotein complex in the resistance mechanism to block the long distance movement of potyviruses. |
AT3G58360 | TRAF-like family protein;(source:Araport11) |
AT3G58380 | TRAF-like family protein;(source:Araport11) |
AT3G58390 | Represses the RNA the non-stop decay (NSD) and no-go decay (NGD) quality control systems that act during translation. Impairs NSD likely by sequestering the HBS1 components of the NSD complex. |
AT3G58400 | TRAF-like family protein;(source:Araport11) |
AT3G58410 | TRAF-like family protein;(source:Araport11) |
AT3G58420 | TRAF-like superfamily protein;(source:Araport11) |
AT3G58430 | MATH domain/coiled-coil protein;(source:Araport11) |
AT3G58440 | TRAF-like superfamily protein;(source:Araport11) |
AT3G58450 | USP domain containing protein, member of the universal stress protein family, regulated by ABA and possibly regulated by the ABA-dependent transcription factor AREB/ABF. Involved in the regulation of seed germination. |
AT3G58490 | Encodes a long-chain base 1-phosphate (LCBP) phosphatase that is expressed in the endoplasmic reticulum. |
AT3G58620 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. |
AT3G58720 | RING/U-box superfamily protein;(source:Araport11) |
AT3G58730 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
AT3G58740 | Encodes a peroxisomal citrate synthase that is expressed in siliques and developing seeds. |
AT3G58780 | One of two genes (SHP1 and SHP2) that are required for fruit dehiscence. The two genes control dehiscence zone differentiation and promote the lignification of adjacent cells. |
AT3G58820 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G58830 | Encodes a phosphatidylglycerophosphate (PGP) phosphatase that localizes to chloroplasts in above ground plant parts and mitochondria in root tips and root hairs and is involved in the synthesis of plastidial Phosphatidylglycerol (PG). This enzyme is responsible for the second step of PG synthesis. Mutants show reduced root growth. |
AT3G58860 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G58877 | hypothetical protein;(source:Araport11) |
AT3G58920 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G58950 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G59000 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G59010 | Encodes PME35, a pectin methylesterase. PME35-mediated demethylesterification of the primary cell wall regulates the mechanical strength of the supporting tissue. |
AT3G59030 | Encodes a proton antiporter. Involved in the transportation of proanthocyanidin precursors into the vacuole. In vitro transport experiments showed that cyanidin-3-O-glucoside (anthocyanin) was an effective substrate, whereas the proanthocyanidin precursor epicatechin was not transported. However catechin-3-O-glucoside inhibited anthocyanin transport in a dose-dependent manner suggesting that glycosylated epicatechin is the in vivo substrate. Recessive mutation has strong reduction of proanthocyanidin deposition in vacuoles and has reduced dormancy. Expressed in the endothelium of ovules and developing seeds. |
AT3G59060 | Encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. Involved in shade avoidance. Functions as negative regulator of PhyB. Protein levels are modulated by phytochrome B. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
AT3G59068 | Natural antisense transcript overlaps with AT3G59070;(source:Araport11) |
AT3G59070 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11) |
AT3G59080 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G59100 | encodes a protein similar to callose synthase |
AT3G59110 | Protein kinase superfamily protein;(source:Araport11) |
AT3G59140 | member of MRP subfamily |
AT3G59150 | F-box/RNI superfamily protein;(source:Araport11) |
AT3G59160 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G59170 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G59200 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G59220 | encodes a cupin-domain containing protein that is similar to pirins which interact with a CCAAT box binding transcription factor. The protein interacts with GPA1 (G protein alpha-subunit) in vitro. Mutants in the gene are affected in germination and early seedling development. |
AT3G59230 | RNI-like superfamily protein;(source:Araport11) |
AT3G59250 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G59260 | pirin;(source:Araport11) |
AT3G59270 | FBD-like domain family protein;(source:Araport11) |
AT3G59280 | Encodes the ortholog of yeast PAM16, part of the mitochondrial inner membrane protein import motor. Single mutant plants exhibit a smaller size and enhanced resistance against virulent pathogens. They also display elevated reactive oxygen species (ROS) accumulation. |
AT3G59310 | solute carrier family 35 protein (DUF914);(source:Araport11) |
AT3G59330 | solute carrier family 35 protein (DUF914);(source:Araport11) |
AT3G59340 | solute carrier family 35 protein (DUF914);(source:Araport11) |
AT3G59350 | Pti-like protein. Interacts with CLV1 and functions in CLE peptide signaling pathway in root development. Membrane localization is dependent on palmytolation. |
AT3G59440 | Encodes an endomembrane localized member of the CML subfamily VII. Contains a canonical CaM domain and unique N-terminal extension that distinguishes it from other members of the subfamily. |
AT3G59450 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT3G59460 | F-box/LRR protein;(source:Araport11) |
AT3G59480 | Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). |
AT3G59500 | Integral membrane HRF1 family protein;(source:Araport11) |
AT3G59510 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT3G59540 | Ribosomal L38e protein family;(source:Araport11) |
AT3G59570 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT3G59580 | Plant regulator RWP-RK family protein;(source:Araport11) |
AT3G59590 | jacalin lectin family protein;(source:Araport11) |
AT3G59640 | Plasma membrane localized. glycine rich protein of unknown function. Involved in non host resistance. |
AT3G59690 | Member of IQ67 (CaM binding) domain containing family. |
AT3G59700 | Member of Receptor kinase-like protein family. Represses stomatal immunity induced by Pseudomonas syringae pv. tomato DC3000. |
AT3G59710 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G59730 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT3G59765 | None;(source:Araport11) |
AT3G59800 | stress response protein;(source:Araport11) |
AT3G59820 | LETM1-like protein;(source:Araport11) |
AT3G59840 | allyl alcohol dehydrogenase-like protein;(source:Araport11) |
AT3G59870 | hypothetical protein;(source:Araport11) |
AT3G59910 | Ankyrin repeat family protein;(source:Araport11) |
AT3G59920 | RAB GDP DISSOCIATION INHIBITOR 2 The mRNA is cell-to-cell mobile. |
AT3G59990 | Encodes a MAP2 like methionine aminopeptidase |
AT3G60020 | SKP1-like 5;(source:Araport11) |
AT3G60030 | squamosa promoter-binding protein-like 12;(source:Araport11) |
AT3G60060 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G60070 | Major facilitator superfamily protein;(source:Araport11) |
AT3G60100 | citrate synthase 5;(source:Araport11) |
AT3G60110 | DNA-binding bromodomain-containing protein;(source:Araport11) |
AT3G60130 | beta glucosidase 16;(source:Araport11) |
AT3G60180 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G60190 | At3g60190 encodes Arabidopsis dynamin-related protein 1E, DRP1E, also known as EDR3, ADL4 and ADL1E, which is 624 amino acid residues long, has a predicted mass of 69.8 kDa and a pI of 7.5. Dynamin-related protein 1E belongs to a plant-specific subclass of dynamin-related proteins (DRP1), consisting of five members in Arabidopsis (A, B, C, D, E). This class is characterized by having an N-terminal GTPase domain, a central `dynamin 2` domain and a C-terminal GTPase effector domain (GED), a typical structure for plant dynamin-related proteins. However, this class lacks a PH domain and a proline-rich domain, which are found in classical animal dynamin-like proteins. Based on work on animal dynamins, the plant DRP1 proteins should be able to form polymeric structures that wrap around membranes to facilitate membrane tubulation and pinching off of vesicles, processes that are essential to vesicle trafficking and membrane compartmentalization. The edr3 mutation causes a P77L substitution in the G2 motif of the GTPase domain of DRP1E. edr3 mutant Arabidopsis plants display enhanced cell death in response to powdery mildew infection. |
AT3G60210 | GroES-like family protein;(source:Araport11) |
AT3G60238 | other_RNA;(source:Araport11) |
AT3G60270 | Cupredoxin superfamily protein;(source:Araport11) |
AT3G60280 | Encodes blue copper-binding protein III. |
AT3G60328 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT3G60330 | H[+]-ATPase 7;(source:Araport11) |
AT3G60360 | embryo sac development arrest 14;(source:Araport11) |
AT3G60380 | cotton fiber protein;(source:Araport11) |
AT3G60400 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT3G60410 | hypothetical protein (DUF1639);(source:Araport11) |
AT3G60470 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT3G60490 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
AT3G60500 | Encodes a 3'-5' exoribonuclease, positively regulates CER3 transcription, involved in cuticular wax biosynthesis. |
AT3G60510 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
AT3G60530 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT3G60560 | hypothetical protein;(source:Araport11) |
AT3G60580 | C2H2-like zinc finger protein;(source:Araport11) |
AT3G60590 | cytochrome P450 family protein;(source:Araport11) |
AT3G60600 | Encodes VAP27 (for Vesicle-Associated Protein). VAP27 has high homology to the VAP33 family of SNARE-like proteins from animals. May be involved in vesicular transport to or from the ER. Located exclusively in limiting membrane of protein storage vacuoles. Binds SRC2. |
AT3G60610 | pseudogene of pre-mRNA processing ribonucleoprotein binding region-containing protein;(source:Araport11) |
AT3G60620 | cytidinediphosphate diacylglycerol synthase 5;(source:Araport11) |
AT3G60630 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
AT3G60710 | F-box family protein. |
AT3G60740 | Encodes tubulin-folding cofactor D. Mutants arrest during embryogenesis with embryos that are small, mushroom-shaped ('pilz') and consist of only one or few large cells each containing one or more variably enlarged nuclei and often cell wall stubs. Gene product necessary for continuous microtubule organization. |
AT3G60760 | hypothetical protein;(source:Araport11) |
AT3G60780 | hypothetical protein (DUF1442);(source:Araport11) |
AT3G60790 | F-box family protein;(source:Araport11) |
AT3G60870 | Encodes an AT hook domain containing protein that, when overexpressed, delays flowering. Los s of function mutations have defects in primary and lateral root development. |
AT3G60961 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G60972 | other_RNA;(source:Araport11) |
AT3G60990 | glycosyltransferase family protein (DUF23);(source:Araport11) |
AT3G61035 | Cytochrome P450 superfamily protein;(source:Araport11) |
AT3G61060 | phloem protein 2-A13;(source:Araport11) |
AT3G61111 | Zinc-binding ribosomal protein family protein;(source:Araport11) |
AT3G61150 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
AT3G61170 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G61190 | Encodes a protein with a C2 domain that binds to BON1 in yeast two hybrid analyses. Its ability to bind to phospholipids is enhanced by calcium ions. Involved in maintaining cell homeostasis. |
AT3G61220 | CytADR/SDR1 is an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. It can also act on menthone and neomenthol in vitro, but these do not represent likely endogenous activities of this enzyme in planta. GFP-tagged CytADR appears to localize to the cytosol where it likely plays a role in detoxifying reactive carbonyls. sdr1 mutants have altered responses to pathogens. The mRNA is cell-to-cell mobile. |
AT3G61250 | LATE MERISTEM IDENTITY2 (LMI2) is a target of the meristem identity regulator LEAFY (LFY). Has a role in the meristem identity transition from vegetative growth to flowering. Member of the R2R3 factor gene family. |
AT3G61280 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
AT3G61290 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
AT3G61300 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT3G61310 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT3G61360 | Encodes SLO3 (SLOW GROWTH3), a pentatricopeptide repeat protein required for the splicing of mitochondrial NADH dehydrogenase subunit7 intron 2. Mutants have smaller RAMs are slower growing than wild type. |
AT3G61390 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT3G61400 | 1-aminocyclopropane-1-carboxylate oxidase-like protein |
AT3G61415 | SKP1-like 21;(source:Araport11) |
AT3G61430 | a member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development. The mRNA is cell-to-cell mobile. |
AT3G61450 | syntaxin of plants 73 (SYP73) |
AT3G61460 | Encodes a novel ring finger protein and forms an N-terminal hydrophobic domain and a C-terminal RING-H2 signature. Expression is down regulated by brassinolide. |
AT3G61490 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G61500 | BPS1-like protein;(source:Araport11) |
AT3G61560 | Reticulon family protein;(source:Araport11) |
AT3G61580 | Fatty acid/sphingolipid desaturase;(source:Araport11) |
AT3G61590 | F-box protein that is involved in some aspect of regulation of gene silencing by miRNA. Loss of function mutations have increased levels of some miRNAs. Its activity depends on the presence of functional F-box. |
AT3G61610 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
AT3G61620 | exonuclease RRP41 (RRP41) |
AT3G61630 | CRF6 encodes one of the six cytokinin response factors. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves. |
AT3G61640 | arabinogalactan protein 20;(source:Araport11) |
AT3G61680 | PLIP1 encodes a plastid localized phospholipase A1 involved in seed oil biosynthesis. |
AT3G61690 | Putative TNAase |
AT3G61710 | Encodes autophagy protein 6 (ATG6), required for pollen germination and plant development. |
AT3G61720 | Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11) |
AT3G61755 | pre-tRNA tRNA-Ala (anticodon: CGC);(source:Araport11, TAIR10) |
AT3G61790 | SINAT E3 ubiquitin ligase involved in mediation of FREE1 and VPS23A degradation to modulate abscisic acid signaling. |
AT3G61825 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
AT3G61830 | auxin response factor 18;(source:Araport11) |
AT3G61840 | auxin response factor, putative (DUF688);(source:Araport11) |
AT3G61860 | encodes an arginine/serine-rich splicing factor. transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
AT3G61880 | Encodes a cytochrome p450 monooxygenase. Overexpression of this gene allows fruit growth independently of fertilization. The gene is normally expressed only in floral organs(during the Arabidopsis stage 14 flower) and in the funiculus at anthesis. |
AT3G61890 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Loss of function mutant has abnormally shaped leaves and stems. |
AT3G61898 | transmembrane protein;(source:Araport11) |
AT3G61900 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT3G61930 | hypothetical protein;(source:Araport11) |
AT3G61940 | Member of Zinc transporter (ZAT) family. Expressed in roots under low zinc conditions. |
AT3G61950 | MYC-type transcription factor which interacts with ICE1 and negatively regulates cold-responsive genes and cold tolerance. |
AT3G61960 | autophagy gene |
AT3G62010 | metal ion-binding protein;(source:Araport11) |
AT3G62020 | germin-like protein (GLP10) |
AT3G62040 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT3G62050 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
AT3G62070 | hypothetical protein;(source:Araport11) |
AT3G62090 | encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. |
AT3G62100 | Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA30 lacks the conserved degron (domain II) found in many family members. IAA30 transcripts are induced by auxin treatment and accumulate preferentially in the quiescent center cells of the root meristem. Overexpression of IAA30 leads to defects in gravitropism, root development, root meristem maintenance, and cotyledon vascular development. Target of LEC2 and AGL15. Promotes somatyic embryogenesis. |
AT3G62150 | Encodes a facultative transporter controlling auxin concentrations in plant cells. |
AT3G62170 | VANGUARD-like protein;(source:Araport11) |
AT3G62190 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT3G62200 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
AT3G62230 | Target promoter of the male germline-specific transcription factor DUO1. Increases seed oil content by attenuating GL2 inhibition. Overexpression results in reduced trichome numbers. |
AT3G62270 | BOR2 is involved in efficient borate crosslinking of rhamnogalacturonan II in cell walls under boron limitation. |
AT3G62280 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G62300 | Encodes a protein with Agenet/Tudor and DUF724 domains. It can interact with ABAP1, a negative regulator of DNA replication and transcription, with the plant histone modification 'reader' LHP1, and with non-modified histones. It may act as a link between DNA replication, transcription and chromatin remodeling during flower development. Loss of function mutant has a WT phenotype. |
AT3G62370 | heme binding protein;(source:Araport11) |
AT3G62380 | F-box/associated interaction domain protein;(source:Araport11) |
AT3G62420 | Encodes a group-S bZIP transcription factor. Forms heterodimers with group-C bZIP transcription factors. The heterodimers bind to the ACTCAT cis-element of proline dehydrogenase gene. |
AT3G62529 | pseudogene of pentatricopeptide (PPR) repeat-containing protein |
AT3G62570 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G62620 | Encodes a protein of unknown function. Previously this protein has been annotated computationally as a sucrose-phosphatase-related protein. However, the source of this annotation can not be verified. This annotation (sucrose-phosphatase-related) has been removed. |
AT3G62630 | stress response NST1-like protein (DUF1645);(source:Araport11) |
AT3G62650 | hypothetical protein;(source:Araport11) |
AT3G62660 | Encodes a protein with putative galacturonosyltransferase activity. |
AT3G62670 | member of Response Regulator: B- Type |
AT3G62690 | Encodes a RING-H2 zinc finger protein related to ATL2. The ATL gene family is represented by fifteen sequences that contain, in addition to the RING, a transmembrane domain which is located in most of them towards the N-terminal end. |
AT3G62700 | member of MRP subfamily |
AT3G62730 | desiccation-like protein;(source:Araport11) |
AT3G62740 | beta glucosidase 7;(source:Araport11) |
AT3G62770 | Required for autophagosome formation during nutrient deprivation and senescence, promotes pexophagy during seedling development. |
AT3G62790 | NADH-ubiquinone oxidoreductase-like protein;(source:Araport11) |
AT3G62830 | Encodes a Golgi localized isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
AT3G62850 | zinc finger protein-like protein;(source:Araport11) |
AT3G62890 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G62980 | Encodes an auxin receptor that mediates auxin-regulated transcription. It contains leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation. Mutations in TIR1 block auxin stimulation of flavonoid synthesis. |
AT3G63003 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
AT3G63010 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. The mRNA is cell-to-cell mobile. |
AT3G63050 | hypothetical protein;(source:Araport11) |
AT3G63210 | encodes a novel zinc-finger protein with a proline-rich N-terminus, identical to senescence-associated protein SAG102 |
AT3G63290 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT3G63320 | Protein phosphatase 2C family protein;(source:Araport11) |
AT3G63360 | Encodes a defensin-like (DEFL) family protein. |
AT3G63430 | zinc finger CCCH domain protein;(source:Araport11) |
AT3G63510 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
AT3G63540 | Conceptual translation of this open reading frame gave the sequence of a 229-residue hypothetical protein that contains the same sequence as the mature A. thaliana chloroplast luminal 19-kDa protein linked to a putative signal sequence. |
AT3G66654 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT4G00110 | Encodes a putative membrane-anchored UDP-D-glucuronate 4-epimerase. |
AT4G00140 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT4G00160 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT4G00200 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT4G00210 | LOB domain-containing protein 31;(source:Araport11) |
AT4G00220 | Encodes a protein containing a LOB domain that is expressed in embryos, flower primordium and lateral floral organ boundaries. Overexpression is correlated with activation of STM and KNAT1 and down regulation of PIN1 and reduced auxin transport levels. Ectopic expression in plants results in premature termination of the shoot apical meristem and small, lobed leaves. A maternally expressed imprinted gene. |
AT4G00230 | xylem serine peptidase 1;(source:Araport11) |
AT4G00236 | pseudogene of Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
AT4G00240 | member of C2-PLD subfamily |
AT4G00260 | Transcriptional factor B3 family protein;(source:Araport11) |
AT4G00290 | Encodes a non-selective mechanosensitive ion channel localized to the inner mitochondrial membrane. |
AT4G00300 | AT4G00300 has been split into two loci based on new cDNA evidence provided by Aleksander Riise Hansen of University of Copenhagen: AT4G00300.2 becomes AT4G00300.1; a new locus AT4G00295 is created. See comments field for AT4G00295 annotation. |
AT4G00305 | RING/U-box superfamily protein;(source:Araport11) |
AT4G00330 | high overall homology to CRCK1 |
AT4G00335 | RING-H2 finger B1A;(source:Araport11) |
AT4G00342 | hypothetical protein;(source:Araport11) |
AT4G00360 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems. |
AT4G00390 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
AT4G00400 | bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly and is functionally redundant with GPAT4. |
AT4G00416 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
AT4G00440 | GPI-anchored adhesin-like protein, putative (DUF3741);(source:Araport11) |
AT4G00460 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT4G00467 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT4G00480 | MYC-related protein with a basic helix-loop-helix motif at the C-terminus and a region similar to the maize B/R family at the N-terminus |
AT4G00500 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G00530 | UvrABC system protein A;(source:Araport11) |
AT4G00560 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G00600 | Amino acid dehydrogenase family protein;(source:Araport11) |
AT4G00610 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
AT4G00660 | RNAhelicase-like 8;(source:Araport11) |
AT4G00690 | UB-like protease 1B;(source:Araport11) |
AT4G00700 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT4G00750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G00752 | UBX domain-containing protein;(source:Araport11) |
AT4G00780 | TRAF-like family protein;(source:Araport11) |
AT4G00820 | Member of IQ67 (CaM binding) domain containing family. |
AT4G00840 | DHHC-type zinc finger family protein;(source:Araport11) |
AT4G00872 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT4G00893 | F-box/kelch-repeat protein;(source:Araport11) |
AT4G00900 | Type IIA (SERCA-type) Ca2+ ATPase, catalyzes the efflux of calcium from the cytoplasm. |
AT4G00920 | COP1-interacting protein-like protein;(source:Araport11) |
AT4G00930 | Encodes COP1-interacting protein CIP4.1. |
AT4G00970 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G00975 | Natural antisense transcript overlaps with AT4G00980;(source:Araport11) |
AT4G00990 | jJumonji-domain-containing H3K9 histone demethylase. Loss of function mutants are susceptible to bacterial infection and early flowering. |
AT4G01000 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT4G01010 | member of Cyclic nucleotide gated channel family |
AT4G01020 | helicase domain-containing protein / IBR domain-containing protein / zinc finger protein-like protein;(source:Araport11) |
AT4G01023 | RING/U-box superfamily protein;(source:Araport11) |
AT4G01030 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
AT4G01070 | the glycosyltransferase (UGT72B1) is involved in metabolizing xenobiotica (chloroaniline and chlorophenole). Comparison between wild type and knock-out mutant demonstrates the central role of this gene for metabolizing chloroaniline but significantly less for chlorophenole. The glucosyltransferase preferred UDP-xylose over UDP-glucose indicating its (additional) functioning as a xylosyltransferase in planta |
AT4G01080 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT4G01090 | Hypothetical protein; participates in wound-induced lateral root development. |
AT4G01110 | late embryogenesis abundant hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT4G01130 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT4G01150 | Integral thylakoid membrane protein required for proper grana stack curvature. |
AT4G01220 | Encodes MGP4 (MALE GAMETOPHYTE DEFECTIVE 4), a rhamnogalacturonan II xylosyltransferase important for growth of pollen tubes and roots. |
AT4G01230 | Reticulon family protein. Mutants are resistant to agrobacterium infection. |
AT4G01245 | hypothetical protein;(source:Araport11) |
AT4G01260 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
AT4G01290 | Protein with evolutionarily conserved eIF4E-binding motif in its N-terminal domain that can form mRNA cap?binding complexes and has the potential for regulating gene expression as a translation factor associated plant-specific cell cycle regulator. |
AT4G01350 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G01360 | Encodes a protein related to BYPASS1 (BPS1). Regulates production of mobile compound: bps signal. |
AT4G01380 | plastocyanin-like domain-containing protein;(source:Araport11) |
AT4G01410 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT4G01430 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
AT4G01440 | nodulin MtN21-like transporter family protein |
AT4G01450 | nodulin MtN21-like transporter family protein |
AT4G01455 | tRNA-Glu (anticodon: TTC) |
AT4G01470 | Encodes AtTIP1;3, functions as water and urea channels in pollen. |
AT4G01480 | Encodes a protein that might have inorganic pyrophosphatase activity. |
AT4G01490 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.4e-44 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT4G01500 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT4G01510 | Arv1-like protein;(source:Araport11) |
AT4G01515 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.1e-18 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT4G01520 | NAC domain containing protein 67;(source:Araport11) |
AT4G01550 | Encodes a plasma-membrane bound NAC transcription factor, whose controlled proteolytic activation allows it to enter the nucleus. |
AT4G01630 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT4G01735 | polyhomeotic-like protein;(source:Araport11) |
AT4G01760 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G01810 | Sec23 homolog , forms a distinct clade with SEC23D.Mutants have defects in pollen exine patterning, tapetal development and pollen intine formation. |
AT4G01820 | member of MDR subfamily |
AT4G01830 | P-glycoprotein 5;(source:Araport11) |
AT4G01895 | systemic acquired resistance (SAR) regulator protein NIMIN-1-like protein;(source:Araport11) |
AT4G01960 | transmembrane protein;(source:Araport11) |
AT4G01970 | Encodes a a raffinose and high affinity stachyose synthase as well as a stachyose and Gol specific galactosylhydrolase enzyme activity.AtRS4 is a sequential multifunctional RafS and StaS as well as a high affinity StaS, accepting only Raf and Gol for Sta product formation. AtRS4 possesses a Sta and Gol specific galactosylhydrolase enzyme activity. |
AT4G02005 | None;(source:Araport11) |
AT4G02010 | Protein kinase superfamily protein;(source:Araport11) |
AT4G02030 | Vps51/Vps67 family (components of vesicular transport) protein;(source:Araport11) |
AT4G02075 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT4G02090 | PADRE protein. |
AT4G02100 | Heat shock protein DnaJ with tetratricopeptide repeat-containing protein;(source:Araport11) |
AT4G02160 | cotton fiber protein;(source:Araport11) |
AT4G02170 | cotton fiber protein;(source:Araport11) |
AT4G02195 | Encodes a member of SYP4 Gene Family that is a plant ortholog of the Tlg2/syntaxin16 Qa-SNARE. Together with SYP43, it regulates the secretory and vacuolar transport pathways in the post-Golgi network and maintains the morphology of the Golgi apparatus and TGN and is required for extracellular resistance responses to a fungal pathogen. |
AT4G02210 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
AT4G02235 | AGAMOUS-like 51;(source:Araport11) |
AT4G02250 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT4G02270 | root hair specific 13;(source:Araport11) |
AT4G02290 | glycosyl hydrolase 9B13;(source:Araport11) |
AT4G02320 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT4G02380 | Encodes AtLEA5 (late embryogenesis abundant like protein). Also known as SENESCENCE-ASSOCIATED GENE 21 (SAG21). Has a role on oxidative stress tolerance. mRNA levels are elevated in response to various stresses. |
AT4G02450 | Encodes one of two isoforms of a co-chaperone of HSP90 that is required for root growth, in particular in the maintenance of the root meristem. |
AT4G02465 | hypothetical protein;(source:Araport11) |
AT4G02480 | AAA-type ATPase family protein;(source:Araport11) |
AT4G02510 | An integral membrane GTPase that functions as a transit-sequence receptor required for the import of proteins necessary for chloroplast biogenesis. Located in the outer chloroplast membrane. Phosphorylation of the G-domains regulate translocon assembly. The mRNA is cell-to-cell mobile. |
AT4G02555 | snoRNA;(source:Araport11) |
AT4G02650 | Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane. |
AT4G02670 | indeterminate(ID)-domain 12;(source:Araport11) |
AT4G02710 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
AT4G02733 | F-box family protein;(source:Araport11) |
AT4G02740 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT4G02780 | Catalyzes the conversion of geranylgeranyl pyrophosphate (GGPP) to copalyl pyrophosphate (CPP) of gibberellin biosynthesis |
AT4G02790 | Encodes a GTPase that is targeted to chloroplasts and co-fractionated with chloroplast ribosomes. Mutants are embryo lethal due to this essential function being lost. |
AT4G02810 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
AT4G02830 | hypothetical protein;(source:Araport11) |
AT4G02850 | DAAR1 encodes a PLP-independent racemase that catalyzes the conversion from L-Ile to D-allo-Ile. |
AT4G02860 | Phenazine biosynthesis PhzC/PhzF protein;(source:Araport11) |
AT4G02870 | B3 domain protein;(source:Araport11) |
AT4G02880 | ELKS/Rab6-interacting/CAST family protein;(source:Araport11) |
AT4G02950 | Ubiquitin family protein;(source:Araport11) |
AT4G02980 | Auxin binding protein involved in cell elongation and cell division. ABP1 is ubiquitinated in vitro and in planta by AtRma2. ABP1 was thought to be embryo lethal but further experimentation has demonstrated that lethality is due to a linked mutation in another gene. |
AT4G03010 | RNI-like superfamily protein;(source:Araport11) |
AT4G03050 | The transcribed allele in ecotype Ler encodes a 2-oxoglutarate-dependent dioxygenase which is involved in glucosinolate biosynthesis. AOP3 is transcriptionally silent in leaf tissues of ecotype Col.The natural variation in this locus explains the diversification of hydroxyalkyl glucosinolates among different ecotypes of Arabidopsis. |
AT4G03110 | Encodes a putative RNA-binding protein that is located in the cytoplasm and is involved in the hypersensitive response and positively regulates salicylic acid-mediated immunity. |
AT4G03115 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT4G03190 | Encodes an F box protein belonging to the TIR1 subfamily. This protein forms SCF complexes with ASK1 and CUL1 and interacts with Aux/IAA proteins in an auxin-dependent manner. It also has sequence similarity to the yeast protein GRR1, which is involved in glucose repression. |
AT4G03200 | catalytics;(source:Araport11) |
AT4G03205 | Coproporphyrinogen III oxidase;(source:Araport11) |
AT4G03210 | Encodes a member of xyloglucan endotransglucosylase/hydrolases (XTHs) that catalyze the cleavage and molecular grafting of xyloglucan chains function in loosening and rearrangement of the cell wall. Gene is expressed in shoot apex region, flower buds, flower stalks and internodes bearing flowers. |
AT4G03220 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
AT4G03250 | Homeodomain-like superfamily protein;(source:Araport11) |
AT4G03270 | Cyclin D6, involved in cortex/endodermis asymmetric stem cell division. |
AT4G03280 | Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. The mRNA is cell-to-cell mobile. |
AT4G03285 | pre-tRNA tRNA-Thr (anticodon: TGT);(source:Araport11, TAIR10) |
AT4G03290 | EF hand calcium-binding protein family;(source:Araport11) |
AT4G03320 | Encodes a component of the TIC (translocon at the inner envelope membrane of chloroplasts) protein translocation machinery mediating the protein translocation across the inner envelope of plastids. The Arabidopsis genome encodes four Tic20 homologous proteins, AT1G04940(Tic20-I), AT2G47840(Tic20-II), AT4G03320(Tic20-IV) and AT5G55710(Tic20-V). |
AT4G03340 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT4G03364 | Pseudogene of AT4G05230; ubiquitin family protein |
AT4G03370 | Ubiquitin family protein;(source:Araport11) |
AT4G03380 | hypothetical protein;(source:Araport11) |
AT4G03420 | hypothetical protein (DUF789);(source:Araport11) |
AT4G03450 | Ankyrin repeat family protein;(source:Araport11) |
AT4G03470 | Ankyrin repeat family protein;(source:Araport11) |
AT4G03505 | hypothetical protein;(source:Araport11) |
AT4G03510 | RMA1 encodes a novel 28 kDa protein with a RING finger motif and a C-terminal membrane-anchoring domain that is involved in the secretory pathway. Has E3 ubiquitin ligase activity. |
AT4G03550 | Encodes a callose synthase that is required for wound and papillary callose formation in response to fungal pathogens Erysiphe and Blumeria. Mutants are resistant to P. parasitica and exhibit an exaggerated PR1 response.Contributes to PAMP-induced basal defense. The mRNA is cell-to-cell mobile. |
AT4G03565 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT4G03580 | hypothetical protein;(source:Araport11) |
AT4G03590 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT4G03610 | Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11) |
AT4G03620 | myosin heavy chain-like protein;(source:Araport11) |
AT4G03630 | RNI-like superfamily protein;(source:Araport11) |
AT4G03730 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.3e-102 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
AT4G03816 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.6e-22 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
AT4G03873 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 8.5e-06 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT4G03876 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G03930 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT4G04020 | Fibrillin precursor protein. The fibrillin preprotein, but not the mature protein interacts with ABI2. Regulated by abscisic acid response regulators. Involved in abscisic acid-mediated photoprotection. The mRNA is cell-to-cell mobile. |
AT4G04030 | transcription repressor;(source:Araport11) |
AT4G04040 | Encodes a pyrophosphate-dependent phosphofructokinase B subunit (PFPbeta2). |
AT4G04100 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.6e-16 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G04170 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.3e-87 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G04220 | receptor like protein 46;(source:Araport11) |
AT4G04255 | transposable_element_gene;(source:Araport11);pseudogene, similar to unnamed protein product, blastp match of 37%25 identity and 5.0e-30 P-value to GP|6815097|dbj|BAA90383.1||AP001081 unnamed protein product {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT4G04260 | Bromo-adjacent homology (BAH) domain-containing protein;(source:Araport11) |
AT4G04316 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 9.6e-40 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G04360 | transmembrane protein, putative (DUF1068);(source:Araport11) |
AT4G04380 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.5e-248 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G04404 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
AT4G04405 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.6e-50 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G04410 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-176 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT4G04423 | hypothetical protein;(source:Araport11) |
AT4G04460 | Saposin-like aspartyl protease family protein;(source:Araport11) |
AT4G04480 | F-box protein with a domain protein;(source:Araport11) |
AT4G04490 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G04500 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G04510 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G04547 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-68 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT4G04620 | Autophagy protein. |
AT4G04635 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43722.1);(source:TAIR10) |
AT4G04690 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT4G04693 | pseudogene of F-box family protein;(source:Araport11) |
AT4G04695 | member of Calcium Dependent Protein Kinase. Involved in response to salicylic acid. |
AT4G04750 | Putative mitochondrial F1F0-ATPase. |
AT4G04780 | Encodes the med21 subunit of the mediator complex which is involved in transcriptional regulation. MED21 interacts physically with the E3 ligase HUB1 and this interaction may be important in mediation defense responses to fungal pathogens. |
AT4G04830 | methionine sulfoxide reductase B5;(source:Araport11) |
AT4G04850 | Encodes a potassium efflux antiporter; has three splice forms KEA3.1, KEA3.2, and KEA3.3, KEA3.2 is the most abundant splice form in all plant organs (silique, flower, leaf and root). KEA3.1 and KEA3.3 are minor variants that can be found in flowers and in leaves. KEA3 is localized to the thylakoid membrane and enriched in the stromal lamellae. It allows proton efflux from the thylakoid lumen by proton/potassium antiport. |
AT4G04885 | Encodes PCFS4 (Pcf11p-similar protein 4), a homolog of yeast polyadenylation factor Protein 1 of Cleavage Factor (Pcf11p). Regulates FCA (AT4G16280) mRNA polyadenylation. Promotes flowering time. |
AT4G04890 | Encodes a homeodomain protein that is expressed in the LI layer of the vegetative, floral and inflorescence meristems. Binds to the L1 box promoter element which is required in some proteins for L1 specific expression. |
AT4G04900 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Most similar to RIC9 and RIC11 (subfamily group I). Gene is expressed predominantly in roots, leaves, and seedlings. |
AT4G04930 | Encodes a sphingolipid delta4-desaturase, involved in sphingolipid biosynthesis. Specifically expressed in floral tissues. Knockout mutants were devoid of sphinga-4,8-dienine in floral tissues. |
AT4G04940 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT4G04950 | Encodes a monothiol glutaredoxin that is a critical component involved in ROS accumulation, auxin signaling, and temperature-dependent postembryonic growth in plants. It has been shown to associate with the cytosolic Fe-S assembly (CIA) complex and contributes to, but is not essential for, the correct functioning of client Fe-S proteins in unchallenged conditions. |
AT4G04957 | RRM in demeter (DUF1985);(source:Araport11) |
AT4G04960 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT4G04972 | hypothetical protein;(source:Araport11) |
AT4G04980 | hypothetical protein;(source:Araport11) |
AT4G05000 | Vacuolar protein sorting-associated protein VPS28 family protein;(source:Araport11) |
AT4G05010 | F-box family protein;(source:Araport11) |
AT4G05020 | Miitochondrial alternative NADH dehydrogenase. |
AT4G05048 | Encodes a C/D box snoRNA (U49.1). Gb: AJ300655 |
AT4G05071 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G05100 | Member of the R2R3 factor gene family. |
AT4G05105 | Encodes a microRNA that targets several Laccase family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCAUUGAGUGCAGCGUUGAUG |
AT4G05110 | equilibrative nucleoside transporter 6;(source:Araport11) |
AT4G05120 | Encodes an equilibrative nucleoside transporter AtENT3. Mutations of this locus allow mutants to grow on uridine analogue fluorouridine. |
AT4G05145 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
AT4G05160 | Encodes a peroxisomal protein involved in the activation of fatty acids through esterification with CoA. At4g05160 preferentially activates fatty acids with medium chain length (C6:0 and C7:0) as well as even-numbered long-chain fatty acids (C14:0, C16:0 and C18:0). At4g05160 was also able to catalyze the conversion of OPC-6:0 to its CoA ester and is therefore thought to be involved in the peroxisomal β-oxidation steps of jasmonic acid biosynthesis. |
AT4G05170 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT4G05180 | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II. |
AT4G05200 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G05220 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT4G05240 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT4G05260 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT4G05310 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT4G05320 | One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. The mRNA is cell-to-cell mobile. |
AT4G05330 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
AT4G05340 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G05360 | Zinc knuckle (CCHC-type) family protein;(source:Araport11) |
AT4G05380 | P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11) |
AT4G05430 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT4G05440 | Plays a role in pollen development and modulating DNA replication via interaction with MCM4 and MCM7 of the pre-replication complex. |
AT4G05460 | Encodes a SKP1/ASK-Interacting protein. |
AT4G05475 | RNI-like superfamily protein;(source:Araport11) |
AT4G05497 | RNI-like superfamily protein;(source:Araport11) |
AT4G05508 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:ATGAGTTGGGTCTAACCCATAACT |
AT4G05510 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 4.0e-144 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G05530 | Encodes a peroxisomal member of the short-chain dehydrogenase/reductase (SDR) family of enzymes. Loss of IBR1 function causes increased resistance to indole-3-butyric acid without affecting plant responses to IAA, NAA, and 2,4-D. This enzyme may be responsible for catalyzing a dehydrogenation step in the beta-oxidation-like conversion of IBA to IAA. The mRNA is cell-to-cell mobile. |
AT4G05540 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G05590 | Encodes NRGA1, a putative mitochondrial pyruvate carrier that mediates ABA regulation of guard cell ion channels and drought stress responses. |
AT4G06479 | nucleic acid binding / zinc ion binding protein;(source:Araport11) |
AT4G06491 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.4e-214 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT4G06494 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains Pfam domain PF03778: Protein of unknown function (DUF321);(source:TAIR10) |
AT4G06496 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G06497 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.0e-48 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G06529 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.7e-246 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT4G06530 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G06533 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G06537 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.5e-20 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT4G06548 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.5e-39 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT4G06557 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 6.5e-16 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
AT4G06571 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G06594 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.1e-215 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
AT4G06617 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 6.2e-37 P-value blast match to At5g59620.1/14-257 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G06635 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G06646 | transposable_element_gene;(source:Araport11);pseudogene, similar to OJ1081_B12.13, blastp match of 33%25 identity and 9.8e-51 P-value to GP|27817864|dbj|BAC55632.1||AP003865 OJ1081_B12.13 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT4G06648 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.0e-181 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT4G06654 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.2e-88 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
AT4G06658 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-182 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
AT4G06678 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G06700 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.7e-54 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
AT4G06701 | other_RNA;(source:Araport11) |
AT4G06702 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G06708 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.9e-289 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT4G06710 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G06718 | transposable_element_gene;(source:Araport11);pseudogene, expressed protein;(source:TAIR10) |
AT4G07031 | transposable_element_gene;(source:Araport11);similar to cytochrome P-450 aromatase-related [Arabidopsis thaliana] (TAIR:AT2G05870.1);(source:TAIR10) |
AT4G07454 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.2e-139 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT4G07510 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42110.1);(source:TAIR10) |
AT4G07526 | hypothetical protein;(source:Araport11) |
AT4G07662 | transposable_element_gene;(source:Araport11);pseudogene, helicase -related, similar to putative helicase;(source:TAIR10) |
AT4G07720 | pseudogene of myosin heavy chain-like protein;(source:Araport11) |
AT4G07730 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 6.8e-198 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT4G07740 | hypothetical protein (DUF3287);(source:Araport11) |
AT4G07770 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.7e-12 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G07803 | transposable_element_gene;(source:Araport11);pseudogene, helicase -related, similar to putative helicase;(source:TAIR10) |
AT4G07810 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.1e-230 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT4G07820 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
AT4G07915 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-15 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G07932 | hypothetical protein;(source:Araport11) |
AT4G07945 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, similar to reverse transcriptase, putative;(source:TAIR10) |
AT4G07950 | DNA-directed RNA polymerase, subunit M, archaeal;(source:Araport11) |
AT4G07960 | encodes a XyG glucan synthase; gene similar to cellulose synthase |
AT4G07990 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT4G08025 | ECA1 gametogenesis family protein (DUF784);(source:Araport11) |
AT4G08032 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative transposable element, similar to transposase, putative;(source:TAIR10) |
AT4G08033 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G08038 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to reverse transcriptase, putative;(source:TAIR10) |
AT4G08039 | Encodes a defensin-like (DEFL) family protein. |
AT4G08040 | encodes an aminotransferase that belongs to ACC synthase gene family structurally |
AT4G08053 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 3.4e-89 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
AT4G08056 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30843.1);(source:TAIR10) |
AT4G08078 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 4.6e-276 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT4G08090 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.4e-12 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G08108 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G08135 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.2e-10 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT4G08136 | pseudogene of purple acid phosphatase 10;(source:Araport11) |
AT4G08150 | A member of class I knotted1-like homeobox gene family (together with KNAT2). Similar to the knotted1 (kn1) homeobox gene of maize. Normally expressed in the peripheral and rib zone of shoot apical meristem but not in the leaf primordia. It is also expressed in the fourth floral whorl, in the region that would become style, particularly in the cell surrounding the transmitting tissue. No expression was detected in the first three floral whorls. Expression is repressed by auxin and AS1 which results in the promotion of leaf fate. |
AT4G08160 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
AT4G08190 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G08230 | glycine-rich protein;(source:Araport11) |
AT4G08262 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.5e-30 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G08300 | nodulin MtN21-like transporter family protein |
AT4G08310 | DNA ligase;(source:Araport11) |
AT4G08330 | hypothetical protein;(source:Araport11) |
AT4G08360 | KOW domain-containing protein;(source:Araport11) |
AT4G08380 | Proline-rich extensin-like family protein;(source:Araport11) |
AT4G08410 | Proline-rich extensin-like family protein;(source:Araport11) |
AT4G08450 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT4G08500 | Encodes a member of the A1 subgroup of the MEKK (MAPK/ERK kinase kinase) family. MEKK is another name for Mitogen-Activated Protein Kinase Kinase Kinase (MAPKKK or MAP3K). This subgroup has four members: At4g08500 (MEKK1, also known as ARAKIN, MAP3Kb1, MAPKKK8), At4g08480 (MEKK2, also known as MAP3Kb4, MAPKKK9), At4g08470 (MEKK3, also known as MAP3Kb3, MAPKKK10) and At4g12020 (MEKK4, also known as MAP3Kb5, MAPKKK11, WRKY19). Nomenclatures for mitogen-activated protein kinases are described in Trends in Plant Science 2002, 7(7):301. Mediates cold, salt, cadmium and wounding stress signalling. Phosphorylates MEK1. |
AT4G08530 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
AT4G08540 | One of a pair of paralogs (the other is AT1G77890)that is a subunit of the lass III phosphatidylinositol 3-kinase (PI3K) complex,but is not essential for PI3P biosynthesis. |
AT4G08555 | hypothetical protein;(source:Araport11) |
AT4G08560 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT4G08570 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT4G08596 | transposable_element_gene;(source:Araport11);pseudogene, FAR1 -related protein, temporary automated functional assignment;(source:TAIR10) |
AT4G08630 | fas-binding factor-like protein;(source:Araport11) |
AT4G08640 | ATP binding protein;(source:Araport11) |
AT4G08657 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G08670 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT4G08730 | RNA-binding protein;(source:Araport11) |
AT4G08740 | hypothetical protein;(source:Araport11) |
AT4G08750 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G08760.1);(source:TAIR10) |
AT4G08770 | Encodes a putative apoplastic peroxidase Prx37. Primarily expressed in the vascular bundles. Overexpression renders a dwarf phenotype with smaller plants and delayed development. Plants overexpressing Prx37 also shows an increase in the amount of esterified phenolic material associated with their walls. |
AT4G08790 | NIT1 amidase involved in the breakdown of deaminated glutathione (dGSH). It is active towards dGSH and dOA with a preference for dGSH. |
AT4G08840 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT4G08876 | pyrophosphate-fructose-6-phosphate 1-phosphotransferase-related / pyrophosphate-dependent 6-phosphofructose-1-kinase-like protein;(source:Araport11) |
AT4G08910 | homeobox protein;(source:Araport11) |
AT4G08920 | Encodes CRY1, a flavin-type blue-light photoreceptor with ATP binding and autophosphorylation activity. Functions in perception of blue / green ratio of light. The photoreceptor may be involved in electron transport. Mutant phenotype displays a blue light-dependent inhibition of hypocotyl elongation. Photoreceptor activity requires light-induced homodimerisation of the N-terminal CNT1 domains of CRY1. Involved in blue-light induced stomatal opening. The C-terminal domain of the protein undergoes a light dependent conformational change. Also involved in response to circadian rhythm. Mutants exhibit long hypocotyl under blue light and are out of phase in their response to circadian rhythm. CRY1 is present in the nucleus and cytoplasm. Different subcellular pools of CRY1 have different functions during photomorphogenesis of Arabidopsis seedlings. The mRNA is cell-to-cell mobile. |
AT4G08930 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. The mRNA is cell-to-cell mobile. |
AT4G08945 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.2e-16 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT4G08980 | Encodes an F-box gene that is a novel negative regulator of AGO1 protein levels and may play a role in ABA signalling and/or response. It is a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins. |
AT4G09070 | TATA-binding related factor (TRF) of subunit 20 of Mediator complex;(source:Araport11) |
AT4G09090 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT4G09100 | RING/U-box superfamily protein;(source:Araport11) |
AT4G09120 | RING/U-box superfamily protein;(source:Araport11) |
AT4G09130 | RING/U-box superfamily protein;(source:Araport11) |
AT4G09180 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT4G09190 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT4G09300 | LisH and RanBPM domains containing protein;(source:Araport11) |
AT4G09316 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.3e-116 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
AT4G09340 | SPla/RYanodine receptor (SPRY) domain-containing protein;(source:Araport11) |
AT4G09350 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT4G09360 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
AT4G09410 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.4e-40 P-value blast match to Q9SI25 /181-349 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT4G09430 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
AT4G09450 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
AT4G09452 | Pseudogene of AT2G38590; F-box family protein |
AT4G09460 | Encodes myb6 DNA-binding protein. The mRNA is cell-to-cell mobile. |
AT4G09530 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G09540 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-43 P-value blast match to GB:AAC64917 gag-pol polyprotein (Ty1_Copia-element) (Glycine max);(source:TAIR10) |
AT4G09545 | Encodes a ECA1 gametogenesis related family protein |
AT4G09550 | Encodes a gamma-tubulin complex protein that plays a role in gamma-tubulin complex localization, spindle stability and chromosomal segregation. |
AT4G09610 | GAST1 protein homolog 2;(source:Araport11) |
AT4G09630 | transmembrane protein (DUF616);(source:Araport11) |
AT4G09690 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G09730 | Encodes RH39, a DEAD-box protein involved in the introduction of the hidden break into the 23S rRNA in the chloroplasts. Recombinant RH39 binds to the 23S rRNA in a segment adjacent to the stem-loop creating the hidden break target loop in a sequence-dependent manner. Has ATP-hydrolyzing activity at a Kcat of 5.3 /min in the presence of rRNA sequence. Mutants have drastically reduced level of level of ribulose 1,5-bisphosphate carboxylase/oxygenase. The mRNA is cell-to-cell mobile. |
AT4G09740 | glycosyl hydrolase 9B14;(source:Araport11) |
AT4G09840 | hypothetical protein;(source:Araport11) |
AT4G09860 | hypothetical protein;(source:Araport11) |
AT4G09870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT4G09900 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
AT4G09920 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT4G09940 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G09950 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G09965 | hypothetical protein;(source:Araport11) |
AT4G09987 | Encodes a defensin-like (DEFL) family protein. |
AT4G09990 | glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11) |
AT4G10000 | Thioredoxin family protein;(source:Araport11) |
AT4G10010 | Protein kinase superfamily protein;(source:Araport11) |
AT4G10020 | Encodes a putative hydroxysteroid dehydrogenase (HSD). Genes that encode HSD include: At5g50600 and At5g50700 (HSD1), At3g47350(HSD2), At3g47360(HSD3), At5g50590 and At5g50690(HSD4), At5g50770(HSD6) (Plant Cell Physiology 50:1463). Two copies of HSD1 and HSD4 exist due to a gene duplication event. In Plant Physiology 145:87, At5g50690 is HSD7, At4g10020 is HSD5. |
AT4G10050 | esterase/lipase/thioesterase family protein;(source:Araport11) |
AT4G10060 | Glucosylceramidase that preferentially hydrolyzes long acyl chain glucosylceramides. |
AT4G10090 | elongator protein 6;(source:Araport11) |
AT4G10115 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT4G10140 | transmembrane protein;(source:Araport11) |
AT4G10150 | RING/U-box superfamily protein;(source:Araport11) |
AT4G10160 | RING/U-box superfamily protein;(source:Araport11) |
AT4G10190 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT4G10200 | TTF-type zinc finger protein with HAT dimerization domain-containing protein;(source:Araport11) |
AT4G10201 | Pseudogene of AT3G21130; F-box family protein-related |
AT4G10290 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT4G10300 | RmlC-like cupins superfamily protein. Overexpression leads to trehalose resistance, drought and stress tolerance. |
AT4G10310 | encodes a sodium transporter (HKT1) expressed in xylem parenchyma cells. Mutants over-accumulate sodium in shoot tissue and have increased sodium in the xylem sap and reduced sodium in phloem sap and roots. |
AT4G10320 | tRNA synthetase class I (I, L, M and V) family protein;(source:Araport11) |
AT4G10350 | NAC domain protein. SMB, BRN1, and BRN2 act to regulate root cap maturation, in a partially redundant fashion.BRN1 and BRN2, control the cell wall maturation processes that are required to detach root cap layers from the root. |
AT4G10360 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
AT4G10380 | Boric acid channel. Essential for efficient boron uptake and plant development under boron limitation. Also functions in arsenite transport and tolerance. Localized preferentially in outer membrane domains of root cells. |
AT4G10390 | Protein kinase superfamily protein;(source:Araport11) |
AT4G10430 | TMPIT-like protein;(source:Araport11) |
AT4G10440 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G10470 | hypothetical protein;(source:Araport11) |
AT4G10480 | Nascent polypeptide-associated complex (NAC), alpha subunit family protein;(source:Araport11) |
AT4G10490 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT4G10500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT4G10507 | other_RNA;(source:Araport11) |
AT4G10510 | Subtilase family protein;(source:Araport11) |
AT4G10520 | Subtilase family protein;(source:Araport11) |
AT4G10540 | Proteolytic enzyme of that phytaspase family which at pH 5.5 is strictly Asp-specific. Strongly preferred cleavage motifs are YVAD and IETD. |
AT4G10595 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G10610 | RNA-binding protein, putative. Member of a family of proteins having an PABC binding domain (PAM motif). |
AT4G10650 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G10660 | CDC68-like protein;(source:Araport11) |
AT4G10670 | Homologous to yeast SPT16, a general chromatin factor required for transcription |
AT4G10695 | CDC68-like protein;(source:Araport11) |
AT4G10770 | oligopeptide transporter |
AT4G10780 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
AT4G10820 | F-box family protein;(source:Araport11) |
AT4G10840 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
AT4G10860 | hypothetical protein;(source:Araport11) |
