37 senescence-associated transcription factors (Sen-TFs) ChIP-seq or DAP-seq data

ABF1  ABF2  ABF3  ABF4  ABI5  ANAC012  ANAC013  ANAC016  ANAC017  ANAC029  
CCA1  EIN3  MYB44  MYC2  MYC3  RAV1  RD26  Revoluta  TCP20  WRKY22  
WRKY45  WRKY50  WRKY55  WRKY6  WRKY70  WRKY71  WRKY75  
ANAC071 Targets Description
AT1G01046 Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUUCUUCUACUUCUUGCACA
AT1G01070 Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed.
AT1G01120 Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis.
AT1G01130 CBL-interacting Serine/Threonine-kinase;(source:Araport11)
AT1G01140 Encodes a CBL-interacting protein kinase with similarity to SOS2
AT1G01150 Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11)
AT1G01180 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT1G01190 cytochrome P450, family 78, subfamily A, polypeptide 8;(source:Araport11)
AT1G01220 Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis.
AT1G01260 bHLH13 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH14 and bHLH17 to negatively regulate jasmonate responses.
AT1G01305 hypothetical protein;(source:Araport11)
AT1G01320 Encodes REDUCED CHLOROPLAST COVERAGE 1 (REC1) a protein with similarity to the FLOURY locus in maize. Located in the nucleus and cytosol. Contributes to establishing the size of the chloroplast compartment.
AT1G01380 ETC1 is involved in trichome and root hair patterning in Arabidopsis.
AT1G01390 Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member.
AT1G01410 Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts.
AT1G01430 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers.Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member.
AT1G01480 a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family, isolated from a flower-specific cDNA library.
AT1G01490 Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT1G01500 Erythronate-4-phosphate dehydrogenase family protein;(source:Araport11)
AT1G01510 Encodes a homolog of human CtBP. Mutant has longer and thicker leaves than wild type. Involved in controlling polar cell expansion in the leaf width direction. It has been shown to localize to cytosolic stress granules and is involved in their formation.
AT1G01520 RVE3 is one of eleven homologous MYB-like transcription factors in Arabidopsis and a member of the RVE8 clade. Plays a minor role in clock regulation.
AT1G01540 Protein kinase superfamily protein;(source:Araport11)
AT1G01550 Encodes a protein with no functionally characterized domains that to prevent the synthesis of a novel substance that moves from the root to the shoot, where it modifies shoot growth by interfering with auxin signaling. Synthesis and delivery of this substance requires neither phloem nor endodermis.
AT1G01580 Encodes the low-iron-inducible ferric chelate reductase responsible for reduction of iron at the root surface. It is likely to be the major Fe(III) chelate reductase in Arabidopsis iron metabolism. Coordinately regulated with IRT1, the major transporter responsible for high-affinity iron uptake from the soil, at both transcriptional and posttranscriptional levels. Steady state mRNA levels are regulated by several metals. Its transcription is regulated by FIT1.
AT1G01590 Encodes a ferric-chelate reductase that is expressed at extremely low levels in Fe deficiency-induced seedlings.
AT1G01600 Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly at highest level in mature stems and flowers.
AT1G01610 bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly and is functionally redundant with GPAT8.
AT1G01630 Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT1G01660 Plant U-box type E3 ubiquitin ligase (PUB).
AT1G01695 Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11)
AT1G01700 Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily.
AT1G01780 Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. The mRNA is cell-to-cell mobile.
AT1G01820 member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.
AT1G01830 ARM repeat superfamily protein;(source:Araport11)
AT1G02020 nitroreductase family protein;(source:Araport11)
AT1G02070 zinc ion-binding protein;(source:Araport11)
AT1G02250 Encodes a member of the NAC family of transcription factors. ANAC005 contains sequences specifying both nuclear and plasma membrane targeting. Overexpression results in increased xylem differentiation suggesting ANAC005 promotes xylem formation.
AT1G02335 Encodes a plasodesmata-located protein involved in regulating primary root growth by controlling phloem-mediated allocation of resources between the primary and lateral root meristems.
AT1G02400 Encodes a gibberellin 2-oxidase that acts on C19 gibberellins but not C20 gibberellins.
AT1G02450 NIMIN1 modulates PR gene expression according the following model: NPR1 forms a ternary complex with NIMIN1 and TGA factors upon SAR induction that binds to a positive regulatory cis-element of the PR-1 promoter, termed LS7. This leads to PR-1 gene induction. NIMIN1 decreases transcriptional activation, possibly through its EAR motif, which results in fine-tuning of PR-1 gene expression.
AT1G02460 Pectin lyase-like superfamily protein;(source:Araport11)
AT1G02470 Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11)
AT1G02520 Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. The mRNA is cell-to-cell mobile.
AT1G02530 P-glycoprotein 12;(source:Araport11)
AT1G02540 hypothetical protein;(source:Araport11)
AT1G02570 transmembrane protein;(source:Araport11)
AT1G02575 transmembrane protein;(source:Araport11)
AT1G02580 Encodes the imprinted gene MEA that belongs to Polycomb Repressive Complex 2 (PRC2) and has a SET domain for methyltransferase activity and is involved in the stable transcriptional silencing of target genes. It negatively regulates seed development in the absence of fertilization. Mutations in this locus result in embryo lethality. MEA is imprinted in the endosperm. The maternal allele is expressed and the paternal allele is silent. MEA is controlled by DEMETER (DME), a DNA glycosylase required to activate MEA expression, and METHYLTRANSFERASE I (MET1), which maintains CG methylation at the MEA locus. MEA is involved in the negative regulation of its own imprinted gene expression; the effect is not only allele-specific but also dynamically regulated during seed development. In the ovule, the MEA transcripts are accumulated at their highest level before fertilization and gradually decrease after fertilization
AT1G02610 RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11)
AT1G02630 Nucleoside transporter family protein;(source:Araport11)
AT1G02640 encodes a protein similar to a beta-xylosidase located in the extracellular matrix. This is a member of glycosyl hydrolase family 3 and has six other closely related members.
AT1G02650 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G02700 GATA transcription factor-like protein;(source:Araport11)
AT1G02720 Encodes a protein with putative galacturonosyltransferase activity.
AT1G02730 Encodes a gene similar to cellulose synthase. Knock-out mutant has reduced growth, reduced xylan level and reduced xylan synthase activity in stems.It's expression is cell cycle dependent and it appears to function in cell plate formation.
AT1G02790 encodes a exopolygalacturonase.
AT1G02830 Ribosomal L22e protein family;(source:Araport11)
AT1G02850 beta glucosidase 11;(source:Araport11)
AT1G02860 Encodes a ubiquitin E3 ligase with RING and SPX domains that is involved in mediating immune responses and mediates degradation of PHT1s at plasma membranes. Targeted by MIR827. Ubiquitinates PHT1;3, PHT1;2, PHT1;1/AtPT1 and PHT1;4/AtPT2.
AT1G02900 Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. Mediates Ca2+-dependent signaling. Regulates the splicing of flowering genes and exerts an opposite effect on the flowering time compared with FER.
AT1G02950 Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002).
AT1G02960 kinetochore protein;(source:Araport11)
AT1G02980 encodes an Arabidopsis cullin
AT1G03010 Phototropic-responsive NPH3 family protein;(source:Araport11)
AT1G03020 Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2.
AT1G03050 Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane.
AT1G03055 Encodes the ortholog of rice D27. It is plastid-localized and is required for the inhibition of secondary bud outgrowth and operates on a nonmobile precursor upstream of MAX1 in the SL biosynthesis pathway.
AT1G03120 responsive to abscisic acid 28;(source:Araport11)
AT1G03170 A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines.
AT1G03230 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT1G03300 Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype
AT1G03310 Encodes a protein with strong similarity to isoamylase (EC:3.2.1.68) however lacks critical residues known to be important for activity. Appears to co localize with ISA1 in the chloroplast isoamylase complex. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. It has been postulated that AtISA2 interacts with AtISA1 to form the Iso1 complex.
AT1G03320 hypothetical protein;(source:Araport11)
AT1G03360 Encodes a core subunit of the RNA exosome required for the processing of rRNA, several snoRNA and the degradation of aberrant transcripts.
AT1G03390 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT1G03440 Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT1G03445 encodes a serine?threonine protein phosphatase with an N-terminal Kelch-repeat domain, which is nuclear localized and expressed preferentially in elongating cells. Genetic evidence suggest that this gene plays a redundant role (along with other members of the same gene family) in modulating growth in response to brassinosteroid.
AT1G03457 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT1G03490 NAC domain containing protein 6;(source:Araport11)
AT1G03515 pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10)
AT1G03520 Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11)
AT1G03580 pseudogene of MATH domain/coiled-coil protein;(source:Araport11)
AT1G03590 Protein phosphatase 2C family protein;(source:Araport11)
AT1G03620 ELMO/CED-12 family protein;(source:Araport11)
AT1G03660 Ankyrin-repeat containing protein;(source:Araport11)
AT1G03670 Ankyrin repeat containing protein
AT1G03730 pyrroline-5-carboxylate reductase;(source:Araport11)
AT1G03740 Protein kinase superfamily protein;(source:Araport11)
AT1G03850 Encodes glutaredoxin ATGRXS13, required to facilitate Botrytis cinerea infection of Arabidopsis thaliana plants. Sylvain La Camera et al (2011, PMID:21756272) reported a third splice variant in addition to the two annotated in TAIR10. It is a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity.
AT1G03880 Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds.
AT1G03920 Protein kinase family protein;(source:Araport11)
AT1G03935 snoRNA;(source:Araport11)
AT1G03950 vacuolar protein sorting-associated protein 2.3;(source:Araport11)
AT1G03970 encodes a basic leucine zipper G-box binding factor that can bind to G-box motifs only as heterodimers with GBF2 or GBF3. A single amino acid change can confer G-box binding as homodimers.
AT1G03990 Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11)
AT1G04090 vacuolar sorting-associated protein (DUF946);(source:Araport11)
AT1G04100 Auxin induced gene, IAA10 (IAA10).
AT1G04110 Initially identified as a mutation affecting stomatal development and distribution. Encodes a protein similar to serine proteases.
AT1G04120 encodes a high-affinity inositol hexakisphosphate transporter that plays a role in guard cell signaling and phytate storage. It is a member of MRP subfamily / ABC transporter subfamily C.
AT1G04170 protein synthesis initiation factor eIF2 gamma The mRNA is cell-to-cell mobile.
AT1G04180 YUCCA 9;(source:Araport11)
AT1G04200 dyggve-melchior-clausen syndrome protein;(source:Araport11)
AT1G04240 SHY2/IAA3 regulates multiple auxin responses in roots. It is induced rapidly by IAA, and has been shown to be phosphorylated by oat phytochrome A in vitro.
AT1G04250 Transcription regulator acting as repressor of auxin-inducible gene expression. Auxin-inducible AUX/IAA gene. Short-lived nuclear protein with four conserved domains. Domain III has homology to beta alpha alpha dimerization and DNA binding domains. Involved in auxin signaling and is a positive modulator of natural leaf senescence. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components.
AT1G04350 encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase
AT1G04360 RING/U-box superfamily protein;(source:Araport11)
AT1G04380 encodes a protein similar to a 2-oxoglutarate-dependent dioxygenase
AT1G04390 BTB/POZ domain-containing protein;(source:Araport11)
AT1G04400 Blue light receptor mediating blue-light regulated cotyledon expansion and flowering time. Positive regulator of the flowering-time gene CONSTANS. This gene possesses a light-induced CNT2 N-terminal homodimerisation domain.Involved in blue-light induced stomatal opening. Involved in triggering chromatin decondensation. An 80-residue motif (NC80) is sufficient to confer CRY2's physiological function. It is proposed that the PHR domain and the C-terminal tail of the unphosphorylated CRY2 form a "closed" conformation to suppress the NC80 motif in the absence of light. In response to blue light, the C-terminal tail of CRY2 is phosphorylated and electrostatically repelled from the surface of the PHR domain to form an "open" conformation, resulting in derepression of the NC80 motif and signal transduction to trigger photomorphogenic responses. Cry2 phosphorylation and degradation both occur in the nucleus.The life-time of cry2 signaling state in situ (in planta) is about 16 min.
AT1G04440 Member of CKL gene family (CKL-C group).
AT1G04450 Encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). It interacts with Rop1 and is involved in pollen tube growth and function, and exocytosis in the pollen tube tip. The protein most similar to RIC1 (family subgroup III). Gene is expressed predominantly in inflorescence and flower tissue. Interacts with ROP1 to modulate calcium ion influxes required to generate tip-focused calcium gradients.It
AT1G04457 Pseudogene of AT2G33450; 50S ribosomal protein L28, chloroplast (CL28)
AT1G04490 hypothetical protein (DUF3527);(source:Araport11)
AT1G04500 CCT motif family protein;(source:Araport11)
AT1G04520 Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata.
AT1G04530 Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones.
AT1G04570 Similar to plastid solute transporters.
AT1G04580 Encodes aldehyde oxidase AAO4 preferentially expressed in developing seeds.
AT1G04670 hypothetical protein;(source:Araport11)
AT1G04710 EC2.3.1.16 thiolase. Its transcript levels change after inducing MUTE expression in a mute background.
AT1G04720 pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10)
AT1G04770 SDI2 is a member of a small family of TPR proteins in Arabidopsis. Like SDI1 it is induced by low sulfer and appears to play a role in negative regulation of glucosinolate biosynthesis.
AT1G04870 Encodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts.
AT1G04910 O-fucosyltransferase family protein;(source:Araport11)
AT1G04920 Encodes a sucrose-phosphate synthase whose activity is stimulated by Glc-6-P and inhibited by Pi.
AT1G04950 Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant.
AT1G04970 Encodes one of the two LBP/BPI related proteins (AT1G04970/LBR-1, AT3G20270/LBR-2) that bind to LPS directly and regulate PR1 expression. Putative BPI/LBP family protein.
AT1G04990 Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11)
AT1G05000 Encodes an atypical dual-specificity phosphatase.
AT1G05010 Encodes 1-aminocyclopropane-1-carboxylate oxidase
AT1G05020 ENTH/ANTH/VHS superfamily protein;(source:Araport11)
AT1G05040 UBA-like domain protein;(source:Araport11)
AT1G05085 hypothetical protein;(source:Araport11)
AT1G05150 Calcium-binding tetratricopeptide family protein;(source:Araport11)
AT1G05160 Encodes an ent-kaurenoic acid hydroxylase, a member of the CYP88A cytochrome p450 family.
AT1G05220 Transmembrane protein 97, Putative;(source:Araport11)
AT1G05260 Encodes a cold-inducible cationic peroxidase that is involved in the stress response. In response to low temperature, RCI3 transcripts accumulate in the aerial part and in roots of etiolated seedlings but only in roots of light-grown seedlings. The mRNA is cell-to-cell mobile.
AT1G05270 TraB family protein;(source:Araport11)
AT1G05300 member of Fe(II) transporter isolog family
AT1G05320 myosin heavy chain, embryonic smooth protein;(source:Araport11)
AT1G05360 KMS2 encode a endoplasmic reticulum protein involved in the early secretory pathway.
AT1G05385 Encodes a Psb27 homolog involved in photosystem II biogenesis.
AT1G05430 Hypothetical protein, expression induced by Al.
AT1G05460 Encodes a protein with similarity to RNA helicases. Mutants are defective in post-transcriptional gene silencing.
AT1G05510 Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds.
AT1G05560 A UDP-glucose transferase localized in the phragmoplast. It has been co-purified with the callose synthase complex and may transfer UDP-glucose from sucrose synthase to the callose synthase and thus help form a substrate channel for the synthesis of callose at the forming cell plate. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. UGT1 encodes a protein with glucosyltransferase activity with high sequence homology to UGT2 (AT1G05530). It belongs to an UGT subfamily that binds UDP-glucose but not UDP-glucuronate, UDP-galactose, or UDP-rhamnose as the glycosyl donor. UGT1 was shown to be able to use abscisic acid as glycosylation substrate in the presence of UDP-glucose. UGT1/UGT75B1 catalyzes the formation of the p-aminobenzoate-glucose ester in vitro and in vivo. It appears to be the enzyme predominantly responsible for pABA-Glc formation in Arabidopsis based on assays in leaves, flowers, and siliques.
AT1G05570 Encodes a callose synthase 1 catalytic subunit . Member of Glycosyltransferase Family- 48.
AT1G05610 Encodes the small subunit of ADP-glucose pyrophosphorylase. The small subunit is the catalytic isoform responsible for ADP-glucose pyrophosphorylase activity. The presence of the small subunit is required for large subunit stability. Two isoforms of the small subunit (ApS1 and ApS2) have been described. ApS2 is a minor small subunit isoform present in all plant tissues tested.
AT1G05615 B3 domain protein (DUF313);(source:Araport11)
AT1G05620 Encodes a cytosolic inosine nucleoside hydrolase. It forms a heterocomplex with NSH1 with almost two orders of magnitude higher catalytic efficiency for xanthosine hydrolysis than observed for NSH1 alone. Transcript levels for this gene are elevated in older leaves suggesting that it may play a role in purine catabolism during senescence.
AT1G05680 Encodes a UDP-glucosyltransferase, UGT74E2, that acts on IBA (indole-3-butyric acid) and affects auxin homeostasis. The transcript and protein levels of this enzyme are strongly induced by H2O2 and may allow integration of ROS (reactive oxygen species) and auxin signaling. This enzyme can also transfer glycosyl groups to several compounds related to the explosive TNT when this synthetic compound is taken up from the environment.
AT1G05700 Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11)
AT1G05750 Encodes a pentatricopeptide repeat protein required for editing of rpoA and clpP chloroplast transcripts.
AT1G05780 Vacuolar ATPase assembly integral membrane protein VMA21-like domain-containing protein;(source:Araport11)
AT1G05785 Got1/Sft2-like vescicle transport protein family;(source:Araport11)
AT1G05800 Encodes a galactolipase. Located in the chloroplast. Involved in the initial step of jasmonic acid biosynthesis. Expressed in vegetative tissues and is necessary for the biosynthesis of basal-level JAs in vegetative tissues.
AT1G05820 SIGNAL PEPTIDE PEPTIDASE-LIKE 5;(source:Araport11)
AT1G05880 Encodes ARI12 (ARIADNE 12). ARI12 belongs to a family of `RING between RING fingers' (RBR) domain proteins with E3 ligase activity. Expression of ARI12 is induced by UV-B exposure.
AT1G05890 RING/U-box superfamily protein;(source:Araport11)
AT1G05920 B3 domain protein (DUF313);(source:Araport11)
AT1G05940 Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters.
AT1G05960 ARM repeat superfamily protein;(source:Araport11)
AT1G05990 EF hand calcium-binding protein family;(source:Araport11)
AT1G06020 Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens).
AT1G06030 Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens).
AT1G06040 Encodes salt tolerance protein (STO) which confers salt tolerance to yeast cells. Fully complements calcineurin deficient yeast but does not encode a phosphoprotein phosphatase. Sequence has similarities to CONSTANS. STO co-localizes with COP1 and plays a role in light signaling.STO transcript levels are regulated by photoperiod and phtyohormones. STO competes with FLC in the regulation of floral transition genes SOC1 and FT.
AT1G06080 Encodes a protein homologous to delta 9 acyl-lipid desaturases of cyanobacteria and acyl-CoA desaturases of yeast and mammals. expression down-regulated by cold temperature. It is involved in the desaturation of VLCFAs to make monounsaturated VLCFAs.
AT1G06130 glyoxalase 2-4;(source:Araport11)
AT1G06135 transmembrane protein;(source:Araport11)
AT1G06140 Encodes MEF3 (mitochondrial editing factor 3), a PPR (pentatricopeptide repeat) protein of the E domain subclass. Functions in mitochondrial RNA editing.
AT1G06148 hypothetical protein;(source:Araport11)
AT1G06170 Encodes a bHLH transcription factor that together with bHLH010 and bHLH091 is important for the normal transcriptome of the developing Arabidopsis anther, possibly by forming a feed-forward loop with DYT1. Recognizes the TCATGTGC box to activate the expression of target genes, including ATA20, EXL4, and MEE48.
AT1G06180 member of MYB3R- and R2R3- type MYB- encoding genes
AT1G06225 Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon.
AT1G06270 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT1G06280 LOB domain-containing protein 2;(source:Araport11)
AT1G06340 Plant Tudor-like protein;(source:Araport11)
AT1G06350 Fatty acid desaturase family protein;(source:Araport11)
AT1G06370 pseudogene of Alg9-like mannosyltransferase family;(source:Araport11)
AT1G06420 DNA ligase-like protein;(source:Araport11)
AT1G06450 Deadenylase.
AT1G06490 Encodes Callose Synthase 7 (CalS7), a phloem-specific callose synthase responsible for callose deposition in developing sieve elements during phloem formation and in mature phloem induced by wounding.
AT1G06520 sn-glycerol-3-phosphate 2-O-acyltransferase. Expressed in flower buds and siliques. Homozygous mutant plants are male sterile.
AT1G06540 hypothetical protein;(source:Araport11)
AT1G06590 anaphase-promoting complex subunit;(source:Araport11)
AT1G06650 encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase The mRNA is cell-to-cell mobile.
AT1G06670 nuclear DEIH-box helicase (NIH) encoding a putative RNA and/or DNA helicase homologous to a group of nucleic acid helicases from the DEAD/H family with nuclear DEIH-box helicase (NIH) distinct N- and C-terminal regions that differ from animal DEIH proteins The mRNA is cell-to-cell mobile.
AT1G06760 winged-helix DNA-binding transcription factor family protein;(source:Araport11)
AT1G06770 Encodes a C3HC4 RING-domain-containing ubiquitin E3 ligase capable of interacting with DREB2A. The DRIP1-GFP fusion protein is nuclear-localized. DRIP1 seems to be involved in regulating stress-related transcriptional changes and drought tolerance.
AT1G06840 Homomultimers interact with cytoplasmic signaling molecule PBL27, resulting in herbivory resistance, in an ethylene-dependent manner.
AT1G06890 UXT3 is a member of the NST-KT subfamily of nucleotide/sugar transporters. It is localized to the golgi and functions as a UDP-Xyl transporter.
AT1G06920 Encodes OFP4, a member of the plant specific ovate family proteins. Members of this family have been shown to bind to KNOX and BELL- like TALE class homeodomain proteins. OFP4 interacts with KNAT7 to regulate secondary cell wall formation.
AT1G06923 transcription repressor OFP17-like protein;(source:Araport11)
AT1G06970 member of Putative Na+/H+ antiporter family
AT1G06980 PADRE protein
AT1G07000 A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT1G07050 FITNESS encodes a protein with a single CCT domain and belongs to the CCT motif family genes (CMF). FITNESS acts upstream JUB1 thereby controlling H2O2 levels. FITNESS has a role in cellular redox homeostasis controlling H2O2 levels, due to changes in enzymes, metabolites and transcripts related to ROS detoxification.
AT1G07051 Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCACUCCUCUUCUUCUUGAUG
AT1G07060 hypothetical protein;(source:Araport11)
AT1G07120 CHUP1-like protein;(source:Araport11)
AT1G07220 O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11)
AT1G07330 dentin sialophosphoprotein;(source:Araport11)
AT1G07340 sugar transporter 2;(source:Araport11)
AT1G07390 receptor like protein 1;(source:Araport11)
AT1G07430 Encodes a member of the group A protein phosphatase 2C (PP2C) family that is responsible for negatively regulating seed dormancy.
AT1G07460 Concanavalin A-like lectin family protein;(source:Araport11)
AT1G07500 SMR5 is a member of the SIAMESE-RELATED Cyclin-Dependent Kinase Inhibitor family. It is induced by ROS/oxidative stress.
AT1G07520 GRAS family transcription factor;(source:Araport11)
AT1G07530 Encodes a member of the GRAS family of transcription factors. The protein interacts with the TGA2 transcription factor and affects the transcription of stress-responsive genes. The protein is found in the nucleus and is also exported to the cytoplasm.
AT1G07540 Arabidopsis thaliana telomere-binding protein, putative (At1g07540)
AT1G07570 Protein kinase capable of phosphorylating tyrosine, serine, and threonine residues
AT1G07610 one of the five metallothioneins (MTs) genes identified in Arabidopsis. MTs are cysteine-rich proteins required for heavy metal tolerance. The mRNA is cell-to-cell mobile.
AT1G07630 Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves.
AT1G07650 Leucine-rich repeat receptor-like kinase with extracellular malectin-like domain, which possesses cell death induction activity in plant leaves.
AT1G07702 snoRNA;(source:Araport11)
AT1G07725 A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT1G07747 Encodes a Protease inhibitor/seed storage/LTP family protein
AT1G07750 RmlC-like cupins superfamily protein;(source:Araport11)
AT1G07810 Encodes an ER-type Ca2+-pumping ATPase. The mRNA is cell-to-cell mobile.
AT1G07850 transferring glycosyl group transferase (DUF604);(source:Araport11)
AT1G07900 LOB domain-containing protein 1;(source:Araport11)
AT1G07920 GTP binding Elongation factor Tu family protein;(source:Araport11)
AT1G07990 SIT4 phosphatase-associated family protein;(source:Araport11)
AT1G08010 Encodes a member of the GATA factor family of zinc finger transcription factors.
AT1G08040 trimethylguanosine synthase (DUF707);(source:Araport11)
AT1G08100 Encodes a high-affinity nitrate transporter.
AT1G08125 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT1G08135 cation/H+ exchanger 6B;(source:Araport11)
AT1G08140 member of Putative Na+/H+ antiporter family
AT1G08160 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11)
AT1G08180 cyclin-dependent kinase inhibitor;(source:Araport11)
AT1G08200 Encodes a putative UDP-D-apiose/UPD-D-xylose synthetase.
AT1G08230 Codes for a H+-driven, high affinity gamma-aminobutyric acid (GABA) transporter. Localized at the plasma membrane. In planta, AtGAT1 expression was highest in flowers and under conditions of elevated GABA concentrations such as wounding or senescence.
AT1G08310 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G08315 ARM repeat superfamily protein;(source:Araport11)
AT1G08320 bZIP transcription factor family protein;(source:Araport11)
AT1G08340 Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11)
AT1G08440 aluminum activated malate transporter family protein;(source:Araport11)
AT1G08465 Member of the YABBY family of Arabidopsis proteins involved in the abaxial cell fate specification in lateral organs
AT1G08500 early nodulin-like protein 18;(source:Araport11)
AT1G08510 Encodes an acyl-acyl carrier protein thioesterase. Hydrolyzes primarily saturated acyl-ACPs with chain lengths that vary between 8 and 18 carbons. Involved in saturated fatty acid synthesis. Nuclear-encoded, plastid-targeted globular protein that is functional as dimer.
AT1G08620 Member of family of Jumonji C (JmjC)-containing demethylases, its catalytic domain exhibits both H3K4 and H3K9 demethylation activities. Together with MMD1 promotes in male meiocytes gene expression in an H3K9me3-dependent manner and thereby contributes to meiotic chromosome condensation.
AT1G08630 Encodes a threonine aldolase, involved in threonine degradation to glycine. Primarily expressed in seeds and seedlings.
AT1G08640 Encodes a choloroplast membrane protein CJD1 (Chloroplast J-like Domain 1). Predicted to contain a transit peptide, three transmembrane domains and an N-terminal J-like domain. Influences fatty acid composition of chloroplast lipids.
AT1G08650 Encodes a phosphoenolpyruvate carboxylase kinase that is expressed at highest levels in leaves. Expression is induced by light. The mRNA is cell-to-cell mobile.
AT1G08730 Encodes a class XI myosin that is involved in organelle motility, actin organization, and optimal growth of pollen tubes.
AT1G08735 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.3e-87 P-value blast match to Q9SLM0 /314-478 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT1G08760 CORD2 is a member of a novel and plant specific family of microtubule associated proteins. CORD1 binds microtubules via a conserved protein domain shared among family members. CORD functions may overlap;cord1 / cord2 mutants have defects in secondary cell wall pit morphology.
AT1G08800 myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11)
AT1G08830 Encodes a cytosolic copper/zinc superoxide dismutase CSD1 that can detoxify superoxide radicals. Its expression is affected by miR398-directed mRNA cleavage. Regulated by biotic and abiotic stress. Activation of CSD1 in the cytoplasm involves both a CCS-dependent and -independent pathway.
AT1G08840 Encodes a homolog of human and yeast DNA2. Mutants have increased sensitivity to DNA damage stress.
AT1G08890 Major facilitator superfamily protein;(source:Araport11)
AT1G08910 Encodes an SP-RING domain containing protein that functions in sumolaytion and is involved in positive regulation of sulfur metabolism and stress response.
AT1G08920 Encodes ESL1, a transporter for monosaccharides.
AT1G09000 NPK1-related protein kinase 1S
AT1G09050 arginine-glutamic acid dipeptide repeat protein;(source:Araport11)
AT1G09060 JMJ24 is a nuclear localized JmjC domain containing protein. It has been shown to bind to transcribed regions AtSN1 and solo LTR and the promoter of SDC. JMJ24 appears to regulate basal levels of transcription of silenced loci in part by controlling methylation in heterochromatic regions.
AT1G09070 SRC2 specifically binds the peptide PIEPPPHH, and moves from ER to a vacuole fraction where it gets internalized. Involved in Protein Storage Vacuole targeting. The mRNA is cell-to-cell mobile.
AT1G09080 Heat shock protein 70 (Hsp 70) family protein;(source:Araport11)
AT1G09110 pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10)
AT1G09155 phloem protein 2-B15;(source:Araport11)
AT1G09160 Protein phosphatase 2C family protein;(source:Araport11)
AT1G09170 P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11)
AT1G09176 transmembrane protein;(source:Araport11)
AT1G09190 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G09195 Ppx-GppA phosphatase;(source:Araport11)
AT1G09210 Encodes one of three Arabidopsis calreticulins.Post-transcriptionally regulates together with CRT1 VAMP721/722 levels under ER stress.
AT1G09245 Plant self-incompatibility protein S1 family;(source:Araport11)
AT1G09260 Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT1G09300 Encodes a mitochondrial protease ICP55. Alters the stability of proteins by removal of a single amino acid from their sequence.
AT1G09310 ABA responsive trichome formation regulator.
AT1G09370 Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT1G09380 nodulin MtN21-like transporter family protein
AT1G09390 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT1G09400 FMN-linked oxidoreductases superfamily protein;(source:Araport11)
AT1G09410 pentatricopeptide (PPR) repeat-containing protein;(source:Araport11)
AT1G09460 Carbohydrate-binding X8 domain superfamily protein;(source:Araport11)
AT1G09530 Transcription factor interacting with photoreceptors phyA and phyB. Forms a ternary complex in vitro with G-box element of the promoters of LHY, CCA1. Acts as a negative regulator of phyB signalling. It degrades rapidly after irradiation of dark grown seedlings in a process controlled by phytochromes. Does not play a significant role in controlling light input and function of the circadian clockwork. Binds to G- and E-boxes, but not to other ACEs. Binds to anthocyanin biosynthetic genes in a light- and HY5-independent fashion. PIF3 function as a transcriptional activator can be functionally and mechanistically separated from its role in repression of PhyB mediated processes.
AT1G09540 Encodes putative transcription factor. Mutants lack of mucilage extrusion from the seeds during imbibition. Reduced quantities of mucilage are deposited during the development of the seed coat epidermis in myb61 mutants. Expressed in guard cells,loss of function mutations show an increase in stomatal pore opening suggesting a role in ABA independent regulation of stomatal pore size.
AT1G09560 Encodes a plasodesmata-located protein involved in regulating primary root growth by controlling phloem-mediated allocation of resources between the primary and lateral root meristems. The mRNA is cell-to-cell mobile.
AT1G09570 Light-labile cytoplasmic red/far-red light photoreceptor involved in the regulation of photomorphogenesis. It exists in two inter-convertible forms: Pr and Pfr (active) and functions as a dimer.The N terminus carries a single tetrapyrrole chromophore, and the C terminus is involved in dimerization. It is the sole photoreceptor mediating the FR high irradiance response (HIR). Major regulator in red-light induction of phototropic enhancement. Involved in the regulation of de-etiolation. Involved in gravitropism and phototropism. Requires FHY1 for nuclear accumulation.
AT1G09575 Mitochondrial calcium channel.
AT1G09610 glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11)
AT1G09650 F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G09660 RNA-binding KH domain-containing protein;(source:Araport11)
AT1G09680 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT1G09700 Encodes a nuclear dsRNA binding protein. Involved in mRNA cleavage. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin.
AT1G09720 Member of NET domain family of actin binding proteins. Paralog of At3g22790 (NET2A).
AT1G09810 evolutionarily conserved C-terminal region 11;(source:Araport11)
AT1G09812 multidrug resistance protein;(source:Araport11)
AT1G09820 Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11)
AT1G09850 Arabidopsis thaliana papain-like cysteine peptidase
AT1G09870 histidine acid phosphatase family protein;(source:Araport11)
AT1G09880 Rhamnogalacturonate lyase family protein;(source:Araport11)
AT1G09930 oligopeptide transporter
AT1G09940 Encodes glutamyl-tRNA reductase. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins
AT1G09960 low affinity (10mM) sucrose transporter in sieve elements (phloem)
AT1G09970 RLK7 belongs to a leucine-rich repeat class of receptor-likekinase (LRR-RLKs). It is involved in the control of germination speed and the tolerance to oxidant stress. The mRNA is cell-to-cell mobile.
AT1G10040 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G10060 encodes a mitochondrial branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant.
AT1G10070 Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. Involved in cell wall development.
AT1G10090 Early-responsive to dehydration stress protein (ERD4);(source:Araport11)
AT1G10130 Encodes a golgi localized P2A-type Ca2+ ATPase involved in Mn nutrition and homeostasis.
AT1G10140 Uncharacterized conserved protein UCP031279;(source:Araport11)
AT1G10190 NEP-interacting protein, putative (DUF239);(source:Araport11)
AT1G10200 Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization.
AT1G10210 Encodes ATMPK1. Kinase is activated by wounding.
AT1G10290 involved in trafficking from the trans-Golgi Network to the central vacuole. The mRNA is cell-to-cell mobile.
AT1G10300 GTPase involved in HA - and ABA-mediated signaling pathways, particularly during defense respnses to pathogens. A truncated version of NOG1-2 has been detected in Col-0, Ler-0, Rsch-4 ecotypes. Functions similarly to the paralogous gene NOG1-1.
AT1G10330 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G10380 Putative membrane lipoprotein;(source:Araport11)
AT1G10385 Vps51/Vps67 family (components of vesicular transport) protein;(source:Araport11)
AT1G10400 UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT1G10417 Encodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens.
AT1G10455 B3 DNA-binding domain protein;(source:Araport11)
AT1G10460 germin-like protein (GLP7)
AT1G10480 Encodes a zinc finger protein containing only a single zinc finger that acts downstream of ZFP6 in regulating trichome development by integrating GA and cytokinin signaling.
AT1G10490 GNAT acetyltransferase (DUF699);(source:Araport11)
AT1G10530 PADRE protein
AT1G10540 nucleobase-ascorbate transporter 8;(source:Araport11)
AT1G10560 Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays.
AT1G10600 associated molecule with the SH3 domain of STAM 2;(source:Araport11)
AT1G10610 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT1G10620 Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807).
AT1G10650 SBP (S-ribonuclease binding protein) family protein;(source:Araport11)
AT1G10670 One of the three genes encoding subunit A of the trimeric protein ATP Citrate Lyase. Antisense ACLA-1 plants cause a reduction in cytosolic acetyl-CoA metabolism and have upregulation of stress-related genes and down-regulation of primary metabolism and growth genes, suggesting the mutation restricts normal growth and developmental processes and puts the plant into a state of stress.
AT1G10680 P-glycoprotein 10;(source:Araport11)
AT1G10690 cyclin-dependent kinase inhibitor;(source:Araport11)
AT1G10740 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G10750 carboxyl-terminal peptidase, putative (DUF239);(source:Araport11)
AT1G10760 Encodes an α-glucan, water dikinase required for starch degradation. Involved in cold-induced freezing tolerance. Mutations that eliminate the GWD protein or affect the dikinase domain of the enzyme dramatically reduce both the amount of phosphate in the amylopectin and the rate of starch degradation. Mature leaves of these mutants accumulate amounts of starch up to seven times greater than those in wild-type leaves. NMR analysis of the mutants, suggests that the gene is specifically involved in the phosphorylation of the glucosyl residues of starch at the C6 position.
AT1G10810 NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11)
AT1G10820 hypothetical protein (DUF3755);(source:Araport11)
AT1G10865 cytochrome C oxidase assembly factor;(source:Araport11)
AT1G10870 A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD4 belongs to the Class 1, together with AGD1, AGD2, and AGD3.
AT1G10890 arginine/glutamate-rich 1 protein;(source:Araport11)
AT1G10960 Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member.
AT1G10980 Lung seven transmembrane receptor family protein;(source:Araport11)
AT1G11030 pre-tRNA tRNA-Arg (anticodon: TCG);(source:Araport11, TAIR10)
AT1G11070 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT1G11110 LisH and RanBPM domains containing protein;(source:Araport11)
AT1G11130 Encodes an atypical receptor-like kinase protein with a predicted extracellular domain of six leucine-rich repeats and an intracellular serine-threonine kinase domain expressed throughout the developing root but whose kinase activity is not essential for its function in vivo. Regulates expression of GLABRA2, CAPRICE, WEREWOLF, and ENHANCER OF GLABRA3. Required for floral organ shape, the development of the outer integument of ovules, and stem development. Regulates cell shape and cell division planes in the L2 layer of floral meristems and the L1-derived outer integument of ovules. Controls specification of epidermal root hairs. Participates in the coordination of cell morphogenesis between cell layers during floral development.
AT1G11145 hypothetical protein (DUF674);(source:Araport11)
AT1G11160 One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules.
AT1G11170 lysine ketoglutarate reductase trans-splicing-like protein (DUF707);(source:Araport11)
AT1G11210 cotton fiber protein, putative (DUF761);(source:Araport11)
AT1G11230 transmembrane protein, putative (DUF761);(source:Araport11)
AT1G11265 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.4e-253 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT1G11310 A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO2 belongs to the clade IV, with AtMLO3, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in roots, in vascular system of cotyledons and young leaves,and in fruit abscission zone; it was not expressed in anthers and pollen, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). mlo resistance in A. thaliana does not involve the signaling molecules ethylene, jasmonic acid or salicylic acid, but requires a syntaxin, glycosyl hydrolase and ABC transporter. It is a novel virulence target of the P. syringae type III secreted effector HopZ2.
AT1G11330 S-locus lectin protein kinase family protein;(source:Araport11)
AT1G11340 G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11)
AT1G11380 PLAC8 family protein;(source:Araport11)
AT1G11410 S-locus lectin protein kinase family protein;(source:Araport11)
AT1G11420 Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins.
AT1G11440 hypothetical protein;(source:Araport11)
AT1G11520 pliceosome associated protein-like protein;(source:Araport11)
AT1G11570 NTF2-like protein;(source:Araport11)
AT1G11572 Encodes a Plant thionin family protein
AT1G11608 F-box associated ubiquitination effector family protein;(source:Araport11)
AT1G11620 F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G11690 BRANCHLESS TRICHOME-like protein;(source:Araport11)
AT1G11710 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT1G11720 Encodes a starch synthase that in addition to its role in starch biosynthesis also has a negative regulatory function in the biosynthesis of transient starch. The protein apparently contains a starch-binding domain (SBD).
AT1G11770 Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs).
AT1G11810 Paternally expressed gene.
AT1G11850 transmembrane protein;(source:Araport11)
AT1G11860 T-protein is the aminomethyltransferase of the glycine cleavage multienzyme system GCS.
AT1G11915 wall-associated receptor kinase galacturonan-binding protein;(source:Araport11)
AT1G11940 Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11)
AT1G11950 Transcription factor jumonji (jmjC) domain-containing protein;(source:Araport11)
AT1G11960 Calcium channel that is phosphorylated by BIK1 in the presence of PAMPS and required for stomatal immunity.
AT1G11980 ubiquitin-related protein 3;(source:Araport11)
AT1G11990 O-fucosyltransferase family protein;(source:Araport11)
AT1G12040 encodes a a chimeric leucine-rich repeat/extensin protein that regulates root hair morphogenesis and elongation. Null mutants develop root hairs that frequently abort, swell, or branch. Gene is expressed in root hair cells and protein is specifically localized in the wall of the hair proper. The mRNA is cell-to-cell mobile.
AT1G12050 Encodes a fumarylacetoacetase that converts fumarylacetoacetate to acetoacetate and fumarate and is likely to be involved in tyrosine catabolism.
AT1G12080 Vacuolar calcium-binding protein-like protein;(source:Araport11)
AT1G12090 extensin-like protein (ELP)
AT1G12110 Encodes NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is expressed in guard cells and function in stomatal opening. Mutants have less transpiration and are more tolerant to drought. Expressed in lateral roots. Involved in nitrate signaling which enables the plant root system to detect and exploit nitrate-rich soil patches. Comparing to the wild type, the mutant displays a strongly decreased lateral root proliferation phenotype in nitrate rich patches on growth medium. Affects flowering time via interaction with the FLC dependent flowering pathway to influence its target gene FT.
AT1G12140 Encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates. It is a suppressor of the bp mutant phenotype.
AT1G12180 14.7 kDa heat shock-like protein;(source:Araport11)
AT1G12211 hypothetical protein;(source:Araport11)
AT1G12240 Encodes a vacuolar invertase betaFruct4. betaFruct4 is transported from the endoplasmic reticulum through the intermediate compartments as a membrane protein. The N-terminal cytoplasmic domain contains multiple sequence motifs that are involved at various stages in the trafficking of betaFruct4 from the ER to the central vacuole. The mRNA is cell-to-cell mobile.