AT4G10925 | Nuclear transport factor 2 (NTF2) family protein;(source:Araport11) |
AT4G11040 | Encodes a nuclear localized protein with sequence similarity to PP2C phosphatases that is involved in seed dormancy. Loss of function mutations have reduced seed dormancy but does not act through ABA or DOG1 pathways. Lacks several conserved key residues and does not possess any appreciable phosphatase activity in in vitro assays. QTL allele with a nonsynonymous amino acid change confers seed dormancy phenotype. |
AT4G11050 | glycosyl hydrolase 9C3;(source:Araport11) |
AT4G11080 | Encodes a protein containing three copies of the HMG (high mobility group)-box domain. The two Arabidopsis 3xHMG-box proteins are: AT4G11080 (3xHMG-box1) and AT4G23800 (3xHMG-box2). Interacts with mitotic and meiotic chromosomes. |
AT4G11140 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
AT4G11170 | Encodes RMG1 (Resistance Methylated Gene 1), a NB-LRR disease resistance protein with a Toll/interleukin-1 receptor (TIR) domain at its N terminus. RMG1 is expressed at high levels in response to flg22 and in naive met1/nrpd2 relative to wild-type plants. Expression of this gene is controlled by DNA methylation in its promoter region. The RMG1 promoter region is constitutively demethylated by active DNA demethylation mediated by the DNA glycosylase ROS1. |
AT4G11175 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT4G11200 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30370.1);(source:TAIR10) |
AT4G11250 | AGAMOUS-like 52;(source:Araport11) |
AT4G11300 | ROH1, putative (DUF793);(source:Araport11) |
AT4G11330 | MAP kinase |
AT4G11393 | Encodes a defensin-like (DEFL) family protein. |
AT4G11400 | ARID/BRIGHT DNA-binding , ELM2 domain and myb-like DNA-binding domain-containing protein;(source:Araport11) |
AT4G11405 | pre-tRNA tRNA-Thr (anticodon: TGT);(source:Araport11, TAIR10) |
AT4G11410 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G11420 | Encodes a subunit of eukaryotic initiation factor 3 (eIF3), a multisubunit complex that is required for binding of mRNA to 40 S ribosomal subunits, stabilization of ternary complex binding to 40 S subunits, and dissociation of 40 and 60 S subunits. |
AT4G11440 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT4G11450 | bromo-adjacent domain protein, putative (DUF3527);(source:Araport11) |
AT4G11460 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G11470 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G11480 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G11485 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G11540 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G11570 | Encodes plastid localized protein involved in riboflavin biosynthesis. It dephosphorylates 5-amino-6-ribitylamino- 2,4(1H,3H) pyrimidinedione 5′-phosphate (ARPP) . |
AT4G11580 | RNI-like superfamily protein;(source:Araport11) |
AT4G11610 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT4G11630 | Ribosomal protein L19 family protein;(source:Araport11) |
AT4G11660 | member of Heat Stress Transcription Factor (Hsf) family |
AT4G11690 | Encodes ABO8, a pentatricopeptide repeat (PPR) protein responsible for the splicing of NAD4 intron 3 in mitochondrial complex I. Abo8 mutants accumulate more reactive oxygen species (ROS) in root tips than the wild type. |
AT4G11700 | hypothetical protein (DUF626);(source:Araport11) |
AT4G11720 | Encodes HAP2 with the following predicted motifs: an N-terminal secretion signal, a single transmembrane domain and a C-terminal histidine-rich domain. HAP2 is expressed only in the haploid sperm and is required for pollen tube guidance and fertilization. Predominantly localized to sperm endoplasmic reticulum membranes. May also reside in other endomembranes, including the plasma membrane. Target promoter of the male germline-specific transcription factor DUO1. |
AT4G11730 | Cation transporter/ E1-E2 ATPase family protein;(source:Araport11) |
AT4G11740 | Isolated as a suppressor of a dominant mutant in the Ara4 gene that was expressed in yeast ypt1 mutant strains. A novel protein with a small region of similarity to coil-coiled domain of yeast VSP27 protein. |
AT4G11745 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT4G11800 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
AT4G11810 | Encodes an SPX domain protein that transports Pi into the vacuole. Overexpression of PHT5:2 leads to massive Pi sequestration into vacuoles and altered regulation of Pi starvation-responsive genes. |
AT4G11820 | Encodes a protein with hydroxymethylglutaryl-CoA synthase activity which was characterized by phenotypical complementation of the S. cerevisiae mutant. Involved in glucosinolate biosynthesis. |
AT4G11840 | member of C2-PLD subfamily |
AT4G11890 | Encodes a receptor-like cytosolic kinase ARCK1. Negatively controls abscisic acid and osmotic stress signal transduction. |
AT4G11910 | Acts antagonistically with SGR1 to balance chlorophyll catabolism in chloroplasts with the dismantling and remobilizing of other cellular components in senescing leaf cells. |
AT4G11930 | hypothetical protein;(source:Araport11) |
AT4G11950 | transmembrane protein, putative (DUF1191);(source:Araport11) |
AT4G11990 | TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of aurora kinase activity. |
AT4G12030 | Required for the biosynthesis of methionine-derived glucosinolates. Involved in the transport of 2-keto acids between chloroplasts and the cytosol. |
AT4G12040 | A20/AN1-like zinc finger family protein;(source:Araport11) |
AT4G12050 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
AT4G12065 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT4G12080 | AT-hook motif nuclear-localized protein 1;(source:Araport11) |
AT4G12090 | Cornichon family protein;(source:Araport11) |
AT4G12100 | Cullin family protein;(source:Araport11) |
AT4G12110 | Encodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha-methyl oxidase. Works together with SMO1-2 to maintain correct sterol composition and balance auxin and cytokinin activities during embryogenesis. |
AT4G12115 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
AT4G12120 | member of KEULE Gene Family |
AT4G12160 | pseudogene of Ribosomal protein S4;(source:Araport11) |
AT4G12180 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.2e-28 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G12200 | transposable_element_gene;(source:Araport11);similar to polyprotein [Oryza sativa] (GB:BAB03249.1);(source:TAIR10) |
AT4G12220 | hypothetical protein;(source:Araport11) |
AT4G12270 | Copper amine oxidase family protein;(source:Araport11) |
AT4G12320 | member of CYP706A |
AT4G12334 | Cytochrome P450 superfamily protein;(source:Araport11) |
AT4G12350 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
AT4G12370 | F-box/kelch-repeat protein;(source:Araport11) |
AT4G12420 | Encodes a protein of unknown function involved in directed root tip growth. It is a member of 19-member gene family and is distantly related structurally to the multiple-copper oxidases ascorbate oxidase and laccase, though it lacks the copper-binding domains. The protein is glycosylated and GPI-anchored. It is localized to the plasma membrane and the cell wall. The gene is expressed most strongly in expanding tissues. |
AT4G12423 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.8e-26 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT4G12430 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT4G12440 | adenine phosphoribosyl transferase 4;(source:Araport11) |
AT4G12450 | zinc finger (C2H2 type) family protein;(source:Araport11) |
AT4G12460 | OSBP(oxysterol binding protein)-related protein 2B;(source:Araport11) |
AT4G12470 | Encodes AZI1 (AZELAIC ACID INDUCED 1). Involved in the priming of salicylic acid induction and systemic immunity triggered by pathogen or azelaic acid. Targeting if AZI1 to chloroplasts is increased during SAR induction and that localization requires the PRR domain.It is involved in the uptake and movement of the azelaic acid signal. AZI1 uses a previously undescribed variant of the signal anchor proteins mechanism to target plastids. AZI1 uses a bipartite N-terminal signature: a non-cleavable TMD that anchors the protein to membranes, followed by a proline rich region with features that are shared with bona fide chloroplastic transit peptides. flg22 MAMP treatment strongly induces AZI1/EARLI1 protein levels and increases their relative enrichment in the plastid fraction. |
AT4G12520 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT4G12570 | Knock-out mutants showed accelerated senescence of leaves. The mRNA is cell-to-cell mobile. |
AT4G12617 | B3 domain protein;(source:Araport11) |
AT4G12670 | Homeodomain-like superfamily protein;(source:Araport11) |
AT4G12690 | DUF868 family protein (DUF868);(source:Araport11) |
AT4G12730 | AF333971 Arabidopsis thaliana fasciclin-like arabinogalactan-protein 2 (Fla2) mRNA, complete cds. Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
AT4G12731 | hypothetical protein;(source:Araport11) |
AT4G12735 | Encodes a peroxisomal protein. |
AT4G12740 | HhH-GPD base excision DNA repair family protein;(source:Araport11) |
AT4G12760 | RPA-interacting protein A;(source:Araport11) |
AT4G12790 | GPN GTPase involved in selective nuclear import of RNA polymerase II. |
AT4G12810 | KIB1 contains an F-box domain at the N-terminal region and three kelch repeats at the C-terminal region. It is expressed ubiquitously and accumulates in the nucleolus and to a lesser extent in the cytoplasm. |
AT4G12825 | Encodes a Protease inhibitor/seed storage/LTP family protein |
AT4G12870 | Gamma interferon responsive lysosomal thiol (GILT) reductase family protein;(source:Araport11) |
AT4G12910 | serine carboxypeptidase-like 20;(source:Araport11) |
AT4G12980 | Activated by OXS2 under the treatment of salt. |
AT4G12990 | transmembrane protein;(source:Araport11) |
AT4G13050 | Acyl-ACP thioesterase;(source:Araport11) |
AT4G13100 | RING/U-box superfamily protein;(source:Araport11) |
AT4G13120 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.6e-50 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G13180 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G13195 | Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini. The C-terminal 12 amino acid sequence of CLE44 is identical to that of a dodeca peptide (TDIF, tracheary element differentiation inhibitory factor) isolated from Arabidopsis and functions as a suppressor of plant stem cell differentiation. TDIF sequence is also identical to the C-terminal 12 amino acids of CLE41 (At3g24770). The protein is expressed in the vascular system and is involved in axillary bud formation. |
AT4G13200 | Plastoglobular protein which is involved in chloroplast function and thylakoid formation. |
AT4G13215 | pseudogene of transmembrane kinase-like 1;(source:Araport11) |
AT4G13230 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
AT4G13240 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT4G13250 | Encodes a chlorophyll b reductase involved in the degradation of chlorophyll b and LHCII (light harvesting complex II). |
AT4G13260 | Encodes YUC2. Catalyzes conversion of IPA (indole-3-pyruvic acid) to IAA (indole-3-acetic acid) in auxin biosynthesis pathway. |
AT4G13262 | pseudogene of Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein;(source:Araport11) |
AT4G13265 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
AT4G13310 | putative cytochrome P450 |
AT4G13345 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
AT4G13420 | Encodes a protein of the KUP/HAK/KT potassium channel class that is upregulated in the roots by K levels. |
AT4G13440 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT4G13455 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-12 P-value blast match to GB:AAC24836 pol polyprotein (Ty1_Copia-element) (Candida albicans);(source:TAIR10) |
AT4G13480 | Member of the R2R3 factor gene family. |
AT4G13490 | RING/U-box superfamily protein;(source:Araport11) |
AT4G13493 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UAAGAUCCGGACUACAACAAAG |
AT4G13494 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGAGAGCAACAAGACAUAAU |
AT4G13505 | Natural antisense transcript overlaps with AT4G13510;(source:Araport11) |
AT4G13510 | Encodes a plasma membrane localized ammonium transporter. Contains a cytosolic trans-activation domain essential for ammonium uptake. The mRNA is cell-to-cell mobile. |
AT4G13540 | ADR is a peroxisome localized, myristoylated protein. It is expressed in flowers and plays a role in suppressing ROS accumulation in anthers. Overexpression results in reduced ROS, lower levels of NST1 and NST2 and, consequently alterations in lignification of the anther endothecium resulting in male sterility. |
AT4G13572 | hypothetical protein;(source:Araport11) |
AT4G13590 | Chloroplast manganese transporter required for chloroplast manganese homeostasis and photosynthetic function. |
AT4G13600 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT4G13615 | Uncharacterized protein family SERF;(source:Araport11) |
AT4G13620 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. The mRNA is cell-to-cell mobile. |
AT4G13670 | plastid transcriptionally active 5;(source:Araport11) |
AT4G13680 | hypothetical protein (DUF295);(source:Araport11) |
AT4G13710 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT4G13750 | Encodes NO VEIN (NOV), a plant-specific nuclear factor required for leaf vascular development, cellular patterning and stem cell maintenance in the root meristem, as well as for cotyledon outgrowth and separation. nov mutations affect many aspects of auxin-dependent development without directly affecting auxin perception. |
AT4G13770 | Encodes a cytochrome p450 enzyme that catalyzes the initial conversion of aldoximes to thiohydroximates in the synthesis of glucosinolates not derived from tryptophan. Also has a role in auxin homeostasis. |
AT4G13790 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G13810 | receptor like protein 47;(source:Araport11) |
AT4G13820 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT4G13830 | DnaJ-like protein (J20); nuclear gene |
AT4G13840 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT4G13860 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G13870 | Encodes a protein with homology to the exonuclease domain of hWRN-p of human protein Werner Syndrome Exonuclease (WEX). Forms a complex with the heterodimeric factor Ku. The interaction with KU stimulates WEX exonuclease activity. |
AT4G13880 | receptor like protein 48;(source:Araport11) |
AT4G13890 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT4G13930 | Encodes a serine hydroxymethyltransferase maximally expressed in root |
AT4G13940 | Encodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing. The mRNA is cell-to-cell mobile. |
AT4G13965 | F-box/FBD/LRR protein;(source:Araport11) |
AT4G13980 | member of Heat Stress Transcription Factor (Hsf) family |
AT4G14010 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT4G14060 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT4G14080 | Involved in the formation of the pollen wall. DYT1 and bHLH089 specifically recognize the TCATGTGC box to activate expression. |
AT4G14090 | The At4g14090 encodes a anthocyanidin 5-O-glucosyltransferase specifically glucosylating the 5-position of the flavonoid A-ring. |
AT4G14100 | transferases, transferring glycosyl groups;(source:Araport11) |
AT4G14110 | Represses photomorphogenesis and induces skotomorphogenesis in the dark. A component of the COP9 signalosome complex. |
AT4G14147 | actin-related protein 2/3 complex 34kDa subunit family / arp2/3 complex 34kDa subunit family |
AT4G14149 | Pseudogene of AT2G24480; zinc finger (C3HC4-type RING finger) family protein |
AT4G14150 | Microtubule motor kinesin PAKRP1/Kinesin-12A. Together with PAKRP1L/Kinesin-12B, serve as linkers of the plus ends of antiparallel microtubules in the phragmoplast. |
AT4G14190 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G14200 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G14220 | encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. RHF1a can interact with the cell cycle inhibitor ICK4/KRP6 in vitro. It apppears to target ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF1a is expressed in the carpels throughout floral development. It is expressed in various tissues of the anthers during the early stages of anther development but not in stage 12 flowers and beyond. The mRNA is cell-to-cell mobile. |
AT4G14225 | A20/AN1-like zinc finger family protein;(source:Araport11) |
AT4G14226 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G14230 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
AT4G14240 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
AT4G14250 | This locus is annotated as a protein-coding gene in TAIR10. Based on communication with Jean-Luc GALLOIS (April 2013), this gene is split into two UBX domain-containing pseudogenes: one retains the original name: AT4G14250 (Chr4:8213237..8211984), one given a new locus identifier AT4G14245 (Chr4:8210231..8208985). Note that the Map Detail Image on the locus detial page and in GBrowse will not be updated until after the next genome release. |
AT4G14280 | ARM repeat superfamily protein;(source:Araport11) |
AT4G14301 | transmembrane protein;(source:Araport11) |
AT4G14310 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G14365 | hypothetical protein;(source:Araport11) |
AT4G14368 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT4G14370 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT4G14380 | cotton fiber protein;(source:Araport11) |
AT4G14390 | Ankyrin repeat family protein;(source:Araport11) |
AT4G14420 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
AT4G14455 | Encodes a Bet1/Sft1-like SNARE protein, which can only partially suppresses the temperature-sensitive growth defect in sft1-1 yeast cells; however, it cannot support the deletion of the yeast BET1 gene (bet1Δ). In yeast, Bet1p is the v-SNARE (soluble N-ethylmaleimide-sensitive factor adaptor protein receptor, V-type) involved in trafficking between the ER and Golgi. |
AT4G14460 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.2e-253 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT4G14480 | Encodes a putative Ser/Thr protein kinase, BLUS1 (BLUE LIGHT SIGNALING1). BLUS1 functions as a phototropin substrate and primary regulator of stomatal control to enhance photosynthetic CO2 assimilation under natural light conditions. |
AT4G14500 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT4G14550 | IAA14 is a member of the Aux/IAA protein family. Involved in lateral root development. Gain of function mutation decreases auxin-inducible gene expression. Protein is localized to the nucleus. Expressed in stele and root tip epidermis. Functions as a negative regulator of ARF7/19. |
AT4G14560 | auxin (indole-3-acetic acid) induced gene (IAA1) encoding a short-lived nuclear-localized transcriptional regulator protein. The mRNA is cell-to-cell mobile. |
AT4G14580 | CBL-interacting protein kinase |
AT4G14610 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT4G14630 | germin-like protein with N-terminal signal sequence that may target it to the vacuole, plasma membrane and/or outside the cell. The mRNA is cell-to-cell mobile. |
AT4G14650 | hypothetical protein;(source:Araport11) |
AT4G14670 | This locus was originally annotated as encoding ClpB2 (also referred to as Hsp92.7), which belongs to the Casein lytic proteinase/heat shock protein 100 (Clp/Hsp100) family. However, according to Lee et al. (2007, Plant Journal, 49:115-127), there is no evidence for expression of an appropriate-sized mRNA from this locus. Re-annotation of the genome indicates that this locus potentially encodes a 68.8-kDa protein, containing only the N-terminal two thirds of the originally predicted open reading frame. This locus contains a 626-bp deletion in WS ecotype compared with the Col ecotype, which eliminates residues 1-86 of the predicted protein. |
AT4G14720 | PPD2 (and its paralog, PPD1) encode plant-specific putative DNA-binding proteins. Deletion of the PPD locus increases leaf lamina size and results in dome-shaped rather than flat leaves. Siliques are also altered in shape because of extra lamina growth. |
AT4G14723 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
AT4G14730 | Stress induced membrane protein. Mutants show enhanced cell death under stress. |
AT4G14740 | FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
AT4G14746 | neurogenic locus notch-like protein;(source:Araport11) |
AT4G14750 | Member of IQ67 (CaM binding) domain containing family. |
AT4G14760 | kinase interacting (KIP1-like) family protein;(source:Araport11) |
AT4G14770 | Regulates fate transition and cell Divisions in the stomatal lineage. |
AT4G14780 | Protein kinase superfamily protein;(source:Araport11) |
AT4G14785 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT4G14790 | encodes a nuclear-encoded DExH box RNA helicase, which is localized to mitochondria and whose in vitro ATPase activity is stimulated with mitochondrial RNA. |
AT4G14815 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT4G14830 | 17.6 kDa class II heat shock protein;(source:Araport11) |
AT4G14870 | Encodes a component of the thylakoid-localized Sec system involved in the translocation of cytoplasmic proteins into plastid. The mRNA is cell-to-cell mobile. |
AT4G14900 | FRIGIDA-like protein;(source:Araport11) |
AT4G14905 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT4G14940 | atao1 gene of Arabidopsis thaliana encodes an extracellular copper amine oxidase expressed during early stages of vascular tissue development. |
AT4G14970 | Encodes a protein that is required for meiotic homologous recombination and acts in parallel to both MUTS HOMOLOG 4 (AtMSH4), known for its role in promoting interfering cross-overs (COs) and MMS AND UV SENSITIVE 81 (AtMUS81), known for its role in the formation of non-interfering COs. |
AT4G15010 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT4G15040 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
AT4G15050 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT4G15060 | FBD, F-box/LRR protein;(source:Araport11) |
AT4G15093 | catalytic LigB subunit of aromatic ring-opening dioxygenase family;(source:Araport11) |
AT4G15100 | serine carboxypeptidase-like 30;(source:Araport11) |
AT4G15110 | member of CYP97B |
AT4G15120 | VQ motif-containing protein;(source:Araport11) |
AT4G15140 | hypothetical protein;(source:Araport11) |
AT4G15150 | glycine-rich protein;(source:Araport11) |
AT4G15200 | Actin nucleation factor that directs the formation of actin cables in pollen tubes. Involved in cytoplasmic streaming and polarized growth in pollen tubes. |
AT4G15210 | cytosolic beta-amylase expressed in rosette leaves and inducible by sugar. RAM1 mutants have reduced beta amylase in leaves and stems. |
AT4G15233 | ABC-2 and Plant PDR ABC-type transporter family protein;(source:Araport11) |
AT4G15248 | B-box type zinc finger family protein;(source:Araport11) |
AT4G15250 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
AT4G15260 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT4G15270 | glucosyltransferase-like protein;(source:Araport11) |
AT4G15280 | UDP-glucosyl transferase 71B5;(source:Araport11) |
AT4G15300 | cytochrome P450, family 702, subfamily A, polypeptide 2;(source:Araport11) |
AT4G15310 | a member of the cytochrome P450 gene family. molecular function unknown. |
AT4G15320 | encodes a gene similar to cellulose synthase |
AT4G15330 | cytochrome P450, family 705, subfamily A, polypeptide 1;(source:Araport11) |
AT4G15360 | member of CYP705A |
AT4G15380 | member of CYP705A |
AT4G15390 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT4G15417 | RNAse II-like 1;(source:Araport11) |
AT4G15430 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
AT4G15450 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
AT4G15490 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
AT4G15500 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
AT4G15530 | Encodes a dual-targeted protein believed to act as a pyruvate, orthophosphate dikinase. These enzymes are normally associated with C4 photosynthesis which does not occur in Arabidopsis. However, PPDK may play a role in remobilizing nitrogen during leaf senescence in Arabidopsis. The product of the long transcript (.1 gene model) was shown to be targeted to the chloroplast, whereas the shorter transcript (no targeting sequence) accumulates in the cytosol. The two proteins were also found to be expressed in slightly different tissues. |
AT4G15545 | NAI1 interacting protein, involved in ER body formation. |
AT4G15550 | UDP-glucose:indole-3-acetate beta-D-glucosyltransferase |
AT4G15570 | Similar to yeast Sen1 (splicing endonuclease 1)helicase protein. Involved in female gametophyte development. The mRNA is cell-to-cell mobile. |
AT4G15610 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT4G15630 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT4G15670 | Encodes a member of the CC-type glutaredoxin (ROXY) family. |
AT4G15740 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT4G15760 | Encodes a protein with similarity to monooxygenases that are known to degrade salicylic acid (SA). |
AT4G15780 | member of VAMP72 Gene Family |
AT4G15802 | Encodes a protein with similarity to heat shock factor binding proteins. Involved in negative regulation of heat shock response. Becomes nuclear localized upon heat treatment. |
AT4G15820 | ABC subfamily C protein;(source:Araport11) |
AT4G15850 | plant DEAD box-like RNA helicase. |
AT4G15860 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-43 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
AT4G15920 | Encodes a vacuolar fructose transporter expressed in parenchyma and xylem that controls leaf fructose content. When its expression is reduced, fructose accumulates in leaves. |
AT4G15970 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
AT4G15975 | RING/U-box superfamily protein;(source:Araport11) |
AT4G16024 | hypothetical protein;(source:Araport11) |
AT4G16030 | Ribosomal protein L19e family protein;(source:Araport11) |
AT4G16045 | TRAF-like superfamily protein;(source:Araport11) |
AT4G16050 | Aminotransferase-like, plant mobile domain family protein;(source:Araport11) |
AT4G16095 | RNI-like superfamily protein;(source:Araport11) |
AT4G16110 | Encodes a pollen-specific transcription factor involved in the expression of nuclear genes for components of mitochondrial complex I in Arabidopsis. Acts in concert with other type-B ARRs in the cytokinin signaling pathway. AHK3 mediates cytokinin-induced phosphorylation of ARR2 on the Asp-80 residue. This phosphorylation plays a positive role of ARR2 in cytokinin-mediated control of leaf longevity. Also involved in cytokinin-dependent inhibition of hypocotyl elongation. |
AT4G16143 | Protein interacts with Agrobacterium proteins VirD2 and VirE2. Is not individually essential for Agrobacterium-mediated root transformation, but when overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
AT4G16144 | Encodes AMSH3, a deubiquitinating enzyme that hydrolyzes K48- and K63-linked ubiquitin chains in vitro. Required for intracellular trafficking and vacuole biogenesis. |
AT4G16146 | cAMP-regulated phosphoprotein 19-related protein;(source:Araport11) |
AT4G16150 | CATMA5 is a transcriptional activator. It acts in the cold response pathway, it can bind to and activate the expression of DREB1 genes. |
AT4G16155 | dihydrolipoamide dehydrogenase;(source:Araport11) |
AT4G16162 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT4G16165 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT4G16230 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT4G16310 | FAD-dependent lysine-specific histone demethylase involved in the control of flowering time. |
AT4G16330 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT4G16340 | Encodes SPIKE1 (SPK1), the lone DOCK family guanine nucleotide exchange factor (GEF) in Arabidopsis. SPK1 is a peripheral membrane protein that accumulates at, and promotes the formation of, a specialized domain of the endoplasmic reticulum (ER) termed the ER exit site (ERES). SPK1 promotes polarized growth and cell-cell adhesion in the leaf epidermis. Mutant has seedling lethal; cotyledon, leaf-shape, trichome defects. |
AT4G16370 | Encodes a phloem-specific iron transporter that is essential for systemic iron signaling and redistribution of iron and cadmium. It loads iron into the phloem, facilitates iron recirculation from the xylem to the phloem, and regulates both shoot-to-root iron signaling and iron redistribution from mature to developing tissues. |
AT4G16380 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT4G16390 | Encodes a pentatricopeptide repeat protein, SVR7 (SUPPRESSOR OF VARIEGATION7), required for FtsH-mediated chloroplast biogenesis. It is involved in accumulation and translation of chloroplast ATP synthase subunits. |
AT4G16410 | transmembrane protein;(source:Araport11) |
AT4G16447 | hypothetical protein;(source:Araport11) |
AT4G16490 | ARM repeat superfamily protein;(source:Araport11) |
AT4G16500 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT4G16515 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
AT4G16540 | Heat shock protein HSP20/alpha crystallin family;(source:Araport11) |
AT4G16563 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G16600 | Nucleotide-diphospho-sugar transferases superfamily protein;(source:Araport11) |
AT4G16610 | C2H2-like zinc finger protein;(source:Araport11) |
AT4G16620 | nodulin MtN21-like transporter family protein |
AT4G16640 | Matrix metalloprotease. |
AT4G16720 | Ribosomal protein L23/L15e family protein;(source:Araport11) |
AT4G16740 | Encodes an (E,E)-alpha-farnesene synthase in the Col ecotype of Arabidopsis. This enzyme can also catalyze the formation of (E)-beta-ocimene as well as trace amounts of myrcene and other related compounds in vitro. The cytosolic localization of the protein may make it favor (E,E)-alpha-farnesene biosynthesis because the precursor of this product, FPP, is primarily cytosolic. Transcript levels for this gene increase in response to treatment with the jasmonic acid mimic coronalon or in response to the insect Plutella xylostella. TPS03 transcripts can also be detected in flowers. A similar protein from the C24 ecotype with one amino acid change (S267F) has a different substrate specificity. |
AT4G16745 | Exostosin family protein;(source:Araport11) |
AT4G16748 | other_RNA;(source:Araport11) |
AT4G16760 | Encodes a medium to long-chain acyl-CoA oxidase. Catalyzes the first step of fatty acid beta-oxidation. Involved in jasmonate biosynthesis. Gene expression is induced by wounding, drought stress, abscisic acid, and jasmonate. |
AT4G16790 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT4G16830 | Encodes a perinuclear and cytoplasmically localized mRNA binding protein. AtRGGA is likely involved in stress responsivness. It is induced by salt and osmotic stress and loss of function mutations are more sensitive to stress. The mRNA is cell-to-cell mobile. |
AT4G16845 | The VERNALIZATION2 (VRN2) gene mediates vernalization and encodes a nuclear-localized zinc finger protein with similarity to Polycomb group (PcG) proteins of plants and animals. In wild-type Arabidopsis, vernalization results in the stable reduction of the levels of the floral repressor FLC. In vrn2 mutants, FLC expression is downregulated normally in response to vernalization, but instead of remaining low, FLC mRNA levels increase when plants are returned to normal temperatures. VRN2 maintains FLC repression after a cold treatment, serving as a mechanism for the cellular memory of vernalization. Required for complete repression of FLC. Required for the methylation of histone H3 |
AT4G16855 | hypothetical protein;(source:Araport11) |
AT4G16890 | Encodes a Toll Interleukin1 receptor-nucleotide binding-Leu- rich repeat-type resistance gene (TIR-NB-LRR-type) involved in the salicylic acid-dependent defense response pathway. Mutant plants constitutively express pathogenesis-related (PR) genes and are pathogen resistant. Resistance signaling in snc1 requires EDS1, MOS3 and PAD4. |
AT4G16920 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT4G16930 | Toll-Interleukin-Resistance (TIR) domain-containing protein;(source:Araport11) |
AT4G16935 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 3.3e-16 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G16970 | Protein kinase superfamily protein;(source:Araport11) |
AT4G16990 | disease resistance protein (TIR-NBS class);(source:Araport11) |
AT4G17000 | neurofilament heavy protein;(source:Araport11) |
AT4G17030 | Encodes EXLB1 (expansin-like B1), a member of the expansin family. |
AT4G17080 | Histone H3 K4-specific methyltransferase SET7/9 family protein;(source:Araport11) |
AT4G17150 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G17160 | RAB GTPase homolog B1A;(source:Araport11) |
AT4G17210 | weak chloroplast movement under blue light protein (DUF827);(source:Araport11) |
AT4G17220 | Encodes a microtubule associated protein (MAP70-5). Regulates secondary wall patterning in wood cells. Expressed in all tissues. |
AT4G17245 | RING/U-box superfamily protein;(source:Araport11) |
AT4G17260 | Lactate/malate dehydrogenase family protein;(source:Araport11) |
AT4G17330 | gene of unknown function expressed in seedlings, flower buds and stems |
AT4G17360 | encodes one of the two putative formyltetrahydrofolate deformylase. Located in the mitochondrion. Involved in photorespiratory tetrahydrofolate cycle. |
AT4G17410 | PQT3 is a nuclear localized E3 ligase involved in negative regulation of stress tolerance.PRMT4b is a substrate of PQT3. |
AT4G17420 | PAWH1 along with PAWH2 is part of endoplasmic reticulum ubiquitin ligase complex with Arabidopsis HRD1 via interaction with EBS7. As such it plays a role in promoting protein degradation via the ERAD pathway. |
AT4G17460 | Encodes a class II HD-ZIP protein that regulates meristematic activity in different tissues, and that it is necessary for the correct formation of the gynoecium. |
AT4G17470 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G17480 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G17483 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G17490 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-6). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. It is involved in the response to reactive oxygen species and light stress. Involved in regulating root architecture and the response to cold stress. |
AT4G17550 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). |
AT4G17580 | Bax inhibitor-1 family protein;(source:Araport11) |
AT4G17650 | Polyketide cyclase / dehydrase and lipid transport protein;(source:Araport11) |
AT4G17660 | Protein kinase superfamily protein;(source:Araport11) |
AT4G17670 | senescence-associated family protein (DUF581);(source:Araport11) |
AT4G17680 | Encodes an S-ribonuclease binding protein specifically involved in plant tolerance to NaHCO3. |
AT4G17700 | hypothetical protein;(source:Araport11) |
AT4G17710 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
AT4G17713 | Encodes a defensin-like (DEFL) family protein. |
AT4G17720 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G17730 | member of SYP2 Gene Family. Together with SYP23 interacts with Tobacco mosaic virus 126 kDa protein; required for normal local virus accumulation and spread. |
AT4G17780 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT4G17785 | Encodes a putative transcription factor (MYB39) involved in the regulation of suberin biosynthetic genes. |
AT4G17790 | SNARE associated Golgi protein family;(source:Araport11) |
AT4G17800 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
AT4G17810 | C2H2 domain regulatory protein. Functions downstream of GL2 during root hair development and regulates expression of targets RDH6, RSL2 and RSL4. |
AT4G17840 | CAAX protease self-immunity protein;(source:Araport11) |
AT4G17870 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
AT4G17890 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
AT4G17900 | PLATZ transcription factor family protein;(source:Araport11) |
AT4G17908 | pseudogene of ubiquitin-specific protease |
AT4G17990 | hypothetical protein;(source:Araport11) |
AT4G18010 | Encodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not appear to be active against phosphatidylinositol 4,5 bisphosphate. Overexpression of this gene renders plants insensitive to ABA in germination and growth assays. |
AT4G18040 | eIF4E protein. The cum1 mutation affects the local spreading of CMV within the inoculated leaf, delaying accumulation of cucumber mosaic virus coat protein. |
AT4G18050 | P-glycoprotein 9;(source:Araport11) |
AT4G18090 | hypothetical protein;(source:Araport11) |
AT4G18180 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT4G18190 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
AT4G18250 | receptor Serine/Threonine kinase-like protein;(source:Araport11) |
AT4G18255 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
AT4G18260 | Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11) |
AT4G18270 | Encodes protein similar to similar to bacterial translocase I (mra Y). Expressed during flower bud development. |
AT4G18330 | Translation elongation factor EF1A/initiation factor IF2gamma family protein;(source:Araport11) |
AT4G18335 | hypothetical protein;(source:Araport11) |
AT4G18340 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT4G18350 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
AT4G18380 | F-box family protein;(source:Araport11) |
AT4G18395 | hypothetical protein;(source:Araport11) |
AT4G18422 | transmembrane protein;(source:Araport11) |
AT4G18425 | transmembrane protein, putative (DUF679);(source:Araport11) |
AT4G18450 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
AT4G18480 | Encodes the CHLI subunit of magnesium chelatase which is required for chlorophyll biosynthesis. All four cysteine residues of the protein form two disulfide bonds (Cys102-Cys193 and Cys354-Cys396) under oxidized conditions but are fully reduced by reduction. It was suggested that the redox state of CHLI is regulated in vivo by the change of the redox environment in the chloroplasts probably via the Trx system. |
AT4G18540 | transmembrane protein;(source:Araport11) |
AT4G18550 | DSEL is cytosolic acylhydrolase that shows prefential lipase activity against the sn-1 position of several classes of lipids, including 1,3-diacylglycerols and 1-monoacylglycerols. Overexpression of DSEL leads to increased peroxisome and oil body levels in cotyledons and reduced beta-oxidation activity in seedlings. |
AT4G18580 | hypothetical protein;(source:Araport11) |
AT4G18600 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
AT4G18630 | hypothetical protein (DUF688);(source:Araport11) |
AT4G18640 | Required for root hair elongation during tip growth. The mRNA is cell-to-cell mobile. |
AT4G18650 | A maternally expressed imprinted gene in the endosperm. It's expression is positively regulated by ROS1. |
AT4G18660 | delay of germination protein;(source:Araport11) |
AT4G18700 | Encodes CBL-interacting protein kinase 12 (CIPK12). |
AT4G18740 | Rho termination factor;(source:Araport11) |
AT4G18770 | MYB98 is a member of the R2R3-MYB gene family, the members of which likely encode transcription factors. Within an ovule, MYB98 is expressed exclusively in the synergid cells, and mutations in this gene affect the female gametophyte specifically. myb98 female gametophytes are affected in two unique features of the synergid cell, pollen tube guidance and the filiform apparatus, but are otherwise normal. This suggests that MYB98 controls the development of specific features within the synergid cell during female gametophyte development. MYB98 also is expressed in trichomes and endosperm. Homozygous myb98 mutants exhibit no sporophytic defects, including trichome and endosperm defects. |
AT4G18780 | Encodes a member of the cellulose synthase family involved in secondary cell wall biosynthesis. Mutants have abnormal xylem formation, reduced cellulose content, and enhanced drought and osmotic stress tolerance. Mediates resistance towards bacterial pathogens via ABA. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling. |
AT4G18810 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G18823 | Encodes a defensin-like (DEFL) family protein. |
AT4G18870 | E2F/DP family winged-helix DNA-binding domain-containing protein;(source:Araport11) |
AT4G18890 | BES1/BZR1 homolog 3;(source:Araport11) |
AT4G18905 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G18910 | Encodes an aquaporin homolog. Functions in arsenite transport and tolerance.When expressed in yeast cells can conduct hydrogen peroxide into those cells. |
AT4G18950 | BHP1 is a Raf-like protein kinase involved in mediating blue light dependent stomatal opening. |
AT4G18975 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G18980 | Encodes a nuclear-targeted protein AtS40-3 that modulates senescence associated gene expression. |
AT4G19000 | The C-terminal portion of this protein has homology to the C-termini of the IWS1 (Interacts With Spt6) proteins found in yeast and humans. |
AT4G19006 | Proteasome component (PCI) domain protein;(source:Araport11) |
AT4G19030 | an aquaporin whose expression level is reduced by ABA, NaCl, dark, and desiccation. is expressed at relatively low levels under normal conditions. Also functions in arsenite transport and tolerance. |
AT4G19038 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G19045 | Member of a conserved family of proteins. Functions redundantly with MOB1A to regulate cell proliferation and JA metabolism. |
AT4G19050 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
AT4G19110 | Protein kinase superfamily protein;(source:Araport11) |
AT4G19120 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G19130 | Replication factor-A protein 1-like protein;(source:Araport11) |
AT4G19150 | Ankyrin repeat family protein;(source:Araport11) |
AT4G19160 | transglutaminase family protein;(source:Araport11) |
AT4G19170 | Encodes a chloroplast-targeted member of a family of enzymes similar to nine-cis-epoxycarotenoid dioxygenase that acts as a major regulator of carotenoid degradation during dark-induced leaf senescence.. The mRNA is cell-to-cell mobile. |
AT4G19190 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
AT4G19210 | member of RLI subfamily The mRNA is cell-to-cell mobile. |
AT4G19220 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G19230 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. CYP707A1 appears to play an important role in determining the ABA levels in dry seeds. Gene involved in postgermination growth. Overexpression of CYP707A1 leads to a decrease in ABA levels and a reduction in after-ripening period to break dormancy. |
AT4G19360 | SCD6 protein-like protein;(source:Araport11) |
AT4G19370 | chitin synthase, putative (DUF1218);(source:Araport11) |
AT4G19395 | Encodes a microRNA that targets AGO1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCGCUUGGUGCAGGUCGGGAA. MIR168a is highly expressed and predominantly produces a 21-nt miR168 species. By contrast, MIR168b is expressed at low levels and produces an equal amount of 21- and 22-nt miR168 species. Only the 21-nt miR168 is preferentially stabilized by AGO1, and consequently, the accumulation of the 22-nt but not the 21-nt miR168 is reduced when DCL1 activity is impaired. mir168a mutants with strongly reduced levels of 21-nt miR168 are viable but exhibit developmental defects, particularly during environmentally challenging conditions. |
AT4G19410 | Pectinacetylesterase family protein;(source:Araport11) |
AT4G19420 | Pectinacetylesterase family protein;(source:Araport11) |
AT4G19430 | hypothetical protein;(source:Araport11) |
AT4G19450 | Major facilitator superfamily protein;(source:Araport11) |
AT4G19460 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT4G19510 | Disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
AT4G19520 | disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT4G19570 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT4G19580 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT4G19600 | Encodes a cyclin T partner CYCT1;4. Plays important roles in infection with Cauliflower mosaic virus (CaMV). The mRNA is cell-to-cell mobile. |
AT4G19610 | nucleotide/nucleic acid binding protein;(source:Araport11) |
AT4G19633 | pseudogene of heat shock factor related protein |
AT4G19670 | RING/U-box superfamily protein;(source:Araport11) |
AT4G19700 | Encodes BOI (Botrytis Susceptible 1 Interactor). Has E3 ubiquitin ligase activity. Interacts with and ubiquitinates BOS1 (Botrytis Susceptible 1). It prevents caspase activation and attenuates cell death. |
AT4G19720 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
AT4G19730 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT4G19740 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT4G19770 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
AT4G19810 | ChiC encodes a Class V chitinase that is a part of glycoside hydrolase family 18 based on CAZy groupings. It appears to primarily act as an exochitinase in vitro where it predominantly cleaves a chitobiose (GlcNAc)2 residue from the non-reducing end of a chitin oligosaccharide. However, it shows some minor endochitinase activity in vitro, as well. A putative 24 amino-acid signal peptide may direct this protein to the secretory system and it has been detected in cell wall apoplastic fluid. RT-PCR experiments demonstrate that ChiC transcript levels are increased in response to abscisisc acid, jasmonic acid, and NaCl stress. Microarray results also suggest that transcript levels rise in response to osmotic stress, two fungal pathogens, a bacterial pathogen, and the elicitor flagellin. The mRNA is cell-to-cell mobile. |
AT4G19820 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
AT4G19840 | encodes a phloem lectin, similar to phloem lectin in cucumber and celery. Gene is expressed in the phloem, predominantly in the companion cells. The mRNA is cell-to-cell mobile. |
AT4G19850 | encodes a protein similar to phloem protein 2 in cucumber. a member of a large gene family. |
AT4G19865 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT4G19910 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
AT4G19970 | nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
AT4G19980 | hypothetical protein;(source:Araport11) |
AT4G20000 | VQ motif-containing protein;(source:Araport11) |
AT4G20030 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G20040 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT4G20050 | Encodes a polygalacturonase that plays a direct role in degrading the pollen mother cell wall during microspore development. |
AT4G20080 | Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein;(source:Araport11) |
AT4G20095 | hypothetical protein (DUF626);(source:Araport11) |
AT4G20100 | PQ-loop repeat family protein / transmembrane family protein;(source:Araport11) |
AT4G20110 | VACUOLAR SORTING RECEPTOR 7;(source:Araport11) |
AT4G20140 | Encodes GASSHO1 (GSO1), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO1 and a homolog GSO2 (At5g44700) are required for the formation of a normal epidermal surface during embryogenesis. Necessary for localizing CASPARIAN STRIP DOMAIN PROTEINS (CASPs) - major players of endodermal differentiation - into an uninterrupted, ring-like domain. |
AT4G20160 | golgin family A protein;(source:Araport11) |
AT4G20170 | glycosyltransferase family protein (DUF23);(source:Araport11) |
AT4G20190 | hypothetical protein;(source:Araport11) |
AT4G20200 | Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
AT4G20210 | Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
AT4G20250 | hypothetical protein;(source:Araport11) |
AT4G20270 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. The mRNA is cell-to-cell mobile. |
AT4G20280 | Encodes TAF11, a putative TBP-associated factor (TBP: TATA binding protein). |
AT4G20290 | transmembrane protein;(source:Araport11) |
AT4G20310 | Encodes a Golgi-localized protease that can cleave the transcription factors bZIP17 and bZIP28 that are translocated from the ER through the Golgi so that the transcription factors can be released to translocate into the nucleus. |
AT4G20325 | ribonuclease H2 subunit B;(source:Araport11) |
AT4G20360 | Nuclear transcribed, plastid localized EF-Tu translation elongation factor. Referred to as AtRabE1b in DOI:10.1104/pp.013052. However, wider community usage and more publications assign the symbol RabE1b to At5g59840. |
AT4G20410 | Encodes a member of the gamma-soluble NSF attachment protein (gSNAP) gene family. |
AT4G20420 | Tapetum specific protein TAP35/TAP44;(source:Araport11) |
AT4G20450 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G20770 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G20780 | Calcium sensor involved in trichome branching. |
AT4G20800 | FAD-binding Berberine family protein;(source:Araport11) |
AT4G20820 | FAD-binding Berberine family protein;(source:Araport11) |
AT4G20850 | Tripeptidyl Peptidase II. Ser protease that assembles into a large oligomeric complex containing two proteins of 153 and 142 kD that are derived from a single TPP2 gene, with the smaller version missing part of the C-terminal end. Not essential, based on the lack of phenotype of a T-DNA disruption mutant. |
AT4G20860 | involved in the generation of H2O2 from reduced compounds |
AT4G20940 | Encodes a plasma-membrane localized LRR receptor-like protein involved in both ABA and H202 mediated signaling involved in stomatal movement. TAIR10 annotation for this gene has a low confidence score (2-star). See Comments field for structural annotation by the community. |
AT4G21090 | MITOCHONDRIAL FERREDOXIN 2;(source:Araport11) |
AT4G21130 | similar to man and yeast U3-55K genes, involved in processing of pre-ribosomal RNA. |
AT4G21200 | Encodes a protein with gibberellin 2-oxidase activity which acts specifically on C-20 gibberellins. |
AT4G21215 | transmembrane protein;(source:Araport11) |
AT4G21220 | Trimeric LpxA-like enzymes superfamily protein;(source:Araport11) |
AT4G21230 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G21240 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT4G21250 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
AT4G21260 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
AT4G21270 | Encodes a kinesin-like motor protein heavy chain. Loss of function mutations have reduced fertility and are defective in spindle formation in male meiosis. |
AT4G21330 | Encodes a bHLH transcription factor strongly expressed in the tapetum from late anther stage 5 to early stage 6, and at a lower level in meiocytes. dyt1 mutant exhibits abnormal anther morphology beginning at anther stage 4. DYT1 acts downstream of SPL/NZZ and EMS1/EXS , and regulates the expression of downstream genes like AMS, MS1 and other tapetum preferential genes for pollen development, primarily via TDF1. |
AT4G21350 | Encodes a U-box/ARM repeat protein required fore self-incompatibility. |
AT4G21362 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGAACAUGGUUUAUUAGGAA |
AT4G21366 | Protein kinase superfamily protein;(source:Araport11) |
AT4G21380 | encodes a putative receptor-like serine/threonine protein kinases that is similar to Brassica self-incompatibility (S) locus. Expressed in root. Shoot expression limited to limited to the root-hypocotyl transition zone and at the base of lateral roots as well as in axillary buds, and pedicels. |
AT4G21390 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT4G21420 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.9e-06 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
AT4G21430 | protein B160;(source:Araport11) |
AT4G21437 | unknown pseudogene |
AT4G21450 | PapD-like superfamily protein;(source:Araport11) |
AT4G21480 | Putative sugar transporter. Expressed in nematode-induced root syncytia. |
AT4G21490 | NAD(P)H dehydrogenase B3;(source:Araport11) |
AT4G21530 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G21534 | Diacylglycerol kinase family protein;(source:Araport11) |
AT4G21560 | vacuolar protein sorting-associated protein-like protein;(source:Araport11) |
AT4G21580 | oxidoreductase, zinc-binding dehydrogenase family protein;(source:Araport11) |
AT4G21600 | Encodes a protein with mismatch-specific endonuclease activity with a preference for T/G, A/G, and G/G of single base mismatches. It also has the ability to cleave indel types of mismatches (heteroduplexes with loops). |
AT4G21620 | glycine-rich protein;(source:Araport11) |
AT4G21630 | Subtilase family protein;(source:Araport11) |
AT4G21640 | Subtilase family protein;(source:Araport11) |
AT4G21650 | Subtilase family protein;(source:Araport11) |
AT4G21670 | encodes a a novel transcriptional repressor harboring two double-stranded RNA-binding domains and a region homologous to the catalytic domain of RNA polymerase II C-terminal domain phosphatases found in yeast and in animals that regulate gene transcription. Protein exhibits innate phosphatase activity in vitro. Mutants exhibit hyperresponsiveness to ABA, cold, and NaCl. |
AT4G21680 | Encodes a nitrate transporter (NRT1.8). Functions in nitrate removal from the xylem sap. Mediates cadmium tolerance. |
AT4G21690 | gibberellin 3-oxidase 3;(source:Araport11) |
AT4G21700 | DUF2921 family protein, putative (DUF2921);(source:Araport11) |
AT4G21705 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G21760 | beta-glucosidase 47;(source:Araport11) |
AT4G21830 | methionine sulfoxide reductase B7;(source:Araport11) |
AT4G21850 | methionine sulfoxide reductase B9;(source:Araport11) |
AT4G21890 | zinc finger MYND domain protein;(source:Araport11) |
AT4G21902 | hypothetical protein;(source:Araport11) |
AT4G21910 | MATE efflux family protein;(source:Araport11) |
AT4G21920 | hypothetical protein;(source:Araport11) |
AT4G21970 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT4G21980 | Encodes APG8, a component of autophagy conjugation pathway. Delivered to the lumens of vacuole under nitrogen-starvation condition. Highest expression in flowers. mRNA abundance increased during dark-induced carbon starvation. Predominantly cytoplasmic with or without N starvation. Upon concanamycin A the protein accumulates in the central vacuole as punctuate structures that resemble autophagic bodies. This localization is more abundant upon N starvation. The mRNA is cell-to-cell mobile. |
AT4G22010 | SKU5 similar 4;(source:Araport11) |
AT4G22030 | F-box protein with a domain protein;(source:Araport11) |
AT4G22050 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G22065 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-09 P-value blast match to GB:AAB51275 reverse transcriptase, gag, polyprotein (Ty1_Copia-element) (Volvox carteri f. nagariensis);(source:TAIR10) |
AT4G22066 | Pseudogene of AT5G66830; F-box family protein |
AT4G22080 | root hair specific 14;(source:Araport11) |
AT4G22090 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT4G22100 | beta glucosidase 2;(source:Araport11) |
AT4G22105 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT4G22120 | Calcium-permeable stretch activated cation channel. |
AT4G22140 | Encoding a chromatin remodeling factor that regulates flowering time. |
AT4G22150 | Arabidopsis thaliana CDC48-interacting UBX-domain protein (PUX3) |
AT4G22165 | F-box protein (DUF295);(source:Araport11) |
AT4G22185 | pseudogene of F-box protein (DUF295);(source:Araport11) |
AT4G22200 | Encodes AKT2, a photosynthate- and light-dependent inward rectifying potassium channel with unique gating properties that are regulated by phosphorylation. Expressed in guard cell protoplasts and in the phloem and xylem of aerial portions of the plant. The channel can coassemble with another K+ channel, KAT1, in vitro. In guard cells, AKT2/3 is responsible for the Ca2+ sensitivity of the K+ uptake channel. In the phloem, it regulates the sucrose/H+ symporters via the phloem potential. AKT2 belongs to the Shaker family K+ channels which include the following groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
AT4G22220 | Encodes a mitochondrial protein similar to E.coli IscU. In bacteria, IscU is a scaffold protein accepting sulfur and iron to build a transient Fe-S cluster,which is subsequently transferred to a target apoprotein. |
AT4G22240 | Involved in photoprotection of photosystem II. The RVSI and twin-positive motifs in the transit peptide are necessary for efficient leucoplast import of prFB. |
AT4G22250 | RING/U-box superfamily protein;(source:Araport11) |
AT4G22265 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT4G22305 | Encodes SOBER1, a carboxylesterase that inhibits AvrBsT-triggered phenotypes in Arabidopsis. SOBER1 was formerly linked to AT4G22300 but this locus was split in the TAIR10 annotation into AT4G22300 and AT4G22305. AT4G22300 is now known as TIPSY1 and AT4G22305 corresponds to SOBER1. |
AT4G22320 | golgin family A protein;(source:Araport11) |
AT4G22380 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
AT4G22400 | hypothetical protein;(source:Araport11) |
AT4G22485 | Encodes a Protease inhibitor/seed storage/LTP family protein |
AT4G22490 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT4G22530 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G22560 | sulfated surface-like glycoprotein;(source:Araport11) |
AT4G22580 | Exostosin family protein;(source:Araport11) |
AT4G22590 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT4G22600 | Encodes a protein involved in involved in the formation of the pollen surface apertures. It acts late in aperture formation by excluding specific membrane domains from exine deposition. |
AT4G22640 | LTPG protein |
AT4G22670 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The mRNA is cell-to-cell mobile. |
AT4G22680 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
AT4G22690 | member of CYP706A The mRNA is cell-to-cell mobile. |
AT4G22730 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G22745 | Protein containing methyl-CpG-binding domain. |
AT4G22754 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
AT4G22758 | PPR containing protein;(source:Araport11) |
AT4G22770 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT4G22790 | Encodes a plasma membrane localized MATE type transporter that is involved in CO2 signaling during stomatal aperture regulation. RHC1 regulates HT1 which phosphorylates OST1, a kinase that regulates the SLAC1 anion channel and thus stomatal closing. |
AT4G22820 | A member of the A20/AN1 zinc finger protein family involved in stress response.Expression is increased in response to water, salt , pathogen and other stressors.SAP9 can pull down both K48-linked and K63- linked tetraubiquitin chains and functions as a E3 ubiquitin ligase suggesting a role in proteasome-dependent protein degradation. |
AT4G22850 | SNARE associated Golgi protein family;(source:Araport11) |
AT4G22880 | encodes leucoanthocyanidin dioxygenase, which is involved in proanthocyanin biosynthesis. Mutant analysis suggests that this gene is also involved in vacuole formation. |
AT4G22900 | transmembrane protein, putative (DUF1191);(source:Araport11) |
AT4G22910 | FIZZY-related 2;(source:Araport11) |
AT4G22940 | Protein kinase superfamily protein;(source:Araport11) |
AT4G22960 | FAM63A-like protein (DUF544);(source:Araport11) |
AT4G22970 | Encodes a separase (ESP), homologous to human and mouse separase protein. Separase is a capase family protease required for the release of sister chromatid cohesion during meiosis and mitosis. Arabidopsis separase contains a predicted 2Fe2S-ferredoxin domain that is not present in the proteins of other organisms. Also contains a putative EF-hand calcium binding domain. Mutant seeds exhibited embryo arrest at the globular stage. The endosperm also exhibited a weak titan-like phenotype. Transgenic plants expressing AESP RNA interference (RNAi) from the meiosis-specific DMC1 promoter exhibited alterations in chromosome segregation during meiosis I and II that resulted in polyads containing from one to eight microspores. Plays an essential role in embryo development. Required for the removal of cohesin from meiotic chromosomes and establishment of meiotic nuclear domains. This gene was also identified through the rsw4 mutant. Lines carrying recessive, temperature-sensitive mutations exhibit reduced anisotropic growth at 30 degrees Celsius. Microtubules and cellulose microfibrils are not depleted or disoriented in the mutants at the restrictive temperature. |
AT4G22980 | molybdenum cofactor sulfurase-like protein;(source:Araport11) |
AT4G22990 | Encodes a member of the PHOSPHATE TRANSPORTER 5 family (PHT5;3). Overexpression of PHT5:3 leads to Pi sequestration into vacuoles and altered regulation of Pi starvation-responsive genes. |
AT4G23010 | UDP-galactose transporter 2;(source:Araport11) |
AT4G23030 | MATE efflux family protein;(source:Araport11) |
AT4G23130 | Encodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) |
AT4G23150 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23160 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23170 | Induced in response to Salicylic acid.Similar to receptor-like kinase 4 and 5. NPR1, a known positive regulator of the SA signaling pathway is responsible for the SA-dependent induction and constitutive repression of EP1 gene's basal expression. The mRNA is cell-to-cell mobile. |
AT4G23180 | Encodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) The mRNA is cell-to-cell mobile. |
AT4G23200 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23210 | Encodes a Cysteine-rich receptor-like kinase (CRK13). Overexpression of CRK13 leads to hypersensitive response cell death, and induces defense against pathogens by causing increased accumulation of salicylic acid. |
AT4G23220 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23240 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23250 | cysteine-rich receptor-like protein kinase 17;(source:Araport11) |
AT4G23260 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23310 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23320 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23340 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT4G23400 | Plasma membrane intrinsic protein, involved redundantly with PIP1;1/2/3/4 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
AT4G23410 | TET5 encodes a member of the TETRASPANIN gene family that is expressed in the embryo and vascular system and is involved in organ growth redundantly with TET6. |
AT4G23430 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G23440 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
AT4G23450 | AtAIRP1 gene encodes a C3H2C3-type RING E3 Ub ligase. It has been shown to be a positive regulator in the Arabidopsis ABA-dependent drought response. |
AT4G23470 | PLAC8 family protein;(source:Araport11) |
AT4G23493 | hypothetical protein;(source:Araport11) |
AT4G23500 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT4G23510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT4G23520 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT4G23530 | ROH1, putative (DUF793);(source:Araport11) |
AT4G23540 | ARM repeat superfamily protein;(source:Araport11) |
AT4G23550 | Encodes WRKY DNA-binding protein 29 (WRKY29). The mRNA is cell-to-cell mobile. |
AT4G23600 | Encodes cystine lyase which is expected to be involved in amino acid metabolism, providing the plant with cysteine and the generation of precursors of ethylene biosynthesis. mRNA levels are elevated in response to wounding. |
AT4G23690 | Encodes a homodimeric all-beta dirigent protein in the superfamily of calycins. Dirigent proteins impart stereoselectivity on the phenoxy radical coupling reaction yielding optically active lignans from two molecules of coniferyl alcohol. |
AT4G23700 | member of Putative Na+/H+ antiporter family |
AT4G23710 | vacuolar ATP synthase subunit G2;(source:Araport11) |
AT4G23713 | Encodes a microRNA that targets several TCP family members controlling leaf development. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGACUGAAGGGAGCUCCCU. The miR319a pri-mRNA also encodes a regulatory peptide miPEP319a (AT4G23712) that regulates accumulation of its own miRNA. |
AT4G23720 | transmembrane protein, putative (DUF1191);(source:Araport11) |
AT4G23730 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
AT4G23740 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G23760 | Cox19-like CHCH family protein;(source:Araport11) |
AT4G23790 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues.A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT4G23810 | member of WRKY Transcription Factor; Group III |
AT4G23870 | hypothetical protein;(source:Araport11) |
AT4G23880 | hypothetical protein;(source:Araport11) |
AT4G23900 | Nucleoside diphosphate kinase family protein;(source:Araport11) |
AT4G23960 | F-box family protein;(source:Araport11) |
AT4G23990 | encodes a protein similar to cellulose synthase |
AT4G24000 | encodes a protein similar to cellulose synthase |
AT4G24010 | encodes a protein similar to cellulose synthase |
AT4G24015 | RING/U-box superfamily protein;(source:Araport11) |
AT4G24020 | Encodes NIN Like Protein 7 (NLP7). Modulates nitrate sensing and metabolism. Mutants of NLP7 show features of nitrogen-starved plants and are tolerant to drought stress. Localized in the nucleus and functions as a putative transcription factor. The mRNA is cell-to-cell mobile. |
AT4G24040 | Encodes a trehalase, member of Glycoside Hydrolase Family 37. |
AT4G24050 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G24070 | carbon-carbon lyase;(source:Araport11) |
AT4G24110 | NADP-specific glutamate dehydrogenase;(source:Araport11) |
AT4G24120 | Member of a small family of oligopeptide transporters similar to the yellow stripe locus of maize (ZmYS1). |
AT4G24130 | ABA responsive SVB family gene. |
AT4G24140 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G24150 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in shoot and flower. |
AT4G24160 | Encodes a soluble lysophosphatidic acid acyltransferase with additional triacylglycerol lipase and phosphatidylcholine hydrolyzing enzymatic activities. Plays a pivotal role in maintaining the lipid homeostasis by regulating both phospholipid and neutral lipid levels. |
AT4G24170 | ATP binding microtubule motor family protein;(source:Araport11) |
AT4G24175 | kinesin-like protein;(source:Araport11) |
AT4G24220 | encodes a progesterone-5beta-reductase-like protein. It has enone reductase activity against a wide range of substrates, including 3-oxo-Δ-4,5-steroids in vitro. The in vivo substrates and product of this enzyme have not yet been elucidated but it is likely to participate in steroid metabolism. The protein contains a mammalian death domain involved in programmed cell death. The gene is expressed in the vascular system and mutants carrying a dominant mutation in the gene have defective vascular patterning. VEP1 gene expression is induced specifically by wounding. |
AT4G24230 | acyl-CoA-binding protein ACBP3. Localized extracellularly in transiently expressed tobacco BY-2 cells and onion epidermal cells. Binds arachidonyl-CoA with high affinity. Microarray data shows up-regulation of many biotic- and abiotic-stress-related genes in an ACBP3 OE-1 in comparison to wild type. |
AT4G24231 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G24250 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO13 belongs to the clade II, with ATMLO1 and ATMLO15. The gene is expressed during early seedling growth, in root and cotyledon vascular system, in pollen and also in placenta of developing siliques, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT4G24265 | homeobox protein;(source:Araport11) |
AT4G24290 | MAC/Perforin domain-containing protein;(source:Araport11) |
AT4G24320 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT4G24400 | Encodes a CBL (calcineurin B-like calcium sensor proteins) -interacting serine/threonine protein kinase. Regulates the low-affinity phase of the primary nitrate response. The mRNA is cell-to-cell mobile. |
AT4G24410 | hypothetical protein;(source:Araport11) |
AT4G24450 | phosphoglucan, water dikinase;(source:Araport11) |
AT4G24480 | Protein kinase superfamily protein;(source:Araport11) |
AT4G24490 | RAB geranylgeranyl transferase alpha subunit 1;(source:Araport11) |
AT4G24510 | Encodes a component of the fatty acid elongation machinery required for C28 to C30 fatty acid elongation. It does not require the acyltransferase catalytic site for biological function. |
AT4G24530 | O-fucosyltransferase family protein;(source:Araport11) |
AT4G24540 | Encodes a MADS-box protein involved in flowering. Regulates the expression of SOC1 and is also upregulated by SOC1. Binds with IMK3 kinase domain. Phosphorylated by IMK3; likely to be a target for IMK3 kinase domain. |
AT4G24690 | Encodes NBR1, a selective autophagy substrate. The mRNA is cell-to-cell mobile. |
AT4G24710 | Encodes an AAA+ ATPase that mediates meiotic chromosome remodeling and crossover maturation. |
AT4G24780 | Encodes a pectate lyase involved in response to nematodes. |
AT4G24790 | AAA-type ATPase family protein;(source:Araport11) |
AT4G24860 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G24880 | snurportin-1 protein;(source:Araport11) |
AT4G24910 | glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11) |
AT4G24960 | Homologous to a eukaryote specific ABA- and stress-inducible gene first isolated from barley. Groups in one subfamily with ATHVA22E. Along with other members of the ATHVA22 family, it may be involved in regulation of autophagy during development. The mRNA is cell-to-cell mobile. |
AT4G24972 | Encodes a novel small protein which is similar to proteins of unknown function from other plant species. TPD1 is involved in cell specification during anther and pollen development. Identified in a screen for male steriles. Mutants lack tapetal cells and have an increased number of microsporocytes. Expressed in flower buds, leaves and young seedlings. In anthers, TPD1 is expressed throughout pollen development in parietal cells and sporocytes. Physically interacts with the LRR kinase EMS1 and that interaction results in phosphorylation of TPD1. |
AT4G24977 | Pseudogene of AT4G24972; TPD1 (TAPETUM DETERMINANT 1) |
AT4G24980 | nodulin MtN21-like transporter family protein |
AT4G25000 | Predicted to be secreted protein based on signalP prediction. Involved in starch mobilization. Mutants are defective in alpha-amylase activity. (Note: AMY1 has been found in the literature to be referred to as AMY3, which is not to be confused with AMY3/At1g69830). |
AT4G25010 | Encodes a member of the SWEET sucrose efflux transporter family proteins. Together with SWEET13, it is likely involved in modulating the GA response and is required for proper development of anthers, seeds and seedlings. |
AT4G25050 | encodes an acyl carrier protein predominantly expressed in leaves. Gene expression is upregulated by light. |
AT4G25070 | caldesmon-like protein;(source:Araport11) |
AT4G25080 | Encodes a protein with methyltransferase activity responsible for the methylation of magnesium protoporphyrin IX. Mutants defective in this gene are affected in chlorophyll biosynthesis and show a reduction in the accumulation of a number of major thylakoid-associated proteins including components of PSI (LHCI), PSII (LHCII, D1, CP43) and the cytochrome b6f complex (Cytf). By contrast, no significant changes were detected for the proteins of the stroma and the chloroplast envelope. |
AT4G25090 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
AT4G25130 | Encodes a chloroplast-localized methionine sulfoxide reductase that is a member of the MSRA family. Involved in protection of chloroplasts from oxidative stress. |
AT4G25180 | RNA polymerase III RPC4;(source:Araport11) |
AT4G25220 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). |
AT4G25235 | Encodes a ECA1 gametogenesis related family protein [pseudogene] |
AT4G25260 | Pectin methylesterase inhibitor. Forms pH dependent complex with PME3. |
AT4G25310 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT4G25320 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT4G25340 | Encodes a member of the FKBP-type immunophilin family that functions as a histone chaparone. Binds to 18S rDNA and represses its expression. The N-terminal nucleoplasmin domain interacts with H2A/H2B and H3/H4 histone oligomers, individually, as well as simultaneously, suggesting two different binding sites for H2A/H2B and H3/H4. |
AT4G25350 | SHB1 encodes a nuclear and cytosolic protein that has motifs homologous with SYG1 protein family members. Acts in cryptochrome signaling. Overexpression of SHB1 enhanced the expression of PHYTOCHROME-INTERACTING FACTOR4 (PIF4) under red light and promoted proteasome-mediated degradation of phytochrome A and hypocotyl elongation under far-red light. A knockout allele suppressed LONG HYPOCOTYL IN FAR-RED LIGHT1 (HFR1) expression and showed several deetiolation phenotypes. Acts upstream of HFR1. Regulates seed development. |
AT4G25390 | Protein kinase superfamily protein;(source:Araport11) |
AT4G25430 | hypothetical protein;(source:Araport11) |
AT4G25433 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
AT4G25434 | nudix hydrolase homolog 10;(source:Araport11) |
AT4G25470 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature, abscisic acid, and circadian rhythm. Overexpressing this gene leads to increased freeze tolerance and induces the expression level of 85 cold-induced genes and reduces the expression level of 8 cold-repressed genes, which constitute the CBF2 regulon. Mutations in CBF2 increases the expression level of CBF1 and CBF3, suggesting that this gene may be involved in a negative regulatory or feedback circuit of the CBF pathway. |
AT4G25490 | Transcriptional activator that binds to the DRE/CRT regulatory element and induces COR (cold-regulated) gene expression increasing plant freezing tolerance. It encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. |
AT4G25500 | Encodes an arginine/serine-rich splicing factor. The transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. RS40 binds to HYL1 and co-localizes to the nuclear dicing body. Along with RS41, it appears to be involved in pri-miRNA processing and miRNA biogenesis (DOI:10.1093/nar/gkv751). |
AT4G25560 | LAF1 is a R2R3-MYB transcription factor and positive regulator of the phyA photoresponse. Interaction of LAF1 with HFR1 stabilize the proteins against ubiquitination by COP1(AT2G32950) and subsequent degrations. Mutants have an elongated hypocotyl specifically under far-red light but retain wild-type responses to other light wavelengths. |
AT4G25570 | Encodes cytochrome b561. |
AT4G25610 | C2H2-like zinc finger protein;(source:Araport11) |
AT4G25630 | encodes a fibrillarin, a key nucleolar protein in eukaryotes which associates with box C/D small nucleolar RNAs (snoRNAs) directing 2'-O-ribose methylation of the rRNA. This gene also encodes a novel box C/D snoRNA, U60.2f in its fifth intron that accumulates in seedlings and that their targeted residue on the 25 S rRNA is methylated. The mRNA is cell-to-cell mobile. |
AT4G25640 | Encodes a multidrug and toxin efflux family transporter. Involved in flavonoid metabolism, affecting Root growth, seed development and germination, and pollen development, release and viability. |
AT4G25670 | stress response NST1-like protein;(source:Araport11) |
AT4G25740 | RNA binding Plectin/S10 domain-containing protein;(source:Araport11) |
AT4G25750 | ABC-2 type transporter family protein;(source:Araport11) |
AT4G25760 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
AT4G25800 | Calmodulin-binding protein;(source:Araport11) |
AT4G25810 | xyloglucan endotransglycosylase-related protein (XTR6) |
AT4G25820 | Encodes a xyloglucan endotransglycosylase with a clear preference for non-fucosylated xyloglucan polymer. The mRNA is cell-to-cell mobile. |
AT4G25860 | OSBP(oxysterol binding protein)-related protein 4A;(source:Araport11) |
AT4G25870 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT4G25885 | Natural antisense transcript overlaps with AT4G25880;(source:Araport11) |
AT4G25900 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
AT4G25940 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
AT4G25950 | V-ATPase G-subunit like protein |
AT4G25960 | P-glycoprotein 2;(source:Araport11) |
AT4G25970 | Encodes the major form of the two non-mitochondrail phosphatidylserine decarboxylase. Located at the ER. The mRNA is cell-to-cell mobile. |
AT4G25990 | chloroplast import apparatus CIA2-like. CIA2 is a transcription factor which upregulates chloroplast translocon genes |
AT4G26055 | transmembrane protein;(source:Araport11) |
AT4G26060 | Ribosomal protein L18ae family;(source:Araport11) |
AT4G26130 | cotton fiber protein;(source:Araport11) |
AT4G26140 | putative beta-galactosidase |
AT4G26180 | Encodes a mitochondrial CoA transporter. |
AT4G26200 | Member of a family of proteins in Arabidopsis that encode 1-Amino-cyclopropane-1-carboxylate synthase, an enzyme involved in ethylene biosynthesis. Not expressed in response to IAA. |
AT4G26210 | Mitochondrial ATP synthase subunit G protein;(source:Araport11) |
AT4G26220 | Encodes a caffeoyl-coenzyme A O-methyltransferase (CCoAOMT)-like protein with a strong preference for methylating the para position of flavanones and dihydroflavonols, whereas flavones and flavonols are methylated in the meta-position. |
AT4G26260 | Encodes a myo-inositol oxygenase, which is the first enzyme in the inositol route to ascorbate (L‐ascorbic acid, AsA, vitamin C). Overexpression results in enhanced biomass and abiotic stress tolerance. |
AT4G26300 | Arginyl-tRNA synthetase, class Ic;(source:Araport11) |
AT4G26310 | elongation factor P (EF-P) family protein;(source:Araport11) |
AT4G26320 | arabinogalactan protein 13;(source:Araport11) |
AT4G26330 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
AT4G26340 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT4G26350 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT4G26375 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
AT4G26380 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G26385 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
AT4G26460 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G26466 | Encodes a membrane localized (putative GPI-anchored) protein involved in fertilization. Loss of function mutations display defects in fertilization-around 25% of embryo sacs abort. |
AT4G26470 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT4G26485 | methyltransferase small domain protein;(source:Araport11) |
AT4G26540 | Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11) |
AT4G26560 | Encodes calcineurin B-like protein 7 (CBL7).Interacts with and modulates the activity of the PM ATPase AHA2. |
AT4G26570 | member of AtCBLs (Calcineurin B-like Calcium Sensor Proteins) |
AT4G26580 | RING/U-box superfamily protein;(source:Araport11) |
AT4G26590 | oligopeptide transporter |
AT4G26600 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G26700 | Encodes a member of the fimbrin family. Different members of the fimbrin/plastin family have diverged biochemically during evolution to generate either tight actin bundles or loose networks with distinct biochemical and biophysical properties. FIM4 generates both actin bundles and branched actin filaments whereas FIM5 only generates actin bundles. |
AT4G26740 | Encodes caleosin, a 27-kDa protein found within seed lipid bodies. Gene is expressed preferentially in the embryo, has similarity to a rice ABA-responsive gene, EFA27. Catalyze hydroperoxide-dependent mono-oxygenation reactions. Require calcium for peroxygenase activity. Probably deeply buried in lipid droplets or microsomes. |
AT4G26770 | Phosphatidate cytidylyltransferase family protein;(source:Araport11) |
AT4G26780 | unknown function |
AT4G26890 | Member of MEKK subfamily. Involved in wound response signaling. Interacts with At5g40440, and activates At1g59580. |
AT4G26910 | Encodes the E2 subunit of the 2-oxoglutarate dehydrogenase. |
AT4G26930 | Encodes a putative transcription factor (MYB97). |
AT4G26950 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT4G26965 | NADH:ubiquinone oxidoreductase, 17.2kDa subunit;(source:Araport11) |
AT4G26970 | Encodes an aconitase that can catalyze the conversion of citrate to isocitrate through a cis-aconitate intermediate, indicating that it may participate in the TCA cycle and other primary metabolic pathways. The protein is believed to accumulate in the mitochondria and the cytosol. It affects CSD2 (At2g28190 - a superoxide dismutase) transcript levels and may play a role in the response to oxidative stress. One member of the family (ACO1 - At35830) was shown to specifically bind to the 5' UTR of CSD2 in vitro. The mRNA is cell-to-cell mobile. |
AT4G26980 | RNI-like superfamily protein;(source:Araport11) |
AT4G26990 | polyadenylate-binding protein interacting protein;(source:Araport11) |
AT4G27000 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G27050 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT4G27110 | COBRA-like protein 11 precursor;(source:Araport11) |
AT4G27190 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
AT4G27220 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
AT4G27230 | Encodes HTA2, a histone H2A protein. |
AT4G27250 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G27260 | encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. It is involved in camalexin biosynthesis via conjugating indole-3-carboxylic acid (ICA) and cysteine (Cys). The mRNA is cell-to-cell mobile. |
AT4G27270 | Quinone reductase family protein;(source:Araport11) |
AT4G27290 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT4G27300 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT4G27310 | Encodes an atypical B-box domain protein that negatively regulates photomorphogenic development by interfering with the binding of the transcription factor HY5 to target gene promoters. Degradation of BBX28 in darkness is dependent on COP1 and occurs via the 26S proteasome pathway. BBX28 acts as a key factor in the COP1-HY5 regulatory hub by maintaining proper HY5 activity to ensure normal photomorphogenic development in plants. Interacts with CO via B-box domain resulting in decreased FT expression and delayed flowering. |
AT4G27330 | Encodes a putative transcription factor that is required for the initiation of both micro- and megagametogenesis and is expressed in the sporogenous tissue of the anther and the ovule. SPL is a chalaza identity gene that share overlapping functions in establishing the prospective chalaza of the ovule. It also plays a central role in patterning both the proximal-distal and the adaxial-abaxial axes in the ovule and generally interacts with YABBY proteins in vitro. Mutant is defective in the differentiation of primary sporogenous cells into microsporocytes, and does not properly form the anther wall. Regulator of anther cell differenctiation. Interacts with TPL and TCP proteins. |
AT4G27340 | Met-10+ like family protein;(source:Araport11) |
AT4G27370 | member of Myosin-like proteins |
AT4G27390 | transmembrane protein;(source:Araport11) |
AT4G27410 | Encodes a NAC transcription factor induced in response to desiccation. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response. |
AT4G27420 | ABC-2 type transporter family protein;(source:Araport11) |
AT4G27430 | Positive regulator of light-regulated genes. Novel nuclear protein which requires light for its high level expression. The mRNA is cell-to-cell mobile. |
AT4G27435 | fiber (DUF1218);(source:Araport11) |
AT4G27440 | light-dependent NADPH:protochlorophyllide oxidoreductase B The mRNA is cell-to-cell mobile. |
AT4G27450 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
AT4G27550 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active but no trehalose phosphatase (TPP)-like domain. |
AT4G27570 | Encodes a UDP-glycosyltransferase that contributes to cold, salt and drought stress tolerance via modulating anthocyanin accumulation. |
AT4G27585 | Encodes a stomatin-like protein that is present in a mitochondrial membrane-bound 3 MDa protein complex and is involved in the assembly of mitochondrial respiratory supercomplexes. There is an observed increase in abundance of respiratory complex III2 in SLP1 single and double knockout mutants. The protein is not redundant with Arabidopsis SLP2 (At5g54100). |
AT4G27595 | Encodes a microtubule-associated protein. |
AT4G27610 | intracellular protein transporter;(source:Araport11) |
AT4G27640 | Nuclear import receptor for GRF-interacting factors (GIFs),roles in ovule development. |
AT4G27690 | vacuolar protein sorting 26B;(source:Araport11) |
AT4G27700 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
AT4G27710 | member of CYP709B The mRNA is cell-to-cell mobile. |
AT4G27720 | Major facilitator superfamily protein;(source:Araport11) |
AT4G27730 | oligopeptide transporter |
AT4G27800 | Choroplast protein phosphatase TAP38/PPH1 is required for efficient dephosphorylation of the LHCII anthena and state transition from state 2 to state 1. |
AT4G27820 | beta glucosidase 9;(source:Araport11) |
AT4G27830 | Encodes a beta-glucosidase that may be responsible for acyl-glucose-dependent anthocyanin glucosyltransferase activity in Arabidopsis. In vitro efforts to demonstrate AAGT activity for BGLU10 have been unsuccessful but experiments with mutants in this gene suggest at least an indirect involvement in anthocyanin formation. |
AT4G27860 | vacuolar iron transporter (VIT) family protein;(source:Araport11) |
AT4G27900 | CCT motif family protein;(source:Araport11) |
AT4G27940 | manganese tracking factor for mitochondrial SOD2;(source:Araport11) |
AT4G27950 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
AT4G27960 | ubiquitin conjugating enzyme |
AT4G27970 | Encodes a protein with ten predicted transmembrane helices. The SLAH2 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. But, it is not expressed in guard cells and cannot complement a slac1-2 mutant suggesting that it performs a different function. SLAH2:GFP localizes to the plasma membrane. |
AT4G28080 | Encodes REDUCED CHLOROPLAST COVERAGE 2 (REC2). Along with REC1 and REC3 it contributes to establishing the size of the chloroplast compartment. |
AT4G28090 | SKU5 similar 10;(source:Araport11) |
AT4G28110 | Member of the R2R3 factor gene family. Expression is induced in response to desiccation, ABA and salt treatment. Overexpression of Myb41 results in abnormal cuticle development and decreased cell expansion. |
AT4G28130 | diacylglycerol kinase 6;(source:Araport11) |
AT4G28140 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. Regulated by heat shock. |
AT4G28160 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT4G28162 | Natural antisense transcript overlaps with AT4G28160;(source:Araport11) |
AT4G28270 | Encodes a RING finger E3 ubiquitin ligase. Binds and ubiquitinates ABP1 in vivo and in vitro. |
AT4G28330 | pyrroline-5-carboxylate reductase;(source:Araport11) |
AT4G28370 | Encodes an E3 ubiquitin ligase that is involved in plant cell wall modification, seed mucilage extrusion, and controls the degree of pectin methylesterification in seed mucilage. fly1 mutant seeds release more compact mucilage capsules and detached outer tangential primary walls when hydrated in water. Fly1 is located in the endomembrane system, likely localized in late endosome/multivesicular bodies/prevacular compartment. It has been shown to ubiquitinate proteins in conjunction with UBA1 and UBC8. |
AT4G28395 | related to lipid transfer proteins |
AT4G28397 | non-specific lipid-transfer-like protein;(source:Araport11) |
AT4G28410 | Tyrosine transaminase family protein;(source:Araport11) |
AT4G28430 | Reticulon family protein;(source:Araport11) |
AT4G28460 | Activates immune responses through RECEPTOR-LIKE KINASE7 (RLK7). Induces stomatal closure is dependent on RLK7 and the transcription of genes involved in SA production and SA-dependent stomatal closure. SA promotes the flg22-induced expression of PIP1 preligand, prePIP1. |
AT4G28480 | DNAJ heat shock family protein;(source:Araport11) |
AT4G28485 | The structure of this gene is mis-annotated in TAIR10. Please refer to PMID:20712629 and the Comment field on the TAIR locus page for revised annotation. |
AT4G28500 | NAC domain containing protein 73;(source:Araport11) |
AT4G28530 | Member of NAC family of transcription factors. Along with NAC2, KIR1 positively regulates programmed cell death of stigmatic tissue. |
AT4G28540 | Member of CKL gene family (CKL-C group). |
AT4G28556 | Encodes RIC7, the downstream effector of active Rop2 GTPase. |
AT4G28560 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Most similar to RIC6 and RIC8 (subfamily group II). Gene is expressed in all tissues examined. |
AT4G28570 | Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11) |
AT4G28590 | Encodes a dual-targeted nuclear/plastidial phytochrome signaling component required for PEP assembly. It controls PhAPG expression primarily from the nucleus by interacting with phytochromes and promoting their localization to photobodies for the degradation of the transcriptional regulators PIF1 and PIF3. RCB-dependent PIF degradation in the nucleus signals the plastids for PEP assembly and PhAPG expression. |
AT4G28600 | encodes a calmodulin-binding protein that is expressed in pollen, suspension culture cells, flowers, and fruits. |
AT4G28650 | Encodes one of the two putative eLRR kinase closely related to PXY (At1g08590/PXL1 and At4g28650/PXL2). Insertion mutants in either pxl1 or pxl2 do not exhibit an obvious phenotype in the stem; double-mutant combinations of a Col allele, of pxy (pxy-3) with pxl1 and pxl2, generate a more severe vascular phenotype than pxy-3 alone, suggesting that these genes act synergistically with PXY in regulating vascular-tissue development in the stem. |
AT4G28660 | Similar to PsbW subunit of photosystem II. |
AT4G28670 | cysteine-rich RECEPTOR-like kinase, putative (DUF26);(source:Araport11) |
AT4G28690 | hypothetical protein;(source:Araport11) |
AT4G28700 | ammonium transporter 1;(source:Araport11) |
AT4G28703 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT4G28720 | Auxin biosynthetic gene regulated by RVE1. Overexpression leads to suppression of bri1 phenotype. |
AT4G28730 | Encodes a glutaredoxin GrxC5. GrxC5 exists as two forms when expressed in Escherichia coli. The monomeric apoprotein possesses deglutathionylation activity mediating the recycling of plastidial methionine sulfoxide reductase B1 and peroxiredoxin IIE, whereas the dimeric holoprotein incorporates a [2Fe-2S] cluster. |
AT4G28740 | LOW PSII ACCUMULATION-like protein;(source:Araport11) |
AT4G28750 | mutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Subunit E of Photosystem I |
AT4G28760 | methyl-coenzyme M reductase II subunit gamma, putative (DUF3741);(source:Araport11) |
AT4G28780 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT4G28790 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT4G28800 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT4G28811 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT4G28840 | Encodes TCP INTERACTOR-CONTAINING EAR MOTIF PROTEIN 1 (TIE1), an important repressor of CINCINNATA (CIN)-like TEOSINTE BRANCHED1/CYCLOIDEA/PCF (TCP) transcription factors, which are key for leaf development. |
AT4G28860 | Member of CKL gene family (CKL-A group) |
AT4G28890 | RING/U-box superfamily protein;(source:Araport11) |
AT4G29020 | glycine-rich protein;(source:Araport11) |
AT4G29030 | Putative membrane lipoprotein;(source:Araport11) |
AT4G29080 | phytochrome-associated protein 2 (PAP2) |
AT4G29103 | transmembrane protein;(source:Araport11) |
AT4G29120 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
AT4G29130 | Encodes a hexokinase (HXK1) in the plant glucose-signaling network. Functions as a glucose sensor to interrelate nutrient, light, and hormone signaling networks for controlling growth and development in response to the changing environment. |
AT4G29140 | Encodes Activated Disease Susceptibility 1 (ADS1), a putative MATE (multidrug and toxic compound extrusion) transport protein that negatively regulates plant disease resistance. |
AT4G29160 | SNF7 family protein;(source:Araport11) |
AT4G29190 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT4G29200 | Over-expressed by salt stress. |
AT4G29220 | phosphofructokinase 1;(source:Araport11) |
AT4G29230 | NAC domain protein involved in negative regulation of flowering. |
AT4G29273 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G29290 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G29300 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G29305 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G29430 | ribosomal protein S15A E;(source:Araport11) |
AT4G29440 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
AT4G29450 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G29460 | Encodes one of the four Arabidopsis phospholipase PLA2 parologs: AT2G06925 (PLA2-ALPHA), AT2G19690 (PLA2-BETA), AT4G29460 (PLA2-GAMMA) and AT4G29470 (PLA2-DELTA). Involved in pollen development and germination and tube growth. |
AT4G29570 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
AT4G29690 | Alkaline-phosphatase-like family protein;(source:Araport11) |
AT4G29700 | Alkaline-phosphatase-like family protein;(source:Araport11) |
AT4G29710 | Alkaline-phosphatase-like family protein;(source:Araport11) |
AT4G29720 | polyamine oxidase 5;(source:Araport11) |
AT4G29730 | cell cycle-related repressor genes encoding WD-repeat proteins. |
AT4G29780 | Expression of the gene is affected by multiple stresses. Knockout and overexpression lines show no obvious phenotypes. |
AT4G29900 | one of the type IIB calcium pump isoforms. encodes an autoinhibited Ca(2+)-ATPase that contains an N-terminal calmodulin binding autoinhibitory domain. |
AT4G29905 | hypothetical protein;(source:Araport11) |
AT4G29920 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. Loss of function mutants show increased sensitivity to salt stress and drought. |
AT4G29930 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT4G29950 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT4G29990 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
AT4G30010 | ATP-dependent RNA helicase;(source:Araport11) |
AT4G30020 | PA-domain containing subtilase family protein;(source:Araport11) |
AT4G30030 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G30040 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G30050 | transmembrane protein;(source:Araport11) |
AT4G30064 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G30074 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G30080 | Involved in root cap cell differentiation. Gene expression is regulated by mir160.Located in the nucleus. |
AT4G30110 | encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc |
AT4G30120 | encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc |
AT4G30170 | Peroxidase family protein;(source:Araport11) |
AT4G30180 | hypothetical protein;(source:Araport11) |
AT4G30190 | Belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal domain. Its plasma membrane localization is light-dependent. |
AT4G30200 | Encodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus. |
AT4G30220 | small nuclear ribonucleoprotein F;(source:Araport11) |
AT4G30250 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G30260 | Encodes one of the two YPT/RAB GTPase Interacting Protein 4a (YIP4a) and YIP4b (formerly YIP2), which form a TGN-localized complex with ECHIDNA (ECH). This complex is required for the secretion of cell wall polysaccharides. |
AT4G30270 | encodes a protein similar to endo xyloglucan transferase in sequence. It is also very similar to BRU1 in soybean, which is involved in brassinosteroid response. |
AT4G30280 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. |
AT4G30300 | member of NAP subfamily |
AT4G30330 | Differs from PCP only in two amino acids, expression is regulated in a manner opposite to that of PCP in that it was upregulated in response to increasing ambient temperature. |
AT4G30350 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. Regulates root and root hair development downstream of KAI2-mediated signaling. |
AT4G30360 | member of Cyclic nucleotide gated channel family |
AT4G30370 | RING/U-box superfamily protein;(source:Araport11) |
AT4G30390 | UDP-arabinopyranose mutase;(source:Araport11) |
AT4G30400 | RING/U-box superfamily protein;(source:Araport11) |
AT4G30410 | sequence-specific DNA binding transcription factor;(source:Araport11) |
AT4G30420 | nodulin MtN21-like transporter family protein |
AT4G30430 | Member of TETRASPANIN family |
AT4G30450 | glycine-rich protein;(source:Araport11) |
AT4G30510 | yeast autophagy 18 B-like protein;(source:Araport11) |
AT4G30520 | Encodes SARK (SENESCENCE-ASSOCIATED RECEPTOR-LIKE KINASE). Regulates leaf senescence through synergistic actions of auxin and ethylene. It is one of a group of LRR-RLKs, designated as CLAVATA3 INSENSITIVE RECEPTOR KINASES (CIKs), that act as co-receptors and have essential roles in regulating CLV3-mediated stem cell homeostasis. |
AT4G30530 | Encodes a gamma-glutamyl peptidase, outside the GGT family, that can hydrolyze gamma-glutamyl peptide bonds. The mRNA is cell-to-cell mobile. |
AT4G30550 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
AT4G30662 | hypothetical protein;(source:Araport11) |
AT4G30760 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
AT4G30790 | Encodes autophagy-related 2 (ATG11) |
AT4G30810 | serine carboxypeptidase-like 29;(source:Araport11) |
AT4G30825 | P-class pentatricopeptide repeat (PPR) protein essential for accumulation of the dicistronic atpH/F transcript in chloroplasts. Acts as barrier to prevent the atpH/F transcript degradation by exoribonucleases by binding to the consensus sequence of the atpF-atpA intergenic region. |
AT4G30830 | myosin-like protein (Protein of unknown function, DUF593);(source:Araport11) |
AT4G30860 | Encodes a member of the trxG protein family. Contains a SET domain which is known to be involved in modification of histone tails by methylation. Interacts physically with AMS, but the implications of this interaction are unknown.Overexpression results in plieotrophic developmental defects. |
AT4G30872 | other_RNA;(source:Araport11) |
AT4G30890 | Encodes a ubiquitin-specific protease. |
AT4G30940 | BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11) |
AT4G30970 | hypothetical protein;(source:Araport11) |
AT4G30990 | ARM repeat superfamily protein;(source:Araport11) |
AT4G30993 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
AT4G31000 | Calmodulin-binding protein;(source:Araport11) |
AT4G31020 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G31030 | Putative membrane lipoprotein;(source:Araport11) |
AT4G31080 | Encodes one of two LUNAPARK proteins in Arabidopsis. Both LNPA and LNPB are predominantly distributed throughout the ER, but not preferentially localized at the three-way junctions. Mutation of both LNPA and LNPB together caused the cortical ER to develop poor ER cisternae and a less dense tubular network. E3 ligase involved in degradation of RHD3 to maintain a tubular ER network. |
AT4G31115 | DUF1997 family protein, putative (DUF1997);(source:Araport11) |
AT4G31150 | endonuclease V family protein;(source:Araport11) |
AT4G31160 | Encodes a DCAF/DWD protein capable of interacting with DDB1 and associating with CUL4, likely as part of a nuclear ubiquitin ligase complex. DCAF1 appears to be required for plant embryogenesis and to affect several other developmental processes including leaf, shoot, and flower development. |
AT4G31170 | Protein kinase superfamily protein;(source:Araport11) |
AT4G31180 | The IBI1 gene encodes an aspartyl tRNA synthetase (AspRS). In addition, the IBI1 protein acts as a receptor protein of the chemical plant defence activator beta-aminobutyric acid (BABA). Binding of IBI1 to the active R-enantiomer of BABA primes non-canonical defence activity of the AspRS protein against pathogen attack. |
AT4G31260 | hypothetical protein;(source:Araport11) |
AT4G31320 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G31380 | encodes a small protein with unknown function and is similar to flower promoting factor 1. This gene is not expressed in apical meristem after floral induction but is expressed in roots, flowers, and in low abundance, leaves. |
AT4G31398 | Natural antisense transcript overlaps with AT4G31400;(source:Araport11) |
AT4G31400 | Encodes CTF7, a homolog of the yeast CTF protein required for the formation of sister chromatid cohesion. Arabidopsis CTF7 is similar to Saccharomyces cerevisiae CTF7 in that it lacks an N-terminal extension, exhibits acetyltransferase activity, and can complement a yeast ctf7 temperature-sensitive mutation. Arabidopsis CTF7 is critical for female gametophyte and embryo development, but not for the establishment of mitotic cohesion during microgametogenesis or during endosperm development. Inactivation of CTF7 results in severe defects in reproduction and vegetative growth. |
AT4G31440 | transcriptional regulator of RNA polII, SAGA, subunit;(source:Araport11) |
AT4G31450 | RING/U-box superfamily protein;(source:Araport11) |
AT4G31500 | Encodes an oxime-metabolizing enzyme in the biosynthetic pathway of glucosinolates. Is required for phytochrome signal transduction in red light. Mutation confers auxin overproduction. |
AT4G31550 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
AT4G31580 | Encodes a Serine/arginine-rich (SR) protein RSZp22. SR proteins are splicing regulators that share a modular structure consisting of one or two N-terminal RNA recognition motif domains and a C-terminal RS-rich domain. RSZp22 is located in the nucleolus. It is a nucleocytoplasmic shuttling protein and an interacting partner to the Arabidopsis U1-70K. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
AT4G31610 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. Expressed specifically in reproductive meristems. |
AT4G31620 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
AT4G31660 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT4G31670 | ubiquitin-specific protease 18;(source:Araport11) |
AT4G31680 | Transcriptional factor B3 family protein;(source:Araport11) |
AT4G31690 | transcriptional factor B3 family protein;(source:Araport11) |
AT4G31700 | Encodes a putative ribosomal protein S6 (rps6a). RPS6A and RPS6B are fully redundant and essential during gametogenesis. |
AT4G31710 | member of Putative ligand-gated ion channel subunit family |
AT4G31770 | Encodes a RNA lariat debranching enzyme required for embryogenesis. |
AT4G31790 | Tetrapyrrole (Corrin/Porphyrin) Methylase;(source:Araport11) |
AT4G31805 | Encodes POLAR, a scaffold protein associated with cellular asymmetry of meristemoids. Its transcript levels change after inducing MUTE expression in a mute background. |
AT4G31810 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
AT4G31820 | A member of the NPY family genes (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Encodes a protein with similarity to NHP3. Contains BTB/POZ domain. Promoter region has canonical auxin response element binding site and Wus binding site. Co-localizes to the late endosome with PID. Regulates cotyledon development through control of PIN1 polarity in concert with PID. Also involved in sepal and gynoecia development. |
AT4G31880 | One of 5 PO76/PDS5 cohesion cofactor orthologs of Arabidopsis. |
AT4G31890 | ARM repeat superfamily protein;(source:Araport11) |
AT4G31900 | chromatin remodeling factor;(source:Araport11) |
AT4G31910 | Encodes an acyltransferase that can modify brassinosteroids (BRs) by acylation and may modulate endogenous BR levels. |
AT4G31930 | Mitochondrial glycoprotein family protein;(source:Araport11) |
AT4G31980 | PPPDE thiol peptidase family protein;(source:Araport11) |
AT4G31990 | Encodes a plastid-localized aspartate aminotransferase. Does not display any PAT (glutamate/aspartate-prephenate aminotransferase) activity even in the presence of a high concentration of prephenate. |
AT4G32010 | Transcriptional repressor involved in the recruitment of PRC2 for genome-wide polycomb silencing. |
AT4G32020 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
AT4G32050 | neurochondrin family protein;(source:Araport11) |
AT4G32060 | Encodes an EF-hand protein with homology to constituents of the mitochondrial Ca2+ uniporter machinery in mammals. MICU binds Ca2+ and localizes to the mitochondria in Arabidopsis. It is a negative regulator of mitochondrial calcium uptake. Mutants display elevated matrix calcium at steady state and modified calcium transient kinetics in vivo. |
AT4G32080 | hypothetical protein;(source:Araport11) |
AT4G32140 | EamA-like transporter family;(source:Araport11) |
AT4G32170 | member of CYP96A |
AT4G32200 | meiotic asynaptic mutant 2, homologue of ASY1 |
AT4G32230 | hypothetical protein;(source:Araport11) |
AT4G32240 | hypothetical protein;(source:Araport11) |
AT4G32320 | Encodes a cytosolic ascorbate peroxidase APX6. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
AT4G32330 | WDL5 is an target of EIN3 that co-localizes with cortical microtubles. It its thought to function to stabilize microtubles during ethylene induced hypocotyl elongation. |
AT4G32340 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G32342 | hypothetical protein;(source:Araport11) |
AT4G32350 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
AT4G32370 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT4G32400 | Encodes a plastidial nucleotide uniport carrier protein required to export newly synthesized adenylates into the cytosol. |
AT4G32410 | Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. |
AT4G32440 | Plant Tudor-like RNA-binding protein;(source:Araport11) |
AT4G32470 | Cytochrome bd ubiquinol oxidase, 14kDa subunit;(source:Araport11) |
AT4G32500 | Encodes AKT5, a member of the Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
AT4G32510 | HCO3- transporter family;(source:Araport11) |
AT4G32540 | Mutant has elevated levels of free IAA in dominant mutant allele; Flavin Monooxygenase-Like Enzyme; Auxin Biosynthesis |
AT4G32560 | paramyosin-like protein;(source:Araport11) |
AT4G32570 | TIFY domain protein 8;(source:Araport11) |
AT4G32630 | ArfGap/RecO-like zinc finger domain-containing protein;(source:Araport11) |
AT4G32670 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT4G32780 | FORKED-LIKE family member, part of Group 2 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
AT4G32790 | Exostosin family protein;(source:Araport11) |
AT4G32810 | Encodes a protein with similarity to carotenoid cleaving deoxygenases, the enzymes that cleave beta-carotene. Involved in the production of a graft transmissable signal to suppress axillary branching. Protein is localized to chloroplast stroma and expressed primarily in root tip. Mutants in the gene exhibit increased shoot branching, and light-dependent defects in hook opening and hypocotyl/root elongation. Only upregulated by auxin in the root and hypocotyl, and this is not required for the inhibition of shoot branching. |
AT4G32820 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G32840 | phosphofructokinase 6;(source:Araport11) |
AT4G32860 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
AT4G32880 | member of homeodomain-leucine zipper family, acting as a differentiation-promoting transcription factor of the vascular meristems. |
AT4G32890 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT4G32940 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteinases that is expressed in vegetative organs and is upregulated in association with various types of cell death and under stressed conditions. They are essential in processing seed storage proteins and for mediating the susceptible response of toxin-induced cell death. |
AT4G33000 | Encodes a member of the calcineurin B-like calcium sensor gene family. Mediates salt tolerance by regulating ion homeostasis in Arabidopsis. |
AT4G33010 | glycine decarboxylase P-protein 1;(source:Araport11) |
AT4G33040 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
AT4G33070 | Thiamine pyrophosphate dependent pyruvate decarboxylase family protein;(source:Araport11) |
AT4G33150 | This is a splice variant of the LKR/SDH locus. It encodes a bifunctional polypeptide lysine-ketoglutarate reductase and saccharopine dehydrogenase involved in lysine degradation. There is another splice variant that encodes a mono saccharopine dehydrogenase protein. Gene expression is induced by abscisic acid, jasmonate, and under sucrose starvation. |
AT4G33160 | F-box family protein;(source:Araport11) |
AT4G33170 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G33220 | pectin methylesterase 44;(source:Araport11) |
AT4G33230 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT4G33240 | Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant. |
AT4G33270 | Encodes a CDC20 protein that interacts with APC subunits, components of the mitochondrial checkpoint complex and mitotic cyclin substrates and is indispensable for normal plant development and fertility. |
AT4G33310 | hypothetical protein;(source:Araport11) |
AT4G33330 | Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. |
AT4G33390 | WEAK CHLOROPLAST MOVEMENT UNDER BLUE LIGHT-like protein (DUF827);(source:Araport11) |
AT4G33420 | Peroxidase superfamily protein;(source:Araport11) |
AT4G33430 | Leu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. Contributes to postinvasive immunity against Alternaria brassicola. |
AT4G33440 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT4G33460 | Member of NAP subfamily. Putative component of chloroplast ECF/ABC-Transporter involved in metal homeostasis. |
AT4G33467 | hypothetical protein;(source:Araport11) |
AT4G33480 | BTB/POZ domain protein TNFAIP protein;(source:Araport11) |
AT4G33490 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G33495 | A member of the RPD gene family - there are13 annotated genes and one EST encoding RPD1-like proteins in Arabidopsis. Shows no homology to any protein of known function. Abundant expression found in the shoot apex and the root. rpd1 mutant is a temperature-sensitive mutant isolated on the basis of the impairment in adventitious roots formation in hypocotyl region. Also, disruption of the RPD1 gene by a T-DNA insertion caused embryogenesis arrest at the globular to transition stages. This phenotype is consistent with the hypothesized function of RPD1 in the maintenance of active cell proliferation. |
AT4G33500 | Protein phosphatase 2C family protein. Loss of function enhances immunity to bacterial pathogens. |
AT4G33530 | potassium transporter |
AT4G33540 | metallo-beta-lactamase family protein;(source:Araport11) |
AT4G33560 | Member of the wound-induced polypeptide (WIP) family. |
AT4G33565 | RING/U-box superfamily protein;(source:Araport11) |
AT4G33580 | beta carbonic anhydrase 5;(source:Araport11) |
AT4G33590 | transmembrane protein;(source:Araport11) |
AT4G33600 | transmembrane protein;(source:Araport11) |
AT4G33620 | Encodes a SUMO protease that, along with ASP1,is required for fertility as asp1/spf2 double mutants have defects in gametogenesis and embroygenesis. |
AT4G33640 | costars family protein;(source:Araport11) |
AT4G33660 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
AT4G33666 | hypothetical protein;(source:Araport11) |
AT4G33780 | ATP phosphoribosyltransferase regulatory subunit;(source:Araport11) |
AT4G33800 | hypothetical protein;(source:Araport11) |
AT4G33820 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT4G33830 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
AT4G33840 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
AT4G33850 | Pseudogene of AT4G33850; glycosyl hydrolase family 10 protein |
AT4G33860 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
AT4G33890 | Component of SAGA complex, SPT module subunit, interacts with HAG1. |
AT4G33900 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT4G33905 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
AT4G33950 | Encodes calcium-independent ABA-activated protein kinase, a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Mutations disrupted ABA induction of stomatal closure as well as ABA inhibition of light-induced stomatal opening. However, regulation of stomatal opening/closing by light or CO(2) is not affected in these mutants. May act in the interval between ABA perception and reactive oxygen species production in the ABA signalling network. |
AT4G33985 | membrane insertase, putative (DUF1685);(source:Araport11) |
AT4G33990 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G34050 | Methyltransferase in the lignin biosynthetic pathway. |
AT4G34060 | Encodes a protein with 5-meC and thymine-DNA glycosylase activity with a preference for CpG and CpHpG sequences. Involved in maintaining methylation marks. Many targets of DML3 are senescence-associated genes (SAGs). |
AT4G34065 | Pseudogene of AT5G06265; hyaluronan mediated motility receptor-related |
AT4G34131 | UDP-glucosyl transferase 73B3;(source:Araport11) |
AT4G34160 | encodes a cyclin D-type protein involved in the switch from cell proliferation to the final stages of differentiation. The gene is transcriptionally regulated by cytokinin and brassinosteroid. Protein interacts with cyclin-dependent kinase inhibitor ICK1. |
AT4G34170 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT4G34180 | Encodes a cyclase-family protein that is a negative regulator of cell death that regulates pathogen-induced symptom development. |
AT4G34215 | Encodes a member of the SGNH-hydrolase superfamily of enzymes. The enzymes of the SGNH-hydrolase superfamily facilitate the hydrolysis of ester, thioester and amide bonds in a range of substrates including complex polysaccharides, lysophospholipids, acyl-CoA esters and other compounds. |
AT4G34220 | Encodes a receptor like kinase involved in ABA-mediated seedling development and drought tolerance.RDK1 is an atypical or pseudokinase and has no phosphorylation activity. Its expression is upregulated in response to ABA.interacts with ABI1 and other PP2C phosphatases. |
AT4G34260 | 1,2-alpha-L-fucosidase;(source:Araport11) |
AT4G34320 | transmembrane protein, putative (DUF677);(source:Araport11) |
AT4G34380 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G34390 | extra-large GTP-binding protein 2;(source:Araport11) |
AT4G34400 | B3-type transcription factor, which promotes floral transition and is repressed by FLC/SVP and promoted by SOC1. |
AT4G34410 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Regulates programmed cell death (PCD) inhibitor genes. Involved in retarding programmed cell death under salt stress due to the regulation of processes participating in ROS inhibition. ERF-regulated transcripts belong to the tryptophan biosynthesis, tryptophan metabolism, and downstream plant hormone signal transduction pathways, where ERF109 potentially acts as a 'master switch' mediator of a cascade of consecutive events across the three pathways, promoting plant growth and re-adjustment to homeostasis due the direct participation in auxin biosynthesis leading to the plants ability to tolerate salt stress. |
AT4G34440 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT4G34450 | Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation. |
AT4G34480 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT4G34490 | CYCLASE ASSOCIATED PROTEIN |
AT4G34500 | Protein kinase superfamily protein;(source:Araport11) |
AT4G34520 | Encodes KCS18, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT4G34550 | F-box protein;(source:Araport11) |
AT4G34555 | Ribosomal protein S25 family protein;(source:Araport11) |
AT4G34560 | transmembrane protein;(source:Araport11) |
AT4G34580 | Encodes COW1 (can of worms1), a phosphatidylinositol transfer protein essential for root hair tip growth. The N-terminus of the COW1 protein is 32% identical to an essential phosphatidylinositol transfer protein (PITP), the yeast Sec14 protein (sec14p) while the C-terminus is 34.5% identical to a late nodulin of Lotus japonicus, Nlj16. Expression of COW1 complements the growth defect associated with Sec14p dysfunction in yeast. GFP fused to the COW1 protein specifically accumulates at the site of root hair outgrowth. |
AT4G34590 | Encodes a basic domain leucine zipper (bZip) transcription factor bZIP11. Translation is repressed by sucrose. Directly regulates gene expression of ASN1 and ProDH2, which are enzyme-coding genes involved in amino acid metabolism. Susceptibility factor during Pseudomonas syringae infection. |
AT4G34600 | CAF2 is a peptide hormone expressed in the root stele that specifically binds the endodermis-expressed leucine-rich repeat receptor kinase GASSHO1 (GSO1)/SCHENGEN3 and its homolog, GSO2. Together with CAF1 it is required for formation of the casparian band. |
AT4G34610 | BEL1-like homeodomain 6;(source:Araport11) |
AT4G34650 | Encodes a protein with similarity to squalene synthase which catalyzes the first committed step in sterol biosynthesis. To date no experimental evidence exists that SQS2 functions as a squalene synthase and some experiments indicate it does not have this function. |
AT4G34660 | SH3 domain-containing protein;(source:Araport11) |
AT4G34700 | Encodes the B22 subunit of eukaryotic mitochondrial Complex I. Mutation in the gene display pleiotropic phenotypes including shorter roots, smaller plants and delayed flowering. The mRNA is cell-to-cell mobile. |
AT4G34710 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1. |
AT4G34730 | ribosome-binding factor A family protein;(source:Araport11) |
AT4G34760 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G34770 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G34780 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G34790 | Putative OXS2-binding DEGs were constitutively activated by OXS2. |
AT4G34890 | Encodes a xanthine dehydrogenase, involved in purine catabolism. Ubiquitously expressed, but the transcript level is altered during aging, senescence, salt and cold stress, ABA treatment, and dark treatment. RNAi lines that suppress both XDH1 and XDH2 produce small plants with reduced fertility and accelerated leaf senescence. Role in drought tolerance. |
AT4G34900 | xanthine dehydrogenase 2;(source:Araport11) |
AT4G34920 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
AT4G34930 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
AT4G34940 | Armadillo repeat protein. One of a family of four in Arabidopsis. Located in the nucleus and cytoplasm of pollen vegetative cells, and in the cytoplasm of egg cells. Involved in the signaling network controlling tip growth and actin organization in the pollen tube. |
AT4G34950 | Major facilitator superfamily protein;(source:Araport11) |
AT4G34960 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT4G34970 | A member of actin polymerizing factors (ADFs)family, ADF9 primarily functions as an actin bundling protein. |
AT4G34980 | Serine protease similar to subtilisin. |
AT4G34990 | Member of the R2R3 factor gene family. |
AT4G35000 | Encodes a microsomal ascorbate peroxidase APX3. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. The APX3 protein interacts with AKR2 (ankyrin-containing protein that interacts with AFT1) and AFT1, a 14-3-3 protein. |
AT4G35025 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G35040 | Basic-region leucine zipper (bZIP19) transcription factor involved in the adaptation to zinc deficiency. Binds ZDRE motifs. |
AT4G35070 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
AT4G35100 | a member of the plasma membrane intrinsic protein PIP. functions as aquaporin. Salt-stress-inducible MIP |
AT4G35120 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT4G35160 | Encodes a cytosolic N-acetylserotonin O-methyltransferase that can convert N-acetylserotonin to melatonin and serotonin to 5-methoxytryptamine in the process of melatonin synthesis. It does not have caffeic acid O- methyltransferase activity. |
AT4G35180 | LYS/HIS transporter 7;(source:Araport11) |
AT4G35190 | Putative lysine decarboxylase family protein;(source:Araport11) |
AT4G35220 | Cyclase family protein;(source:Araport11) |
AT4G35230 | Encodes BR-signaling kinase 1 (BSK1), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
AT4G35240 | DNA-directed RNA polymerase subunit beta, putative (DUF630 and DUF632);(source:Araport11) |
AT4G35250 | HCF244 is a member of the atypical short-chain dehydrogenase/reductase superfamily, a modified group, which has lost enzyme activity.HCF244 interacts with unknown partners in a 200-400 kD membrane associated complex. |
AT4G35280 | Target promoter of the male germline-specific transcription factor DUO1. |
AT4G35310 | calmodulin-domain protein kinase CDPK isoform 5 (CPK5) |
AT4G35360 | pantothenate kinase;(source:Araport11) |
AT4G35370 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G35380 | Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking. |
AT4G35390 | AT-hook protein of GA feedback 1;(source:Araport11) |
AT4G35460 | NADPH-dependent thioredoxin reductase 1 (NTR1. Similar to E.coli NTR and has conserved NADPH binding domains. |
AT4G35480 | Encodes a putative RING-H2 finger protein RHA3b. |
AT4G35490 | mitochondrial ribosomal protein L11;(source:Araport11) |
AT4G35510 | PHD finger-like protein;(source:Araport11) |
AT4G35530 | phosphatidylinositolglycan-like protein;(source:Araport11) |
AT4G35550 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. WOX13 is the only family member that does not contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
AT4G35560 | Target promoter of the male germline-specific transcription factor DUO1. The mRNA is cell-to-cell mobile. |
AT4G35570 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Cannot be phosphorylated by CK2alpha. |
AT4G35630 | Encodes a phosphoserine aminotransferase which is involved in serine biosynthesis in the chloroplast which operates via the phosphorylated pathway. The mRNA is cell-to-cell mobile. |
AT4G35655 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
AT4G35680 | selection/upkeep of intraepithelial T-cells protein;(source:Araport11) |
AT4G35690 | hypothetical protein (DUF241);(source:Araport11) |
AT4G35790 | Encodes a protein with phospholipase D activity. Involved in phospolipase metabolism. Mutants are affected in hydrogen peroxide mediated cell death. |
AT4G35800 | Encodes the unique largest subunit of nuclear DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB1 and a homolog of the E. coli RNA polymerase beta prime subunit. |
AT4G35810 | 2-oxoglutarate-dependent dioxygenase |