AT1G12244 Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11)
AT1G12260 Encodes a NAC-domain transcription factor that is expressed in developing xylem. Over expression of this protein causes ectopic secondary cell wall growth. Complements some of the cell wall defects seen in SND1/NST1 double mutants.
AT1G12280 Encodes a NB-LRR protein SUMM2 involved in defense response to bacterium.
AT1G12320 ankyrin repeat/KH domain protein (DUF1442);(source:Araport11)
AT1G12330 cyclin-dependent kinase-like protein;(source:Araport11)
AT1G12340 Cornichon family protein;(source:Araport11)
AT1G12360 encodes a Sec1 protein and expressed throughout the plant. physically interacts with Syntaxin1 and is required for cytokinesis.
AT1G12370 encodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele
AT1G12380 hypothetical protein;(source:Araport11)
AT1G12390 Cornichon family protein;(source:Araport11)
AT1G12420 ACT domain repeat 8;(source:Araport11)
AT1G12430 Encodes the kinesin-like protein PAK has an Armadillo motif tail and is involved in guard cell development in Arabidopsis (from Genbank record AF159052).However, no defect in stomatal complexes has been observed in loss of function mutations. It accumulates at the preprophase band (PPB) in a cell-cycle and microtubule-dependent manner and is most highly expressed in cells where the placement of the division plane (early embryogenesis, stomatal lineages) is critical.
AT1G12460 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G12480 Encodes a membrane protein with 10 predicted transmembrane helices. SLAC1 is a multispanning membrane protein expressed predominantly in guard cells that plays a role in regulating cellular ion homeostasis and S-type anion currents. SLAC1 is important for normal stomatal closure in response to a variety of signals including elevated CO2, ozone, ABA, darkness, and humidity. SLAC1:GFP localizes to the plasma membrane.
AT1G12560 Member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Containing a conserved root hair-specific cis-element RHE. Expressed specifically in root hair cell and involved in root hair elongation.
AT1G12570 Ortholog of maize IPE1 gene which is involved in pollen exine development.
AT1G12590 pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10)
AT1G12600 UDP-N-acetylglucosamine (UAA) transporter family;(source:Araport11)
AT1G12640 Encodes a lysophosphatidylcholine acyltransferase (LPCAT). Participates in the Lands cycle in developing seeds.
AT1G12680 phosphoenolpyruvate carboxylase-related kinase 2;(source:Araport11)
AT1G12710 This gene is predicted to encode a protein with a PP2 domain. This domain in present in lectins found in squash and cucumber, suggesting that this protein could potentially have carbohydrate binding capabilities.
AT1G12730 GPI transamidase subunit PIG-U;(source:Araport11)
AT1G12740 encodes a protein with cytochrome P450 domain
AT1G12780 Encodes a UDP-glucose epimerase that catalyzes the interconversion of the sugar nucleotides UDP-glucose UDP-galactose via a UDP-4-keto-hexose intermediate. Responsive to stress.
AT1G12855 F-box family protein;(source:Araport11)
AT1G12870 F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G12890 encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
AT1G12930 Ran effector.
AT1G12990 beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11)
AT1G13000 transmembrane protein, putative (DUF707);(source:Araport11)
AT1G13050 proline-rich receptor-like kinase;(source:Araport11)
AT1G13070 putative cytochrome P450
AT1G13080 cytochrome P450 monooxygenase
AT1G13090 putative cytochrome P450
AT1G13100 putative cytochrome P450
AT1G13130 Cellulase (glycosyl hydrolase family 5) protein;(source:Araport11)
AT1G13140 member of CYP86C
AT1G13145 pseudogene of expressed protein;(source:Araport11)
AT1G13150 member of CYP86C
AT1G13170 OSBP(oxysterol binding protein)-related protein 1D;(source:Araport11)
AT1G13180 Mutant has defect in trichome cell expansion and actin organization resulting in a distorted trichome phenotype.
AT1G13195 RING/U-box superfamily protein;(source:Araport11)
AT1G13200 F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G13230 Encodes a leucine-rich repeat protein pii-2. Located in the endoplasmic reticulum/plasma membrane continuum in Arabidopsis roots. Required for growth promotion and enhanced seed production mediated by the endophytic fungus Piriformospora indica in Arabidopsis.
AT1G13240 pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10)
AT1G13250 Encodes a protein with putative galacturonosyltransferase activity.
AT1G13260 Encodes an AP2/B3 domain transcription factor which is upregulated in response to low temperature. It contains a B3 DNA binding domain. It has circadian regulation and may function as a negative growth regulator. The mRNA is cell-to-cell mobile.
AT1G13290 Encodes a putative zinc finger protein (C2H2 family, type IIIA, subclass A1d) that has a WIP domain. Seedlings with mutations in DOT5 have a misaligned venation defect in their leaves and cotyledons. Additional developmental abnormalities, such as elongated petioles and aberrant phyllotaxy suggest that DOT5 is required for normal shoot and root development.
AT1G13300 Encodes a nuclear localized member of the GARP family of transcription factors. Involved in nitrate/phosphate signaling in roots. It is transcriptionally regulated by nitrate and post transcriptionally by phosphate and functions to integrate these two nutrient signaling pathways in the root. HRS1 and HHO2 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance.
AT1G13310 Endosomal targeting BRO1-like domain-containing protein;(source:Araport11)
AT1G13360 hypothetical protein;(source:Araport11)
AT1G13380 sodium/hydrogen exchanger (DUF1218);(source:Araport11)
AT1G13410 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G13430 Encodes a sulfotransferase. Unlike the related ST4A protein (At2g14920), in vitro experiements show that this enzyme does not act brassinosteroids. ST4C is expressed in the roots and transcript levels rise in response to cytokinin treatment.
AT1G13448 Natural antisense transcript overlaps with AT1G13450;(source:Araport11)
AT1G13470 hypothetical protein (DUF1262);(source:Araport11)
AT1G13485 hypothetical protein;(source:Araport11)
AT1G13490 hypothetical protein (DUF1262);(source:Araport11)
AT1G13500 hypothetical protein (DUF1262);(source:Araport11)
AT1G13520 hypothetical protein (DUF1262);(source:Araport11)
AT1G13580 Encodes a ceramide synthase that together with LOH1 is essential for production of ceramides containing Very Long Chain Fatty acid VLCFA-Ceramides(mainly C 22 to 26).
AT1G13590 Encodes a phytosulfokine-alpha (PSK) precursor, a unique plant peptide growth factor first described in Asparagus.
AT1G13600 basic leucine-zipper 58;(source:Araport11)
AT1G13605 Encodes a defensin-like (DEFL) family protein.
AT1G13608 Encodes a defensin-like (DEFL) family protein.
AT1G13609 Encodes a defensin-like (DEFL) family protein.
AT1G13620 Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9).
AT1G13630 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G13635 DNA glycosylase superfamily protein;(source:Araport11)
AT1G13640 Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11)
AT1G13670 hypothetical protein;(source:Araport11)
AT1G13700 Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP).
AT1G13710 Encodes the cytochrome P450 CYP78A5 monooxygenase. Contributes to the generation of a growth-stimulating signal distinct from the classical phytohormones that prevents proliferation arrest, promoting organ growth. In ovules it is required for megagametogenesis, maternal control of seed size and restricting megaspore mother cell fate to a single cell.
AT1G13740 Encodes a member of a small plant-specific gene family whose members interact with ABI5 and appear to be involved in mediating stress responses. AFP2 mutants affect a number of ABA mediated processes such as germination and response to osmotic and sugar stress. AFP2 nuclear localization is stress dependent.
AT1G13755 Encodes a defensin-like (DEFL) family protein.
AT1G13760 hypothetical protein;(source:Araport11)
AT1G13780 F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT1G13800 Encodes a PPR (pentatricopeptide repeat motif) protein that is essential for the initiation of zygotic embryogenesis.
AT1G13830 Carbohydrate-binding X8 domain superfamily protein;(source:Araport11)
AT1G13840 pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10)
AT1G13860 Encodes QUASIMODO2 LIKE1 (QUL1), a paralog of QUASIMODO2 (QUA2). AT1G78240 (QUA2), AT1G13860 (QUL1) and AT2G03480 (QUL2) form a clade with a possible role in plant vasculature development.
AT1G13880 ELM2 domain-containing protein;(source:Araport11)
AT1G13920 Remorin family protein;(source:Araport11)
AT1G13970 beta-hexosaminidase (DUF1336);(source:Araport11)
AT1G13990 plant/protein;(source:Araport11)
AT1G14020 O-fucosyltransferase family protein;(source:Araport11)
AT1G14040 Encodes a PHO1 homologue that is upregulated in response to Zn deficiency and is involved in Pi homeostasis in response to Zn deficiency. The mRNA is cell-to-cell mobile.
AT1G14048 GCK domain-containing protein;(source:Araport11)
AT1G14080 Encodes an alpha-(1,2)-fucosyltransferase.
AT1G14120 DAO2 is an IAA oxidase expressed in root caps. it is a member of a family of dioxygenase and 2OG Fe(II) oxygenase domain and DAO domain containing proteins. It is expressed specifically in root cap cells and does not appear to be the major IAA oxidase in planta.
AT1G14130 DAO1 is an IAA oxidase expressed in many different plant parts. it is a member of a family of dioxygenase and 2OG Fe(II) oxygenase domain and DAO domain containing proteins. It appears to be the major IAA oxidase in planta and major contributor to IAA degradation.
AT1G14160 Uncharacterized protein family (UPF0497);(source:Araport11)
AT1G14200 E3 ligase involved in the regulation of the homeostasis of sensor NLR immune receptors.
AT1G14210 Ribonuclease T2 family protein;(source:Araport11)
AT1G14240 GDA1/CD39 nucleoside phosphatase family protein;(source:Araport11)
AT1G14250 GDA1/CD39 nucleoside phosphatase family protein;(source:Araport11)
AT1G14260 RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11)
AT1G14270 CAAX amino terminal protease family protein;(source:Araport11)
AT1G14280 Encodes phytochrome kinase substrate 2. PKS proteins are critical for hypocotyl phototropism. Forms a complex with Phot1, Phot2 and NPH3.
AT1G14300 ARM repeat superfamily protein;(source:Araport11)
AT1G14310 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT1G14340 ACD11 binding partner, negatively regulates ROS-mediated defense response.
AT1G14360 UDP-galactose transporter 3;(source:Araport11)
AT1G14370 Encodes protein kinase APK2a. Protein is N-myristoylated.
AT1G14390 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G14410 Encodes a homolog of the potato p24 protein. Binds single strand telomeric repeats. Negatively regulates telomerase activity and telomere length.
AT1G14455 hypothetical protein;(source:Araport11)
AT1G14510 Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7).
AT1G14518 other_RNA;(source:Araport11)
AT1G14530 tobamovirus multiplication-like protein (DUF1084);(source:Araport11)
AT1G14630 XRI1-like protein;(source:Araport11)
AT1G14650 SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein;(source:Araport11)
AT1G14670 Endomembrane protein 70 protein family;(source:Araport11)
AT1G14686 ENTH/ANTH/VHS superfamily protein;(source:Araport11)
AT1G14687 homeobox protein 32;(source:Araport11)
AT1G14700 purple acid phosphatase 3;(source:Araport11)
AT1G14710 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT1G14720 member of Glycoside Hydrolase Family 16
AT1G14740 Encodes a PHD-finger protein that, with TTA1, is redundantly required for MP-dependent embryonic root meristem initiation.
AT1G14760 Encodes a novel Arabidopsis KNOX gene that encodes a MEINOX domain but lacks the homeodomain and interacts with TALE-class homeodomain proteins to modulate their activities
AT1G14770 RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11)
AT1G14780 MAC/Perforin domain-containing protein;(source:Araport11)
AT1G14830 Encodes a dynamin-like protein that is involved in mitochondrial morphogenesis and pollen development. Protein is localized as speckles in the cytoplasm, partially co-localizes with mitochondrial markers, cell plate of dividing cells, and the tip of root hairs, root cap cells, and expanding part of trichoblasts.
AT1G14880 PLANT CADMIUM RESISTANCE 1;(source:Araport11)
AT1G14940 Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11)
AT1G14970 O-fucosyltransferase family protein;(source:Araport11)
AT1G15100 Encodes a putative RING-H2 finger protein RHA2a.
AT1G15200 protein-protein interaction regulator family protein;(source:Araport11)
AT1G15215 Encodes SHH1, a homeodomain protein required for DNA methylation. It is an atypical RNA-directed DNA methylation component, and functions in transcriptional silencing through both DNA methylation-dependent and -independent pathways.
AT1G15290 Encodes REDUCED CHLOROPLAST COVERAGE 3 (REC3). Contributes to establishing the size of the chloroplast compartment.
AT1G15340 Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins.
AT1G15385 cotton fiber protein;(source:Araport11)
AT1G15450 pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10)
AT1G15520 ABC transporter family involved in ABA transport and resistance to lead. Localizes to plasma membrane. Upregulated by lead. Expressed in leaves, flowers, stomata and roots.
AT1G15560 transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 3.8e-130 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT1G15570 A2-type cyclin. Negatively regulates endocycles and acts as a key regulator of ploidy levels in Arabidopsis endoreduplication. Interacts physically with CDKA;1. Expressed preferentially in trichomes and young developing tissues.
AT1G15580 auxin induced protein
AT1G15670 Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB1, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase.
AT1G15680 F-box family protein;(source:Araport11)
AT1G15750 Encodes a protein with several WD40 repeats at the C-terminus and predicted protein-protein interaction domains at the N-terminus. Together with the TOPLESS-RELATED PROTEINS (TPRs), it is thought to be involved in transcriptional repression of root-promoting genes in the top half of the embryo during the transition stage of embryogenesis. It can also interact with IAA12 through the EAR domain of IAA12 and the CTLH domain of TPL. The ability of IAA12 to repress transcription is diminished in a tpl-1 mutant background.
AT1G15760 Sterile alpha motif (SAM) domain-containing protein;(source:Araport11)
AT1G15770 mediator of RNA polymerase II transcription subunit;(source:Araport11)
AT1G15772 mediator of RNA polymerase II transcription subunit;(source:Araport11)
AT1G15850 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT1G15900 transmembrane protein;(source:Araport11)
AT1G15920 Deadenylase.
AT1G15950 Encodes a cinnamoyl CoA reductase. Involved in lignin biosynthesis. The mRNA is cell-to-cell mobile.
AT1G15960 member of Nramp2 family
AT1G15980 encodes a novel subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in cyclic electron flow around photosystem I to produce ATP.
AT1G15990 Encodes a plasma membrane localized member of the cyclic nucleotide gated channel (CNGC) family that is essential for male reproductive fertility.
AT1G16060 Encodes ADAP, an AP2-domain protein that interacts with ARIA. ADAP is a positive regulator of the ABA response and is also involved in regulating seedling growth.
AT1G16110 Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. It has been shown to be localized to the cell wall.
AT1G16120 Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats.
AT1G16130 Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats.
AT1G16140 Encodes a predicted WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats.
AT1G16160 WAK-like kinase The mRNA is cell-to-cell mobile.
AT1G16170 ephrin-A3 protein;(source:Araport11)
AT1G16210 coiled-coil protein;(source:Araport11)
AT1G16225 Target SNARE coiled-coil domain protein;(source:Araport11)
AT1G16320 plant/protein (DUF2358);(source:Araport11)
AT1G16330 core cell cycle genes
AT1G16370 organic cation/carnitine transporter 6;(source:Araport11)
AT1G16380 member of Putative Na+/H+ antiporter family
AT1G16420 Encodes a metacaspase (cysteine-type endopeptidase) that is involved in promoting programmed cell death in response to hydrogen peroxide (H2O2), UV light, and methyl viologen (MV). Transcript levels rise in response to UV-C, H2O2, and MV. In vitro assays demonstrate that this enzyme has a preference for cleaving after an arginine residue, and it has a pH optimum of 8.0.
AT1G16440 Member of AGC VIIIa Kinase gene family. Invovled in the maintenance of (p)ppGpp level to accustom plastidial gene expression to darkness.
AT1G16470 Encodes 20S proteasome subunit PAB1 (PAB1).
AT1G16480 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G16489 Natural antisense transcript overlaps with AT1G16490;(source:Araport11)
AT1G16490 Member of the R2R3 factor gene family.
AT1G16515 transmembrane protein;(source:Araport11)
AT1G16530 ASYMMETRIC LEAVES 2-like 9;(source:Araport11)
AT1G16560 Per1-like family protein;(source:Araport11)
AT1G16570 Encodes a encodes a putative UDP-glycosyltransferase superfamily protein belonging to the glycosyltransferase (GT) family 33 that is localized to the endoplasmic reticulum. Loss of function alleles are male sterile, with pollen tubes bursting after germination. Loss of function also causes increased callose deposition in the female gametophyte, pollen tube overgrowth and reduced transmission.
AT1G16650 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT1G16680 Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT1G16705 p300/CBP acetyltransferase-related protein-like protein;(source:Araport11)
AT1G16710 Encodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC12 acetylation of the H3 or H4 peptides, suggesting that HAC12 can acetylate any of several lysines present in the peptides.
AT1G16720 Encodes HCF173, a protein with weak similarities to the superfamily of the short-chain dehydrogenases/reductases. HCF173 is involved in the initiation of translation of the psbA mRNA and binds a specific site in the 5' UTR of psbA mRNA. Mutants shows a high chlorophyll fluorescence phenotype (hcf) and are severely affected in the accumulation of PSII subunits. The protein HCF173 is localized in the chloroplast, where it is mainly associated with the membrane system and is part of a higher molecular weight complex with psbA mRNA as a component of this complex.
AT1G16740 Ribosomal protein L20;(source:Araport11)
AT1G16760 kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11)
AT1G16770 hypothetical protein;(source:Araport11)
AT1G16860 Plasma membrane-localized proteins that negatively regulate cellulose synthesis by inhibiting the exocytosis of CESAs.
AT1G16900 Encodes the Arabidopsis ortholog of the yeast/human ALG9 catalyzing the luminal addition of two alpha-1,2 Man residues in assembling Glc3Man9GlcNAc2.
AT1G16905 Curculin-like (mannose-binding) lectin family protein;(source:Araport11)
AT1G16950 transmembrane protein;(source:Araport11)
AT1G16960 Ubiquitin domain-containing protein;(source:Araport11)
AT1G16980 Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active but no trehalose phosphatase (TPP)-like domain.
AT1G17000 Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active but no trehalose phosphatase (TPP)-like domain.
AT1G17010 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT1G17020 Encodes a novel member of the Fe(II)/ascorbate oxidase gene family; senescence-related gene.
AT1G17080 Ribosomal protein L18ae family;(source:Araport11)
AT1G17130 DUF572 domain protein involved in alternative splicing.
AT1G17145 RING/U-box superfamily protein;(source:Araport11)
AT1G17160 RBSK is a plastid localized ribokinase involved in nucleoside metabolism. It is the only member of this gene family in Arabidopsis.
AT1G17170 Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). It is involved in the detoxification of the environmental pollutant 2,4,6-trinitrotoluene. Arabidopsis plants over-expressing At1g17170 were more resistant to TNT, removed more TNT from sterile and soil-based media, and had reduced levels of glutathione when grown in the presence of TNT.
AT1G17180 Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). Detoxification of the environmental pollutant 2,4,6-trinitrotoluene. Arabidopsis plant over-expressing At1g17180 were more resistant to TNT, removed more TNT from sterile and soil-based media, and had reduced levels of glutathione when grown in the presence of TNT.
AT1G17220 Encodes a chloroplast localized protein with similarity to translation initiation factor 2. Can complement loss of INFB in E.coli suggesting FUG1 does function as a translation initiation factor in vivo. Identified as a suppressor of the leaf variegation mutant var2-6. Suppression is only seen in hypomorphs as complete loss of function alleles are embryo lethal. The mRNA is cell-to-cell mobile.
AT1G17235 This gene is predicted to encode a small protein with a DVL domain found in the DVL / RTFL protein family. Over-expression analyses using truncated versions of a related family member, ROT4, suggest that the DVL / RTF domain is involved in regulating cell proliferation.
AT1G17250 receptor like protein 3;(source:Araport11)
AT1G17270 O-fucosyltransferase family protein;(source:Araport11)
AT1G17310 MADS-box transcription factor family protein;(source:Araport11)
AT1G17340 Phosphoinositide phosphatase family protein;(source:Araport11)
AT1G17345 SAUR-like auxin-responsive protein family;(source:Araport11)
AT1G17360 LOW protein: protein phosphatase 1 regulatory subunit-like protein;(source:Araport11)
AT1G17380 jasmonate-zim-domain protein 5;(source:Araport11)
AT1G17400 Protein of unknown function. Similar to LAZY1, a gene required or gravitropic response in shoots and roots. Involved in determining lateral root branch angle.
AT1G17420 LOX3 encode a Lipoxygenase. Lipoxygenases (LOXs) catalyze the oxygenation of fatty acids (FAs).
AT1G17430 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G17440 Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. The gene product is an EIN3-interacting TFIID transcription factor required for proper ethylene response, including ERF1 induction. Loss of function mutants show enhanced response to ethylene. Located in nucleus and expressed throughout the plant. Required for ERF1 expression. Cytokinin-hypersensitive 1 (CKH1) mutants are characterized by rapidly growing calli with a green color at low levels of cytokinins, which are insufficient to induce such cytokinin responses in wild-type explants. It is hypothesized that CKH1 acts as a negative regulator of cytokinin signaling in Arabidopsis.
AT1G17480 Transient expression of Pro35S:GFP-IQD7 in leaves of N. benthamiana alters microtubule organization, in patterns similar to Pro35S:GFP-IQD8 and Pro35S:GFP-IQD6.Member of IQ67 (CaM binding) domain containing family.
AT1G17580 Encodes a member of the type XI myosin protein family involved in organelle trafficking and overall plant development.
AT1G17590 Binds directly to CCAAT cis-elements in the promoters of multiple MIR156 genes and inhibits the juvenile-to adult transition by activating transcription of these MIR156s.
AT1G17600 SOC3 is a TIR-NB-leucine-rich repeat (TNL) protein.Mutants suppress loss of chs2 phenotype of auto-activation of immunity. When the TIR domain of SOC3 interacts with CHS2 the binding results in temperature activation of cell death, the suppressors inhibit this interaction.
AT1G17610 TN-type protein that controls temperature-dependent growth and defense responses .Mutant accumulates steryl-esters at low temperatures and shows temperature dependent activation of defense responses..
AT1G17620 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11)
AT1G17630 Encodes a PPR protein involved in mitochondrial functioning. Mutants suppress cell wall defects caused by C17 chemical inhibitor. Mutants are defective in cytochrome c maturation and activation of mitochondrial retrograde signalling.
AT1G17700 prenylated RAB acceptor 1.F1;(source:Araport11)
AT1G17710 Encodes a phosphoethanolamine/phosphocholine phosphatase. It is likely to be involved in the liberation of inorganic phosphate from intracellular sources. Expression is upregulated in the shoot of cax1/cax3 mutant.
AT1G17744 hypothetical protein;(source:Araport11)
AT1G17760 Encodes a homolog of the mammalian protein CstF77, a polyadenylation factor subunit. RNA 3′-end?processing factor of antisense FLC transcript. Mediates silencing of the floral repressor gene FLC. Member of CstF complex.
AT1G17770 Encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. A paternally expressed imprinted gene.
AT1G17780 ATG8A/F interacting protein containing a WxxL LIR motif at the C terminus which is essential for interaction with ATG8. Stress (abiotic or biotic) results in the formation of ATG8- and ATI3-labeled punctate structures, likely reflecting increased formation of ATG8-labeled phagophores or autophagosomes. ATI3 proteins probably act as selective autophagy receptors that target specific cellular components during the plant stress response. ATI3 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner.
AT1G17840 Encodes a plasma membrane-localized ATP-binding cassette transporter, that is required for cutin transport to the extracellular matrix. The mRNA is cell-to-cell mobile.
AT1G17910 Wall-associated kinase family protein;(source:Araport11)
AT1G17930 Mobile domain protein involved in silencing of transposable elements. Loss of function affects shoot and root meristem maintenance. Interacts and functions with MAIL1 and PP7L in gene silencing.
AT1G17940 Endosomal targeting BRO1-like domain-containing protein;(source:Araport11)
AT1G17950 putative transcription factor: R2R3-MYB transcription family
AT1G17960 Threonyl-tRNA synthetase;(source:Araport11)
AT1G18130 Class II aaRS and biotin synthetases superfamily protein;(source:Araport11)
AT1G18140 putative laccase, a member of laccase family of genes (with 17 members in Arabidopsis).
AT1G18150 Encodes mitogen-activated protein kinase 8 (MPK8). MPK8 connects protein phosphorylation, Ca2+, and ROS in the wound-signaling pathway.
AT1G18191 Pseudogene of AT1G18200; AtRABA6b (Arabidopsis Rab GTPase homolog A6b); GTP binding
AT1G18270 ketose-bisphosphate aldolase class-II family protein;(source:Araport11)
AT1G18330 EARLY-PHYTOCHROME-RESPONSIVE1
AT1G18350 MAP kinase kinase7. Member of plant mitogen-activated protein kinase kinase group D. Negative regulator of polar auxin transport. Overexpression leads to activation of basal and systemic acquired resistance.
AT1G18360 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G18382 Natural antisense transcript overlaps with AT1G18380;(source:Araport11)
AT1G18390 Serine/Threonine kinase family catalytic domain protein;(source:Araport11)
AT1G18400 Encodes the brassinosteroid signaling component BEE1 (BR-ENHANCED EXPRESSION 1). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings.
AT1G18410 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT1G18490 2-aminoethanethiol dioxygenase, putative (DUF1637);(source:Araport11)
AT1G18610 Galactose oxidase/kelch repeat superfamily protein, induced by calcium.
AT1G18620 Member of a small gene family in Arabidopsis. Quadruple mutants in this family display defects in cell elongation.
AT1G18700 DNAJ heat shock N-terminal domain-containing protein;(source:Araport11)
AT1G18710 Member of the R2R3 factor gene family. Promotes seed longevity (viability of seed over time.) Expressed in the chalazal seed coat. Overexpresion enhances resistance of seed to deterioration (PMID:32519347).
AT1G18790 RWP-RK domain-containing protein;(source:Araport11)
AT1G18810 phytochrome kinase substrate-like protein;(source:Araport11)
AT1G18835 Encodes a small zinc finger protein whose overexpression induces ectopic meristem formation on leaf margins.
AT1G18840 Member of IQ67 (CaM binding) domain containing family.
AT1G18860 member of WRKY Transcription Factor; Group II-b
AT1G18879 Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AUCAGUUUCUUGUUCGUUUCA
AT1G18910 E3 ubiquitin ligase that functions redundantly in the root with BTSL1 to negatively regulate iron uptake.
AT1G18950 DDT domain superfamily;(source:Araport11)
AT1G18960 myb-like HTH transcriptional regulator family protein;(source:Araport11)
AT1G18970 Encodes a germin-like protein with possible oxalate oxidase activity (based on GenBank record).
AT1G18980 RmlC-like cupins superfamily protein;(source:Araport11)
AT1G19010 hypothetical protein;(source:Araport11)
AT1G19020 Modulates defense against bacterial pathogens and tolerance to oxidative stress.
AT1G19040 NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11)
AT1G19086 hypothetical protein;(source:Araport11)
AT1G19100 Encodes a member of the conserved Microrchidia (MORC) adenosine triphosphatase (ATPase) family, predicted to catalyze alterations in chromosome superstructure. Required for heterochromatin condensation and gene silencing.
AT1G19115 Member of the IGT gene family.
AT1G19160 F-box family protein;(source:Araport11)
AT1G19170 Pectin lyase-like superfamily protein;(source:Araport11)
AT1G19200 cyclin-dependent kinase, putative (DUF581);(source:Araport11)
AT1G19230 Riboflavin synthase-like superfamily protein;(source:Araport11)
AT1G19240 transmembrane protein;(source:Araport11)
AT1G19260 Encodes a ceramide synthase that uses very-long- chain fatty acyl-CoA and trihydroxy LCB substrates.
AT1G19310 RING/U-box superfamily protein;(source:Araport11)
AT1G19320 Pathogenesis-related thaumatin superfamily protein;(source:Araport11)
AT1G19330 Evening-expressed key component of Sin3-HDAC complex, which bind directly to the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and PSEUDO-RESPONSE REGULATOR 9 (PRR9) promoters and catalyze histone 3 (H3) deacetylation at the cognate regions to repress expression, allowing the declining phase of their expression at dusk.
AT1G19340 Methyltransferase MT-A70 family protein;(source:Araport11)
AT1G19360 Encodes an arabinosyltransferase that modifies extensin proteins in root hair cells.
AT1G19390 Wall-associated kinase family protein;(source:Araport11)
AT1G19410 FBD / Leucine Rich Repeat domains containing protein;(source:Araport11)
AT1G19420 pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G19470 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT1G19510 RAD-like 5;(source:Araport11)
AT1G19530 Direct target of RGA, plays an essential role in GA-mediated tapetum and pollen development.
AT1G19560 pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G19610 Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2.
AT1G19620 transmembrane protein;(source:Araport11)
AT1G19640 Encodes a S-adenosyl-L-methionine:jasmonic acid carboxyl methyltransferase that catalyzes the formation of methyljasmonate from jasmonic acid. Its expression is induced in response to wounding or methyljasmonate treatment.
AT1G19690 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT1G19710 UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT1G19715 Mannose-binding lectin superfamily protein;(source:Araport11)
AT1G19770 Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. The mRNA is cell-to-cell mobile.
AT1G19780 Encodes a member of the cyclic nucleotide gated channel (CNGC) family that is essential for male reproductive fertility.
AT1G19800 Encodes a permease-like protein involved in lipid transfer from the ER to the chloroplast, more specifically, transfer of phosphatidate across the chloroplast inner membrane. Mutant leaves accumulate trigalactosyldiacylglycerol, triacylglycerol and phosphatidate. Chloroplast lipids are altered in their fatty acid composition and as a consequence the development of chloroplasts in the mutants are impacted. The mutant seeds has a higher abortion rate. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2.
AT1G19810 pseudogene of cell division cycle 48C;(source:Araport11)
AT1G19835 TCS1 encodes a coiled-coil domain protein that binds to microtubules and co-localizes with the cortical microtubules. Mutants have defects in trichome branching and hypocotyl elongation. TCS1 interacts with ZWI and appears to be involved in microtubule assembly.
AT1G19840 SAUR-like auxin-responsive protein family;(source:Araport11)
AT1G19850 Encodes a transcription factor (IAA24) mediating embryo axis formation and vascular development. Similar to AUXIN RESPONSIVE FACTOR 1 (ARF1) shown to bind to auxin responsive elements (AREs), and to the maize transcriptional activator VIVIPAROUS 1( VP1). In situ hybridization shows expression in provascular tissue of embryos, the emerging shoot primordia, then is restricted to provascular tissue, and in the root central vascular cylinder.
AT1G19870 Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family.
AT1G19940 glycosyl hydrolase 9B5;(source:Araport11)
AT1G19960 Unknown gene, expression decreased in response to Mn and increased by cytokinin.
AT1G19990 nucleolin;(source:Araport11)
AT1G20000 Encodes TAF11b, a putative TBP-associated factor (TBP: TATA binding protein).
AT1G20020 Encodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the stroma The mRNA is cell-to-cell mobile.
AT1G20080 Encodes a synaptotagmin localized on the Golgi apparatus and that regulates protein secretion via the unconventional protein transport from the cytosol to the extracellular matrix in plant cells.
AT1G20090 Member of the Rho GTPase family. Functions to organize the microtubular cytoskeleton in combination with RIC1 and RIC4. These interactions affect pavement cell morphogenesis and pollen tube growth. ROP2 expression is stimulated by brassinosteroid treatment. Inhibit light-induced stomatal opening. The mRNA is cell-to-cell mobile.
AT1G20100 DNA ligase-like protein;(source:Araport11)
AT1G20180 transmembrane protein (DUF677);(source:Araport11)
AT1G20190 member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio)
AT1G20200 PAM domain (PCI/PINT associated module) protein;(source:Araport11)
AT1G20220 Alba DNA/RNA-binding protein;(source:Araport11)
AT1G20260 One of three genes encoding the vacuolar ATP synthase subunit B1. The protein binds to and co-localizes with F-actin, bundles F-actin to form higher-order structure, and stabilizes actin filaments in vitro. The mRNA is cell-to-cell mobile.
AT1G20300 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT1G20320 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT1G20350 mitochondrial inner membrane translocase
AT1G20360 F-box family protein;(source:Araport11)
AT1G20440 Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. Cold regulated gene, amino acid sequence homology with Group II LEA (late embryogenesis abundant) proteins. Also responds to osmotic stress, ABA, dehydration and inhibits e.coli growth while overexpressed. COR47 and RAB18 double overexpressor plants are cold tolerant. Regulated by heat shock.
AT1G20490 AMP-dependent synthetase and ligase family protein;(source:Araport11)
AT1G20500 AMP-dependent synthetase and ligase family protein;(source:Araport11)
AT1G20520 DUF241 domain protein, putative (DUF241);(source:Araport11)
AT1G20530 girdin (DUF630 and DUF632);(source:Araport11)
AT1G20540 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT1G20550 O-fucosyltransferase family protein;(source:Araport11)
AT1G20620 Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen. The mRNA is cell-to-cell mobile.
AT1G20640 Plant regulator RWP-RK family protein;(source:Araport11)
AT1G20657 Pseudogene of AT3G61340; F-box family protein
AT1G20690 SWI-SNF-related chromatin binding protein;(source:Araport11)
AT1G20696 Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. The mRNA is cell-to-cell mobile.
AT1G20700 Encodes WOX14, a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Functions in the shoot meristem organizing center to maintain the stem cells in an undifferentiated state. WOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation.
AT1G20710 Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box.
AT1G20720 RAD3-like DNA-binding helicase protein;(source:Araport11)
AT1G20735 F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G20740 transport/golgi organization-like protein (DUF833);(source:Araport11)
AT1G20750 RAD3-like DNA-binding helicase protein;(source:Araport11)
AT1G20770 coiled-coil protein;(source:Araport11)
AT1G20790 F-box family protein;(source:Araport11)
AT1G20795 F-box family protein;(source:Araport11)
AT1G20810 FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11)
AT1G20830 Encodes MCD1 (MULTIPLE CHLOROPLAST DIVISION SITE 1). Determines the site of chloroplast division in concert with MinD (AT5G24020).
AT1G20850 Cysteine peptidase. Enzyme activity detected in leaf.
AT1G20875 hypothetical protein;(source:Araport11)
AT1G20900 Encodes an AT hook domain containing protein that acts redundantly with SOB3 to modulate hypocotyl growth inhibition in response to light.
AT1G20940 F-box family protein;(source:Araport11)
AT1G20950 Phosphofructokinase family protein;(source:Araport11)
AT1G20960 Similar to DEAD/DExH box ATP-dependent RNA helicase . Required for proper splicing of FLC. Mutants have reduced FLC levels and are early flowering.
AT1G20970 calponin-like domain protein;(source:Araport11)
AT1G20980 Encodes a nuclear plant-specific protein with features characteristic of a transcriptional regulator, including a nuclear localization signal sequence, a plant-specific DNA binding domain (the SBP box), and a protein interaction motif (ankyrin repeats). It unctions as a transcriptional regulator that plays a role not only in sensitivity to FB1, but also in the development of normal plant architecture. The mRNA is cell-to-cell mobile.
AT1G20990 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G21000 PLATZ transcription factor family protein;(source:Araport11)
AT1G21010 PADRE proteinup-regulated after infection by S. sclerotiorun.
AT1G21060 Serine/Threonine-kinase, putative (Protein of unknown function, DUF547);(source:Araport11)
AT1G21090 Cupredoxin superfamily protein;(source:Araport11)
AT1G21100 O-methyltransferase family protein;(source:Araport11)
AT1G21120 O-methyltransferase family protein;(source:Araport11)
AT1G21130 O-methyltransferase family protein;(source:Araport11)
AT1G21140 The gene encodes nodulin-like1 whose transcript abundance was repressed under conditions of Fe-deficient growth.
AT1G21170 Exocyst complex component SEC5;(source:Araport11)
AT1G21210 cell wall-associated ser/thr kinase involved in cell elongation and lateral root development
AT1G21220 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-26 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT1G21240 encodes a wall-associated kinase The mRNA is cell-to-cell mobile.
AT1G21245 Protein kinase superfamily protein;(source:Araport11)
AT1G21250 Encodes a cell wall-associated kinase that interacts with AtGRP3 and may function as a signaling receptor of extracellular matrix component such as oligogalacturonides. The mRNA is cell-to-cell mobile.
AT1G21260 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.4e-23 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT1G21330 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G40680.1);(source:TAIR10)
AT1G21340 Dof-type zinc finger DNA-binding family protein;(source:Araport11)
AT1G21400 Thiamin diphosphate-binding fold (THDP-binding) superfamily protein;(source:Araport11)
AT1G21420 pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10)
AT1G21430 Flavin-binding monooxygenase family protein;(source:Araport11)
AT1G21460 Nodulin MtN3 family protein;(source:Araport11)
AT1G21470 hypothetical protein;(source:Araport11)
AT1G21480 Exostosin family protein;(source:Araport11)
AT1G21500 hypothetical protein;(source:Araport11)
AT1G21510 TPRXL;(source:Araport11)
AT1G21525 Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167. Virus-induced small peptide composed of 71 amino acids, which harbor a ubiquitin-interacting motif that mediates interaction with autophagy-related protein 8. Small peptide receptor functioning in the crosstalk between selective autophagy and RNA silencing.
AT1G21529 DRIR is a 755 nt long non coding RNA. Over-expression results in plants with increased salt and drought tolerance and ABA sensitivity. DRIR probably regulates the accumulation of genes involved in drought stress response. DRIR likely acts as a regulator of drought stress responsive gene expression.
AT1G21530 AMP-dependent synthetase and ligase family protein;(source:Araport11)
AT1G21640 Encodes a protein with NAD kinase activity. The protein was also shown to bind calmodulin.
AT1G21660 Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT1G21695 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT1G21738 hypothetical protein;(source:Araport11)
AT1G21760 This gene is predicted to encode an F-box protein that is evolutionarily conserved between Arabidopsis and other eukaryotes including S.cerevisiae and humans. It may play a role in regulating translation under conditions of temperature stress. FBP7 transcript levels are increased at high and low temperatures. The mRNA is cell-to-cell mobile.
AT1G21850 SKU5 similar 8;(source:Araport11)
AT1G21900 Encodes an ER-localized p24 protein. Interacts with p24beta2 at ER export sites for ER exit and coupled transport to the Golgi apparatus. Once in the Golgi, p24delta5 interacts very efficiently with the COPI machinery for retrograde transport back to the ER.
AT1G21925 Encodes a Plant thionin family protein
AT1G21950 transmembrane protein;(source:Araport11)
AT1G21973 Encodes a Plant thionin family protein [pseudogene]
AT1G21980 Type I phosphatidylinositol-4-phosphate 5-kinase. Preferentially phosphorylates PtdIns4P. Induced by water stress and abscisic acid in Arabidopsis thaliana. Expressed in procambial cells of leaves, flowers and roots. A N-terminal Membrane Occupation and Recognition Nexus (MORN)affects enzyme activity and distribution.
AT1G21990 F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT1G22030 Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member.
AT1G22040 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT1G22050 membrane-anchored ubiquitin-fold protein 6 precursor;(source:Araport11)
AT1G22060 sporulation-specific protein;(source:Araport11)
AT1G22090 hypothetical protein;(source:Araport11)
AT1G22100 Inositol-pentakisphosphate 2-kinase family protein;(source:Araport11)
AT1G22150 sulfate transporter Sultr1;3
AT1G22160 senescence-associated family protein (DUF581);(source:Araport11)
AT1G22170 Phosphoglycerate mutase family protein;(source:Araport11)
AT1G22180 Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT1G22210 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT1G22220 F-box family protein;(source:Araport11)
AT1G22230 nucleolar GTP-binding protein;(source:Araport11)
AT1G22240 Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts.
AT1G22280 Encodes a phytochrome-associated protein, PAPP2C (phytochrome-associated protein phosphatase type 2C). PAPP2C interacts in the nucleus with phyA (phytochrome A) and phyB. Functions as a regulator of phytochrome-interacting factor PIF3 by dephosphorylating phytochromes in the nucleus.
AT1G22290 14-3-3 family protein;(source:Araport11)
AT1G22340 UDP-glucosyl transferase 85A7;(source:Araport11)
AT1G22400 UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT1G22440 Zinc-binding alcohol dehydrogenase family protein;(source:Araport11)
AT1G22460 O-fucosyltransferase family protein;(source:Araport11)
AT1G22470 Hypothetical protein;(source:Araport11). Target of SR45.
AT1G22490 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT1G22540 Major facilitator superfamily protein;(source:Araport11)
AT1G22550 Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots.
AT1G22560 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.4e-20 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10)
AT1G22570 Major facilitator superfamily protein;(source:Araport11)
AT1G22580 transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 32%25 identity and 1.1e-13 P-value to GP|21952510|gb|AAM82604.1|AF525305_2|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10)
AT1G22600 Late embryogenesis abundant protein (LEA) family protein;(source:Araport11)
AT1G22610 C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11)
AT1G22640 MYB-type transcription factor (MYB3) that represses phenylpropanoid biosynthesis gene expression
AT1G22650 Plant neutral invertase family protein;(source:Araport11)
AT1G22660 Polynucleotide adenylyltransferase family protein;(source:Araport11)
AT1G22670 Protease-associated (PA) RING/U-box zinc finger family protein;(source:Araport11)
AT1G22700 Encodes a TPR protein with homology to Ycf37 from Synechocystis that is localized to the thylakoid membrane and is involved in photosystem I biogenesis.