AT4G35900 | bZIP protein required for positive regulation of flowering. Mutants are late flowering. FD interacts with FT to promote flowering.Expressed in the shoot apex in floral anlagen, then declines in floral primordia. |
AT4G35905 | Trm112p-like protein;(source:Araport11) |
AT4G35920 | Encodes an integral plasma membrane protein. Functionally complements the yeast mid1 mutant, a deficiency of Ca2+ influx. Involved in Ca2+ influx and mechanical sensing in roots. An over-expression line showed increased Ca2+ uptake than the wild type plant. The primary root of a knock-out mutant failed to penetrate a harder agar medium from a softer medium. |
AT4G35970 | Encodes a microsomal ascorbate peroxidase APX5. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
AT4G35985 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
AT4G36010 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT4G36030 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
AT4G36060 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT4G36070 | member of Calcium Dependent Protein Kinase |
AT4G36105 | polyamine-modulated factor 1-binding protein;(source:Araport11) |
AT4G36110 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G36120 | filament-like protein (DUF869);(source:Araport11) |
AT4G36130 | Ribosomal protein L2 family;(source:Araport11) |
AT4G36160 | Encodes a NAC-domain transcription factor that is expressed in developing xylem. Over expression of this protein causes ectopic secondary cell wall growth. Complements some of the cell wall defects seen in SND1/NST1 double mutants. |
AT4G36170 | hypothetical protein;(source:Araport11) |
AT4G36180 | LRR-RLK which regulates lateral root development. |
AT4G36210 | transmembrane/coiled-coil protein (DUF726);(source:Araport11) |
AT4G36220 | encodes ferulate 5-hydroxylase (F5H). Involved in lignin biosynthesis. |
AT4G36230 | transmembrane protein;(source:Araport11) |
AT4G36250 | Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures. |
AT4G36260 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Encodes protein with a single zinc finger motif and a members of a small gene family of putative transcription factors in which the SHORT INTERNODES (SHI) gene is found. STY2/STY1 double mutants showed defective style, stigma as well as serrated leaves. |
AT4G36280 | Member of the microrchidia protein family which have been described as epigenetic regulators and plant immune mediators, contains a hallmark GHKL-type ATPase domain in N-terminus. |
AT4G36290 | R-protein-interacting protein that localizes to endosomes and functions in resistance gene?mediated immunity. Belongs to the conserved Microrchidia (MORC) adenosine triphosphatase (ATPase) family, predicted to catalyze alterations in chromosome superstructure. Required for heterochromatin condensation and gene silencing. |
AT4G36350 | purple acid phosphatase 25;(source:Araport11) |
AT4G36380 | Encodes a cytochrome P-450 gene that is involved in leaf blade expansion by controlling polar cell expansion in the leaf length direction. Member of the CYP90C CYP450 family. ROT3 was shown to be involved in brassinosteroid biosynthesis, most likely in the conversion step of typhasterol (TY) to castasterone (CS). As 6-deoxo-CS was unable to restore the phenotype of rot3-1, it has been postulated that ROT3 might be specifically involved in the conversion of TY to CS in the C6-oxidation pathway of brassinolide. Recently, CYP90C1 was shown to catalyse the C-23 hydroxylation of several brassinosteroids (the enzyme has a broad specificity for 22-hydroxylated substrates). |
AT4G36390 | Methylthiotransferase;(source:Araport11) |
AT4G36400 | Encodes a (D)-2-hydroxyglutarate dehydrogenase. |
AT4G36410 | ubiquitin-conjugating enzyme |
AT4G36420 | Ribosomal protein L12 family protein;(source:Araport11) |
AT4G36430 | Peroxidase superfamily protein;(source:Araport11) |
AT4G36480 | Encodes the LCB1 subunit of serine palmitoyltransferase. Together with the LCB2 subunit, forms a functional serine palmitoyltransferase complex, which catalyzes the first reaction of sphingolipid biosynthesis. Knockout of LCB1 was embryo lethal. Partial suppression of LCB1 expression led to smaller plants due to reduced cell expansion. |
AT4G36490 | SEC14-like 12;(source:Araport11) |
AT4G36510 | hypothetical protein;(source:Araport11) |
AT4G36515 | trichohyalin-like protein;(source:Araport11) |
AT4G36530 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G36540 | Encodes the brassinosteroid signaling component BEE2 (BR-ENHANCED EXPRESSION 2). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
AT4G36550 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT4G36560 | transmembrane protein;(source:Araport11) |
AT4G36580 | AAA-type ATPase family protein;(source:Araport11) |
AT4G36590 | MADS-box transcription factor family protein;(source:Araport11) |
AT4G36610 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G36640 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT4G36670 | Major facilitator superfamily protein;(source:Araport11) |
AT4G36680 | Ribosomal pentatricopeptide repeat protein |
AT4G36690 | Regulates flowering time and displays a redundant role in pollen tube growth together with AtU2AF65b. |
AT4G36700 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT4G36730 | member of a gene family encoding basic leucine zipper proteins (GBFs) which bind the G-box |
AT4G36760 | Arabidopsis aminopeptidase P1 The mRNA is cell-to-cell mobile. |
AT4G36790 | Major facilitator superfamily protein;(source:Araport11) |
AT4G36808 | Natural antisense transcript overlaps with AT4G36810;(source:Araport11) |
AT4G36830 | ELO family protein. |
AT4G36860 | DAR1 is a member of a small (7 member) ubiquitin binding protein family. It appears to play a role in regulation of endoreduplication in leaf epidermal tissue. |
AT4G36880 | cysteine proteinase1;(source:Araport11) |
AT4G36890 | IRX14 was identified as MUCI64 in a reverse genetic screen for MUCILAGE-RELATED genes. IRX14/MUCI64 is a GT43 protein essential for xylan elongation in seed coat mucilage. The xylan backbone maintains the attachment of mucilage to the seed surface and the distribution of cellulose. It was identified based on its gene expression co-variance with the IRX3 gene involved in secondary cell wall synthesis. A biochemical assay using the irx14 mutant indicates that IRX14 might function in xylose chain elongation. |
AT4G36925 | transmembrane protein;(source:Araport11) |
AT4G36930 | Encodes a transcription factor of the bHLH protein family. Mutants have abnormal, unfused carpels and reduced seed dormancy. |
AT4G36940 | nicotinate phosphoribosyltransferase 1;(source:Araport11) |
AT4G36970 | Remorin family protein;(source:Araport11) |
AT4G36990 | Encodes a protein whose sequence is similar to heat shock factors that regulate the expression of heat shock proteins. Transcript level is increased in response to heat shock. However, overexpression of this gene did not result in the increase of decrease of heat shock proteins. |
AT4G37000 | Mutants have spontaneous spreading cell death lesions and constitutive activation of defenses in the absence of pathogen infection. Its product was shown to display red chlorophyll catabolite reductase (RCCR), which catalyzes one step in the breakdown of the porphyrin component of chlorophyll. The enzyme was further assessed to be a Type-1 (pFCC-1-producing) RCCR.Upon P. syringae infection, ACD2 localization shifts from being largely in chloroplasts to partitioning to chloroplasts, mitochondria, and to a small extent, cytosol. Overexpression of ACD2 delayed cell death and the replication of P. syringae. |
AT4G37010 | Encodes a member of the Centrin family. Mutants are hypersensitive to UV and prone to UV induced DNA damage. Based on sequence similarity and mutant phenotype CEN2 is thought to be involved in nucelotide excision repair/DNA repair. |
AT4G37030 | membrane protein;(source:Araport11) |
AT4G37040 | encodes a methionine aminopeptidase |
AT4G37050 | Patatin-related phospholipase A. Expressed in the floral gynaecium and is induced by abscisic acid (ABA) or phosphate deficiency in roots. |
AT4G37080 | ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547);(source:Araport11) |
AT4G37100 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT4G37150 | Encodes a protein shown to have carboxylesterase activity, methyl salicylate esterase activity, methyl jasmonate esterase activity, and methyl IAA esterase activity in vitro. MES9 appears to be involved in MeSA hydrolysis in planta. Expression of MES9 can restore systemic acquired resistance in SAR-deficient tobacco plants. This protein does not act on MeGA4, or MEGA9 in vitro. |
AT4G37160 | SKU5 similar 15;(source:Araport11) |
AT4G37170 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G37190 | plasma membrane, autoregulation-binding site, misato segment II, myosin-like, tubulin/FtsZ protein;(source:Araport11) |
AT4G37235 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT4G37240 | PADRE protein down-regulated after infection by S. sclerotiorun. |
AT4G37250 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G37295 | Encodes an 86 AA polypeptide sequence that produces an 11 AA secreted, bioactive peptide. It is induced by BD16. The peptide is bound by the RLK7 receptor kinase and inhibits the formation of lateral root founder cells. Homolog of prePIP1. |
AT4G37310 | member of CYP81H |
AT4G37320 | member of CYP81D |
AT4G37330 | member of CYP81D |
AT4G37340 | member of CYP81D |
AT4G37360 | member of CYP81D |
AT4G37420 | glycosyltransferase family protein (DUF23);(source:Araport11) |
AT4G37430 | Encodes a member of the CYP81F cytochrome P450 monooxygenase subfamily. |
AT4G37445 | calcium ion-binding protein;(source:Araport11) |
AT4G37450 | AGP18 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP17 and AGP19, other lysine-rich AGPs. It is expressed in young leaves, shoots, roots and flowers and is active in the regulation of the selection and survival of megaspores. |
AT4G37460 | Encodes a tetratricopeptide repeat domain containing protein that shows sequence similarity to those of transcriptional repressors in other organisms. Involved in mediating effector-triggered immunity. |
AT4G37470 | HTL belonging to the alpha/beta fold hydrolase superfamily. Mutant and over-expression studies indicates its involvement in seedling de-etiolation process. Involved in the perception of karrikins. Interacts with MAX2. Important for cotyledon expansion. |
AT4G37490 | Cyclin-dependent protein kinase CYCB1;1. Functions as an effector of growth control at G2/M. Regulated by TCP20. |
AT4G37510 | Ribonuclease III family protein;(source:Araport11) |
AT4G37553 | Natural antisense transcript overlaps with AT4G37550 and AT4G37560;(source:Araport11) |
AT4G37580 | involved in apical hook development. putative N-acetyltransferase |
AT4G37590 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
AT4G37620 | transposable_element_gene;(source:Araport11);similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT4G09490.1);(source:TAIR10) |
AT4G37630 | core cell cycle genes; a quantitative trait gene for endoreduplication. |
AT4G37650 | Involved in radial organization of the root and shoot axial organs. Essential for normal shoot gravitropism. The protein moves in a highly specific manner from the cells of the stele in which it is synthesized outward. Movement requires sequences within the GRAS and VHIID domains. SHORT-ROOT forms a network in combination with JACKDAW, BLUEJAY AND SCARECROW to regulate tissue patterning through asymmetric cell division. The ground tissue lineage remains in shortroot mutant, while it is progressively lost in the triple mutant bluejay jackdaw scarecrow and double mutant jackdaw scarecrow. In addition, ground tissue basal identity remains in shortroot mutant while it is defective in the quadruple mutant bluejay jackdaw magpie nutcracker. |
AT4G37660 | Ribosomal protein L12/ ATP-dependent Clp protease adaptor protein ClpS family protein;(source:Araport11) |
AT4G37705 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.5e-203 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT4G37710 | VQ motif-containing protein;(source:Araport11) |
AT4G37720 | Probable phytosulfokines 6 precursor, coding for a unique plant peptide growth factor. |
AT4G37730 | basic leucine-zipper 7;(source:Araport11) |
AT4G37750 | ANT is required for control of cell proliferation and encodes a putative transcriptional regulator similar to AP2. Loss of function alleles have reduced fertility, abnormal ovules and abnormal lateral organs. Expressed in the chalaza, floral organ primordia, and lateral shoot organ primordia. Regulates growth and cell numbers during organogenesis. |
AT4G37760 | squalene epoxidase 3;(source:Araport11) |
AT4G37770 | Encodes an auxin inducible ACC synthase. |
AT4G37820 | transmembrane protein;(source:Araport11) |
AT4G37840 | Encodes a putative hexokinase. |
AT4G37850 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT4G37860 | SPT2 chromatin protein;(source:Araport11) |
AT4G37890 | Involved in shoot regenaration from root explants. |
AT4G37930 | Encodes a protein with mitochondrial serine hydroxymethyltransferase activity, which functions in the photorespiratory pathway, catalyzes the conversion of serine and tetrahydrofolate to glycine and 5,10-methylene tetrahydrofolate. Involved in controlling cell damage caused by abiotic stress, such as high light and salt and the hypersensitive defense response of plants. |
AT4G37940 | encodes a MADS box protein, highly expressed in the root. |
AT4G37970 | cinnamyl alcohol dehydrogenase 6;(source:Araport11) |
AT4G38060 | hypothetical protein;(source:Araport11) |
AT4G38070 | transcription factor bHLH131-like protein;(source:Araport11) |
AT4G38190 | encodes a gene similar to cellulose synthase |
AT4G38230 | member of Calcium Dependent Protein Kinase |
AT4G38340 | Chip-seq data indicates bZIP1 binds to the NLP3 promoter. |
AT4G38360 | LAZ1 is a DUF300 domain protein that appears to function in vacuolar transport effecting brassinosteroid and programmed cell dealth signaling pathways. |
AT4G38370 | Phosphoglycerate mutase family protein;(source:Araport11) |
AT4G38510 | One of three genes encoding the vacuolar ATP synthase subunit B1. The protein binds to and co-localizes with F-actin, bundles F-actin to form higher-order structure, and stabilizes actin filaments in vitro. |
AT4G38552 | Natural antisense transcript overlaps with AT4G38550;(source:Araport11) |
AT4G38590 | putative beta-galactosidase (BGAL14 gene) |
AT4G38600 | encodes a member of HECT ubiquitin protein ligase family that is involved in trichome cell morphogenesis. Mutants in this gene exhibit supernumerary trichome branches and increased DNA content. |
AT4G38620 | Encodes a R2R3 MYB protein which is involved in the response to UV-B. It functions as a repressor of target gene expression. One of its target genes encodes cinnamate 4-hydroxylase; mutants accumulate sinapate esters in their leaves. MYB4 binds to its own promoter and represses its own expression. Nuclear localization of MYB4 depends on the action of the beta importin SAD2. The mRNA is cell-to-cell mobile. |
AT4G38630 | Regulatory particle non-ATPase subunit of the 26S proteasome with multiubiquitin-chain-binding capabilities |
AT4G38740 | Encodes cytosolic cyclophilin ROC1. |
AT4G38760 | nucleoporin (DUF3414);(source:Araport11) |
AT4G38850 | mRNA is rapidly induced by auxin and is very short-lived. Has been used as a reporter gene in studying auxin mutants. |
AT4G38860 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G38880 | GLN PHOSPHORIBOSYL PYROPHOSPHATE AMIDOTRANSFERASE 2 |
AT4G38900 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
AT4G38910 | Encodes a basic pentacysteine protein that is localized to the nucleus and specifically binds in vitro to GA dinucleotide repeats. |
AT4G38920 | vacuolar-type H[+]-ATPase C3;(source:Araport11) |
AT4G38932 | Natural antisense transcript overlaps with AT4G38930;(source:Araport11) |
AT4G38940 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT4G38950 | ATP binding microtubule motor family protein;(source:Araport11) |
AT4G38960 | BBX19 is a B-box containing transcriptional regulator involved in photomorphogenesis and flowering. |
AT4G38970 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
AT4G38990 | glycosyl hydrolase 9B16;(source:Araport11) |
AT4G39000 | glycosyl hydrolase 9B17;(source:Araport11) |
AT4G39030 | Encodes an orphan multidrug and toxin extrusion transporter. Essential component of salicylic acid-dependent signaling for disease resistance. Member of the MATE-transporter family. Expression induced by salicylic acid. Mutants are salicylic acid-deficient. |
AT4G39100 | Encodes a plant-specific histone reader capable of recognizing both H3K27me3 and H3K4me3 via its bromo-adjacent homology (BAH) and plant homeodomain (PHD) domains, respectively. Detailed biochemical and structural studies suggest a binding mechanism that is mutually exclusive for either H3K4me3 or H3K27me3. SHL plays a role in the repression of flowering. |
AT4G39110 | bups1 and bups1/2 double mutants have reduced feritlity due to premature rupture of pollen tubes before they reach the ovule. BUSP1 interacts with RALF4/19 peptide ligands and ANX1/2 receptors. BUPS/ANX signaling may regulate and promote pollen tube growth. |
AT4G39140 | RING/U-box superfamily protein;(source:Araport11) |
AT4G39220 | Key player of retrieval of ER membrane proteins |
AT4G39290 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT4G39340 | Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion. |
AT4G39360 | hypothetical protein;(source:Araport11) |
AT4G39380 | TSL-kinase interacting-like protein;(source:Araport11) |
AT4G39400 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction. BRI1 ligand is brassinolide which binds at the extracellular domain. Binding results in phosphorylation of the kinase domain which activates the BRI1 protein leading to BR responses. Residue T-1049 and either S-1044 or T-1045 were essential for kinase function in vitro and normal BRI1 signaling in planta. The structure of BRI1 ligand-binding domain has been determined at 2.5A resolution. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. BRI1 appears to be involved in the autonomous pathway that regulates the transition to flowering, primarily through its effects on FLC expression levels, as uncovered by double mutant analyses. This most likely occurs as a result of BRI1-dependent effects on histone acetylation, but not histone triMeH3K4 methylation, at the FLC locus. The mRNA is cell-to-cell mobile. |
AT4G39420 | spatacsin carboxy-terminus protein;(source:Araport11) |
AT4G39490 | member of CYP96A |
AT4G39500 | cytochrome P450, family 96, subfamily A, polypeptide 11;(source:Araport11) |
AT4G39530 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G39540 | Encodes a shikimate kinase. Its transcripts appear to be expressed in vegetative tissues and developing embryos. SK2 transcript levels rise in response to Phytophthora infestans spores. SK2 is believed to be localized to the chloroplast. |
AT4G39570 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT4G39610 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT4G39650 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in the apoplast of young siliques (within the ovules of the carpel) and is involved in the degradation of glutathione. The encoded enzyme also acts as part of a GSH pumping gamma-glutamyl cycle in this tissue and may also be involved in gamma-glutamyl amino acid formation. |
AT4G39670 | Member of the glycolipid transfer protein (GLTP) superfamily, shuttles ceramide-1-phosphate (C1P) between membranes. |
AT4G39700 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT4G39770 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT4G39780 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
AT4G39800 | ** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
AT4G39810 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT4G39840 | cell wall integrity/stress response component-like protein;(source:Araport11) |
AT4G39850 | Encodes a peroxisomal protein of the ATP binding cassette (ABC) transporter class (PMP subfamily) with significant identity to the human X-linked adrenoleukodystrophy protein (ALDP). The gene product promotes germination and represses embryo dormancy. ABI3, ABA1, FUS3 and LEC1 are epistatic to this gene. Mutants accumulate fatty acyl CoA suggesting a defect in uptake of fatty acyl CoA into the peroxisome. |
AT4G39860 | hematological/neurological-like protein;(source:Araport11) |
AT4G39880 | Ribosomal protein L23/L15e family protein;(source:Araport11) |
AT4G39890 | RAB GTPase homolog H1C;(source:Araport11) |
AT4G39910 | Encodes a nuclear ubiquitin-specific protease. |
AT4G39940 | adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete The mRNA is cell-to-cell mobile. |
AT4G39955 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G39960 | Essential for chloroplast iron?sulfur cluster biogenesis. |
AT4G39970 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT4G39990 | Rab GTPase that selectively marks cell wall-containing TGN compartments. Involved in protein trafficking to membranes during tip growth. |
AT4G40020 | Myosin heavy chain-related protein;(source:Araport11) |
AT4G40050 | signal transducer, putative (DUF3550/UPF0682);(source:Araport11) |
AT4G40060 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
AT4G40070 | RING/U-box superfamily protein;(source:Araport11) |
AT4G40090 | arabinogalactan protein 3;(source:Araport11) |
AT5G01020 | Protein kinase superfamily protein;(source:Araport11) |
AT5G01030 | enolase, putative (DUF3527);(source:Araport11) |
AT5G01040 | putative laccase, knockout mutant showed early flowering |
AT5G01050 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
AT5G01070 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT5G01100 | O-fucosyltransferase family protein;(source:Araport11) |
AT5G01110 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G01130 | hypothetical protein (DUF674);(source:Araport11) |
AT5G01140 | hypothetical protein (DUF674);(source:Araport11) |
AT5G01150 | hypothetical protein (DUF674);(source:Araport11) |
AT5G01170 | hypothetical protein (DUF740);(source:Araport11) |
AT5G01180 | Encodes a dipeptide transporter expressed in pollen and ovules during early seed development. GFP-tagged PTR5 localizes to the plasma membrane. |
AT5G01215 | Natural antisense transcript overlaps with AT5G01210;(source:Araport11) |
AT5G01220 | Encodes a UDP-sulfoquinovose:DAG sulfoquinovosyltransferase that is involved in sulfolipid biosynthesis and whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. |
AT5G01225 | josephin-like protein;(source:Araport11) |
AT5G01250 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
AT5G01270 | Encodes CPL2, a carboxyl-terminal domain (CTD) phosphatase that dephosphorylates CTD Ser5-PO4 of the RNA polymerase II complex. Regulates plant growth, stress and auxin responses. |
AT5G01310 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
AT5G01320 | Thiamine pyrophosphate dependent pyruvate decarboxylase family protein;(source:Araport11) |
AT5G01360 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).The dwarf phenotype can only be seen in tbl3 tbl31 esk1 triple mutant. tbl3 and tbl31 are specifically involved in 3-O-monoacetylation of xylan. |
AT5G01380 | Homeodomain-like superfamily protein;(source:Araport11) |
AT5G01390 | DNAJ heat shock family protein;(source:Araport11) |
AT5G01420 | Glutaredoxin family protein;(source:Araport11) |
AT5G01430 | Got1/Sft2-like vescicle transport protein family;(source:Araport11) |
AT5G01450 | RING/U-box superfamily protein;(source:Araport11) |
AT5G01490 | Encodes a cation/proton antiporter, a member of low affinity calcium antiporter CAX2 family. Involved in root development under metal stress. |
AT5G01520 | Encodes a cytosolic RING-type E3 ubiquitin (Ub) ligase that is critical for ABA and high salinity responses during germination. AtAIRP2 and SDIR1 likely play a combinatory role in ABA signaling and the response to high salt in Arabidopsis. |
AT5G01540 | Encodes LecRKA4.1, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. Positively regulates pattern-triggered immunity. |
AT5G01550 | Encodes LecRKA4.2, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. |
AT5G01620 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).TBL35 are required only for xylan 3-O-monoacetylation and 2,3-di-O-acetylation. The biochemical phenotype can be observed in tbl35 esk1, double mutant and tbl34 tbl35 esk1 triple mutants. |
AT5G01660 | influenza virus NS1A-binding protein;(source:Araport11) |
AT5G01680 | member of Putative Na+/H+ antiporter family |
AT5G01690 | member of Putative Na+/H+ antiporter family |
AT5G01700 | Protein phosphatase 2C family protein;(source:Araport11) |
AT5G01720 | RAE1 is an F-box protein component of a SCF-type E3 ligase complex. It is part of an alumium induced regulatory loop: its activity is induced by STOP1 and it in turn ubiquitinates STOP1 which is then targeted for degradation. |
AT5G01730 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
AT5G01790 | hypothetical protein;(source:Araport11) |
AT5G01820 | Encodes a CBL-interacting serine/threonine protein kinase. |
AT5G01840 | Encodes a member of the plant specific ovate protein family. Members of this family have been shown to bind to KNOX and BELL- like TALE class homeodomain proteins. This interaction may mediate relocalization of the TALE homeodomain from the nucleus to the cytoplasm. Functions as a transcriptional repressor that suppresses cell elongation. May also directly affect microtubule organization via interactions with TON2. |
AT5G01880 | RING/U-box superfamily protein;(source:Araport11) |
AT5G01890 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
AT5G01950 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G02030 | Mutant has additional lateral organs and phyllotaxy defect. Encodes a homeodomain transcription factor. Has sequence similarity to the Arabidopsis ovule development regulator Bell1. Binds directly to the AGAMOUS cis-regulatory element. Its localization to the nucleus is dependent on the coexpression of either STM or BP. |
AT5G02035 | microRNA ath-MIR2111b precursor;(source:Araport11) |
AT5G02060 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT5G02090 | hypothetical protein;(source:Araport11) |
AT5G02110 | Encodes CYCLIN D7;1. Overexpression of CYCD7;1 induces cell proliferation and cell enlargement in the embryo and endosperm leading to overgrowth. |
AT5G02120 | Encodes a one helix protein homologous to cyanobacterial high-light inducible proteins. The protein is localized to the thylakoid membrane and its transcript is transiently induced by exposure to high light conditions. The mRNA is cell-to-cell mobile. |
AT5G02130 | SSR1 encodes a tetratricopeptide repeat- containing protein localized in mitochondria. It is involved in root development, possibly by through effects on auxin transport. In ssr1 mutants, the expression PIN genes and trafficking of PIN2 is altered which in turn affects distribution of auxin in the roots. |
AT5G02170 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT5G02180 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT5G02200 | Encodes a small plant-specific protein with both nuclear localization and nuclear export signals that is specifically required, together with FHY1, for the light-regulated nuclear accumulation of phyA. |
AT5G02250 | Encodes a exoribonuclease involved in rRNA processing in mitochondria and chloroplasts.Loss of function mutations are pale green and require supplementation with sucrose for germination and early development. Plants are pale green due to defects in chloroplast biogenesis. |
AT5G02260 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT5G02310 | Encodes PROTEOLYSIS6 (PRT6), a component of the N-end rule pathway that targets protein degradation through the identity of the amino-terminal residue of specific protein substrates. Another component of the N-end rule pathway is arginyl-tRNA:protein arginyltransferase (ATE). Arabidopsis contains two ATE genes: At5g05700/ATE1, At3g11240/ATE2. PRT6 and ATE were shown to regulate seed after-ripening, seedling sugar sensitivity, seedling lipid breakdown, and abscisic acid (ABA) sensitivity of germination. The mRNA is cell-to-cell mobile. |
AT5G02385 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
AT5G02400 | Encodes a protein with similarity to the POL locus which is a novel protein phosphatase 2C. Ubiquitously expressed. No phenotype observed in homozygous null mutant background. |
AT5G02410 | Encodes ALG10, an ER-resident alpha1,2-glucosyltransferase that is required for lipid-linked oligosaccharide biosynthesis and subsequently for normal leaf development and abiotic stress response. |
AT5G02450 | Ribosomal protein L36e family protein;(source:Araport11) |
AT5G02460 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
AT5G02480 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT5G02502 | Oligosaccaryltransferase;(source:Araport11) |
AT5G02520 | Arabidopsis KNL2 localizes at chromocenters during all stages of the mitotic cell cycle, except from metaphase to mid-anaphase, and its level is strictly regulated by the proteasome degradation pathway. Knockout of KNL2 via a T-DNA insertion resulted in a reduced amount of centromeric cenH3, mitotic and meiotic abnormalities, and reduced growth and fertility. |
AT5G02540 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G02560 | Encodes HTA12, a histone H2A protein. |
AT5G02590 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G02600 | Encodes a phloem mobile metal binding protein necessary for phloem function and root meristem maintenance. |
AT5G02630 | Lung seven transmembrane receptor family protein;(source:Araport11) |
AT5G02640 | hypothetical protein;(source:Araport11) |
AT5G02660 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (DUF627 and DUF629);(source:Araport11) |
AT5G02740 | Ribosomal protein S24e family protein;(source:Araport11) |
AT5G02750 | Encodes an E3 ligase, SHOOT GRAVITROPISM9. Modulates the interaction between statoliths and F-Actin in gravity sensing. |
AT5G02760 | Encodes a phosphatase that functions in sustaining proper leaf longevity and preventing early senescence by suppressing or perturbing SARK-mediated senescence signal transduction. |
AT5G02870 | Ribosomal protein L4/L1 family;(source:Araport11) |
AT5G02880 | encodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis. The mRNA is cell-to-cell mobile. |
AT5G02920 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G02930 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G03020 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G03040 | Member of IQ67 (CaM binding) domain containing family. |
AT5G03130 | hypothetical protein;(source:Araport11) |
AT5G03180 | RING/U-box superfamily protein;(source:Araport11) |
AT5G03190 | peptide upstream protein;(source:Araport11) |
AT5G03260 | LAC11 is a putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
AT5G03280 | Involved in ethylene signal transduction. Acts downstream of CTR1. Positively regulates ORE1 and negatively regulates mir164A,B,C to regulate leaf senescence. A maternally expressed imprinted gene. Mutations in ein2 block ethylene stimulation of flavonol synthesis. The mRNA is cell-to-cell mobile. |
AT5G03290 | Encodes a catalytic subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase. The mRNA is cell-to-cell mobile. |
AT5G03300 | Encodes adenosine kinase 2 (ADK2), a typical, constitutively expressed housekeeping enzyme. Shows a high sequence identity with ADK1. Involved in salvage synthesis of adenylates and methyl recycling. Enzyme activity is substantially inhibited in roots, siliques and dry seeds by an unknown compound. May contribute to cytokinin interconversion. The mRNA is cell-to-cell mobile. |
AT5G03320 | Protein kinase superfamily protein;(source:Araport11) |
AT5G03330 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT5G03377 | pseudogene of acylphosphatase family protein |
AT5G03415 | Encodes a homolog of the animal DP protein. DP, in animals, forms a heterodimer with E2F and plays a central role in G1/S transition in the cell division cycle. DPB has been shown to interact with non phosphorylated E2Fc; when E2Fc is phosphorylated, the formation of the E2Fc/DPB heterodimer is lost. |
AT5G03435 | Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11) |
AT5G03450 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G03455 | Encodes a homolog of yeast cell cycle regulator CDC25. It has a sole catalytic domain and devoid of the N-terminal regulatory region found in the human CDC25 and is capable of reducing the mitotic cell length of transformed fission yeast. Non-plant CDC25 proteins have been shown to do this. However, the gene is more or less constant, regardless of whether the tissue examined contained proliferative cells. Also described as having arsenate reductase activity involved in arsenate resistance. |
AT5G03480 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G03495 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G03510 | C2H2-type zinc finger family protein;(source:Araport11) |
AT5G03520 | GTPase that colocalizes with golgi and plasma membranes. |
AT5G03530 | Encodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. CFP:RabC2a appears to co-localize with peroxisomes. |
AT5G03545 | Expressed in roots in response to phosphate starvation, this response is enhanced by the presence of IAA. Additionally, its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. The mRNA is cell-to-cell mobile. |
AT5G03550 | MATH domain/coiled-coil protein;(source:Araport11) |
AT5G03552 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGCGGGAAGCAUUUGCACAUG |
AT5G03580 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G03620 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
AT5G03650 | Encodes starch branching enzyme (E.C.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout the plant and highest in seedlings and cauline leaves. |
AT5G03668 | Natural antisense transcript overlaps with AT5G03670;(source:Araport11) |
AT5G03670 | histone-lysine N-methyltransferase SETD1B-like protein;(source:Araport11) |
AT5G03680 | Recessive mutations are defective in organ initiation and orientation in the second whorl. This gene encodes a trihelix transcription factor whose expression is limited to margins of floral and vegetative organs. Overexpression and double mutant analyses suggest that this gene is involved in limiting lateral growth of organs. |
AT5G03710 | replication factor C large subunit;(source:Araport11) |
AT5G03720 | Member of Heat Stress Transcription Factor (Hsf) family. Expression is regulated by DREB2A and in turn HSFA3 regulates the expression of hsps Hsp18.1-CI and Hsp26.5-MII35S. Involved in establishing thermotolerence. |
AT5G03740 | HD2-type histone deacetylase HDAC. Involved in the ABA and stress responses. Mediates transcriptional repression via histone modification. |
AT5G03745 | pre-tRNA tRNA-Leu (anticodon: TAA);(source:Araport11, TAIR10) |
AT5G03750 | E3 ubiquitin-protein ligase;(source:Araport11) |
AT5G03760 | encodes a beta-mannan synthase that is required for agrobacterium-mediated plant genetic transformation involves a complex interaction between the bacterium and the host plant. 3' UTR is involved in transcriptional regulation and the gene is expressed in the elongation zone of the root. |
AT5G03770 | Encodes a putative KDO (3-deoxy-D-manno-octulosonate) transferase |
AT5G03790 | Encodes a homeodomain leucine zipper class I (HD-Zip I) meristem identity regulator that acts together with LFY to induce CAL expression. It binds to the CAL promoter proximal CAATNATTG element. LMI1 acts primarily downstream of LFY in meristem identity regulation. The interaction between LFY, LMI1 and CAL resembles a feed-forward loop transcriptional network motif. The gene also had additional LFY-independent roles in leaf morphogenesis and bract formation. |
AT5G03795 | Exostosin family protein;(source:Araport11) |
AT5G03810 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G03820 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G03858 | Pseudogene of AT5G03960; IQD12 (IQ-domain 12); calmodulin binding protein |
AT5G03880 | Thioredoxin family protein;(source:Araport11) |
AT5G03890 | PADRE protein up-regulated after infection by S. sclerotiorum. |
AT5G03930 | F-box protein;(source:Araport11) |
AT5G03960 | Member of IQ67 (CaM binding) domain containing family. |
AT5G03980 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
AT5G03990 | FK506-binding-like protein;(source:Araport11) |
AT5G04000 | hypothetical protein;(source:Araport11) |
AT5G04010 | F-box family protein;(source:Araport11) |
AT5G04030 | transmembrane protein;(source:Araport11) |
AT5G04050 | Essential maturase splicing factor required for splicing of nad1 introns 1, 3 and 4, holo‐complex I biogenesis, and embryo development. |
AT5G04080 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
AT5G04140 | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation. The mRNA is cell-to-cell mobile. |
AT5G04150 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. |
AT5G04170 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT5G04200 | Encodes a putative metacaspase. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
AT5G04230 | Member of Phenylalanine ammonialyase (PAL) gene family. Differs significantly from PAL1 and PAL2 and other sequenced plant PAL genes. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
AT5G04250 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT5G04267 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G04275 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AGAAUCUUGAUGAUGCUGCAU. Pri-mRNA coordinates for MIR172b (converted to TAIR10 based on PMID19304749): Chr5: 1188916-1187500 (reverse), length: 1417 bp; exon coordinates: exon 1: 1188916 to 1188742, exon 2: 1188623 to 1188583, exon 3: 1188383 to 1188133, exon 4: 1187852 to 1187500; mature miRNA and miRNA* are located on exon 3. |
AT5G04310 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G04340 | Encodes a C2H2 zinc finger transcription factor that coordinately activates phytochelatin-synthesis related gene expression and directly targets GSH1 by binding to its promoter to positively regulate Cd accumulation and tolerance. |
AT5G04347 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT5G04400 | NAC domain protein;(source:Araport11) |
AT5G04460 | RING/U-box superfamily protein;(source:Araport11) |
AT5G04470 | Encodes a novel nuclear 14-kD protein containing a cyclin binding motif and a motif found in ICK/KRP cell cycle inhibitor proteins. It is required for coordinating cell division and cell differentiation during the development of Arabidopsis trichomes, playing a key role in the mitosis-to-endoreduplication transition. It interacts with D-type cyclins in vivo. |
AT5G04490 | Encodes a protein with phytol kinase activity involved in tocopherol biosynthesis. |
AT5G04510 | Encodes 3-phosphoinositide-dependent protein kinase that contains pleckstrin homology domain and binds 3-phosphoinositides. It activates the protein kinase AGC2-1 in a phosphatidic acid dependent manner. Phosphorylates S6K1. Interacts with PID, and transphosphorylation by PDK1 increases PID autophosphorylation. The mRNA is cell-to-cell mobile. |
AT5G04530 | Encodes KCS19, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT5G04550 | type-1 restriction enzyme mjaxp r protein (DUF668);(source:Araport11) |
AT5G04590 | A.thaliana gene encoding sulfite reductase. |
AT5G04670 | Polycomb related protein that is part of a protein complex involved in histone deacetylation and heterochromatin silencing. |
AT5G04680 | Ankyrin repeat family protein;(source:Araport11) |
AT5G04690 | Ankyrin repeat family protein;(source:Araport11) |
AT5G04700 | Ankyrin repeat family protein;(source:Araport11) |
AT5G04720 | Encodes a member of the ADR1 family nucleotide-binding leucine-rich repeat (NB-LRR) immune receptors. The mRNA is cell-to-cell mobile. |
AT5G04730 | Ankyrin-repeat containing protein;(source:Araport11) |
AT5G04780 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G04810 | Pentatricopeptide which is essential during the early stages of embryo development and acts in the plastid nucleoids as the factor responsible of rps12 intron 1 trans-splicing and, indirectly, in the assembly of 70S ribosomes and plastid translation. |
AT5G04820 | ovate family protein 13;(source:Araport11) |
AT5G04830 | Nuclear transport factor 2 (NTF2) family protein;(source:Araport11) |
AT5G04840 | bZIP protein;(source:Araport11) |
AT5G04870 | A calcium-dependent protein kinase that can phosphorylate phenylalanine ammonia lyase (PAL), a key enzyme in pathogen defense.Phosphorylates, in vivo, the transcription factor ORE1, a master regulator of senescence. |
AT5G04885 | Encodes a beta-glucosidase involved in xyloglucan metabolism. |
AT5G04890 | Specifically restricts the long-distance movement of tobacco etch potyvirus (TEV) without involving either hypersensitive cell death or systemic acquired resistance. Multidomain protein containing an N-terminal region with high similarity to plant small heat shock proteins (HSPs). |
AT5G04895 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT5G04910 | DNA repair REX1-B protein;(source:Araport11) |
AT5G04930 | Encodes a putative aminophospholipid translocase (p-type ATPase) involved in chilling response. It is targeted to the plasma membrane following association in the endoplasmic reticulum with an ALIS protein beta-subunit. The mRNA is cell-to-cell mobile. |
AT5G04940 | Encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. SUVH1 has been shown to have a preference for binding methylated DNA. |
AT5G04970 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT5G04980 | DNAse I-like superfamily protein;(source:Araport11) |
AT5G05020 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT5G05025 | Encodes a Pollen Ole e I allergen and extensin family protein [pseudogene] |
AT5G05110 | Cystatin/monellin family protein;(source:Araport11) |
AT5G05130 | DNA/RNA helicase protein;(source:Araport11) |
AT5G05140 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
AT5G05150 | autophagy-related protein 18E;(source:Araport11) |
AT5G05180 | myosin heavy chain, striated protein;(source:Araport11) |
AT5G05220 | hypothetical protein;(source:Araport11) |
AT5G05280 | Encodes a RING-finger E3 ligase protein that controls anther dehiscence by positively regulating the expression of DAD1 in the jasmonic acid biosynthesis pathway. |
AT5G05290 | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT5G05300 | IDL6 peptide is induced in response to Pathogen-Associated Molecular Patterns (PAMPs). Overexpression of IDL6 results in increased susceptibility to pathogens. |
AT5G05330 | Encodes a protein with a putative HMG-box domain. The high-mobility group (HMG) proteins are chromatin-associated proteins that act as architectural factors in various nucleoprotein structures, which regulate DNA-dependent processes such as transcription and recombination. Expression of this gene was not detected according to Grasser et al. (J. Mol. Biol. 2006:358, 654-664). |
AT5G05340 | Encodes a protein with sequence similarity to peroxidases that is involved in lignin biosynthesis. Loss of function mutations show abnormal development of xylem fibers and reduced levels of lignin biosynthetic enxymes. |
AT5G05350 | PLAC8 family protein;(source:Araport11) |
AT5G05380 | prenylated RAB acceptor 1.B3;(source:Araport11) |
AT5G05390 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
AT5G05420 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT5G05460 | Encodes a cytosolic beta-endo-N-acetyglucosaminidase (ENGase). ENGases N-glycans cleave the O-glycosidic linkage between the two GlcNAc residues of the N-glycan core structure and thus generate a protein with a single GlcNAc attached to asparagine. |
AT5G05480 | Peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase A protein;(source:Araport11) |
AT5G05550 | Encodes trihelix-domain transcription factor VFP5. Interacts with agrobacterium virulence protein VirF. |
AT5G05598 | Encodes a Defensin-like (DEFL) family protein |
AT5G05600 | Encodes a protein with similarity to flavonol synthases that is involved in the detoxifcation polycyclic aromatic hydrocarbons.One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
AT5G05640 | nucleoprotein-like protein;(source:Araport11) |
AT5G05657 | late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G05670 | signal recognition particle binding protein;(source:Araport11) |
AT5G05700 | Encodes an arginyl-tRNA:protein transferase (ATE1), a component of the N-end rule pathway that targets protein degradation through the identity of the amino-terminal residue of specific protein substrates. Arabidopsis contains two ATE genes: At5g05700/ATE1, At3g11240/ATE2. Another component of the N-end rule pathway is At5g02310/PROTEOLYSIS6 (PRT6). PRT6 and ATE were shown to regulate seed after-ripening, seedling sugar sensitivity, seedling lipid breakdown, and abscisic acid (ABA) sensitivity of germination. Mutants of ATE1 also display delayed leaf senescence and altered responses to pathogens. |
AT5G05720 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G05740 | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442?454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171?179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria. |
AT5G05760 | A SNARE protein (ortholog of syntaxin 5), a membrane fusion machine component involved in cytokinesis |
AT5G05780 | Encodes a putative 26S proteasome subunit RPN8a. The function of RPN8a and other 26S subunits may be required for specifying leaf adaxial identity. The mRNA is cell-to-cell mobile. |
AT5G05790 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
AT5G05810 | RING/U-box superfamily protein;(source:Araport11) |
AT5G05820 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT5G05840 | replication factor C subunit, putative (DUF620);(source:Araport11) |
AT5G05850 | Encodes PIRL1, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen. |
AT5G05870 | UDP-glucosyl transferase 76C1;(source:Araport11) |
AT5G05880 | Encodes a nicotinate-N-glycosyltransferase. |
AT5G05890 | Encodes a nicotinate-N-glycosyltransferase. |
AT5G05910 | RING/U-box superfamily protein;(source:Araport11) |
AT5G05940 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT5G05980 | Encodes one of the three folylpolyglutamate synthetase isoforms (FPGSs): FPGS1 (At5g05980, plastidic), FPGS2 (At3g10160, mitochondrial) and FPGS3 (At3g55630, cytosolic). |
AT5G06010 | hypothetical protein;(source:Araport11) |
AT5G06070 | Isolated as a mutation defective in petal development with specific effects on adaxial petals which are filamentous or absent. Encodes a Superman (SUP) like protein with zinc finger motifs. Transcript is detected in petal primordia and protein is localized to the nucleus. |
AT5G06090 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
AT5G06100 | Encodes a member of the myb family of transcription factors (MYB33), contains Pfam profile: PF00249 myb DNA-binding domain. Double mutants with MYB65 are male sterile- anthers are small, pollen development is defective. Spatial expression appears to be under the control of miR159, contains a target site for this micro RNA. A highly conserved RNA secondary structure abuts the miR159 binding site which facilitates its regulation by miR159. When the target site is mutated, expression is detected in leaves, roots, anther filament, pistil. The expression of a translational fusion is specific to anther locules in contrast to constructs lacking the miR159 target site. Phenotype is conditional and can be restored by lower temperature or higher light intensity. |
AT5G06130 | Encodes an OR(orange)-like protein that interacts directly with the PSY (phytoene synthase) protein and acts as a positive posttranscriptional regulator of its expression, thereby affecting carotenoid biosynthesis. |
AT5G06150 | Encodes a cyclin whose expression is reduced in response to high salt. |
AT5G06170 | sucrose symporter with hight affinity for sucrose (K0.5=0.066 +/- 0.025mM), that can also transport a wide range of glucosides. |
AT5G06220 | LETM1-like protein;(source:Araport11) |
AT5G06230 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT5G06250 | Transcription repressor involved in regulation of inflorescence architecture. |
AT5G06265 | hyaluronan mediated motility receptor-like protein;(source:Araport11) |
AT5G06270 | One of two plant specific paralogs of unknown function. Interacts with GL2. GIR1/GIR2 loss of function resembles gl2 lof mutations |
AT5G06278 | pseudogene of abscisic acid-responsive HVA22 family protein |
AT5G06290 | Encodes a 2-Cys peroxiredoxin (2-Cys PrxB) that contains two catalytic Cys residues. The mRNA is cell-to-cell mobile. |
AT5G06310 | Encodes AtPOT1b. Note on nomenclature: different names have been given to Arabidopsis POT-like genes (Kuchar and Fajkus, 2004; Shakirov et al, 2005; Tani and Murata, 2005). According to a unifying nomenclature (Surovtseva et al, 2007), At2g05210 (previously named AtPOT1) is designated AtPOT1a, while At5g06310 (previously named AtPOT2) is designated AtPOT1b. |
AT5G06320 | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus, spermine and Pseudomonas syringae pv. tomato DC3000. The gene product is localized to the plasma membrane. |
AT5G06330 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT5G06350 | ARM repeat superfamily protein;(source:Araport11) |
AT5G06390 | FASCICLIN-like arabinogalactan protein 17 precursor;(source:Araport11) |
AT5G06440 | polyketide cyclase/dehydrase/lipid transport superfamily protein;(source:Araport11) |
AT5G06470 | Glutaredoxin family protein;(source:Araport11) |
AT5G06510 | nuclear factor Y, subunit A10;(source:Araport11) |
AT5G06570 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G06610 | DUF620 domain protein. In xylem cells BRD1 is expressed in the secondary wall pit boundaries. BRD1 interacts with and appears to be necessary to recruit WALLIN to the plasma membrane. |
AT5G06620 | SET domain protein 38;(source:Araport11) |
AT5G06710 | Homeobox-leucine zipper protein. |
AT5G06720 | Encodes a peroxidase with diverse roles in the wound response, flower development, and syncytium formation. |
AT5G06730 | Peroxidase superfamily protein;(source:Araport11) |
AT5G06740 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT5G06790 | cotton fiber protein;(source:Araport11) |
AT5G06800 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
AT5G06850 | Encodes an endoplasmic reticulum protein that is involved in the transport of the florigen FT from companion cells to sieve elements, thus affecting FT transport through the phloem to the SAM. |
AT5G06920 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
AT5G06960 | Encodes a basic leucine zipper (B-ZIP) containing protein that interacts with NPR1 to promote expression of salicylic acid induced genes. Binds the ocs-element. |
AT5G06970 | PATROL1 is a Munc13-like protein involved in mediating H[+]-ATPase translocation. It interacts with AHA1and is responsible for its translocation during stomatal movement. |
AT5G07010 | Encodes a sulfotransferase that acts specifically on 11- and 12-hydroxyjasmonic acid. Transcript levels for this enzyme are increased by treatments with jasmonic acid (JA), 12-hydroxyJA, JA-isoleucine, and 12-oxyphytodienoic acid (a JA precursor). |
AT5G07030 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT5G07080 | Encodes enzymes that can efficiently convert putrescine and caffeoyl-CoA to di-caffeoyl putrescine. Can convert spermidine/spermine and feruloyl CoA to mono-feruloyl spermidine/spermine. Has a preference for feruloyl-CoA binding, but little acyl-acceptor specificity. |
AT5G07090 | Ribosomal protein S4 (RPS4A) family protein;(source:Araport11) |
AT5G07100 | Encodes WRKY DNA-binding protein 26 (WRKY26). |
AT5G07140 | Protein kinase superfamily protein;(source:Araport11) |
AT5G07160 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
AT5G07170 | TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of Aurora kinase activity. |
AT5G07180 | Encodes a receptor-like kinase that, together with ER and ERL1 governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. It is also important for maintaining stomatal stem cell activity and preventing terminal differentiation of the meristemoid into the guard mother cell. When heterozygous in an er/erl1 null background, plants are female sterile due to cell division defect in the integuments. |
AT5G07215 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.9e-34 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G07280 | Encodes EMS1 (EXCESS MICROSPOROCYTES1), a putative leucine-rich repeat receptor protein kinase that controls somatic and reproductive cell fates in Arabidopsis anther. |
AT5G07290 | AML4 A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML4 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM14. AML4 is expressed during embryo development (heart and torpedo stage) and in vegetative and floral apices. |
AT5G07300 | Encodes a copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. |
AT5G07310 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Cytokinin production induced by jasmonate represses adventitious rooting. |
AT5G07322 | other_RNA;(source:Araport11) |
AT5G07360 | Amidase family protein;(source:Araport11) |
AT5G07390 | respiratory burst oxidase homolog A;(source:Araport11) |
AT5G07450 | cyclin p4;(source:Araport11) |
AT5G07480 | KAR-UP oxidoreductase 1;(source:Araport11) |
AT5G07540 | encodes a glycine-rich protein that is expressed only in flowers during a specific developmental stage (flower stages 11 and 12). |
AT5G07550 | member of Oleosin-like protein family |
AT5G07600 | Oleosin family protein;(source:Araport11) |
AT5G07610 | F-box family protein;(source:Araport11) |
AT5G07620 | Protein kinase superfamily protein;(source:Araport11) |
AT5G07640 | RING/U-box superfamily protein;(source:Araport11) |
AT5G07650 | Actin-binding FH2 protein;(source:Araport11) |
AT5G07660 | Encodes SMC6A (STRUCTURAL MAINTENANCE OF CHROMOSOMES 6A), a component of the SMC5/6 complex. SMC5/6 complex promotes sister chromatid alignment and homologous recombination after DNA damage. |
AT5G07690 | Encodes a putative transcription factor (MYB29) that acts as a negative regulator of mitochondrial stress responses. |
AT5G07700 | Encodes a putative transcription factor (MYB76). |
AT5G07710 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT5G07740 | actin binding protein;(source:Araport11) |
AT5G07760 | formin homology 2 domain-containing protein / FH2 domain-containing protein;(source:Araport11) |
AT5G07790 | hypothetical protein;(source:Araport11) |
AT5G07800 | Flavin-binding monooxygenase family protein;(source:Araport11) |
AT5G07810 | SNF2 domain-containing protein / helicase domain-containing protein / HNH endonuclease domain-containing protein;(source:Araport11) |
AT5G07820 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
AT5G07830 | Belongs to the plant glycoside hydrolase family 79. Encodes a protein with several posttranslational modification sites including O-β-GlcNAc attachment sites and serine-, threonine- and tyrosine-phosphorylation sites, suggesting that this protein is extensively modified posttranslationally. The protein is predicted (WoLF PSORT program) to be membrane-associated. It is involved in cell elongation. The mRNA is cell-to-cell mobile. |
AT5G07840 | Ankyrin repeat family protein;(source:Araport11) |
AT5G07850 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT5G07910 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT5G07920 | Encodes a putative diacylglycerol kinase that is mainly expressed in roots, shoots and leaves, but its enzyme product was not active in vitro. |
AT5G08000 | Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and binds callose. |
AT5G08010 | hypothetical protein;(source:Araport11) |
AT5G08090 | transmembrane protein;(source:Araport11) |
AT5G08110 | Plays a role in the maintenance of genome stability and the repair of aberrant replication intermediates in the root meristem. Is involved with RAD1, FAN1, and RECQ4A in the repair of DNA CLs. |
AT5G08141 | Part of complex with ENO2 which mediates secondary metabolism, affecting seed size and weight. |
AT5G08150 | Encodes SOB5. Activation tagging lines accumulated higher level of cytokinin. |
AT5G08160 | Encodes a serine/threonine protein kinase. |
AT5G08230 | HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. |
AT5G08250 | Cytochrome P450 superfamily protein;(source:Araport11) |
AT5G08270 | C5orf35;(source:Araport11) |
AT5G08305 | E+-type pentatricopeptide repeat protein involved in C to U editing in mitochondria and chloroplasts. |
AT5G08335 | Encodes an isoprenyl cysteine methylatransferase (ICMT) involved in the post-translational processing of proteins that have a C-terminal CaaX box. This protein appears to have higher catalytic activity and a higher transcript expression level than the other ICMT present in Arabidopsis (At5g23320). Analysis of ICMT RNAi lines suggests that this protein is involved in flower and stem development. |
AT5G08360 | Stu1, putative (DUF789);(source:Araport11) |
AT5G08370 | Member of Glycoside Hydrolase Family 27 (GH27)that functions as an α-galactosidase. |
AT5G08400 | structural maintenance of chromosomes-like protein, putative (DUF3531);(source:Araport11) |
AT5G08450 | Component of histone-deacetylase complexes. Interacts with HDA6 and HDA19 and facilitates histone deacetylation. Several salt-inducible genes are de-repressed in hdc1 mutants. Mutants are hypersensitive to ABA during germination, grow less and flower later than wildtype. HDC1-overexpressing plants display opposite phenotypes. |
AT5G08540 | ribosomal RNA small subunit methyltransferase J;(source:Araport11) |
AT5G08560 | WRDR26 is a WD-40 repeat containing protein initially identified as an interacting partner RanBPM. Its expression is induced by abiotic stress as well as various plant growth regulators including IAA, ABA and ethylene. Role as a novel modulator of redox homeostatis, responding to developmental and stress signals to regulate leaf senescence. |
AT5G08630 | DDT domain-containing protein;(source:Araport11) |
AT5G08640 | Encodes a flavonol synthase that catalyzes formation of flavonols from dihydroflavonols. Co-expressed with CHI and CHS (qRT-PCR). |
AT5G08710 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT5G08717 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC |
AT5G08730 | IBR domain-containing protein;(source:Araport11) |
AT5G08750 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT5G09220 | member of AAAP family The mRNA is cell-to-cell mobile. |
AT5G09270 | transmembrane protein;(source:Araport11) |
AT5G09280 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G09300 | Thiamin diphosphate-binding fold (THDP-binding) superfamily protein;(source:Araport11) |
AT5G09320 | vacuolar protein sorting-associated 9A-like protein;(source:Araport11) |
AT5G09420 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT5G09430 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G09450 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G09460 | transcription factor bHLH143;(source:Araport11) |
AT5G09550 | GDP dissociation inhibitor family protein / Rab GTPase activator family protein;(source:Araport11) |
AT5G09560 | RNA-binding KH domain-containing protein;(source:Araport11) |
AT5G09570 | Twin CX9C domain protein. Induced by low phosphate or iron, drought and heat stress. Loss of both At12cys-1 and At12cys-2 lead to enhanced tolerance to drought and light stress and increased anti-oxidant capacity. |
AT5G09610 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT5G09680 | Encodes RLF (Reduced Lateral root Formation). Involved in lateral root formation. Contains a cytochrome b5-like heme/steroid binding domain. Localized in the cytosol. |
AT5G09740 | Encodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2. |
AT5G09770 | Ribosomal protein L17 family protein;(source:Araport11) |
AT5G09790 | Encodes a SET-domain protein, a H3K27 monomethyltransferases required for chromatin structure and gene silencing. Regulates heterochromatic DNA replication. Contains a PCNA-binding domain. ATXR5 accumulates preferentially during the late G1 or S phase, suggesting that it plays a role in cell-cycle regulation or progression. A plant line expressing an RNAi construct directed against this gene has reduced agrobacterium-mediated tumor formation. |
AT5G09800 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G09805 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
AT5G09820 | Encodes fibrillin 5 (FBN5). Located in chloroplast stroma. Essential for plastoquinone-9 biosynthesis. Stimulates enzymatic activity of solanesyl diphosphate synthases (SPS) 1 and 2 through binding to solanesyl moiety. Two splicing variants, named FBN5-A shorter one and FBN5-B longer one. FBN5-B is the protein detected in chloroplast stroma. Involved in plastoquinone biosynthesis. |
AT5G09830 | Encodes a cytosolic BolA protein. Plays a repressive role in the tolerance against excess iron and methyl viologen-induced oxidative stress. |
AT5G09850 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
AT5G09870 | Encodes a cellulose synthase CESA5 that produces seed mucilage cellulose.Mutants are defective in seed coat mucilage.Involved in the regulation of mucilage composition and/or mucilage synthesis. |
AT5G09900 | Encodes one of two isoforms for the 26S proteasome regulatory protein (RN) subunit RPN5. For many functions it acts redundantly with the paralogous gene RPN5b but also appears to exert independent effects. |
AT5G09930 | ABCF2 is one of five members of the ABCF gene family in Arabidopsis, which are homologs of the yeast ABCF protein, GCN20. |
AT5G09940 | hypothetical protein (DUF1635);(source:Araport11) |
AT5G09960 | sorbin/SH3 domain protein;(source:Araport11) |
AT5G09990 | elicitor peptide 5 precursor;(source:Araport11) |
AT5G09995 | transmembrane protein;(source:Araport11) |
AT5G10080 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT5G10090 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT5G10100 | Trehalose-6-phosphate phosphatase which enhances drought tolerance by regulating stomatal apertures. |
AT5G10110 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
AT5G10160 | Thioesterase superfamily protein;(source:Araport11) |
AT5G10180 | Encodes a low-affinity sulfate transporter expressed in the root cap and central cylinder, where it is induced by sulfur starvation. Expression in the shoot vascular system is not induced by sulfur starvation. |
AT5G10210 | nitric oxide synthase-interacting protein;(source:Araport11) |
AT5G10230 | Encodes a calcium-binding protein annexin (AnnAt7). |
AT5G10240 | Encodes asparagine synthetase (ASN3). |
AT5G10260 | RAB GTPase homolog H1E;(source:Araport11) |
AT5G10270 | Encodes CDKC;1, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. |
AT5G10310 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
AT5G10380 | Encodes a RING finger domain protein with E3 ligase activity that is localized to the lipid rafts of the plasma membrane. Expression is increased in response to fungal pathogen. May be involved in regulation of programmed cell death by facilitating degredation of regulation of PDC activators. The mRNA is cell-to-cell mobile. |
AT5G10470 | Kinesin that binds cyclin-dependent kinase CDKA;1 as homodimer or as heterodimer with KCA2. Demarcates the division site in plant cells. |
AT5G10500 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
AT5G10510 | Encodes an AP2-domain transcription factor involved in root stem cell identity and root development. It is also required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions. Intronic sequences are required for its expression in flowers.Acts redundantly with PLT5 and 7 in lateral root pattern formation. |
AT5G10520 | ROP binding protein kinases 1;(source:Araport11) |
AT5G10540 | Zincin-like metalloproteases family protein;(source:Araport11) |
AT5G10580 | plant/protein (Protein of unknown function, DUF599);(source:Araport11) |
AT5G10620 | methyltransferase;(source:Araport11) |
AT5G10660 | calmodulin-binding protein-like protein;(source:Araport11) |
AT5G10690 | pentatricopeptide (PPR) repeat-containing protein / CBS domain-containing protein;(source:Araport11) |
AT5G10720 | member of Histidine Kinase |
AT5G10730 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G10750 | enhanced disease resistance-like protein (DUF1336);(source:Araport11) |
AT5G10760 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT5G10770 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT5G10820 | Major facilitator superfamily protein;(source:Araport11) |
AT5G10930 | Encodes CBL-interacting protein kinase 5 (CIPK5). |
AT5G10946 | hypothetical protein;(source:Araport11) |
AT5G10950 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
AT5G10970 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
AT5G11000 | hypothetical protein (DUF868);(source:Araport11) |
AT5G11010 | Nuclear-localizing protein. |
AT5G11020 | Protein kinase superfamily protein;(source:Araport11) |
AT5G11050 | Member of R2R3-MYB transcription factor gene family. |
AT5G11060 | A member of Class II KN1-like homeodomain transcription factors (together with KNAT3 and KNAT5), with greatest homology to the maize knox1 homeobox protein. Expression regulated by light. Detected in all tissues examined, but most prominent in leaves and young siliques. Transient expression of GFP translational fusion protein suggests bipartite localization in nucleus and cytoplasm. KNAT4 promoter activity showed cell-type specific pattern along longitudinal root axis; GUS expression pattern started at the elongation zone, predominantly in the phloem and pericycle cells, extending to endodermis toward the base of the root. |
AT5G11070 | hypothetical protein;(source:Araport11) |
AT5G11100 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT5G11110 | Encodes a sucrose-phosphate synthase involved in pollen exine formation. This is the dominant SPS isoform in leaves with respect to protein levels. |
AT5G11140 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
AT5G11160 | adenine phosphoribosyltransferase 5;(source:Araport11) |
AT5G11190 | Encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT5G11242 | pseudogene of ribosomal protein |
AT5G11250 | Encodes an atypical TIR-NBS-LRR protein that is involved in stress responses. Loss of function alleles overproduce stress hormones JA,SA, ABA, and ET. |
AT5G11290 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT5G11310 | The SOAR1 gene encodes a pentatricopeptide repeat (PPR) protein which localizes to both the cytosol and nucleus. Down-regulation of SOAR1 strongly enhances, but up-regulation of SOAR1 almost completely impairs, ABA responses, revealing that SOAR1 is a critical, negative, regulator of ABA signalling. Further genetic evidence supports that SOAR1 functions downstream of ABAR and probably upstream of an ABA-responsive transcription factor ABI5. Changes in the SOAR1 expression alter expression of a subset of ABA-responsive genes including ABI5. These findings provide important information to elucidate further the functional mechanism of PPR proteins and the complicated ABA signalling network. |
AT5G11320 | Belongs to the YUC gene family. Encodes a predicted flavin monooxygenase. YUC4 is part of a pathway linking auxin biosynthesis and gynoecium development. It is expressed in the stigma and the apical meristem and is ethylene inducible. |
AT5G11325 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
AT5G11350 | Deadenylase. |
AT5G11360 | Interleukin-1 receptor-associated kinase 4 protein;(source:Araport11) |
AT5G11440 | Interacts with PAB (poly A binding protein) in yeast two hybrid experiments. Contains PAM2 motif, a PABC interacting domain. |
AT5G11460 | FCS like zinc finger 10 is induced during energy starvation through SnRK1 signaling. Mutants accumulate more SnRK1alpha1 which results in the inhibition of seedling growth under favorable growth conditions. Increased SnRK1 activity in the mutant also results in the downregulation of TOR signaling (DOI:10.1111/tpj.13854). |
AT5G11470 | SG1 is a Bromo-Adjacent Homology (BAH) domain containing protein involved in CHG methylation within genebodies. Loss of function results in pleiotrophic developmental effects that increase after 4 generations. |
AT5G11500 | coiled-coil protein;(source:Araport11) |
AT5G11530 | Involved in regulating reproductive development |
AT5G11540 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
AT5G11650 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G11660 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT5G11670 | The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME2 is presumably a cytosolic enzyme involved in malate metabolism and possibly assisting the oxidative pentose phosphate pathway. AtNADP-ME2 counts for the major part of NADP-ME activity in mature tissues of Arabidopsis. |
AT5G11730 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT5G11790 | Plays a role in dehydration stress response. |
AT5G11820 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT5G11830 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT5G11840 | YCF36, putative (DUF1230);(source:Araport11) |
AT5G11880 | Meso-diaminopimelate decarboxylase which catalyzes the decarboxylation of mesodiaminopimelate, the final reaction in the diaminopimelate L-lysine biosynthetic pathway. |
AT5G11900 | Translation initiation factor SUI1 family protein;(source:Araport11) |
AT5G11920 | Encodes a protein with fructan exohydrolase (FEH) activity acting on both inulin and levan-type fructans (1- and 6-FEH). The enzyme does not have invertase activity. |
AT5G11940 | Subtilase family protein;(source:Araport11) |
AT5G11990 | proline-rich family protein;(source:Araport11) |
AT5G12010 | nuclease;(source:Araport11) |
AT5G12050 | rho GTPase-activating protein;(source:Araport11) |
AT5G12060 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT5G12140 | Encodes a cystatin. |
AT5G12180 | member of Calcium Dependent Protein Kinase |
AT5G12235 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. |
AT5G12250 | Encodes a beta-tubulin. Expression of TUB6 has been shown to decrease in response to cold treatment. |
AT5G12260 | transferring glycosyl group transferase;(source:Araport11) |
AT5G12270 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT5G12280 | SWAP (Suppressor-of-White-APricot)/surp RNA-binding domain-containing protein;(source:Araport11) |
AT5G12290 | Encodes a mitochondrial outer membrane protein that is found in a complex with MIC60, TOM40, RISP and TOM20. Involved in galactoglycerolipid biosynthesis/lipid homeostasis. The dgd1 mutant phenotype is suppressed in the dgs1 mutant background. |
AT5G12300 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT5G12400 | PHD-finger and DNA binding domain-containing protein;(source:Araport11) |
AT5G12420 | WSD7 can function in vitro as wax ester synthase but does not appear to be essential for cuticular wax biosynthesis. |
AT5G12430 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT5G12860 | AtpOMT1 encodes dicarboxylate transporter functions both as as an oxaloacetate/malate transporter and as a 2-oxoglutarate/malate transporter. |
AT5G12870 | Encodes MYB46, member of the R2R3 factor gene family. Modulates Disease Susceptibility to Botrytis cinerea. |
AT5G12880 | proline-rich family protein;(source:Araport11) |
AT5G12900 | DNA double-strand break repair RAD50 ATPase;(source:Araport11) |
AT5G12920 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G12940 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT5G12970 | Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein;(source:Araport11) |
AT5G12990 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT5G13070 | MSF1-like family protein;(source:Araport11) |
AT5G13100 | Gap junction beta-4 protein;(source:Araport11) |
AT5G13130 | Member of the microrchidia protein family which have been described as epigenetic regulators and plant immune mediators, contains a hallmark GHKL-type ATPase domain in N-terminus. Possible role in the development of reproductive tissues. |
AT5G13140 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT5G13170 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
AT5G13180 | Encodes a NAC domain transcription factor that interacts with VND7 and negatively regulates xylem vessel formation. |
AT5G13181 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G13190 | Encodes a plasma membrane localized LITAF domain protein that interacts with LSD1 and acts as a negative regulation of hypersensitive cell death. |
AT5G13210 | Uncharacterized conserved protein UCP015417, vWA;(source:Araport11) |
AT5G13230 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G13240 | Global repressor of RNA polymerase III (Pol III). Maf1 repressor activity is critical for plant survival during environmental stresses, and is regulated by its phosphorylation/dephosphorylation through the activity of TOR and PP4/PP2A phosphatases. |
AT5G13250 | RING finger protein;(source:Araport11) |
AT5G13260 | myosin;(source:Araport11) |
AT5G13300 | Belongs to 15-member small GTPase gene family, ARF-GAP domain proteins (AGD); corresponds to AGD3, and is one of four proteins belonging to class 1, together with AGD1, AGD2 and AGD4. The protein contains four domains: BAR domain, PH domain, an ARF-GAP domain, and two Ankyrin repeats. In sfc mutants, the secondary and tertiary veins of cotyledons, leaves, sepals and petals are largely replaced by small segments of discontinuous veins. sfc mutants have exaggerated responses to auxin. |
AT5G13350 | Auxin-responsive GH3 family protein;(source:Araport11) |
AT5G13380 | Auxin-responsive GH3 family protein;(source:Araport11) |
AT5G13390 | Required for normal pollen development and lipid accumulation within the tapetum |
AT5G13420 | Transaldolase which contributes to reactive oxygen species homeostasis in response to Glc during early seedling growth. |
AT5G13460 | Member of IQ67 (CaM binding) domain containing family. |
AT5G13548 | Pseudogene of AT3G12600; ATNUDT16 (Arabidopsis thaliana Nudix hydrolase homolog 16); hydrolase |
AT5G13550 | Encodes a sulfate transporter. |
AT5G13590 | hypothetical protein;(source:Araport11) |
AT5G13610 | Encodes a mitochondria-localized protein involved in ABI4-mediated mitochondrial retrograde signalling. |
AT5G13640 | arabidopsis phospholipid:diacylglycerol acyltransferase (PDAT) |
AT5G13670 | nodulin MtN21-like transporter family protein |
AT5G13680 | A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1?ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. Mutants have no ncm5U (5-carbamoylmethyluridine). |
AT5G13700 | Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants). |
AT5G13730 | Encodes sigma 4 factor, involved in regulating the activity of the plastid-encoded RNA polymerase PEP. Regulates the overall quantity of NDH complexes and thus influences NDH activity. |
AT5G13810 | Glutaredoxin family protein;(source:Araport11) |
AT5G13850 | nascent polypeptide-associated complex subunit alpha-like protein 3;(source:Araport11) |
AT5G13860 | ELCH-like protein;(source:Araport11) |
AT5G13930 | Encodes chalcone synthase (CHS), a key enzyme involved in the biosynthesis of flavonoids. Required for the accumulation of purple anthocyanins in leaves and stems. Also involved in the regulation of auxin transport and the modulation of root gravitropism. The mRNA is cell-to-cell mobile. |
AT5G13940 | aminopeptidase;(source:Araport11) |
AT5G14000 | NAC domain containing protein 84;(source:Araport11) |
AT5G14010 | Encodes KNUCKLES (KNU), a C2H2-type zinc finger protein with a conserved transcriptional repression motif. Mediates the repression of WUS in floral meristem determinacy control. |
AT5G14020 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
AT5G14060 | lysine-sensitive aspartate kinase |
AT5G14070 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. ROXY2, together with ROXY1 (AT3G02000), controls anther development. roxy1 roxy2 double mutants are sterile and do not produce pollen. |
AT5G14090 | LAZY1 is required for gravitropic response. Mutants have abnormal shoot angles and abnormal root gravitropism. LZY1 affects the redistribution of auxin in response to gravity in shoots and roots via an unknown mechanism. |
AT5G14110 | peroxidase (DUF 3339);(source:Araport11) |
AT5G14130 | Peroxidase superfamily protein;(source:Araport11) |
AT5G14180 | Myzus persicae-induced lipase 1;(source:Araport11) |
AT5G14210 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G14280 | DNA-binding storekeeper-like protein;(source:Araport11) |
AT5G14300 | prohibitin 5;(source:Araport11) |
AT5G14340 | Member of the R2R3 factor gene family. |
AT5G14360 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT5G14370 | CCT motif family protein;(source:Araport11) |
AT5G14440 | Surfeit locus protein 2 (SURF2);(source:Araport11) |
AT5G14460 | Pseudouridine synthase family protein;(source:Araport11) |
AT5G14490 | NAC domain containing protein 85;(source:Araport11) |
AT5G14510 | Armadillo (ARM) repeat containing protein involved in vascular development. |
AT5G14520 | Encodes a nucleolar protein that plays an essential role in cell growth and survival through its regulation of ribosome biogenesis and mitotic progression. |
AT5G14560 | hypothetical protein;(source:Araport11) |
AT5G14580 | polyribonucleotide nucleotidyltransferase;(source:Araport11) |
AT5G14602 | methyltransferase-like protein;(source:Araport11) |
AT5G14640 | shaggy-like kinase 13;(source:Araport11) |
AT5G14660 | Encodes a peptide deformylase PDF1B. The crystal structure has been determined at a resolution of 0.24 nm (Biochem J, 2008, vol 413:417-427). |
AT5G14690 | transmembrane protein;(source:Araport11) |
AT5G14700 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G14710 | proteasome assembly chaperone-like protein;(source:Araport11) |
AT5G14740 | Encodes a beta carbonic anhydrase likely to be localized in the cytoplasm. Expression of its mRNA is seen in etiolated seedlings and points to a possible nonphotosynthetic role for this isoform. |
AT5G14770 | PPR repeat protein;(source:Araport11) |
AT5G14790 | ARM repeat superfamily protein;(source:Araport11) |
AT5G14850 | Encodes a putative mannosyltransferase homolog to human PIG-B and yeast GPI10, both of which are involved in the biosynthesis of glycosylphosphatidylinositol (GPI) anchors. Disruption of the gene affects COBRA-LIKE10 localization, a GPI-anchored protein (GPI-AP) important for pollen tube growth and guidance. |
AT5G14870 | Encodes a member of the cyclic nucleotide gated channel family that is asymmetrically localized to the plasma membrane at the growing tip of the pollen tube and is involved in pollen tube growth and pollen tube guidance to ovules. It likely directly transduces a cNMP signal into an ion flux that can produce a localized signal capable of regulating the pollen tip-growth machinery. Also functions as a Ca2+ permeable channel. |
AT5G14890 | potassium transporter;(source:Araport11) |
AT5G14910 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT5G14940 | Major facilitator superfamily protein;(source:Araport11) |
AT5G14980 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G14990 | WPP domain associated protein;(source:Araport11) |
AT5G14995 | Encodes a ECA1 gametogenesis related family protein |
AT5G15000 | Encodes a ECA1 gametogenesis related family protein |
AT5G15008 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G15010 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G15020 | Encodes a homolog of the transcriptional repressor SIN3 (AT1G24190). |
AT5G15022 | Natural antisense transcript overlaps with AT5G15030;(source:Araport11) |
AT5G15100 | Encodes an auxin transporter with a strong expression in a male gametophyte. Mutant studies reveal a role for auxin transport in regulating pollen development and function. It acts together with PIN5. |
AT5G15110 | Pectate lyase family protein;(source:Araport11) |
AT5G15120 | 2-aminoethanethiol dioxygenase, putative (DUF1637);(source:Araport11) |
AT5G15140 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
AT5G15150 | homeobox-containing gene with an unusual feature: a leucine zipper motif adjacent to the carboxyl-terminal of the homeodomain structure. This gene is expressed primarily in the cortex of the root and the stem. |
AT5G15200 | Ribosomal protein S4;(source:Araport11) |
AT5G15210 | Encodes ZFHD3, a member of the zinc finger homeodomain transcriptional factor family. |
AT5G15230 | Encodes gibberellin-regulated protein GASA4. Promotes GA responses and exhibits redox activity. |
AT5G15240 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT5G15250 | Encodes an FtsH protease that is localized to the chloroplast. AtFtsH6 is involved in the degradation of both Lhcb3 and Lhcb1 during senescence and high-light acclimation. |
AT5G15265 | transmembrane protein;(source:Araport11) |
AT5G15290 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT5G15310 | Member of the R2R3 factor gene family; MIXTA-like transcription factor that controls trichome maturation and cuticle formation. |
AT5G15360 | transmembrane protein;(source:Araport11) |
AT5G15380 | Encodes methyltransferase involved in the de novo DNA methylation and maintenance of asymmetric methylation of DNA sequences. |
AT5G15390 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
AT5G15400 | Single copy gene encoding a putative ubiquitin conjugating E4 factor. Contains Ub elongating factor core domain and C-terminal U-box. Involved in ubiquitination of NLRs. |
AT5G15480 | Cys2/His2 zinc finger protein involved in pollen wall development. |
AT5G15490 | Encodes one of four UDP-glucose dehydrogenase UGD) genes. Mutation of this gene in combination with UGD2 leads to swollen plant cell walls and severe developmental defects associated with changes in pectic polysaccharides. |
AT5G15510 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
AT5G15520 | Ribosomal protein S19e family protein;(source:Araport11) |
AT5G15540 | Encodes Adherin SCC2. Essential for viability. Required for normal seed development. Plays a role in the establishment of sister-chromatid cohesion and chromosome organization during meiosis. |
AT5G15560 | hypothetical protein;(source:Araport11) |
AT5G15640 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT5G15650 | RGP2 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1(at3g02230)/rgp2 double mutants have a male gametophyte lethal phenotype. RGP2 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. RGP2 was originally identified as Reversibly Glycosylated Polypeptide-2. Constitutive expression in tobacco impairs plant development and virus spread. |
AT5G15690 | zinc ion binding protein;(source:Araport11) |
AT5G15700 | Nucleus encoded plastid RNA polymerase. Localized in mitochondria and chloroplast. |
AT5G15720 | Contains lipase signature motif and GDSL domain. |
AT5G15740 | RRT1 is a member of a novel glycosyltransferase famly in plants. It functions as a rhamnosyltransferase, elongating the RG-1 backbone. It functions during seed coat mucilage development. |
AT5G15750 | Alpha-L RNA-binding motif/Ribosomal protein S4 family protein;(source:Araport11) |
AT5G15770 | Encodes a putative glucose-6-phosphate acetyltransferase that is likely involved in UDP-N-acetylglucosamine biosynthesis. A GFP:GNA1 fusion protein localizes to the endoplasmic reticulum. |
AT5G15830 | basic leucine-zipper 3;(source:Araport11) |
AT5G15850 | Homologous to the flowering-time gene CONSTANS. |
AT5G15900 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT5G15940 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G16000 | NSP-interacting kinase (NIK1), receptor-like kinase, involved in defense response against geminivirus It acts as a virulence target of the begomovirus nuclear shuttle protein (NSP). |
AT5G16010 | 3-oxo-5-alpha-steroid 4-dehydrogenase family protein;(source:Araport11) |
AT5G16020 | Encodes GEX3, a plasma membrane localized protein expressed in the male gametophyte. Required for micropylar pollen tube guidance. Also plays a role during early embryogenesis. |
AT5G16023 | Encodes a plant peptide that could be involved in the coordination of socket cell development in wild-type plants. |
AT5G16060 | Cytochrome c oxidase biogenesis protein Cmc1-like protein;(source:Araport11) |
AT5G16090 | RAD23 UV excision repair family protein;(source:Araport11) |
AT5G16100 | RWP-RK domain protein;(source:Araport11) |
AT5G16120 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G16150 | Encodes a putative plastidic glucose transporter. |
AT5G16190 | encodes a gene similar to cellulose synthase |
AT5G16220 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT5G16230 | Encodes one of two ∆9 palmitoyl-ACP desaturases responsible for the biosynthesis of ω-7 fatty acids in the maturing endosperm. |
AT5G16240 | Redundant Δ9 stearoyl-ACP desaturase gene which together with FAB2 and AAD5 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with FAB2, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase. |
AT5G16250 | transmembrane protein;(source:Araport11) |
AT5G16260 | Encodes a RNA binding protein ELF9 (EARLY FLOWERING9). Loss of ELF9 function in the Wassilewskija ecotype causes early flowering in short days. ELF9 reduces SOC1 (SUPPRESSOR OF OVEREXPRESSION OF CO1) transcript levels, possibly via nonsense-mediated mRNA decay. The mRNA is cell-to-cell mobile. |
AT5G16280 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
AT5G16350 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
AT5G16400 | Encodes an f-type thioredoxin (Trx-f2) localized in chloroplast stroma. |
AT5G16410 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT5G16450 | Ribonuclease E inhibitor RraA/Dimethylmenaquinone methyltransferase;(source:Araport11) |
AT5G16490 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). It interacts with Rop1 and is involved in pollen tube growth and function, and exocytosis in the pollen tube tip. Protein most similar to RIC2 (family subgroup V). Gene is expressed in all tissues examined.Interacts with ROP2 during pavement cell morphogenesis and with ROP1 to promote apical F-actin assembly. |
AT5G16500 | Encodes a receptor-like cytoplasmic kinase localized in the membrane of pollen tube tip regions that controls micropylar pollen tube guidance in Arabidopsis. |
AT5G16540 | Encodes a zinc finger protein. |
AT5G16550 | Lipid droplet protein associated with LDAP3. |
AT5G16560 | Encodes a KANADI protein (KAN) that regulates organ polarity in Arabidopsis. KAN is required for abaxial identity in both leaves and carpels, and encodes a nuclear-localized protein in the GARP family of putative transcription factors. Together with KAN2, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN2 and KAN4, KAN1 appears to be required for proper regulation of PIN1 in early embryogenesis. |
AT5G16570 | Encodes a cytosolic glutamine synthetase, the enzyme has high affinity with substrate ammonium |
AT5G16580 | beta glucosidase 2;(source:Araport11) |
AT5G16590 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G16610 | hypothetical protein;(source:Araport11) |
AT5G16640 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G16680 | PHD protein which cooperates with AIPP2 and BAH domain protein AIPP3 to read H3K4 histone marks. The BAH-PHD bivalent histone reader complex silences a substantial subset of H3K27me3-enriched loci, including development and stress response-related genes. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
AT5G16720 | caldesmon-like protein (Protein of unknown function, DUF593);(source:Araport11) |
AT5G16730 | Encodes a microtubule-associated protein. The mRNA is cell-to-cell mobile. |
AT5G16770 | Member of the R2R3 factor gene family. |
AT5G16820 | Encodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes. |
AT5G16900 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G16910 | encodes a gene similar to cellulose synthase. Located in Golgi membranes. The mRNA is cell-to-cell mobile. |
AT5G16920 | Fasciclin-like arabinogalactan family protein;(source:Araport11) |
AT5G16960 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
AT5G17030 | UDP-glucosyl transferase 78D3;(source:Araport11) |
AT5G17080 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT5G17090 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT5G17120 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT5G17130 | cysteine-type peptidase;(source:Araport11) |
AT5G17170 | rubredoxin family protein;(source:Araport11) |
AT5G17220 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). Mutants display no pigments on leaves and stems. Likely to function as a carrier to transport anthocyanin from the cytosol to tonoplasts. |
AT5G17240 | SET domain group 40;(source:Araport11) |
AT5G17250 | Alkaline-phosphatase-like family protein;(source:Araport11) |
AT5G17260 | NAC domain containing protein 86;(source:Araport11) |
AT5G17290 | Autophagy protein ATG5. Forms a conjugate with ATG12 with an essential role in plant nutrient recycling. Mutants missing ATG5 display early senescence and are hypersensitive to nitrogen or carbon starvation, accompanied by a more rapid loss of organellar and cytoplasmic proteins. |
AT5G17310 | UDP-glucose pyrophosphorylase 2;(source:Araport11) |
AT5G17350 | PADRE protein up-regulated after infection by S. sclerotiorum. |
AT5G17360 | DNA ligase;(source:Araport11) |
AT5G17380 | Thiamine pyrophosphate dependent pyruvate decarboxylase family protein;(source:Araport11) |
AT5G17420 | Encodes a xylem-specific cellulose synthase that is phosphorylated on one or more serine residues (on either S185 or one of S180 or S181). |
AT5G17450 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT5G17460 | glutamyl-tRNA (Gln) amidotransferase subunit C;(source:Araport11) |
AT5G17470 | EF hand calcium-binding protein family;(source:Araport11) |
AT5G17490 | Encodes a DELLA subfamily member that acts as a negative regulator of GA signaling and as a coactivator of ABI3 to promote seed storage protein biosynthesis during the seed maturation stage. |
AT5G17500 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT5G17540 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT5G17550 | Encodes the predominant PEX19 peroxin isoform, a cytosolic chaperone for peroxisome membrane proteins (PMPs) that delivers PMPs to the endoplasmic reticulum or peroxisomal membrane. It is predominantly cytosolic, forms dimers, promotes peroxisome function and is essential for viability. The protein is farnesylated in vivo through the actions of ERA1 and PLP. |
AT5G17580 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT5G17590 | Putative membrane lipoprotein;(source:Araport11) |
AT5G17600 | RING/U-box superfamily protein;(source:Araport11) |
AT5G17610 | hypothetical protein;(source:Araport11) |
AT5G17630 | Phosphate translocator family member which resides in the plastid inner envelope membrane. Retrieves excessive pentose phosphates from the extra-plastidial space and makes them available to the plastids. |
AT5G17650 | glycine/proline-rich protein;(source:Araport11) |
AT5G17690 | Regulates the meristem response to light signals and the maintenance of inflorescence meristem identity. Influences developmental processes controlled by APETALA1. TFL2 silences specific genes within euchromatin but not genes positioned in heterochromatin. TFL2 protein localized preferentially to euchromatic regions and not to heterochromatic chromocenters. Involved in euchromatin organization. Required for epigenetic maintenance of the vernalized state. |
AT5G17700 | MATE efflux family protein;(source:Araport11) |
AT5G17710 | Chloroplast GrpE protein involved in chloroplastic response to heat stress and the correct oligomerization of the photosynthesis-related LHCII complex. |
AT5G17720 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G17725 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.9e-07 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
AT5G17730 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G17750 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G17760 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G17770 | Encodes NADH:cytochrome (Cyt) b5 reductase that displayed strict specificity to NADH for the reduction of a recombinant Cyt b5 (AtB5-A), whereas no Cyt b5 reduction was observed when NADPH was used as the electron donor. |
AT5G17780 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G17810 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Together with WOX11, WOX12 is involved in de novo root organogenesis. |
AT5G17830 | Plasma-membrane choline transporter family protein;(source:Araport11) |
AT5G17847 | hypothetical protein;(source:Araport11) |
AT5G17860 | Cation/Ca2+ exchanger family member. Double mutants with CCX4 show delayed greening and defects in ROS response. |
AT5G17900 | microfibrillar-associated protein-like protein;(source:Araport11) |
AT5G17960 | Encodes a member of a Cys-rich protein family known as C1-clan proteins, that contains C1_2, C1_3 and ZZ/PHD type C1 domains. Its expression is responsive to phytohormones and is affected by biotic (chitin) and different abiotic (salinity, drought, cold and UV) treatments. |
AT5G17980 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT5G17990 | Encodes the tryptophan biosynthetic enzyme phosphoribosylanthranilate transferase (PAT1, called trpD in bacteria). Converts anthranilate and phosphoribosylpyrophosphate into phosphoribosylanthranilate and inorganic pyrophosphate. The mRNA is cell-to-cell mobile. |
AT5G18000 | Encodes VERDANDI (VDD), a putative transcription factor belonging to the reproductive meristem (REM) family. VDD is a direct target of the MADS domain ovule identity complex. Mutation in VDD affects embryo sac differentiation. |
AT5G18020 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT5G18060 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT5G18070 | encodes a novel protein involved in DNA repair from UV damage. Isolated by functional complementation of E. coli UV-sensitive mutants (UVR genes). |
AT5G18080 | Encodes SAUR24 (small auxin up RNA 24). Note that TAIR nomenclature is based on Plant Mol Biol. 2002, 49:373-85 (PMID:12036261). In Planta (2011) 233:1223?1235 (PMID:21327815), SAUR24 is At5g18010. |
AT5G18090 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT5G18130 | transmembrane protein;(source:Araport11) |
AT5G18140 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT5G18150 | Methyltransferase-related protein;(source:Araport11) |
AT5G18160 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT5G18220 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT5G18240 | Encodes MYR1 (MYR1). |
AT5G18270 | NAC domain containing protein 87;(source:Araport11) |
AT5G18280 | Encodes an enzyme with ATPase and ADPase activity (an apyrase) that when mutated in combination with ATAPY1 causes a complete inhibition of pollen germination. |
AT5G18300 | NAC domain containing protein 88;(source:Araport11) |
AT5G18310 | ubiquitin hydrolase;(source:Araport11) |
AT5G18320 | One of three tandemly located, paralogous plant U-box proteins. Mutants show increased sensitivity to water stress.Expression in roots is enhanced by auxin and to a lesser extent ABA and cytokinin treatment. |
AT5G18340 | One of three tandemly located, paralogous plant U-box proteins. Mutants show increased sensitivity to water stress. E3 ligase which acts as a regulator in the heat response signaling pathway. Over-expressing AtPUB48 could induce the expression of the heat-related genes (HSP101, HSP70, HSP25.3, HSFA2, and ZAT12). Enhances plant resistance to heat stress during seed germination and seedling growth. |
AT5G18350 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G18390 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G18407 | Encodes a defensin-like (DEFL) family protein. |
AT5G18410 | distorted trichomes and exhibits a diffuse actin cytoskeleton |
AT5G18440 | Encodes NUFIP that directs assembly of C/D snoRNP (small nucleolar ribonucleoprotein). |
AT5G18450 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
AT5G18460 | carboxyl-terminal peptidase (DUF239);(source:Araport11) |
AT5G18490 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
AT5G18560 | Encodes PUCHI, a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. PUCHI is required for morphogenesis in the early lateral root primordium of Arabidopsis. Expressed in early floral meristem (stage 1 to 2). Required for early floral meristem growth and for bract suppression. Triple mutant with bop1 and bop2 displays a strong defect in the determination of floral meristem identity with reduced LFY expression and the lack of AP1 expression. |
AT5G18580 | fass mutants have aberrant cell shapes due to defects in arrangement of cortical microtubules. Encodes a protein highly conserved in higher plants and similar in its C-terminal part to B' regulatory subunits of type 2A protein phosphatases. Interacts with an Arabidopsis type A subunit of PP2A in the yeast two-hybrid system. |
AT5G18660 | Encodes a protein with 3,8-divinyl protochlorophyllide a 8-vinyl reductase activity. Mutants accumulate divinyl chlorophyll rather than monovinyl chlorophyll. |
AT5G18750 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT5G18755 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT5G18790 | Ribosomal protein L33 family protein;(source:Araport11) |
AT5G18840 | Major facilitator superfamily protein;(source:Araport11) |
AT5G18850 | Low-density receptor-like protein;(source:Araport11) |
AT5G18860 | Encodes a purine nucleoside hydrolase active in the apoplast. It might play a role in salvaging extracellular ATP. NSH3 transcript levels rise in response to jasmonic acid and wounding. |
AT5G18870 | Similar to N terminal region of NSH1 nucleoside hydrolase. |
AT5G18890 | Inosine-uridine preferring nucleoside hydrolase family protein;(source:Araport11) |
AT5G18910 | Protein kinase superfamily protein;(source:Araport11) |
AT5G18930 | S-adenosylmethionine decarboxylase family member. |
AT5G18940 | Mo25 family protein;(source:Araport11) |
AT5G18950 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G18970 | AWPM-19-like family protein;(source:Araport11) |
AT5G18980 | ARM repeat superfamily protein;(source:Araport11) |
AT5G19020 | Encodes a pentatricopeptide repeat protein (PPR) protein involved in mitochondrial mRNA editing. |
AT5G19030 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G19040 | Encodes cytokinin synthase. |
AT5G19050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G19060 | cytochrome P450 family protein;(source:Araport11) |
AT5G19080 | Paralog of LOG2 (At3g09770), a ubiquitin ligase that regulates amino acid export. |
AT5G19090 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT5G19095 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
AT5G19160 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT5G19170 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT5G19190 | hypothetical protein;(source:Araport11) |
AT5G19260 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
AT5G19280 | kinase associated protein phosphatase composed of three domains: an amino-terminal signal anchor, a kinase interaction (KI) domain, and a type 2C protein phosphatase catalytic region |
AT5G19320 | Encodes RAN GTPase activating protein 2. The protein is localized to the nuclear envelope during interphase. |
AT5G19360 | member of Calcium Dependent Protein Kinase |
AT5G19390 | Encodes a protein with similarity to REN1, a Rho GTPase activating protein.It is cytoplasmic and plasma membrane associated in interphase, but during mitosis localizes to the CDZ/CDS in a POK-dependent manner. |
AT5G19400 | Encodes SMG7, a protein that possesses an evolutionarily conserved EST1 domain and exhibits strong homology to human SMG6 (EST1A) and SMG7 (EST1C) proteins. SMG7 plays an evolutionarily conserved role in nonsense-mediated RNA decay (NMD). Required for exit from meiosis. Hypomorphic smg7 alleles render mutant plants sterile by causing an unusual cell-cycle arrest in anaphase II that is characterized by delayed chromosome decondensation and aberrant rearrangement of the meiotic spindle. Disruption of SMG7 causes embryonic lethality. |
AT5G19410 | ABC-2 type transporter family protein;(source:Araport11) |
AT5G19440 | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), apple tree, PIR:T16995; NOT a cinnamyl-alcohol dehydrogenase |
AT5G19473 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
AT5G19520 | mechanosensitive channel of small conductance-like 9;(source:Araport11) |
AT5G19530 | Encodes a spermine synthase. Required for internode elongation and vascular development, specifically in the mechanism that defines the boundaries between veins and nonvein regions. This mechanism may be mediated by polar auxin transport. Though ACL5 has been shown to function as a spermine synthase in E. coli, an ACL5 knockout has no effect on the endogenous levels of free and conjugated polyamines in Arabidopsis, suggesting that ACL5 may have a very specific or altogether different in vivo function. |
AT5G19560 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT5G19570 | transmembrane protein;(source:Araport11) |
AT5G19580 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
AT5G19610 | GNOM-like 2;(source:Araport11) |
AT5G19630 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G19640 | Influences leaf N export via sink-to-source feedback, perhaps via a role in sensing plant internal N-status. Necessary for normal leaf N export under low N. |
AT5G19670 | Exostosin family protein;(source:Araport11) |
AT5G19720 | Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain-containing protein;(source:Araport11) |
AT5G19820 | Encodes an importin that transports HYL1, a component of the microprocessor, from the cytoplasm to the nucleus to constitute functional microprocessor, thereby affecting miRNA processing. Knockdown amiR mutants significantly reduced nuclear portion of HYL1 protein and correspondingly compromised the pri-miRNA processing in the nucleus.KETCH1 may protect RPs from the 26S proteasome-mediated degradation. |
AT5G19850 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G19860 | transmembrane protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
AT5G19880 | Peroxidase superfamily protein;(source:Araport11) |
AT5G19890 | Peroxidase superfamily protein;(source:Araport11) |
AT5G19900 | PRLI-interacting factor;(source:Araport11) |
AT5G19970 | GRAS family transcription factor family protein;(source:Araport11) |
AT5G20030 | Plant Tudor-like RNA-binding protein;(source:Araport11) |
AT5G20100 | Tightly connected with MAPK signaling to fine-tune stomatal production and patterning. |
AT5G20150 | Expression is upregulated in the shoot of cax1/cax3 mutant. Additionally, its expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. The mRNA is cell-to-cell mobile. |
AT5G20160 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
AT5G20190 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G20220 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
AT5G20225 | Natural antisense transcript overlaps with AT5G20220;(source:Araport11) |
AT5G20250 | encodes a member of glycosyl hydrolase family 36. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile. |
AT5G20260 | Exostosin family protein;(source:Araport11) |
AT5G20270 | heptahelical transmembrane protein homologous to human adiponectin receptors and progestin receptors |
AT5G20280 | Encodes a sucrose-phosphate synthase activity. This is the major leaf isoform. |
AT5G20300 | Encodes Toc90, part of the TOC (translocon at the outer chloroplast membrane) machinery involved in the import of nucleus-encoded proteins into the chloroplast. |
AT5G20310 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT5G20340 | Encodes a putative beta 1,3-glucanase. |
AT5G20370 | serine-rich protein-like protein;(source:Araport11) |
AT5G20440 | Mob1/phocein family protein;(source:Araport11) |
AT5G20470 | Encodes a headless derivative of myosin XI-K, which likely arose from a partial duplication of the XI-K gene and is developmentally regulated. |
AT5G20570 | Encodes a ring-box 1 like protein and component of the SCF ubiquitinization complex mediating auxin responses. Forms a E3 ubiquitin ligase complex with CUL3A and At1g21780.1 a BTB domain protein. |
AT5G20630 | Encodes a germin-like protein. Its transcripts are more abundant in RNA from leaves collected in the evening, suggesting some kind of circadian regulation. |
AT5G20635 | Encodes an atypical heterotrimeric G-protein gamma-subunit involved in guard cell K+-channel regulation and morphological development. |
AT5G20650 | Encodes COPT5, a member of copper transporter family and functionally complements a high affinity copper transporter mutant in yeast. Plays an important role in the plant response to environmental copper scarcity, probably by remobilizing copper from prevacuolar vesicles, which could act as internal stores or recycling vesicles to provide the metal cofactor to key copper-dependent processes such as photosynthesis. |
AT5G20670 | DUF1677 family protein (DUF1677);(source:Araport11) |
AT5G20690 | PRK6 is pollen specific receptor kinase that functions as a receptor for the pollen attractant LURE1 in pollen tube guidance. It is localized to the tip the pollen tube and becomes asymmetrically distributed towards the source of the LURE1 signal prior to pollen tube growth reorientation. |
AT5G20700 | senescence-associated family protein, putative (DUF581);(source:Araport11) |
AT5G20720 | Encodes a chloroplast co-chaperonin with similarity to CPN21 from spinach, E.coli GroES. |
AT5G20760 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42700.1);(source:TAIR10) |
AT5G20830 | Encodes a protein with sucrose synthase activity (SUS1). |
AT5G20858 | pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10) |
AT5G20860 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT5G20870 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT5G20885 | RING/U-box superfamily protein;(source:Araport11) |
AT5G20910 | Encodes an E3 ligase that can interact with and polyubiquitinate ABI3 in vitro. AIP2 likely negatively regulates ABA signaling by targeting ABI3 for post-translational destruction. |
AT5G20970 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT5G21020 | transmembrane protein;(source:Araport11) |
AT5G21030 | PAZ domain-containing protein / piwi domain-containing protein;(source:Araport11) |
AT5G21080 | Uncharacterized protein;(source:Araport11) |
AT5G21100 | Plant L-ascorbate oxidase;(source:Araport11) |
AT5G21120 | ethylene-insensitive3-like2 (EIL2) |
AT5G21150 | AGO9-dependent sRNA silencing is crucial to specify cell fate in the Arabidopsis ovule. AGO9 is expressed in reproductive companion cells but not in the associated male or female gametes or their precursors. Therefore, AGO9 acts non-cell autonomously to silencing the activity of TEs activity in the female gametophyte.Loss of function mutants produce ectopic megaspore mother cell and supernumary female gametophytes. |
AT5G21160 | Encodes a protein with sequence similarity to mRNA binding proteins from humans. LARP1a is involved in mRNA degradation in response to heat stress. Upon heat stress LARP1a interacts with XRN4 and appears to be responsible for addressing XRN4 to the polysome. LARP1/XRN4 double mutants are impaired in thermotolerance and lower levels of heat induced RNA turnover. |
AT5G21170 | Encodes AKINbeta1, a subunit of the SnRK1 kinase (Sucrose non-fermenting-1-related protein kinase). Involved in regulation of nitrogen and sugar metabolism. As part of the regulatory subunit, it binds maltose which promotes kinase activity. Acts as a global regulator of genes involved in carbon, lipid and nitrogen metabolism. |
AT5G21280 | Seed plant lineage specific gene that is expressed in response to oxidative and abiotic stresses. |
AT5G21482 | This gene used to be called AtCKX5. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. Enzyme assays show preference for N6 -(2-isopentenyl)adenine 9-glucoside substrate. |
AT5G21535 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G21900 | Contributes to UV tolerance through nucleotide excision repair. |
AT5G21940 | hybrid signal transduction histidine kinase M-like protein;(source:Araport11) |
AT5G21950 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G22000 | encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. Double mutant analyses with RHF1a suggests that RHF2a may be involved in targetting ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF2a is expressed in all four floral whorls and is present at ~8-fold higher levels than RHF1a in inflorescences by RT-PCR analyses. |
AT5G22010 | Encodes RFC1, the largest subunit of replication factor C. Mediates genomic stability and transcriptional gene silencing. |
AT5G22080 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT5G22090 | EAR1 is a negative regulator of ABA signaling that enhances the activity of all six clade A PP2Cs (ABI1, ABI2, HAB1, HAB2, AHG1, AHG3) by interacting with and releasing the N-terminal autoinhibition of these proteins. EAR1 indirectly affects OST1 activity through enhancing ABI1 activity. The EAR1 141-287 fragment is sufficient for the functioning of EAR1 in ABA responses; the 131-248 region harbors an intrinsically disordered region and only 249-278 can form a predicted regular structure. EAR1 is located in the ER, nuclei, and cytoplasm; ABA signaling promotes the translocation of EAR1 from the ER and/or cytoplasm to the nucleus. Mutations showed that it functions in seed germination, primary root growth, and drought tolerance. |
AT5G22100 | RNA cyclase family protein;(source:Araport11) |
AT5G22120 | coiled-coil protein;(source:Araport11) |
AT5G22180 | hypothetical protein;(source:Araport11) |
AT5G22250 | Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses. |
AT5G22260 | Sporophytic factor controlling anther and pollen development. Mutants fail to make functional pollen;pollen degeneration occurs after microspore release and the tapetum also appears abnormally vacuolated. Similar to PHD-finger motif transcription factors. |
AT5G22310 | trichohyalin-like protein;(source:Araport11) |
AT5G22340 | NF-kappa-B inhibitor-like protein;(source:Araport11) |
AT5G22350 | fission ELM1-like protein (DUF1022);(source:Araport11) |
AT5G22380 | NAC domain containing protein 90;(source:Araport11) |
AT5G22390 | FANTASTIC four-like protein (DUF3049);(source:Araport11) |
AT5G22400 | Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11) |
AT5G22410 | root hair specific 18;(source:Araport11) |
AT5G22420 | fatty acid reductase 7;(source:Araport11) |
AT5G22430 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT5G22460 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G22470 | PARP3 is one of three canonical PARPs in Arabidopsis. |
AT5G22500 | Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. |
AT5G22510 | Encodes a chloroplast-targeted alkaline/neutral invertase that is implicated in the development of the photosynthetic apparatus and nitrogen assimilation in seedlings to control the sucrose to hexose ratio. |
AT5G22530 | Unknown protein, knockout shows increased sensitivity to Al stress. |
AT5G22540 | Associated with a QTL for quantitative disease resistance. |
AT5G22555 | transmembrane protein;(source:Araport11) |
AT5G22580 | Stress responsive A/B Barrel Domain-containing protein;(source:Araport11) |
AT5G22630 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile. |
AT5G22660 | FBD, F-box, Skp2-like and Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT5G22730 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G22750 | DNA repair gene. gamma-radiation hypersensitive (RAD5) involved in stable transformation and T-DNA transfer |
AT5G22791 | F-box family protein;(source:Araport11) |
AT5G22800 | A locus involved in embryogenesis. Mutations in this locus result in embryo lethality. |
AT5G22810 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G22850 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT5G22910 | member of Putative Na+/H+ antiporter family |
AT5G22930 | enabled-like protein (DUF1635);(source:Araport11) |
AT5G22950 | SNF7 family protein;(source:Araport11) |
AT5G22980 | serine carboxypeptidase-like 47;(source:Araport11) |
AT5G23010 | Encodes a methylthioalkylmalate synthase, catalyzes the condensation reactions of the first two rounds of methionine chain elongation in the biosynthesis of methionine-derived glucosinolates. The mRNA is cell-to-cell mobile. |
AT5G23020 | methylthioalkymalate synthase-like. Also known as 2-isopropylmalate synthase (IMS2). encodes a methylthioalkylmalate synthase involved in the biosynthesis of aliphatic glucosinolates which accepts all the omega-methylthio-2-oxoalkanoic acids needed to form the known C3 to C8 glucosinolates in Arabidopsis. The mRNA is cell-to-cell mobile. |
AT5G23060 | Encodes a chloroplast-localized protein that modulates cytoplasmic Ca2+ concentration and is crucial for proper stomatal regulation in response to elevations of external Ca2+. Phosphorylation of this protein is dependent on calcium. |
AT5G23080 | Interacts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. It is an important component of miRNA and siRNA biogenesis. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1. |
AT5G23100 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT5G23110 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
AT5G23120 | encodes a stability and/or assembly factor of photosystem II The mRNA is cell-to-cell mobile. |
AT5G23130 | Peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
AT5G23140 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). This mitochondrial CLPP2 assists coordination and homeostasis of respiratory complexes. |
AT5G23150 | Putative transcription factor. Member of the floral homeotic AGAMOUS pathway.Mutations in HUA enhance the phenotype of mild ag-4 allele. Single hua mutants are early flowering and have reduced levels of FLC mRNA. Other MADS box flowering time genes such as FLM and MAF2 also appear to be regulated by HUA2. HUA2 normally activates FLC expression and enhances AG function. HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. The mRNA is cell-to-cell mobile. |
AT5G23160 | transmembrane protein;(source:Araport11) |
AT5G23180 | mediator-associated-like protein;(source:Araport11) |
AT5G23190 | cytochrome P450 CYP86B1, nuclear gene for chloroplast product. CYP86B1 is a very long chain fatty acid hydroxylase specifically involved in polyester monomer biosynthesis during the course of plant development. |
AT5G23210 | serine carboxypeptidase-like 34;(source:Araport11) |
AT5G23212 | Encodes a defensin-like (DEFL) family protein. |
AT5G23220 | nicotinamidase 3;(source:Araport11) |
AT5G23250 | Succinyl-CoA ligase, alpha subunit;(source:Araport11) |
AT5G23260 | Encodes a MADS box protein. Regulates proanthocyanidin biosynthesis in the inner-most cell layer of the seed coat. Also controls cell shape of the inner-most cell layer of the seed coat. Also shown to be necessary for determining the identity of the endothelial layer within the ovule. Paralogous to GOA. Plays a maternal role in fertilization and seed development. |
AT5G23270 | Membrane localized sucrose transporter. |
AT5G23280 | Transcription factor which plays an important role during leaf and hypocotyl development, redundantly, with at least six class I TCPs, and regulates the expression of CYCD1;1 to affect endoreplication. |
AT5G23290 | prefoldin 5;(source:Araport11) |
AT5G23300 | dihydroorotate dehydrogenase, catalyses fourth step of pyrimidine biosynthesis |
AT5G23340 | RNI-like superfamily protein;(source:Araport11) |
AT5G23360 | GRAM domain-containing protein / ABA-responsive protein-like protein;(source:Araport11) |
AT5G23390 | polygalacturonase inhibitor (DUF639);(source:Araport11) |
AT5G23413 | pseudogene of HMG-box (high mobility group) DNA-binding family protein;(source:Araport11) |
AT5G23430 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
AT5G23440 | ferredoxin/thioredoxin reductase subunit A (variable subunit) 1;(source:Araport11) |
AT5G23450 | Encodes a sphingosine kinase that specifically phosphorylates D-erythro-dihydrosphingosine (DHS), but not N-acetyl-DHS or D-threo-DHS. It also also phosphorylates D-erythro-sphingosine, trans-4, trans-8-sphingadienine and phytosphingosine. |
AT5G23480 | SWIB/MDM2, Plus-3 and GYF domain-containing protein;(source:Araport11) |
AT5G23510 | hypothetical protein;(source:Araport11) |
AT5G23530 | carboxyesterase 18;(source:Araport11) |
AT5G23550 | Got1/Sft2-like vescicle transport protein family;(source:Araport11) |
AT5G23580 | Member of a unique family of enzymes containing a single polypeptide chain with a kinase domain at the amino terminus and a putative calcium-binding EF hands structure at the carboxyl terminus; recombinant protein is fully active and induced by Ca2+ |
AT5G23660 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
AT5G23730 | Encodes REPRESSOR OF UV-B PHOTOMORPHOGENESIS 2 (RUP2). Functions as a repressor of UV-B signaling. |
AT5G23750 | Remorin family protein;(source:Araport11) |
AT5G23790 | Predicted to encode a galactinol synthase. |
AT5G23830 | MD-2-related lipid recognition domain-containing protein;(source:Araport11) |
AT5G23860 | beta-tubulin, preferentially expressed in endodermal and phloem cells of primary roots and in the vascular tissues of leaves, stems, and flowers. The mRNA is cell-to-cell mobile. |
AT5G23880 | Encodes a protein similar to the 100kD subunit of cleavage and polyadenylation specificity factor (CPSF), the factor responsible for the recognition of the AAUAAA motif during mRNA polyadenylation. The protein interacts with a portion of a nuclear poly(A) polymerase. It is likely to be a part of the mRNA 3'end formation apparatus. |
AT5G23890 | GPI-anchored adhesin-like protein;(source:Araport11) |
AT5G23910 | ATP binding microtubule motor family protein;(source:Araport11) |
AT5G23920 | transmembrane protein;(source:Araport11) |
AT5G23955 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.6e-41 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G23960 | Encodes a sesquiterpene synthase involved in generating all of the group A sesquiterpenes found in the Arabidopsis floral volatile blend. Strongly expressed in the stigma. |
AT5G23970 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT5G23990 | Encodes a ferric chelate reductase that is expressed at low levels in roots,shoots and flowers, but not cotyledons. |
AT5G24010 | Protein kinase superfamily protein;(source:Araport11) |
AT5G24080 | Protein kinase superfamily protein;(source:Araport11) |
AT5G24090 | Chitinase A (class III) expressed exclusively under environmental stress conditions. Shown be a plant lysozyme involved in plant immunity. |
AT5G24105 | Encodes a putative arabinogalactan-protein (AGP41). |
AT5G24130 | polypyrimidine tract-binding-like protein;(source:Araport11) |
AT5G24140 | Encodes a protein with similarity to squalene monoxygenases. |
AT5G24165 | hypothetical protein;(source:Araport11) |
AT5G24180 | Lipase class 3-related protein;(source:Araport11) |
AT5G24200 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G24205 | other_RNA;(source:Araport11) |
AT5G24220 | Lipase class 3-related protein;(source:Araport11) |
AT5G24270 | encodes a calcium sensor that is essential for K+ nutrition, K+/Na+ selectivity, and salt tolerance. The protein is similar to calcineurin B. Lines carrying recessive mutations are hypersensitive to Na+ and Li+ stresses and is unable to grow in low K+. The growth defect is rescued by extracellular calcium. |
AT5G24280 | Encodes GMI1, a structural-maintenance-of-chromosomes-hinge domain-containing protein. Involved in somatic homologous recombination. |
AT5G24290 | Vacuolar iron transporter (VIT) family protein;(source:Araport11) |
AT5G24314 | plastid transcriptionally active7;(source:Araport11) |
AT5G24316 | proline-rich family protein;(source:Araport11) |
AT5G24330 | Encodes a SET-domain protein, a H3K27 monomethyltransferases required for chromatin structure and gene silencing. Regulates heterochromatic DNA replication. Contains a PCNA-binding domain. ATXR6 accumulates preferentially during the late G1 or S phase, suggesting that it plays a role in cell-cycle regulation or progression. |
AT5G24340 | 3-5 exonuclease domain-containing protein;(source:Araport11) |
AT5G24350 | Member of MAG2 complex on the ER that is responsible for efficient transport of seed storage proteins, functions in protein transport between the ER and Golgi apparatus, contain a Zeste?White 10 (ZW10) domain and a Sec39 domain. Required for proper maturation of seed storage proteins. |
AT5G24360 | IRE1A and IRE1B catalyze bZIP60 mRNA splicing, producing the active bZIP60 transcription factor. |
AT5G24370 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT5G24380 | closest Arabidopsis homolog of Zea maize metal-phytosiderophore/metal-nicotianamine transporter ZmYS1 |
AT5G24390 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT5G24400 | Encodes a protein with 6-phosphoglucunolactonase activity that localizes to the chloroplasts and the peroxisome. However, mutant phenotypes observed in pgl3 mutant plants can be complemented with a chloroplast-targeted version of the protein. PGL3 likely functions in the oxidative branch of the pentose phosphate pathway. pgl3 mutant phenotypes suggest that it is important in pathogen defense and maintenance of cellular redox homeostasis. |
AT5G24420 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
AT5G24430 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
AT5G24530 | Encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility to downy mildew. The mRNA is cell-to-cell mobile. |
AT5G24540 | beta glucosidase 31;(source:Araport11) |
AT5G24570 | hypothetical protein;(source:Araport11) |
AT5G24620 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT5G24655 | response to low sulfur 4;(source:Araport11) |
AT5G24660 | response to low sulfur 2;(source:Araport11) |
AT5G24740 | Encodes a vacuolar sorting protein that interacts with the plant-specific GRAS family transcription factor SHORT-ROOT and acts in a pathway that controls root growth and radial patterning. It provides a connections between gibberellic acid, SHR and PLT signaling in the root. |
AT5G24775 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.6e-99 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
AT5G24790 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
AT5G24810 | ABC1 family protein;(source:Araport11) |
AT5G24820 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT5G24825 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: CAGCCAAGGAUGACUUGCCGG |
AT5G24840 | tRNA (guanine-N-7) methyltransferase;(source:Araport11) |