AT1G22710 Encodes for a high-affinity transporter essential for phloem loading and long-distance transport. A major sucrose transporter, AtSUC2 can also transport a wide range of physiological and synthetic glucose conjugates with both α- or β-linkage.
AT1G22740 GTP-binding protein Rab7
AT1G22750 transmembrane protein;(source:Araport11)
AT1G22840 Encodes cytochrome c. Contains two site II (TGGGCC/T) elements, which interact with a TCP-domain transcription factor, and a downstream internal telomeric repeat, and are required for expression of the Cytc-1 gene. Promoter directs preferential expression in root and shoot meristems and in anthers. Double mutants with CYTC-2 accumulate starch during the day, have delayed growth and development and reduced GA and DELLA proteins linking cellular metabolism and GA homeostasis.
AT1G22900 Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11)
AT1G22920 AJH1 encodes a protein similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Encodes a subunit of the COP9 complex that is involved in protein deneddylation. Plants with mutations in CSN5A and CSN5B have a de-etiolated phenotype. Required for the recovery of AUX/IAA repressor levels following recurrent heat stress to regulate auxin homeostasis.
AT1G22930 T-complex protein 11;(source:Araport11)
AT1G22985 encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.
AT1G23000 Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT1G23010 Encodes a protein with multicopper oxidase activity. Located in ER. Function together with LPR2 (AT1G71040) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability.
AT1G23020 Encodes a ferric chelate reductase whose transcription is regulated by FIT1. Expressed in the root, shoot, flower and cotyledon.
AT1G23030 Encodes a plant U-Box protein that is capable of binding and ubiquitinating a variety of targets including MYC2,LRR1,KIN and acting as an E3 ligase. Regulates a number of physiological hormonal and environment al responses via selective degradation of targets.Unlike PUB10, its closest homolog in Arabidopsis, it does not appear to play a major role in the MeJA-mediated response.
AT1G23037 F-box associated ubiquitination effector family protein;(source:Araport11)
AT1G23050 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT1G23060 hypothetical protein;(source:Araport11)
AT1G23070 organic solute transporter ostalpha protein (DUF300);(source:Araport11)
AT1G23080 Encodes a novel component of auxin efflux that is located apically in the basal cell and is involved during embryogenesis in setting up the apical-basal axis in the embryo. It is also involved in pattern specification during root development. In roots, it is expressed at lateral and basal membranes of provascular cells in the meristem and elongation zone, whereas in the columella cells it coincides with the PIN3 domain. Plasma membrane-localized PIN proteins mediate a saturable efflux of auxin. PINs mediate auxin efflux from mammalian and yeast cells without needing additional plant-specific factors. The action of PINs in auxin efflux is distinct from PGPs, rate-limiting, specific to auxins and sensitive to auxin transport inhibitors. PINs are directly involved of in catalyzing cellular auxin efflux.
AT1G23090 Encodes AST91 mRNA for sulfate transporter.
AT1G23130 Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11)
AT1G23150 hypothetical protein;(source:Araport11)
AT1G23170 Involved in cell wall modifications resulting in resistance to the biotroph Hpa.
AT1G23180 ARM repeat superfamily protein;(source:Araport11)
AT1G23200 ProPME pectin methyl esterase involved in embryo development.
AT1G23201 GCK domain protein;(source:Araport11)
AT1G23205 Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT1G23230 Mediator tail subunit, involved in transcriptional regulation. Mediator Complex Subunit, interacts with MED2, MED5, MED16 in the Regulation of Phenylpropanoid Biosynthesis.
AT1G23250 Caleosin-related family protein
AT1G23270 hypothetical protein;(source:Araport11)
AT1G23300 MATE efflux family protein;(source:Araport11)
AT1G23310 Identified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway.
AT1G23330 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G23380 homeodomain transcription factor KNAT6, belonging to class I of KN transcription factor family (which also includes KNAT1 and KNAT2). Expression is increased in as and bop1 leaf mutants.
AT1G23390 A kelch domain-containing F-box protein. Its N terminus contains a typical F-box motif but its C-terminal domain only consists of one predicted kelch motif. Predicted to be stu Interacts with chalcone synthase CHS to mediate CHS ubiquitination and degradation.
AT1G23410 cytosolic ribosomal protein gene, part of eS31 family
AT1G23440 Peptidase C15, pyroglutamyl peptidase I-like protein;(source:Araport11)
AT1G23510 OBP32pep protein;(source:Araport11)
AT1G23520 hypothetical protein (DUF220);(source:Araport11)
AT1G23550 Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Its transcript level is up-regulated by tunicamycin (N-linked glycosylation inhibitor causing ER stress).
AT1G23570 hypothetical protein (DUF220);(source:Araport11)
AT1G23580 transmembrane protein, putative (Domain of unknown function DUF220);(source:Araport11)
AT1G23590 OBP32pep protein, putative (Domain of unknown function DUF220);(source:Araport11)
AT1G23600 OBP32pep protein, putative (Domain of unknown function DUF220);(source:Araport11)
AT1G23610 hypothetical protein;(source:Araport11)
AT1G23710 hypothetical protein (DUF1645);(source:Araport11)
AT1G23730 beta carbonic anhydrase 3;(source:Araport11)
AT1G23740 AOR is an alkenal/one oxidoreductase that acts on compounds with unsaturated alpha,beta-carbonyls. The activity of this enzyme with a number of substrates, including acrolein and 3-buten-2-one, was demonstrated in vitro using a truncated form of the protein that lacked approximately 80 of the first amino acids. This protein appears to localize to the chloroplast where it likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation.
AT1G23760 Encodes aromatic rich glycoprotein JP630.
AT1G23770 F-box family protein;(source:Araport11)
AT1G23790 dicer-like protein (DUF936);(source:Araport11)
AT1G23810 Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11)
AT1G23830 transmembrane protein;(source:Araport11)
AT1G23870 Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. The mRNA is cell-to-cell mobile.
AT1G23910 Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11)
AT1G24030 Protein kinase superfamily protein;(source:Araport11)
AT1G24100 Encodes a UDP-glucose:thiohydroximate S-glucosyltransferase, involved in glucosinolate biosynthesis
AT1G24110 Peroxidase superfamily protein;(source:Araport11)
AT1G24150 Encodes a group I formin. Localized to cell junctions. Polymerizes actin. Binds profilin. Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. FORMIN4 is a spatial feedback element in a multi-layered, temporally defined sequence of cytoskeletal response, contributing to the distribution of actin filaments at the dynamic cell wall appositions boundary and to the outcomes of pre-invasion defense.
AT1G24200 Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11)
AT1G24212 pseudogene of paired amphipathic helix repeat-containing protein
AT1G24220 paired amphipathic helix repeat-containing protein;(source:Araport11)
AT1G24256 hypothetical protein;(source:Araport11)
AT1G24260 Member of the MADs box transcription factor family. SEP3 is redundant with SEP1 and 2. Flowers of SEP1/2/3 triple mutants show a conversion of petals and stamens to sepals.SEP3 forms heterotetrameric complexes with other MADS box family members and binds to the CArG box motif.
AT1G24270 hypothetical protein;(source:Araport11)
AT1G24320 Six-hairpin glycosidases superfamily protein;(source:Araport11)
AT1G24400 High-affinity transporter for neutral and acidic amino acids, expressed in tapetum tissue of anthers. Transport of 1-Aminocyclopropane-1-carboxylic acid (ACC).
AT1G24405 hypothetical protein;(source:Araport11)
AT1G24420 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT1G24430 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT1G24470 Encodes one of the two Arabidopsis homologues to YBR159w encoding a S. cerevisiae beta-ketoacyl reductase (KCR), which catalyzes the first reduction during VLCFA (very long chain fatty acids, >18 carbon) elongation: KCR1 (At1g67730), KCR2 (At1g24470). Complementation of the yeast ybr159Delta mutant demonstrated that the two KCR proteins are divergent and that only AtKCR1 can restore heterologous elongase activity similar to the native yeast KCR gene.
AT1G24485 ER protein carbohydrate-binding protein;(source:Araport11)
AT1G24530 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT1G24540 member of CYP86C
AT1G24570 transmembrane protein, putative (DUF707);(source:Araport11)
AT1G24575 DEAD-box ATP-dependent RNA helicase-like protein;(source:Araport11)
AT1G24580 RING/U-box superfamily protein;(source:Araport11)
AT1G24590 Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and LEAFY PETIOLE. This gene functions in the regeneration of shoots in tissue culture, probably through transcriptional regulation of CUC1. May also be involved in activation of the cell cycle via CycD1;1.
AT1G24600 hypothetical protein;(source:Araport11)
AT1G24640 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-37 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10)
AT1G24650 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G24706 Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. Mutations in THO have severe developmental defects and affect the production of several different classes of small RNAs indicating a broader role in small RNA biosynthesis.
AT1G24764 Member of the MAP70 protein family.
AT1G25240 ENTH/VHS/GAT family protein;(source:Araport11)
AT1G25275 Thionin-like gene involved in resistance against the beet cyst nematode (Heterodera schachtii).
AT1G25300 Octicosapeptide/Phox/Bem1p family protein;(source:Araport11)
AT1G25310 basic helix-loop-helix (bHLH) DNA-binding family protein;(source:Araport11)
AT1G25330 Encodes CESTA, a positive regulator of brassinosteroid biosynthesis.
AT1G25340 putative transcription factor (MYB116)
AT1G25370 hypothetical protein (DUF1639);(source:Araport11)
AT1G25425 CLAVATA3/ESR-RELATED 43;(source:Araport11)
AT1G25450 Encodes KCS5, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids).
AT1G25540 Encodes a nuclear protein that acts in a phyB pathway (but downstream of phyB) and induces flowering in response to suboptimal light conditions. PFT1 promotes flowering in CO dependent and independent pathways and integrates several environmental stimuli, such as light quality and JA-dependent defenses. Mutants are hypo-responsive to far-red and hyper-responsive to red light and flower late under long day conditions. Also shown to be a Mediator subunit regulating jasmonate-dependent defense.
AT1G25550 Member of HHO/HRS GARP type transcriptional repressor family. Involved in Pi uptake and Pi starvation signaling. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus.
AT1G25570 Di-glucose binding protein with Leucine-rich repeat domain-containing protein;(source:Araport11)
AT1G26130 ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11)
AT1G26190 TTM2 is a triphosphate tunnel metalloenzyme that displays pyrophosphatase activity.It contains both a uridine kinase (UK) domain and CYTH domain. TTM2 is involved in negative regulation defense response to pathogens (PMID:28733390).
AT1G26200 TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11)
AT1G26240 Proline-rich extensin-like family protein;(source:Araport11)
AT1G26270 Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11)
AT1G26290 hypothetical protein;(source:Araport11)
AT1G26320 Zinc-binding dehydrogenase family protein;(source:Araport11)
AT1G26390 FAD-binding Berberine family protein;(source:Araport11)
AT1G26410 FAD-binding Berberine family protein;(source:Araport11)
AT1G26430 pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10)
AT1G26450 Carbohydrate-binding X8 domain superfamily protein;(source:Araport11)
AT1G26570 UDP-glucose dehydrogenase 1;(source:Araport11)
AT1G26600 Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo.
AT1G26610 C2H2-like zinc finger protein;(source:Araport11)
AT1G26640 Encodes a cytosolic isopentenyl phosphate kinase that plays an important role in regulating the formation of both MVA (mevalonic acid) and MEP (methylerythritol phosphate) pathway-derived terpenoid compounds by controlling the ratio of IP/DMAP to IPP/DMAPP. IPP and DMAPP are the universal C5 building blocks of all natural terpenoids. IPK enhances terpenoid formation by returning IP/DMAP to the terpenoid biosynthetic network.
AT1G26680 transcriptional factor B3 family protein;(source:Araport11)
AT1G26690 emp24/gp25L/p24 family/GOLD family protein;(source:Araport11)
AT1G26700 A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO14 belongs to the clade I, with AtMLO4 and AtMLO11. The gene is expressed during early seedling growth, in developing primary root, and particularly in root tips of 10-day old seedlings; it was not expressed in leaves or flowers, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s).
AT1G26730 EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11)
AT1G26770 Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana.
AT1G26790 Dof-type zinc finger DNA-binding family protein;(source:Araport11)
AT1G26796 Plant self-incompatibility protein S1 family;(source:Araport11)
AT1G26797 Plant self-incompatibility protein S1 family;(source:Araport11)
AT1G26799 Plant self-incompatibility protein S1 family;(source:Araport11)
AT1G26800 MPSR1 is cytoplasmic E3 ligase that senses misfolded proteins independently of chaperones and targets those proteins for degradation via the 26S proteasome. Involved in the regulation of the homeostasis of sensor NLR immune receptors.
AT1G26850 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT1G26870 NAC-domain protein. Expressed in root cap stem cells, where it promotes periclinal root cap-forming divisions. Involved in a regulatory feedback loop with SMB. FEZ activates SMB in hte root cap daughter cells soon after division, and SMB in turn represses FEZ expression in these cells, thereby preventing further stem cell divisions.
AT1G26890 FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11)
AT1G26900 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT1G26921 hypothetical protein;(source:Araport11)
AT1G26930 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT1G26970 Protein kinase superfamily protein;(source:Araport11)
AT1G27000 GRIP/coiled-coil protein, putative (DUF1664);(source:Araport11)
AT1G27008 transmembrane protein;(source:Araport11)
AT1G27040 Major facilitator superfamily protein;(source:Araport11)
AT1G27050 Encodes a protein with a RNA recognition motif. Previously annotated as ATHB54, a homeodomain leucine zipper (HD-Zip) family protein. In the TAIR10 genome release (2010), this locus was split into two loci: AT1G27045 (containing homeodomain and leucine zipper domains) and AT1G27050 (containing a RNA recognition motif). AT1G27045 is now named ATHB54. Note that Affymetrix ATH1 Probe Set linked to symbol ATHB54 is in fact directed against the product of the AT1G27050 locus (the mRNA coding for the RNA-recognition-motif protein).
AT1G27060 Regulator of chromosome condensation (RCC1) family protein;(source:Araport11)
AT1G27080 Encodes a protein with low-affinity nitrate transporter activity that is expressed in the vascular tissue of the funiculus and the silique. This plasma membrane-localized enzyme is predicted to have 12 transmembrane domains. Plants lacking NRT1.6 have reduced levels of nitrate in their seeds and have increased levels of early embryonic developmental defects and seed abortion.
AT1G27090 glycine-rich protein;(source:Araport11)
AT1G27100 Actin cross-linking protein;(source:Araport11)
AT1G27110 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G27140 Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).
AT1G27170 transmembrane receptors / ATP binding protein;(source:Araport11)
AT1G27190 Activated by TCP8/14/15/22, involved in modulation of GA-dependent stamen filament elongation.
AT1G27250 Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11)
AT1G27260 Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11)
AT1G27270 Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11)
AT1G27285 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT1G27290 transmembrane protein;(source:Araport11)
AT1G27370 In conjunction with SPL11 and SPL2, SPL10 redundantly controls proper development of lateral organs in association with shoot maturation in the reproductive phase. SPL2, SPL10, and SPL11, suppress root regeneration with age by inhibiting wound-induced auxin biosynthesis. SPL10 also controls lamina shape during vegetative development.
AT1G27440 IRX10 was identified as MUCI69 in a reverse genetic screen for MUCILAGE-RELATED genes. Mutations in this gene did not disrupt mucilage properties, likely due to the presence of the functionally redundant IRX10-L.
AT1G27500 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G27670 transmembrane protein;(source:Araport11)
AT1G27690 lipase, putative (DUF620);(source:Araport11)
AT1G27720 TBP-associated factor 4B;(source:Araport11)
AT1G27730 Related to Cys2/His2-type zinc-finger proteins found in higher plants. Compensated for a subset of calcineurin deficiency in yeast. Salt tolerance produced by ZAT10 appeared to be partially dependent on ENA1/PMR2, a P-type ATPase required for Li+ and Na+ efflux in yeast. The protein is localized to the nucleus, acts as a transcriptional repressor and is responsive to chitin oligomers. Also involved in response to photooxidative stress.
AT1G27740 Basic helix-loop-helix (bHLH) transcription factor that is sufficient to promote postmitotic cell growth in root-hair cells. RSL4 is a direct transcriptional target of RHD6
AT1G27770 Encodes a chloroplast envelope Ca2+-ATPase with an N-terminal autoinhibitor.
AT1G27850 Encodes a microtubule-associated protein involved in cortical microtubule organization during leaf development.
AT1G27860 hypothetical protein (DUF626);(source:Araport11)
AT1G27890 Deadenylase.
AT1G27920 microtubule-associated protein 65-8;(source:Araport11)
AT1G27930 Arabinogalactan methylesterase,involved in arabinogalactan glucuronic acid methylation. Interacts with eIF3.
AT1G27940 P-glycoprotein 13;(source:Araport11)
AT1G27980 Encodes an ER-localized sphingoid long-chain base-1-phosphate lyase involved in the dehydration stress response.
AT1G28010 Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem.
AT1G28020 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G28030 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT1G28040 RING/U-box superfamily protein;(source:Araport11)
AT1G28080 RING finger protein;(source:Araport11)
AT1G28090 Polynucleotide adenylyltransferase family protein;(source:Araport11)
AT1G28100 hypothetical protein;(source:Araport11)
AT1G28110 serine carboxypeptidase-like 45;(source:Araport11)
AT1G28120 Deubiquitinase with preference towards M1 and K48 linkages.
AT1G28130 Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin.
AT1G28135 hypothetical protein;(source:Araport11)
AT1G28160 encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
AT1G28180 DEAD-box ATP-dependent RNA helicase-like protein;(source:Araport11)
AT1G28190 PADRE protein up-regulated after infection by S. sclerotiorum.
AT1G28210 DnaJ homolog AtJ1 (atj)
AT1G28220 Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.
AT1G28230 Encodes a transporter that transports purines,cytokinins and other adenine derivatives. Expressed in the leaf hydathodes where it may be involved in re-uptake of cytokinins during guttation.
AT1G28250 transmembrane protein;(source:Araport11)
AT1G28260 Telomerase activating protein Est1;(source:Araport11)
AT1G28300 Transcription factor that contains a B3 domain, a DNA-binding motif unique to plants and characteristic of several transcription factors. Plays critical roles both early and late during embryo development. LEC2 RNA accumulates primarily during seed development. LEC2 is required for the maintenance of suspensor morphology, specification of cotyledon identity, progression through the maturation phase, and suppression of premature germination. It establishes a cellular environment sufficient to initiate embryo development - ectopic, postembryonic expression of LEC2 in transgenic plants induces the formation of somatic embryos and other organ-like structures and often confers embryonic characteristics to seedlings and to reproductive and vegetative organs of mature plants.
AT1G28306 Plant self-incompatibility protein S1 family;(source:Araport11)
AT1G28320 Mutants in this gene are defective in the processing of pre-glyoxysomal malate dehydrogenase (pre-gMDH) to gMDH.
AT1G28323 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.9e-140 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10)
AT1G28327 E3 ubiquitin-protein ligase;(source:Araport11)
AT1G28335 Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT1G28350 Nucleotidylyl transferase superfamily protein;(source:Araport11)
AT1G28360 encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ERF12). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. Regulates floral development.
AT1G28380 This gene is predicted to encode a protein involved in negatively regulating salicylic acid-related defense responses and cell death programs. nsl1 mutants develop necrotic lesions spontaneously and show other features of a defense response, such as higher levels of SA and disease resistance-related transcripts, in the absence of a biotic stimulus. The NSL1 protein is predicted to have a MACPF domain, found in proteins that form a transmembrane pore in mammalian immune responses. NSL1 transcript levels do not appear to change in response to biotic stresses, but are elevated by cycloheximide in seedlings, and by sodium chloride in roots. The mRNA is cell-to-cell mobile.
AT1G28430 member of CYP705A
AT1G28440 HAESA-like 1;(source:Araport11)
AT1G28470 NAC domain containing protein 10;(source:Araport11)
AT1G28490 Encodes SYP61, one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. SYP61 and SYP121 coordinate the trafficking of plasma membrane aquaporin PIP2;7 to modulate the cell membrane water permeability.
AT1G28520 VOZ transcription factor which acts as positive regulator of several salt-responsive genes. Functionally redundant in salt stress with VOZ2.
AT1G28570 SGNH hydrolase-type esterase superfamily protein;(source:Araport11)
AT1G28580 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT1G28590 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT1G28591 Pseudogene of AT1G28610; GDSL-motif lipase, putative
AT1G28600 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT1G28610 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT1G28620 pseudogene of GDSL-like Lipase/Acylhydrolase superfamily protein;(source:Araport11)
AT1G28640 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT1G28650 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT1G28660 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT1G28670 Arabidopsis thaliana lipase
AT1G28685 Natural antisense transcript overlaps with AT1G28680;(source:Araport11)
AT1G28690 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G28695 Nucleotide-diphospho-sugar transferase family protein;(source:Araport11)
AT1G28700 Nucleotide-diphospho-sugar transferase family protein;(source:Araport11)
AT1G28720 pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT1G28760 Encodes an orthlog of the Xenopus inner nuclear membrane (INM) protein Nemp1/TMEM194A.
AT1G28860 pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT1G29000 Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT1G29010 verprolin;(source:Araport11)
AT1G29020 Calcium-binding EF-hand family protein;(source:Araport11)
AT1G29025 Calcium-binding EF-hand family protein;(source:Araport11)
AT1G29041 hypothetical protein;(source:Araport11)
AT1G29050 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT1G29080 Papain family cysteine protease;(source:Araport11)
AT1G29090 Cysteine proteinases superfamily protein;(source:Araport11)
AT1G29100 Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT1G29110 Cysteine proteinases superfamily protein;(source:Araport11)
AT1G29140 Pollen Ole e 1 allergen and extensin family protein;(source:Araport11)
AT1G29150 specifically interacts with FUS6/COP11 via the C-terminal domain of FUS6/COP11 and associates with an ATPase subunit of the 19S proteasome regulatory complex, AtS6A. The mRNA is cell-to-cell mobile.
AT1G29160 Encodes a DOF transcription factor involved in seed coat development. Regulates PRX2 and PRX25, involved in seed longevity.
AT1G29170 Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments.
AT1G29200 O-fucosyltransferase family protein;(source:Araport11)
AT1G29220 transcriptional regulator family protein;(source:Araport11)
AT1G29230 Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.20), which has also been reported as a member of the CBL-interacting protein kinases (CIPK18).
AT1G29240 transcription initiation factor TFIID subunit, putative (DUF688);(source:Araport11)
AT1G29290 Group II CEP family member; binds to vascular tissue independently of CEPR1 or CRA2.
AT1G29300 intracellular protein transporter, putative (DUF641);(source:Araport11)
AT1G29310 SecY protein transport family protein;(source:Araport11)
AT1G29320 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT1G29340 Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity. It is required for cell death and full resistance specified by Arabidopsis RPM1 and RPS4 resistance proteins against Pseudomonas syringae pv tomato. The mRNA is cell-to-cell mobile.
AT1G29380 Carbohydrate-binding X8 domain superfamily protein;(source:Araport11)
AT1G29390 Integral membrane protein in the inner envelope of chloroplasts. Provide freezing tolerance.
AT1G29395 Integral membrane protein in the inner envelope of chloroplasts. Provide freezing tolerance. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. involved in response to salt tolerance
AT1G29400 A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML5 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. Among mei2-like genes, AML5 is the transcript with highest frequency of alternative splicing. Expression was detected during embryo development (heart and torpedo stage) and in vegetative and floral apices.
AT1G29430 SAUR762 expression is induced during pollination and expressed in pollen tubes. SAUR62 likely functions in translation of proteins required for pollen tube development/function.
AT1G29460 SAUR-like auxin-responsive protein family;(source:Araport11)
AT1G29465 transmembrane protein;(source:Araport11)
AT1G29475 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-91 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT1G29480 hypothetical protein;(source:Araport11)
AT1G29490 SAUR-like auxin-responsive protein family;(source:Araport11)
AT1G29510 This locus was referred to as SAUR68 in PMID:17948056 but the nomenclature should be SAUR67.
AT1G29520 AWPM-19-like family protein;(source:Araport11)
AT1G29540 LOW protein: protein BOBBER-like protein;(source:Araport11)
AT1G29560 Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11)
AT1G29570 Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11)
AT1G29580 mediator of RNA polymerase II transcription subunit;(source:Araport11)
AT1G29600 Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11)
AT1G29620 Cytochrome C oxidase polypeptide VIB family protein;(source:Araport11)
AT1G29630 5-3 exonuclease family protein;(source:Araport11)
AT1G29650 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-28 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10)
AT1G29660 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT1G29690 Encodes a protein containing a domain with significant homology to the MACPF (membrane attack complex and perforin) domain of complements and perforin proteins that are involved in innate immunity in animals. Transgenic cad1-1 mutant plants show lesions seen in the hypersensitive response, as well as a spontaneous activation of expression of pathogenesis-related genes and leading to a 32-fold increase in salicylic acid (SA). CAD1 is postulated to act as a negative regulator controlling SA-mediated pathway of programmed cell death in plant immunity.
AT1G29710 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G29715 pseudogene of Leucine-rich repeat transmembrane protein kinase;(source:Araport11)
AT1G29720 Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth.
AT1G29730 Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth.
AT1G29740 Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth.
AT1G29760 Membrane protein involved in lipid droplet biogenesis primarily in pollen. The interaction motif on SEIPIN2 for VAP27-1 is restricted to the N-terminal 30 amino acids that contain an FFAT motif.
AT1G29770 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT1G29840 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G29870 tRNA synthetase class II (G, H, P and S) family protein;(source:Araport11)
AT1G29890 Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Has high similarity to RWA2 whose mutant displays reduced acetylation. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis.
AT1G29910 member of Chlorophyll a/b-binding protein family
AT1G29920 Encodes lhcb1.1 a component of the LHCIIb light harvesting complex associated with photosystem II.
AT1G29930 Subunit of light-harvesting complex II (LHCII),which absorbs light and transfers energy to the photosynthetic reaction center. The mRNA is cell-to-cell mobile.
AT1G29940 Encodes a subunit of RNA polymerase 1 (aka RNA polymerase A).
AT1G29962 AGAMOUS-like 64;(source:Araport11)
AT1G30000 alpha-mannosidase 3;(source:Araport11)
AT1G30040 Encodes a gibberellin 2-oxidase that acts on C-19 gibberellins. AtGA2OX2 expression is responsive to cytokinin and KNOX activities.
AT1G30050 tropomyosin;(source:Araport11)
AT1G30080 Glycosyl hydrolase superfamily protein;(source:Araport11)
AT1G30090 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT1G30100 Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition.
AT1G30110 Encodes a ppGpp pyrophosphohydrolase.
AT1G30120 Encodes a putative plastid pyruvate dehydrogenase E1 beta subunit that is distinct from the mitochondrial pyruvate dehydrogenase E1 beta subunit.
AT1G30130 DUF1365 family protein;(source:Araport11)
AT1G30150 transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 2.2e-24 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10)
AT1G30170 Hypothetical protein (DUF295) of unknown function.
AT1G30180 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.5e-115 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT1G30190 cotton fiber protein;(source:Araport11)
AT1G30210 TCP family protein involved in heterochronic regulation of leaf differentiation.
AT1G30250 hypothetical protein;(source:Araport11)
AT1G30270 Arabidopsis thaliana CBL-interacting protein kinase 23. CIPK23 serves as a positive regulator of the potassium transporter AKT1 by directly phosphorylating AKT1. CIPK23 is activated by the binding of two calcineurin B-like proteins, CBL1 and CBL9. The mRNA is cell-to-cell mobile.
AT1G30310 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.6e-19 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT1G30320 Remorin family protein;(source:Araport11)
AT1G30350 Pectin lyase-like superfamily protein;(source:Araport11)
AT1G30360 Early-responsive to dehydration stress protein (ERD4);(source:Araport11)
AT1G30370 Encodes a mitochondria-localized class III phospholipase A1 that plays a role in seed viability.
AT1G30400 glutathione S-conjugate transporting ATPase (AtMRP1) mRNA. An ABCC-type arsenite-phytochelatin transporter. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim.
AT1G30410 member of MRP subfamily
AT1G30420 member of MRP subfamily
AT1G30440 Phototropic-responsive NPH3 family protein;(source:Araport11)
AT1G30455 cyclin/Brf1-like TBP-binding domain-containing protein;(source:Araport11)
AT1G30460 Encodes AtCPSF30, the 30-KDa subunit of cleavage and polyadenylation specificity factor. AtCPSF30 is a probable processing endonuclease. Nucleus-localized RNA binding protein capable of interacting with itself and with calmodulin. Its RNA-binding activity is inhibited by calmodulin in a calcium-dependent fashion.
AT1G30500 nuclear factor Y, subunit A7;(source:Araport11)
AT1G30515 GATA zinc finger protein;(source:Araport11)
AT1G30560 Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5).
AT1G30590 RNA polymerase I specific transcription initiation factor RRN3 protein;(source:Araport11)
AT1G30610 Pentatricopeptide repeat protein .Mutations in this locus result in embryo lethality due to defects in chloroplast development. Embryo shape at seed maturity is globular.
AT1G30620 encodes a type-II membrane protein that catalyzes 4-epimerization of UDP-D-Xylose to UDP-L-Arabinose in vitro, the nucleotide sugar used by glycosyltransferases in the arabinosylation of cell wall polysaccharides and wall-resident proteoglycans.
AT1G30640 Protein kinase family protein;(source:Araport11)
AT1G30660 A truncated version of Twinkle that retains only the DNA primase domain.
AT1G30670 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT1G30680 Twinkle is a dual localized (mitochondria and chloroplast) DNA primase-helicase. It synthesizes RNA primers from a 5′ -(G/C)GGA-3′ template, where the last two 3' nucleotides are cryptic. Mitochondrial protein involved in DNA replication which binds to DNA polymerases, Pol1A and Pol1B.
AT1G30700 FAD-binding Berberine family protein;(source:Araport11)
AT1G30710 FAD-binding Berberine family protein;(source:Araport11)
AT1G30720 FAD-binding Berberine family protein;(source:Araport11)
AT1G30750 TPRXL;(source:Araport11)
AT1G30755 elongation factor G, putative (DUF668);(source:Araport11)
AT1G30757 transmembrane protein;(source:Araport11)
AT1G30760 Encodes a BBE-like enzyme that acts in monolignol metabolism by catalyzing the oxidation of aromatic allylic alcohols, such as coumaryl-, sinapyl-, and coniferyl alcohol, to the corresponding aldehydes. The mRNA is cell-to-cell mobile.
AT1G30780 F-box associated ubiquitination effector family protein;(source:Araport11)
AT1G30790 F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G30820 Cytidine triphosphate synthase.
AT1G30825 Involved in trichome maturation. mutant displays enlarged trichomes
AT1G30830 pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10)
AT1G30835 Member of Sadhu non-coding retrotransposon family The mRNA is cell-to-cell mobile.
AT1G30845 cell growth defect protein;(source:Araport11)
AT1G30850 root hair specific 4;(source:Araport11)
AT1G30860 RING/U-box superfamily protein;(source:Araport11)
AT1G30880 hypothetical protein;(source:Araport11)
AT1G30900 VACUOLAR SORTING RECEPTOR 6;(source:Araport11)
AT1G30910 Molybdenum cofactor sulfurase family protein;(source:Araport11)
AT1G30925 F-box/associated interaction domain protein;(source:Araport11)
AT1G30935 Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167
AT1G30940 pseudogene of F-box family protein;(source:Araport11)
AT1G30945 pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G30950 Required for the proper identity of the floral meristem. Involved in establishing the whorled pattern of floral organs, in the control of specification of the floral meristem, and in the activation of APETALA3 and PISTILLATA. UFO is found at the AP3 promoter in a LFY-dependent manner, suggesting that it works with LFY to regulate AP3 expression. UFO may also promote the ubiquitylation of LFY.
AT1G30960 Ortholog of ERA (E. coli RAS-like protein)-related GTPase (ERG). Mitochondrial protein that associates with 18sRNA. Heterozygous mutants segregate for embryo lethality inherited as a sporphytic maternal effect. Increased ROS in the mutant ovule suggests a heritable mitochondrial defect results in lethality.
AT1G30972 Encodes a Plant thionin family protein
AT1G31040 ORE15 is a nuclear localized member of the PLATZ family of transcription factors. Based on over expression and loss of function phenotypes, ORE15 functions in regulation of leaf cell proliferation and senescence.
AT1G31070 Encodes a protein that functions as an N-acetylglucosamine-1-phosphate uridylyltransferase that catalyzes the formation of UDP-N-acetylglucosamine (UDP-GlcNAc). This is an essential precursor for glycolipid and glycoprotein synthesis and is also used for regulatory protein modification in signaling pathways. The enzyme can also catalyze the reverse reaction using both UDP-GlcNAc and the less common UDP-N-acetylgalactosamine as substrates.
AT1G31080 F-box family protein;(source:Araport11)
AT1G31093 pseudogene of calcium-dependant protein kinase
AT1G31130 polyadenylate-binding protein 1-B-binding protein;(source:Araport11)
AT1G31140 Encodes a B-sister MADS-box protein, GORDITA which is specific to the Brassicaceae. GOA is the most closely related paralog of ABS. GOA represses fruit growth and contributes to integument development. Over-expression of GOA results in disorganized floral structure and addition of carpel-like features to sepals.
AT1G31150 K-box region protein (DUF1985);(source:Araport11)
AT1G31163 F-box associated ubiquitination effector family protein;(source:Araport11)
AT1G31170 encodes a cysteine-sulfinic acid reductase (sulfiredoxin - EC 1.8.98.2) capable of reducing overoxidized plastidic 2-Cys-Prx involved in peroxide detoxification and response to oxidative stress
AT1G31173 Encodes a microRNA that targets ARF family members ARF6 and ARF8. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAAGCUGCCAGCAUGAUCUGG
AT1G31175 cytochrome C oxidase biogenesis Cmc1-like protein;(source:Araport11)
AT1G31230 Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine.
AT1G31250 proline-rich family protein;(source:Araport11)
AT1G31260 member of Fe(II) transporter isolog family
AT1G31290 ARGONAUTE 3;(source:Araport11)
AT1G31300 TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11)
AT1G31310 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT1G31370 Ubiquitin-specific protease family C19-related protein;(source:Araport11)
AT1G31380 TRAF-like family protein;(source:Araport11)
AT1G31420 Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots.
AT1G31450 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT1G31470 Major facilitator superfamily protein;(source:Araport11)
AT1G31490 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT1G31500 HESP identified based on similarity to nocturnins and presence circadian regulatory elements in the promoter. It functions as a Mg(II) dependent poly(A) exoribonuclease.It is under circadian regulation and expressed at night. Knockdowns affect the regulation of circadian genes CCA1 and TOC1.
AT1G31520 hypothetical protein;(source:Araport11)
AT1G31530 Deadenylase.
AT1G31550 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT1G31580 Encodes cell wall protein. ECS1 is not a Xcc750 resistance gene, but the genetic data indicate that ECS1 is linked to a locus influencing resistance to Xcc750. The mRNA is cell-to-cell mobile.
AT1G31630 AGAMOUS-like 86;(source:Araport11)
AT1G31670 Copper amine oxidase family protein;(source:Araport11)
AT1G31710 Copper amine oxidase family protein;(source:Araport11)
AT1G31720 chitin synthase, putative (DUF1218);(source:Araport11)
AT1G31760 SWIB/MDM2 domain superfamily protein;(source:Araport11)
AT1G31780 Encodes a component of the oligomeric Golgi (COG) complex. Found in pollen golgi apparatus. Loss of function results in defects in pollen tube growth resulting in lack of transmission through the pollen.
AT1G31812 Acyl-CoA-binding protein. Bind acyl-CoA esters and protect acyl-CoAs from degradation by microsomal acyl-hydrolases. Plays a role in determining seed oil content.
AT1G31830 Encodes POLYAMINE UPTAKE TRANSPORTER 2, an amino acid permease family protein.
AT1G31850 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT1G31860 encodes a bifunctional protein that has phosphoribosyl-ATP pyrophosphohydrolase (PRA-PH) and phosphoribosyl-AMP cyclohydrolase (PRA-CH) activities.
AT1G31870 Ortholog of yeast BUD13 RES complex protein. Functions in pre mRNA processing of RNAs expressed in embryos.
AT1G31885 NOD26-like intrinsic protein 3;(source:Araport11)
AT1G31910 GHMP kinase family protein;(source:Araport11)
AT1G31935 Has been identified as a translated small open reading frame by ribosome profiling.
AT1G31960 hypothetical protein;(source:Araport11)
AT1G31970 DEA(D/H)-box RNA helicase family protein;(source:Araport11)
AT1G31983 pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT1G31990 transmembrane protein;(source:Araport11)
AT1G32030 plant-specific B3-DNA-binding domain protein (DUF313);(source:Araport11)
AT1G32090 early-responsive to dehydration stress protein (ERD4);(source:Araport11)
AT1G32100 Encodes a pinoresinol reductase involved in lignan biosynthesis. Expressed strongly in roots and less strongly in stems. Shows specificity for pinoresinol and not lariciresinol.
AT1G32150 Encodes a G group bZIP transcription factor family member that can bind cis elements with an ACGT core, such as G-box, Hex, C-box and As-1. The protein is localized in the nucleus and can homodimerize and can heterodimerize with other G group members.
AT1G32160 beta-casein (DUF760);(source:Araport11)
AT1G32172 other_RNA;(source:Araport11)
AT1G32180 encodes a gene similar to cellulose synthase
AT1G32200 Encodes a chloroplast glycerol-3-phosphate acyltransferase.Involved in the biosynthesis of chloroplast phosphatidylglycerol.
AT1G32230 Encodes a protein belonging to the (ADP-ribosyl)transferase domain-containing subfamily of WWE protein-protein interaction domain protein family. Superoxide radicals are necessary and sufficient to propagate cell death or lesion formation in rcd1 mutants. Without stress treatment, RCD1 is localized in the nucleus. Under high salt or oxidative stress, RCD1 is found not only in the nucleus but also in the cytoplasm. The mRNA is cell-to-cell mobile.
AT1G32240 Encodes a member of the KANADI family of putative transcription factors. Together with KAN1, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN1 and KAN4 appears to regulate the proper localization of PIN1 in early embryogenesis.
AT1G32250 Calcium-binding EF-hand family protein;(source:Araport11)
AT1G32270 member of SYP2 Gene Family
AT1G32310 Encodes a plant-specific negative regulator of the APC/C complex. It is expressed during embryogenesis and early plant development and plays a key role in organ size control. Mutants are defective in mitosis I of pollen development, resulting in pollen without sperm nuclei.
AT1G32320 member of MAP Kinase Kinase
AT1G32337 hypothetical protein;(source:Araport11)
AT1G32361 Putative RING-H2 finger protein ATL1F precursor.
AT1G32390 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10)
AT1G32460 hypothetical protein;(source:Araport11)
AT1G32470 Single hybrid motif superfamily protein;(source:Araport11)
AT1G32510 NAC domain containing protein 11;(source:Araport11)
AT1G32520 TLDc domain protein;(source:Araport11)
AT1G32540 Encodes a protein with 3 plant-specific zinc finger domains that acts as a positive regulator of cell death.
AT1G32600 F-box associated ubiquitination effector family protein;(source:Araport11)
AT1G32640 Encodes a MYC-related transcriptional activator with a typical DNA binding domain of a basic helix-loop-helix leucine zipper motif. Binds to an extended G-Box promoter motif and interacts with Jasmonate ZIM-domain proteins. MYC2 interacts with EIN3 and EIL1 to repress hook curvature and resistance to Botrytis cinera.Its transcription is induced by dehydration stress, ABA treatment and blue light via CRY1. Negative regulator of blue light-mediated photomorphogenic growth and blue and far-red-light-regulated gene expression. Positive regulator of lateral root formation. Regulates diverse JA-dependent functions. Negatively regulates Trp metabolism and biosynthesis of Trp-derived secondary metabolites. Positively regulates flavonoid biosynthesis, resistance to insects, and response to oxidative stress. Regulates other transcription factors, and negatively regulates its own expression. For example it binds to and regulates the expression of NST1. Its stability is modulated by PUB10 through polyubiquitination.
AT1G32680 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G35880.1);(source:TAIR10)
AT1G32700 PLATZ transcription factor family protein;(source:Araport11)
AT1G32730 electron carrier/iron ion-binding protein;(source:Araport11)
AT1G32763 Encodes a defensin-like (DEFL) family protein.
AT1G32780 GroES-like zinc-binding dehydrogenase family protein;(source:Araport11)
AT1G32790 RNA-binding protein, putative, similar to RNA-binding protein GB:CAB40027 GI:4539439 from (Arabidopsis thaliana).Member of a family of PAB2 binding domain proteins.
AT1G32850 ubiquitin-specific protease 11;(source:Araport11)
AT1G32860 Glycosyl hydrolase superfamily protein;(source:Araport11)
AT1G32870 Expression in rosette leaves is activated by high concentration of boron.