AT5G24870 | Ubiquitin E3 ligase, works with WDL7 in module which regulates microtubule disassembly to mediate stomatal closure in response to drought stress and ABA treatment. MREL57 interacts with, ubiquitinates and degrades WDL7, effect is enhanced by ABA. |
AT5G24879 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G24880 | chromo domain cec-like protein;(source:Araport11) |
AT5G24890 | stress response NST1-like protein;(source:Araport11) |
AT5G24900 | Member of CYP714A. Encodes one of the two tandemly duplicated gene pair ELA1 (CYP714A1) and ELA2 (CYP714A2), homologs of the rice cytochrome P450 monooxygenase gene EUI1. Double mutation of ELA1 and ELA2 results in increased biomass and enlarged organs. |
AT5G24915 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.1e-38 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G24930 | Flowering repressor in long days (LD) and short days (SD) and acts on the expression of FT and FT-like genes as well as on SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1). |
AT5G24940 | Protein phosphatase 2C family protein;(source:Araport11) |
AT5G24950 | putative cytochrome P450 |
AT5G25010 | enhanced disease resistance-like protein (DUF1336);(source:Araport11) |
AT5G25040 | Major facilitator superfamily protein;(source:Araport11) |
AT5G25050 | Major facilitator superfamily protein;(source:Araport11) |
AT5G25060 | RNA recognition motif (RRM)-containing protein;(source:Araport11) |
AT5G25080 | Sas10/Utp3/C1D family;(source:Araport11) |
AT5G25110 | salt- and anoxia-induced member of AtCIPK family. |
AT5G25120 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
AT5G25140 | putative cytochrome P450 |
AT5G25160 | Encodes a zinc finger protein containing only a single zinc finger. |
AT5G25190 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT5G25200 | Ta11-like non-LTR retrotransposon;(source:Araport11) |
AT5G25210 | hypothetical protein;(source:Araport11) |
AT5G25260 | Belongs to the group of plant flotillins, which are plasma membrane proteins. Flot2 complexes are found in microdomains and may be involved in plant-pathogen interactions, water transport and intracellular trafficking. |
AT5G25280 | serine-rich protein-like protein;(source:Araport11) |
AT5G25290 | F-box protein (DUF295);(source:Araport11) |
AT5G25310 | Exostosin family protein;(source:Araport11) |
AT5G25320 | ACT-like superfamily protein;(source:Araport11) |
AT5G25330 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT5G25340 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT5G25360 | hypothetical protein;(source:Araport11) |
AT5G25370 | member of C2-PLD subfamily. Analyses on the gene structures/sequences, overall amino acid sequences, and domain structures indicate that PLDalpha3 is most closely related to other two PLDalphas than to other PLDs. Phylogenetic analysis has not identified a true ortholog for PLDalpha3. Involved in hyperosmotic response. |
AT5G25380 | core cell cycle genes |
AT5G25400 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT5G25420 | Xanthine/uracil/vitamin C permease;(source:Araport11) |
AT5G25430 | HCO3- transporter family;(source:Araport11) |
AT5G25440 | Receptor like kinase involved in HopZ1a effector triggered immunity. Interacts with ZAR1. Localization to membrane is dependent on N-terminal myristoylation domain. |
AT5G25451 | Pseudogene of AT5G25440; protein kinase family protein |
AT5G25470 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT5G25475 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT5G25500 | exosome complex exonuclease;(source:Araport11) |
AT5G25530 | DNAJ heat shock family protein;(source:Araport11) |
AT5G25560 | CHY-type/CTCHY-type/RING-type Zinc finger protein;(source:Araport11) |
AT5G25580 | hypothetical protein;(source:Araport11) |
AT5G25585 | pre-tRNA tRNA-Leu (anticodon: CAA);(source:Araport11, TAIR10) |
AT5G25600 | putative nucleic-acid protein;(source:Araport11) |
AT5G25640 | Rhomboid-related intramembrane serine protease family protein;(source:Araport11) |
AT5G25754 | RNA polymerase I-associated factor PAF67;(source:Araport11) |
AT5G25757 | RNA polymerase I-associated factor PAF67;(source:Araport11) |
AT5G25770 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G25800 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT5G25830 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT5G25840 | DUF1677 family protein (DUF1677);(source:Araport11) |
AT5G25850 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G25860 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G25880 | The malic enzyme (EC 1.1.1.40) encoded by the ATNADP-ME3 is presumably cytosolic and restricted in its expression by both developmental and cell-specific signals. |
AT5G25890 | encodes a protein that may be a negative regulator of lateral root formation in response to auxin. It is a member of IAA/ARF gene family and is plant-specific. Gain of function mutations in this gene suppresses lateral root formation and is resistant to inhibition of root elongation by auxin, cytokinin, and ethylene. |
AT5G25900 | Encodes a member of the CYP701A cytochrome p450 family that is involved in later steps of the gibberellin biosynthetic pathway. |
AT5G25930 | kinase family with leucine-rich repeat domain-containing protein;(source:Araport11) |
AT5G25980 | Myrosinase (thioglucoside glucohydrolase) gene involved in glucosinoloate metabolism. The mRNA is cell-to-cell mobile. |
AT5G26038 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCAAUAGAUUGGACUAUGUAU |
AT5G26040 | Class III RPD3 type protein. Encodes HDA2, a member of the histone deacetylase family proteins. |
AT5G26080 | proline-rich family protein;(source:Araport11) |
AT5G26090 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT5G26100 | hypothetical protein;(source:Araport11) |
AT5G26120 | alpha-L-arabinofuranosidase 2;(source:Araport11) |
AT5G26130 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
AT5G26170 | member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses. |
AT5G26190 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G26250 | Sugar transporter expressed strongly in pollen and pollen tubes. |
AT5G26286 | pseudogene of TRAF-like family protein;(source:Araport11) |
AT5G26300 | TRAF-like family protein;(source:Araport11) |
AT5G26330 | Cupredoxin superfamily protein;(source:Araport11) |
AT5G26570 | chloroplastidic phosphoglucan, water dikinase (PWD) which is required for normal degradation of leaf starch in Arabidopsis. NMR analysis of the mutants, suggests that the gene is specifically involved in the phosphorylation of the glucosyl residues of starch at the C3 position. |
AT5G26622 | Beta-galactosidase related protein;(source:Araport11) |
AT5G26630 | MADS-box transcription factor family protein;(source:Araport11) |
AT5G26660 | myb domain protein 86;(source:Araport11) |
AT5G26670 | Pectinacetylesterase family protein;(source:Araport11) |
AT5G26692 | Encodes a Plant thionin family protein |
AT5G26717 | Encodes a Plant thionin family protein |
AT5G26731 | hypothetical protein;(source:Araport11) |
AT5G26740 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
AT5G26742 | DEAD box RNA helicase (RH3);(source:Araport11) |
AT5G26760 | Encodes RPAP2 IYO Mate (RIMA), a homologue of yeast and human proteins linked to nuclear import of selective cargo. Knockdown of RIMA causes delayed onset of cell differentiation. |
AT5G26780 | Encodes a protein with serine hydroxymethyltransferase activity which is thought to be localized in the mitochondrial matrix. SHM2 expression fails to rescue the conditional lethal phenotype of the shm1-1 mutant, defective in SHM1. |
AT5G26790 | transmembrane protein;(source:Araport11) |
AT5G26805 | B3 domain protein;(source:Araport11) |
AT5G26930 | Encodes a member of the GATA factor family of zinc finger transcription factors. Controls lateral root founder cell specification. |
AT5G26990 | Drought-responsive family protein;(source:Araport11) |
AT5G27010 | ARM repeat superfamily protein;(source:Araport11) |
AT5G27020 | hypothetical protein;(source:Araport11) |
AT5G27043 | pseudogene of cell division cycle 20.2;(source:Araport11) |
AT5G27120 | SAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; has similarity to MAR binding NOP58 protein The mRNA is cell-to-cell mobile. |
AT5G27130 | AGAMOUS-like 39;(source:Araport11) |
AT5G27140 | NOP56-like pre RNA processing ribonucleoprotein;(source:Araport11) |
AT5G27150 | Encodes a vacuolar sodium/proton antiporter involved in salt tolerance, ion homeostasis, and leaf development. The mRNA is cell-to-cell mobile. |
AT5G27210 | Protein of unknown function, transmembrane-40;(source:Araport11) |
AT5G27220 | Frigida-like protein;(source:Araport11) |
AT5G27230 | Frigida-like protein;(source:Araport11) |
AT5G27238 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT5G27247 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G27310 | Transcription factor IIS family protein;(source:Araport11) |
AT5G27320 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. |
AT5G27350 | Encodes a sugar-porter family protein that is induced during leaf senescence. The increase in its gene expression during leaf senescence is paralleled by an accumulation of monosaccharides. The mRNA is cell-to-cell mobile. |
AT5G27400 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; CONTAINS InterPro DOMAIN/s: Methyltransferase-16, putative (InterPro:IPR019410); BEST Arabidopsis thaliana protein match is: D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein (TAIR:AT5G27410.2). Note that the At5g27410.2 gene model (TAIR10) of the adjacent locus has been obsoleted due to the lack of experimental support. |
AT5G27410 | D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Aminotransferase, class IV (InterPro:IPR001544); BEST Arabidopsis thaliana protein match is: D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein (TAIR:AT3G05190.1). Note that the At5g27410.2 gene model (TAIR10) has been obsoleted due to the lack of experimental support. |
AT5G27430 | Signal peptidase subunit;(source:Araport11) |
AT5G27460 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G27470 | seryl-tRNA synthetase / serine-tRNA ligase;(source:Araport11) |
AT5G27500 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43920.1);(source:TAIR10) |
AT5G27510 | Protein kinase superfamily protein;(source:Araport11) |
AT5G27530 | Member of pectin lyase gene family. |
AT5G27540 | Encodes a protein with similarity to GTPases that is localized to the mitochondrion. Involved in embryogenesis, pollen tube growth and required for mitochondrial development. |
AT5G27550 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G27580 | AGAMOUS-like 89;(source:Araport11) |
AT5G27610 | protein ALWAYS EARLY 1;(source:Araport11) |
AT5G27620 | core cell cycle genes The mRNA is cell-to-cell mobile. |
AT5G27640 | encodes a member of eukaryotic translation initiation factor 3B family. |
AT5G27670 | Encodes HTA7, a histone H2A protein. |
AT5G27680 | RECQ helicase SIM;(source:Araport11) |
AT5G27700 | Cytosolic ribosomal protein. Similar to EVR1 and redundant with EVR1. Also enhances VAR2 mutant varigation, but to a lesser extent than evr1. |
AT5G27807 | Encodes a microRNA that targets several genes containing NAC domains including NAC1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCG. Early extra petal mutant (eep1). Pri-mRNA coordinates for MIR164c (converted to TAIR10 based on PMID19304749): Chr5: 9852483-9853314 (forward), length: 832 bp; exon coordinates: exon 1: 9852483-9853314; mature miRNA and miRNA* are located on exon 1. |
AT5G27840 | Encodes a Type One Protein Phosphatase that acts as a nucleocytoplasmic negative regulator of tip growth. Mutants affect pollen germination, pollen tube growth, and root hair growth. It acts genetically downstream of ANX1 (AT3G04690) and ANX2 (AT5G28680) and is functionally redundant with ATUNIS1/TOPP9 (AT3G05580). |
AT5G27850 | Ribosomal protein L18e/L15 superfamily protein;(source:Araport11) |
AT5G27870 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT5G27889 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G27902 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 5.3e-51 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT5G27930 | EGR2 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress. EGR2 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
AT5G27940 | WPP domain protein 3;(source:Araport11) |
AT5G27950 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G28010 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT5G28020 | Encodes cysteine synthase CysD2. |
AT5G28050 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
AT5G28080 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. |
AT5G28145 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.1e-195 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT5G28150 | hypothetical protein (DUF868);(source:Araport11) |
AT5G28180 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G28190 | transmembrane protein;(source:Araport11) |
AT5G28210 | mRNA capping enzyme family protein;(source:Araport11) |
AT5G28237 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
AT5G28240 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10) |
AT5G28280 | pseudogene of sterol desaturase domain-containing protein;(source:Araport11) |
AT5G28285 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 9.8e-101 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
AT5G28295 | hypothetical protein;(source:Araport11) |
AT5G28300 | Encodes a Ca(2+)-dependent CaM-binding protein. AtGT2L specifically targets the nucleus and possesses both transcriptional activation and DNA-binding abilities, implicating its function as a nuclear transcription factor. |
AT5G28310 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G28463 | transmembrane protein;(source:Araport11) |
AT5G28480 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G28270.1);(source:TAIR10) |
AT5G28490 | Encodes a nuclear protein that mediates light regulation of seedling development in a phytochrome-dependent manner. |
AT5G28510 | beta glucosidase 24;(source:Araport11) |
AT5G28523 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 8.9e-31 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT5G28525 | pseudogene of hypothetical protein;(source:Araport11) |
AT5G28526 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 7.1e-289 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
AT5G28530 | FAR1-related sequence 10;(source:Araport11) |
AT5G28545 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.7e-08 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT5G28550 | separase;(source:Araport11) |
AT5G28600 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10) |
AT5G28605 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.3e-44 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT5G28620 | kinase C-like protein;(source:Araport11) |
AT5G28637 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.1e-23 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT5G28646 | Encodes a novel protein. The wvd2 gain-of-function mutant has impaired cell expansion and root waving, and changed root skewing. |
AT5G28680 | Receptor-like kinase required for maintenance of pollen tube growth. Display polar localization at the plasma membrane of the pollen tube tip. |
AT5G28773 | transposable_element_gene;(source:Araport11);pseudogene, similar to Putative retroelement, similar to putative reverse transcriptase;(source:TAIR10) |
AT5G28776 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.6e-199 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT5G28780 | PIF1 helicase;(source:Araport11) |
AT5G28870 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G28880 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G28885 | hypothetical protein;(source:Araport11) |
AT5G28890 | transposable_element_gene;(source:Araport11);similar to DNA binding [Arabidopsis thaliana] (TAIR:AT4G01980.1);(source:TAIR10) |
AT5G28892 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, blastp match of 40%25 identity and 7.3e-142 P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT5G28894 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-23 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT5G28910 | alpha-(1,6)-fucosyltransferase;(source:Araport11) |
AT5G28927 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 3.9e-45 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
AT5G28935 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.0e-48 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT5G28996 | pseudogene of phosphoenolpyruvate carboxykinase 1;(source:Araport11) |
AT5G29015 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.3e-121 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
AT5G29020 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G60930.1);(source:TAIR10) |
AT5G29029 | transposable_element_gene;(source:Araport11);pseudogene, similar to Putative copia-type polyprotein, blastp match of 46%25 identity and 3.0e-30 P-value to GP|15209144|gb|AAK91877.1|AC091665_3|AC091665 Putative copia-type polyprotein {Oryza sativa};(source:TAIR10) |
AT5G29031 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G29090 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G33131.1);(source:TAIR10) |
AT5G29210 | hypothetical protein;(source:Araport11) |
AT5G29560 | caleosin-related family protein;(source:Araport11) |
AT5G29562 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.8e-228 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT5G30269 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-141 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT5G30584 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-15 P-value blast match to GB:CAA28054 ORF (Ty1_Copia-element) (Drosophila melanogaster);(source:TAIR10) |
AT5G30852 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to contains similarity to Arabidopsis thaliana hypothetical protein (GB:AC004483);(source:TAIR10) |
AT5G31122 | transposable_element_gene;(source:Araport11);pseudogene, similar to Putative copia-type polyprotein, blastp match of 56%25 identity and 1.5e-39 P-value to GP|15209144|gb|AAK91877.1|AC091665_3|AC091665 Putative copia-type polyprotein {Oryza sativa};(source:TAIR10) |
AT5G31355 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 9.8e-153 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT5G31412 | hAT transposon superfamily protein;(source:Araport11) |
AT5G31770 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.7e-53 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G31787 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32312.1);(source:TAIR10) |
AT5G31804 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-259 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G31807 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.4e-05 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT5G31821 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 6.2e-86 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G32072 | pseudogene of Glucose-6-phosphate isomerase |
AT5G32112 | transposable_element_gene;(source:Araport11);pseudogene, replication protein A1 -related, similar to putative replication protein A1;(source:TAIR10) |
AT5G32600 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G60930.1);(source:TAIR10) |
AT5G32605 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G06140.1);(source:TAIR10) |
AT5G32630 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, various predicted helicase proteins, Arabidopsis thaliana and others;(source:TAIR10) |
AT5G32702 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-150 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
AT5G32875 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-79 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G32925 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.0e-105 P-value blast match to GB:AAA66266 unknown protein ORF1 transposable element En-1 (CACTA-element) (Zea mays);(source:TAIR10) |
AT5G32975 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative transposase, similar to En/Spm-like transposon protein, putative;(source:TAIR10) |
AT5G33050 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 6.2e-129 P-value blast match to gb|AAL06421.1|AF378079_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10) |
AT5G33270 | transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBb0043H09.1, predicted proteins - Arabidopsis thaliana;(source:TAIR10) |
AT5G33285 | transposable_element_gene;(source:Araport11);pseudogene, similar to Hypothetical protein with similarity to putative Ac-like transposases, similar to Ac-like transposase;(source:TAIR10) |
AT5G33290 | Acts as a xylogalacturonan xylosyltransferase within the XGA biosynthesis pathway. Involved in pectin biosynthesis. |
AT5G33340 | Encodes a protein with aspartic protease activity (also known as aspartate-type endopeptidase activity). Overexpression of the gene was shown to lead to salicylic acid (SA)-mediated disease resistance upon exposure to the pathogen Pseudomonas syringae. Moreover, overexpression of this gene led to the upregulation of two pathogenesis-related genes PR1 and PR2. This upregulation was no longer observed in transgenic lines expressing the bacterial NahG gene encoding a hydroxylase suppressing SA accumulation. |
AT5G33360 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT1G17390.1);(source:TAIR10) |
AT5G33370 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. Mutants are defective in cuticle formation with reduced sepal cuticle ridge formation. |
AT5G33405 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
AT5G33406 | hAT dimerization domain-containing protein / transposase-like protein;(source:Araport11) |
AT5G33420 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G33441 | pseudogene of cytochrome P450;(source:Araport11) |
AT5G34832 | pseudogene of hypothetical protein;(source:Araport11) |
AT5G34835 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G34839 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-09 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G34841 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 0.00011 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G34846 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.2e-44 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G34848 | pseudogene of hypothetical protein;(source:Araport11) |
AT5G34850 | Encodes a root-secreted purple acid phosphatase precursor involved in extracellular phosphate-scavenging. |
AT5G34854 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-96 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT5G34857 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.7e-70 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT5G34860 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G06908.1);(source:TAIR10) |
AT5G34866 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 5.8e-39 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G34871 | other_RNA;(source:Araport11) |
AT5G34920 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 3.2e-40 P-value blast match to At5g59620.1/14-257 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G34940 | The protein is predicted (WoLF PSORT program) to be membrane-associated. |
AT5G34945 | pseudogene of Zinc-finger domain of monoamine-oxidase A repressor R1 protein;(source:Araport11) |
AT5G35050 | hypothetical protein (DUF1985);(source:Araport11) |
AT5G35073 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.3e-39 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
AT5G35080 | Encodes a protein involved in the endoplasmic reticulum-associated degradation of glycoproteins. |
AT5G35111 | pseudogene of Peroxidase superfamily protein;(source:Araport11) |
AT5G35118 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.5e-10 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G35160 | Endomembrane protein 70 protein family;(source:Araport11) |
AT5G35170 | adenylate kinase family protein;(source:Araport11) |
AT5G35190 | proline-rich extensin-like family protein;(source:Araport11) |
AT5G35200 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
AT5G35220 | Membrane-associated and ATP-independent metalloprotease; EGY1 protein contains eight trans-membrane domains at its C-terminus, and carries out beta-casein degradation in an ATP-independent manner. EGY1 is required for development of both thylakoid grana and a well-organized lamellae system in chloroplast. Additionally, EGY1 is required for the accumulation of chlorophyll and chlorophyll a/b binding (CAB) proteins (both PS I and PS II) in chloroplast membranes, and for grana formation and normal chloroplast development. Loss of EGY1 function also has an effect on endodermal plastid biogenesis. Mutant studies suggest that EGY1 is involved in the regulation of nuclear gene expression response to ammonium stress and interacts with ABA signaling. |
AT5G35280 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G07310.1);(source:TAIR10) |
AT5G35339 | pseudogene of Polynucleotidyl transferase;(source:Araport11) |
AT5G35341 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G35360 | Encodes biotin carboxylase subunit (CAC2). |
AT5G35370 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT5G35375 | transmembrane protein;(source:Araport11) |
AT5G35407 | Encodes a microRNA that targets several GRF family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCCACAGCUUUCUUGAACUU. Expression increased with leaf development, antagonizing with expression of GRFs. Transcript accumulates in the distal zone of young developing seeds, restricing the expression of GRF2 to the proximal part. miR396 attenuates cell proliferation in developing leaves through the repression of GRF activity and a decrease in the expression of cell cycle genes. |
AT5G35410 | encodes a member of the CBL-interacting protein kinase family, is a regulatory component controlling plant potassium nutrition |
AT5G35450 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
AT5G35460 | membrane protein;(source:Araport11) |
AT5G35510 | TIR-NBS-LRR class disease resistance protein;(source:Araport11) |
AT5G35520 | encodes a homologue of the yeast (S. pombe) Mis12 (minichromosome instability) protein. MIS12 co-localizes with 180 bp repeats of centromeric DNA throughout the cell cycle with a similar pattern to AtCENH3/HTR12. Neither of these two proteins completely cover the 180 bp regions based on FISH analysis. |
AT5G35550 | TT2 encodes a R2R3 MYB domain putative transcription factor that acts as a key determinant in the proanthocyanidin accumulation of developing seed. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. |
AT5G35555 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.1e-177 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT5G35575 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 7.5e-41 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT5G35580 | Protein kinase superfamily protein;(source:Araport11) |
AT5G35600 | Encodes a histone deacetylase that is crucial for female gametophyte development and embryogenesis. |
AT5G35603 | hypothetical protein (DUF3287);(source:Araport11) |
AT5G35605 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
AT5G35615 | pseudogene of Ribonuclease H-like superfamily protein;(source:Araport11) |
AT5G35630 | chloroplastic glutamine synthetase The mRNA is cell-to-cell mobile. |
AT5G35640 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
AT5G35715 | encodes a protein with cytochrome P450 domain |
AT5G35720 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.9e-12 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT5G35735 | Auxin-responsive family protein;(source:Araport11) |
AT5G35736 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G35737 | Ta11-like non-LTR retrotransposon;(source:Araport11). Maternally expressed, imprinted gene. |
AT5G35750 | Encodes histidine kinase AHK2. |
AT5G35756 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.3e-30 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT5G35760 | Beta-galactosidase related protein;(source:Araport11) |
AT5G35780 | pseudogene of B3 domain protein (DUF313);(source:Araport11) |
AT5G35805 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G01700.1);(source:TAIR10) |
AT5G35830 | Ankyrin repeat family protein;(source:Araport11) |
AT5G35917 | a pseudogene with cytochrome P450 domain |
AT5G35926 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
AT5G35932 | pseudogene of hypothetical protein;(source:Araport11) |
AT5G35935 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-232 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT5G35950 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT5G35960 | Protein kinase family protein;(source:Araport11) |
AT5G36090 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G28010.1);(source:TAIR10) |
AT5G36160 | Encodes a cytosolic L-tyrosine aminotransferase. AtTAT2 exhibits much broader amino donor specificity than AtTAT1 and can use not only Tyr but also Phe, Trp, His, Met, Leu, Ala, Ser, Cys, Asp, Asn, Gln, and Arg as amino donors. |
AT5G36190 | F-box protein interaction domain protein;(source:Araport11) |
AT5G36210 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G36228 | nucleic acid binding / zinc ion binding protein;(source:Araport11) |
AT5G36230 | ARM repeat superfamily protein;(source:Araport11) |
AT5G36260 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT5G36270 | Annotated as pseudogene of dehydroascorbate reductase. Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT5G36296 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.6e-14 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G36297 | pseudogene of aspartyl protease family protein |
AT5G36880 | Encodes a plastidic acetyl-coA synthetase. This enzyme plays a role in converting acetate to acetyl-coA in the plastids. It does not appear to be a major contributor to fatty acid biosynthesis based on mutant phenotypes. The enzyme seems to act as a monomer and may play an important role in preventing the toxic accumulation of fermentation products including acetaldehyde, acetate, and ethanol. It participates in the pyruvate dehydrogenase bypass pathway |
AT5G36903 | pseudogene of protein related to self-incompatibility |
AT5G36960 | hypothetical protein;(source:Araport11) |
AT5G36970 | NDR1/HIN1-like protein, expression induced during incompatible response to a pathogen, expression is at least partly dependent on the salicylic acid signaling pathway |
AT5G36990 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 8.5e-61 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G37055 | Encodes SERRATED LEAVES AND EARLY FLOWERING (SEF), an Arabidopsis homolog of the yeast SWC6 protein, a conserved subunit of the SWR1/SRCAP complex. SEF loss-of-function mutants have a pleiotropic phenotype characterized by serrated leaves, frequent absence of inflorescence internodes, bushy aspect, and flowers with altered number and size of organs. sef plants flower earlier than wild-type plants both under inductive and non-inductive photoperiods. SEF, ARP6 and PIE1 might form a molecular complex in Arabidopsis related to the SWR1/SRCAP complex identified in other eukaryotes. |
AT5G37140 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G37160 | P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11) |
AT5G37170 | O-methyltransferase family protein;(source:Araport11) |
AT5G37175 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT2G15750.1);(source:TAIR10) |
AT5G37200 | RING/U-box superfamily protein;(source:Araport11) |
AT5G37210 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G37260 | Encodes a MYB family transcription factor Circadian 1 (CIR1). Involved in circadian regulation in Arabidopsis. |
AT5G37310 | Endomembrane protein 70 protein family;(source:Araport11) |
AT5G37320 | hypothetical protein (DUF674);(source:Araport11) |
AT5G37370 | encodes a putative splicing factor. Over-expression in yeast and Arabidopsis result in increased tolerance to high salt. |
AT5G37430 | hypothetical protein (DUF577);(source:Araport11) |
AT5G37440 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT5G37445 | pseudogene of hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G37450 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G37460 | hypothetical protein (DUF577);(source:Araport11) |
AT5G37476 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-18 P-value blast match to GB:CAA37925 orf 3 (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G37478 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
AT5G37480 | maltase-glucoamylase, intestinal protein;(source:Araport11) |
AT5G37490 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G37500 | Encodes a guard cell outward potassium channel. Belongs to the Shaker family K+ channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mutants have increased water consumption and limited stomatal closure in response to abscisic and jasmonic acids. It forms a heteromeric K(out) channels with SKOR. The gene is expressed ubiquitously in root and the vasculature and guard cells of leaves. Expression is suppressed during agrobacterium-induced tumor formation and increased in response to water deprivation and cold. |
AT5G37540 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT5G37550 | hypothetical protein;(source:Araport11) |
AT5G37560 | RING/U-box superfamily protein;(source:Araport11) |
AT5G37590 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G37650 | hypothetical protein (DUF577);(source:Araport11) |
AT5G37660 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
AT5G37730 | hypothetical protein;(source:Araport11) |
AT5G37732 | pseudogene of hypothetical protein;(source:Araport11) |
AT5G37770 | Encodes a protein with 40% similarity to calmodulin. Binds Ca(2+) and, as a consequence, undergoes conformational changes. CML24 expression occurs in all major organs, and transcript levels are increased from 2- to 15-fold in plants subjected to touch, darkness, heat, cold, hydrogen peroxide, abscisic acid (ABA), and indole-3-acetic acid. However, CML24 protein accumulation changes were not detectable. The putative CML24 regulatory region confers reporter expression at sites of predicted mechanical stress; in regions undergoing growth; in vascular tissues and various floral organs; and in stomata, trichomes, and hydathodes. CML24-underexpressing transgenics are resistant to ABA inhibition of germination and seedling growth, are defective in long-day induction of flowering, and have enhanced tolerance to CoCl(2), molybdic acid, ZnSO(4), and MgCl(2). Also regulates nitric oxide levels. |
AT5G37790 | Protein kinase superfamily protein;(source:Araport11) |
AT5G37795 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
AT5G37800 | RHD SIX-LIKE 1;(source:Araport11) |
AT5G37810 | NOD26-like intrinsic protein 4;(source:Araport11) |
AT5G37830 | Encodes a 5-oxoprolinase that acts in the glutathione degradation pathway and in 5-oxoproline metabolism. |
AT5G37840 | PADRE protein, up-regulated after infection by S. sclerotiorum. |
AT5G37860 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT5G37920 | hypothetical protein (DUF577);(source:Araport11) |
AT5G37930 | Protein with RING/U-box and TRAF-like domain;(source:Araport11) |
AT5G37970 | SABATH family methyltransferase. |
AT5G37980 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
AT5G38000 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
AT5G38005 | other_RNA;(source:Araport11) |
AT5G38020 | encodes a protein whose sequence is similar to SAM:salicylic acid carboxyl methyltransferase (SAMT) (GI:6002712)(Clarkia breweri) and to SAM:benzoic acid carboxyl methyltransferase (BAMT)(GI:9789277)(Antirrhinum majus). SABATH family methyltransferase. |
AT5G38030 | MATE transporter involved in auxin homeostasis in roots. |
AT5G38035 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.9e-71 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G38080 | transmembrane protein;(source:Araport11) |
AT5G38100 | SABATH family methyltransferase. |
AT5G38130 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT5G38210 | Protein kinase family protein;(source:Araport11) |
AT5G38240 | Protein kinase family protein;(source:Araport11) |
AT5G38250 | Protein kinase family protein;(source:Araport11) |
AT5G38270 | F-box family protein;(source:Araport11) |
AT5G38275 | pseudogene of PR5-like receptor kinase;(source:Araport11) |
AT5G38310 | hypothetical protein;(source:Araport11) |
AT5G38317 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT5G38344 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
AT5G38350 | Disease resistance protein (NBS-LRR class) family;(source:Araport11) |
AT5G38380 | zinc transporter;(source:Araport11) |
AT5G38386 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G38393 | pseudogene of F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G38396 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G38400 | hypothetical protein;(source:Araport11) |
AT5G38440 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT5G38450 | cytochrome P450, family 735, subfamily A, polypeptide 1;(source:Araport11) |
AT5G38470 | Encodes a member of the RADIATION SENSITIVE23 (RAD23) family: AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome. |
AT5G38490 | B3 domain protein (DUF313);(source:Araport11) |
AT5G38500 | B3 domain protein (DUF313);(source:Araport11) |
AT5G38510 | Rhomboid-related intramembrane serine protease family protein;(source:Araport11) |
AT5G38520 | CLD1 is involved in steady-state chlorophyll turnover; CLD1 dephytylates chlorophyll a, chlorophyll b, and pheophytin a in vitro; CLD1 and CHLG form a salvage cycle in recycling chlorophyll. Suppression of CLD1 expression results in reduced tolerance to moderately high temperature. |
AT5G38540 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT5G38565 | F-box/FBD-like domains containing protein;(source:Araport11) |
AT5G38570 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G38610 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT5G38620 | MADS-box transcription factor family protein;(source:Araport11) |
AT5G38640 | NagB/RpiA/CoA transferase-like superfamily protein;(source:Araport11) |
AT5G38650 | Proteasome maturation factor UMP1;(source:Araport11) |
AT5G38710 | Methylenetetrahydrofolate reductase family protein;(source:Araport11) |
AT5G38730 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G38800 | basic leucine-zipper 43;(source:Araport11) |
AT5G38810 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT5G38850 | Disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
AT5G38900 | Thioredoxin superfamily protein;(source:Araport11) |
AT5G38960 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT5G38970 | Encodes a polypeptide involved in the C-6 oxidation of brassinosteroids. Heterologous expression of the protein in yeast conferred the ability to catalyze multiple reactions in which the C-6 position of 6-deoxocastasterone, 6-deoxotyphasterol, 3-dehydro-6-deoxoteasterone and 6-deoxoteasterone are oxidized. |
AT5G38975 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.0e-15 P-value blast match to GB:CAA30503 pol polypeptide (Ty1_Copia-element) (Drosophila melanogaster);(source:TAIR10) |
AT5G39000 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
AT5G39040 | Encodes a member of TAP subfamily of ABC transporters that is located in the vacuole. Mutants are hypersensitive to aluminum and the gene product may be important for intracellular movement of some substrate, possibly chelated Al, as part of a mechanism of aluminum sequestration. |
AT5G39050 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. |
AT5G39060 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 7.3e-252 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G39095 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-250 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT5G39100 | germin-like protein (GLP6) |
AT5G39110 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT5G39210 | Encodes a protein of the chloroplastic NAD(P)H dehydrogenase complex (NDH Complex) involved in respiration, photosystem I (PSI) cyclic electron transport and CO2 uptake. The product of this gene appears to be essential for the stable formation of the NDH Complex. The mRNA is cell-to-cell mobile. |
AT5G39230 | TFIIB zinc-binding protein;(source:Araport11) |
AT5G39240 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
AT5G39320 | UDP-glucose 6-dehydrogenase family protein;(source:Araport11) |
AT5G39330 | transmembrane protein, putative (DUF1163);(source:Araport11) |
AT5G39380 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
AT5G39390 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G39400 | Calcium/lipid-binding (CaLB) phosphatase;(source:Araport11) |
AT5G39420 | CDC2C;(source:Araport11) |
AT5G39460 | F-box family protein;(source:Araport11) |
AT5G39470 | F-box family protein;(source:Araport11) |
AT5G39473 | pseudogene of DC1 (domain-containing protein) |
AT5G39480 | F-box family protein;(source:Araport11) |
AT5G39500 | Encodes GNOM-LIKE1/ERMO1, a member of ARF-GEF family. Required for endoplasmic reticulum (ER) morphology. The mRNA is cell-to-cell mobile. |
AT5G39520 | Plastid localized transmembrane protein involved in ABA mediated leaf senescence and stomatal movement. |
AT5G39532 | Pseudogene of AT3G59455 |
AT5G39540 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT5G39610 | Encodes a NAC-domain transcription factor. Positively regulates aging-induced cell death and senescence in leaves. This gene is upregulated in response to salt stress in wildtype as well as NTHK1 transgenic lines although in the latter case the induction was drastically reduced. It was also upregulated by ABA, ACC and NAA treatment, although in the latter two cases, the induction occurred relatively late when compared with NaCl or ABA treatments. Note: this protein (AtNAC6) on occasion has also been referred to as AtNAC2, not to be confused with the AtNAC2 found at locus AT3G15510. |
AT5G39620 | RAB GTPase homolog G1;(source:Araport11) |
AT5G39630 | Vesicle transport v-SNARE family protein;(source:Araport11) |
AT5G39670 | Calmodulin like protein involved in negative regulation of pattern triggered immunity. |
AT5G39690 | NAC domain containing protein 93;(source:Araport11) |
AT5G39760 | Functions together with TZP in co-regulation of the expression of blue-light dependent transcriptional regulators. Coassociates with and regulates the expression of light-regulated loci as well as transcriptional regulators to shape plant development in response to environmental stimuli with targets in RNA processing factors as well as proteins involved in salt stress and ABA signaling, in addition to embryo development. Acts downstream of TZP action with regard to blue-light-regulated hypocotyl elongation. |
AT5G39785 | hypothetical protein (DUF1666);(source:Araport11) |
AT5G39820 | NAC domain containing protein 94;(source:Araport11) |
AT5G39850 | Ribosomal protein S4;(source:Araport11) |
AT5G39860 | Encodes PRE1 (PACLOBUTRAZOL RESISTANCE1). PRE1 and IBH1 form a pair of antagonistic HLH/bHLH transcription factors that function downstream of BZR1 to mediate brassinosteroid regulation of cell elongation. BNQ1 is directly and negatively regulated by AP3 and PI in petals.Required for appropriate regulation of flowering time. |
AT5G39861 | pseudogene of receptor kinase 3;(source:Araport11) |
AT5G39863 | pseudogene of receptor kinase 3;(source:Araport11) |
AT5G39865 | Glutaredoxin family protein;(source:Araport11) |
AT5G39870 | hypothetical protein (DUF1216);(source:Araport11) |
AT5G39920 | pre-mRNA cleavage complex II protein;(source:Araport11) |
AT5G39930 | Encodes a protein with similarity to the CLP1 polyadenylation factor. |
AT5G39940 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
AT5G39990 | Encodes GlcAT14A, a beta-glucuronosyltransferase involved in the biosynthesis of type II arabinogalactan. The protein was localized to the Golgi apparatus when transiently expressed in Nicotiana benthamiana. Plays a role in cell elongation during seedling growth. |
AT5G39995 | pseudogene of myb domain protein 110;(source:Araport11) |
AT5G40010 | Encodes a mitochondrial ATPase involved in seed and silique development. |
AT5G40130 | pseudogene of ribosomal protein L5 B;(source:Araport11) |
AT5G40160 | Encodes ankyrin repeat protein EMB506. Mutations in this locus result in embryo lethality. |
AT5G40170 | receptor like protein 54;(source:Araport11) |
AT5G40190 | Identified in a screen for calmodulin-binding proteins obtained from an auxin treated cDNA library. |
AT5G40230 | nodulin MtN21-like transporter family protein |
AT5G40250 | RING/U-box superfamily protein;(source:Araport11) |
AT5G40260 | Encodes RPG1 (RUPTURED POLLEN GRAIN1), a member of the MtN3/saliva gene family. Crucial for exine pattern formation and cell integrity of microspores. |
AT5G40275 | other_RNA;(source:Araport11) |
AT5G40280 | encodes a beta subunit of farnesyl-trans-transferase, which is involved in meristem organization and ABA-mediated signal transduction pathway. Mutant phenotypes have been observed in meristem organization, and response to abscisic acid and drought. The mRNA is cell-to-cell mobile. |
AT5G40290 | HD domain-containing metal-dependent phosphohydrolase family protein;(source:Araport11) |
AT5G40330 | Encodes a MYB gene that, when overexpressed ectopically, can induce ectopic trichome formation. It is a member of subgroup 15, together with WER and GL1. Members of this subgroup share a conserved motif of 19 amino acids in the putative transcription activation domain at the C-terminal end. The gene is expressed in leaves, stems, flowers, seeds and roots and quite strongly in trichomes. There is partial functional redundancy between ATMYB23 and GL1. The two proteins are functionally equivalent with respect to the regulation of trichome initiation but not with respect to trichome branching - which is controlled by MYB23 and not GL1. |
AT5G40360 | Encodes a member of the MYB family of transcription factors and in involved in regulation of glucosinolate (GLS) biosynthesis. MYB115 binds to the promoters of a number of GLS biosynthetic enzymes and mutations show differences in accumulation of GLS compared to wild type. |
AT5G40370 | Glutaredoxin family protein;(source:Araport11) |
AT5G40380 | Encodes a cysteine-rich receptor-like protein kinase. |
AT5G40382 | Cytochrome c oxidase subunit Vc family protein;(source:Araport11) |
AT5G40384 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: ACAAAAUCCGUCUUUGAAGA |
AT5G40390 | Encodes a protein which might be involved in the formation of verbascose. A T-DNA insertion mutant was shown to have a decreased amount of verbascose (as well as mannitol) whereas the levels of raffinose and stachyose remained unchanged. Enhances drought tolerance through raffinose synthesis or galactinol hydrolysis. |
AT5G40395 | U6acat;(source:Araport11) |
AT5G40410 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G40440 | Encodes a mitogen-activated protein kinase kinase. Activates MPK8 and is a target of MPKKK20. Mutant root growth is sensitive oryzalin and suggestive of a role in signaling during microtubule organization. |
AT5G40450 | Encodes a member of a plant gene family, APK_ORTHOMCL5144,of unknown function. RBB1 is localized to the cytosol and involved in vacuolar biogenesis and organization. RBB1 mutants have increased number of vacuolar bulbs and fewer trans-vacuolar strands. |
AT5G40460 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
AT5G40470 | RNI-like superfamily protein;(source:Araport11) |
AT5G40490 | HLP1 is a member of the conserved hnRNP A/B family and contains RNA Recognition Motifs (RRM).It binds mRNA and appears to be involved in targeting alternative polyadenylation (APA). APA targets include genes involved in flowering. Loss of HLP1 function results causes late flowering under long and short day conditions. This phenotype is suppressed by loss of FLC. |
AT5G40510 | Sucrase/ferredoxin-like family protein;(source:Araport11) |
AT5G40580 | Encodes 20S proteasome beta subunit PBB2 (PBB2). |
AT5G40590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G40620 | transmembrane protein;(source:Araport11) |
AT5G40630 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT5G40640 | transmembrane protein;(source:Araport11) |
AT5G40680 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G40690 | histone-lysine N-methyltransferase trithorax-like protein;(source:Araport11) |
AT5G40830 | Encodes an SAM‐dependent methyltransferase superfamily protein that has an N‐terminal transmembrane domain and a putative methyltransferase domain, DUF248, and is strongly expressed in the vasculature. Overexpression results in increased phloem and xylem in the plant. |
AT5G40880 | Involved in seed germination, seedling/seed development, interacting with PPPDE family protein Desi1. |
AT5G40890 | Encodes a member of the voltage-dependent chloride channel. Also functions as a NO3-/H+ exchanger that serves to accumulate nitrate nutrient in vacuoles. Mutants homozygous for the T-DNA insertion mutation have reduced nitrate uptake capacity in high nitrate environment and exhibit hypersensitivity to chlorate. Role in cytosolic pH homeostasis. |
AT5G40981 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G40990 | Component of plant resistance. Contains lipase signature motif and GDSL domain. Directly interferes with the fungal infection process by acting on fungal cell walls through its action as a antimicrobial compound. Critical component for both local and systemic resistance responses in the incompatible interaction with Alternaria brassicicola in the ethylene-dependent pathway. |
AT5G41040 | Encodes a feruloyl-CoA transferase required for suberin synthesis. Has feruloyl-CoA-dependent feruloyl transferase activity towards substrates with a primary alcohol. |
AT5G41060 | DHHC-type zinc finger family protein;(source:Araport11) |
AT5G41080 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
AT5G41090 | NAC domain containing protein 95;(source:Araport11) |
AT5G41100 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G41109 | hypothetical protein;(source:Araport11) |
AT5G41110 | meiosis chromosome segregation family protein;(source:Araport11) |
AT5G41170 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT5G41190 | Encodes a cytoplasmic protein with RNA endonuclease activity. Mutants display aberrant RNA processing and male and female gametophyte development. |
AT5G41250 | Exostosin family protein;(source:Araport11) |
AT5G41265 | pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10) |
AT5G41300 | Receptor-like protein kinase-related family protein;(source:Araport11) |
AT5G41310 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
AT5G41315 | Encodes a basic helix loop helix domain protein that interacts with GL1 in trichome development.GL3 interacts with JAZ and DELLA proteins to regulate trichome initiation. |
AT5G41320 | stress response NST1-like protein;(source:Araport11) |
AT5G41330 | BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11) |
AT5G41360 | Encodes XPB2, a DNA repair protein and transcription factor. Arabidopsis thaliana has duplicated XPB gene (AtXPB1 and AtXPB2, with high similarity to each other). XPB proteins are involved in both DNA repair and transcription, they are component of the transcription factor IIH (TFIIH) and are responsible for DNA helicase activity during nucleotide (nt) excision repair (NER). Complementation assays in yeast rad25 mutant strains suggest the involvement of AtXPB2 in DNA repair. Although both genes are expressed in a constitutive manner during the plant life cycle, Northern blot analyses suggest that light modulates the expression level of both XPB copies.XPB2 preferentially expressed in developing organs and during the cell cycle. |
AT5G41370 | Encodes XPB1, a DNA repair protein and transcription factor. Arabidopsis thaliana has duplicated XPB gene (AtXPB1 and AtXPB2, with high similarity to each other). XPB proteins are involved in both DNA repair and transcription, they are component of the transcription factor IIH (TFIIH) and are responsible for DNA helicase activity during nucleotide (nt) excision repair (NER). Complementation assays in yeast rad25 mutant strains suggest the involvement of AtXPB2 in DNA repair. Although both genes are expressed in a constitutive manner during the plant life cycle, Northern blot analyses suggest that light modulates the expression level of both XPB copies. The mRNA is cell-to-cell mobile. |
AT5G41390 | PLAC8 family protein;(source:Araport11) |
AT5G41410 | Homeodomain protein required for ovule identity.Loss of function mutations show homeotic conversion of integuments to carpels.Forms heterodimers with STM and KNAT1. Interacts with AG-SEP heterodimers is thought to restrict WUS expression. BEL interacts with MADS box dimers composed of SEP1(or SEP3) and AG, SHP1, SHP2 and STK. The interaction of BEL1 with AG-SEP3 is required for proper integument development and specification of integument identity. |
AT5G41480 | Encodes a dihydrofolate synthetase based on yeast complementation experiments. This protein is involved in folate biosynthesis. |
AT5G41490 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT5G41500 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT5G41530 | transmembrane protein;(source:Araport11) |
AT5G41550 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G41590 | LURP-one-like protein (DUF567);(source:Araport11) |
AT5G41600 | VIRB2-interacting protein 3;(source:Araport11) |
AT5G41612 | Natural antisense transcript overlaps with AT5G41610;(source:Araport11) |
AT5G41620 | intracellular protein transporter USO1-like protein;(source:Araport11) |
AT5G41640 | Mutants have decreased tolerance to osmotic stress. |
AT5G41663 | Encodes a microRNA that targets several TCP family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGGACUGAAGGGAGCUCCCU. Pri-mRNA coordinates for MIR319b (converted to TAIR10 based on PMID19304749): Chr5: 16660967-16660095 (reverse), length: 873 bp; exon coordinates: exon 1: 16660967 to 16660095; mature miRNA and miRNA* are located on exon 1. |
AT5G41690 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G41710 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 6.2e-18 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT5G41730 | Protein kinase family protein;(source:Araport11) |
AT5G41740 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G41750 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G41765 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
AT5G41780 | myosin heavy chain-like protein;(source:Araport11) |
AT5G41790 | encodes a protein that physically interacts specifically with the putative coiled-coil region of COP1 in vitro. In hypocotyl and cotyledon protoplasts, it is associated to the cytoskeleton, but not in the root. expression is not regulated by light. The mRNA is cell-to-cell mobile. |
AT5G41800 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT5G41820 | RAB geranylgeranyl transferase alpha subunit 2;(source:Araport11) |
AT5G41840 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G41905 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC |
AT5G41950 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G42010 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G42020 | Luminal binding protein (BiP2) involved in polar nuclei fusion during proliferation of endosperm nuclei. |
AT5G42053 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G42120 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT5G42130 | Encodes a protein belonging to the mitochondrial carrier family and similar to animal mitoferrin but likely NOT to be located in the mitochondria, but rather in chloroplasts. It is likely to be involved in transporting iron into the chloroplast. |
AT5G42180 | Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
AT5G42210 | Major facilitator superfamily protein;(source:Araport11) |
AT5G42223 | Encodes a defensin-like (DEFL) family protein. |
AT5G42242 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT5G42323 | Pseudogene of AT1G06390; GSK1 (GSK3/SHAGGY-LIKE PROTEIN KINASE 1); kinase |
AT5G42340 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G42360 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G42410 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT5G42430 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT5G42490 | ATP binding microtubule motor family protein;(source:Araport11) |
AT5G42500 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT5G42505 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-23 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
AT5G42520 | Encodes a member of the BASIC PENTACYSTEINE (BPC) proteins. BPC proteins are plant-specific transcription factors present throughout land plants. BPC transcription factor family is integral for a wide range of processes that support normal growth and development. |
AT5G42540 | Encodes a protein with similarity to yeast 5'-3'exonucleases and can functionally complement the yeast mutations. In Arabidopsis XRN2 acts as a suppressor of posttranscriptional gene silencing. |
AT5G42570 | B-cell receptor-associated 31-like protein;(source:Araport11) |
AT5G42600 | Encodes an oxidosqualene synthase that produces the monocyclic triterpene marneral. Crucial for growth and development. |
AT5G42635 | glycine-rich protein;(source:Araport11) |
AT5G42640 | Member of a small family of zinc finger containing putative transcription factors.Similar to GAZ. |
AT5G42650 | Encodes a member of the cytochrome p450 CYP74 gene family that functions as an allene oxide synthase. This enzyme catalyzes dehydration of the hydroperoxide to an unstable allene oxide in the JA biosynthetic pathway. It shows a dual catalytic activity, the major one being a 13-AOS but also expressing a 9-AOS activity. CFA-Leu, CFA-Val, CFA-Met and CFA-Ala can induce the expression of AOS. |
AT5G42660 | DNA-directed RNA polymerase subunit beta (DUF616);(source:Araport11) |
AT5G42677 | Pseudogene of AT5G19630 |
AT5G42680 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT5G42690 | transcription factor, putative (Protein of unknown function, DUF547);(source:Araport11) |
AT5G42710 | hypothetical protein;(source:Araport11) |
AT5G42730 | pseudogene similar to ACT domain-containing protein, similar to F-box family protein |
AT5G42750 | Encodes a plasma-membrane associated phosphoprotein that interacts directly with the kinase domain of BRI1 through the evolutionarily conserved C-terminal BIM motif binding to the C-lobe of the BRI1 kinase domain. It interferes with the interaction between BRI1 with its signalling partner, the plasma membrane localised LRR-receptor kinase BAK1 by inhibiting the transphosphorylation to keep BRI1 at a basal level of activity. It is phosphorylated by BRI1 at Ser270 & Ser274 and at tyrosine site Tyr211 and dissociates from plasma membrane to end up in the cytosol after phosphorylation. Its loss-of-function mutant shows higher sensitivity to BR treatment. |
AT5G42800 | dihydroflavonol reductase. Catalyzes the conversion of dihydroquercetin to leucocyanidin in the biosynthesis of anthocyanins. Not expressed in roots (qRT-PCR). The mRNA is cell-to-cell mobile. |
AT5G42850 | Thioredoxin superfamily protein;(source:Araport11) |
AT5G42900 | Acts with COR28 as a key regulator in the COP1-HY5 regulatory hub by regulating HY5 activity to ensure proper skotomorphogenic growth in the dark and photomorphogenic development in the light. |
AT5G42920 | Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. |
AT5G42930 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G42940 | RING/U-box superfamily protein;(source:Araport11) |
AT5G42957 | inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (DUF784);(source:Araport11) |
AT5G42960 | outer envelope pore 24B-like protein;(source:Araport11) |
AT5G43010 | 26S proteasome AAA-ATPase subunit RPT4a (RPT4a) mRNA, |
AT5G43020 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G43060 | Peptidase, activity detected in extracts of root, leaf and cell culture. |
AT5G43066 | Homolog of prePIP1. |
AT5G43090 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT5G43110 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT5G43120 | ARM-repeat/Tetratricopeptide repeat (TPR)-like protein;(source:Araport11) |
AT5G43170 | Encodes zinc finger protein. mRNA levels are elevated in response to high salinity and low temperature. The protein is localized to the nucleus and acts as a transcriptional repressor. |
AT5G43175 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G43180 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
AT5G43211 | hypothetical protein;(source:Araport11) |
AT5G43270 | Member of the SPL (squamosa-promoter binding protein-like) gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. In conjunction with SPL10 and SPL11, SPL2 redundantly controls proper development of lateral organs in association with shoot maturation in the reproductive phase. SPL2, SPL10, and SPL11, suppress root regeneration with age by inhibiting wound-induced auxin biosynthesis. |
AT5G43300 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
AT5G43320 | Member of CKL gene family (CKL-C group) |
AT5G43340 | Encodes Pht1;6, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
AT5G43370 | Encodes a phosphate transporter Pht1;2. Members of the Pht1 family of phosphate transporters include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341) The mRNA is cell-to-cell mobile. |
AT5G43380 | encodes a type I serine/threonine protein phosphatase expressed in expressed in roots, rosettes and flowers. |