AT1G32880 ARM repeat superfamily protein;(source:Araport11)
AT1G32890 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-37 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10)
AT1G32910 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT1G32920 hypothetical protein;(source:Araport11)
AT1G32928 Avr9/Cf-9 rapidly elicited protein;(source:Araport11)
AT1G32930 Galactosyltransferase family protein;(source:Araport11)
AT1G32960 Subtilase family protein;(source:Araport11)
AT1G32970 Subtilisin-like serine endopeptidase family protein;(source:Araport11)
AT1G32975 hypothetical protein;(source:Araport11)
AT1G32980 Subtilisin-like serine endopeptidase family protein;(source:Araport11)
AT1G33010 F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G33020 F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G33030 O-methyltransferase family protein;(source:Araport11)
AT1G33055 hypothetical protein;(source:Araport11)
AT1G33060 NAC 014;(source:Araport11)
AT1G33170 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT1G33220 Glycosyl hydrolase superfamily protein;(source:Araport11)
AT1G33230 TMPIT-like protein;(source:Araport11)
AT1G33240 Encodes a plant transcriptional activator that contains two separate, but similar, trihelix DNA-binding domains, similar to GT-2. Gene is expressed in all aerial parts of the plant, with higher level of expression in siliques. At-GTL2 was thought to be a duplicated copy of this gene but is likely to be a cloning artefact, the result of a chimeric clone. Regulates ploidy-dependent cell growth in trichome.
AT1G33265 Encodes a chloroplast membrane-localized fatty acid exporter that plays a critical roles in transporting plastid fatty acids for TAG biosynthesis during seed and embryo development.
AT1G33290 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT1G33320 Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11)
AT1G33340 ENTH/ANTH/VHS superfamily protein;(source:Araport11)
AT1G33350 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT1G33380 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.1e-10 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT1G33400 Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones.
AT1G33440 Major facilitator superfamily protein;(source:Araport11)
AT1G33470 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT1G33490 E3 ubiquitin-protein ligase;(source:Araport11)
AT1G33500 tropomyosin;(source:Araport11)
AT1G33530 F-box family protein;(source:Araport11)
AT1G33540 serine carboxypeptidase-like 18;(source:Araport11)
AT1G33600 Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT1G33640 hypothetical protein;(source:Araport11)
AT1G33670 Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT1G33700 Beta-glucosidase, GBA2 type family protein;(source:Araport11)
AT1G33710 RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11)
AT1G33720 cytochrome P450, family 76, subfamily C, polypeptide 6;(source:Araport11)
AT1G33730 cytochrome P450, family 76, subfamily C, polypeptide 5;(source:Araport11)
AT1G33740 pseudogene of TCP-1/cpn60 chaperonin family protein;(source:Araport11)
AT1G33785 pseudogene of photosynthetic electron transfer B;(source:Araport11)
AT1G33790 jacalin lectin family protein;(source:Araport11)
AT1G33800 Encodes a glucuronoxylan(GX)-specific 4-O-methyltransferase responsible for methylating GlcA residues in GX. Reduced methylation of GX ingxmt1-1 plants is correlated with altered lignin composition. The mRNA is cell-to-cell mobile.
AT1G33813 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.8e-39 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT1G33820 hypothetical protein;(source:Araport11)
AT1G33840 LURP-one-like protein (DUF567);(source:Araport11)
AT1G33910 One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance.
AT1G33930 One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance.
AT1G33950 Avirulence induced gene (AIG1) family protein;(source:Araport11)
AT1G33960 Identified as a gene that is induced by avirulence gene avrRpt2 and RPS2 after infection with Pseudomonas syringae pv maculicola strain ES4326 carrying avrRpt2
AT1G33970 IAN9 is a member of a small family of proteins. It's expression is repressed upon pathogen infection and loss of function mutants show increased resistance to bacterial pathogens.
AT1G34050 Ankyrin repeat family protein;(source:Araport11)
AT1G34060 Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11)
AT1G34070 Copia-like polyprotein/retrotransposon;(source:Araport11)
AT1G34100 pseudogene of Protein kinase superfamily protein;(source:Araport11)
AT1G34110 Leucine-rich receptor-like protein kinase family protein;(source:Araport11)
AT1G34140 polyadenylate-binding protein, putative / PABP, putative, non-consensus splice donor TA at exon 1; similar to polyadenylate-binding protein (poly(A)-binding protein) from (Triticum aestivum) GI:1737492, (Nicotiana tabacum) GI:7673355, {Arabidopsis thaliana} SP:P42731; contains InterPro entry IPR000504: RNA-binding region RNP-1 (RNA recognition motif) (RRM). Only member of the class IV PABP family.
AT1G34160 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G34180 NAC domain containing protein 16;(source:Araport11)
AT1G34220 Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11)
AT1G34260 Encodes a protein that is predicted to act as a phosphatidylinositol-3P 5-kinase, but, because it lacks a FYVE domain, it is unlikely to be efficiently targeted to membranes containing the porposed phosphatidylinositol-3P substrate. Therefore, its molecular function remains unknown. The mRNA is cell-to-cell mobile.
AT1G34290 receptor like protein 5;(source:Araport11)
AT1G34310 auxin response factor 12;(source:Araport11)
AT1G34355 Encodes PS1 (Parallel Spindle 1). Mutations in PS1 lead to diploid male spores, diploid pollen grains, and spontaneous triploid plants in the next generation. Female meiosis is not affected in the mutants.
AT1G34420 leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11)
AT1G34470 magnesium transporter, putative (DUF803);(source:Araport11)
AT1G34480 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G34490 MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11)
AT1G34500 MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11)
AT1G34530 transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 7.8e-116 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT1G34540 member of CYP94D
AT1G34550 transmembrane protein (DUF616);(source:Araport11)
AT1G34570 Essential protein Yae1, N-terminal;(source:Araport11)
AT1G34575 FAD-binding Berberine family protein;(source:Araport11)
AT1G34580 Major facilitator superfamily protein;(source:Araport11)
AT1G34650 Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family.
AT1G34660 transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.1e-114 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10)
AT1G34750 Protein phosphatase 2C family protein;(source:Araport11)
AT1G34760 Encodes a 14-3-3 protein. Binds H+-ATPase in response to blue light.
AT1G34790 Encodes a zinc finger protein; involved in photomorphogenesis, flavonoid biosynthesis, flower and seed development.
AT1G34904 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-90 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10)
AT1G35050 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-61 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10)
AT1G35115 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.1e-168 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT1G35170 TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11)
AT1G35183 zinc finger, C3HC4 type (RING finger) protein;(source:Araport11)
AT1G35200 pseudogene of Ribosomal protein L4/L1 family;(source:Araport11)
AT1G35210 hypothetical protein;(source:Araport11)
AT1G35230 Encodes arabinogalactan-protein (AGP5). The mRNA is cell-to-cell mobile.
AT1G35310 MLP-like protein 168;(source:Araport11)
AT1G35330 RING/U-box superfamily protein;(source:Araport11)
AT1G35340 ATP-dependent protease La (LON) domain protein;(source:Araport11)
AT1G35350 EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11)
AT1G35360 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.5e-38 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10)
AT1G35420 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G35430 transmembrane protein;(source:Araport11)
AT1G35440 cyclin T1;(source:Araport11)
AT1G35460 Encodes a bHLH transcription factor involved in CFL1-mediated regulation of cuticle development. Overexpression leads to abnormal cuticle development.
AT1G35465 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-27 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT1G35467 Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide.
AT1G35470 Encodes a homologue of human RanBPM that belongs to the uncharacterized family of plant SPRY, LisH, CTLH and CRA domain-containing proteins.
AT1G35530 Encodes FANCM, a highly conserved helicase that functions as a major factor limiting meiotic crossover formation. It is not directly involved in the repair of DNA lesions but suppresses spontaneous somatic homologous recombination via a RecQ helicase (At-RECQ4A)-independent pathway.
AT1G35535 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-252 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT1G35570 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10)
AT1G35580 CINV1 / A/N-InvG is an alkaline/neutral invertase that breaks sucrose down into fructose and glucose (GH100). The exact localization of CINV1 remains under investigation but there is evidence that fluorescently-tagged CINV1 localizes to the cytoplasm. atinvg mutants have reduced root growth, reduced invertase activity, and increased expression of antioxidant genes under basal conditions. The levels of CINV1 / A/N-InvG transcripts rise in response to a hydrogen peroxide treatment. The protein has been shown to interact with PIP5K9.
AT1G35670 Encodes a Ca(2+)-dependent, calmodulin-independent protein kinase that is rapidly induced by drought and high-salt stress but not by low-temperature stress or heat stress. Positive regulator of ABA signaling. Phosphorylates ABA responsive transcription factors ABF1 and ABF4.
AT1G35680 Encodes a chloroplast ribosomal protein L21 that is required for chloroplast development and embryogenesis. The mRNA is cell-to-cell mobile.
AT1G35710 kinase family with leucine-rich repeat domain-containing protein;(source:Araport11)
AT1G35730 Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts.
AT1G35740 pseudogene of glucan synthase-like 9;(source:Araport11)
AT1G35750 Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts.
AT1G35780 N-lysine methyltransferase;(source:Araport11)
AT1G35790 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.3e-42 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT1G35830 VQ motif-containing protein;(source:Araport11)
AT1G35860 TOC75 pseudogene due to a 5.4-kb gypsy/Ty3-related retrotransposon inserted at the 5' end of the gene
AT1G35910 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT1G36060 encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.Overexpression results in increased drought tolerance and vitrified leaves. Binds to DRE/GCC promoter elements and activates expression of aquaporin genes AtTIP1;1, AtTIP2;3, and AtPIP2;2.
AT1G36070 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT1G36105 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.7e-33 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10)
AT1G36110 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.2e-59 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT1G36160 Encodes acetyl-CoA carboxylase. Mutant displays uncoordinated cell divisions which are enhanced by cytokinins. Mutant also has aberrant organization of the apical region in the embryo and abnormal root and shoot development and is deficient in freezing tolerance after cold acclimation. Essential for very long chain fatty acid elongation. The mRNA is cell-to-cell mobile.
AT1G36180 acetyl-CoA carboxylase 2 (ACC2) The mRNA is cell-to-cell mobile.
AT1G36190 transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 8.5e-119 P-value blast match to At1g36190.1/92-340 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT1G36220 pseudogene of seryl-tRNA synthetase / serine-tRNA ligase;(source:Araport11)
AT1G36260 transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 4.2e-91 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT1G36300 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-218 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT1G36360 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.4e-39 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10)
AT1G36406 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.1e-26 P-value blast match to O80466 /172-336 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT1G36420 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 0.00011 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10)
AT1G36440 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains Pfam profile PF03384: Drosophila protein of unknown function, DUF287;(source:TAIR10)
AT1G36510 Nucleic acid-binding proteins superfamily;(source:Araport11)
AT1G36670 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G37050.1);(source:TAIR10)
AT1G36730 Translation initiation factor IF2/IF5;(source:Araport11)
AT1G36880 pseudogene of FAR1-related sequence 5;(source:Araport11)
AT1G36933 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.2e-15 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10)
AT1G36936 transposable_element_gene;(source:Araport11);pseudogene, similar to Putative copia-type polyprotein, blastp match of 43%25 identity and 2.1e-28 P-value to GP|15209144|gb|AAK91877.1|AC091665_3|AC091665 Putative copia-type polyprotein {Oryza sativa};(source:TAIR10)
AT1G36960 hypothetical protein;(source:Araport11)
AT1G37080 transposable_element_gene;(source:Araport11);similar to DNA binding [Arabidopsis thaliana] (TAIR:AT4G01980.1);(source:TAIR10)
AT1G37120 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 8.3e-14 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10)
AT1G37140 Amember of mei2-like gene family; phylogenetic analysis revealed that it belongs to the fourth clade of mei2-like proteins, with conserved C-terminal RNA recognition motif (RRM) only. MCT1 expression is increased in the presence of ABA and RNAi suppression showed increased germination rates in the presence of ABA.
AT1G37150 Although HCS2 is predicted to encode a biotin protein ligase / holocarboxylase synthetase (HCS), hcs2 mutants do not show a decrease in HCS activity. A dual-targeted HCS1 (At2g25710) might account for the HCS activity observed in multiple subcellular compartments in Arabidopsis.
AT1G38185 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-21 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT1G38430 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 9.8e-109 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT1G38440 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 6.0e-121 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT1G40104 hypothetical protein;(source:Araport11)
AT1G41760 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 7.1e-11 P-value blast match to GB:226407 retrotransposon del1-46 (Gypsy_Ty3-element) (Lilium henryi);(source:TAIR10)
AT1G41830 SKU5-similar 6;(source:Araport11)
AT1G41835 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-96 P-value blast match to GB:BAA22288 pol polyprotein (Ty1_Copia-element) (Oryza australiensis)GB:BAA22288 polyprotein (Ty1_Copia-element) (Oryza australiensis)gi|2443320|dbj|BAA22288.1| polyprotein (RIRE1) (Oryza australiensis) (Ty1_Copia-element);(source:TAIR10)
AT1G41860 transposable_element_gene;(source:Araport11);contains InterPro domain Retrotransposon gag protein;(source:TAIR10)
AT1G42120 pre-tRNA tRNA-Met;(source:Araport11, TAIR10)
AT1G42240 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT1G42310 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT1G42350 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.1e-102 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT1G42400 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G35090.1);(source:TAIR10)
AT1G42480 TLR4 regulator/MIR-interacting MSAP protein;(source:Araport11)
AT1G42490 pseudogene of glutamate dehydrogenase 2;(source:Araport11)
AT1G42550 Encodes a plant-specific protein of unknown function that appears to be conserved among angiosperms. The mRNA is cell-to-cell mobile.
AT1G42560 A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO9 belongs to the clade III, with AtMLO5, AtMLO7, AtMLO8, and AtMLO10. The gene is expressed during early seedling growth, in cotyledon vascular system, in flowers (with strong expression in anthers) in siliques and fruit abscission zone; not expressed in roots, or in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s).
AT1G42700 hypothetical protein;(source:Araport11)
AT1G42703 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-08 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10)
AT1G42970 Encodes chloroplast localized glyceraldehyde-3-phosphate dehydrogenase that can use both NADH and NADPH to reduce 1,3-diphosphate glycerate. It forms A2B2 heterotetramers with GapA forms of the GADPH enzyme. These complexes are active in the light under reducing conditions, but show reduced NADPH-dependent activity in response to oxidized thioredoxins and increased NAD(H)/NADP(H) ratios due to the formation of inactive A8B8 hexadecamers. The mRNA is cell-to-cell mobile.
AT1G42980 Actin-binding FH2 (formin homology 2) family protein;(source:Araport11)
AT1G42990 bZIP60 consists of a bZIP DNA binding domain followed by a putative transmembrane domain. bZIP60 mRNA is upregulated by the addition of ER stress inducers, tunicamycin (inhibitor of N-linked glycosylation), DTT (inhibitor of disulfide bond formation) and azetin-2-carboxylate (proline analog perturbing protein structure). Upon ER stress, bZIP60 mRNA is spliced by IRE1A and IRE1B to produce bZIP60-S, an active transcription factor without the transmembrane domain. bZIP60-U, a product of unspliced form of bZIP60 mRNA, is localized at the ER membrane and bZIP60-S is localized in the nucleus.
AT1G43000 PLATZ transcription factor family protein;(source:Araport11)
AT1G43010 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT1G43020 electron protein, putative (Protein of unknown function, DUF547);(source:Araport11)
AT1G43030 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.1e-109 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10)
AT1G43040 SAUR-like auxin-responsive protein family;(source:Araport11)
AT1G43130 like COV 2;(source:Araport11)
AT1G43171 B3 domain protein;(source:Araport11)
AT1G43575 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-34 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10)
AT1G43580 Sphingomyelin synthetase family protein;(source:Araport11)
AT1G43630 plant/protein (DUF793);(source:Araport11)
AT1G43640 Member of TLP family of tubby like proteins that also contain an F-Box.
AT1G43650 nodulin MtN21-like transporter family protein
AT1G43670 Encodes a fructose-1,6-bisphosphatase. This enzyme, in addition to catalyzing the formation of fructose-6-phosphate for sucrose biosynthesis, appears to play a role in fructose-mediated signaling that is independent of its enzymatic activity. atcfbp-1/fins1 mutants have reduced photosynthetic rates, elevated levels of starch and reduced levels of sucrose during the day. Although the protein is expected to be cytosolic, a GFP-tagged version localizes to the cytoplasm and the nucleus. The mRNA is cell-to-cell mobile.
AT1G43700 Encodes a VirE2-interacting protein. VIP1 mediates nuclear translocation of VirE2 via its amino half, and interacts with histone H2A via it carboxyl half. Involved in osmosensory response. The mRNA is cell-to-cell mobile.
AT1G43715 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-130 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10)
AT1G43775 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-147 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10)
AT1G43780 serine carboxypeptidase-like 44;(source:Araport11)
AT1G43781 Pseudogene of AT1G53790; F-box family protein
AT1G43785 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.7e-174 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10)
AT1G43790 tracheary element differentiation-related 6;(source:Araport11)
AT1G43810 hypothetical protein;(source:Araport11)
AT1G43835 transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 2.7e-63 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10)
AT1G43886 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.3e-165 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10)
AT1G43895 pseudogene of Protein kinase superfamily protein;(source:Araport11)
AT1G43910 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT1G44080 F-box SKIP23-like protein (DUF295);(source:Araport11)
AT1G44130 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT1G44160 HSP40/DnaJ peptide-binding protein;(source:Araport11)
AT1G44170 Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. It is also able to oxidize beta-unsaturated aldehydes, but not aromatic aldehydes. Activity of ALDH3H1 is NAD +-dependent.
AT1G44180 Peptidase M20/M25/M40 family protein;(source:Araport11)
AT1G44191 Encodes a ECA1 gametogenesis related family protein
AT1G44224 Encodes a ECA1 gametogenesis related family protein
AT1G44382 pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11)
AT1G44414 zinc-ribbon domain protein;(source:Araport11)
AT1G44542 Cyclase family protein;(source:Araport11)
AT1G44575 Encoding PSII-S (CP22), a ubiquitous pigment-binding protein associated with photosystem II (PSII) of higher plants. Involved in nonphotochemical quenching rather than in photosynthesis. Mutant has a normal violaxanthin cycle but has a limited capacity of quenching singlet excited chlorophylls and is tolerant to lipid peroxidation.
AT1G44750 Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.
AT1G44760 Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11)
AT1G44800 Encodes Siliques Are Red 1 (SIAR1). Functions as a bidirectional amino acid transporter that is crucial for the amino acid homeostasis of siliques. Member of nodulin MtN21-like transporter family.
AT1G44830 Encodes a nuclear-localized member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. Overexpression in cultured cells results in an increase in pectin deposition.ERF014 differentially regulates responses to bacterial and fungal pathogens.
AT1G44920 transmembrane protein;(source:Araport11)
AT1G44941 hypothetical protein;(source:Araport11)
AT1G45000 AAA-type ATPase family protein;(source:Araport11)
AT1G45010 TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11)
AT1G45015 MD-2-related lipid recognition domain-containing protein;(source:Araport11)
AT1G45050 member of ubiquitin-conjugating E2-proteins
AT1G45063 copper ion binding / electron carrier protein;(source:Araport11)
AT1G45110 Tetrapyrrole (Corrin/Porphyrin) Methylase;(source:Araport11)
AT1G45130 beta-galactosidase 5;(source:Araport11)
AT1G45140 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.4e-37 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10)
AT1G45145 encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells.
AT1G45150 alpha-1,6-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase;(source:Araport11)
AT1G45180 RING/U-box superfamily protein;(source:Araport11)
AT1G45190 downregulated in DIF1 18;(source:Araport11)
AT1G45191 beta-glucosidase related protein, similar to beta-glucosidase GI:3820531 from (Pinus contorta); contains Pfam profile: PF00232 Glycosyl hydrolase family 1
AT1G45207 Remorin family protein;(source:Araport11)
AT1G45243 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G45545 WEAK CHLOROPLAST MOVEMENT UNDER BLUE LIGHT-like protein (DUF827);(source:Araport11)
AT1G45616 receptor like protein 6;(source:Araport11)
AT1G45688 CC1 is a plant specific gene that interacts with with the cellulose synthase complex and microtubules. It appears to play a role in localizing CESA to the membrane, microtuble dynamics , particularly during salt stress.
AT1G46048 pseudogene of hypothetical protein;(source:Araport11)
AT1G46192 transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 7.4e-69 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10)
AT1G46264 Encodes SCHIZORIZA, a member of Heat Shock Transcription Factor (Hsf) family. Functions as a nuclear factor regulating asymmetry of stem cell divisions.
AT1G46480 Encodes WOX4, a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. This protein also contains an acidic domain approximately 10 residues upstream of the WUS box. Part of the TDIF-TDR-WOX4 signaling pathway that plays a crucial role in the maintenance of the vascular meristem organization during secondary growth. WOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation.
AT1G46552 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.6e-184 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT1G46768 encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.1). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.9 and RAP2.10.
AT1G46840 F-box family protein;(source:Araport11)
AT1G46912 F-box associated ubiquitination effector family protein;(source:Araport11)
AT1G46984 F-box family protein;(source:Araport11)
AT1G47128 Cysteine proteinase precursor-like protein/ dehydration stress-responsive gene (RD21). Has been shown to have peptide ligase activity and protease activity in vitro. RD21 is involved in immunity to the necrotrophic fungal pathogen Botrytis cinerea.Activity detected in root, leaf, flower and cell culture.
AT1G47200 WPP family members contains an NE targeting domain. This domain, called the WPP domain after a highly conserved Trp-Pro-Pro motif, is necessary for NE targeting of WPP1. RNAi suppression of WPP2 resulted in reduced mitotic activity.
AT1G47220 Cyclin A3;(source:Araport11)
AT1G47240 Encodes a member of the NRAMP2 gene family of metal ion transporters that is required for root growth at low Mn conditions. NRAMP2 is mainly localized to TGN and has influx transport activity of Mn in yeast. Mutation of NRAMP2 impaired root growth, although there was greater Mn retention in the roots under Mn-deficient conditions.
AT1G47250 Encodes 20S proteasome subunit PAF2 (PAF2).
AT1G47265 hypothetical protein;(source:Araport11)
AT1G47271 Cystathionine beta-synthase (CBS) family protein;(source:Araport11)
AT1G47290 Encodes an enzyme with 3β-hydroxysteroid dehydrogenase/C4-decarboxylase activity in vitro. The activity of the enzyme was determined using microsomal extracts of yeast overexpressing the Arabidopsis gene. Cytosolic fractions failed to be associated to the activity, leading to the speculation that the enzyme is membrane-bound.
AT1G47317 Encodes a defensin-like (DEFL) family protein.
AT1G47340 F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G47350 F-box associated ubiquitination effector family protein;(source:Araport11)
AT1G47370 RBA1 variant in Ag0 background is a TIR-only receptor protein that binds to the bacterial type III effector protein HopBA. The Col-0 variant, which is not expressed, is likely a psuedogene and more highly methylated than the Ag0 variant which is expressed.
AT1G47380 Protein phosphatase 2C family protein;(source:Araport11)
AT1G47389 transmembrane protein;(source:Araport11)
AT1G47510 Encodes a phosphatidylinositol polyphosphate 5-phosphatase. It can dephosphorylate PI(4,5)P2, PI(3,5)P2, and PI(3,4,5)P3, but, it is not active against PI(5)P or the water soluble inositol(1,4,5)P3 or inositol(1,3,4,5)P4. The transcript levels for this gene rise in response to auxin, ABA, and JA.
AT1G47530 MATE efflux family protein;(source:Araport11)
AT1G47550 Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. It binds phosphoinositide lipids.
AT1G47570 RING/U-box superfamily protein;(source:Araport11)
AT1G47578 Redundant octanoyltransferase involved in fatty acid synthesis.
AT1G47590 Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.Previously annotated as pseudogene, evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167
AT1G47603 Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.
AT1G47625 pseudogene of seven transmembrane domain protein
AT1G47705 pseudogene of F-box/RNI/FBD-like domain protein;(source:Araport11)
AT1G47710 Serine protease inhibitor (SERPIN) family protein;(source:Araport11)
AT1G47760 AGAMOUS-like 102;(source:Araport11)
AT1G47770 Beta-galactosidase related protein;(source:Araport11)
AT1G47780 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G47840 Encodes a putative hexokinase.
AT1G47880 pseudogene of receptor like protein 6;(source:Araport11)
AT1G47885 Ribonuclease inhibitor;(source:Araport11)
AT1G47890 receptor like protein 7;(source:Araport11)
AT1G47940 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT1G47960 Plant cell wall (CWI) and vacuolar invertases (VI) play important roles in carbohydrate metabolism, stress responses and sugar signaling. This protein may inhibit their activity.
AT1G47980 desiccation-like protein;(source:Araport11)
AT1G47990 Encodes a gibberellin 2-oxidase that acts on C19 gibberellins. AtGA2OX4 expression is responsive to cytokinin and KNOX activities.
AT1G48000 Encodes a putative transcription factor (MYB112).
AT1G48180 target of trans acting-siR480/255 protein;(source:Araport11)
AT1G48220 Protein kinase superfamily protein;(source:Araport11)
AT1G48230 Nucleotide/sugar transporter family protein
AT1G48250 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G35400.1);(source:TAIR10)
AT1G48260 Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.21), which has also been reported as a member of the CBL-interacting protein kinases (CIPK17).
AT1G48270 encodes a protein similar to G-coupled receptor with 7 transmembrane regions. Overexpression studies suggest this gene is involved in dormancy and flowering. Reduction of expression results in decreased sensitivity to cytokinin.
AT1G48280 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT1G48300 Cytosolic iron-sulfur protein with a [2Fe-2S] cluster which synthesizes triacylglycerol (DGAT activity).
AT1G48340 pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G48360 Encodes a FAN1 homolog that is involved in interstrand crosslink repair. FAN1 appears to act in in a different pathway from MUS81 but in similar pathway with RECQ4A, RAD5A and MFH1.
AT1G48380 Encodes a novel nuclear protein required for root hair initiation and ploidy-dependent cell growth. Its sequence has similarity to the C-terminal domain of mammalian DNA topo IIalpha. Shows in vitro DNA binding activity and is likely to be part of the topo VI complex by binding to subunit A.
AT1G48400 F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT1G48405 Kinase interacting (KIP1-like) family protein;(source:Araport11)
AT1G48410 Encodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus.
AT1G48422 Encodes a defensin-like (DEFL) family protein.
AT1G48450 alanine-tRNA ligase, putative (DUF760);(source:Araport11)
AT1G48480 Arabidopsis thaliana receptor-like protein kinase (RKL1) gene
AT1G48490 Protein kinase which together with IREH1 plays an important role in controlling root skewing and maintaining the microtubule network.
AT1G48510 Encodes one of two Arabidopsis mitochondrial proteins similar to human SURF1 which is known to be involved in cytochrome c oxidase assembly. Mutations result in defects in hypocotyl elongation and changes in GA homeostasis.
AT1G48520 Encodes Glu-tRNA(Gln) amidotransferase subunit B (from Genbank record AF239836).
AT1G48530 proteasome inhibitor-like protein;(source:Araport11)
AT1G48540 Outer arm dynein light chain 1 protein;(source:Araport11)
AT1G48610 AT hook motif-containing protein;(source:Araport11)
AT1G48630 Encodes a protein with similarity to mammalian RACKs. RACKs function to shuttle activated protein kinase C to different subcellular sites and may also function as a scaffold through physical interactions with other proteins. RACK1B has no phenotype on its own and probably acts redundantly with RACK1A and RACK1C.
AT1G48640 Transmembrane amino acid transporter family protein;(source:Araport11)
AT1G48660 Auxin-responsive GH3 family protein;(source:Araport11)
AT1G48670 auxin-responsive GH3 family protein;(source:Araport11)
AT1G48745 hypothetical protein;(source:Araport11)
AT1G48810 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.2e-46 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT1G48830 Ribosomal protein S7e family protein;(source:Araport11)
AT1G48870 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT1G48900 Signal recognition particle, SRP54 subunit protein;(source:Araport11)
AT1G48953 hypothetical protein;(source:Araport11)
AT1G48970 NagB/RpiA/CoA transferase-like superfamily protein;(source:Araport11)
AT1G48980 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT1G48990 Oleosin family protein;(source:Araport11)
AT1G49000 transmembrane protein;(source:Araport11)
AT1G49005 Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo.
AT1G49010 Duplicated homeodomain-like superfamily protein;(source:Araport11)
AT1G49032 hypothetical protein;(source:Araport11)
AT1G49050 Encodes a member of the aspartyl protease family. Interacts with BAGP1 and BAG6 and appears to be required for cleavage of BAG6 as BAG6 is not cleaved in APCB1 mutant backgrounds.
AT1G49100 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G49110 hypothetical protein;(source:Araport11)
AT1G49180 protein kinase family protein;(source:Araport11)
AT1G49190 member of Response Regulator: B- Type
AT1G49200 RING/U-box superfamily protein;(source:Araport11)
AT1G49240 Member of a subclass of actins composed of ACT2 and ACT8. Its mRNA is strongly expressed in strongly expressed in leaves, roots, stems, flowers, pollen, and siliques. However, protein expression, assayed by a ACT8:GUS fusion reporter, is very low in pollen.
AT1G49250 ATP-dependent DNA ligase;(source:Araport11)
AT1G49260 mechanosensitive ion channel-like protein;(source:Araport11)
AT1G49270 Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807).
AT1G49280 pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10)
AT1G49290 Paternally expressed gene that is localized around the sperm nuclei of pollen. PEG2 acts as a sponge for siRNA854 during endosperm development, this action is necessary to induce triploid seed abortion.
AT1G49310 transmembrane protein;(source:Araport11)
AT1G49350 PsiMP Glycosylase (PUMY) that hydrolyzes PsiMP to uracil and ribose-5-phosphate. Acts together with PUMY in the peroxisome to prevent toxic pseudouridine monophosphate accumulation. Acts together with the a pseudouridine kinase PUKI in the peroxisome to prevent toxic pseudouridine monophosphate accumulation.
AT1G49390 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT1G49430 Encodes a long chain acyl-CoA synthetase that catalyzes the synthesis of omega-hydroxy fatty acyl-CoA intermediates in the pathway to cutin synthesis. Required for repression of lateral root formation.
AT1G49450 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT1G49470 transmembrane epididymal protein (DUF716);(source:Araport11)
AT1G49520 SWIB complex BAF60b domain-containing protein;(source:Araport11)
AT1G49530 encodes a mitochondria-targeted geranylgeranyl pyrophosphate synthase
AT1G49560 Homeodomain-like superfamily protein;(source:Araport11)
AT1G49570 Peroxidase superfamily protein;(source:Araport11)
AT1G49580 Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11)
AT1G49610 F-box family protein;(source:Araport11)
AT1G49620 Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Binds to D type cyclins and may inhibit cell cycle.
AT1G49720 Identified as a protein that binds to abscisic acid response elements. May mediate transcriptional regulation of ABA responses.
AT1G49730 Protein kinase superfamily protein;(source:Araport11)
AT1G49740 PLC-like phosphodiesterases superfamily protein;(source:Araport11)
AT1G49750 Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT1G49770 Encodes a member of the basic helix loop helix family of transcription factors. Loss of RGE1 function causes shriveled seeds that contain small embryos. The cuticle in the embryos does not develop normally, possible due to the adeherence of the endosperm to the developing embryo. RGE1 is expressed in the endosperm surrounding region which directly surrounds the developing embryo, however it exerts its effect non autonomously- in the developing embryo. Mutant seedlings are extremely sensitive to desiccation due to the abnormal cuticle. Together with ICE1, ZOU determines primary seed dormancy depth independently of their joint role in endosperm development.
AT1G49800 Homolog of PIP1.
AT1G49850 RING/U-box superfamily protein;(source:Araport11)
AT1G49880 Encodes Erv1, a component of the mitochondrial intermembrane space assembly machinery involved in the import pathway of the small intermembrane space proteins. It contains a Cys-X-Cys shuttle disulfide and oxidizes thioredoxin in vitro. Flavoenzyme-encoding gene.
AT1G49900 C2H2 type zinc finger transcription factor family;(source:Araport11)
AT1G49960 Xanthine/uracil permease family protein;(source:Araport11)
AT1G49975 photosystem I reaction center subunit N;(source:Araport11)
AT1G49990 F-box family protein;(source:Araport11)
AT1G50020 tubulin alpha-6 chain;(source:Araport11)
AT1G50040 formin-like protein, putative (DUF1005);(source:Araport11)
AT1G50070 pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10)
AT1G50080 ribonuclease;(source:Araport11)
AT1G50090 D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein;(source:Araport11)
AT1G50100 pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10)
AT1G50120 Encodes a Golgi-localized protein which regulates pollen tube growth. Required for TGN formation and Golgi structure maintenance.
AT1G50140 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT1G50190 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G50200 Alanyl-tRNA synthetase;(source:Araport11)
AT1G50210 pseudogene of NB-ARC domain-containing disease resistance protein;(source:Araport11)
AT1G50220 B3 domain protein;(source:Araport11)
AT1G50280 BTB/POZ protein that forms a complex with CUL3a. Involved in repression of ABA responses.
AT1G50330 pseudogene of methylesterase PCR A;(source:Araport11)
AT1G50370 Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11)
AT1G50390 pfkB-like carbohydrate kinase family protein;(source:Araport11)
AT1G50420 Encodes a scarecrow-like protein (SCL3) Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay).
AT1G50450 Saccharopine dehydrogenase;(source:Araport11)
AT1G50460 Involved in glucose-ethylene crosstalk.
AT1G50470 F-box associated ubiquitination effector family protein;(source:Araport11)
AT1G50480 10-formyltetrahydrofolate synthetase (THFS) mRNA, complete The mRNA is cell-to-cell mobile.
AT1G50490 Encodes one of two ubiquitin-conjugating enzymes belonging to the E2-C gene family (the other being UBC19). Transcript is always found in diving cells, but also in other non-dividing cells.
AT1G50575 Putative lysine decarboxylase family protein;(source:Araport11)
AT1G50580 UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT1G50590 RmlC-like cupins superfamily protein;(source:Araport11)
AT1G50610 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G50630 extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11)
AT1G50680 AP2/B3 transcription factor family protein;(source:Araport11)
AT1G50700 Member of Calcium Dependent Protein Kinase. Mediates Strigolactone-Induced Stomatal Closure
AT1G50732 transmembrane protein;(source:Araport11)
AT1G50840 DNA Polymerase gamma2. Dual targeting to mitochondria and plastids due to alternative translation initiation.
AT1G50870 F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G50900 Encodes GDC1 (Grana Deficient Chloroplast 1), an ankyrin domain containing protein required fro chloroplast thylakoid grana formation. The mRNA is cell-to-cell mobile.
AT1G50930 Serine/Threonine-kinase;(source:Araport11)
AT1G50970 Membrane trafficking VPS53 family protein;(source:Araport11)
AT1G51000 hypothetical protein;(source:Araport11)
AT1G51030 hypothetical protein;(source:Araport11)
AT1G51050 pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT1G51080 golgin family A protein;(source:Araport11)
AT1G51110 localized to chloroplasts
AT1G51130 δ-kleisin component of the SMC5/6 complex, possibly involved in synaptonemal complex formation.
AT1G51150 Encodes a putative DegP protease.
AT1G51170 Encodes an active AGC VIII protein kinase that interacts with the putative transcription factor ATS and regulates planar growth during integument development in the ovule. Mutants exhibit ectopic growth in filaments and petals, as well as aberrant embryogenesis.
AT1G51190 Encodes a member of the AINTEGUMENTA-like (AIL) subclass of the AP2/EREBP family of transcription factors and is essential for quiescent center (QC) specification and stem cell activity. It is a key effector for establishment of the stem cell niche during embryonic pattern formation. It is transcribed in response to auxin accumulation and is dependent on auxin response transcription factors.
AT1G51210 UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT1G51260 ACYL-COA:1-ACYLGLYCEROL-3-PHOSPHATE ACYLTRANSFERASE, PUTATIVE SIMILAR TO ACYL-COA:1-ACYLGLYCEROL-3-PHOSPHATE ACYLTRANSFERASE GI:4583544 FROM [BRASSICA NAPUS]
AT1G51290 F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G51350 ARM repeat superfamily protein;(source:Araport11)
AT1G51355 cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11)
AT1G51390 Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU4 than to NFU1,2, and 3. Targeted to the mitochondrion. The mRNA is cell-to-cell mobile.
AT1G51410 similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), apple tree, PIR:T16995; NOT a cinnamyl-alcohol dehydrogenase
AT1G51440 Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols.
AT1G51460 ABCG13 encodes a member of the ATP-binding cassette (ABC) transporter family protein. Mutants show defects in petal elongation resulting in a folded petal phenotype.
AT1G51480 disease resistance protein (CC-NBS-LRR class) family protein;(source:Araport11)
AT1G51500 Encodes an ABC transporter involved in cuticular wax biosynthesis. Lines carrying recessive mutations in this locus have weakly glaucous stem surface, and relative elevated secondary alcohols and ketones.
AT1G51520 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT1G51540 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT1G51580 RNA-binding KH domain-containing protein;(source:Araport11)
AT1G51620 Protein kinase superfamily protein;(source:Araport11)
AT1G51630 O-fucosyltransferase family protein;(source:Araport11)
AT1G51645 Natural antisense transcript overlaps with AT1G51640;(source:Araport11)
AT1G51650 ATP synthase epsilon chain;(source:Araport11)
AT1G51680 encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. In addition to 4-coumarate, it also converts ferulate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, ferulic acid, caffeic acid and 5-OH-ferulic acid. At4CL1 was unable to use sinapic acid as substrate.
AT1G51700 Encodes dof zinc finger protein (adof1). The mRNA is cell-to-cell mobile.
AT1G51710 Ubiquitin-specific protease 6 (UBP6). Deubiquinating enzyme. Interacts with calmodulin.
AT1G51730 Ubiquitin-conjugating enzyme family protein;(source:Araport11)
AT1G51745 Tudor/PWWP/MBT superfamily protein;(source:Araport11)
AT1G51750 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.6e-20 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10)
AT1G51760 encodes a member of the six Arabidopsis IAA-amino acid conjugate hydrolase subfamily and conjugates and conjugates IAA-Ala in vitro. Gene is expressed most strongly in roots, stems, and flowers. The mRNA is cell-to-cell mobile.
AT1G51780 encodes a member of the six Arabidopsis IAA-amino acid conjugate hydrolase subfamily and conjugates and is very similar to IAR3.
AT1G51790 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G51800 The gene encodes a putative member of the LRR-RLK protein family. Expressin and mutant analysis revealed that it contributes to the interaction between Arabidopsis and Hyaloperonospora arabidopsidis. and The mRNA is cell-to-cell mobile.
AT1G51802 Encodes a defensin-like (DEFL) family protein.
AT1G51805 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G51810 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G51860 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G51870 protein kinase family protein;(source:Araport11)
AT1G51880 root hair specific 6;(source:Araport11)
AT1G51890 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G51900 Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11)
AT1G51910 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G51940 Encodes a LysM-containing receptor-like kinase. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. Based on protein sequence alignment analysis, it has a typical RD signaling domain in its catalytic loop and possesses autophosphorylation activity.It is required for the suppression of defense responses in absence of pathogen infection or upon abscisic acid treatment. Loss-of-function mutants display enhanced resistance to Botrytis cinerea and Pectobacterium carotovorum. Its expression is repressed by pathogen infection and biological elicitors and is induced abscisic acid.Expression is strongly repressed by elicitors and fungal infection, and is induced by the hormone abscisic acid (ABA). Insertional mutants show increased expression of PHYTOALEXIN-DEFICIENT 3 (PAD3), enhanced resistance to Botrytis cinerea and Pectobacterium carotovorum infection and reduced physiological responses to ABA, suggesting that LYK3 is important for the cross-talk between signaling pathways activated by ABA and pathogens (PMID:24639336).
AT1G51950 indole-3-acetic acid inducible 18;(source:Araport11)
AT1G51965 Encodes ABA Overly-Sensitive5 (ABO5), a pentatricopeptide repeat protein required for cis-splicing of mitochondrial nad2 intron 3. Involved in response to abscisic acid.
AT1G51990 O-methyltransferase family protein;(source:Araport11)
AT1G52000 Mannose-binding lectin superfamily protein;(source:Araport11)
AT1G52050 Mannose-binding lectin superfamily protein;(source:Araport11)
AT1G52060 Mannose-binding lectin superfamily protein;(source:Araport11)
AT1G52140 Avr9/Cf-9 rapidly elicited protein;(source:Araport11)
AT1G52150 Member of the class III HD-ZIP protein family. Contains homeodomain and leucine zipper domain. Critical for vascular development and negatively regulates vascular cell differentiation.
AT1G52155 transmembrane protein;(source:Araport11)
AT1G52185 Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:TAGAATGCTATTGTAATCCAG
AT1G52190 Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves.
AT1G52191 Thioesterase superfamily protein;(source:Araport11)
AT1G52210 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-186 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT1G52220 Thylakoid membrane localized protein that interacts with other CURT family proteins. Oligomerization is associated with grana thylakoid curavature.
AT1G52230 Phosphorylation of this protein is dependent on calcium. The mRNA is cell-to-cell mobile.
AT1G52240 Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily .
AT1G52280 RAB GTPase homolog G3D;(source:Araport11)
AT1G52315 Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11)
AT1G52325 Initiation factor eIF-4 gamma, MA3;(source:Araport11)
AT1G52330 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11)
AT1G52343 Similar to GET2, transmembrane protein that interacts with GET1.
AT1G52360 Coatomer, beta subunit;(source:Araport11)
AT1G52390 hypothetical protein;(source:Araport11)
AT1G52400 encodes a member of glycosyl hydrolase family 1, located in inducible ER bodies which were formed after wounding, required in inducible ER body formation The mRNA is cell-to-cell mobile.