AT5G43390 | plant/protein;(source:Araport11) |
AT5G43400 | plant/protein;(source:Araport11) |
AT5G43403 | other_RNA;(source:Araport11) |
AT5G43420 | RING/U-box superfamily protein;(source:Araport11) |
AT5G43455 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT5G43513 | Encodes a cysteine-rich peptide that acts as a pollen tube attractant guiding pollen tubes to the ovular micropyle. It is expressed in the synergid cell and appears to be secreted toward the funicular surface through the micropyle. |
AT5G43520 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G43535 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
AT5G43580 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Functions in resistance to necrotrophic fungi and insect herbivory. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860. |
AT5G43590 | Acyl transferase/acyl hydrolase/lysophospholipase superfamily protein;(source:Araport11) |
AT5G43600 | Encodes a protein with ureidoglycolate amidohydrolase activity in vitro. It is 27% identical and 43% similar to the E. coli allantoate amidohydrolase (AAH), but, in vitro assays with purified protein and allantoate as a substrate do not show any increase in ammonium concentration, indicating that there this enzyme has no AAH activity. The mRNA is cell-to-cell mobile. |
AT5G43630 | Encodes a zinc knuckle protein that negatively regulates morning specific growth. The role of TZP in hypocotyl elongation was established through a QTL analysis of BayXSha RIL populations. The Bay-0 allele contains a deletion causing a frameshift mutation. TZP is under circadian control and acts to regulate morning-specific hypocotyl growth. The mRNA is cell-to-cell mobile. |
AT5G43640 | cytosolic ribosomal protein gene, part of uS19 family. |
AT5G43700 | Auxin inducible protein similar to transcription factors. |
AT5G43745 | ion channel POLLUX-like protein, putative (DUF1012);(source:Araport11) |
AT5G43755 | non-LTR retrolelement reverse transcriptase-like protein;(source:Araport11) |
AT5G43770 | proline-rich family protein;(source:Araport11) |
AT5G43780 | sulfate adenylyltransferase, ATP sulfurylase |
AT5G43790 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G43810 | Encodes Argonaute10, a member of the EIF2C (elongation initiation factor 2c)/ Argonaute class of proteins. Required to establish the central-peripheral organization of the embryo apex. Along with WUS and CLV genes, controls the relative organization of central zone and peripheral zone cells in meristems. Acts in embryonic provascular tissue potentiating WUSCHEL function during meristem development in the embryo. AGO10 specifically sequesters miR166/165 to regulate shoot apical meristem development. |
AT5G43820 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G43830 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
AT5G43840 | member of Heat Stress Transcription Factor (Hsf) family |
AT5G43850 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT5G43860 | Encodes a chlorophyllase, the first enzyme in chlorophyll degradation. It catalyzes the hydrolysis of the ester bond to chlorophyllide and phytol. AtCLH2 has a typical signal sequence for the chloroplast. Gene expression does not respond to methyljasmonate, a known promoter of senescence and chlorophyll degradation. |
AT5G43870 | FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
AT5G43880 | methyl-coenzyme M reductase II subunit gamma, putative (DUF3741);(source:Araport11) |
AT5G43890 | Encodes a YUCCA-like putative flavin monooxygenase, the activation tagging mutant has increased level of IAA, increased auxin response and phenotype of auxin overproduction, rescues erecta mutant phenotype |
AT5G43900 | Encodes a member of the type XI myosin protein family that binds F-actin and co-localizes with actin filaments and peroxisomes. Homozygous mutants are reported to have pleiotropic effects in growth and fertility and may also be lethal. This protein is also involved in root hair growth and organelle trafficking. This protein interacts with RabC2a and RabD1 in a GTP-dependent manner. |
AT5G43920 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT5G43980 | Encodes a plasmodesmal protein that affects the intercellular movement of molecules through the plasmodesmata. The cytoplasmic C-terminal portion of the protein is connected to the apoplastic N-terminal portion of the protein by a single transmembrane domain (TMD). It is transported to the plasmodesmata through the secretory pathway. PDLP1 has two DUF26 domains and a signal peptide, but the proper localization of the protein appears to depend on the TMD. |
AT5G44005 | hypothetical protein;(source:Araport11) |
AT5G44030 | Encodes a cellulose synthase involved in secondary cell wall biosynthesis. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling. The mRNA is cell-to-cell mobile. |
AT5G44040 | eisosome SEG2-like protein;(source:Araport11) |
AT5G44060 | embryo sac development arrest protein;(source:Araport11) |
AT5G44080 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
AT5G44100 | Member of CKL gene family. Expression up-regulated under high temperature in anthers. Transcription activated by MYB24. |
AT5G44160 | NUC is a member of the BIRD group of transcriptional regulators and is required for the formative divisions that pattern the root. the ground tissue into cortex and endodermis. |
AT5G44170 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G44210 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-9). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
AT5G44220 | F-box family protein;(source:Araport11) |
AT5G44240 | Expression is upregulated in the shoot of cax1/cax3 mutant. The mRNA is cell-to-cell mobile. |
AT5G44255 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.5e-09 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
AT5G44300 | Dormancy/auxin associated family protein;(source:Araport11) |
AT5G44310 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
AT5G44316 | Stabilizer of iron transporter SufD superfamily protein;(source:Araport11) |
AT5G44345 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT5G44360 | FAD-binding Berberine family protein;(source:Araport11) |
AT5G44370 | Encodes an inorganic phosphate transporter (PHT4;6). |
AT5G44375 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
AT5G44380 | FAD-binding Berberine family protein;(source:Araport11) |
AT5G44390 | FAD-binding Berberine family protein;(source:Araport11) |
AT5G44400 | FAD-binding Berberine family protein;(source:Araport11) |
AT5G44410 | FAD-binding Berberine family protein;(source:Araport11) |
AT5G44416 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.6e-75 P-value blast match to Q9SI25 /181-349 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT5G44418 | pseudogene of cytochrome P450;(source:Araport11) |
AT5G44430 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
AT5G44440 | FAD-binding Berberine family protein;(source:Araport11) |
AT5G44460 | Calcium sensor. |
AT5G44480 | mutant has Altered lateral root; UDP Glucose Epimerase The mRNA is cell-to-cell mobile. |
AT5G44530 | Subtilase family protein;(source:Araport11) |
AT5G44540 | Tapetum specific protein TAP35/TAP44;(source:Araport11) |
AT5G44550 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT5G44555 | Encodes a ECA1 gametogenesis related family protein [pseudogene] |
AT5G44562 | Natural antisense transcript overlaps with AT5G44560;(source:Araport11) |
AT5G44568 | Secreted peptide which functions in plant growth and pathogen defense. |
AT5G44590 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G44610 | Encodes a protein with seven repeated VEEKK motifs. RNAi and overexpression experiments suggest that the gene is not involved in cell division but might be consequential for cell shape of epidermal and cortical cells. The protein encoded by this gene binds to cortical microtubules and inhibits tubulin polymerization. Associates to the plasma membrane and interacts with calmodulin and phosphatidylinositol phosphates, indicating an involvement in cellular signal transduction. Expression is enhanced by abiotic and hormonal factors. Induced during senescence.Interacts with Ca2+/calmodulin complex, phosphatidylinositol phosphates, and free Ca2+. |
AT5G44670 | glycosyltransferase family protein (DUF23);(source:Araport11) |
AT5G44680 | DNA glycosylase superfamily protein;(source:Araport11) |
AT5G44690 | RING finger PFF0165c-like protein;(source:Araport11) |
AT5G44700 | Encodes GASSHO2 (GSO2), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO2 and a homolog GSO1 (At4g20140) are required for the formation of a normal epidermal surface during embryogenesis. |
AT5G44705 | pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10) |
AT5G44730 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G44750 | Homologous to Y-family DNA polymerases, contains BRCT domain. Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS). |
AT5G44760 | C2 domain-containing protein;(source:Araport11) |
AT5G44780 | Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
AT5G44785 | Organellar Single-stranded DNA Binding protein. Decreases MMEJ on long ssDNA templates. |
AT5G44790 | ATP dependent copper transporter vital for ethylene response pathway |
AT5G44820 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
AT5G44910 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
AT5G44920 | Encodes a KASH domain protein that localizes to the nuclear envelope and affects nuclear morphology. |
AT5G44930 | Encodes a putative arabinosyltransferase that is associated with arabinan biosynthesis and is not redundant with ARAD1. The two glycosyltransferases may function in complexes held together by disulfide bridges. |
AT5G44940 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G44950 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G44960 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G44990 | Glutathione S-transferase family protein;(source:Araport11) |
AT5G45020 | Glutathione S-transferase family protein;(source:Araport11) |
AT5G45085 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.2e-148 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10) |
AT5G45090 | phloem protein 2-A7;(source:Araport11) |
AT5G45100 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
AT5G45110 | Encodes NPR3, a paralog of NPR1. Involved in negative regulation of defense responses against bacterial and oomycete pathogens. npr3 mutants has elevated level of PR1 expression. Interacts with TGA2, TGA3, TGA5 and TGA6 in yeast two hybrid assays. NPR3 and NPR4 are receptors for the immune signal salicylic acid. The mRNA is cell-to-cell mobile. |
AT5G45116 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.2e-227 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT5G45120 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT5G45130 | small GTP binding protein The mRNA is cell-to-cell mobile. |
AT5G45150 | RNAse THREE-like protein 3;(source:Araport11) |
AT5G45160 | Root hair defective 3 GTP-binding protein (RHD3);(source:Araport11) |
AT5G45170 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G45180 | Flavin-binding monooxygenase family protein;(source:Araport11) |
AT5G45190 | Encodes a cyclin T partner CYCT1;5. Plays important roles in infection with Cauliflower mosaic virus (CaMV). |
AT5G45200 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G45210 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G45240 | Disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
AT5G45250 | RPS4 belongs to the Toll/interleukin-1 receptor (TIR)-nucleotide binding site (NBS)-Leu-rich repeat (LRR) class of disease resistance (R ) genes. Confers specific resistance to Pseudomonas syringae pv. tomato carrying the avirulence gene AvrRPS4. Produces alternative transcripts with truncated open reading frames. |
AT5G45260 | Confers resistance to Ralstonia solanacearum. Similar to NBLS-TIR resistance genes,and also contains similarity to transcription factors. Interacts with pathogen effector protein AvrPop2. |
AT5G45275 | Major facilitator superfamily protein;(source:Araport11) |
AT5G45276 | pseudogene of Frigida-like protein;(source:Araport11) |
AT5G45280 | Pectin acetylesterase involved in pectin remodelling. |
AT5G45300 | Encodes a beta-amylase-like protein present in the nucleus rather than targeted to the chloroplast. Contains BRASSINAZOLE RESISTANT1 (BZR1)-type DNA binding domains. Activates gene expression in protoplast transactivation assays. |
AT5G45320 | late embryogenesis abundant protein;(source:Araport11) |
AT5G45330 | decapping 5-like protein;(source:Araport11) |
AT5G45340 | Encodes a protein with ABA 8'-hydroxylase activity; involved in ABA catabolism. Mutant analyses show that disruption in the gene results in more drought tolerance whereas overexpression results in increased transpiration rate and reduced drought tolerance. Gene involved in postgermination growth. Plant P450 CYP707A3, ABA 8'-hydroxylase, binds enantioselectively (+)-ABA but not (-)-ABA, whereas the enzyme binds both enantiomers of AHI1 (a structural ABA analogue used as ABA 8'-hydroxylase competitive inhibitor). |
AT5G45390 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). The mRNA is cell-to-cell mobile. |
AT5G45410 | Plastid localized protein of unknown function. Mutants are more susceptible to P. syringae and produce less callose upon infection. |
AT5G45430 | Protein kinase superfamily protein;(source:Araport11) |
AT5G45440 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G45469 | transmembrane protein;(source:Araport11) |
AT5G45470 | transmembrane protein, putative (DUF594);(source:Araport11) |
AT5G45475 | other_RNA;(source:Araport11) |
AT5G45510 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT5G45520 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT5G45530 | transmembrane protein, putative (DUF594);(source:Araport11) |
AT5G45540 | transmembrane protein, putative (DUF594);(source:Araport11) |
AT5G45630 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT5G45650 | subtilase family protein;(source:Araport11) |
AT5G45680 | Peptidyl-Prolyl Isomerase located in chloroplast thylakoid lumen The mRNA is cell-to-cell mobile. |
AT5G45690 | histone acetyltransferase (DUF1264);(source:Araport11) |
AT5G45710 | member of Heat Stress Transcription Factor (Hsf) family |
AT5G45720 | AAA-type ATPase family protein;(source:Araport11) |
AT5G45740 | Ubiquitin domain-containing protein;(source:Araport11) |
AT5G45745 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
AT5G45750 | RAB GTPase homolog A1C;(source:Araport11) |
AT5G45770 | receptor like protein 55;(source:Araport11) |
AT5G45780 | Encodes one of a group of LRR-RLKs, designated as CLAVATA3 INSENSITIVE RECEPTOR KINASES (CIKs), that act as co-receptors and have essential roles in regulating CLV3-mediated stem cell homeostasis. |
AT5G45790 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT5G45800 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G45810 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.5), which has also been reported as a member of the CBL-interacting protein kinases (CIPK19). |
AT5G45820 | Encodes a CBL-interacting serine/threonine protein kinase comprised of an N-terminal kinase catalytic domain similar to SNF1/AMPK and a unique C-terminal regulatory domain. |
AT5G45840 | Encodes a leucine-rich-repeat RLK that is localized to the plasma membrane of pollen tubes and functions with MIK1/2 as the male receptor of the pollen tube chemo-attractant LURE1.MDIS1 forms a complex with MIK1/2 and binds LURE1. |
AT5G45850 | hypothetical protein (DUF688);(source:Araport11) |
AT5G45875 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT5G45940 | Encodes a CoA pyrophosphatase, also has ppGpp pyrophosphohydrolase and exhibits minor activity of NADH pyrophosphatase. Most strongly expressed in embryo cotyledon and hypocotyl, flower, and phloem of vascular tissue. Over-expression mutant had a bigger plant with wider rosette. |
AT5G45970 | Encodes a Rac-like protein ARAC2. A member of ROP GTPase gene family. |
AT5G45990 | crooked neck protein, putative / cell cycle protein;(source:Araport11) |
AT5G46000 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT5G46010 | Homeodomain-like superfamily protein;(source:Araport11) |
AT5G46040 | Major facilitator superfamily protein;(source:Araport11) |
AT5G46080 | Protein kinase superfamily protein;(source:Araport11) |
AT5G46105 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT5G46115 | hypothetical protein;(source:Araport11) |
AT5G46160 | Ribosomal protein L14p/L23e family protein;(source:Araport11) |
AT5G46180 | Encodes an ornithine delta-aminotransferase that is transcriptionally up-regulated in young seedlings and in response to salt stress. It is unlikely to play a role in salt-stress-induced proline accumulation, however, it appears to participate in arginine and ornithine catabolism. |
AT5G46200 | carboxyl-terminal proteinase-like protein (DUF239);(source:Araport11) |
AT5G46220 | Encodes a protein with alkaline ceramidase activity that is involved in regulation of turgor during pollen tube growth and silique stomatal movement. Tod1 is expressed specifically in pollen and silique guard cells. Loss of function mutations have reduced fertility due to defects in pollen transmission. |
AT5G46250 | RNA-binding protein;(source:Araport11) |
AT5G46295 | transmembrane protein;(source:Araport11) |
AT5G46315 | U6-29;(source:Araport11) |
AT5G46330 | Encodes a leucine-rich repeat serine/threonine protein kinase that is expressed ubiquitously. FLS2 is involved in MAP kinase signalling relay involved in innate immunity. Essential in the perception of flagellin, a potent elicitor of the defense response. FLS2 is directed for degradation by the bacterial ubiquitin ligase AvrPtoB. The mRNA is cell-to-cell mobile. |
AT5G46340 | Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Has high similarity to RWA2 whose mutant displays reduced acetylation. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. |
AT5G46350 | member of WRKY Transcription Factor; Group II-c |
AT5G46390 | C-terminal peptidase |
AT5G46420 | 16S rRNA processing protein RimM family;(source:Araport11) |
AT5G46460 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G46490 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G46500 | protein VARIATION IN COMPOUND TRIGGERED ROOT growth protein;(source:Araport11) |
AT5G46510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G46520 | VICTR (VARIATION IN COMPOUND TRIGGERED ROOT growth response) encodes a TIR-NB-LRR (for Toll-Interleukin1 Receptor-nucleotide binding-Leucine-rich repeat) protein. VICTR is necessary for DFPM-induced root growth arrest and inhibition of abscisic acid-induced stomatal closing (DFPM is [5-(3,4-dichlorophenyl)furan-2-yl]-piperidine-1-ylmethanethione)(PMID:21620700). DFPM-mediated root growth arrest is accession-specific and depends on EDS1 and PAD4; Col-0 has a functional copy of VICTR. Induction of the VICTR gene by DFPM treatment requires functional VICTR (Col). A close homolog to VICTR, named VICTL (At5g46510) lies in tandem with VICTR. The mRNA is cell-to-cell mobile. |
AT5G46530 | AWPM-19-like family protein;(source:Araport11) |
AT5G46540 | P-glycoprotein 7;(source:Araport11) |
AT5G46560 | Man1-Src1p-carboxy-terminal domain protein;(source:Araport11) |
AT5G46570 | Encodes BR-signaling kinase 2 (BSK2), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
AT5G46590 | Transcription factor required for the initiation of cell division during wound healing. Redundantly involved with ANAC071 in the process of "cambialization". |
AT5G46600 | aluminum activated malate transporter family protein;(source:Araport11) |
AT5G46640 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT5G46660 | protein kinase C-like zinc finger protein;(source:Araport11) |
AT5G46690 | beta HLH protein 71;(source:Araport11) |
AT5G46710 | PLATZ transcription factor family protein;(source:Araport11) |
AT5G46820 | carboxyl-terminal proteinase-like protein, putative (DUF239);(source:Araport11) |
AT5G46830 | Calcium-binding transcription factor involved in salt stress signaling. |
AT5G46845 | Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA |
AT5G46874 | Encodes a defensin-like (DEFL) family protein. |
AT5G46880 | homeobox-7;(source:Araport11) |
AT5G46900 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT5G46910 | H3K27me3 demethylase involved in temperature and photoperiod dependent repressing of flowering. |
AT5G46915 | transcriptional factor B3 family protein;(source:Araport11) |
AT5G46950 | One of of a pair of paralogous invertase with very high similarity.Expressed in female gametophyte and endosperm, particularly mycropylar endosperm. May function during embryogenesis to provide sugars to the developing embryo. |
AT5G47040 | Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins. |
AT5G47050 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
AT5G47060 | hypothetical protein (DUF581);(source:Araport11) |
AT5G47070 | Encodes a member of the RLCK VII-4 subfamily of receptor-like cytoplasmic kinases that has been shown to phosphorylate MAPKKK5 Ser-599 and MEKK1 Ser-603, both players in PRR-mediated resistance to bacterial and fungal pathogens. |
AT5G47077 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT5G47100 | member of AtCBLs (Calcineurin B-like Calcium Sensor Proteins. CBL9 interacts with and targets CIPK23 to the plasma membrane in vivo. |
AT5G47120 | Encodes BI-1, a homolog of mammalian Bax inhibitor 1. Functions as an attenuator of biotic and abiotic types of cell death. Bax-induced cell death can be downregulated by ectopically expressing AtBI in planta. The mRNA is cell-to-cell mobile. |
AT5G47140 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT5G47150 | YDG/SRA domain-containing protein;(source:Araport11) |
AT5G47160 | YDG/SRA domain-containing protein;(source:Araport11) |
AT5G47175 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT5G47220 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-2). The protein contains one AP2 domain. Functions as activator of GCC box?dependent transcription. Positive regulator of JA-responsive defense genes and resistance to F. oxysporum and enhances JA inhibition of root elongation. |
AT5G47225 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10) |
AT5G47360 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G47370 | homeobox-leucine zipper genes induced by auxin, but not by other phytohormones. Plays opposite roles in the shoot and root tissues in regulating auxin-mediated morphogenesis. |
AT5G47380 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
AT5G47440 | FORKED-LIKE family member, part of Group 3 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
AT5G47460 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G47500 | predicted to encode a pectin methylesterase |
AT5G47510 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT5G47530 | Auxin-responsive family protein;(source:Araport11) |
AT5G47590 | Heat shock protein HSP20/alpha crystallin family;(source:Araport11) |
AT5G47610 | RING/U-box superfamily protein;(source:Araport11) |
AT5G47620 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G47635 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT5G47818 | pseudogene of WPP domain interacting protein 1;(source:Araport11) |
AT5G47820 | Encodes a kinesin-like protein with an N-terminal microtubule binding motor domain. Protein is localized to the periphery of the cytoplasm and mutants in the gene exhibit altered orientation of cellulose microfibrils and reduced mechanical strength of fibers. |
AT5G47840 | adenosine monophosphate kinase;(source:Araport11) |
AT5G47850 | CRINKLY4 related 4;(source:Araport11) |
AT5G47910 | NADPH/respiratory burst oxidase protein D (RbohD).Interacts with AtrbohF gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. The mRNA is cell-to-cell mobile. |
AT5G47950 | BIA2 is a putative HXXXD-type BAHD acyltransferase. Overexpression results in a BR deficient phenotype and is dependent on a functional HXXXD motif. BIA2 may function in BR homeostasis by regulating the pool of bioactive BR. |
AT5G48000 | Encodes a member of the CYP708A family of cytochrome P450 enzymes. THAH appears to add a hydroxyl group to the triterpene thalianol. thah1 mutants have an elevated accumulation of thalianol. thah1-1 mutants have longer roots than wild type plants. Thalian-diol and desaturated thalian-diol are lost from the root extracts of thah1-1 mutants. Overexpression of the sequence from At5g48000.1 rescues the thah1-1 mutant phenotype (Field 2008); it is unknown whether the shorter sequences associated with other gene models would provide functional complementation. |
AT5G48020 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT5G48060 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT5G48070 | putative xyloglucan endotransglycosylase/hydrolase, expressed primarily in the stele of mature non-elongating regions of both the main and the lateral root. Is expressed in lateral root primordia but expression ceases after lateral root begins to grow. Involved in cell proliferation in incised inflorescence stems. |
AT5G48090 | EDM2-like protein1;(source:Araport11) |
AT5G48100 | Encodes a protein that is similar to laccase-like polyphenol oxidases. Involved in lignin and flavonoids biosynthesis. It has four conserved copper binding domains. Expressed in developing testa, where it colocalizes with the flavonoid end products proanthocyanidins and flavonols. Mutant plants exhibited a delay in developmentally determined browning of the testa, characterized by the pale brown color of seed coat. The tt10 mutant seeds accumulate more epicatechin monomers and more soluble proanthocyanidins than wild-type seeds. Flavonol composition was also affected in tt10 seeds, which exhibited a higher ratio of quercetin rhamnoside monomers versus dimers than wild-type seeds. |
AT5G48130 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT5G48160 | Encodes a nuclear PHD finger protein that is functionally redundant with OBE1 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems. |
AT5G48230 | Encodes an acetoacetyl-CoA thiolase that generates the bulk of the acetoacetyl-CoA precursor needed for the cytosolic localized, mevalonate-derived isoprenoids biosynthetic pathway. Loss-of-function mutants are embryo lethal. |
AT5G48250 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
AT5G48375 | Is a myrosinase pseudogene that codes for a truncated and frameshifted protein. Although TGG3 apparently is a pseudogene, its mRNA is expressed specifically in stamen and petal according to RT-PCR analysis. Western analysis shows no band of the size expected for a TGG3 protein. |
AT5G48385 | FRIGIDA-like protein;(source:Araport11) |
AT5G48400 | member of Putative ligand-gated ion channel subunit family |
AT5G48410 | member of Putative ligand-gated ion channel subunit family |
AT5G48450 | Encodes a protein with two DUF26 domains and a signal peptide for secretion. The protein is transported to the apoplast when it is expressed as a GFP fusion protein. |
AT5G48490 | Encodes a protein with similarity to a lipid transfer protein that may contribute to systemic acquired resistance (SAR). |
AT5G48500 | pathogenic type III effector avirulence factor Avr AvrRpt-cleavage: cleavage site protein;(source:Araport11) |
AT5G48510 | BTB/POZ domain-containing protein;(source:Araport11) |
AT5G48545 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
AT5G48550 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT5G48570 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT5G48605 | Encodes a defensin-like (DEFL) family protein. |
AT5G48610 | myb-like protein X;(source:Araport11) |
AT5G48630 | Cyclin family protein;(source:Araport11) |
AT5G48650 | Negative regulator of defense response to Pseudomonas syringae pv. tomato through altered stomatal and apoplastic immunity. |
AT5G48680 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
AT5G48690 | ubiquitin-associated (UBA)/TS-N domain protein;(source:Araport11) |
AT5G48710 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT5G48730 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G48740 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G48800 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT5G48820 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type and CDC2A cyclins and may inhibit cell cycle. Seven KRP genes were found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. |
AT5G48830 | phosphoglycolate phosphatase;(source:Araport11) |
AT5G48880 | Encodes a peroxisomal 3-keto-acyl-CoA thiolase 2 precursor. EC2.3.1.16 thiolases. AT5G48880.1 is named PKT1 and AT5G48880.2 is named PKT2. |
AT5G48890 | Encodes a C(2) H(2) -type zinc-finger transcriptional regulator and is expressed in the leaf vasculature and the vegetative shoot apical meristem and controls the transition to flowering. |
AT5G48900 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G48940 | RGFR2 is a leucine--rich repeat receptor kinase that, together with RGFR1 and RGFR3, binds ROOT GROWTH FACTORS and is required for establishing the gradient of PLETHORA1 and PLETHORA2 essential for proper root growth and development. |
AT5G49040 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT5G49070 | Encodes KCS21, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT5G49110 | fanconi anemia group I-like protein;(source:Araport11) |
AT5G49120 | DUF581 family protein, putative (DUF581);(source:Araport11) |
AT5G49138 | Natural antisense transcript overlaps with AT5G49130;(source:Araport11) |
AT5G49170 | hypothetical protein;(source:Araport11) |
AT5G49240 | member of Response Regulator: Pseudo |
AT5G49270 | Involved in successfully establishing tip growth in root hairs. |
AT5G49280 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G49290 | receptor like protein 56;(source:Araport11) |
AT5G49300 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT5G49301 | Pseudogene of AT5G49310; importin alpha-1 subunit, putative |
AT5G49310 | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
AT5G49320 | transmembrane protein, putative (DUF1218);(source:Araport11) |
AT5G49330 | Member of the R2R3 factor gene family. Together with MYB11 and MYB111 redundantly regulates flavonol biosynthesis. |
AT5G49340 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT5G49350 | Glycine-rich protein family;(source:Araport11) |
AT5G49420 | MADS-box transcription factor family protein;(source:Araport11) |
AT5G49460 | One of the two genes encoding subunit B of the cytosolic enzyme ATP Citrate Lyase (ACL) |
AT5G49470 | Encodes a protein with similarity to RAF MAP Kinase that is expressed in most plant tissues. Based on loss of function and gain of function phenotypes, RAF10 appears to be involved in ABA response. |
AT5G49490 | AGAMOUS-like 83;(source:Araport11) |
AT5G49510 | prefoldin 3;(source:Araport11) |
AT5G49520 | Encodes WRKY48, a member of the WRKY Transcription Factor. WRKY48 is a stress- and pathogen-induced transcriptional activator that represses plant basal defense. The mRNA is cell-to-cell mobile. |
AT5G49525 | transmembrane protein;(source:Araport11) |
AT5G49540 | Rab5-interacting family protein;(source:Araport11) |
AT5G49570 | Encodes a protein that has peptide:N-glycanase activity in enzymatic assay in heterologous systems (although the activity was not detected in wild-type plants). |
AT5G49610 | F-box family protein;(source:Araport11) |
AT5G49620 | Member of the R2R3 factor gene family. |
AT5G49640 | hypothetical protein;(source:Araport11) |
AT5G49650 | Encodes a cytosolic protein capable of phosphorylating xylulose and deoxy-xylulose. It most likely plays a role in producing precursors for isoprenoid biosynthesis. |
AT5G49660 | The gene encodes receptorlike kinase (RLK). Involved in the maintenance organization of cell files or cell morphology in conductive elements. Functions as a receptor for CEP1 peptide. Mediates nitrate uptake signaling. |
AT5G49665 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT5G49680 | Conserved among eukaryotes, similar to Arabidopsis SABRE. The phenotype of the kip/sab double mutant suggests related functions for both genes, however, the KIP protein is mostly required for tip-growth. Predicted to be targeted to the secretory pathway. mRNA was detected in all organs, with most abundance in pollen and roots. |
AT5G49690 | UDP-glycosyltransferase that can act upon sulcotrione herbicide. Overexpression confers resistance to herbicide. |
AT5G49740 | Encodes a chloroplast ferric chelate reductase. Shows differential splicing and has three different mRNA products. Expressed in the shoot, flower and cotyledon. |
AT5G49760 | Leucine rich receptor kinase. Encodes a receptor of extracellular reactive oxygen species. |
AT5G49770 | Leucine rich receptor kinase. |
AT5G49780 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G49790 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G36010.1);(source:TAIR10) |
AT5G49820 | root UVB sensitive protein (Protein of unknown function, DUF647);(source:Araport11) |
AT5G49880 | Encodes a spindle assembly checkpoint protein MAD1. The mRNA is cell-to-cell mobile. |
AT5G49890 | member of Anion channel protein family |
AT5G49900 | Beta-glucosidase, GBA2 type family protein;(source:Araport11) |
AT5G49950 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G49960 | ion channel protein;(source:Araport11) |
AT5G49990 | Xanthine/uracil permease family protein;(source:Araport11) |
AT5G50000 | Belongs to the Raf-like kinase subfamily of the mitogen-activated protein kinase kinase kinase (MAPKKK) family. Negatively regulates stomatal opening by negatively regulating plasma membrane H+-ATPase phosphorylation. |
AT5G50020 | DHHC-type zinc finger family protein;(source:Araport11) |
AT5G50080 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain and is phosphorylated in planta. There are 7 members in this subfamily. |
AT5G50120 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G50150 | LOTR1 protein has an unknown function. It contains both DUF4409 and DUF239 domains. Loss of function mutations show defects in formation of the Casparian band- which is correlated with mis localization of CASP1. |
AT5G50160 | Encodes a ferric chelate reductase that is expressed in shoots and flowers. |
AT5G50170 | C2 calcium/lipid-binding and GRAM domain containing protein;(source:Araport11) |
AT5G50175 | transmembrane protein;(source:Araport11) |
AT5G50190 | other_RNA;(source:Araport11) |
AT5G50200 | Wound-responsive gene 3 (WR3). Encodes a high-affinity nitrate transporter. Up-regulated by nitrate. Involved in jasmonic acid-independent wound signal transduction. |
AT5G50240 | L-isoaspartyl methyltransferase 2 (PIMT2)gene, alternatively spliced. |
AT5G50250 | Encodes a RNA binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). Supports editing of specific CP31A-dependent sites. |
AT5G50290 | wall-associated receptor kinase galacturonan-binding protein;(source:Araport11) |
AT5G50300 | Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2). |
AT5G50340 | DNA repair protein RadA-like protein;(source:Araport11) |
AT5G50345 | Encodes a Maternally expressed gene (MEG) family protein |
AT5G50360 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
AT5G50375 | Converts pentacyclic cyclopropyl sterols to conventional tetracyclic sterols. CPI1 function during and just after division and support gravitropism by establishing polar PIN2 localization. Required for endocytosis of PIN2 |
AT5G50380 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT5G50440 | Member of Membrin Gene Family. Encodes a Golgi-localized SNARE protein MEMB12. MEMB12 is a target of miR393b-mediated gene silencing during Pseudomonas syringae pv. Tomato infection. Loss of function of MEMB12 leads to increased exocytosis of an antimicrobial pathogenesis-related protein, PR1. |
AT5G50450 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
AT5G50470 | nuclear factor Y, subunit C7;(source:Araport11) |
AT5G50740 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT5G50750 | RGP4 is a reversibly glycosylated polypeptide. Analyses using tagged RGP4 suggest that it is present in the cytosol and in association with the Golgi apparatus. Recombinant RGP4 does not have UDP-arabinose mutase activity based on an in vitro assay even though the related RGP1, RGP2, and RGP3 proteins do have activity in the same assay. RGP4 can form complexes with RGP1 and RGP2. RGP4 is expressed during seed development. |
AT5G50760 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT5G50780 | MORC4 is a member of a family of GHKL ATPases. It is localized in the nuceloplasm and adjacent to chromocenters. Along with MORC7, it appears to repress the expression |
AT5G50790 | Encodes a member of the SWEET sucrose efflux transporter family proteins. Transcriptionally activated by long photoperiods; activation depends on FT and SOC1. The ectopic expression of SWEET10 causes early flowering and leads to higher levels of transcription of flowering-time related genes in the shoot apex. |
AT5G50810 | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. |
AT5G50820 | NAC domain containing protein 97;(source:Araport11) |
AT5G50840 | alpha-taxilin-like protein;(source:Araport11) |
AT5G50900 | ARM repeat superfamily protein;(source:Araport11) |
AT5G50915 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G50960 | Highly similar to Saccharomyces cerevisiae NBP35, locus YGL091C. Cytosolic protein that homodimerizes and can assemble both 4Fe-4S - type and 2Fe-2S - type clusters on its amino terminal and carboxy therminal respectively. Null mutants are embryo lethal. |
AT5G51020 | Encodes CRL (CRUMPLED LEAF), a protein localized in the outer envelope membrane of plastids. Mutation in this gene affects the pattern of cell division, cell differentiation and plastid division. |
AT5G51070 | ATP-dependent Clp protease regulatory subunit The mRNA is cell-to-cell mobile. |
AT5G51105 | ECA1 gametogenesis family protein (DUF1278);(source:Araport11) |
AT5G51110 | Encodes a protein involved in Rubisco assembly that also mediates Abscisic acid-dependent stress response. It is a ubiquitination target of the intracellular E3 ligase SDIR1. It selectively regulates the expression of the downstream basic region/leucine zipper motif transcription factor gene ABA-INSENSITIVE5, rather than ABA-RESPONSIVE ELEMENTS BINDING FACTOR3 (ABF3) or ABF4, to regulate ABA-mediated seed germination and the plant salt response. |
AT5G51180 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G51190 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture and the response to cold stress. |
AT5G51230 | Polycomb group protein with zinc finger domain involved in negative regulation of reproductive development. Forms a complex with FIE, CLF, and MSI1. This complex modulates the expression of target genes including AG, PI and AP3. |
AT5G51250 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G51260 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
AT5G51280 | DEAD-box protein abstrakt;(source:Araport11) |
AT5G51320 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42556.1);(source:TAIR10) |
AT5G51330 | Encodes novel protein involved in sister chromatid cohesion and meiotic chromosome organization during both male and female meiosis. Gene has two alternate transcripts which produce two similar proteins, one 57 aa shorter than the other. |
AT5G51360 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
AT5G51420 | long-chain-alcohol O-fatty-acyltransferase family protein / wax synthase family protein;(source:Araport11) |
AT5G51440 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT5G51460 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
AT5G51510 | jagunal-like protein;(source:Araport11) |
AT5G51530 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT5G51550 | EXORDIUM like 3;(source:Araport11) |
AT5G51560 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G51600 | Mutant has defective roots. Essential for giant cell ontogenesis. Role in organizing the mitotic microtubule array during both early and late mitosis in all plant organs. |
AT5G51630 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G51660 | cleavage and polyadenylation specificity factor 160;(source:Araport11) |
AT5G51670 | hypothetical protein (DUF668);(source:Araport11) |
AT5G51680 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G51700 | Encodes a resistance signalling protein with two zinc binding (CHORD) domains that are highly conserved across eukaryotic phyla. Mutant has reduced RPS5 and RPM1 mediated resistance. Potentially involved in transduction of R gene mediated disease resistance. Required for R protein accumulation. |
AT5G51710 | member of Putative potassium proton antiporter family |
AT5G51750 | subtilase 1.3;(source:Araport11) |
AT5G51770 | Protein kinase superfamily protein;(source:Araport11) |
AT5G51780 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G51800 | Protein kinase superfamily protein;(source:Araport11) |
AT5G51810 | Encodes gibberellin 20-oxidase. Involved in gibberellin biosynthesis. Up-regulated by far red light in elongating petioles. Not regulated by a circadian clock. Mutation of GA20ox2 delays flowering. |
AT5G51820 | Encodes a plastid isoform of the enzyme phosphoglucomutase involved in controlling photosynthetic carbon flow. Effective petiole movement against the direction of the gravity requires functional PGM activity that is required for full development of amyloplasts. |
AT5G51830 | Encodes one of the several Arabidopsis fructokinases. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). Important for seed oil accumulation and vascular development. |
AT5G51840 | junctophilin-like protein;(source:Araport11) |
AT5G51845 | Encodes a defensin-like (DEFL) family protein. |
AT5G51890 | encodes peroxidase involved in the lignification of tracheary elements (TE) in roots |
AT5G51920 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT5G51980 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G52000 | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. Target promoter of the male germline-specific transcription factor DUO1. |
AT5G52040 | Encodes an arginine/serine-rich splicing factor. Transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. RS41 binds to HYL1 and co-localizes to the nuclear dicing body. Along with RS41, it appears to be involved in pri-miRNA processing and miRNA biogenesis. |
AT5G52050 | MATE efflux family protein;(source:Araport11) |
AT5G52055 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-30 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT5G52060 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
AT5G52130 | hypothetical protein;(source:Araport11) |
AT5G52145 | Encodes a defensin-like (DEFL) family protein. |
AT5G52170 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
AT5G52250 | Encodes a transducin protein whose gene expression is induced by UV-B. This induction is reduced in hy5 mutant and may be a target of HY5 during UV-B response. Functions as a repressor of UV-B signaling. |
AT5G52260 | Member of the R2R3 factor gene family. |
AT5G52270 | SNARE-like superfamily protein;(source:Araport11) |
AT5G52300 | Encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and desiccation. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. Upregulation by P. polymyxa CR1 increases drought resistance. |
AT5G52310 | cold regulated gene, the 5' region of cor78 has cis-acting regulatory elements that can impart cold-regulated gene expression The mRNA is cell-to-cell mobile. |
AT5G52320 | cytochrome P450, family 96, subfamily A, polypeptide 4;(source:Araport11) |
AT5G52340 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT5G52355 | pre-tRNA tRNA-Ser (anticodon: TGA);(source:Araport11, TAIR10) |
AT5G52400 | member of CYP715A |
AT5G52420 | transmembrane protein;(source:Araport11) |
AT5G52440 | HCF106; nuclear gene for chloroplast. Thylakoid membrane delta pH translocation pathway component protein; related to Escherichia coli TatA and TatB The mRNA is cell-to-cell mobile. |
AT5G52450 | MATE efflux family protein;(source:Araport11) |
AT5G52480 | RNI-like superfamily protein;(source:Araport11) |
AT5G52490 | Fibrillarin family protein;(source:Araport11) |
AT5G52520 | Encodes a chloroplast and mitochondria localized prolyl-tRNA synthetase. |
AT5G52530 | dentin sialophosphoprotein-like protein;(source:Araport11) |
AT5G52545 | RNA-binding protein-like RNA recognition motif protein;(source:Araport11) |
AT5G52610 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT5G52640 | Encodes a cytosolic heat shock protein AtHSP90.1. AtHSP90.1 interacts with disease resistance signaling components SGT1b and RAR1 and is required for RPS2-mediated resistance. The mRNA is cell-to-cell mobile. |
AT5G52650 | RNA binding Plectin/S10 domain-containing protein;(source:Araport11) |
AT5G52680 | Copper transport protein family;(source:Araport11) |
AT5G52690 | Copper transport protein family;(source:Araport11) |
AT5G52700 | Member of plant specific copper transport protein family. Expressed in response to Al treatment. |
AT5G52780 | Chloroplast NAD(P)H dehydrogenase complex assembly factor. |
AT5G52790 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
AT5G52820 | Encodes a NOTCHLESS homolog, a non-ribosomal protein involved in the maturation and assembly of the 60S ribosomal subunit, that is required for female gametogenesis. The mRNA is cell-to-cell mobile. |
AT5G52850 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G52860 | ABC-2 type transporter family protein;(source:Araport11) |
AT5G52882 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G52890 | AT hook motif-containing protein;(source:Araport11) |
AT5G52900 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
AT5G52920 | encodes a dominant chloroplast pyruvate kinase beta subunit. Important for seed oil biosynthesis. Ubiquitously expressed, with significantly increased expression in maturing seeds. The mutant plant has wrinkled seeds, with a 50-70% reduction in seed fatty acid content. The mRNA is cell-to-cell mobile. |
AT5G52940 | DUF295 domain protein. |
AT5G52980 | ER-based factor for assembly of V-ATPase;(source:Araport11) |
AT5G53010 | calcium-transporting ATPase;(source:Araport11) |
AT5G53020 | Ribonuclease P protein subunit P38-like protein;(source:Araport11) |
AT5G53030 | hypothetical protein;(source:Araport11) |
AT5G53040 | Encodes GROUNDED (GRD), a putative RWP-RK-type transcription factor broadly expressed in early development. GRD promotes zygote elongation and basal cell fates. |
AT5G53048 | Natural antisense transcript overlaps with AT5G53050;(source:Araport11) |
AT5G53100 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G53120 | encodes a novel spermine synthase and is a paralog of previously characterized spermidine synthases, SPDS1 and SPDS2. SPDS3 forms heterodimers with SDPS2, which in turn forms heterodimers with SDPS1 in vivo. The gene does not complement speDelta3 deficiency of spermidine synthase in yeast but DOES complement speDelta4 deficiency. |
AT5G53160 | Encodes RCAR3, a regulatory component of ABA receptor. Interacts with protein phosphatase 2Cs ABI1 and ABI2. Stimulates ABA signaling. The mRNA is cell-to-cell mobile. |
AT5G53190 | Nodulin MtN3 family protein;(source:Araport11) |
AT5G53220 | hypothetical protein;(source:Araport11) |
AT5G53230 | hypothetical protein (DUF295);(source:Araport11) |
AT5G53240 | hypothetical protein (DUF295);(source:Araport11) |
AT5G53250 | arabinogalactan protein 22;(source:Araport11) |
AT5G53290 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
AT5G53300 | Encodes a ubiquitin conjugating enzyme. |
AT5G53340 | Encodes a hydroxyproline O-galactosyltransferase. |
AT5G53370 | pectin methylesterase PCR fragment F;(source:Araport11) |
AT5G53380 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
AT5G53410 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT5G53420 | Member of ASML2 family of CCT domain proteins.There is a preferential accumulation of RNA isoforms CCT101.1 and CCT101.2 in response to N-treatment, each isoform has different targets. |
AT5G53430 | Homology Subgroup III; Orthology Group 2 - A putative histone methyltransferase (predicted to methylate H3K4) related to the Drosophila trithorax group proteins TRX and TRR and the yeast gene SET1. A plant line expressing an RNAi construct directed against this gene has reduced agrobacterium-mediated tumor formation. |
AT5G53490 | thylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein. |
AT5G53500 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G53510 | oligopeptide transporter |
AT5G53520 | Encodes an oligopeptide transporter. Target promoter of the male germline-specific transcription factor DUO1. |
AT5G53530 | Homolog of yeast retromer subunit VPS26. Part of a retromer-like protein complex involved in endosome to lysosome protein transport. |
AT5G53550 | YELLOW STRIPE like 3;(source:Araport11) |
AT5G53570 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT5G53580 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT5G53592 | FBD-like domain family protein;(source:Araport11) |
AT5G53635 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G53680 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G53700 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G53710 | hypothetical protein;(source:Araport11) |
AT5G53780 | F-box protein, putative (DUF295);(source:Araport11) |
AT5G53790 | F-box protein, putative (DUF295);(source:Araport11) |
AT5G53800 | nucleic acid-binding protein;(source:Araport11) |
AT5G53820 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
AT5G53830 | VQ motif-containing protein;(source:Araport11) |
AT5G53870 | early nodulin-like protein 1;(source:Araport11) |
AT5G53890 | Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of phytosulfokine (PSK), which is a 5-aa tyrosine-sulfated peptide that primarily promotes cellular proliferation. |
AT5G53900 | Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11) |
AT5G53920 | Protein methyltransferase. One target is PRPL11 which it methylates on Lys 109. |
AT5G53930 | transcriptional regulator ATRX-like protein;(source:Araport11) |
AT5G53960 | Mid-1-related chloride channel domain-containing protein;(source:Araport11) |
AT5G53970 | Encodes a cytosolic tyrosine aminotransferase which is strongly induced upon aging and coronatine treatment. AtTAT1 prefers Tyr as an amino donor but can also use Phe, Trp, His, Met, and Leu. The mRNA is cell-to-cell mobile. |
AT5G54010 | Encodes a flavonoid 3-O-glucoside:2″-O-glucosyltransferase that determines pollen-specific flavonol structure. |
AT5G54045 | pseudogene of UF3GT |
AT5G54060 | Encodes a anthocyanin 3-O-glucoside: 2"-O-xylosyl-transferase involved in anthocyanin modification that converts cyanidin 3-O-glucoside to cyanidin 3-O-xylosyl(1->2)glucoside. Its preferred sugar donor is UDP-xylose. |
AT5G54070 | A member of Heat Stress Transcription Factor (Hsf) family. Not responding to heat stress. Is regulated by the seed-specific transcription factor ABI3. In turn, it regulates other heat stress proteins including Hsp17.4-CI, Hsp17.7-CII and Hsp101 during seed maturation. |
AT5G54075 | U3 small nucleolar RNA |
AT5G54090 | DNA mismatch repair protein MutS, type 2;(source:Araport11) |
AT5G54100 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
AT5G54130 | Calcium-binding endonuclease/exonuclease/phosphatase family;(source:Araport11) |
AT5G54145 | hypothetical protein;(source:Araport11) |
AT5G54148 | sarcosine dehydrogenase-2C protein;(source:Araport11) |
AT5G54165 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
AT5G54190 | light-dependent NADPH:protochlorophyllide oxidoreductase A |
AT5G54200 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G54210 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G54240 | membrane lipoprotein lipid attachment site-like protein, putative (DUF1223);(source:Araport11) |
AT5G54250 | member of Cyclic nucleotide gated channel family, downstream component of the signaling pathways leading to HR resistance. mutant plants exhibit gene-for-gene disease resistance against avirulent Pseudomonas syringae despite the near-complete absence of the hypersensitive response (HR). Salicylic acid accumulation in dnd2 mutants is completely PAD4-independent. |
AT5G54260 | DNA repair and meiotic recombination protein, component of MRE11 complex with RAD50 and NBS1 |
AT5G54270 | Lhcb3 protein is a component of the main light harvesting chlorophyll a/b-protein complex of Photosystem II (LHC II). |
AT5G54280 | Type VII myosin gene |
AT5G54290 | Encodes CcdA, a thylakoid membrane protein required for the transfer of reducing equivalents from stroma to thylakoid lumen. |
AT5G54300 | cotton fiber-like protein (DUF761);(source:Araport11) |
AT5G54365 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
AT5G54370 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
AT5G54375 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
AT5G54400 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G54430 | Contains a universal stress protein domain. Protein is phosphorylated in response to Phytophthora infestans zoospores and xylanase. |
AT5G54450 | hypothetical protein (DUF295);(source:Araport11) |
AT5G54460 | wound-responsive protein-like protein;(source:Araport11) |
AT5G54470 | B-box type zinc finger family protein;(source:Araport11) |
AT5G54480 | hypothetical protein (DUF630 and DUF632);(source:Araport11) |
AT5G54490 | Encodes a PINOID (PID)-binding protein containing putative EF-hand calcium-binding motifs. The interaction is dependent on the presence of calcium. mRNA expression is up-regulated by auxin. Not a phosphorylation target of PID, likely acts upstream of PID to regulate the activity of this protein in response to changes in calcium levels. |
AT5G54500 | Encodes a flavin mononucleotide-binding flavodoxin-like quinone reductase that is a primary auxin-response gene. |
AT5G54510 | Encodes an IAA-amido synthase that conjugates Ala, Asp, Phe, and Trp to auxin. Lines overexpressing this gene accumulate IAA-ASP and are hypersensitive to several auxins. Identified as a dominant mutation that displays shorter hypocotyls in light grown plants when compared to wild type siblings. Protein is similar to auxin inducible gene from pea (GH3). |
AT5G54520 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G54540 | Uncharacterized conserved protein (UCP012943);(source:Araport11) |
AT5G54570 | beta glucosidase 41;(source:Araport11) |
AT5G54585 | hypothetical protein;(source:Araport11) |
AT5G54600 | Translation protein SH3-like family protein;(source:Araport11) |
AT5G54630 | zinc finger protein-like protein;(source:Araport11) |
AT5G54661 | Pseudogene of AT5G54660; heat shock protein-related |
AT5G54670 | Encodes a truncated KatC polypeptide (KatC(207-754)), which includes the carboxyl-terminal region of KatC. This was expressed in Escherichia coli and was shown to possess microtubule-stimulated ATPase activity. |
AT5G54680 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G54690 | Encodes a protein with putative galacturonosyltransferase activity. Mutants defective in this gene displayed a notable reduction in xylose (>50%) in the cell walls from stems and roots and a reduction in cellulose (~25%). |
AT5G54700 | Ankyrin repeat family protein;(source:Araport11) |
AT5G54730 | yeast autophagy 18 F-like protein;(source:Araport11) |
AT5G54760 | Translation initiation factor SUI1 family protein;(source:Araport11) |
AT5G54770 | Encodes a thiamine biosynthetic gene that has a dual function in thiamine biosynthesis and mitochondrial DNA damage tolerance. It appears to be involved in producing the thiazole portion of thiamine (vitamin B1). A crystal structure of the protein reveals that it forms a 2-ring homo-octamer. The mRNA is cell-to-cell mobile. |
AT5G54820 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G54840 | Monomeric G protein. Expressed in the root quiescent center, flowers, and leaf guard cells and hydathodes. |
AT5G54865 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
AT5G54910 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT5G54930 | AT hook motif-containing protein;(source:Araport11) |
AT5G54950 | Aconitase family protein;(source:Araport11) |
AT5G54990 | RING/U-box superfamily protein;(source:Araport11) |
AT5G55020 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB120). |
AT5G55040 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
AT5G55050 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. The mRNA is cell-to-cell mobile. |
AT5G55070 | Encodes the E2 subunit of the 2-oxoglutarate dehydrogenase. |
AT5G55090 | member of MEKK subfamily |
AT5G55120 | Encodes a GDP-L-galactose phosphorylase, with similar biochemical properties as VTC2. |
AT5G55140 | ribosomal protein L30 family protein;(source:Araport11) |
AT5G55150 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
AT5G55160 | Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets. SUMO2 can form SUMO chains through lysine residue 10 during in vitro assays. |
AT5G55230 | Binds and bundles microtubules. Plays a role in stabilizing anti-parallel microtubules in the central spindle at anaphase to early cytokinesis but is not essential at the midline of the phragmoplast at later stages. The timing with which the MAP65-1 was targeted to the spindle appears to be regulated by a phosphorylation sensitive switch. Enhances microtubule polymerization, promotes nucleation and stabilizes microtubules against cold treatment and dilution. |
AT5G55240 | Catalyze hydroperoxide-dependent mono-oxygenation reactions. Require calcium for peroxygenase activity. Probably deeply buried in lipid droplets or microsomes. |
AT5G55250 | Encodes an enzyme which specifically converts IAA to its methyl ester form MelIAA. This gene belongs to the family of carboxyl methyltransferases whose members catalyze the transfer of the methyl group from S-adenosyl-L-methionine to carboxylic acid-containing substrates to form small molecule methyl esters. Expression of TCP genes is downregulated in mutant iamt1-D. SABATH methyltransferase. |
AT5G55260 | Encodes a protein with similarity to the catalytic subunit of the mammalian PPX protein phospatase. |
AT5G55270 | hypothetical protein (DUF295);(source:Araport11) |
AT5G55290 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
AT5G55300 | Encodes a type-I DNA topoisomerase I. Disruptions in this gene affect phyllotaxis and plant architecture suggesting that the gene plays a critical role in the maintenance of a regular pattern of organ initiation. Isolated as a protein oxidized during seed germination; proteomics approach revealed differences in de novo synthesis levels of this protein in condition with vs. without salicylic acid in the period from 0 to 40 hrs. following seed imbibition. Functions in stem cell maintenance at all stages of shoot and floral meristems and in the regulation of gene silencing. |
AT5G55310 | Encodes one of two Arabidopsis type-I DNA topoisomerase I genes. Reducing the level of expression of this gene in a top1alpha (At5g55300) mutant background causes seedling lethality. |
AT5G55330 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
AT5G55350 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
AT5G55390 | Encodes EDM2 (enhanced downy mildew 2). The predicted protein bears typical features of transcriptional regulators. EDM2 contains two putative bipartite nuclear localization signals (NLS) two zinc-finger-like motifs, a Proline-rich region and a large aspartic acid-rich region. Both zinc-finger-like stretches resemble the PHD (plant homeodomain) finger motif. Mutations in EDM2 comprise RPP7 mediated resistance against Hyaloperonospora parasitica isolate Hiks1 (HpHiks1). EDM2 may function as a direct or indirect regulator of RPP7 expression. |
AT5G55400 | Encodes a member of the fimbrin family. Different members of the fimbrin/plastin family have diverged biochemically during evolution to generate either tight actin bundles or loose networks with distinct biochemical and biophysical properties. FIM4 generates both actin bundles and branched actin filaments whereas FIM5 only generates actin bundles. |
AT5G55410 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT5G55450 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT5G55480 | Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development. The mRNA is cell-to-cell mobile. |
AT5G55490 | Encodes a transmembrane domain containing protein that is expressed in pollen germ cells. |
AT5G55500 | Encodes a beta-1,2-xylosyltransferase that is glycosylated at two positions. The mRNA is cell-to-cell mobile. |
AT5G55510 | PRAT protein family which has a unique system for importing and exporting proteins from chloroplasts. Acts in the export of proteins from chloroplasts during leaf senescence. |
AT5G55520 | kinesin-like protein;(source:Araport11) |
AT5G55540 | Encodes a large plant-specific protein of unknown function, with conserved domains also found in a variety of signaling proteins, In trn mutants, the leaf venation network had a severely reduced complexity: incomplete loops, no tertiary or quaternary veins, and vascular islands. The leaf laminas were asymmetric and narrow because of a severely reduced cell number. TRN1 is required for the maintenance of both the radial pattern of tissue differentiation in the root and for the subsequent circumferential pattern within the epidermis. Double mutant analysis showed that TRN1 and TRN2 act in the same pathway. |
AT5G55640 | Na-translocating NADH-quinone reductase subunit A;(source:Araport11) |