AT1G52410 Contains a novel calcium-binding repeat sequence. Binds TSK in vitro. Localizes to small cytoplasmic vesicles in interphase cells. In cells synchronized for cell division, TSA1 and TSK relocalize to ends of spindle microtubules that are ahead of separating chromatids during metaphase and anaphase of mitosis. May be involved in mitosis together with TSK. Expressed preferentially in the flower and shoot apex. Can form multimers. The mRNA is cell-to-cell mobile.
AT1G52415 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT1G52430 Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11)
AT1G52440 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G52450 Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11)
AT1G52490 F-box/associated interaction domain protein;(source:Araport11)
AT1G52520 FAR1-related sequence 6;(source:Araport11)
AT1G52540 Protein kinase superfamily protein;(source:Araport11)
AT1G52550 transmembrane protein;(source:Araport11)
AT1G52560 HSP20-like chaperones superfamily protein;(source:Araport11)
AT1G52565 cytochrome P450 family protein;(source:Araport11)
AT1G52590 Putative thiol-disulfide oxidoreductase DCC;(source:Araport11)
AT1G52618 hypothetical protein;(source:Araport11)
AT1G52620 Mitochondrial pentatricopeptide repeat protein required for stabilizing nad1 transcripts.
AT1G52660 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT1G52680 late embryogenesis abundant protein-related / LEA protein-like protein;(source:Araport11)
AT1G52695 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G52696 Pseudogene of AT1G52695; phospholipase/carboxylesterase family protein
AT1G52780 PII, uridylyltransferase (DUF2921);(source:Araport11)
AT1G52790 encodes a putative oxidoreductase, 2OG-Fe(II) oxygenase family protein, similar to GS-AOP loci (GI:16118889, GI:16118887, GI:16118891, GI:16118893); contains PF03171 2OG-Fe(II) oxygenase superfamily domain
AT1G52810 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT1G52855 hypothetical protein;(source:Araport11)
AT1G52860 pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10)
AT1G52880 Transcription factor with a NAC domain. Homologous to the petunia gene NAM which is required for the development of the shoot. Expressed in the embryo.
AT1G52910 fiber (DUF1218);(source:Araport11)
AT1G52920 Encodes a plasma membrane?localized ABA receptor, which interacts with the Gαβγ complex. It has been postulated that the binding of ABA to GCR2 results in the release of the G protein and dissociation of the heterotrimeric complex into Gα and the Gβγ dimer to activate downstream ABA effectors and to trigger the ABA responses.
AT1G52940 Encodes a purple acid phosphatase that is induced under prolonged phosphate (Pi) starvation and is required for maintaining basal resistance against Pseudomonas syringae and Botrytis cinerea.
AT1G53010 RING/U-box superfamily protein;(source:Araport11)
AT1G53020 Cognate nuclear E2 enzyme that interacts with the RFA4 E3 ligase and forms UBC26-RFA4-Receptor complexes in nuclear speckles.
AT1G53050 Protein kinase superfamily protein;(source:Araport11)
AT1G53060 Legume lectin family protein;(source:Araport11)
AT1G53070 Legume lectin family protein;(source:Araport11)
AT1G53090 Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA4 (and SPA3) predominantly regulates elongation growth in adult plants.
AT1G53130 Encodes GRIM REAPER (GRI), involved in the regulation of cell death induced by extracellular ROS (reactive oxygen species). Secreted into the extracellular space.
AT1G53163 membrane-associated kinase regulator;(source:Araport11)
AT1G53170 encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
AT1G53180 hypothetical protein;(source:Araport11)
AT1G53190 Encodes a RING-type E3 ligase that positively regulates CIN-like TCP activity to promote leaf development by mediating the degradation of the TCP repressor TIE1.
AT1G53250 histone-lysine N-methyltransferase, H3 lysine-79 specific-like protein;(source:Araport11)
AT1G53260 hypothetical protein;(source:Araport11)
AT1G53270 ABC-2 type transporter family protein;(source:Araport11)
AT1G53300 Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. The mRNA is cell-to-cell mobile.
AT1G53320 Member of plant TLP family. TLP7 is tethered to the PM but detaches upon stimulus and translocates to the nucleus. Has DNA binding activity but lacks conservation of the transcription activation domain.
AT1G53330 encodes a member of the pentatricopeptide repeat (PPR) gene family. T-DNA insertion mutants had a complex phenotypic expression, ranging from embryo lethal to seedling lethal, to just subtle changes.
AT1G53360 F-box/associated interaction domain protein;(source:Araport11)
AT1G53380 hypothetical protein (DUF641);(source:Araport11)
AT1G53410 pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10)
AT1G53420 Leucine-rich repeat transmembrane protein kinase;(source:Araport11)
AT1G53430 Probable LRR receptor-like ser/thr-protein kinase; Commonly-enriched candidate LPS-interacting PM-associated proteins for both LPS chemotypes subsequent to the polymyxin B affinity chromatography strategy.
AT1G53440 Leucine-rich repeat transmembrane protein kinase;(source:Araport11)
AT1G53470 mechanosensitive channel of small conductance-like 4;(source:Araport11)
AT1G53540 Member of the class I small heat-shock protein (sHSP) family, which accounts for the majority of sHSPs in maturing seeds
AT1G53550 F-box family protein;(source:Araport11)
AT1G53560 Ribosomal protein L18ae family;(source:Araport11)
AT1G53580 Mononuclear Fe(II)-containing member of the b-lactamase fold superfamily. ETHE1 is homodimeric in solution, exhibits low-level esterase activity, and specifically binds a single Fe(II) atom in the active site.
AT1G53590 Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT1G53610 transmembrane protein;(source:Araport11)
AT1G53625 hypothetical protein;(source:Araport11)
AT1G53640 transmembrane protein;(source:Araport11)
AT1G53650 RNA-binding protein, putative, similar to RNA-binding protein GB:AAA86641 GI:1174153 from (Arabidopsis thaliana).Contains PAB2 domain which facilitates binding to PABC proteins.
AT1G53660 Nucleotide/sugar transporter family protein
AT1G53690 Protein of unknown function that is homologous to At5g41010, which encodes a non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB12.
AT1G53700 The WAG1 and its homolog, WAG2 each encodes a protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons.
AT1G53705 putative aminoacyl-tRNA ligase;(source:Araport11)
AT1G53708 ROTUNDIFOLIA like 9;(source:Araport11)
AT1G53760 K+-H+ exchange-like protein;(source:Araport11)
AT1G53820 RING/U-box superfamily protein;(source:Araport11)
AT1G53850 Encodes alpha5 subunit of 20s proteosome involved in protein degradation and RNA degradation.
AT1G53930 Ubiquitin-like superfamily protein;(source:Araport11)
AT1G53970 GDSL esterase/lipase-like protein;(source:Araport11)
AT1G53990 Contains lipase signature motif and GDSL domain. The mRNA is cell-to-cell mobile.
AT1G54000 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT1G54010 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT1G54035 pseudogene of epithiospecifier protein
AT1G54040 Epithiospecifier protein, interacts with WRKY53. Involved in pathogen resistance and leaf senescence.
AT1G54070 Dormancy/auxin associated family protein;(source:Araport11)
AT1G54095 DUF1677 family protein, putative (DUF1677);(source:Araport11)
AT1G54115 Involved in cation (Na and K) homeostasis.
AT1G54130 This gene appears to be at least partially redundant with RSH2 (At3g14050). Guanosine tetraphosphate synthesized by RSH2/RSH3 (and CRSH At3g17470) to an unknown extent can repress chloroplast gene expression, and also reduce chloroplast size. Involved in the maintenance of the (p)ppGp level to accustom plastidial gene expression to darkness.
AT1G54150 Encodes a chloroplast-localized putative RING-type ubiquitin E3 ligase.
AT1G54160 Encodes a member of the CCAAT-binding transcription factor (CBF-B/NF-YA) family. Expression is upregulated in response to ABA and drought. This regulation appears to be mediated by MIR169A which is downregulated in response to drought. NFYA5 is a target of MIR169A. Loss of function mutations are hypersensitive to drought.
AT1G54170 ataxin-2-related, similar to SCA2 (GI:1770390) (Homo sapiens); similar to ataxin-2 (GI:3005020) (Mus musculus). Member of a family of PAM2 motif containing proteins.
AT1G54200 DNA mismatch repair Msh6-like protein;(source:Araport11)
AT1G54220 Encodes a subunit of the mitochondrial pyruvate dehydrogenase complex.
AT1G54230 Winged helix-turn-helix transcription repressor DNA-binding protein;(source:Araport11)
AT1G54350 ABC transporter family protein;(source:Araport11)
AT1G54410 Encodes a KS-type dehydrin can reduce the formation of reactive oxygen species (ROS) from Cu.
AT1G54445 Encodes a defensin-like (DEFL) family protein.
AT1G54490 Involved in the ethylene response. XRN4 does not appear to regulate ethylene signaling via an RNA-INDUCED SILENCING COMPLEX-based RNA silencing mechanism but acts by independent means. Endogenous suppressor of posttranscriptional gene silencing. The mRNA is cell-to-cell mobile.
AT1G54510 Encodes AtNEK1, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.
AT1G54560 Encodes a class XI myosin that is involved in organelle motility, actin organization, and optimal growth of pollen tubes.
AT1G54600 pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT1G54640 F-box family protein-like protein;(source:Araport11)
AT1G54740 FANTASTIC four-like protein (DUF3049);(source:Araport11)
AT1G54790 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT1G54850 HSP20-like chaperones superfamily protein;(source:Araport11)
AT1G54890 Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11)
AT1G54940 Encodes a xylan glucuronosyltransferase.
AT1G54980 Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT1G55010 Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2.
AT1G55020 lipoxygenase, a defense gene conferring resistance Xanthomonas campestris The mRNA is cell-to-cell mobile.
AT1G55030 RNI-like superfamily protein;(source:Araport11)
AT1G55035 pseudogene of importin alpha isoform 1;(source:Araport11)
AT1G55050 hypothetical protein;(source:Araport11)
AT1G55070 F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G55120 Encodes a protein with fructan exohydrolase (FEH) activity acting on levan-type fructans (6-FEH, levanase). The enzyme does not have invertase activity.
AT1G55130 Encodes an Arabidopsis Transmembrane nine (TMN) protein. Transmembrane nine (TM9) proteins are localized in the secretory pathway of eukaryotic cells and are involved in cell adhesion and phagocytosis.
AT1G55160 WAS/WASL-interacting family protein;(source:Araport11)
AT1G55175 hypothetical protein;(source:Araport11)
AT1G55180 member of C2-PLD. subfamily Represents a phospholipase D (PLD) gene with four exons, hence it is a member of the alpha class. Its amino acid sequence is quite different from other PLDs, therefore it might possess unique structural and/or catalytic properties.
AT1G55190 PRA1 (Prenylated rab acceptor) family protein;(source:Araport11)
AT1G55205 hypothetical protein;(source:Araport11)
AT1G55210 Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11)
AT1G55240 proteinase inhibitor I4, serpin (DUF716);(source:Araport11)
AT1G55265 DUF538 family protein, putative (Protein of unknown function, DUF538);(source:Araport11)
AT1G55270 SAGL1 is a member of a small family of KELCH domain containing proteins. Loss of function mutants show increased lignin and anthocyanin production suggesting a role in regulation of phenylpropanoid biosynthesis.
AT1G55330 Encodes a putative arabinogalactan-protein (AGP21).
AT1G55340 hypothetical protein (DUF1639);(source:Araport11)
AT1G55350 Similar to maize DEK1, a gene encoding a membrane protein of the calpain gene superfamily required for aleurone cell development in the endosperm of maize grains. A key component of the embryonic L1 cell-layer specification pathway. It localizes to membranes and undergoes intramolecular autolytic cleavage events that release the calpain domain into the cytoplasm.
AT1G55365 hypothetical protein;(source:Araport11)
AT1G55370 NDH-dependent cyclic electron flow 5;(source:Araport11)
AT1G55430 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G55510 branched-chain alpha-keto acid decarboxylase E1 beta
AT1G55530 RING/U-box superfamily protein;(source:Araport11)
AT1G55550 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT1G55560 SKU5 similar 14;(source:Araport11)
AT1G55570 SKU5 similar 12;(source:Araport11)
AT1G55580 Encodes a member of the GRAS family of putative transcriptional regulators. It is involved in the initiation of axillary meristems during both the vegetative and reproductive growth phases and functions upstream of REV and AXR1 in the regulation of shoot branching.
AT1G55600 member of WRKY Transcription Factor; Group I. It has WRKY domain at its N terminal end and zinc-finger like motif.
AT1G55610 mutant has Altered vascular cell differentiation; LRR Receptor Kinase
AT1G55660 FOF2, is the F-box protein family. Overexpression of FOF2 results in delayed transitions to flowering under both LD and SD conditions.FOF2 expression is induced by ABA during seed germination where it acts through ABI3 and ABI5 to modulate germination.
AT1G55670 Encodes subunit G of photosystem I, an 11-kDa membrane protein that plays an important role in electron transport between plastocyanin and PSI and is involved in the stability of the PSI complex. PSI-G subunit is bound to PSI-B and is in contact with Lhca1. The protein inserts into thylakoids by a direct or "spontaneous" pathway that does not involve the activities of any known chloroplast protein-targeting machinery. PSI-G appears to be directly or indirectly involved in the interaction between Photosystem I and plastocyanin.
AT1G55690 Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT1G55700 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G55720 member of Low affinity calcium antiporter CAX2 family
AT1G55730 member of Low affinity calcium antiporter CAX2 family
AT1G55740 seed imbibition 1;(source:Araport11)
AT1G55760 Expression induced under NaCl, mannitol, ABA and indole-3-acetic acid (IAA) treatment.
AT1G55770 Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT1G55830 coiled-coil protein;(source:Araport11)
AT1G55850 encodes a protein similar to cellulose synthase The mRNA is cell-to-cell mobile.
AT1G55880 Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11)
AT1G55900 component of a translocase in the mitochondrial inner membrane
AT1G55920 Encodes a chloroplast/cytosol localized serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. The mRNA is cell-to-cell mobile.
AT1G55940 cytochrome P450 family protein;(source:Araport11)
AT1G56020 serine/arginine repetitive matrix-like protein;(source:Araport11)
AT1G56030 RING/U-box protein;(source:Araport11)
AT1G56040 HEAT/U-box protein;(source:Araport11)
AT1G56060 CYSTM3 is a mitochondrial protein that is induced by salt stress and is a negative regulator of salt stress.
AT1G56080 NAI1 interacting protein, involved in ER body formation.
AT1G56090 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G56150 SAUR-like auxin-responsive protein family;(source:Araport11)
AT1G56220 Dormancy/auxin associated family protein;(source:Araport11)
AT1G56230 enolase (DUF1399);(source:Araport11)
AT1G56242 Natural antisense transcript overlaps with AT1G56240;(source:Araport11)
AT1G56250 Encodes an F-box protein that can functionally replace VirF, regulating levels of the VirE2 and VIP1 proteins via a VBF-containing SCF complex. It is thought to be involved in DNA integration and T-DNA degradation.
AT1G56260 Required for the maintenance of stem cells through a reduction in DNA damage.
AT1G56290 CwfJ-like family protein;(source:Araport11)
AT1G56300 Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT1G56310 DEDDy-type 3′ -> 5′ exoribonuclease involved in miRNA degradation.
AT1G56400 F-box family protein;(source:Araport11)
AT1G56410 encodes a heat shock protein whose gene expression is induced by heat and dehydration.
AT1G56430 Encodes a protein with nicotianamine synthase activity.
AT1G56500 Encodes a thylakoid membrane protein with thioredoxin-like and beta-propeller domains located in the lumen and a haloacid-dehalogenase domain exposed to the chloroplast stroma. The protein's role may be to prevent formation of a slowly reversible form of antenna quenching, thereby maintaining the efficiency of light harvesting. The mRNA is cell-to-cell mobile.
AT1G56520 Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT1G56540 Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT1G56560 A/N-InvA is a neutral invertase that breaks sucrose down into fructose and glucose. It is member of the larger family of alkaline/neutral invertases (GH100). GFP-tagged A/N-InvA localizes to the mitochondria. atinva mutants have reduced root growth, reduced invertase activity, and increased expression of antioxidant genes under basal conditions. The levels of A/N-InvA transcripts rise in response to a hydrogen peroxide treatment.
AT1G56580 Encodes SMALLER WITH VARIABLE BRANCHES (SVB), a protein with a conserved domain of unknown function (DUF538). The trichomes of the SVB mutants are smaller and exhibit branches of variable length and number. ABA responsive trichome formation regulator.
AT1G56590 Involved in vesicle trafficking between the trans -Golgi network and vacuoles.
AT1G56612 Natural antisense transcript overlaps with AT1G56610;(source:Araport11)
AT1G56650 Encodes a putative MYB domain containing transcription factor involved in anthocyanin metabolism and radical scavenging. Essential for the sucrose-mediated expression of the dihydroflavonol reductase gene. Auxin and ethylene responsiveness of PAP1 transcription is lost in myb12 mutants. Interacts with JAZ proteins to regulate anthocyanin accumulation.
AT1G56670 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT1G56710 Pectin lyase-like superfamily protein;(source:Araport11)
AT1G57550 Low temperature and salt responsive protein family;(source:Araport11)
AT1G57560 Member of the R2R3 factor gene family.
AT1G57565 SWI-SNF-related chromatin binding protein;(source:Araport11)
AT1G57580 F-box family protein;(source:Araport11)
AT1G57590 Pectinacetylesterase family protein;(source:Araport11)
AT1G57650 ATP binding protein;(source:Araport11)
AT1G57660 Translation protein SH3-like family protein;(source:Araport11)
AT1G57670 Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11)
AT1G57690 F-box/RNI-like superfamily protein;(source:Araport11)
AT1G57720 Translation elongation factor EF1B, gamma chain;(source:Araport11)
AT1G57750 Encodes a CYP96A15, midchain alkane hydroxylase, involved in cuticular wax biosynthesis.
AT1G57777 Encodes a ECA1 gametogenesis related family protein
AT1G57790 F-box family protein;(source:Araport11)
AT1G57810 transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 29%25 identity and 1.1e-12 P-value to GP|21952510|gb|AAM82604.1|AF525305_2|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10)
AT1G57820 Encodes a 645-amino acid methylcytosine-binding protein with a PHD domain, two RING finger domains, and an SRA domain that is involved in centromere heterochromatinization. This protein functions as an E3 ubiquitin ligase in vitro. The protein has been shown to bind to methylated cytosines of CG, CNG and CNN motifs via its SRA domain but has a preference for the former. It plays a role in the establishment/maintenance of chromatin structure during cell division and is localized in the nucleus. Plants over-expressing VIM1/ORTH2 show an inhibition in root growth and a delay in flowering. Both over-expression of GFP:ORTH2 and loss of ORTH2/VIM1 lead to decreased levels of DNA methylation. GFP:ORTH2 over-expressers also have increased levels of FWA transcripts.
AT1G57840 pseudogene of Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT1G57850 Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11)
AT1G57870 shaggy-like kinase 42;(source:Araport11)
AT1G57990 Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.
AT1G58040 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-28 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT1G58050 RNA helicase family protein;(source:Araport11)
AT1G58070 WALLIN is an actin binding protein involved in ROP11 mediated xylem pit patterning.
AT1G58090 F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G58120 hypothetical protein;(source:Araport11)
AT1G58130 pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT1G58150 phosphoglycerate kinase;(source:Araport11)
AT1G58190 receptor like protein 9;(source:Araport11)
AT1G58200 A member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity.
AT1G58210 Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It colocalizes with filamentous actin and is localized to the plasma membrane.
AT1G58220 Plays an essential role in organ development by regulating cell expansion either directly by affecting cell wall architecture and/or cytoplasmic growth or indirectly through the ethylene and/or ABA signaling pathways.DRMY1 is Involved in regulating floral organ development, especially ensuring organ size robustness (PMID:32451448).
AT1G58230 binding protein;(source:Araport11)
AT1G58235 hypothetical protein;(source:Araport11)
AT1G58245 Encodes a Plant thionin family protein
AT1G58265 Cytochrome P450 superfamily protein;(source:Araport11)
AT1G58270 ZW9 mRNA, complete cds The mRNA is cell-to-cell mobile.
AT1G58280 Phosphoglycerate mutase family protein;(source:Araport11)
AT1G58290 Encodes a protein with glutamyl-tRNA reductase (GluTR) activity, catalyzing the NADPH-dependent reduction of Glu-tRNA(Glu) to glutamate 1-semialdehyde (GSA) with the release of free tRNA(Glu). It is involved in the early steps of chlorophyll biosynthesis.
AT1G58300 Encodes a member (HO4) of the heme oxygenase family.
AT1G58330 transcription factor-like protein;(source:Araport11)
AT1G58340 Encodes a plant MATE (multidrug and toxic compound extrusion) transporter that is localized to the Golgi complex and small organelles and is involved in determining the rate of organ initiation. It is also involved in iron homeostasis when plants are under osmotic stress.
AT1G58350 Putative serine esterase family protein;(source:Araport11)
AT1G58360 Encodes AAP1 (amino acid permease 1), a neutral amino acid transporter expressed in seeds. Functions in amino acid uptake into embryos. The transporter also functions in acquisition of glutamate and neutral amino acids by the root.
AT1G58370 Encodes a protein with xylanase activity.
AT1G58380 Ribosomal protein S5 family protein;(source:Araport11)
AT1G58470 Encodes an mRNA-binding protein that contains two RNA recognition motifs (RRMs) and is expressed in proliferating tissues. Preferentially binds UUAGG, GUAGG and/or UUAGU. Loss of function of RBP1 causes decreased root length.
AT1G58561 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.8e-219 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10)
AT1G58602 LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11)
AT1G59453 B-block-binding subunit of TFIIIC protein;(source:Araport11)
AT1G59500 encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro.
AT1G59520 Encodes CW7.
AT1G59530 basic leucine-zipper 4;(source:Araport11)
AT1G59550 This locus is annotated as a protein-coding gene in TAIR10. Based on communication with Jean-Luc GALLOIS (April 2013), this gene is re-annotated as a UBX domain-containing pseudogene. Note that the Map Detail Image on the locus detial page and in GBrowse will not be updated until after the next genome release.
AT1G59620 Encodes CW9.
AT1G59650 Encodes CW14.
AT1G59660 Encodes a protein with similarity to mammalian nucleoporin Nup98.Its expression is upregulated in mutants that are NUP deficient. Nucleoportin which redundantly inhibits flowering together with Nup98a through multiple pathways including clock, photoperiod, and age pathways. Gates flowering in a CONSTANS (CO)-independent mode and bypasses the CO checkpoint in photoperiodic signaling and integrated signals from multiple pathways to directly target FLOWERING LOCUS T (FT) for flowering control.
AT1G59675 F-box family protein;(source:Araport11)
AT1G59720 Pentatricopeptide Repeat Protein containing the DYW motif. Required for editing of multiple plastid transcripts. Endonuclease activity.
AT1G59722 hypothetical protein;(source:Araport11)
AT1G59725 DNAJ heat shock family protein;(source:Araport11)
AT1G59740 Major facilitator superfamily protein;(source:Araport11)
AT1G59750 Encodes a member of the auxin response factor family. ARFs bind to the cis element 5'-TGTCTC-3' ARFs mediate changes in gene expression in response to auxin. ARF's form heterodimers with IAA/AUX genes. ARF1 enhances mutant phenotypes of ARF2 and may act with ARF2 to control aspects of maturation and senescence.ARF1:LUC and 3xHA:ARF1 proteins have a half-life of ~3-4 hours and their degradation is reduced by proteasome inhibitors. 3xHA:ARF1 degradation is not affected by a pre-treatment with IAA. A nuclear-targeted fusion protein containing the middle region of ARF1 linked to LUC:NLS has a similar half-life to the full-length ARF1:LUC construct. The degradation of 3xHA:ARF1 is not affected in an axr6-3 mutant grown at room temperature, although the degradation of AXR2/IAA7 is slowed under these conditions.
AT1G59760 Encodes MTR4, a putative RNA helicase and exosome co-factor. Required for proper rRNA biogenesis and development.
AT1G59790 Cullin family protein;(source:Araport11)
AT1G59810 AGL50 MADS box gene.
AT1G59860 HSP20-like chaperones superfamily protein;(source:Araport11)
AT1G59870 ATP binding cassette transporter. Localized to the plasma membrane in uninfected cells. In infected leaves, the protein concentrated at infection sites. Contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration in a salicylic acid?dependent manner. Required for mlo resistance. Has Cd transporter activity (Cd2+ extrusion pump) and contributes to heavy metal resistance. The mRNA is cell-to-cell mobile.
AT1G59880 pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10)
AT1G59920 MADS-box family protein;(source:Araport11)
AT1G59940 Type A response regulator highly similar to bacterial two-component response regulators. Rapidly induced by cytokinin. Involved in red-light signaling. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner.
AT1G59980 ARG1-like 2;(source:Araport11)
AT1G60010 PADRE protein down-regulated after infection by S. sclerotiorun.
AT1G60030 nucleobase-ascorbate transporter 7;(source:Araport11)
AT1G60050 nodulin MtN21-like transporter family protein
AT1G60060 Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11)
AT1G60080 3-5-exoribonuclease family protein;(source:Araport11)
AT1G60095 Mannose-binding lectin superfamily protein;(source:Araport11)
AT1G60110 Mannose-binding lectin superfamily protein;(source:Araport11)
AT1G60120 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.3e-38 P-value blast match to GB:226407 retrotransposon del1-46 (Gypsy_Ty3-element) (Lilium henryi);(source:TAIR10)
AT1G60160 Member of the KT/KUP/HAK family of proton-coupled potassium transporters which have potential effect on cellular expansion.
AT1G60190 Encodes PUB19, a plant U-box armadillo repeat protein. Involved in salt inhibition of germination together with PUB18. The mRNA is cell-to-cell mobile.
AT1G60200 RBM25 is an alternative splicing factor involved in mediation of abiotic stress response and ABA response. Its expression is modulated by a variety of stressors and it in turn appears to affect the ratio of splice variants of stress responsive genes such as HAB1.2/HAB1.1.
AT1G60240 NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11)
AT1G60250 B-box zinc finger family protein;(source:Araport11)
AT1G60260 beta glucosidase 5;(source:Araport11)
AT1G60270 beta glucosidase 6;(source:Araport11)
AT1G60280 NAC domain containing protein 23;(source:Araport11)
AT1G60300 NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11)
AT1G60320 Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11)
AT1G60330 pseudogene of Chalcone-flavanone isomerase family protein;(source:Araport11)
AT1G60340 NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11)
AT1G60350 NAC domain containing protein 24;(source:Araport11)
AT1G60360 RING/U-box superfamily protein;(source:Araport11)
AT1G60390 polygalacturonase 1;(source:Araport11)
AT1G60410 A paternally expressed imprinted gene.
AT1G60420 Reduce transmission through pollen. The mRNA is cell-to-cell mobile.
AT1G60470 Predicted to encode a galactinol synthase.
AT1G60490 Encodes a phosphatidylinositol 3-kinase that is expressed in most plant tissues. Defects in VPS34 affect a number of cellular processes. Loss of function mutations are not transmitted through the male gametophyte due to defects in microgametogenesis therefore it is difficult to assess the effects of loss of VPS34 function in the whole plant. Involved in salt-stress responses.
AT1G60500 Dynamin related protein 4C;(source:Araport11)
AT1G60510 pseudogene of Dynamin related protein 4C;(source:Araport11)
AT1G60520 pseudogene of Dynamin related protein 4A;(source:Araport11)
AT1G60530 Dynamin related protein 4A;(source:Araport11)
AT1G60560 SWIM zinc finger family protein;(source:Araport11)
AT1G60590 Pectin lyase-like superfamily protein;(source:Araport11)
AT1G60600 Encodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport.
AT1G60625 Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide.
AT1G60640 stress response protein;(source:Araport11)
AT1G60660 member of Cytochromes b5
AT1G60680 NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11)
AT1G60700 SMAD/FHA domain-containing protein;(source:Araport11)
AT1G60750 NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11)
AT1G60783 cyclin-dependent kinase inhibitor SMR2-like protein;(source:Araport11)
AT1G60800 Encodes one of a group of LRR-RLKs, designated as CLAVATA3 INSENSITIVE RECEPTOR KINASES (CIKs), that act as co-receptors and have essential roles in regulating CLV3-mediated stem cell homeostasis.
AT1G60850 DNA-directed RNA polymerase family protein;(source:Araport11)
AT1G60980 gibberellin 20-oxidase 4;(source:Araport11)
AT1G60985 Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein).
AT1G60989 Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein).
AT1G60990 Encodes a chloroplast-localized COG0354 protein that requires folate for its function in Fe/S cluster biogenesis.
AT1G61050 alpha 1,4-glycosyltransferase family protein;(source:Araport11)
AT1G61060 F-box family protein;(source:Araport11)
AT1G61070 Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2.
AT1G61090 hypothetical protein;(source:Araport11)
AT1G61095 hypothetical protein;(source:Araport11)
AT1G61130 serine carboxypeptidase-like 32;(source:Araport11)
AT1G61160 retrotransposon gag;(source:Araport11)
AT1G61170 hypothetical protein;(source:Araport11)
AT1G61215 Bromodomain protein with a DNA binding motif
AT1G61260 cotton fiber (DUF761);(source:Araport11)
AT1G61270 Involved in transport of 1-Aminocyclopropane-1-carboxylic acid (ACC).
AT1G61290 member of SYP12 Gene Family
AT1G61330 FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11)
AT1G61350 ARM repeat superfamily protein;(source:Araport11)
AT1G61360 S-locus lectin protein kinase family protein;(source:Araport11)
AT1G61390 S-locus lectin protein kinase family protein;(source:Araport11)
AT1G61400 S-locus lectin protein kinase family protein;(source:Araport11)
AT1G61420 S-locus lectin protein kinase family protein;(source:Araport11)
AT1G61440 S-locus lectin protein kinase family protein;(source:Araport11)
AT1G61460 G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11)
AT1G61490 S-locus lectin protein kinase family protein;(source:Araport11)
AT1G61500 S-locus lectin protein kinase family protein;(source:Araport11)
AT1G61520 PSI type III chlorophyll a/b-binding protein (Lhca3*1) The mRNA is cell-to-cell mobile.
AT1G61560 A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in roots and lateral root primordia, in flower and fruit abscission zone, in vascular system of cotyledons, young leaves and petals, in mature rosette leaves, in anthers, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s).
AT1G61563 Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide.
AT1G61575 Serine/Threonine kinase;(source:Araport11)
AT1G61600 DUF1262 family protein (DUF1262);(source:Araport11)
AT1G61610 S-locus lectin protein kinase family protein;(source:Araport11)
AT1G61660 Encodes a transcriptional activator that regulates the expression of genes by binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. Governs the competence of pericycle cells to initiate lateral root primordium formation.
AT1G61667 serine protease, putative (Protein of unknown function, DUF538);(source:Araport11)
AT1G61710 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G61730 DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11)
AT1G61732 Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCUAAGUCUUCUAUUGAUGUU
AT1G61740 Sulfite exporter TauE/SafE family protein;(source:Araport11)
AT1G61770 J domain protein. The mRNA is cell-to-cell mobile.
AT1G61795 PAK-box/P21-Rho-binding family protein;(source:Araport11)
AT1G61810 beta-glucosidase 45;(source:Araport11)
AT1G61820 beta glucosidase 46;(source:Araport11)
AT1G61830 pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G61850 Encodes a non-specific lipase that hydrolyzes phospholipids as well as galactolipids, at both sn-1 and sn-2 positions. Involved in basal jasmonic acid biosynthesis by releasing the precursor fatty acid from membrane lipids. Mutant plants were impacted in resistance to fungus B. cinerea.
AT1G61860 Protein kinase superfamily protein;(source:Araport11)
AT1G61880 pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10)
AT1G61890 MATE efflux family protein;(source:Araport11)
AT1G61940 Member of TLP family
AT1G61950 member of Calcium Dependent Protein Kinase
AT1G61960 Mitochondrial transcription termination factor family protein;(source:Araport11)
AT1G61980 Mitochondrial transcription termination factor family protein;(source:Araport11)
AT1G62035 Encodes a microRNA that targets several SCL family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGAGCCGUGCCAAUAUCACG. Pri-mRNA coordinates for MIR171c (converted to TAIR10 based on PMID19304749): Chr1: 22930427-22929567 (reverse), length: 861 bp; exon coordinates: exon 1: 22930427 to 22930342, exon 2: 22930233 to 22930047, exon 3: 22929839 to 22929567; mature miRNA and miRNA* are located on exon 1.
AT1G62045 ankyrin repeat protein;(source:Araport11)
AT1G62090 pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G62120 Mitochondrial transcription termination factor family protein;(source:Araport11)
AT1G62160 Serine protease inhibitor (SERPIN) family protein;(source:Araport11)
AT1G62170 Serine protease inhibitor (SERPIN) family protein;(source:Araport11)
AT1G62180 encodes a adenosine 5'-phosphosulfate reductase, involved in sulfate assimilation. Is a major effect locus for natural variation of shoot sulfate content in Arabidopsis.
AT1G62210 hypothetical protein;(source:Araport11)
AT1G62220 transmembrane protein;(source:Araport11)
AT1G62225 transmembrane protein;(source:Araport11)
AT1G62280 Encodes a protein with ten predicted transmembrane helices. The SLAH1 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. Although it is not expressed in guard cells, it can complement a slac1-2 mutant suggesting that it performs a similar function. SLAH1:GFP localizes to the plasma membrane.
AT1G62290 Saposin-like aspartyl protease family protein;(source:Araport11)
AT1G62300 Encodes a transcription factor WRKY6. Regulates Phosphate1 (Pho1) expression in response to low phosphate (Pi) stress.
AT1G62305 Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11)
AT1G62320 ERD (early-responsive to dehydration stress) family protein;(source:Araport11)
AT1G62340 Subtilisin-like serine protease required for epidermal surface formation in embryos and juvenile plants
AT1G62360 Class I knotted-like homeodomain protein that is required for shoot apical meristem (SAM) formation during embryogenesis and for SAM function throughout the lifetime of the plant. Functions by preventing incorporation of cells in the meristem center into differentiating organ primordia. It has also been shown to have a role in the specification of flower meristem identity.
AT1G62370 RING/U-box superfamily protein;(source:Araport11)
AT1G62380 Encodes a protein similar to 1-aminocyclopropane-1-carboxylic oxidase (ACC oxidase). Expression of the AtACO2 transcripts is affected by ethylene.
AT1G62400 Protein kinase involved in regulation of stomatal aperture in response to CO2.
AT1G62420 DUF506 family protein (DUF506);(source:Araport11)
AT1G62430 Encodes a CDP-diacylglycerol synthase, involved in phospholipid biosynthesis.
AT1G62480 Vacuolar calcium-binding protein-like protein;(source:Araport11)
AT1G62520 sulfated surface-like glycoprotein;(source:Araport11)
AT1G62530 hypothetical protein (DUF863);(source:Araport11)
AT1G62540 belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile.
AT1G62550 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to non-LTR retroelement reverse transcriptase-like protein GI:9758853 from (Arabidopsis thaliana);(source:TAIR10)
AT1G62560 belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile.
AT1G62570 belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile.
AT1G62630 Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11)
AT1G62640 3-ketoacyl-acyl carrier protein synthase III (KAS III)
AT1G62650 pseudogene of P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT1G62660 Glycosyl hydrolases family 32 protein;(source:Araport11)
AT1G62680 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT1G62690 hypothetical protein;(source:Araport11)
AT1G62700 Encodes a NAC-domain transcription factor. Expressed in the vascular tissue.
AT1G62710 Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteases that is expressed specifically in seeds and is essential for the proper processing of storage proteins.
AT1G62780 dimethylallyl, adenosine tRNA methylthiotransferase;(source:Araport11)
AT1G62800 Encodes aspartate aminotransferase (Asp4).
AT1G62810 Encodes COPPER AMINE OXIDASE1 (CuAO1). Contributes to abscisic acid- and polyamine-induced nitric oxide biosynthesis and abscisic acid signal transduction.
AT1G62820 Calcium-binding EF-hand family protein;(source:Araport11)
AT1G62835 pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11)
AT1G62840 ankyrin repeat/KH domain protein (DUF1442);(source:Araport11)
AT1G62870 hypothetical protein;(source:Araport11)
AT1G62880 Cornichon family protein;(source:Araport11)
AT1G62940 encodes an acyl-CoA synthetase, has in vitro activity towards medium- to long-chain fatty acids and their hydroxylated derivatives. Expressed in the tapetum. Involved in pollen wall exine formation. Null mutants were devoid of pollen grains at anther maturity and were completely male sterile.
AT1G62950 leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11)
AT1G62970 SDJ3 functions partially redundantly with SDJ1 and SDJ2 and interacts with SUVH1 and SUVH3 to form a SUVH-SDJ complex. The complex binds promoters with DNA methylation and mediates transcriptional activation of promoter methylated genes.
AT1G62981 transmembrane protein, putative (DUF1191);(source:Araport11)
AT1G62990 Encodes a homeodomain transcription factor of the Knotted family. May be involved in secondary cell wall biosynthesis. Mutants have moderately irregular xylem development. Expression of this gene is upregulated by SND1 and MYB46.
AT1G63000 nucleotide-rhamnose synthase/epimerase-reductase;(source:Araport11)
AT1G63030 encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (DDF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. Overexpression of this gene results in the reduction of gibberellic acid biosynthesis. This gene is expressed in all tissues examined, but most abundantly expressed in rosette leaves and stems. Overexpression of DDF1, a putative paralog of this gene, also reduces gibberellic acid biosynthesis and makes the plants more tolerant to high-salinity levels.
AT1G63050 Encodes a lysophosphatidylcholine acyltransferase (LPCAT). Participates in the Lands cycle in developing seeds. Involved in triacylglycerol biosynthesis.
AT1G63060 ribosome biogenesis NEP1-like protein;(source:Araport11)
AT1G63090 phloem protein 2-A11;(source:Araport11)
AT1G63100 Transcription factor belonging to the GRAS family which controls the mitotic cell cycle and division plane orientation.
AT1G63105 hypothetical protein;(source:Araport11)
AT1G63120 AtRBL2 has been identified as a rhomboid protein involved in regulated intramembrane proteolysis (RIP). The enzyme has the proteolytic activity and substrate specificity comparable to the Drosophila Rho-1 protein.
AT1G63170 Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11)
AT1G63180 Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in pollen development.
AT1G63190 Cystatin/monellin superfamily protein;(source:Araport11)
AT1G63200 Cystatin/monellin superfamily protein;(source:Araport11)
AT1G63205 Cystatin/monellin superfamily protein;(source:Araport11)
AT1G63220 Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT1G63295 Remorin family protein;(source:Araport11)
AT1G63310 hypothetical protein;(source:Araport11)
AT1G63340 Flavin-containing monooxygenase family protein;(source:Araport11)
AT1G63350 Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11)
AT1G63440 The Arabidopsis P-type ATPase HMA5 is involved in Cu detoxification. hma5 mutant plants exhibit Cu hypersensitivity, which is especially dramatic in roots where HMA5 is mostly expressed.
AT1G63450 Encodes a xyloglucan-specific galacturonosyltransferase (XUT1) that forms the beta-d-galactosyluronic acid-(1->2)-alpha-d-xylosyl linkage.
AT1G63460 Encodes GPX8 (glutathione peroxidase 8). Involved in the suppression of oxidative damages in nucleus and cytosol. The mRNA is cell-to-cell mobile.
AT1G63480 AT hook motif DNA-binding family protein;(source:Araport11)
AT1G63530 hypothetical protein;(source:Araport11)
AT1G63540 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT1G63570 Receptor-like protein kinase-related family protein;(source:Araport11)
AT1G63600 Receptor-like protein kinase-related family protein;(source:Araport11)
AT1G63630 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G63650 Mutant has reduced trichomes, anthocyanin, and seed coat mucilage and abnormally patterned stomates. Mutants are defective in jasmonate-induced anthocyanin accumulation. Encodes a bHLH Transcription Factor 1. The protein is functionally redundant with GL3 and TT8 and interacts with TTG1, the myb proteins GL1, PAP1 and 2, CPC and TRY, and it will form heterodimers with GL3. Expression in N (non-hair cell forming) cell layers is negatively regulated by WER. Expression in H cells (hair cell forming) is promoted by CPC/TRY.
AT1G63690 SIGNAL PEPTIDE PEPTIDASE-LIKE 2;(source:Araport11)
AT1G63720 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT1G63750 Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT1G63760 pseudogene of RING/U-box superfamily protein;(source:Araport11)
AT1G63800 ubiquitin-conjugating enzyme 5;(source:Araport11)
AT1G63855 Putative methyltransferase family protein;(source:Araport11)
AT1G63860 Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT1G63870 Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT1G63910 member of MYB3R- and R2R3- type MYB- encoding genes
AT1G63950 Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT1G63980 D111/G-patch domain-containing protein;(source:Araport11)
AT1G64020 Serine protease inhibitor (SERPIN) family protein;(source:Araport11)
AT1G64035 pseudogene of serpin 2;(source:Araport11)
AT1G64060 Interacts with AtrbohD gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site.
AT1G64065 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11)
AT1G64070 Encodes a TIR-NBS-LRR class of disease resistance protein effective against Leptosphaeria maculans.
AT1G64090 Reticulan like protein B3;(source:Araport11)
AT1G64100 pentatricopeptide (PPR) repeat-containing protein;(source:Araport11)
AT1G64107 Encodes a defensin-like (DEFL) family protein.
AT1G64110 Target promoter of the male germline-specific transcription factor DUO1.