AT5G55650 | transmembrane protein;(source:Araport11) |
AT5G55700 | In vitro assay indicates no beta-amylase activity of BAM4. However mutation in BAM4 impairs starch breakdown. BAM4 may play a regulatory role. |
AT5G55780 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G55835 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAAAGAGAGCAC |
AT5G55840 | PPR superfamily protein;(source:Araport11) |
AT5G55860 | WEB1/PMI2 related protein involved in mecahnotransduction.TREPH1 is phosphorylated at position S625 in response to touch, and this is required for mechanosensitive growth response. |
AT5G55896 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.7e-49 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G55900 | Sucrase/ferredoxin-like family protein;(source:Araport11) |
AT5G55940 | Uncharacterized protein family (UPF0172);(source:Araport11) |
AT5G55960 | transmembrane protein C9orf5 protein;(source:Araport11) |
AT5G55970 | Drought-induced gene encoding an ER-localized RING-type E3 Ub ligase. |
AT5G55980 | serine-rich protein-like protein;(source:Araport11) |
AT5G55990 | Encodes a member of the Arabidopsis CBL (Calcineurin B-like Calcium Sensor) protein family. |
AT5G56000 | HEAT SHOCK PROTEIN 81.4;(source:Araport11) |
AT5G56040 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
AT5G56050 | late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G56110 | Encodes a member of the R2R3 MYB transcription factor gene family that is required for anther development by regulation tapetum development, callose dissolution and exine formation. It acts upstream of MS2. |
AT5G56150 | ubiquitin-conjugating enzyme 30;(source:Araport11) |
AT5G56160 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT5G56170 | LORELEI-LIKE-GPI-ANCHORED PROTEIN 1;(source:Araport11) |
AT5G56200 | Encodes a transcription factor expressed in the female gametophyte. |
AT5G56210 | Encodes an outer nuclear membrane protein that anchors RanGAP1 to the nuclear envelope. It interacts with SUN proteins and is required for maintaining the elongated nuclear shape of epidermal cells. |
AT5G56230 | prenylated RAB acceptor 1.G2;(source:Araport11) |
AT5G56240 | hapless protein;(source:Araport11) |
AT5G56250 | hapless 8;(source:Araport11) |
AT5G56260 | Ribonuclease E inhibitor RraA/Dimethylmenaquinone methyltransferase;(source:Araport11) |
AT5G56290 | Encodes the peroxisomal targeting signal type 1 receptor that facilitates peroxisomal protein translocation. It recognizes proteins with the PTS1 consensus sequence (tripeptide SKL or a conserved variant) at the extreme C terminus. The protein has several domains, including C-terminal tetratricopeptide repeat motifs which act in binding the C-terminal "SKL" targeting signal. The mechanism of transport has been worked out in other organisms: The receptor recognizes and binds cytosolic PTS1-containing proteins. The PEX5-PTS1 complex binds a PEX14/PEX13 receptor complex at the peroxisome membrane and is translocated into the peroxisome matrix in a process dependent on PEX2,PEX10, and PEX12. In the peroxisome matrix, PEX5 releases its cargo and is recycled to the cytosol in a process dependent on PEX1, PEX4, PEX6 and PEX22. It is also involved, in conjunction with PEX7, in PTS1- and PTS2-dependent peroxisomal protein import. RNAi experiments suggest that PEX5 is necessary for the maintenance of both glyoxysomal and leaf peroxisomal functions. |
AT5G56320 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT5G56370 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G56390 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G56400 | FBD, F-box, Skp2-like and Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT5G56440 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G56452 | FBD-like domain family protein;(source:Araport11) |
AT5G56460 | Protein kinase superfamily protein;(source:Araport11) |
AT5G56470 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
AT5G56510 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT5G56520 | hypothetical protein;(source:Araport11) |
AT5G56530 | tRNA-splicing ligase (DUF239);(source:Araport11) |
AT5G56540 | Encodes arabinogalactan protein (AGP14). Mutants exhibit longer root hairs. The mRNA is cell-to-cell mobile. |
AT5G56544 | pseudogene of arginyl-tRNA synthetase |
AT5G56560 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT5G56610 | Encodes a phosphatidylglycerophosphate (PGP) phosphatase involved in the synthesis of plastidial Phosphatidylglycerol (PG) in conjunction with PGPP1 and PTPMT1 in root. For PTPMT2.1, lower expression levels were detected in leaf and stem as compared to the other tissues. |
AT5G56630 | phosphofructokinase 7;(source:Araport11) |
AT5G56640 | Myo-Inositol Oxygenase gene family |
AT5G56690 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT5G56720 | predicted to encode a cytosolic malate dehydrogenase. |
AT5G56760 | Encodes a cytosolic serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. |
AT5G56770 | transcription repressor-like protein;(source:Araport11) |
AT5G56790 | Protein kinase superfamily protein;(source:Araport11) |
AT5G56795 | one of the five metallothioneins (MTs) genes identified in Arabidopsis. MTs are cysteine-rich proteins required for heavy metal tolerance. The MT1b gene, however, is indicated to be inactive. |
AT5G56810 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G56830 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.7e-14 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT5G56850 | hypothetical protein;(source:Araport11) |
AT5G56870 | beta-galactosidase 4;(source:Araport11) |
AT5G56880 | hypothetical protein;(source:Araport11) |
AT5G56890 | Protein kinase superfamily protein;(source:Araport11) |
AT5G56950 | Encodes a member of a small gene family of proteins with similarity to nucleosome assembly proteins.May function in nucleotide excision repair. Loss of function mutations have no obvious visible phenotypes but do seem to affect transcription of NER related genes. Plants mutated in three ubiquitously expressed NAP1 genes (NAP1;1~NAP1;3) and organ-specifically expressed NAP1;4 gene show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. The NAP1 genes act synergistically with NRP genes in promoting somatic homologous recombination. |
AT5G56960 | basic helix-loop-helix (bHLH) DNA-binding family protein;(source:Araport11) |
AT5G56970 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins.Acts on N6-(2-isopentenyl)adenine 9-riboside. |
AT5G56975 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
AT5G56990 | proteinase inhibitor I25, cystatin, motif protein;(source:Araport11) |
AT5G57015 | Member of CKL gene family (member of CKL-B group). |
AT5G57030 | Lutein-deficient 2 (LUT2) required for lutein biosynthesis, member of the xanthophyll class of carotenoids. Encodes lycopene epsilon cyclase |
AT5G57040 | Vicinal oxygen chelate (VOC) superfamily member. Responds to NaCl,drought and high light stress. |
AT5G57070 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G57080 | transmembrane protein;(source:Araport11) |
AT5G57090 | Encodes an auxin efflux carrier that is similar to bacterial membrane transporters. Root-specific role in the transport of auxin. Acts downstream of CTR1 and ethylene biosynthesis, in the same pathway as EIN2 and AUX1, and independent from EIN3 and EIN5/AIN1 pathway. In the root, the protein localizes apically in epidermal and lateral root cap cells and predominantly basally in cortical cells. Functions may be regulated by phosphorylation status. EIR1 expression is induced by brassinolide treatment in the brassinosteroid-insensitive br1 mutant. Gravistimulation results in asymmetric PIN2 distribution, with more protein degraded at the upper side of the gravistimulated root. Membrane sterol composition is essential for the acquisition of PIN2 polarity. Its expression is downregulated at hypoxic conditions. RAP2.12 overexpression inhibits this downregulation. |
AT5G57110 | Arabidopsis-autoinhibited Ca2+ -ATPase, isoform 8, contains all of the characteristic motifs of Ca2+ -transporting P-type Ca2+ -ATPases and is localized to the plasma membrane. |
AT5G57126 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.2e-282 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G57140 | purple acid phosphatase 28;(source:Araport11) |
AT5G57150 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G57160 | Encodes the Arabidopsis orthologue of the yeast and mammalian DNA ligase IV. Involved in the repair of DNA damage but, unlike in yeast, not required for T-DNA integration. Interacts with the Arabidopsis homologue of XRCC4. |
AT5G57230 | Thioredoxin superfamily protein;(source:Araport11) |
AT5G57260 | putative cytochrome P450 |
AT5G57270 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT5G57290 | 60S acidic ribosomal protein family;(source:Araport11) |
AT5G57330 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
AT5G57340 | ras guanine nucleotide exchange factor Q-like protein;(source:Araport11) |
AT5G57345 | OXR is a single copy gene in Arabidopsis. It is localized to the ER. It is expressed throughout the plant and expression is induced in response to abiotic stress. While the function of OXR is unknown, overexpression results in increased abiotic stress tolerance and increased ascorbic acid content. |
AT5G57350 | member of Plasma membrane H+-ATPase family |
AT5G57380 | Encodes a plant homeodomain protein VERNALIZATION INSENSITIVE 3 (VIN3). In planta VIN3 and VRN2, VERNALIZATION 2, are part of a large protein complex that can include the polycomb group (PcG) proteins FERTILIZATION INDEPENDENT ENDOSPERM (FIE), CURLY LEAF (CLF), and SWINGER (SWN or EZA1). The complex has a role in establishing FLC (FLOWERING LOCUS C) repression during vernalization. |
AT5G57390 | Encodes a member of the AP2 family of transcriptional regulators. May be involved in germination and seedling growth. Mutants are resistant to ABA analogs and are resistant to high nitrogen concentrations.essential for the developmental transition between the embryonic and vegetative phases in plants. Overexpression results in the formation of somatic embryos on cotyledons. It is also required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions. Acts redundantly with PLT3 and 7 in lateral root pattern formation. |
AT5G57410 | Encodes a microtubule-associated protein. |
AT5G57420 | Belongs to auxin inducible gene family. |
AT5G57460 | TPLATE complex subunit involved in clathirin mediated endocytosis. |
AT5G57480 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G57500 | Galactosyltransferase family protein;(source:Araport11) |
AT5G57510 | cotton fiber protein;(source:Araport11) |
AT5G57540 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. |
AT5G57560 | Encodes a cell wall-modifying enzyme, rapidly upregulated in response to environmental stimuli. |
AT5G57570 | GCK domain-containing protein;(source:Araport11) |
AT5G57580 | Calmodulin-binding protein;(source:Araport11) |
AT5G57590 | Encodes a bifunctional enzyme with both dethiobiotin synthetase and diaminopelargonic acid aminotransferase activities that is involved in biotin synthesis. |
AT5G57620 | MYB36 is a transcriptional regulator that acts to promote differentiation of the endodermis during root development. It promotes the development the Casparian band in part by regulating the expression of genes involved in localizing lignin biosynthetic machinery to the Casparian band. MYB36 binds to and regulates the expression of factors involved in producing the Casparian band including CASP1, PER64, and ESB1. |
AT5G57630 | CBL-interacting protein kinase.When mutated plants are hypersensitive to salt and osmotic stress. |
AT5G57660 | CONSTANS-like 5;(source:Araport11) |
AT5G57670 | Protein kinase superfamily protein;(source:Araport11) |
AT5G57685 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
AT5G57690 | Involved in nitric oxide-dependent pollen tube guidance and fertilization. |
AT5G57700 | BNR/Asp-box repeat family protein;(source:Araport11) |
AT5G57750 | RING/U-box superfamily protein;(source:Araport11) |
AT5G57760 | hypothetical protein;(source:Araport11) |
AT5G57790 | Encodes a nuclear localized protein of unknown function that is involved in pollen and embryo sac development. |
AT5G57800 | encodes a transmembrane protein with similarity to the sterol desaturase family at the N-terminus and to the short-chain dehydrogenase/reductase family at the C-terminus. Mutant analyses indicate this protein is involved in cuticle membrane and wax biosynthesis. The mRNA is cell-to-cell mobile. |
AT5G57820 | zinc ion binding protein;(source:Araport11) |
AT5G57840 | encodes a protein whose sequence is similar to anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (gi:2239091) |
AT5G57900 | F-box protein, interacts with SKP1/ASK1 subunit of SCF ubiquitin ligase in a glucose-dependent manner |
AT5G57930 | ACCUMULATION OF PHOTOSYSTEM ONE 2 |
AT5G57960 | GTP-binding protein, HflX;(source:Araport11) |
AT5G58000 | Reticulon family protein;(source:Araport11) |
AT5G58010 | Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3). |
AT5G58060 | Constitutively expressed SNARE protein of the YKT6 family. |
AT5G58080 | member of Response Regulator: B- Type |
AT5G58120 | DM10 is a singleton TIR-NLR, and causal QTL responsible for severe hybrid necrosis. |
AT5G58130 | Encodes ROS3 (repressor of silencing 3), a RNA-binding protein required for DNA demethylation. |
AT5G58170 | Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family. |
AT5G58290 | 26S proteasome AAA-ATPase subunit RPT3 (RPT3) mRNA, |
AT5G58310 | Encodes a protein shown to have methyl IAA esterase activity in vitro. This protein does not act on methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
AT5G58330 | lactate/malate dehydrogenase family protein;(source:Araport11) |
AT5G58360 | ovate family protein 3;(source:Araport11) |
AT5G58390 | Peroxidase superfamily protein;(source:Araport11) |
AT5G58410 | HEAT/U-box domain-containing protein;(source:Araport11) |
AT5G58412 | Encodes a Plant thionin family protein |
AT5G58450 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G58580 | Encodes a functional E3 ligase that is involved in membrane trafficking and regulation of salt stress responses. It is localized to membranes including the plasma membrane, pre-vacuolar compartments and Golgi. |
AT5G58590 | Encodes a Ran-binding protein 1 homolog (RanBP1). |
AT5G58610 | PHD finger transcription factor;(source:Araport11) |
AT5G58640 | Selenoprotein, Rdx type;(source:Araport11) |
AT5G58660 | Encodes a class III gibberellin 2-oxidase that oxidizes GA12 to GA110 and GA9 to GA40. |
AT5G58670 | phosphatidylinositol-specific phospholipase C is induced to a significant extent under various environmental stresses, such as dehydration, salinity, and low temperature. May play a role in secondary ABA response. There are two genes called ATPLC1, one corresponding to AT4g38530 and one corresponding ot AT5g58670 (this one). |
AT5G58690 | phosphatidylinositol-speciwc phospholipase C5;(source:Araport11) |
AT5G58740 | Member of the family of NudC proteins. Over-expression improves free radical sacenving activity and antioxidant status, promotes root growth and branching under abiotic stress. |
AT5G58750 | Putative PRISE (progesterone 5β-reductase and/or iridoid synthase-like 1,4-enone reductases). |
AT5G58770 | AtCPT7 synthesizes medium-chain polyprenols of approximately 55 carbons in length. The enzyme utlizes geranylgeranyl pyrophosphate (GGPP) and isopentenyl pyrophosphate (IPP) as substrates. The enzymatic product accumulates into plastdial membranes (DOI:10.1105/tpc.16.00796). |
AT5G58780 | Encodes a novel Z,E-mixed heptaprenyl diphosphate (Z,E-HepPP) synthase, which may be responsible for short-chain betulaprenols. It catalyzes the formation of C 35 short-chain polyisoprenoids in which the optimal allylic substrate was E,E-FPP. It may have a role in response to cold stress in root. |
AT5G58784 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
AT5G58810 | pseudogene of Subtilase family protein;(source:Araport11) |
AT5G58820 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
AT5G58830 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
AT5G58840 | Subtilase family protein;(source:Araport11) |
AT5G58850 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB119). |
AT5G58860 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly only in root tissue. |
AT5G58880 | LRR protein;(source:Araport11) |
AT5G58890 | AGAMOUS-like 82;(source:Araport11) |
AT5G58910 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
AT5G58940 | Arabidopsis thaliana calmodulin-binding receptor-like kinase mRNA The mRNA is cell-to-cell mobile. |
AT5G58960 | Mutant plants display impaired light-regulation of the hypocotyl randomization response. |
AT5G58970 | UCP2 and its paralog UCP1 is a member of the PUMP2 family of uncoupling proteins. It functions as a mitochondrial transporter of spartate, glutamate and dicarboxylates. |
AT5G59000 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT5G59040 | encodes a member of copper transporter family and functionally complements a high affinity copper transporter mutant in yeast |
AT5G59050 | G patch domain protein;(source:Araport11) |
AT5G59080 | hypothetical protein;(source:Araport11) |
AT5G59090 | subtilase 4.12;(source:Araport11) |
AT5G59100 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
AT5G59110 | subtilisin-like serine protease-like protein;(source:Araport11) |
AT5G59120 | SBT4.13 subtilase. Activity is inhibited by SPI-1. |
AT5G59130 | Subtilase family protein;(source:Araport11) |
AT5G59190 | subtilase family protein;(source:Araport11) |
AT5G59200 | Encodes a chloroplast RNA editing factor. |
AT5G59230 | transcription factor-like protein;(source:Araport11) |
AT5G59240 | Ribosomal protein S8e family protein;(source:Araport11) |
AT5G59260 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT5G59290 | Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
AT5G59330 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT5G59340 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. WOX2 has a putative Zinc finger domain downstream of the homeodomain. Transcripts are expressed in the egg cell, the zygote and the apical cell lineage and are reduced in met3-1 early embryos. This gene is necessary for cell divisions that form the apical embryo domain. |
AT5G59420 | OSBP(oxysterol binding protein)-related protein 3C;(source:Araport11) |
AT5G59430 | Encodes a telomeric repeat binding protein with a DNA binding domain at its C terminus. The DNA binding domain has a preference for GGTTTAG sequences and at least five of these repeats are required for recognition by a nearly full-length TRP1 protein. |
AT5G59450 | GRAS family transcription factor;(source:Araport11) |
AT5G59480 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G59490 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G59570 | Encodes BOA (BROTHER OF LUX ARRHYTHMO), a component of the circadian clock. The mRNA is cell-to-cell mobile. |
AT5G59580 | UDP-glucosyl transferase 76E1;(source:Araport11) |
AT5G59600 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G59670 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G59690 | Histone superfamily protein;(source:Araport11) |
AT5G59710 | Encodes a nuclear-localized NOT (negative on TATA-less) domain-containing protein that interacts with the Agrobacterium VirE2 protein and is required for Agrobacterium-mediated plant transformation. It likely facilitates T-DNA integration into plant chromosomes and may play a role as a transcriptional regulator. The mRNA is cell-to-cell mobile. |
AT5G59720 | encodes a low molecular weight heat shock protein that contains the heat shock element in the promoter region. Expression is induced in response to heat shock. |
AT5G59780 | Encodes a putative transcription factor (MYB59). In roots it is involved in K+/NO3- transport and expression of the NPF7.3 transporter. |
AT5G59800 | Encodes a protein containing a methyl-CpG-binding domain that acts as an anti-silencing factor that prevent gene repression and DNA hypermethylation by tethering other anti-silencing factors to methylated DNA, which enables the function of DNA demethylases that in turn limit DNA methylation and prevent transcriptional gene silencing. |
AT5G59810 | Subtilase family protein;(source:Araport11) |
AT5G59820 | Encodes a zinc finger protein involved in high light and cold acclimation. Overexpression of this putative transcription factor increases the expression level of 9 cold-responsive genes and represses the expression level of 15 cold-responsive genes, including CBF genes. Also, lines overexpressing this gene exhibits a small but reproducible increase in freeze tolerance. Because of the repression of the CBF genes by the overexpression of this gene, the authors speculate that this gene may be involved in negative regulatory circuit of the CBF pathway. The mRNA is cell-to-cell mobile. |
AT5G59870 | Encodes HTA6, a histone H2A protein. |
AT5G59890 | actin depolymerizing factor 4 (ADF4) mRNA, complete cds |
AT5G59920 | Isolated in a screen for UV-B insensitive mutants using a hypocotyl growth inhibition assay. Mutants are defective in a number of UV-B responses. |
AT5G59930 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G60010 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
AT5G60020 | LAC17 appears to have laccase activity based on enzyme assays performed using lac17 mutants. Notably, these mutants appear to have a reduced deposition of G lignin units. LAC17 is expressed in interfascicular fibers and likely contributes to lignin biosynthesis, and hence, cell wall biosynthesis, there. |
AT5G60030 | hypothetical protein;(source:Araport11) |
AT5G60060 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
AT5G60070 | ankyrin repeat family protein;(source:Araport11) |
AT5G60080 | Protein kinase superfamily protein;(source:Araport11) |
AT5G60090 | Protein kinase superfamily protein;(source:Araport11) |
AT5G60160 | Vacuolar aspartyl aminopeptidase which also functions as a molecular chaperone. |
AT5G60170 | E3 ligase involved in regulation of chloroplast protein synthesis through activity of PGR3. |
AT5G60180 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT5G60190 | Encodes a protein that can cleave residues from the C-terminus of RUB1 to prepare it for conjugation to target proteins. |
AT5G60200 | Encodes a Dof-type transcription factor. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
AT5G60210 | Encodes RIP5 (ROP interactive partner 5), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants). |
AT5G60260 | hypothetical protein;(source:Araport11) |
AT5G60310 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT5G60335 | Encodes the mitochondria-localized 3-hydroxyacyl-acyl carrier protein (ACP) dehydratase (mtHD) component of the mitochondrial fatty acid synthase (mtFAS) system. It catalyzes the third of the four iterative reactions that constitute the mtFAS cycle. Additionally, it supports the assembly of lipid A-like molecules and has an unexpected function in maintaining the morphology of chloroplastic starch granules. |
AT5G60350 | hypothetical protein;(source:Araport11) |
AT5G60360 | Encodes a senescence-associated thiol protease. The mRNA is cell-to-cell mobile. |
AT5G60370 | exonuclease V-like protein;(source:Araport11) |
AT5G60408 | Encodes a microRNA of the miR390 family with unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCGCAGGAGAGAUAGCGCCA |
AT5G60450 | Encodes a member of the ARF family of transcription factors which mediate auxin responses. ARF4 appears to have redundant function with ETT(ARF3) in specifying abaxial cell identity. |
AT5G60460 | Preprotein translocase Sec, Sec61-beta subunit protein;(source:Araport11) |
AT5G60490 | Encodes a member of fasciclin-like arabinogalactan proteins (FLAs) containing a cell adhesion fasciclin (FAS) domain. Mutations result in altered stem biomechanics with reduced tensile strength and reduced tensile modulus of elasticity, as well as altered cell wall architecture and composition, with increased cellulose microfibril angle, reduced arabinose, galactose and cellulose content. Possibly involved in embryogenesis and seed development. |
AT5G60510 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
AT5G60520 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
AT5G60530 | Root tip expressed LEA protein involved in ribosome biogenesis. |
AT5G60570 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G60580 | RING/U-box superfamily protein;(source:Araport11) |
AT5G60610 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G60615 | Encodes a defensin-like (DEFL) family protein. |
AT5G60650 | proline-rich receptor-like kinase;(source:Araport11) |
AT5G60680 | transcription initiation factor TFIID subunit (Protein of unknown function, DUF584);(source:Araport11) |
AT5G60700 | glycosyltransferase family protein 2;(source:Araport11) |
AT5G60710 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT5G60720 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
AT5G60740 | ABC transporter family protein. Localizes to the growing tip of pollen tubes where it appears to be critical for localizing polyamines and reactive oxygen species. |
AT5G60780 | member of High affinity nitrate transporter family |
AT5G60820 | RING/U-box superfamily protein;(source:Araport11) |
AT5G60850 | Encodes a zinc finger protein. |
AT5G60870 | Encodes a mitochondrial protein RUG3 that is required for accumulation of mitochondrial respiratory chain complex I. RUG3 is related to human REGULATOR OF CHROMOSOME CONDENSATION 1 (RCC1) and Arabidopsis UV-B RESISTANCE 8 (UVR8). |
AT5G60880 | Encodes BASL (BREAKING OF ASYMMETRY IN THE STOMATAL LINEAGE), a regulator of asymmetric divisions. In asymmetrically dividing stomatal-lineage cells, BASL accumulates in a polarized crescent at the cell periphery before division, and then localizes differentially to the nucleus and a peripheral crescent in self-renewing cells and their sisters after division. Its transcript levels change after inducing MUTE expression in a mute background. |
AT5G60900 | Encodes a receptor-like protein kinase. |
AT5G60910 | MADS box gene negatively regulated by APETALA1 |
AT5G60920 | Encodes a glycosylphosphatidylinositol-anchored protein localized primarily in the plasma membrane of the longitudinal sides of root cells. Necessary for oriented cell expansion in Arabidopsis. Cob mutants have abnormal roots that expand radially rather than longitudinally under certain growth conditions. |
AT5G60950 | COBRA-like protein 5 precursor;(source:Araport11) |
AT5G61010 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT5G61060 | Encodes a member of the histone deacetylase family. Class II RPD3-like family HDAC member which controls negative responses to salinity stress. |
AT5G61070 | Encodes a protein with similarity to histone deacetylases, a class of chromatin remodeling factors which act on H3/H4 histones. Class II RPD3-like family HDAC member which controls negative responses to salinity stress. Expressed in roots where it appears to regulate the expression of epidermal cell fate genes controlling hair cell differentiation. |
AT5G61110 | PHD finger-containing protein. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
AT5G61120 | PHD finger-containing protein. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
AT5G61210 | membrane localized t-SNARE SNAP25 homologue, probably involved in cytokinesis and cell plate formation The mRNA is cell-to-cell mobile. |
AT5G61240 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT5G61250 | Belongs to the plant glycoside hydrolase family 79. Encodes a protein with several posttranslational modification sites including O-β-GlcNAc attachment sites and serine-, threonine- and tyrosine-phosphorylation sites, suggesting that this protein is extensively modified posttranslationally. The protein is predicted (WoLF PSORT program) to be secreted. |
AT5G61260 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
AT5G61270 | Basic helix-loop-helix (bHLH) phytochrome interacting factor. Interacts specifically with the far-red light?absorbing Pfr form of phyB through a conserved domain called the active phyB binding motif. Upon light exposure, PIF7 rapidly migrates to intranuclear speckles, where it colocalizes with phyB. Role as negative regulator of phyB-mediated seedling deetiolation. |
AT5G61280 | Remorin family protein;(source:Araport11) |
AT5G61290 | Flavin-binding monooxygenase family protein;(source:Araport11) |
AT5G61330 | rRNA processing protein-like protein;(source:Araport11) |
AT5G61340 | transmembrane protein;(source:Araport11) |
AT5G61350 | Encodes a membrane-localized receptor-like kinase that regulates root hair tip growth by maintaining cytoplasmic Ca2+ gradients. Knockouts of CAP1 produced more cytoplasmic NH4+ and ceased growth of root hairs on MS medium except when NH4+ was depleted; NH4+ depletion reestablished the Ca2+ gradient necessary for normal growth. The lower net NH4+ influx across the vacuolar membrane and relatively alkaline cytosolic pH of root hairs in cap1-1 relative to wild type implied that mutation of CAP1 results in more NH4+ accumulation in the cytoplasm. Furthermore, CAP1 functionally complemented npr1 kinase yeast mutant defective in high-affinity NH4+ uptake via MEP2, distinguishing CAP1 as a cytosolic modulator of NH4+ level that participates in NH4+ homeostasis-regulated root hair growth by modulating tip-focused cytoplasmic Ca2+ gradients. |
AT5G61360 | hypothetical protein;(source:Araport11) |
AT5G61390 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT5G61400 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G61420 | Encodes a nuclear localized member of the MYB transcription factor family. Involved in positive regulation of aliphatic glucosinolate biosynthesis.Expression is induced by touch, wounding and glucose. |
AT5G61430 | NAC domain containing protein 100;(source:Araport11) |
AT5G61480 | Encodes PXY, a receptor-like kinase essential for maintaining polarity during plant vascular-tissue development. |
AT5G61490 | transmembrane protein;(source:Araport11) |
AT5G61510 | GroES-like zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
AT5G61560 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G61570 | Protein kinase superfamily protein;(source:Araport11) |
AT5G61600 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture. |
AT5G61620 | myb-like transcription factor family protein;(source:Araport11) |
AT5G61680 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G61690 | ABC2 homolog 15;(source:Araport11) |
AT5G61700 | ABC2 homolog 16;(source:Araport11) |
AT5G61710 | cotton fiber protein;(source:Araport11) |
AT5G61720 | hypothetical protein (DUF1216);(source:Araport11) |
AT5G61730 | Encodes an ER-localized ABC transporter with a role in the supply of fatty acid substrates for TAG biosynthesis at the ER during the seed-filling stage. |
AT5G61750 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT5G61780 | Involved in the regulation of AtGA20ox3 expression, as well as seed germination. The mRNA is cell-to-cell mobile. |
AT5G61790 | calnexin 1;(source:Araport11) |
AT5G61800 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G61810 | Encodes the predominant of three APC isoforms in Arabidopsis, a calcium-dependent mitochondrial ATP-Mg/Pi transporter. |
AT5G61840 | Encodes a UDP-Xyl:beta-(1,4)-xylosyl transferase. |
AT5G61890 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
AT5G61900 | Encodes a plasma-membrane localized, copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Mutants exhibit temperature-sensitive growth defects and increased hypersensitive response where permissive conditions are low temperature (22 degrees Celsius) and low humidity. Gene is expressed at 22 but not at 28 (restrictive condition) degrees. Lethality of double mutants with BON3 can be partially suppressed by SNC1. Double mutants show defects in development that are genetically separable from hypersensitive/cell death response. |
AT5G61910 | DCD (Development and Cell Death) domain protein;(source:Araport11) |
AT5G61940 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT5G61960 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML1 is a member of two sister clades of mei2-like gene family, AML1 through AML5 and belongs to the clade named ALM14. AML1 is expressed during early embryo development, particularly along embryonic axis at torpedo stage, in shoot apex (weaker expression) and in the organogenic regions of floral apices. |
AT5G61970 | signal recognition particle-related / SRP-like protein;(source:Araport11) |
AT5G61990 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G62020 | member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. |
AT5G62065 | Encodes a Protease inhibitor/seed storage/LTP family protein. Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
AT5G62080 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT5G62100 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
AT5G62130 | Per1-like family protein;(source:Araport11) |
AT5G62140 | ATP-dependent Clp protease ATP-binding subunit;(source:Araport11) |
AT5G62150 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
AT5G62162 | Encodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCAAAGGAGAGUUGCCCUG |
AT5G62170 | LOW protein: M-phase inducer phosphatase-like protein;(source:Araport11) |
AT5G62180 | Carboxyesterase that binds stringolactones. |
AT5G62200 | Embryo-specific protein 3, (ATS3);(source:Araport11) |
AT5G62210 | Embryo-specific protein 3, (ATS3);(source:Araport11) |
AT5G62230 | Encodes a receptor-like kinase that, together with ER and ERL2 governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. It is important for maintaining stomatal stem cell activity and preventing terminal differentiation of the meristemoid into the guard mother cell. Along with erl2 functionally compensates for loss of erecta during integument development. Its transcript levels change after inducing MUTE expression in a mute background. |
AT5G62240 | TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of Aurora kinase activity. |
AT5G62250 | microtubule-associated protein 65-9;(source:Araport11) |
AT5G62270 | Ribosomal protein L20;(source:Araport11). Required for proper mitochondrial cristae formation. Expressed throughout plant. Mutants are defective in late stages of megagametogenesis. Pollen tube defective. Gametophytic lethality is probably due to mitochondrial disfunction. |
AT5G62280 | DUF1442 family protein (DUF1442);(source:Araport11) |
AT5G62360 | Pectin methylesterase inhibitor expressed throughout the plant. |
AT5G62380 | Encodes a NAC-domain transcription factor involved in xylem formation. Induces transdifferentiation of various cells into metaxylem vessel elements. Located in the nucleus. Expression induced in the presence of auxin, cytokinin and brassinosteroids. |
AT5G62420 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT5G62460 | RZFP is a zinc finger protein involved in mediating abiotic stress tolerance. |
AT5G62490 | Part of the AtHVA22 family. Protein expression is ABA- and stress-inducible. |
AT5G62570 | Calmodulin binding protein-like protein;(source:Araport11) |
AT5G62627 | Encodes a defensin-like (DEFL) family protein. |
AT5G62630 | hipl2 protein precursor;(source:Araport11) |
AT5G62640 | nuclear targeted protein involved in flowering time regulation that affects flowering time independent of FLC |
AT5G62680 | Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds. |
AT5G62690 | encodes tubulin beta-2/beta-3 chain The mRNA is cell-to-cell mobile. |
AT5G62710 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G62720 | Integral membrane HPP family protein. Putative nitrate transporter. |
AT5G62730 | Major facilitator superfamily protein;(source:Araport11) |
AT5G62740 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
AT5G62750 | hypothetical protein;(source:Araport11) |
AT5G62760 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G62780 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT5G62820 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT5G62830 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT5G62840 | Phosphoglycerate mutase family protein;(source:Araport11) |
AT5G62860 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT5G62865 | hypothetical protein;(source:Araport11) |
AT5G62880 | ROP (Rho of plant GTPases) family member involved in cell wall patterning. Locally activated to form plasma membrane domains, which direct formation of cell wall pits in metaxylem vessel cells through interaction with cortical microtubules. Pattern formation of cell wall pits is governed by ROP activation via a reaction-difusion mechanism. Patterning involves active ROP1 recruiting BDR1 to the plasma membrane in pit regions. BRD1 in turn recruits the actin binding protein WAL. |
AT5G62900 | PADRE protein down-regulated after infection by S. sclerotiorum. |
AT5G62920 | Encodes a Type-A response regulator that is responsive to cytokinin treatment. Its C-ter domain is very short in comparison to other Arabidopsis ARRs (17 total). Arr6 protein is stabilized by cytokinin. |
AT5G62940 | HCA2 induces the formation of interfascicular cambium and regulates vascular tissue development in the aerial parts of the plant. Evidence from both gain of function and dominant negative alleles. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
AT5G62950 | RNA polymerase II, Rpb4, core protein;(source:Araport11) |
AT5G62960 | UDP-N-acetylglucosamine-N-acetylmuramyl-pyrophosphoryl-undecaprenol N-acetylglucosamine protein;(source:Araport11) |
AT5G62970 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
AT5G62980 | Encodes an enzyme that can act as a aldolase or an epimerase for 7,8-dihydroneopterin and 7,8-dihydromonapterin in vitro. It is likely to act in folate biosynthesis as a homooctamer in vivo. |
AT5G63030 | Thioredoxin superfamily protein, redox sensor. |
AT5G63040 | transmembrane protein;(source:Araport11) |
AT5G63060 | Sec14p like protein involved in chloroplast vesicle transport. Required for photoauxotrophic growth. |
AT5G63087 | Encodes a Plant thionin family protein |
AT5G63090 | Involved in lateral organ development |
AT5G63130 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT5G63160 | BTB and TAZ domain protein. Short-lived nuclear-cytoplasmic protein targeted for degradation by the 26S proteosome pathway. Acts redundantly with BT2 and BT3 during female gametophyte development. |
AT5G63190 | Encodes a member of the MRF (MA3 DOMAIN-CONTAINING TRANSLATION REGULATORY FACTOR) gene family under TOR control that is transcriptionally induced by dark and starvation. MRF1 can be phosphorylated in vitro by S6K1 and S6K2. |
AT5G63200 | tetratricopeptide repeat (TPR)-containing protein;(source:Araport11) |
AT5G63220 | golgi-to-ER traffic-like protein;(source:Araport11) |
AT5G63340 | hypothetical protein;(source:Araport11) |
AT5G63410 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G63450 | AtWRKY33 regulates root apoplastic barrier formation by controlling AtCYP94B1 leading to increased salt tolerance of Arabidopsis plants. Regulation by WRKY33 to control apoplastic barrier formation in roots to confer salt tolerance. |
AT5G63460 | Enhances ABA response and plant drought tolerance by modulating the stability and localization of c2-domain ABA-related proteins.LOT1 regulates plant tolerance to drought stress by affecting ABA signaling through regulating the stability and dynamic localization of CAR9 (PMID:31102784). |
AT5G63530 | Farnesylated protein that binds metals. |
AT5G63560 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT5G63600 | encodes a protein whose sequence is similar to flavonol synthase |
AT5G63610 | significant sequence similarity to plant and animal cyclin-dependent protein kinases, and was classified as an E-type CDK with a SPTAIRE cyclin binding motif in the kinase domain. |
AT5G63620 | Encodes an oxidoreductase involved in transducing the perception of E-2-hexenal, which changes the redox status of the mitochondria. |
AT5G63630 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G63650 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. |
AT5G63690 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT5G63710 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G63715 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. Dominant gain of function alleles have enlarged meristems, fasciated stems and radialized leaves. During early embryo development expression is reciprocal to target mRNAs but then changes to overlapping expression with targets. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC |
AT5G63720 | Encodes KOKOPELLI (KPL). kokopelli (kpl) mutants display frequent single-fertilization events indicating that KPL is involved in double fertilization. KPL and an inversely transcribed gene, ARIADNE14 (ARI14), which encodes a putative ubiquitin E3 ligase, generate a sperm-specific natural cis-antisense siRNA pair. In the absence of KPL, ARI14 RNA levels in sperm are increased and fertilization is impaired. |
AT5G63730 | Encodes ARIADNE14 (ARI14), a putative ubiquitin E3 ligase. ARI14 and an inversely transcribed gene KPL generate a sperm-specific natural cis-antisense siRNA pair. In the absence of KPL, ARI14 RNA levels in sperm are increased and fertilization is impaired. |
AT5G63750 | RING/U-box superfamily protein;(source:Araport11) |
AT5G63780 | Encodes SHA1 (shoot apical meristem arrest), a putative E3 ligase (a RING finger protein) required for post-embryonic SAM maintenance. The mutant sha1-1 shows a primary SAM-deficient phenotype at the adult stage. |
AT5G63800 | Involved in mucilage formation. Mutants form columella and outer cell wall architecture of the mucilage cells resembles wild-type. However, mum2 seeds completely lack seed coat mucilage. This mutation appears to represent a later step in the development of this cell-type. Encodes a beta-galactosidase involved in seed coat mucilage biosynthesis. Member of Glycoside Hydrolase Family 35 |
AT5G63810 | member of Glycoside Hydrolase Family 35 |
AT5G63820 | hypothetical protein (DUF626);(source:Araport11) |
AT5G63850 | Amino acid transporter whose expression is downregulated by dehydration. |
AT5G63900 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
AT5G63930 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G63941 | Pseudogene of AT5G09270 |
AT5G63990 | Inositol monophosphatase family protein;(source:Araport11) |
AT5G64000 | 3'(2'),5'-bisphosphate nucleotidase |
AT5G64010 | U2 small nuclear ribonucleoprotein auxiliary factor-like protein;(source:Araport11) |
AT5G64030 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G64060 | NAC domain containing protein 103;(source:Araport11) |
AT5G64090 | hyccin;(source:Araport11) |
AT5G64110 | Peroxidase superfamily protein;(source:Araport11) |
AT5G64130 | cAMP-regulated phosphoprotein 19-related protein;(source:Araport11) |
AT5G64140 | Encodes a putative ribosomal protein S28. |
AT5G64190 | neuronal PAS domain protein;(source:Araport11) |
AT5G64210 | encodes an isoform of alternative oxidase, which is expressed in rosettes, stems, and roots. Transcript accumulates in dry seeds and decreased upon germination and is not affected by actinomycin A. Protein is localized to mitochondria. |
AT5G64230 | 1,8-cineole synthase;(source:Araport11) |
AT5G64250 | Aldolase-type TIM barrel family protein;(source:Araport11) |
AT5G64310 | Encodes arabinogalactan-protein (AGP1). The mRNA is cell-to-cell mobile. |
AT5G64330 | Involved in blue light response signaling pathway; interacts with the blue light photoreceptor NPH1. Null mutations abolish phototrophic responses of etiolated seedlings to low fluence blue light. Protein contains multiple protein-protein interaction domains. |
AT5G64340 | Encodes a bHLH(basic helix-loop-helix)-type transcription factor SAC51 [suppressor of acaulis 51]. Upregulation of SAC51 reverses the dwarf phenotype caused by a loss-of-function mutation in ACL5 (Arabidopsis thaliana ACAULIS 5) gene, suggesting that activation of SAC51 may lead to the expression of a subset of genes required for stem elongation. |
AT5G64410 | oligopeptide transporter |
AT5G64420 | DNA polymerase V family;(source:Araport11) |
AT5G64440 | AtFAAH (fatty acid amide hydrolase) modulates endogenous NAEs (N-Acylethanolamines) levels in plants by hydrolyzing NAEs to ethanolamine and their corresponding free fatty acids. NAE depletion likely participates in the regulation of plant growth. The mRNA is cell-to-cell mobile. |
AT5G64450 | NYN domain protein;(source:Araport11) |
AT5G64490 | ARM repeat superfamily protein;(source:Araport11) |
AT5G64520 | Encodes a protein of the XRCC2 family involved in DNA repair. atxrcc2-1 Mutants are sensitive to MitomycinC but do not show fertility defects. |
AT5G64530 | xylem NAC domain 1;(source:Araport11) |
AT5G64570 | Encodes a beta-d-xylosidase that belongs to family 3 of glycoside hydrolases. |
AT5G64580 | Strong interaction with TIC inner envelope protein translocon which consists of Tic20/Tic56/Tic100/Tic214(Ycf1)(DOI:10.1105/tpc.18.00357). |
AT5G64610 | Encodes an enzyme with histone acetyltransferase activity. HAM1 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM1. HAM1 acetylates histone H4 lysine 5. |
AT5G64650 | Ribosomal protein L17 family protein;(source:Araport11) |
AT5G64690 | neurofilament triplet H protein-like protein;(source:Araport11) |
AT5G64700 | nodulin MtN21-like transporter family protein |
AT5G64735 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
AT5G64740 | Encodes a cellulose synthase isomer. CESA6 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA6, along with CESA1 and CESA3 are present in the same plasma membrane complex for cellulose biosynthesis. CESA2 and CESA5 are related to CESA6, having partially redundant roles. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. The mRNA is cell-to-cell mobile. |
AT5G64750 | Encodes a putative transcription factor containing an AP2 domain. Is a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. Expressed in response to ABA, osmotic stress, sugar stress and drought. Mutants are hypersensitive to these stresses. May be involved in regulation of ABA mediated stress response. The mRNA is cell-to-cell mobile. |
AT5G64770 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
AT5G64790 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT5G64810 | member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses. |
AT5G64855 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
AT5G64860 | Encodes a maltotriose-metabolizing enzyme with chloroplastic α-1,4-glucanotransferase activity. Mutant has altered starch degradation. |
AT5G64870 | Belongs to the group of plant flotillins, which are plasma membrane proteins. Flot3 is found in membrane nanodomains. |
AT5G64880 | transmembrane protein;(source:Araport11) |
AT5G64910 | Serine/Threonine-kinase;(source:Araport11) |
AT5G64920 | Encodes a RING-H2 protein that interacts with the RING finger domain of COP1. CIP8 exhibits a strong interaction with the E2 ubiquitin conjugating enzyme AtUBC8 through its N-terminal domain and promotes ubiquitination in an E2-dependent fashion in vitro. It is possible that the AtUBC8-CIP8 module might interact with COP1 in vivo, thereby participating in proteasome-mediated degradation of HY5. |
AT5G64930 | Regulator of expression of pathogenesis-related (PR) genes. Participates in signal transduction pathways involved in plant defense (systemic acquired resistance -SAR). |
AT5G64990 | RAB GTPase homolog H1A;(source:Araport11) |
AT5G65030 | nitric oxide synthase-interacting protein;(source:Araport11) |
AT5G65060 | MADS domain protein - flowering regulator that is closely related to FLC |
AT5G65080 | Is upregulated during vernalization and regulates flowering time. Encodes MADS-domain protein. Two variants encoding proteins of 198 and 184 amino acids have been reported. |
AT5G65090 | Encodes a protein involved in root hair morphogenesis and tip growth. Required for restricting both the size of the root-hair initiation site and the width of the root hairs during the transition to tip growth, but, apparently, is not required for normal subsequent tip growth. |
AT5G65120 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
AT5G65130 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
AT5G65140 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G65160 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT5G65165 | One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Transcripts appear during seed maturation, persist through desiccation, are abundant in dry seeds, and markedly decline during germination. |
AT5G65170 | VQ motif-containing protein;(source:Araport11) |
AT5G65180 | ENTH/VHS family protein;(source:Araport11) |
AT5G65205 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G65210 | Encodes TGA1, a redox-controlled regulator of systemic acquired resistance. TGA1 targets the activation sequence-1 (as-1) element of the promoter region of defense proteins. TGA1 are S-nitrosylated. |
AT5G65250 | transmembrane protein;(source:Araport11) |
AT5G65274 | ARP2/3 complex 16 kDa subunit (p16-Arc);(source:Araport11) |
AT5G65280 | Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor. Loss of function mutations in GCL1 show no ABA response defects based on assays of seed germination and seedling development.GCL1 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase. |
AT5G65290 | LMBR1-like membrane protein;(source:Araport11) |
AT5G65300 | Gene of unknown function. Expression is induced by a variety of biotic (P. syringae) and abiotic stresses (salt, ABA,IAA, and more.)Member of a small family that includes AT1G35210, AT1G72240, and AT1G22470.Mutants have no obvious loss of function phenotype but overexpressors are early flowering. |
AT5G65305 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
AT5G65330 | AGAMOUS-like 78;(source:Araport11) |
AT5G65340 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT5G65380 | MATE efflux family protein;(source:Araport11) |
AT5G65400 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G65410 | Encodes ZFHD2, a member of the zinc finger homeodomain transcriptional factor family.Gain of function of ATHB25 (35S and UBQ10 proomoters) and double loss of function of ATHB25 and ATHB22 increases and decreases, respectively, seed longevity. This phenotype is maternal and related to seed coat alterations. Gain of function increases expression of GA3OX2 and GA4 and GA1 levels. Together with REM7 induces the expression of genes controlling shoot stem characteristics by ectopic expression in roots. |
AT5G65420 | Encodes a D-type cyclin CYCD4;1 that physically interacts with CDC2A and is expressed during vascular tissue development, embryogenesis, and formation of lateral root primordia. Its expression is upregulated early during germination.Involved in stomatal cell lineage proliferation in the hypocotyl. |
AT5G65450 | Encodes a ubiquitin-specific protease. The mRNA is cell-to-cell mobile. |
AT5G65460 | Kinesin that binds cyclin-dependent kinase CDKA;1 as homodimer or as heterodimer with KCA1 |
AT5G65470 | O-fucosyltransferase family protein;(source:Araport11) |
AT5G65500 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G65550 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT5G65575 | Natural antisense transcript overlaps with AT5G65580;(source:Araport11) |
AT5G65590 | Encodes a plant-specific Dof-type transcription factor expressed in maturing guard cells, but not in guard mother cells. It regulates essential processes of stomatal guard cell maturation and functions as a key transcription factor regulating the final stages of guard cell differentiation. |
AT5G65615 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
AT5G65630 | This gene is predicted to encode a bromodomain-containing protein. Plant lines expressing RNAi constructs targeted against GTE7 show some resistance to agrobacterium-mediated root transformation. |
AT5G65660 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G65670 | auxin (indole-3-acetic acid) induced gene The mRNA is cell-to-cell mobile. |
AT5G65687 | Major facilitator superfamily protein;(source:Araport11) |
AT5G65700 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM2,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM1 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. The mRNA is cell-to-cell mobile. |
AT5G65770 | Encodes a protein that localizes to the nuclear periphery and affects nuclear morphology. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
AT5G65780 | Encodes a chloroplast branched-chain amino acid aminotransferase, can complement the yeast leu/iso-leu/val auxotrophy mutant. Note that the AT5G65780.2 gene model (TAIR10) has been obsoleted due to the lack of experimental support. The mRNA is cell-to-cell mobile. |
AT5G65790 | Encodes a MYB family protein with N-terminal R2R3 DNA-binding domains involved in root development. |
AT5G65800 | 1-aminocyclopropane-1-carboxylate synthase (ACS) is encoded by a multigene family consisting of at least five members whose expression is induced by hormones, developmental signals, and protein synthesis inhibition. |
AT5G65840 | Thioredoxin superfamily protein;(source:Araport11) |
AT5G65860 | ankyrin repeat family protein;(source:Araport11) |
AT5G65880 | transmembrane protein;(source:Araport11) |
AT5G65930 | encodes a novel member of the kinesin superfamily of motor proteins. recessive mutations have reduced number of trichome branches. |
AT5G65950 | TRAPPIII complex protein which regulates TGN integrity, by altered TGN/EE association of several residents, including SYNTAXIN OF PLANTS 61 (SYP61), and altered vesicle morphology. Involved in regulation of endosomal function and salt stress response. |
AT5G65970 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO10 belongs to the clade III, with AtMLO5, AtMLO7, AtMLO8, and AtMLO9. The gene is expressed in root and cotyledon vascular system, in root-shoot junction and lateral root primordia and in developing siliques, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s |
AT5G65990 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT5G66020 | Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. non-consensus AT donor splice site at exon 7, TA donor splice site at exon 10, AT acceptor splice at exon 13. |
AT5G66050 | Wound-responsive family protein;(source:Araport11) |
AT5G66052 | transmembrane protein;(source:Araport11) |
AT5G66070 | E3 ubiquitin ligase that functions in negative regulation of ABA signaling. |
AT5G66090 | cell wall integrity/stress response component;(source:Araport11) |
AT5G66160 | Encodes a receptor homology region transmembrane domain, ring H2 motif protein involved in transport of storage proteins to protein storage vacuoles. Localized to endoplasmic reticulum and co-localizes with DIP positive vesicles and to the trans-golgi network when complexed with RMR2. |
AT5G66180 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G66260 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT5G66310 | ATP binding microtubule motor family protein;(source:Araport11) |
AT5G66320 | Encodes GATA transcription factor gene GNC, involved in regulating carbon and nitrogen metabolism. Expression occurs in aerial tissue at an early stage of development and is inducible by nitrate. |
AT5G66340 | hypothetical protein;(source:Araport11) |
AT5G66370 | metal ion-binding protein;(source:Araport11) |
AT5G66390 | Encodes a peroxidase that is involved in lignin biosynthesis. Required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
AT5G66440 | tRNA-methyltransferase non-catalytic subunit trm6MTase subunit;(source:Araport11) |
AT5G66460 | Encodes a endo-beta-mannanase involved in seed germination and silique dehiscence. |
AT5G66540 | U3 small nucleolar ribonucleoprotein;(source:Araport11) |
AT5G66550 | Maf-like protein;(source:Araport11) |
AT5G66570 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO1 is the major isoform in the wild-type. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the membrane. The mRNA is cell-to-cell mobile. |
AT5G66607 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G66630 | DA1-related protein 5;(source:Araport11) |
AT5G66650 | Chloroplast localized mitochondrial calcium uniporter. |
AT5G66658 | hypothetical protein;(source:Araport11) |
AT5G66670 | pectinesterase, putative (DUF677);(source:Araport11) |
AT5G66675 | transmembrane protein, putative (DUF677);(source:Araport11) |
AT5G66690 | UGT72E2 is an UDPG:coniferyl alcohol glucosyltransferase which glucosylates sinapyl- and coniferyl aldehydes as well as sinapyl- and coniferyl alcohol. The enzyme is thought to be involved in lignin metabolism. A knockdown mutant line (72E2KD) was obtained using RNAi silencing. A twofold reduction in coniferyl alcohol 4-O-glucoside and sinapyl alcohol 4-O-glucoside was detected in this line compared to wildtype. In comparison, both knockout and knockdown lines of UGT72E1 and UGT72E3, respectively, failed to display the same reduction in phenylpropanoid 4-O-glucosides. The mRNA is cell-to-cell mobile. |
AT5G66700 | Encodes a homeodomain protein. Member of HD-ZIP 1 family, most closely related to HB5. AtHB53 is auxin-inducible and its induction is inhibited by cytokinin, especially in roots therefore may be involved in root development. |
AT5G66755 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
AT5G66790 | Protein kinase superfamily protein;(source:Araport11) |
AT5G66815 | Counteracts auxin effects by stabilizing AUX/IAA transcriptional repressors. Impact on abiotic stress processes. |
AT5G66816 | DNA-directed RNA polymerase II subunit RPB1-like protein;(source:Araport11) |
AT5G66820 | transmembrane protein;(source:Araport11) |
AT5G66870 | Encodes LOB domain protein whose overexpression results in KNOX gene repression. Overexpression also results in plants with hyponastic leaves, downward pointing flowers and reduced apical dominance. May be involved in the transcriptional regulation of the homeobox gene BP (brevipedicellus) during lateral organ differentiation. Acts together with AS2 in proximal-distal symmetry determination. |
AT5G66880 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. The mRNA is cell-to-cell mobile. |
AT5G66890 | RPW8 -CNL gene. |
AT5G66920 | SKU5 similar 17;(source:Araport11) |
AT5G66940 | Encodes a nuclear localized DOF-domain binding transcription factor. |
AT5G66950 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT5G67040 | F-box protein, putative (DUF295);(source:Araport11) |
AT5G67090 | Encodes a subtilisin-like serine protease with in vitro protease activity. |
AT5G67140 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G67190 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
AT5G67200 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G67230 | Encodes a member of the GT43 family glycosyltransferases involved in glucuronoxylan biosynthesis: AT2G37090 (IRX9) and AT1G27600 (IRX9-L or I9H, IRX9 homolog); AT4G36890 (IRX14) and AT5G67230 (IRX14-L or I14H, IRX14 homolog). They form two functionally non-redundant groups essential for the normal elongation of glucuronoxylan backbone. I9H functions redundantly with IRX9, I14H is redundant with IRX14. IRX9 or I9H do not complement IRX14, IRX14 or I14H do not complement IRX9. |
AT5G67245 | hypothetical protein;(source:Araport11) |
AT5G67270 | encodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis. |
AT5G67280 | receptor-like kinase;(source:Araport11) |
AT5G67290 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
AT5G67340 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G67380 | Casein kinase II (CK2) catalytic subunit (alpha 1). One known substrate of CK2 is Phytochrome Interacting Factor 1 (PIF1). CK2-mediated phosphorylation enhances the light-induced degradation of PIF1 to promote photomorphogenesis. |
AT5G67385 | Encodes a phototropin-interacting NRL protein that is an early signaling component in the phototrophic response and is essential for the phototropin-mediated chloroplast accumulation response but is not involved in the chloroplast avoidance response or stomatal opening. |
AT5G67390 | glycosyltransferase-like protein;(source:Araport11) |
AT5G67400 | root hair specific 19;(source:Araport11) |
AT5G67411 | GRAS family transcription factor;(source:Araport11) |
AT5G67420 | Encodes a LOB-domain protein involved in nitrogen metabolism and affecting leaf morphogenesis. |
AT5G67440 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
AT5G67460 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT5G67470 | formin homolog 6;(source:Araport11) |
AT5G67480 | BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves. |
AT5G67540 | Arabinanase/levansucrase/invertase;(source:Araport11) |
AT5G67550 | transmembrane protein;(source:Araport11) |
AT5G67560 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. Possible pseudogene because it lacks an N-terminal part that is conserved among the other ARL8 proteins. The mRNA is cell-to-cell mobile. |
AT5G67570 | Encodes a pentratricopeptide repeat containing protein that is targeted to the chloroplast. Mutants have pale young leave and reduced accumulation of plastid encoded transcripts suggesting a role for DG1 in regulation of plastid gene expression. |
AT5G67600 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
AT5G67610 | Encodes an orthlog of the Xenopus inner nuclear membrane (INM) protein Nemp1/TMEM194A. |
AT5G67640 | hypothetical protein;(source:Araport11) |