AT1G64150 Encodes an integral thylakoid membrane protein that is required for normal operation of oxygen-evolving complex (as evidenced by oxygen evolution rates) and for manganese incorporation. PAM71 belongs to a small gene family in Arabidopsis comprising five members. PAM71 is well conserved in the green lineage and shares homology with putative Ca2+/H+ exchangers from yeast (Saccharomyces cerevisiae) (GDT1) and human (Homo sapiens) (TMEM165).
AT1G64160 Encodes a dirigent protein involved in the synthesis of (-)pinoresinol. Dirigent proteins impart stereoselectivity on the phenoxy radical coupling reaction yielding optically active lignans from two molecules of coniferyl alcohol.
AT1G64170 member of Putative Na+/H+ antiporter family
AT1G64180 intracellular protein transport protein USO1-like protein;(source:Araport11)
AT1G64195 Encodes a defensin-like (DEFL) family protein.
AT1G64255 MuDR family transposase;(source:Araport11)
AT1G64290 F-box protein-like protein;(source:Araport11)
AT1G64295 F-box associated ubiquitination effector family protein;(source:Araport11)
AT1G64300 Protein kinase family protein;(source:Araport11)
AT1G64320 myosin heavy chain-like protein;(source:Araport11)
AT1G64330 myosin heavy chain-like protein;(source:Araport11)
AT1G64350 seh1-like protein
AT1G64360 SAQR is a clade specific protein present in single copy in Arabidopsis.It's expression is increased during light induced oxidative stress ,drought stress and also during senescence. Promoter contains two AGL15 binding sites.
AT1G64380 encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.
AT1G64385 transmembrane protein;(source:Araport11)
AT1G64390 glycosyl hydrolase 9C2;(source:Araport11)
AT1G64440 Encodes a protein with UDP-D-glucose 4-epimerase activity. Mutants in RHD1 have abnormally shaped root hairs with a bulbous region at the base. Allelic to REB1 encoding a UDP-D-glucose 4-epimerase involved in cell wall biosynthesis.Involved in growth and cell wall carbohydrate biosynthesis.
AT1G64540 F-box/FBD-like domains containing protein;(source:Araport11)
AT1G64560 pseudogene of S-adenosylmethionine-dependent methyltransferase/rRNA (adenine-N6,N6-)-dimethyltransferase/rRNA methyltransferase
AT1G64570 Homeodomain-like superfamily protein;(source:Araport11)
AT1G64600 copper ion binding / methyltransferase;(source:Araport11)
AT1G64620 Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis.
AT1G64625 Encodes a plant-specific basic helix-loop-helix (bHLH) protein that is required for normal meiotic entry and the establishment of meiotic synchrony. It plays a role in xylem differentiation downstream of auxin.
AT1G64660 Encodes a functional methionine gamma-lyase, a cytosolic enzyme catalyzes the degradation of methionine into methanethiol, alpha-ketobutyrate and ammonia. The catabolism of excess methionine is important to methionine homeostasis. The mRNA is cell-to-cell mobile.
AT1G64680 beta-carotene isomerase D27;(source:Araport11)
AT1G64690 Encodes BRANCHLESS TRICHOME (BLT) involved in trichome development. A large portion of the internal amino acid sequence of BLT is predicted to form a coiled-coil domain. BLT mutants form branchless trichomes with blunt tips.
AT1G64700 PADRE protein up-regulated after infection by S. sclerotiorun.
AT1G64770 encodes a novel subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in cyclic electron flow around photosystem I to produce ATP.
AT1G64780 encodes an ammonium transporter protein believed to act as a high affinity transporter. It is expressed in the root, primarily in endodermal and cortical cells, and contributes to ammonium uptake in the root.
AT1G64830 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT1G64840 LOW protein: F-box/kelch-repeat protein (DUF295);(source:Araport11)
AT1G64860 Subunit of chloroplast RNA polymerase, confers the ability to recognize promoter sequences on the core enzyme
AT1G64880 Ribosomal protein S5 family protein;(source:Araport11)
AT1G64910 UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT1G64950 member of CYP89A The mRNA is cell-to-cell mobile.
AT1G64980 Encodes a putative nucleotide-diphospho-sugar transferase required for pollen germination and tube growth.
AT1G65010 Encodes a microtubule-associated protein. Putative role in flower development. Comparison of SALK_061426C to Columbia wild type in normal lighting and under low light of 33 micromoles per meter-squared per second resulted in a trend toward earlier bolting in the mutant under low light (P=0.055) (Ann Stapleton and Patrick Pridgen, 2009, personal communication).
AT1G65032 COMPLEX 1 LYR-like protein;(source:Araport11)
AT1G65050 TRAF-like superfamily protein;(source:Araport11)
AT1G65060 encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. mRNA levels are not induced in response to wounding or to fungal infection by P. parasitica. mRNA is expressed in flowers, to a lesser degree in mature leaves and siliques and marginally in seedling roots and bolting stems of mature plants. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, ferulic acid, cinnamic acid and 5-OH-ferulic acid. At4CL3 was unable to use sinapic acid as substrate.
AT1G65110 Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11)
AT1G65120 Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11)
AT1G65130 Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11)
AT1G65140 Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11)
AT1G65150 TRAF-like family protein;(source:Araport11)
AT1G65160 ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11)
AT1G65170 Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11)
AT1G65190 Protein kinase superfamily protein;(source:Araport11)
AT1G65230 transmembrane protein, putative (DUF2358);(source:Araport11)
AT1G65240 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT1G65300 Encodes PHERES2, a homolog of PHERES1. PHERES1 and PHERES2 are both target genes of the FIS Polycomb group complex but only PHERES1 is regulated by genomic imprinting, which is likely caused by the presence of repeat sequences in the proximity of the PHERES1 locus.
AT1G65330 Type I MADS-box protein, regulated by MEA and FIE, expressed transiently after fertilization in embryo and endosperm.
AT1G65360 Encodes AGL23, a Type I MADS-box gene that controls female gametophyte development and the biogenesis of organelles during embryo development.
AT1G65365 pseudogene of WALL ASSOCIATED KINASE (WAK)-LIKE 10;(source:Araport11)
AT1G65390 Phloem Protein2 family gene encoding a two-domain protein containing predicted lectin and Toll/Interleukin-1 receptor domains, which is induced upon spider mite attack and improves the ability to defend against T. urticae by participating in the tight regulation of hormonal cross talk upon mite feeding.
AT1G65430 IBR domain-containing protein;(source:Araport11)
AT1G65470 Chromatin Assembly Factor-1 (CAF-1) p150 subunit. Mutants have reduced heterochromatin content. In Arabidopsis, the three CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1, respectively. Mutations in FAS1 or FAS2 lead to increased frequency of homologous recombination and T-DNA integration in Arabidopsis.
AT1G65480 FT, together with LFY, promotes flowering and is antagonistic with its homologous gene, TERMINAL FLOWER1 (TFL1). Together with TSF, it plays an antagonistic role to TFL1 in the determination of inflorescence meristem identity. FT is expressed in leaves and is induced by long day treatment. Either the FT mRNA or protein is translocated to the shoot apex where it induces its own expression. Recent data suggests that FT protein acts as a long-range signal. FT is a target of CO and acts upstream of SOC1.
AT1G65481 transmembrane protein;(source:Araport11)
AT1G65483 hypothetical protein;(source:Araport11)
AT1G65490 Secreted peptide which functions in plant growth and pathogen defense.
AT1G65500 Secreted peptide which functions in plant growth and pathogen defense.
AT1G65560 Zinc-binding dehydrogenase family protein;(source:Araport11)
AT1G65570 Encodes a glycosyl hydrolase 28 (GH28) family polygalacturonase (PG) protein. Involved in root cap development.
AT1G65585 pseudogene of Ribonuclease H-like superfamily protein;(source:Araport11)
AT1G65590 Encodes a protein with beta-hexosaminidase activity. Located on the plasma membrane.
AT1G65610 Six-hairpin glycosidases superfamily protein;(source:Araport11)
AT1G65620 required for formation of a symmetric flat leaf lamina, encodes a member of a family of proteins characterized by cysteine repeats and a leucine zipper; involved in KNOX gene regulation. Acts together with ASL1 in proximal-distal symmetry determination. Forms a complex with AS1 that binds to the BP promoter and leads to silencing of BP.
AT1G65630 Encodes a putative DegP protease.
AT1G65642 pseudogene of F-box family protein
AT1G65670 a member of the cytochrome P450 gene family. molecular function unknown.
AT1G65680 member of BETA-EXPANSINS. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio)
AT1G65690 Encodes NHL6 (NDR1/HIN1-like 6). Plays an important role in the abiotic stresses-induced ABA signaling and biosynthesis, particularly during seed germination and early seedling development.
AT1G65750 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.9e-18 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10)
AT1G65770 Encodes AMR1 (Ascorbic acid Mannose Pathway Regulator 1). Coordinately and negatively regulates the mannose/L-galactose ascorbic acid biosynthetic pathway in response to developmental and environmental cues.
AT1G65800 Encodes a putative receptor-like serine/threonine protein kinases that is similar to brassica self-incompatibility (S) locus. expressed in specifically in cotyledons, leaves, and sepals, in correlation with the maturation of these structures. Together with AtPUB9, it is required for auxin-mediated lateral root development under phosphate-starved conditions. The mRNA is cell-to-cell mobile.
AT1G65810 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT1G65860 belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates
AT1G65875 pseudogene of AMP-dependent synthetase and ligase family protein;(source:Araport11)
AT1G65880 Encodes a benzoate-CoA ligase. Involved in the biosynthesis of benzoyloxyglucosinolate in Arabidopsis seeds.
AT1G65890 acyl activating enzyme 12;(source:Araport11)
AT1G65910 NAC domain containing protein 28;(source:Araport11)
AT1G65920 Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11)
AT1G65970 thioredoxin-dependent peroxidase 2
AT1G65980 thioredoxin-dependent peroxidase
AT1G66010 pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11)
AT1G66030 Encodes a protein with cytochrome P450 domain. Probable psuedogene.
AT1G66060 hypothetical protein (DUF577);(source:Araport11)
AT1G66090 Disease resistance protein (TIR-NBS class);(source:Araport11)
AT1G66110 hypothetical protein (DUF577);(source:Araport11)
AT1G66130 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT1G66140 Encodes a zinc finger protein containing only a single zinc finger.
AT1G66150 Receptor-like transmembrane kinase I (TMK1); key regulator in auxin signaling. High auxin and TMK1 play essential and positive roles in ABA signaling through regulating ABA INSENSITIVE 1 and 2 (ABI1/2). Inhibits the phosphatase activity of ABI2 by direct phosphorylation of threonine 321 (T321), a conserved phosphorylation site in ABI2 proteins, whose phosphorylation status is important for both auxin and ABA responses.
AT1G66160 CYS, MET, PRO, and GLY protein 1;(source:Araport11)
AT1G66190 hypothetical protein;(source:Araport11)
AT1G66200 encodes a cytosolic glutamate synthetase, this enzyme has low affinity with substrate ammonium
AT1G66210 Subtilisin-like serine endopeptidase family protein;(source:Araport11)
AT1G66220 Subtilase family protein;(source:Araport11)
AT1G66230 Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation.
AT1G66250 O-Glycosyl hydrolases family 17 protein;(source:Araport11)
AT1G66280 Glycosyl hydrolase superfamily protein;(source:Araport11)
AT1G66360 Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT1G66400 Encodes a calmodulin-like protein. Regulates nitric oxide levels and transition to flowering.
AT1G66420 DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11)
AT1G66430 Encodes one of the several Arabidopsis fructokinases. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). Important for seed oil accumulation and vascular development.
AT1G66440 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G66450 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G66460 Protein kinase superfamily protein;(source:Araport11)
AT1G66470 ROOT HAIR DEFECTIVE6;(source:Araport11)
AT1G66480 Involved in chloroplast avoidance movement under intermediate and high light intensities; PADRE protein up-regulated after infection by S. sclerotiorun.
AT1G66490 F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G66500 Pre-mRNA cleavage complex II;(source:Araport11)
AT1G66540 Cytochrome P450 superfamily protein;(source:Araport11)
AT1G66600 A member of WRKY Transcription Factor; Group III. Involved in the regulation of plant responses to ABA and drought stress.
AT1G66660 Protein with RING/U-box and TRAF-like domain;(source:Araport11)
AT1G66710 pseudogene of S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT1G66720 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT1G66750 Encodes a CDK-activating kinase that interacts with SPT5, a regulator of transcription and histone methylation.
AT1G66760 MATE efflux family protein;(source:Araport11)
AT1G66780 MATE efflux family protein;(source:Araport11)
AT1G66810 Encodes a tandem CCCH zinc finger (TZF) protein that can bind DNA and RNA, function as a transcriptional activator, and is involved in secondary wall biosynthesis.
AT1G66820 glycine-rich protein;(source:Araport11)
AT1G66830 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G66852 Carbohydrate-binding X8 domain superfamily protein;(source:Araport11)
AT1G66855 Carbohydrate-binding X8 domain superfamily protein;(source:Araport11)
AT1G66860 Class I glutamine amidotransferase-like superfamily protein;(source:Araport11)
AT1G66870 Carbohydrate-binding X8 domain superfamily protein;(source:Araport11)
AT1G66900 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G66920 Protein kinase superfamily protein;(source:Araport11)
AT1G66930 Protein kinase superfamily protein;(source:Araport11)
AT1G66940 kinase-like protein;(source:Araport11)
AT1G66950 Encodes a plasma membrane-localized ABC transporter. Confers tolerance to herbicide paraquat.
AT1G66960 Terpenoid cyclases family protein;(source:Araport11)
AT1G66970 Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family.
AT1G66990 pseudogene of suppressor of npr1-1 constitutive 4;(source:Araport11)
AT1G67000 Protein kinase superfamily protein;(source:Araport11)
AT1G67010 pseudogene of Protein kinase superfamily protein;(source:Araport11)
AT1G67020 transmembrane protein;(source:Araport11)
AT1G67025 wall-associated receptor kinase carboxy-terminal protein;(source:Araport11)
AT1G67050 membrane-associated kinase regulator;(source:Araport11)
AT1G67070 Encodes a protein with phosphomannose isomerase activity that is involved in synthesis of ascorbic acid. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell.
AT1G67090 Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Functions to yield sufficient Rubisco content for leaf photosynthetic capacity.
AT1G67105 other_RNA;(source:Araport11)
AT1G67110 cytochrome P450, family 735, subfamily A, polypeptide 2;(source:Araport11)
AT1G67120 Represents a homolog of the yeast MDN gene, which encodes a non-ribosomal protein involved in the maturation and assembly of the 60S ribosomal subunit. In Arabidopsis, it is essential for female gametogenesis progression.
AT1G67130 F-box family protein;(source:Araport11)
AT1G67150 transmembrane protein, putative (DUF247);(source:Araport11)
AT1G67170 Coiled coil domain protein required for phase separation of FCA.
AT1G67190 F-box/RNI-like superfamily protein;(source:Araport11)
AT1G67220 histone acetyltransferase of the CBP family 2;(source:Araport11)
AT1G67230 Encodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5.
AT1G67238 other_RNA;(source:Araport11)
AT1G67240 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.5e-23 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10)
AT1G67250 Proteasome maturation factor UMP1;(source:Araport11)
AT1G67260 Encodes protein with TCP (TB1,CYC,PCF) domain which is likely to be involved in DNA binding and protein-protein interactions. Based on genome analysis, there is a 9-member gene family that possesses this domain in Arabidopsis. Orthologue of Antirrhinum gene CYCLOIDEA.
AT1G67270 Zinc-finger domain of monoamine-oxidase A repressor R1 protein;(source:Araport11)
AT1G67300 Major facilitator superfamily protein;(source:Araport11)
AT1G67310 Calmodulin-binding transcription activator protein with CG-1 and Ankyrin domain;(source:Araport11)
AT1G67328 Natural antisense transcript overlaps with AT1G67330;(source:Araport11)
AT1G67340 HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11)
AT1G67390 F-box family protein;(source:Araport11)
AT1G67400 ELMO/CED-12 family protein;(source:Araport11)
AT1G67410 Exostosin family protein;(source:Araport11)
AT1G67470 Protein kinase superfamily protein;(source:Araport11)
AT1G67500 Encodes the catalytic subunit of DNA polymerase zeta.Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS).
AT1G67510 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G67520 lectin protein kinase family protein;(source:Araport11)
AT1G67530 ARM repeat superfamily protein;(source:Araport11)
AT1G67560 PLAT/LH2 domain-containing lipoxygenase family protein;(source:Araport11)
AT1G67635 phosphatidylinositol 4-kinase gamma-like protein;(source:Araport11)
AT1G67645 pseudogene of F-box protein (DUF295);(source:Araport11)
AT1G67650 SRP72 RNA-binding domain-containing protein;(source:Araport11)
AT1G67660 Restriction endonuclease, type II-like superfamily protein;(source:Araport11)
AT1G67700 multidrug resistance protein;(source:Araport11)
AT1G67710 Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Affects ABA-JA crosstalk.
AT1G67720 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G67740 PsbY precursor (psbY) mRNA. This single nuclear gene is imported into the chloroplasts where it is processed into two integral membrane proteins with identical topology (PsbY-1 and PsbY-2). The protein appears to bind manganese. Important for the redox control of cytochrome b559.
AT1G67800 Copine (Calcium-dependent phospholipid-binding protein) family;(source:Araport11)
AT1G67820 Protein phosphatase 2C family protein;(source:Araport11)
AT1G67830 Encodes a protein with α-fucosidase activity. The activity was assessed on 2'-fucosyl-lactitol. AtFXG1 was able to remove the t-fucosyl residues of XXFG xyloglucan oligosaccharides.
AT1G67855 hypothetical protein;(source:Araport11)
AT1G67865 hypothetical protein;(source:Araport11)
AT1G67900 Phototropic-responsive NPH3 family protein;(source:Araport11)
AT1G67910 hypothetical protein;(source:Araport11)
AT1G67970 member of Heat Stress Transcription Factor (Hsf) family
AT1G67990 Encodes a tapetum-specific O-methyltransferase. In vitro enzyme assay indicated activity with caffeoyl-CoA, caffeoyl glucose, chlorogenic acid and polyamine conjugates. RNAi mutants had impaired silique development and seed setting.
AT1G68050 Encodes FKF1, a flavin-binding kelch repeat F box protein, is clock-controlled, regulates transition to flowering. Forms a complex with GI on the CO promoter to regulate CO expression.
AT1G68060 Encodes a microtubule associated protein (MAP70-1). Expressed in all tissues.
AT1G68090 Encodes a calcium-binding protein annexin (AnnAt5). Plays a vital role in pollen development via Ca2+ dependent membrane trafficking.
AT1G68110 An ENTH (Epsin NH2 terminal homology)/ANTH/VHS superfamily protein with adenylate cyclase activity and a role in clathrin assembly and endocytosis.
AT1G68140 zinc finger/BTB domain protein, putative (DUF1644);(source:Araport11)
AT1G68150 member of WRKY Transcription Factor; Group II-b The mRNA is cell-to-cell mobile.
AT1G68190 B-box zinc finger family protein;(source:Araport11)
AT1G68200 Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11)
AT1G68220 aerobic coproporphyrinogen-III oxidase (DUF1218);(source:Araport11)
AT1G68230 Reticulon family protein;(source:Araport11)
AT1G68240 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT1G68250 hypothetical protein;(source:Araport11)
AT1G68320 putative transcription factor: R2R3-MYB transcription family. Involved in regulation of phosphate starvation responses and gibberellic acid biosynthesis.
AT1G68330 membrane-associated kinase regulator;(source:Araport11)
AT1G68350 cotton fiber protein;(source:Araport11)
AT1G68370 DnaJ-like protein with homology to coiled coils found in cytoskeleton-interacting proteins.
AT1G68390 Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11)
AT1G68400 leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11)
AT1G68420 Class II aaRS and biotin synthetases superfamily protein;(source:Araport11)
AT1G68440 Transmembrane protein;(source:Araport11). Expression induced by abiotic stressors such as ABA, drought, heat, light, NaCl, osmotic stress and wounding.
AT1G68450 VQ motif-containing protein;(source:Araport11)
AT1G68460 Encodes a putative adenylate isopentenyltransferase. It catalyzes the formation of isopentenyladenosine 5'-monophosphate (iPMP) from AMP and dimethylallylpyrophosphate (DMAPP), but it has a lower Km for ADP and likely works using ADP or ATP in plants. It is involved in cytokinin biosynthesis.
AT1G68470 Exostosin family protein;(source:Araport11)
AT1G68480 Encodes a putative zinc finger transcription factor that is necessary for proper lateral organ shape and is sufficient to induce the proliferation of lateral organ tissue. Together with NUB, it is involved in stamen and carpel development.
AT1G68490 translocase subunit seca;(source:Araport11)
AT1G68500 hypothetical protein;(source:Araport11)
AT1G68530 Encodes KCS6, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids).
AT1G68620 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G68630 PLAC8 family protein;(source:Araport11)
AT1G68660 ClpS1 is a member of the caseionolytic proteinase S family of N-recognins. It is involved in proteolysis in the chloroplast stroma. An arginine residue (Arg50) controls low-affinity substrate binding.
AT1G68690 Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807).
AT1G68710 ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11)
AT1G68720 Encodes the chloroplastic A-to-I tRNA editing enzyme.
AT1G68730 Zim17-type zinc finger protein;(source:Araport11)
AT1G68735 Encodes a defensin-like (DEFL) family protein.
AT1G68740 Encodes PHO1;H1, a member of the PHO1 family. Involved in inorganic phosphate (Pi) transport and homeostasis. Complements pho1 mutation. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots.
AT1G68750 Encodes one of four Arabidopsis phosphoenolpyruvate (PEP) carboxylase proteins. But, it is more similar to bacterial PEP carboxylase than plant PEP carboxylase. Efforts to express this enzyme and to demonstrate its enzymatic activity in E.coli failed.
AT1G68765 Encodes a small protein of 77 amino acids. Loss of function mutations are defective in the process of ethylene independent floral organ abscission. Although the mutants have a normal appearing abscission zone, the floral organs do not abscisce. The peptide appears to be secreted and may function as a ligand. Arabidopsis 35S:IDA lines constitutively overexpressing IDA exhibit earlier abscission of floral organs, showing that the abscission zones are responsive to IDA soon after the opening of the flowers. In addition, ectopic abscission was observed at the bases of the pedicel, branches of the inflorescence, and cauline leaves. The silique valves also dehisced prematurely.
AT1G68780 RNI-like superfamily protein;(source:Araport11)
AT1G68790 Member of small gene family in Arabidopsis containing 4 members (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5.
AT1G68795 Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon.
AT1G68800 Encodes a TCP transcription factor, closely related to teosinte branched1, arrests axillary bud development and prevents axillary bud outgrowth. Transcription level and mutant phenotype are weaker than its homolog BRC1 (At3G18550).
AT1G68810 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT1G68825 ROTUNDIFOLIA like 15;(source:Araport11)
AT1G68840 Rav2 is part of a complex that has been named `regulator of the (H+)-ATPase of the vacuolar and endosomal membranes' (RAVE) The mRNA is cell-to-cell mobile.
AT1G68845 hypothetical protein;(source:Araport11)
AT1G68850 Peroxidase superfamily protein;(source:Araport11)
AT1G68880 basic leucine-zipper 8;(source:Araport11)
AT1G68910 Encodes one of the WPP domain-interacting proteins (WIT1/AT5G11390, WIT2/AT1G68910) required for RanGAP nuclear envelope association in root tip cells. Ran GTPase plays essential roles in multiple cellular processes, including nucleocytoplasmic transport, spindle formation, and postmitotic nuclear envelope reassembly. The cytoplasmic Ran GTPase activating protein RanGAP is critical to establish a functional RanGTP/RanGDP gradient across the nuclear envelope and is associated with the outer surface of the nuclear envelope in metazoan and higher plant cells. Arabidopsis thaliana RanGAP association with the root tip nuclear envelope requires a family of likely plant-specific nucleoporins combining coiled-coil and transmembrane domains (CC-TMD) and WPP domain-interacting proteins (WIPs). WIT1 and WIT2 have been identified as a second family of CC-TMD proteins, structurally similar, yet clearly distinct from the WIP family, that is required for RanGAP nuclear envelop association in root tip cells.
AT1G68930 pentatricopeptide (PPR) repeat-containing protein;(source:Araport11)
AT1G68970 pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10)
AT1G69030 BSD domain-containing protein;(source:Araport11)
AT1G69070 nucleolar-like protein;(source:Araport11)
AT1G69080 Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11)
AT1G69120 Floral homeotic gene encoding a MADS domain protein homologous to SRF transcription factors. Specifies floral meristem and sepal identity. Required for the transcriptional activation of AGAMOUS. Interacts with LEAFY.Binds to promoter and regulates the expression of flowering time genes SVP, SOC1 and AGL24.
AT1G69160 suppressor;(source:Araport11)
AT1G69170 Encodes SPL6. Required for the resistance mediated by the TIR-NB-LRR RPS4 against Pseudomonas syringae carrying the avrRps4 effector. Transcriptome analysis indicates that SPL6 positively regulates a subset of defense genes.
AT1G69190 encodes a bifunctional cytosolic hydroxymethyldihydropterin pyrophosphokinase/ dihydropteroate synthase (HPPK/DHPS)that is involved in tetrahydrofolate biosynthesis and is responsive to oxidative stress.
AT1G69220 Encodes serine/threonine kinase 1 (SIK1), a Hippo homolog. Regulates cell proliferation and cell expansion.
AT1G69240 Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco but no enzymatic activity has been identified for this protein.
AT1G69252 other_RNA;(source:Araport11)
AT1G69260 ABI five binding protein;(source:Araport11)
AT1G69270 RPK1 is a leucine-rich receptor-like kinase located in the plasma membrane which is upregulated by abscisic acid, dehydration, high salt, low temperature, but not by other plant hormones. RPK1 knock-out and antisense plants show an ABA-insensitive phenotype. RPK1 plays a role in ABA-controlled cell proliferation and is a regulator of the ABA signal transduction pathway. Overexpression of the LRR domain has a dominant negative effect on RPK1. Mutations in RPK1 uncouple cotyledon anlagen and primordia by modulating epidermal cell shape and polarity.
AT1G69310 Encodes WRKY57, a member of the WRKY Transcription Factor. Activation of WRKY57 confers drought tolerance.
AT1G69320 Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon.
AT1G69360 T-box transcription factor, putative (DUF863);(source:Araport11)
AT1G69420 DHHC-type zinc finger family protein;(source:Araport11)
AT1G69430 Son of sevenless protein;(source:Araport11)
AT1G69440 Encodes ARGONAUTE7, a member of the ARGONAUTE family, characterised by the presence of PAZ and PIWI domains. Involved in the regulation of developmental timing. Required for the accumulation of TAS3 ta-siRNAs but not for accumulation of miR171, miR173, miR390 or mi391. Localized in mature rosette leaves and floral buds.
AT1G69460 emp24/gp25L/p24 family/GOLD family protein;(source:Araport11)
AT1G69480 EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11)
AT1G69485 Ribosomal L32p protein family;(source:Araport11)
AT1G69490 Encodes a member of the NAC transcription factor gene family. It is expressed in floral primordia and upregulated by AP3 and PI. Its expression is associated with leaf senescence. The mRNA is cell-to-cell mobile.
AT1G69500 Encodes a cytochrome P450, designated CYP704B1. Expressed in the developing anthers. Essential for pollen exine development. Mutations in CYP704B1 result in impaired pollen walls that lack a normal exine layer and exhibit a characteristic striped surface, termed zebra phenotype. Heterologous expression of CYP704B1 in yeast cells demonstrated that it catalyzes omega-hydroxylation of long-chain fatty acids, implicating these molecules in sporopollenin synthesis.
AT1G69510 cAMP-regulated phosphoprotein 19-related protein;(source:Araport11)
AT1G69523 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT1G69526 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT1G69530 Member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana.
AT1G69540 Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators.
AT1G69550 disease resistance protein (TIR-NBS-LRR class);(source:Araport11)
AT1G69570 CDF5 is a circadian regulated transcript that is antiphasic with respect to its natural antisense transcript (NAT) FLORE (AT1G69572).CDF5 transcript accumulation delays flowering. CDF5 links circadian oscillation and photoperiodism.
AT1G69572 Circadian regulated lncRNA, natural antisense gene of CDF5 (AT1G69570). Displays antiphasic expression pattern in relation to CDF5 expression (PMID:28758689).
AT1G69580 Homeodomain-like superfamily protein;(source:Araport11)
AT1G69588 Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini
AT1G69620 putative 60S ribosomal protein L34 The mRNA is cell-to-cell mobile.
AT1G69630 F-box/RNI-like superfamily protein;(source:Araport11)
AT1G69680 ran guanine nucleotide release factor, putative (Mog1/PsbP/DUF1795-like photosystem II reaction center PsbP family protein);(source:Araport11)
AT1G69710 Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11)
AT1G69720 Encodes a member (HO3) of the heme oxygenase family.
AT1G69730 Wall-associated kinase family protein;(source:Araport11)
AT1G69770 Encodes a chromomethylase involved in methylating cytosine residues at non-CG sites. Involved in preferentially methylating transposon-related sequences, reducing their mobility. CMT3 interacts with an Arabidopsis homologue of HP1 (heterochromatin protein 1), which in turn interacts with methylated histones. Involved in gene silencing.
AT1G69790 Protein kinase superfamily protein;(source:Araport11)
AT1G69810 member of WRKY Transcription Factor; Group II-b
AT1G69820 Note that conflicting nomenclature exists in the literature: At1g69820 is named as GGT4 in Plant J. 2007 Mar 49(5):878-88; and as GGT3 in Plant Physiol. 2007 Aug 144(4):1715-32.
AT1G69840 SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11)
AT1G69850 Encodes an inducible component of low-affinity nitrate uptake. mRNA found primarily in root hairs and the epidermis of roots. It also acts as an ABA importer at the site of ABA biosynthesis and is important for the regulation of stomatal aperture in inflorescence stems.
AT1G69860 Major facilitator superfamily protein;(source:Araport11)
AT1G69870 Encodes a low affinity nitrate transporter NRT1.7. Expressed in phloem. Responsible for source-to-sink remobilization of nitrate. The mRNA is cell-to-cell mobile.
AT1G69880 thioredoxin H-type 8;(source:Araport11)
AT1G69910 Protein kinase superfamily protein;(source:Araport11)
AT1G69920 Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).
AT1G69935 Encodes a nuclear localized serine-arginine-aspartate-rich protein that acts as a negative regulator of photomorphogenesis.
AT1G69960 type 2A serine/threonine protein phosphatase (PP2A) mRNA, positive regulators of SPCH and thus stomatal production.
AT1G69970 Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can not replace CLV3 function in vivo.
AT1G69990 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G70020 transmembrane protein, putative (DUF1163);(source:Araport11)
AT1G70110 Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT1G70120 transmembrane protein, putative (DUF1163);(source:Araport11)
AT1G70130 Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT1G70150 zinc ion binding protein;(source:Araport11)
AT1G70170 Matrix metalloprotease. Expression induced by fungal and bacterial pathogens. Mutants are late flowering with early senescence.
AT1G70185 other_RNA;(source:Araport11)
AT1G70200 Encodes a RNA-Binding Protein RBD1. Promotes chilling tolerance through 23S rRNA processing.
AT1G70210 Encodes a D-type cyclin that physically interacts with CDC2A. Its expression is upregulated early during germination.
AT1G70260 Encodes an endoplasmic reticulum (ER)-localized nodulin MtN21-like transporter family protein that negatively regulates resistance against biotrophic pathogens but not the necrotrophic pathogen, B. cinerea, possibly by regulating ROS production, cell death and PR1 expression.
AT1G70280 NHL domain-containing protein;(source:Araport11)
AT1G70290 Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants.
AT1G70300 potassium transporter
AT1G70350 hypothetical protein;(source:Araport11)
AT1G70370 Polygalacturonase involved in cell wall modification.
AT1G70390 F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G70400 NOSIC domain protein;(source:Araport11)
AT1G70420 DNA ligase-like protein, putative (DUF1645);(source:Araport11)
AT1G70430 Protein kinase superfamily protein;(source:Araport11)
AT1G70470 transmembrane protein;(source:Araport11)
AT1G70480 Protein residing in the chloroplast outer membrane, has channel-like properties facilitating the export of the jasmonate precursor 12-oxophytodienoic acid (OPDA) from the chloroplast.
AT1G70520 Encodes a cysteine-rich receptor-like protein kinase located to the plasma membrane. Involved in regulating microbe-associated molecular pattern-triggered ROS production and stress induced callose deposition at the plasmodesmata in roots. Required for MAMP-triggered responses and resistance to Pseudomonas syringae pv. tomato 118 DC3000 .
AT1G70530 Encodes a cysteine-rich receptor-like protein kinase.
AT1G70540 Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT1G70550 NEP-interacting protein, putative (DUF239);(source:Araport11)
AT1G70560 TAA1 is involved in the shade-induced production of indole-3-pyruvate (IPA), a precursor to IAA, a biologically active auxin. It is also involved in regulating many aspects of plant growth and development from embryogenesis to flower formation and plays a role in ethylene-mediated signaling. This enzyme can catalyze the formation of IPA from L-tryptophan. Though L-Trp is expected to be the preferred substrate in vivo, TAA1 also acts as an aminotransferase using L-Phe, L-Tyr, L-Leu, L-Ala, L-Met, and L-Gln. Lines carrying mutations in this gene are unaffected by auxin transporter inhibitor NPA. Double mutant analysis and exogenous auxin treatment suggest that this gene is required for auxin signaling during lateral root and root meristem development. The activity of TAA1 can be controlled by phosphorylation of residue T101, which, when phosphorylated results in loss of activity. TAA1 is a target of TMK4.
AT1G70600 Ribosomal protein L18e/L15 superfamily protein;(source:Araport11)
AT1G70630 Nucleotide-diphospho-sugar transferase family protein;(source:Araport11)
AT1G70690 Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain.
AT1G70700 JAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. The mRNA is cell-to-cell mobile.
AT1G70730 Encodes a cytosolic phosphoglucomutase (PGM). Two Arabidopsis PGM proteins (AT1G70730/PGM2 and AT1G23190/PGM3) have high sequence similarities and redundant functions. Mature plants possessing a single cPGM allele had a major reduction in cPGM activity. Whereas pgm2 and pgm3 single mutants are undistinguishable from the wild type, loss of both PGM2 and PGM3 severely impairs male and female gametophyte development.
AT1G70750 myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11)
AT1G70820 phosphoglucomutase, putative / glucose phosphomutase;(source:Araport11)
AT1G70960 F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G70970 F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G71000 Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT1G71002 Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUCGUUGUCUGUUCGACCUU. Regulates flavonoid-specific MYB transcription factor genes resulting in resistance to pathogen infection.
AT1G71015 PADRE protein.
AT1G71030 Encodes a putative myb family transcription factor. In contrast to most other myb-like proteins its myb domain consists of a single repeat. A proline-rich region potentially involved in transactivation is found in the C-terminal part of the protein. Its transcript accumulates mainly in leaves.
AT1G71040 Encodes LPR2. Function together with LPR1 (AT1G23010) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability.
AT1G71110 transmembrane protein;(source:Araport11)
AT1G71120 Contains lipase signature motif and GDSL domain.
AT1G71140 MATE transporter that can export the antibiotic norfloxacin.
AT1G71200 bHLH160 transcription factor. Induced by copper deficiency and seems to mediate copper uptake along with SPL7. Alternative splicing variant in response to MeJa treatment has potential novel function where it can dimerize but not bind DNA, resulting in a function opposite of the primary isoform.
AT1G71300 Vps52 / Sac2 family;(source:Araport11)
AT1G71360 Encodes a member of the mid-SUN subfamily of SUN-domain proteins that is localized to both the nuclear envelope and the ER. It is involved in early seed development and nuclear morphology.
AT1G71370 DEA(D/H)-box RNA helicase family protein;(source:Araport11)
AT1G71380 cellulase 3;(source:Araport11)
AT1G71390 receptor like protein 11;(source:Araport11)
AT1G71400 Encodes a CLAVATA2 (CLV2)-related gene. Complements the clv2 mutant when expressed under the control of the CLV2 promoter. The mRNA is cell-to-cell mobile.
AT1G71440 Encodes tubulin-folding cofactor E. Mutant embryos consist of one or a few grossly enlarged cells, surrounded by an endosperm that fails to cellularize and contains a few big nuclei.
AT1G71680 Transmembrane amino acid transporter family protein;(source:Araport11)
AT1G71690 glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11)
AT1G71696 Encodes a Putative Zn2+ carboxypeptidase, 4 splice variants have been identified but not characterized for different functions and/or expression patterns.SOL1 isolated as a suppressor of root- specific overexpression of CLE19, a clavata3 like gene. sol1 partially suppresses the short root phenotype caused by CLE19 overexpression.
AT1G71697 Encodes choline kinase. mRNA levels are increased in response to wounding. The mRNA is cell-to-cell mobile.
AT1G71700 pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10)
AT1G71710 DNAse I-like superfamily protein;(source:Araport11)
AT1G71770 Encodes a Class I polyA-binding protein. Expressed in floral organs. Binds polyA sepharose in vitro.
AT1G71790 Encodes a heterodimeric actin binding protein composed of an alpha and a beta sumunit. Stabilizes actin filament cytoskeleton by capping.
AT1G71800 RNA 3′-end?processing factor of antisense FLC transcript. Mediates silencing of the floral repressor gene FLC. Member of CstF complex.
AT1G71820 Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion.
AT1G71880 Sucrose transporter gene induced in response to nematodes; member of Sucrose-proton symporter family. The mRNA is cell-to-cell mobile.
AT1G71890 Encodes a sucrose transporter that is expressed in the endosperm. Mutants have delayed accumulation of fatty acids and embryo maturation.
AT1G71940 SNARE associated Golgi protein family;(source:Araport11)
AT1G71980 RMR2 is a secretory pathway protein localized to the trans-golgi network. It belongs to a family of vacuolar sorting receptors. If forms heterodimers with RMR1.
AT1G72000 Plant neutral invertase family protein;(source:Araport11)
AT1G72100 late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11)
AT1G72150 novel cell-plate-associated protein that is related in sequence to proteins involved in membrane trafficking in other eukaryotes The mRNA is cell-to-cell mobile.
AT1G72180 Encodes a leucine-rich repeat receptor kinase that functions as a receptor for CEP1 peptide. Mediates nitrate uptake signaling.
AT1G72190 D-isomer specific 2-hydroxyacid dehydrogenase family protein;(source:Araport11)
AT1G72220 RING/U-box superfamily protein;(source:Araport11)
AT1G72260 Encodes a thionin which is a cysteine rich protein having antimicrobial properties. Thi2.1 is expressed in response to a variety of pathogens and induced by ethylene and jasmonic acid. Belongs to the plant thionin (PR-13) family with the following members: At1g66100, At5g36910, At1g72260, At2g15010, At1g12663, At1g12660.
AT1G72270 Encodes IDAP1. Acts together with IDAP2 and IDM1 to regulate active DNA demethylation.
AT1G72300 Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of PSY1. PSY1 is an 18-aa tyrosine-sulfated glycopeptide encoded by AT5G58650 that promotes cellular proliferation and expansion.
AT1G72310 Encodes a putative RING-H2 zinc finger protein ATL3 (ATL3).
AT1G72350 MADS-box transcription factor family protein;(source:Araport11)
AT1G72410 COP1-interacting protein-like protein;(source:Araport11)
AT1G72430 SAUR-like auxin-responsive protein family;(source:Araport11)
AT1G72440 Encodes SLOW WALKER2 (SWA2), a NOC1/Mak21 homologue. Essential for coordinated cell cycle progression during female gametophyte development.
AT1G72460 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G72470 A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT1G72480 Lung seven transmembrane receptor family protein;(source:Araport11)
AT1G72510 DUF1677 family protein (DUF1677);(source:Araport11)
AT1G72530 Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing.
AT1G72590 Encodes a polyphenol reductase.
AT1G72610 germin-like protein (GLP1)
AT1G72620 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G72640 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT1G72700 ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11)
AT1G72760 Protein kinase superfamily protein;(source:Araport11)
AT1G72770 mutant has ABA hypersensitive inhibition of seed germination; Protein Phosphatase 2C; regulates the activation of the Snf1-related kinase OST1 by abscisic acid. The mRNA is cell-to-cell mobile.
AT1G72800 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT1G72810 Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11)
AT1G72880 Survival protein SurE-like phosphatase/nucleotidase;(source:Araport11)
AT1G72900 Toll-Interleukin-Resistance (TIR) domain-containing protein;(source:Araport11)
AT1G72980 LOB domain-containing protein 7;(source:Araport11)
AT1G73020 anoctamin-like protein;(source:Araport11)
AT1G73040 Mannose-binding lectin superfamily protein;(source:Araport11)
AT1G73130 ATG8A/F interacting protein containing a WxxL LIR motif at the C terminus which is essential for interaction with ATG8. Stress (abiotic or biotic) results in the formation of ATG8- and ATI3-labeled punctate structures, likely reflecting increased formation of ATG8-labeled phagophores or autophagosomes. ATI3 proteins probably act as selective autophagy receptors that target specific cellular components during the plant stress response. ATI3 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner.
AT1G73160 UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT1G73165 Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can replace CLV3 function in vivo.
AT1G73180 Eukaryotic translation initiation factor eIF2A family protein;(source:Araport11)
AT1G73190 Moves to the Protein Storage Vacuole in a Golgi independent manner
AT1G73210 hypothetical protein (DUF789);(source:Araport11)
AT1G73220 Encodes Organic Cation Transporter 1 (OCT1), likely to be involved in polyamine transport.
AT1G73310 serine carboxypeptidase-like 4;(source:Araport11)
AT1G73320 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT1G73330 encodes a plant-specific protease inhibitor-like protein whose transcript level in root disappears in response to progressive drought stress. The decrease in transcript level is independent from abscisic acid level.
AT1G73340 ADTO1 is required for the activation of systemic acquired resistance.
AT1G73360 Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. It is involved in trichome branching. The transcription factor directly upregulates the expression of several cell-wall-loosening protein genes and reveals the important role that these target genes play in coordinating cell-wall extensibility with root development.
AT1G73370 Encodes a protein with sucrose synthase activity (SUS6).
AT1G73430 COG3 is a component of a putative conserved oligomeric Golgi (COG) complex that is thought to be involved in tethering of retrograde intra Golgi vesicles. In mutant pollen,golgi appear abnormal. It is required for proper deposition of cell wall materials in pollen tube growth. When homozygotes can be produced (by complementing the defect in pollen), the plants are embryo lethal suggesting an essential function. COG3 interacts with several other putative COG components.
AT1G73440 calmodulin-like protein;(source:Araport11)
AT1G73480 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G73490 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT1G73500 member of MAP Kinase Kinase family. Autophosphorylates and also phosphorylates MPK3 and MPK6. Independently involved in ethylene and calmalexin biosynthesis. Induces transcription of ACS2, ACS6, ERF1, ERF2, ERF5, ERF6, CYP79B2, CYP79B3, CYP71A13 and PAD3.
AT1G73580 Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT1G73590 Encodes an auxin efflux carrier involved in shoot and root development. It is involved in the maintenance of embryonic auxin gradients. Loss of function severely affects organ initiation, pin1 mutants are characterised by an inflorescence meristem that does not initiate any flowers, resulting in the formation of a naked inflorescence stem. PIN1 is involved in the determination of leaf shape by actively promoting development of leaf margin serrations. In roots, the protein mainly resides at the basal end of the vascular cells, but weak signals can be detected in the epidermis and the cortex. Expression levels and polarity of this auxin efflux carrier change during primordium development suggesting that cycles of auxin build-up and depletion accompany, and may direct, different stages of primordium development. PIN1 action on plant development does not strictly require function of PGP1 and PGP19 proteins.
AT1G73680 Encodes an alpha dioxygenase. Recombinant protein catalyzes the conversion of a wide range of fatty acids into 2(R)-hydroperoxy derivatives.
AT1G73687 Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUUGGAUUGAAGGGAGCUCUA. Functions redundantly with MIR159B. Plants that are doubly mutated for MIR159AB have curled leaves and reduced stature. Pri-mRNA coordinates for MIR159a (converted to TAIR10 based on PMID19304749): Chr1: 27713700-27712893 (reverse), length: 808 bp; exon coordinates: exon 1: 27713700 to 27712893, mature miRNA and miRNA* are located on exon 1.
AT1G73690 cyclin dependent kinase activator CDKD;1. Nuclear localization. Involved in cell cycle regulation and cell differentiation.
AT1G73760 RING/U-box superfamily protein;(source:Araport11)
AT1G73790 Encodes a gamma-tubulin complex protein that plays a role in gamma-tubulin complex localization, spindle stability and chromosomal segregation.
AT1G73805 Encodes SAR Deficient 1 (SARD1), a key regulator for ICS1 (Isochorismate Synthase 1) induction and salicylic acid (SA) synthesis.
AT1G73850 DNA ligase (DUF1666);(source:Araport11)
AT1G73860 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT1G73870 B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11)
AT1G73875 Deadenylase.
AT1G73950 Transmembrane Fragile-X-F-associated protein;(source:Araport11)
AT1G73960 Member of TFIID complex.
AT1G73965 Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo.
AT1G74000 encodes a protein similar to strictosidine synthase, which is involved in the production of monoterpene indole alkaloids. This gene belongs to a family of 13 members in Arabidopsis.
AT1G74010 Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11)
AT1G74040 Encodes an active Arabidopsis isopropylmalate synthase IPMS2. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS2 can be compensated by a second isopropylmalate synthase gene IPMS1 (At1g18500).
AT1G74090 encodes a desulfoglucosinolate sulfotransferase, involved in the final step of glucosinolate core structure biosynthesis. Has a broad-substrate specificity with preference with methionine-derived desulfoglucosinolates.
AT1G74100 encodes a desulfoglucosinolate sulfotransferase, involved in the final step of glucosinolate core structure biosynthesis. Has a broad-substrate specificity with different desulfoglucosinolates, the best substrate is indole-3-methyl-dsGS, followed by benzyl-dsGS. Expression was induced by wounding, jasmonate and ethylene stimulates.
AT1G74110 member of CYP78A
AT1G74220 homeobox-like protein;(source:Araport11)
AT1G74240 Mitochondrial substrate carrier family protein;(source:Araport11)
AT1G74320 encodes a choline kinase, whose expression is induced by high salt and mannitol.
AT1G74410 RING/U-box superfamily protein;(source:Araport11)
AT1G74440 Similar to MPH1, can complement mph1-1 salt sensitivity phenotype.
AT1G74458 transmembrane protein;(source:Araport11)
AT1G74470 Encodes for a multifunctional protein with geranylgeranyl reductase activity shown to catalyze the reduction of prenylated geranylgeranyl-chlorophyll a to phytyl-chlorophyll a (chlorophyll a) and free geranylgeranyl pyrophosphate to phytyl pyrophosphate. The mRNA is cell-to-cell mobile.
AT1G74480 RWP-RK domain-containing protein;(source:Araport11)
AT1G74500 Encodes a basic helix/loop/helix transcription factor that acts downstream of MP in root initiation. TMO7 protein moves to the hypophysis and to vascular cells, contributing to MP-dependent root formation. Promotes the correct definition of the hypophysis cell division plane.
AT1G74520 Part of the AtHVA22a family. Protein expression is ABA- and stress-inducible.
AT1G74550 Encodes a tricoumaroylspermidine meta-hydroxylase that participates in the formation of N1,N5-di(hydroxyferuloyol)- N10-sinapoylspermidine, an important constituent of pollen. This gene appears to be expressed in young flower buds and inflorescence tips with notably high levels of expression in the tapetum and pollen. It is also expressed in root tips.
AT1G74640 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G74670 Gibberellin-regulated family protein;(source:Araport11)
AT1G74680 Exostosin family protein;(source:Araport11)
AT1G74720 Encodes a putative transmembrane protein carrying four C(2) domains, suggesting that QKY may function in membrane trafficking in a Ca(2+)-dependent fashion. Mutant analysis shows that this gene is involved in organ development.
AT1G74770 zinc ion binding protein;(source:Araport11)
AT1G74810 HCO3- transporter family;(source:Araport11)
AT1G74820 RmlC-like cupins superfamily protein;(source:Araport11)
AT1G74870 RING/U-box superfamily protein;(source:Araport11)
AT1G74910 KONJAC1 is imilar to sugar pyrophosphorylases but has an insertion of 2 AA in the pyrophosphorylase consensus motif that is highly conserved in GMPPs. It lacks GDP-mannose pyrophosphorylase activity but can simulate the GDP-mannose pyrophosphorylase activity of VTC1.
AT1G74940 cyclin-dependent kinase, putative (DUF581);(source:Araport11)
AT1G74990 RING/U-box superfamily protein;(source:Araport11)
AT1G75030 encodes a PR5-like protein
AT1G75040 Thaumatin-like protein involved in response to pathogens. mRNA level of the PR-5 gene (At1g75040)is significantly changed after cutting the inflorescence stem indicating the existence of a network of signal transducing pathways as other stress-regulated genes (At5g01410, At3g17800, At1g29930)do not response to the treatment. The mRNA is cell-to-cell mobile.
AT1G75060 Evening-expressed key component of Sin3-HDAC complex, which bind directly to the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and PSEUDO-RESPONSE REGULATOR 9 (PRR9) promoters and catalyze histone 3 (H3) deacetylation at the cognate regions to repress expression, allowing the declining phase of their expression at dusk.
AT1G75070 pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10)
AT1G75090 DNA glycosylase superfamily protein;(source:Araport11)
AT1G75100 Contains a J-domain at the C-terminus which is similar to the J-domain of auxilin, a clathrin-uncoating factor in cow, yeast and worm. Arabidopsis contains 6 other proteins similar to auxilin. Expressed in leaves and stems, but not in roots. Localized in the cytoplasm. Required for the chloroplast accumulation response, but not for the avoidance response. No molecular function known. Influences the composition of photosynthetic pigments, the efficiency of photosynthesis, and the CO2 uptake rate. Positive effect on water use efficiency (WUE) by reducing stomatal aperture and water vapor conductance; involved in the fine-tuning of H2O2 foliar levels, antioxidant enzymes activities and cell death after UV-C photooxidative stress.
AT1G75190 hypothetical protein;(source:Araport11)
AT1G75200 flavodoxin family protein / radical SAM domain-containing protein;(source:Araport11)
AT1G75210 HAD-superfamily hydrolase, subfamily IG, 5-nucleotidase;(source:Araport11)
AT1G75220 Encodes a vacuolar glucose exporter that is induced in response to factors that activate vacuolar glucose pools like darkness, heat stress and wounding and repressed during conditions that trigger glucose accumulation in the vacuole like cold stress and external sugar supply.
AT1G75260 oxidoreductases, acting on NADH or NADPH;(source:Araport11)
AT1G75261 Pseudogene of AT4G39230; isoflavone reductase, putative
AT1G75290 encodes a protein whose sequence is similar to an isoflavone reductase
AT1G75380 Encodes a nuclease involved in ABA-mediated callose deposition. It has been shown to interact with JAZ proteins, binds to a jasmonic acid-responsive element (JARE) and repress AtJMT expression.
AT1G75400 RING/U-box superfamily protein;(source:Araport11)
AT1G75410 BEL1-like homeodomain 3 (BLH3)
AT1G75430 BEL1-like homeodomain 11;(source:Araport11)
AT1G75440 ubiquitin-conjugating enzyme 16;(source:Araport11)
AT1G75460 ATP-dependent protease La (LON) domain protein;(source:Araport11)
AT1G75500 An Arabidopsis thaliana homolog of Medicago truncatula NODULIN21 (MtN21). The gene encodes a plant-specific, predicted integral membrane protein and is a member of the Plant-Drug/Metabolite Exporter (P-DME) family (Transporter Classification number: TC 2.A.7.3) and the nodulin MtN21-like transporter family.
AT1G75510 Transcription initiation factor IIF, beta subunit;(source:Araport11)
AT1G75520 A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis.SRS5 is a positive regulator of photomorphogenesis.
AT1G75530 Forkhead-associated (FHA) domain-containing protein;(source:Araport11)
AT1G75540 Encodes a B-box zinc finger transcription factor BBX21 (also named STH2/salt tolerance homolog2 and LHUS/long hypocotyl under shade). Interacts with COP1 to control de-etiolation. Also genetically interacts with COP1 to regulate shade avoidance. The mRNA is cell-to-cell mobile.
AT1G75590 SAUR-like auxin-responsive protein family;(source:Araport11)
AT1G75600 Histone superfamily protein;(source:Araport11)
AT1G75630 vacuolar H+-pumping ATPase 16 kD proteolipid (ava-p) mRNA, The mRNA is cell-to-cell mobile.
AT1G75690 Thylakoid Thiol/Disulfide-Modulating Protein.
AT1G75700 HVA22-like protein G;(source:Araport11)
AT1G75730 hypothetical protein;(source:Araport11)
AT1G75760 ER lumen protein retaining receptor family protein;(source:Araport11)
AT1G75800 Pathogenesis-related thaumatin superfamily protein;(source:Araport11)
AT1G75840 Belongs to the plant-specific ROP group of Rho GTPases; localized to the plasma membrane of tips of root hairs; involved in polar growth control. The mRNA is cell-to-cell mobile.
AT1G75860 DNA ligase;(source:Araport11)
AT1G75930 member of Lipase proteins
AT1G76030 One of three genes encoding the vacuolar ATP synthase subunit B1. This subunit was shown to interact with the gene product of hexokinase1 (ATHXK1). This interaction, however, is solely restricted to the nucleus. The protein binds to and co-localizes with F-actin, bundles F-actin to form higher-order structure, and stabilizes actin filaments in vitro. The mRNA is cell-to-cell mobile.
AT1G76040 member of Calcium Dependent Protein Kinase
AT1G76050 Pseudouridine synthase family protein;(source:Araport11)
AT1G76080 Encodes a thioredoxin like protein. Localizes to the chloroplast and is redistributed to the chloroplast envelope under heat stress. It is involved in non host resistance and thermotolerance.
AT1G76090 Encodes S-adenosyl-methionine-sterol-C-methyltransferase, an enzyme in the sterol biosynthetic pathway.
AT1G76110 HMG (high mobility group) box protein with ARID/BRIGHT DNA-binding domain-containing protein;(source:Araport11)
AT1G76150 Encodes a monofunctional enoyl-CoA hydratase 2, involved in the degradation of even cis-unsaturated fatty acids, gene expression is enhanced during the first 2 days of germination, as well as in senescent leaves.
AT1G76160 SKU5 similar 5;(source:Araport11)
AT1G76180 Encodes a dehydrin protein whose expression is induced early on in response to dehydration stress. This gene's expression to cold occurs in two waves, with early induction occurring within 1 h and secondary induction occurring 5 h after the beginning of cold stress. Expression is also induced in response to ABA but not in response to 2,4-D, BA, and GA3. ERD14 protein is capable of binding Ca2+, especially when the protein is phosphorylated.
AT1G76190 SAUR-like auxin-responsive protein family;(source:Araport11)
AT1G76210 DUF241 domain protein, putative (DUF241);(source:Araport11)
AT1G76240 DUF241 domain protein (DUF241);(source:Araport11)
AT1G76250 transmembrane protein;(source:Araport11)
AT1G76280 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G76300 snRNP core protein SMD3;(source:Araport11)
AT1G76310 core cell cycle genes
AT1G76350 Plant regulator RWP-RK family protein;(source:Araport11)
AT1G76370 Protein kinase superfamily protein;(source:Araport11)
AT1G76390 Plant U-box type E3 ubiquitin ligase (PUB).
AT1G76430 Encodes Pht1;9, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341).
AT1G76460 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT1G76490 Encodes a 3-hydroxy-3-methylglutaryl coenzyme A reductase, which is involved in melavonate biosynthesis and performs the first committed step in isoprenoid biosynthesis. Expression is activated in dark in leaf tissue but not controlled by light in the root (confine The mRNA is cell-to-cell mobile.
AT1G76500 Encodes an AT hook domain containing protein. Identified in a screen of activation tagged lines that suppress the long-hypocotyl phenotype of a weak phyB allele. Affects cell elongation in the hypocotyl and leaves.Acts redundantly with ESC to modulate hypocotyl growth inhibition in response to light
AT1G76540 Encodes a cyclin-dependent protein kinase involved in regulation of the G2/M transition of the mitotic cell cycle. Specifically binds to the cyclin CYCD4;1, expressed in shoot meristem, young leaves and vascular tissue during the G2/M phase. Required for proper organization of the shoot apical meristem and for hormone signaling.
AT1G76560 CP12 domain-containing protein 3;(source:Araport11)
AT1G76580 Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein;(source:Araport11)
AT1G76590 PLATZ transcription factor family protein;(source:Araport11)
AT1G76620 Serine/Threonine-kinase, putative (Protein of unknown function, DUF547);(source:Araport11)
AT1G76630 SKI3 encodes a cytplasmically localized component of the SKI complex which is involved in exosome mediated RNA decay.
AT1G76650 calmodulin-like 38;(source:Araport11)
AT1G76680 Encodes a member of an alpha/beta barrel fold family of FMN-containing oxidoreductases. One of the closely related 12-oxophytodienoic acid reductases. This enzyme is not expected to participate in jasmonic acid biosynthesis because during in vitro assays, it shows very little activity with the naturally occurring OPDA isomer. Shows activity towards 2,4,6-trinitrotoluene. Expressed predominately in root. Up-regulated by senescence and jasmonic acid. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. Predicted to be a cytosolic protein.
AT1G76690 Encodes one of the closely related 12-oxophytodienoic acid reductases. This enzyme is not expected to participate in jasmonic acid biosynthesis because during in vitro assays, it shows very little activity with the naturally occurring OPDA isomer. Shows activity towards 2,4,6-trinitrotoluene. Expressed predominately in root. Predicted to be a cytosolic protein.
AT1G76705 calmodulin binding protein;(source:Araport11)
AT1G76728 transmembrane protein;(source:Araport11)
AT1G76760 Encodes a y-type thioredoxin (Trx-y1) localized in chloroplast stroma.
AT1G76770 HSP20-like chaperone
AT1G76780 HSP20-like chaperones superfamily protein;(source:Araport11)
AT1G76790 Encodes a protein with similarity to N-acetylserotonin O-methyltransferase (ASMT) but it does not have ASMT activity in vitro.
AT1G76830 F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G76870 transcription factor;(source:Araport11)
AT1G76890 encodes a plant trihelix DNA-binding protein
AT1G76892 Natural antisense transcript overlaps with AT1G76890;(source:Araport11)
AT1G76900 Member of plant TLP family. Contains terminal F-box domain, interacts with ASK proteins. Tethered to the PM.
AT1G76920 F-box family protein;(source:Araport11)
AT1G76950 Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11)
AT1G76965 Encodes a Protease inhibitor/seed storage/LTP family protein
AT1G76970 Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses.
AT1G76980 patatin-like phospholipase domain protein;(source:Araport11)
AT1G76990 ACT domain repeat 3;(source:Araport11)
AT1G77010 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT1G77020 DNAJ heat shock N-terminal domain-containing protein;(source:Araport11)
AT1G77080 MADS domain protein - flowering regulator that is closely related to FLC. Deletion of this locus in Nd ecotype is correlated with earlier flowering in short days suggesting function as a negative regulator of flowering.
AT1G77095 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.8e-14 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT1G77120 Catalyzes the reduction of acetaldehyde using NADH as reductant. Requires zinc for activity. Dimer. Anaerobic response polypeptide (ANP). Fermentation. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. The mRNA is cell-to-cell mobile.
AT1G77145 transmembrane protein, putative (DUF506);(source:Araport11)
AT1G77150 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT1G77210 AtSTP14 belongs to the family of sugar transport proteins (AtSTPs)in volved in monosaccharide transport. Heterologous expression in yeast revealed that AtSTP14 is the transporter specifc for galactose and does not transport other monosaccharides such as glucose or fructose.
AT1G77220 LAZ1H1 is a DUF300 that is localized to the tonoplast. Along with LAZ1 it appears to play a role in maintaining the structural integrity of vacuoles and regulating BR signaling by modulating downstream subcellular distribution of BAK1.
AT1G77230 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G77240 AMP-dependent synthetase and ligase family protein;(source:Araport11)
AT1G77260 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT1G77290 Glutathione S-transferase family protein;(source:Araport11)
AT1G77320 Mutant is defective in meiosis and produces abnormal microspores. Encodes a BRCT-domain-containing protein that could be specific to the meiotic cell cycle and that plays a crucial role in some DNA repair events independent of SPO11 DSB recombination repair.
AT1G77340 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT1G77380 Amino acid permease which transports basic amino acids.
AT1G77410 beta-galactosidase 16;(source:Araport11)
AT1G77450 NAC domain transcriptional regulator that is induced by ROS in roots where it regulates the expression of downstream genes such as MYB30.
AT1G77480 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT1G77510 Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. This protein has been shown to be an attenuator of D1 synthesis, modulating photoinhibition in a light-regulated manner.
AT1G77530 O-methyltransferase family protein;(source:Araport11)
AT1G77550 tubulin-tyrosine ligase;(source:Araport11)
AT1G77570 Winged helix-turn-helix transcription repressor DNA-binding. Expressed in pollen and mutants show enlarged pollen grain nucleoli.
AT1G77580 filament-like protein (DUF869);(source:Araport11)
AT1G77660 Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member.
AT1G77690 Encodes an auxin influx carrier LAX3 (Like Aux1) that promotes lateral root emergence. Auxin-induced expression of LAX3 in turn induces a selection of cell-wall-remodelling enzymes, which are likely to promote cell separation in advance of developing lateral root primordia.
AT1G77720 Encodes a predicted protein kinase based on sequence similarity.
AT1G77730 Pleckstrin homology (PH) domain superfamily protein;(source:Araport11)
AT1G77760 Encodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. Similar to molybdopterin oxidoreductases at the N-terminus, and to FAD/NAD-binding cytochrome reductases at the C-terminus. Cofactors: FAD, heme iron (cytochrome B-557), and molybdenum-pterin.
AT1G77765 transmembrane protein;(source:Araport11)
AT1G77770 forkhead box protein, putative (DUF1644);(source:Araport11)
AT1G77840 Translation initiation factor IF2/IF5;(source:Araport11)
AT1G77885 hypothetical protein;(source:Araport11)
AT1G77890 One of a pair of paralogs (the other is AT4G08540)that is a subunit of the lass III phosphatidylinositol 3-kinase (PI3K) complex but is not essential for PI3P biosynthesis.
AT1G77910 transmembrane protein;(source:Araport11)
AT1G77920 bZIP transcription factor family protein;(source:Araport11)
AT1G77930 Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT1G77932 FANTASTIC four protein, putative (DUF3049);(source:Araport11)
AT1G77940 Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11)
AT1G77980 Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL66 is expressed in pollen.It forms heterodimers with other MICK family members (AGL104). Involved in late stages of pollen development and pollen tube growth.
AT1G78000 Encodes a sulfate transporter that can restore sulfate uptake capacity of a yeast mutant lacking sulfate transporter genes.
AT1G78010 tRNA modification GTPase;(source:Araport11)
AT1G78030 hypothetical protein;(source:Araport11)
AT1G78050 phosphoglycerate/bisphosphoglycerate mutase;(source:Araport11)
AT1G78070 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT1G78080 Encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family (RAP2.4). The protein contains one AP2 domain. Role in mediating light and ethylene signaling. The mRNA is cell-to-cell mobile.
AT1G78090 homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases
AT1G78095 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 5.0e-45 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10)
AT1G78100 F-box family protein;(source:Araport11)
AT1G78110 nucleolar GTP-binding protein;(source:Araport11)
AT1G78120 Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones.
AT1G78130 Major facilitator superfamily protein;(source:Araport11)
AT1G78140 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT1G78160 Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts.
AT1G78230 Outer arm dynein light chain 1 protein;(source:Araport11)
AT1G78240 Encodes TSD2 (TUMOROUS SHOOT DEVELOPMENT2), a putative methyltransferase with an essential role in cell adhesion, anthocyanin accumulation, and coordinated plant development.
AT1G78265 Natural antisense transcript overlaps with AT1G78270;(source:Araport11)
AT1G78290 encodes a member of SNF1-related protein kinase (SnRK2) family whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress and dehydration.
AT1G78320 Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).
AT1G78340 Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).
AT1G78370 Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).
AT1G78390 Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition.
AT1G78400 PGX2 is a cell wall protein that codes for a polygalacturonase.
AT1G78420 Activates the latent peptidases DA1, DAR1 and DAR2 by mono-ubiquitination at multiple sites. Subsequently, these activated peptidases destabilize various positive regulators of growth.
AT1G78430 Encodes RIP2 (ROP interactive partner 2), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants).
AT1G78450 SOUL heme-binding family protein;(source:Araport11)
AT1G78490 member of CYP708A family. The mRNA is cell-to-cell mobile.
AT1G78500 Encodes a protein with pentacyclic triterpene synthase activity. In addition to the compounds lupeol, α-amyrin and bauerenol, this enzyme was also shown to produce two seco-triterpenes: α- and β-seco-amyrin.
AT1G78520 Carbohydrate-binding X8 domain superfamily protein;(source:Araport11)
AT1G78580 Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain but no trehalose phosphatase (TPP)-like domain. ATTPS1 is able to complement yeast tps1 mutants in vivo. The gene product modulates cell growth but not cell differentiation by determining cell wall deposition and cell division. The N-terminal domain of TPS1 has a nuclear localization signal and an autoinhibitory function. The C-terminal domain is important for catalytic fidality of TPS1 and for appropriate signaling of the sucrose status by trehalose 6-phosphate levels in the plant (10.1105/tpc.19.00837).
AT1G78590 Encodes a NADH kinase which can synthesize NADPH from NADH; also utilizes NAD+ as substrate although NADH is the preferred substrate.
AT1G78600 light-regulated zinc finger protein 1;(source:Araport11)
AT1G78620 integral membrane protein (Protein of unknown function DUF92, transmembrane);(source:Araport11)
AT1G78640 B3 domain protein;(source:Araport11)
AT1G78670 gamma-glutamyl hydrolase 3;(source:Araport11)
AT1G78720 SecY protein transport family protein;(source:Araport11)
AT1G78730 FBD, F-box, Skp2-like and Leucine Rich Repeat domains containing protein;(source:Araport11)
AT1G78820 D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11)
AT1G78900 Encodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology. The mRNA is cell-to-cell mobile.
AT1G78940 kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11)
AT1G78950 Terpenoid cyclases family protein;(source:Araport11)
AT1G78955 Encodes a cyclase that generates predominantly a monocyclic triterpene alcohol. The product is 97% camelliol, 2% achilleol A and 0.2% beta-amyrin. Achilleol is an isomer of camelliol C with a 4-methylenecyclohexanol ring system.
AT1G78970 Lupeol synthase. Converts oxidosqualene to multiple triterpene alcohols and a triterpene diols. This conversion proceeds through the formation of a 17β-dammarenyl cation.
AT1G78980 STRUBBELIG-receptor family 5;(source:Araport11)
AT1G78990 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT1G79030 Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT1G79080 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT1G79110 Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea.
AT1G79130 SAUR-like auxin-responsive protein family;(source:Araport11)
AT1G79150 binding protein;(source:Araport11)
AT1G79160 filamentous hemagglutinin transporter;(source:Araport11)
AT1G79190 ARM repeat superfamily protein;(source:Araport11)
AT1G79240 pre-tRNA tRNA-Arg (anticodon: CCG);(source:Araport11, TAIR10)
AT1G79250 AGC kinase 1.7;(source:Araport11)
AT1G79320 Encodes a putative metacaspase. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200.
AT1G79330 Metacaspase AtMCPb2/AMC6. Caspase family protein. Arginine/lysine-specific cysteine protease activity. Induces apoptosis in yeast. Contains Pfam domain, PF00656: ICE-like protease (caspase) p20 domain. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200.
AT1G79380 Encodes a ubiquitin ligase that is an essential upstream modulator of JA signaling in response to various stimuli.
AT1G79390 centrosomal protein;(source:Araport11)
AT1G79400 member of Putative Na+/H+ antiporter family
AT1G79410 organic cation/carnitine transporter5;(source:Araport11)
AT1G79420 C-type mannose receptor (DUF620);(source:Araport11)
AT1G79430 Encodes gene product that is required for several aspects of phloem development in the root: (1) the specific divisions organizing the phloem pole, (2) sieve element differentiation and (3) the expression of a companion-specific gene. Mutant has a defect in the organization of phloem poles in the root. apl seedlings have a short, determinate root with only occasional lateral branches.
AT1G79470 Aldolase-type TIM barrel family protein;(source:Araport11)
AT1G79480 Carbohydrate-binding X8 domain superfamily protein;(source:Araport11)
AT1G79500 Encodes a protein with 3-deoxy-8-phosphooctulonate synthase (KDOP synthase) activity which is involved in the biosynthesis of KDO, a component of cell wall rhamnogalacturonan II.
AT1G79570 kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11)
AT1G79580 NAC-domain protein. Involved in root cap development. Involved in a regulatory feedback loop with FEZ. FEZ activates SMB in hte root cap daughter cells soon after division, and SMB in turn represses FEZ expression in these cells, thereby preventing further stem cell divisions.
AT1G79590 Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed.
AT1G79610 Encodes an endosomal Na(+)/H(+) antiporter: AT1G54370 (NHX5), AT1G79610 (NHX6). Double knockout nhx5 nhx6 showed reduced growth, with smaller and fewer cells and increased sensitivity to salinity.
AT1G79620 VRLK1 is a LRR kinase involved in switching between cell elongation and secondary cell wall thickening.VRLK1 is a member of a gene family that includes a small number of recently duplicated paralogs.
AT1G79640 Protein kinase superfamily protein;(source:Araport11)
AT1G79670 Encodes a receptor-like kinase that does not contain an extracellular leucine-rich repeat domain. A novel type of dominant disease-resistance protein that confers resistance to a broad spectrum of Fusarium races.
AT1G79720 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT1G79730 Encodes a PAF1 homolog that is involved in the control of flowering time by elevating FLC expression to a level that creates the vernalization-responsive, winter-annual habit. Yeast PAF1 is a component of a five-member complex that associates with RNA pol II and is thought to regulate gene expression by recruiting SET1 (a histone 3 Lys 4 [H3-K4] methyl transferase) to the initially transcribed [5'] regions of target chromatin. Mutants display reduced H3-K4 methylation in both FLC and FLM chromatin. Member of PAF-C complex.
AT1G79820 Major facilitator superfamily protein;(source:Araport11)
AT1G79950 Encodes a homologue of human Regulator of Telomere Elongation Helicase1 (RTEL1). Plays a central role in the preservation of genome stability.
AT1G79960 ovate family protein 14;(source:Araport11)
AT1G80030 Molecular chaperone Hsp40/DnaJ family protein;(source:Araport11)
AT1G80050 Encodes an adenosine phosphoribosyl transferase(E.C:2.4.2.7), a constitutively expressed enzyme involved in the one-step salvage of adenine to AMP. This isozyme has high affinity for cytokinins and is likely to be localized to the cytosol.
AT1G80100 AHP6 lacks the conserved histidine residue (Asn83 in AHP6b), which is required for phosphotransfer, present in the other AHPs. AHP6 does not appear to have phosphotransfer activity. Acts as an inhibitor of cytokinin signaling by interacting with the phosphorelay machinery. Expressed in developing protoxylem and associated pericycle cell files. Negative regulator of cytokinin signaling. Expression is down-regulated by cytokinins. There are two alternatively spliced genes for this locus, AHP6a and AHP6b, differing in the length of the first exon. In ahp6-2 seedlings, only the AHP6a transcript is present. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6).
AT1G80110 phloem protein 2-B11;(source:Araport11)
AT1G80120 LURP-one-like protein (DUF567);(source:Araport11)
AT1G80130 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G80150 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G80170 Pectin lyase-like superfamily protein;(source:Araport11)
AT1G80240 DUF642 gene
AT1G80250 pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10)
AT1G80260 Spc97 / Spc98 family of spindle pole body (SBP) component;(source:Araport11)
AT1G80320 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT1G80350 encodes a p60 katanin protein that is expressed throughout the plant. Required for the specification of cell fates from early in development (in the meristem) through differentiation and for normal postmitotic organization of cortical microtubules into transverse arrays in root epidermis cells. Mutants display cytoskeletal defects.
AT1G80360 Encodes a methionine-specific aminotransferase that uses the ethylene biosynthetic intermediate methionine as an amino donor and the auxin biosynthetic intermediate indole-3-pyruvic acid as an amino acceptor to produce L-tryptophan and 2-oxo-4-methylthiobutyric acid. These actions allow VAS1 to coordinate both auxin and ethylene biosynthesis. It functions downstream of TAA1/SAV3 but upstream of YUCs to negatively modulate IAA biosynthesis directly by altering the 3-IPA pool.
AT1G80370 Encodes a A2-type cyclin. Contributes to the fine-tuning of local proliferation during plant development.
AT1G80380 encodes a glycerate kinase which catalyzes the last step of photorespiration C2 cycle.
AT1G80390 Member of a multigene family of Auxin responsive genes.
AT1G80420 Encodes a component of plant break excision repair and functions at several stages during active DNA demethylation in Arabidopsis.
AT1G80430 pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10)
AT1G80440 Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB20, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. The mRNA is cell-to-cell mobile.
AT1G80450 VQ motif-containing protein;(source:Araport11)
AT1G80470 F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT1G80530 Major facilitator superfamily protein;(source:Araport11)
AT1G80540 envelope glycoprotein B;(source:Araport11)
AT1G80580 encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
AT1G80590 member of WRKY Transcription Factor; Group III
AT1G80620 S15/NS1, RNA-binding protein;(source:Araport11)
AT1G80660 H[+]-ATPase 9;(source:Araport11)
AT1G80750 Cytosolic ribosomal 60S subunit protein.
AT1G80940 Snf1 kinase interactor-like protein;(source:Araport11)
AT1G80950 Encodes an acyl-CoA: lysophosphatidylethanolamine acyltransferase with 16:0-CoA being the best acyl donor. Mutations adversely affect the growth of plants and result in decreased lipid content in roots and seeds.
AT1G80960 F-box and Leucine Rich Repeat domains containing protein;(source:Araport11)
AT2G01010 rRNA;(source:Araport11)
AT2G01023 hypothetical protein;(source:Araport11)
AT2G01120 Origin Recognition Complex subunit 4. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with all ORC subunits except ORC1b.
AT2G01130 DEA(D/H)-box RNA helicase family protein;(source:Araport11)
AT2G01140 Aldolase superfamily protein;(source:Araport11)
AT2G01150 Encodes a RING-H2 finger protein that is expressed in vascular tissue, root tips, embryos and pistils.
AT2G01170 Encodes a bidirectional amino acid transporter that can transport ala, arg, glu and lys, GABA but not pro with both export and import activity. Its expression is localized in the vascular tissues suggesting a function in amino acids export from the phloem into sink tissue.
AT2G01180 Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves.
AT2G01220 Nucleotidylyl transferase superfamily protein;(source:Araport11)
AT2G01275 RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11)
AT2G01300 mediator of RNA polymerase II transcription subunit;(source:Araport11)
AT2G01330 nucleotide binding protein;(source:Araport11)
AT2G01372 Pseudogene of AT3G13062
AT2G01440 Encodes an ortholog of the bacterial RecG translocase, an organellar protein with multiple roles in mtDNA maintenance. The protein is targeted to mitochondria and plastids and is required for recombination-dependent repair and for suppression of ectopic recombination in mitochondria, most likely because of its role in recovery of stalled replication forks.
AT2G01490 Encodes a phytanoyl-CoA 2-hydroxylase (PAHX). The mRNA is cell-to-cell mobile.
AT2G01505 Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon.
AT2G01520 Encodes a cis-cinnamic acid responsive gene that is a member of the major latex protein-like gene family and plays a role in promoting vegetative growth and delaying flowering. The mRNA is cell-to-cell mobile.
AT2G01560 Plant protein 1589 of unknown function;(source:Araport11)
AT2G01650 encodes a peripheral membrane protein that contains UBX domain and interacts with AtCDC48 in vitro and co-fractionates with membrane-associated but not soluble AtCDC48 in vivo.
AT2G01660 Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain.
AT2G01680 Ankyrin repeat family protein;(source:Araport11)
AT2G01710 SDJ2 functions partially redundantly with SDJ1 and SDJ3 and interacts with SUVH1 and SUVH3 to form a SUVH-SDJ complex. The complex binds promoters with DNA methylation and mediates transcriptional activation of promoter methylated genes.
AT2G01720 Ribophorin I;(source:Araport11)
AT2G01780 Curculin-like (mannose-binding) lectin family protein;(source:Araport11)
AT2G01810 RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11)
AT2G01818 PLATZ transcription factor family protein;(source:Araport11)
AT2G01820 Transmembrane kinase (TMK), member of the plant receptor-like kinase (RLK) family. TMKs are characterized by an extracellular leucine-rich-repeat (LRR) domain, a single transmembrane region and a cytoplasmic kinase domain. TMKs have been shown to act as critical modulators of cell expansion and cell proliferation.
AT2G01830 Histidine kinase: cytokinin-binding receptor that transduces cytokinin signals across the plasma membrane
AT2G01850 EXGT-A3 has homology to xyloglucan endotransglucosylases/hydrolases (XTHs). Mutants in this gene show a lesion mimic phenotype associated with leaf maturation and a reduction in the number of tertiary veins. Individual tracheary elements in the mutants are shorter, but phloem transport activity is not severely affected. EXGT-A3 plays a role in xyloglucan degradation in the differentiating tracheary elements of rosette leaves. The mRNA is cell-to-cell mobile.
AT2G01870 transmembrane protein;(source:Araport11)
AT2G01880 PEP complex component.
AT2G01890 Encodes a purple acid phosphatase (PAP) belonging to the low molecular weight plant PAP group.
AT2G01910 Binds microtubules. Induces a crisscross mesh of microtubules, not bundles. Not involved in microtubule polymerization nor nucleation. Localizes to mitochondria. The mRNA is cell-to-cell mobile.
AT2G01920 ENTH/VHS/GAT family protein;(source:Araport11)
AT2G01930 BASIC PENTACYSTEINE1 (BPC1) is a regulator of the homeotic Arabidopsis thaliana gene SEEDSTICK (STK), which controls ovule identity. BPC1 induces conformational changes by cooperative binding to purine-rich elements present in the STK regulatory sequence. STK is upregulated in bpc1 mutant.Along with BPC2, BPC1 binds to the promoter of and represses GALS1 thereby reducing beta 1,4- galactan accumulation.
AT2G01940 Encodes a transcription factor that, together with IDD14 and IDD16, regulates auxin biosynthesis and transport and thus aerial organ morphogenesis and gravitropic responses. May be involved in an early event in shoot gravitropism such as gravity perception and/or a signaling process subsequent to amyloplast sedimentation as a putative transcription factor in gravity-perceptive cells.
AT2G01950 Encodes a leucine rich repeat receptor kinase and associated with provascular/procambial cells. Similar to BRI, brassinosteroid receptor protein.
AT2G01960 Member of TETRASPANIN family
AT2G01980 Encodes a plasma membrane-localized Na+/H+ antiporter SOS1. Functions in the extrusion of toxic Na+ from cells and is essential for plant salt tolerance. Has 12 predicted transmembrane domains in the N-terminal region and a long cytoplasmic tail of approx. 700 aa at the C-terminal side. SOS1 interacts through its predicted cytoplasmic tail with RCD1, a regulator of oxidative-stress responses, suggesting that SOS1 might function in oxidative-stress tolerance.
AT2G02010 glutamate decarboxylase 4;(source:Araport11)
AT2G02020 Major facilitator superfamily protein;(source:Araport11)
AT2G02030 F-box family protein;(source:Araport11)
AT2G02050 NADH-ubiquinone oxidoreductase B18 subunit;(source:Araport11)
AT2G02061 Nucleotide-diphospho-sugar transferase family protein;(source:Araport11)
AT2G02070 RAVEN is part of the network regulated by BLJUEJAY, JACKDAW, SACRECROW and SHORT-ROOT to regulate root tissue patterning through cell lineage specification and asymmetric cell division. RAVEN is directly activated by SHORT-ROOT and directly repressed by JACKDAW.
AT2G02080 C2H2 BIRD transcription factor family.
AT2G02100 Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. The mRNA is cell-to-cell mobile.
AT2G02148 PPR containing protein;(source:Araport11)
AT2G02170 Remorin family protein;(source:Araport11)
AT2G02220 Encodes a protein interacting with phytosulfokine, a five amino acid sulfated peptide (YIYTQ). Contains dual guanylate cyclase and kinase catalytic activities that operate in vivo.
AT2G02230 phloem protein 2-B1;(source:Araport11)
AT2G02240 F-box family protein;(source:Araport11)
AT2G02250 phloem protein 2-B2;(source:Araport11)
AT2G02270 pseudogene of phloem protein 2-B2;(source:Araport11)
AT2G02300 phloem protein 2-B5;(source:Araport11)
AT2G02340 phloem protein 2-B8;(source:Araport11)
AT2G02350 encodes a protein containing an F-box domain and physically interacts with SCF subunit SKP1/ASK1. The protein also exhibits similarity in sequence to phloem protein 2 (PP2) from cucumber.
AT2G02370 SNARE associated Golgi protein family;(source:Araport11)
AT2G02380 Encodes glutathione transferase belonging to the zeta class of GSTs. Naming convention according to Wagner et al. (2002).
AT2G02430 pseudogene of Arginyl-tRNA synthetase;(source:Araport11)
AT2G02450 NAC domain containing protein 35;(source:Araport11)
AT2G02560 Arabidopsis thaliana homolog of human CAND1 (cullin-associated and neddylation-dissociated). Putative similarity to TBP-interacting protein TIP120. Ubiquitously expressed in plant tissues throughout development. T-DNA insertion mutant plants were completely sterile and resistant to sirtinol and auxin, but not to gibberellins or brassinolide. Displayed developmental phenotypes similar to those of axr1, namely, short petioles, downwardly curling leaves, shorter inflorescence. Required for SCF function and appears to modulate SCF complex cycling. Physically interacts with CUL1. The mRNA is cell-to-cell mobile.
AT2G02580 member of CYP71B
AT2G02590 small multi-drug export protein;(source:Araport11)
AT2G02660 F-box associated ubiquitination effector family protein;(source:Araport11)
AT2G02700 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT2G02720 Pectate lyase family protein;(source:Araport11)
AT2G02740 Encodes a homolog of the potato p24 protein. It shares the conserved KGKAAL domain, a putative DNA-binding domain, with potato p24 and is localized to the plastid and not the nucleus.
AT2G02770 4-phosphopantetheinyl transferase domain protein;(source:Araport11)
AT2G02780 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G02790 Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family.
AT2G02800 Encodes protein kinase APK2b.
AT2G02810 Encodes a multitransmembrane hydrophobic protein that functions as transporter of UDP-galactose and UDP-glucose into the Golgi. Localized in the ER. Involved in the unfolded protein response, a mechanism that controls proper protein folding in the ER.
AT2G02830 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-37 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT2G02860 encodes a sucrose transporter in sieve elements and a number of sink tissues and cell types. Gene expression is induced by wounding.
AT2G02880 mucin-like protein;(source:Araport11)
AT2G02890 F-box family protein;(source:Araport11)
AT2G02900 pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10)
AT2G02910 transmembrane protein (DUF616);(source:Araport11)
AT2G02950 Encodes a basic soluble protein which can independently bind to either PHYA or PHYB, regardless of whether the phytochromes are in the Pr or Pfr state. PKS1 can be phosphorylated by oat phyA in vitro in a light regulated manner. It is postulated to be a negative regulator of phyB signalling.
AT2G02960 RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11)
AT2G02980 Encodes a chloroplast RNA editing factor.
AT2G03010 hypothetical protein (DUF577);(source:Araport11)
AT2G03060 Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL30 is expressed in pollen.It forms heterodimers with other MICK family members.
AT2G03090 member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana.
AT2G03110 putative RNA-binding protein;(source:Araport11)
AT2G03120 homologous to Signal Peptide Peptidases (SPP), required for pollen development and pollen germination. No homozygotes could be recovered from a T-DNA insertion mutant. The mRNA is cell-to-cell mobile.
AT2G03160 SKP1-like 19;(source:Araport11)
AT2G03190 one of SKP1 homologs. Gene is expressed specifically in the silique.
AT2G03200 Atypical aspartic protease which modulates lateral root development.
AT2G03210 member of Glycosyltransferase Family- 37
AT2G03240 EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11)
AT2G03250 EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11)
AT2G03260 EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11)
AT2G03280 O-fucosyltransferase family protein;(source:Araport11)
AT2G03340 Encodes WRKY DNA-binding protein 3 (WRKY3).
AT2G03410 Mo25 family protein;(source:Araport11)
AT2G03420 hypothetical protein;(source:Araport11)
AT2G03440 Induced at the transcriptional level by Pseudomonas syringae pv. tomato infection.
AT2G03450 purple acid phosphatase 9;(source:Araport11)
AT2G03460 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT2G03470 ELM2 domain-containing protein;(source:Araport11)
AT2G03500 Encodes a nuclear localized member of the MYB family of transcriptional regulators that is involved in negative regulation of flowering. It is expressed in vascular tissues and at low levels in the shoot apex during the transition to flowering. Loss of function mutations are early flowering.EFM is involved in the autonomous, thermosensory and GA pathways and expression is directly regulated by SVP. EFM interacts with JMJD5 to repress FT expression.
AT2G03505 Carbohydrate-binding X8 domain superfamily protein;(source:Araport11)
AT2G03520 Encodes AtUPS4, a member of the Arabidopsis ureide permease family.
AT2G03550 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT2G03565 hypothetical protein;(source:Araport11)
AT2G03590 Encodes a member of a class of allantoin transporters.
AT2G03630 suppressor SRP40-like protein;(source:Araport11)
AT2G03690 Ubiquinone biosynthesis protein COQ4 homolog.
AT2G03720 Involved in root hair development
AT2G03740 Late embryogenesis abundant protein. Associates with and stabilizes membranes as part of cryoprotective response.
AT2G03750 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT2G03760 Encodes a brassinosteroid sulfotransferase. In vitro experiements show that this enzyme has a preference for 24-epibrassinosteroids, particularly 24-epicathasterone, but does not act on castasterone and brassinolide. It also shows sulfating activity toward flavonoids. It is differentially expressed during development, being more abundant in young seedlings and actively growing cell cultures. Expression is induced in response to salicylic acid and methyl jasmonate and bacterial pathogens.
AT2G03770 Encodes a sulfotransferase with sulfating activity toward flavonoids, specifically kaempferol.
AT2G03800 encodes a D-aminoacyl-tRNA deacylase. Involved in detoxification of D-aminoacyl-tRNA. Mutants also show ethanol-hypersensitive phenotype.
AT2G03810 18S pre-ribosomal assembly protein gar2-like protein;(source:Araport11)
AT2G03840 TET13 encodes a member of the TETRASPANIN gene family that is expressed in the hypophysis, QC, root stem cells, lateral root primordia and is involved in primary root growth and lateral root development.
AT2G03850 Late embryogenesis abundant protein (LEA) family protein;(source:Araport11)
AT2G03870 Small nuclear ribonucleoprotein family protein;(source:Araport11)
AT2G03880 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT2G03890 Phosphoinositide kinase which undergo autophosphorylation and phosphorylate serine/threonine residues of protein substrates. Contains phosphoinositide 3/4-kinase and ubiquitin-like domains. The mRNA is cell-to-cell mobile.
AT2G03913 Encodes a defensin-like (DEFL) family protein.
AT2G03915 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT2G03970 transposable_element_gene;(source:Araport11);pseudogene, similar to SAE1-S9-protein, blastp match of 33%25 identity and 1.2e-17 P-value to GP|4760708|dbj|BAA77394.1||AB012866 SAE1-S9-protein {Brassica rapa};(source:TAIR10)
AT2G03980 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT2G04030 Encodes a chloroplast-targeted 90-kDa heat shock protein located in the stroma involved in red-light mediated deetiolation response and crucial for protein import into the chloroplast stroma. Mutants are resistant to chlorate, have elongated hypocotyls in light, and affect the expression of NR2, CAB, and RBCS but NOT NR1 and NiR.
AT2G04032 zinc transporter 7 precursor;(source:Araport11)
AT2G04035 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to (GB:AC005508);(source:TAIR10)
AT2G04036 transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 2.6e-169 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10)
AT2G04039 NdhV is loosely associated with the NDH complex and is required for stabilizing NDH subcomplexes A and E.
AT2G04045 Encodes a defensin-like (DEFL) family protein.
AT2G04047 Encodes a defensin-like (DEFL) family protein.
AT2G04050 MATE efflux family protein;(source:Araport11)
AT2G04070 Expression in rosette leaves is activated by high concentration of boron.
AT2G04110 pseudogene of expressed protein;(source:Araport11)
AT2G04160 isolated from differential screening of a cDNA library from auxin-treated root culture. encodes a protein similar to subtilisin-like serine protease which is believed to be active outside the plant cell.
AT2G04170 TRAF-like family protein;(source:Araport11)
AT2G04190 TRAF-like family protein;(source:Araport11)
AT2G04220 DUF868 family protein (DUF868);(source:Araport11)
AT2G04250 pseudogene of ribonuclease H;(source:Araport11)
AT2G04260 pseudogene of P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11)
AT2G04290 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.1e-36 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10)
AT2G04300 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G04350 AMP-dependent synthetase and ligase family protein;(source:Araport11)
AT2G04400 Acts during tryptophan biosynthesis controlled by ERF109.
AT2G04425 Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT2G04450 Encodes a protein with NADH pyrophosphatase activity. Although this protein was also shown to have ADP-ribose diphosphatase activity in vitro, mutant analyses suggest that NUDX6 is involved in NADH metabolism in vivo.
AT2G04495 transmembrane protein;(source:Araport11)
AT2G04500 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT2G04530 Encodes a protein with RNAse Z activity suggesting a role in tRNA processing. Protein contains a signal sequence for import into the chloroplast.
AT2G04550 Encodes a protein phosphatase that interacts with MPK12, but not with other MAP kinases. It can dephosphorylate a dually phosphorylated MPK12 in vitro and can inactivate MPK12 in vivo. ibr5 mutants have reduced sensitivity to auxin and abscisic acid. IBR5 promotes auxin responses, including auxin-inducible transcription, differently than the TIR1 auxin receptor and without destabilizing Aux/IAA repressor proteins. It plays a role in male gametophyte development, auxin and TCP growth regulatory pathways. Regulates leaf serrations development via modulation of the expression of PIN1.
AT2G04560 transferases, transferring glycosyl groups;(source:Araport11)
AT2G04580 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10)
AT2G04590 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-28 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10)
AT2G04620 Encodes a Zn transporter that localizes to the Golgi apparatus and forms a functional complex with AtMTP5t1 to transport Zn into the Golgi.
AT2G04625 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to reverse transcriptase;(source:TAIR10)
AT2G04675 hypothetical protein;(source:Araport11)
AT2G04790 PTB domain engulfment adapter;(source:Araport11)
AT2G04810 F-box only protein (DUF295);(source:Araport11)
AT2G04820 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.8e-214 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT2G04850 Auxin-responsive family protein;(source:Araport11)
AT2G04890 Encodes a scarecrow-like protein (SCL21). Member of GRAS gene family.
AT2G04900 hypothetical protein;(source:Araport11)
AT2G05025 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT2G05040 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.6e-200 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10)
AT2G05050 Protein phosphatase 2C family protein;(source:Araport11)
AT2G05060 Protein kinase superfamily protein;(source:Araport11)
AT2G05070 Encodes Lhcb2.2. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus.
AT2G05090 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G37080.1);(source:TAIR10)
AT2G05100 Lhcb2.1 protein encoding a subunit of the light harvesting complex II. Member of a gene family with high degree of sequence similarity. Initially LHCB2.3 was considered as a separate gene but appears to be an allele of LHCB2.1.
AT2G05110 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.6e-51 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10)
AT2G05117 Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein).
AT2G05120 Nucleoporin, Nup133/Nup155-like protein;(source:Araport11)
AT2G05160 CCCH-type zinc fingerfamily protein with RNA-binding domain-containing protein;(source:Araport11)
AT2G05210 Encodes AtPOT1a, an accessory factor for telomerase required for positive telomere length regulation. Note on nomenclature: different names have been given to Arabidopsis POT-like genes (Kuchar and Fajkus, 2004; Shakirov et al, 2005; Tani and Murata, 2005). According to a unifying nomenclature (Surovtseva et al, 2007), At2g05210 (previously named AtPOT1) is designated AtPOT1a, while At5g06310 (previously named AtPOT2) is designated AtPOT1b.
AT2G05280 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.4e-30 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10)
AT2G05320 beta-1,2-N-acetylglucosaminyltransferase II;(source:Araport11)
AT2G05350 hypothetical protein;(source:Araport11)
AT2G05360 F-box associated ubiquitination effector family protein;(source:Araport11)
AT2G05380 glycine-rich protein 3 short isoform (GRP3S) mRNA, complete The mRNA is cell-to-cell mobile.
AT2G05410 MATH domain/coiled-coil protein;(source:Araport11)
AT2G05420 TRAF-like family protein;(source:Araport11)
AT2G05430 Ubiquitin-specific protease family C19-related protein;(source:Araport11)
AT2G05440 GLYCINE RICH PROTEIN 9;(source:Araport11)
AT2G05441 Annotated as unknown pseudogene.Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167
AT2G05490 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.4e-88 P-value blast match to Q9SL18 /349-510 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT2G05518 other_RNA;(source:Araport11)
AT2G05580 Glycine-rich protein family;(source:Araport11)
AT2G05620 Involved in electron flow in Photosystem I. Essential for photoprotection.
AT2G05635 DEAD helicase
AT2G05640 transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, low similarity to SP|Q9UUA2 DNA repair and recombination protein pif1, mitochondrial precursor {Schizosaccharomyces pombe};(source:TAIR10)
AT2G05642 Nucleic acid-binding, OB-fold-like protein;(source:Araport11)
AT2G05690 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.9e-45 P-value blast match to O22273 /233-373 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT2G05730 pseudogene of DNA (cytosine-5-)-methyltransferase family protein;(source:Araport11)
AT2G05740 pseudogene of DNA (cytosine-5-)-methyltransferase family protein;(source:Araport11)
AT2G05750 transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 2.9e-126 P-value blast match to GB:AAA66266 unknown protein ORF1 transposable element En-1 (CACTA-element) (Zea mays);(source:TAIR10)
AT2G05760 Xanthine/uracil permease family protein;(source:Araport11)
AT2G05840 Encodes 20S proteasome subunit PAA2 (PAA2).
AT2G05910 LURP-one-like protein (DUF567);(source:Araport11)
AT2G05914 Potential natural antisense gene, locus overlaps with AT2G05915
AT2G05920 Subtilase family protein;(source:Araport11)
AT2G05940 Encodes a receptor-like cytoplasmic kinase that phosphorylates the host target RIN4, leading to the activation of a plant innate immune receptor RPM1.
AT2G05950 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G32050.1);(source:TAIR10)
AT2G05960 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.2e-200 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10)
AT2G05970 F-box protein (DUF295);(source:Araport11)
AT2G06020 Homeodomain-like superfamily protein;(source:Araport11)
AT2G06025 Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11)
AT2G06050 Encodes a 12-oxophytodienoate reductase that is required for jasmonate biosynthesis. Mutants are male sterile and defective in pollen dehiscence. Shows activity towards 2,4,6-trinitrotoluene. CFA-Ile, CFA-Leu, CFA-Val, CFA-Met and CFA-Ala can restore the fertility of opr3 plants by inducing filament elongation and anther dehiscence.
AT2G06060 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.7e-05 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10)
AT2G06080 transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 38%25 identity and 7.7e-40 P-value to GP|21952510|gb|AAM82604.1|AF525305_2|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10)
AT2G06200 Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in root, shoot and flower
AT2G06210 Encodes a yeast CTR9 homolog that is involved in the control of flowering time by elevating FLC expression to a level that creates the vernalization-responsive, winter-annual habit. Yeast CTR9 is a component of a five-member PAF1 complex that associates with RNA pol II and is thought to regulate gene expression by recruiting SET1 (a histone 3 Lys 4 [H3-K4] methyl transferase) to the initially transcribed [5'] regions of target chromatin. Mutants display reduced H3-K4 methylation in both FLC and FLM chromatin. Member of PAF-C complex.
AT2G06260 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.0e-28 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT2G06500 hAT family dimerization domain-containing protein;(source:Araport11)
AT2G06760 transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.4e-38 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10)
AT2G06770 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.7e-15 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT2G06780 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.8e-17 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10)
AT2G06822 Pseudogene of AT2G06822
AT2G06840 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-184 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT2G06845 Beta-galactosidase related protein;(source:Araport11)
AT2G06880 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.5e-55 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10)
AT2G06908 hypothetical protein;(source:Araport11)
AT2G06910 transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 4.3e-100 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10)
AT2G06920 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 7.7e-13 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10)
AT2G06922 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-20 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10)
AT2G06925 Encodes a secretory phospholipase A2 enzyme, which specifically hydrolyzes the sn-2 position of phospholipids. The enzyme has a preference towards linoleoyl acyl chain over palmitoyl acyl chain. It also has a slight preference for phosphatidylcholine over phosphatidylethanolamine.
AT2G06930 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-233 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT2G06940 pseudogene of Pectin lyase-like superfamily protein;(source:Araport11)
AT2G06950 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-243 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10)
AT2G06980 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT2G06985 pseudogene of Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT2G06990 Encodes a putative DExH-box RNA helicase that acts redundantly with HEN1, HUA1, and HUA2 in the specification of floral organ identity in the third whorl.
AT2G07000 hypothetical protein;(source:Araport11)
AT2G07020 kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11)
AT2G07040 Pollen receptor kinase. Coexpression of AtPRK2a with AtRopGEF12 resulted in isotropic pollen tube growth.
AT2G07070 transposable_element_gene;(source:Araport11)
AT2G07090 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43920.1);(source:TAIR10)
AT2G07150 transposable_element_gene;(source:Araport11);pseudogene, similar to P0707D10.17, blastp match of 27%25 identity and 3.3e-12 P-value to GP|13603432|dbj|BAB40159.1||AP002910 P0707D10.17 {Oryza sativa (japonica cultivar-group)};(source:TAIR10)
AT2G07160 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.2e-44 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10)
AT2G07213 Natural antisense transcript overlaps with AT2G07215;(source:Araport11)
AT2G07360 TPLATE-associated SH3 domain containing protein.
AT2G07440 two-component responsive regulator-related / response regulator protein-like protein;(source:Araport11)
AT2G07530 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 4.4e-17 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT2G07540 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 7.8e-90 P-value blast match to gb|AAL06421.1|AF378079_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10)
AT2G07560 H[+]-ATPase 6;(source:Araport11)
AT2G07640 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT2G07680 Encodes ABCC13/MRP11, a member of the multidrug resistance associated protein MRP/ABCC subfamily. Its expression is induced by gibberellic acid and downregulated by naphthalene acetic acid, abscisic acid, and zeatin.
AT2G07687 Cytochrome c oxidase, subunit III;(source:Araport11)
AT2G07690 Member of the minichromosome maintenance complex, involved in DNA replication initiation. Abundant in proliferating and endocycling tissues. Localized in the nucleus during G1, S and G2 phases of the cell cycle, and are released into the cytoplasmic compartment during mitosis. Binds chromatin.
AT2G07700 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.7e-21 P-value blast match to GB:226407 retrotransposon del1-46 (Gypsy_Ty3-element) (Lilium henryi);(source:TAIR10)
AT2G07716 pseudogene of Sec-independent periplasmic protein translocase;(source:Araport11)
AT2G07811 pseudogene of mitochondrial protein
AT2G07981 hypothetical protein;(source:Araport11)
AT2G08986 hypothetical protein;(source:Araport11)
AT2G09795 Natural antisense transcript overlaps with AT2G09800. Has been identified as a translated small open reading frame by ribosome profiling.
AT2G09860 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.1e-47 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10)
AT2G09890 transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, PIF1 family of mitochondrial helicases;(source:TAIR10)
AT2G09990 Ribosomal protein S5 domain 2-like superfamily protein;(source:Araport11)
AT2G10253 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT2G10260 Ulp1 protease family protein;(source:Araport11)
AT2G10430 pseudogene of hypothetical protein;(source:Araport11)
AT2G10450 14-3-3 family protein;(source:Araport11)
AT2G10530 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.9e-42 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10)
AT2G10535 Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT2G10589 pseudogene of splicing factor 3A subunit;(source:Araport11)
AT2G10610 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-162 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10)
AT2G10710 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to MURA transposase of maize Mutator transposon;(source:TAIR10)
AT2G10800 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.9e-92 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10)
AT2G10820 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.8e-34 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10)
AT2G10850 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43970.1);(source:TAIR10)
AT2G11000 Encodes a non-functional Arabidopsis homolog of the yeast protein MAK10, a component of the N-terminal acetyltransferase complex C. Mutant plants have normal photosynthesis as well as growth rates and pigmentation comparable to wild type.
AT2G11140 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.0e-71 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT2G11190 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-90 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10)
AT2G11220 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-16 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT2G11235 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.6e-94 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10)
AT2G11345 transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT4G04130.1);(source:TAIR10)
AT2G11530 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.4e-24 P-value blast match to Q9SI25 /181-349 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT2G11623 Plant protein 1589 of unknown function;(source:Araport11)
AT2G11640 transposable_element_gene;(source:Araport11);pseudogene, replication protein A1;(source:TAIR10)
AT2G11690 transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 4.8e-34 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10)
AT2G11778 transmembrane protein;(source:Araport11)
AT2G11810 MGD3 is the major enzyme for galactolipid metabolism during phosphate starvation. Does not contribute to galactolipid synthesis under P1-sufficient conditions.
AT2G11850 transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, PIF1 family of mitochondrial helicases;(source:TAIR10)
AT2G11880 None;(source:Araport11)
AT2G11891 hypothetical protein;(source:Araport11)
AT2G11950 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.9e-158 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT2G11990 pseudogene of AGAMOUS-like 57;(source:Araport11)
AT2G12160 pseudogene of Transcriptional factor B3 family protein;(source:Araport11)
AT2G12170 hypothetical protein;(source:Araport11)
AT2G12320 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32169.1);(source:TAIR10)
AT2G12385 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT2G12390 transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 1.5e-186 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10)
AT2G12400 plasma membrane fusion protein;(source:Araport11)
AT2G12475 Encodes a defensin-like (DEFL) family protein.
AT2G12480 serine carboxypeptidase-like 43;(source:Araport11)
AT2G12646 Plant AT-rich sequence and zinc-binding transcription factor (PLATZ) family protein which plays central role in mediating RGF1 signalling. Controls root meristem size through ROS signalling.
AT2G12650 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-38 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10)
AT2G12670 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.9e-29 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10)
AT2G12855 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.4e-13 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10)
AT2G12890 pseudogene of Class-II DAHP synthetase family protein;(source:Araport11)
AT2G12905 hypothetical protein;(source:Araport11)
AT2G13080 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.7e-183 P-value blast match to GB:AAD11615 prpol (gypsy_Ty3-element) (Zea mays);(source:TAIR10)
AT2G13116 pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11)
AT2G13146 Pseudogene of AT2G12905
AT2G13175 transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.5e-34 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT2G13274 Pseudogene of AT2G13150; transcription factor
AT2G13300 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.8e-11 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10)
AT2G13335 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 9.7e-06 P-value blast match to GB:BAA84457 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902444|dbj|BAA84457.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10)
AT2G13360 Encodes a peroxisomal photorespiratory enzyme that catalyzes transamination reactions with multiple substrates. It is involved in photorespiration.
AT2G13420 Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167
AT2G13460 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.0e-35 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10)
AT2G13500 Ta11-like non-LTR retrotransposon;(source:Araport11)
AT2G13510 Ta11-like non-LTR retrotransposon;(source:Araport11)
AT2G13547 hypothetical protein;(source:Araport11)
AT2G13570 nuclear factor Y, subunit B7;(source:Araport11)
AT2G13580 pseudogene of hypothetical protein;(source:Araport11)
AT2G13590 pseudogene of Ta11-like non-LTR retrotransposon;(source:Araport11)
AT2G13610 ABC-2 type transporter family protein;(source:Araport11)
AT2G13620 member of Putative Na+/H+ antiporter family
AT2G13680 Responsible for the synthesis of callose deposited at the primary cell wall of meiocytes, tetrads and microspores. Required for exine formation during microgametogenesis and for pollen viability. Highest expression in meiocytes, tetrads, microspores and mature pollen.
AT2G13690 PRLI-interacting factor;(source:Araport11)
AT2G13706 Pseudogene of AT4G15975; zinc finger (C3HC4-type RING finger) family protein
AT2G13720 putative DNA topoisomerase;(source:Araport11)
AT2G13810 ALD1 is a L-lysine alpha-aminotransferase. It is part of the pipecolic acid biosynthetic pathway, where it catalyzes the biochemical conversion of lysine to epsilon-amino-alpha-ketocaproic acid (KAC) which is subject to subsequent transamination, cyclization and isomerization to form 2,3-dehydropipecolic acid.
AT2G14060 encodes a protein whose sequence is similar to SAM:salicylic acid carboxyl methyltransferase (SAMT) (GI:6002712)(Clarkia breweri) and to SAM:benzoic acid carboxyl methyltransferase (BAMT)(GI:9789277)(Antirrhinum majus)
AT2G14070 wound-responsive protein-like protein;(source:Araport11)
AT2G14090 pseudogene of F-box/RNI-like superfamily protein;(source:Araport11)
AT2G14190 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 8.5e-177 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT2G14200 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.0e-133 P-value blast match to gb|AAO73523.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT2G14210 MADS box gene, transcription factor
AT2G14247 Expressed protein;(source:Araport11)
AT2G14370 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.2e-116 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10)
AT2G14440 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G14500 F-box family protein;(source:Araport11)
AT2G14510 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G14520 CBS domain protein (DUF21);(source:Araport11)
AT2G14535 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-19 P-value blast match to GB:CAA37925 orf 3 (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT2G14540 serpin 2;(source:Araport11)
AT2G14550 pseudogene of RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT2G14570 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G48290.1);(source:TAIR10)
AT2G14605 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.9e-29 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10)
AT2G14620 xyloglucan endotransglucosylase/hydrolase 10;(source:Araport11)
AT2G14640 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.5e-119 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10)
AT2G14670 sucrose-proton symporter 8;(source:Araport11)
AT2G14680 myosin heavy chain-like protein;(source:Araport11)
AT2G14690 Encodes a putative glycosyl hydrolase family 10 protein (xylanase).
AT2G14700 hypothetical protein;(source:Araport11)
AT2G14710 F-box family protein;(source:Araport11)
AT2G14830 Ist1p;(source:Araport11)
AT2G14835 RING/U-box superfamily protein;(source:Araport11)
AT2G14850 SPT module subunit, interacts with HAG1.
AT2G14960 encodes a protein similar to IAA-amido synthases. Lines carrying an insertion in this gene are hypersensitive to auxin.
AT2G15012 Pseudogene of AT4G00416; MBD3 (methyl-CpG-binding domain 3); DNA binding
AT2G15045 transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT4G08860.1);(source:TAIR10)
AT2G15080 receptor like protein 19;(source:Araport11)
AT2G15090 Encodes KCS8, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). The mRNA is cell-to-cell mobile.
AT2G15120 pseudogene of Plant basic secretory protein (BSP) family protein;(source:Araport11)
AT2G15300 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G15325 Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15.
AT2G15330 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to reverse transcriptase;(source:TAIR10)
AT2G15380 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.1e-29 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10)
AT2G15390 Encodes an alpha-(1,2)-fucosyltransferase.
AT2G15480 UDP-glucosyl transferase 73B5;(source:Araport11)
AT2G15500 RNA-binding protein;(source:Araport11)
AT2G15510 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.0e-20 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10)
AT2G15530 RING/U-box superfamily protein;(source:Araport11)
AT2G15535 low-molecular-weight cysteine-rich 10;(source:Araport11)
AT2G15580 RING/U-box superfamily protein;(source:Araport11)
AT2G15610 hypothetical protein (DUF1685);(source:Araport11)
AT2G15630 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT2G15640 F-box family protein;(source:Araport11)
AT2G15660 AGAMOUS-like 95;(source:Araport11)
AT2G15670 transmembrane protein;(source:Araport11)
AT2G15680 Encodes a calmodulin-like protein.
AT2G15730 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT2G15740 Member of a small family of zinc finger containing putative transcription factors.Similar to GAZ.
AT2G15760 calmodulin-binding protein (DUF1645);(source:Araport11)
AT2G15765 pseudogene of F-box/RNI-like superfamily protein;(source:Araport11)
AT2G15815 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G26350.1);(source:TAIR10)
AT2G15830 hypothetical protein;(source:Araport11)
AT2G15840 pseudogene of hypothetical protein;(source:Araport11)
AT2G15850 pseudogene of non-LTR retroelement reverse transcriptase;(source:Araport11)
AT2G15890 Encodes CBP1, a regulator of transcription initiation in central cell-mediated pollen tube guidance.
AT2G15910 CSL zinc finger domain-containing protein;(source:Araport11)
AT2G16010 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G07630.1);(source:TAIR10)
AT2G16050 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT2G16060 Encodes a class 1 nonsymbiotic hemoglobin induced by low oxygen levels with very high oxygen affinity. It is not likely to be a hemoglobin transporter because of its extremely high affinity for oxygen. Overexpression impairs cold stress-induced nitric oxide (NO) production.
AT2G16120 polyol/monosaccharide transporter 1;(source:Araport11)
AT2G16130 polyol/monosaccharide transporter 2;(source:Araport11)
AT2G16145 Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:GGTTCGTACGTACACTGTTCA
AT2G16210 Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily.
AT2G16230 O-Glycosyl hydrolases family 17 protein;(source:Araport11)
AT2G16260 pseudogene of glycine-rich RNA-binding protein
AT2G16270 transmembrane protein;(source:Araport11)
AT2G16300 F-box family protein;(source:Araport11)
AT2G16310 pseudogene of endoplasmatic reticulum retrieval protein 1B;(source:Araport11)
AT2G16340 hypothetical protein;(source:Araport11)
AT2G16360 40S ribosomal protein S25;(source:Araport11)
AT2G16367 Encodes a defensin-like (DEFL) family protein.
AT2G16380 Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT2G16385 CAF1 is a peptide hormone expressed in the root stele that specifically binds the endodermis-expressed leucine-rich repeat receptor kinase GASSHO1 (GSO1)/SCHENGEN3 and its homolog, GSO2. Together with CAF2 it is required for formation of the casparian band.
AT2G16405 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT2G16440 Regulates DNA replication via interaction with BICE1 and MCM7.
AT2G16450 F-box and associated interaction domains-containing protein;(source:Araport11)
AT2G16460 coiled-coil 90B-like protein (DUF1640);(source:Araport11)
AT2G16505 Encodes a Maternally expressed gene (MEG) family protein. Expressed in pollen and involved in pollen-stigma interaction.
AT2G16520 RING/U-box protein with C6HC-type zinc finger protein;(source:Araport11)
AT2G16535 Encodes a Maternally expressed gene (MEG) family protein
AT2G16660 Major facilitator superfamily protein;(source:Araport11)
AT2G16690 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G41570.1);(source:TAIR10)
AT2G16700 Encodes actin depolymerizing factor 5 (ADF5).
AT2G16710 Iron-sulfur cluster biosynthesis family protein;(source:Araport11)
AT2G16720 Encodes a member of MYB3R- and R2R3- type MYB- encoding gene family that acts as a repressor of flavonol biosynthesis. AtMYB7 gene expression is induced by salt treatment.
AT2G16730 putative beta-galactosidase (BGAL13 gene)
AT2G16740 ubiquitin-conjugating enzyme 29;(source:Araport11)
AT2G16750 kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11)
AT2G16760 Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11)
AT2G16800 Encodes a nuclear-encoded chloroplast protein that plays an important role in vegetative growth, female gametogenesis, and embryogenesis likely by mediating chloroplast integrity and development.
AT2G16810 F-box and associated interaction domains-containing protein;(source:Araport11)
AT2G16840 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-06 P-value blast match to GB:AAC64917 gag-pol polyprotein (Ty1_Copia-element) (Glycine max);(source:TAIR10)
AT2G16860 GCIP-interacting family protein;(source:Araport11)
AT2G16905 pseudogene of MATE efflux family protein;(source:Araport11)
AT2G16970 Major facilitator superfamily protein;(source:Araport11)
AT2G16990 Major facilitator superfamily protein;(source:Araport11)
AT2G17000 Mechanosensitive ion channel family protein;(source:Araport11)
AT2G17010 MSL8 encodes a protein with similarity to mechano-sensitive channel proteins. MSL8 is expressed specifically in pollen and germinating pollen tubes.It regulates pollen germination and is needed to maintain cellular integrity during pollen hydration and germination.
AT2G17030 Encodes a SKP1/ASK-interacting protein.
AT2G17036 F-box SKIP23-like protein (DUF295);(source:Araport11)
AT2G17040 Member of the NAC transcription factor family and more specifically, the ONAC022 subfamily. Involved in leaf and inflorescence stem morphogenesis. The mRNA is cell-to-cell mobile.
AT2G17043 hypothetical protein;(source:Araport11)
AT2G17050 disease resistance protein (TIR-NBS-LRR class);(source:Araport11)
AT2G17060 Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT2G17090 Encodes a N-myrystolylated plasma membrane associated member of the RLCK II family of IRAK/Pelle-like kinases that regulates the MAPK pathway that promotes the elongation of the Arabidopsis zygote and the development of its basal daughter cell into the extra-embryonic suspensor. SSP transcripts are produced in mature pollen but are not translated until delivery to the zygote and the endosperm after fertilization, exerting a paternal effect on embryonic development. The primary role of its kinase domain may lie in protein binding rather than in catalysis as key residues of the active site are absent.
AT2G17110 DNA-directed RNA polymerase subunit beta, putative (DUF630 and DUF632);(source:Araport11)
AT2G17130 Encodes a regulatory subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase.
AT2G17160 Interleukin-1 receptor-associated kinase 4 protein;(source:Araport11)
AT2G17170 Protein kinase superfamily protein;(source:Araport11)
AT2G17180 Target promoter of the male germline-specific transcription factor DUO1.
AT2G17200 Encodes a ubiquitin receptor protein that specifically associates with PEX2 and PEX12.
AT2G17210 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT2G17220 Encodes a putative serine/threonine-specific protein kinase kin3. Protein is N-myristoylated.
AT2G17250 Encodes a nucleolar protein that is a ribosome biogenesis co-factor. Mutants display aberrant RNA processing and homozygous embryos arrest in the globular stage of development.
AT2G17270 Encodes a mitochondrial phosphate transporter. Modulates plant responses to salt stress.
AT2G17300 hypothetical protein;(source:Araport11)
AT2G17310 Encodes an F-Box protein that regulates a novel induced defense response independent of both salicylic acid and systemic acquired resistance
AT2G17380 Encodes clathrin assembly protein AP19. The mRNA is cell-to-cell mobile.
AT2G17442 hypothetical protein;(source:Araport11)
AT2G17450 Encodes a putative RING-H2 finger protein RHA3a.
AT2G17460 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 5.5e-22 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT2G17470 Encodes ALMT6, a member of the aluminum-activated malate transporter family.
AT2G17477 Pseudogene of AT3G22350; F-box family protein
AT2G17490 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.3e-199 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT2G17500 Auxin efflux carrier family protein;(source:Araport11)
AT2G17520 Encodes a endoribonuclease/protein kinase IRE1-like protein that is predicted to form a type I transmembrane protein structure and contain kinase/endoribonuclease domains at their C-terminal halves. The transcript levels for several ER-stress responsive genes, including six protein disulfide isomerases (PDIs), BiP2, and AtbZIP60 are not affected in ire1-2 null mutants. The mRNA is cell-to-cell mobile.
AT2G17540 hypothetical protein;(source:Araport11)
AT2G17580 Encodes a bacterial-type poly(A) polymerase, AGS1.
AT2G17600 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT2G17630 Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11)
AT2G17670 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT2G17695 outer envelope protein;(source:Araport11)
AT2G17710 Big1;(source:Araport11)
AT2G17723 Encodes a defensin-like (DEFL) family protein.
AT2G17730 Intrinsic thylakoid membrane protein that fixes RPOTmp on the stromal side of the thylakoid membrane.
AT2G17740 VACUOLELESS GAMETOPHYTES (VLG) as a DC1 domain containing protein that is found in the endomembrane system. It is essential for both female and male gametophyte development.
AT2G17750 Intrinsic thylakoid membrane protein that fixes RPOTmp on the stromal side of the thylakoid membrane.
AT2G17760 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT2G17780 Encodes a mechanosensitive channel candidate MCA2. The three-dimensional structure of MCA2 was reconstructed and appears to comprise a small transmembrane region and large cytoplasmic region.
AT2G17785 zinc-binding protein-like protein;(source:Araport11)
AT2G17790 Encodes a protein with similarity to yeast VPS35 which encodes a component of the retromer involved in retrograde endosomal transport. Mutants partially suppress the loss of VTI11 function in Arabidopsis and restores gravitropism in the double mutant. The mRNA is cell-to-cell mobile.
AT2G17820 Encodes a member of the histidine kinase family.
AT2G17830 F-box and associated interaction domains-containing protein;(source:Araport11)
AT2G17840 Identified as drought-inducible gene by differential hybridization. Upregulated by high light, drought, cold and salt stress determined by microarray analysis.
AT2G17845 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT2G17850 Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11)
AT2G17880 Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT2G17890 Encodes a member of Calcium Dependent Protein Kinase. Protein is N-myristoylated. Localizes to the plasma membrane. Localizes to the chloroplast when the myristoylation motif is mutated.
AT2G17910 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.8e-42 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10)
AT2G17920 nucleic acid binding / zinc ion binding protein;(source:Araport11)
AT2G17950 Homeobox gene controlling the stem cell pool. Expressed in the stem cell organizing center of meristems. Required to keep the stem cells in an undifferentiated state. Regulation of WUS transcription is a central checkpoint in stem cell control. The size of the WUS expression domain controls the size of the stem cell population through WUS indirectly activating the expression of CLAVATA3 (CLV3) in the stem cells and CLV3 repressing WUS transcription through the CLV1 receptor kinase signaling pathway. Repression of WUS transcription through AGAMOUS (AG) activity controls stem cell activity in the determinate floral meristem. Binds to TAAT element core motif. WUS is also involved in cell differentiation during anther development. Responds to CMV infection and represses virus accumulation in the meristem central and peripheral zones; inhibits viral protein synthesis by repressing the expression of plant S-adenosyl-L-methionine?dependent methyltransferases, which are involved in ribosomal RNA processing and ribosome stability.
AT2G17960 hypothetical protein;(source:Araport11)
AT2G18000 TBP-associated factor 14;(source:Araport11)
AT2G18010 SAUR-like auxin-responsive protein family;(source:Araport11)
AT2G18060 Encodes a NAC-domain transcription factor that is expressed in developing vessels and protoxylem. Along with other members of this family, VND1 appears to regulate the development of genes required for secondary cell wall biosynthesis.
AT2G18110 Translation elongation factor EF1B/ribosomal protein S6 family protein;(source:Araport11)
AT2G18140 Peroxidase superfamily protein;(source:Araport11)
AT2G18150 Peroxidase superfamily protein;(source:Araport11)
AT2G18180 Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT2G18190 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT2G18193 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT2G18196 Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT2G18200 transmembrane protein;(source:Araport11)
AT2G18260 member of SYP11 Gene Family
AT2G18300 DNA-binding bHLH protein involved in positive regulation of cell elongation and proliferation and, negative control of plant immunity.One component of PRE-IBH1-HBI1 tripartite module.
AT2G18330 AAA-type ATPase family protein;(source:Araport11)
AT2G18340 late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11)
AT2G18350 homeobox protein 24;(source:Araport11)
AT2G18380 Encodes a member of the GATA factor family of zinc finger transcription factors.
AT2G18450 Nuclear encoded mitochondrial flavoprotein subunit of succinate dehydrogenase complex .
AT2G18460 like COV 3;(source:Araport11)
AT2G18470 Proline-rich extensin-like receptor kinase 4. Functions at an early stage of ABA signalling inhibiting primary root cell elongation by perturbing Ca2+ homeostasis.
AT2G18480 Major facilitator superfamily protein;(source:Araport11)
AT2G18490 GAZ is a nuclear localized transcriptional activator that is regulated (decreased) by GA and ABA levels. GAZ is expressed in the root stele and may function non-cell autonomously to effect hormone mediated control of ground tissue maturation.
AT2G18500 ovate family protein 7;(source:Araport11)
AT2G18510 Essential gene (embryo lethal) that is similar to component of splicosome. Regulates embryonic pattern formation through Pol II-Mediated transcription of WOX2 an PIN7 (DOI:10.1016/j.isci.2019.09.004). JANUS positively regulates PLT1 expression in the root meristem by recruiting RNA polymerase II (Pol II) to PLT1 and by interacting with PLT1. Nuclear accumulation of JANUS in root meristem depends on IMB4. (DOI:10.1105/tpc.20.00108 )
AT2G18540 RmlC-like cupins superfamily protein;(source:Araport11)
AT2G18550 Encodes a homeodomain leucine zipper class I (HD-Zip I) protein.
AT2G18570 UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT2G18600 Ubiquitin-conjugating enzyme family protein;(source:Araport11)
AT2G18640 Encodes an endoplasmic reticulum-targeted geranylgeranyl pyrophosphate synthase
AT2G18660 Encodes PNP-A (Plant Natriuretic Peptide A). PNPs are a class of systemically mobile molecules distantly related to expansins; their biological role has remained elusive. PNP-A contains a signal peptide domain and is secreted into the extracellular space. Co-expression analyses using microarray data suggest that PNP-A may function as a component of plant defence response and SAR in particular, and could be classified as a newly identified PR protein. It is stress responsive and can enhance its own expression.
AT2G18690 transmembrane protein;(source:Araport11)
AT2G18700 Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain.
AT2G18710 Encodes a component of the thylakoid-localized Sec system involved in the translocation of cytoplasmic proteins into plastid.
AT2G18721 hypothetical protein;(source:Araport11)
AT2G18750 Calmodulin-binding protein;(source:Araport11)
AT2G18780 F-box and associated interaction domains-containing protein;(source:Araport11)
AT2G18820 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.7e-38 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10)
AT2G18850 SET domain-containing protein;(source:Araport11)
AT2G18860 Syntaxin/t-SNARE family protein;(source:Araport11)
AT2G18876 Encodes a microtubule-associated protein.
AT2G18880 vernalization5/VIN3-like protein;(source:Araport11)
AT2G18890 RLCK VI_A class kinase which activity is regulated by Rho-of-plants (ROP) GTPases. Controls seedling and plant growth in parallel with gibberrellin.
AT2G18900 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT2G18910 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT2G18960 Encodes a plasma membrane proton ATPase. Mutants have a reduced ability to close their stomata in response to drought and are affected in stomatal but not seed responsiveness to ABA. The mRNA is cell-to-cell mobile.
AT2G18969 Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors.
AT2G18970 hypothetical protein;(source:Araport11)
AT2G19060 SGNH hydrolase-type esterase superfamily protein;(source:Araport11)
AT2G19070 encodes a protein whose sequence is similar to anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (gi:2239091). BAHD acyltransferase. Uses hydroxycinnamoyl CoAs, including caffeoyl/feruoyl/p-coumaroyl/sinapoyl-CoA as acyl donors to fully substitute the N1, N5, and N10 positions of spermidine.
AT2G19080 metaxin-like protein;(source:Araport11)
AT2G19100 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.2e-33 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10)
AT2G19110 Encodes a protein with similarity to Zn ATPase. Can rescue Zn deficiency in yeast and Cd resistance, suggesting a role in Zn and Cd transport. The mRNA is cell-to-cell mobile.
AT2G19140 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-09 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT2G19160 Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11)
AT2G19170 Encodes a novel subtilisin-like serine protease.
AT2G19180 hypothetical protein;(source:Araport11)
AT2G19200 pseudogene of hypothetical protein (DUF626);(source:Araport11)
AT2G19210 Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11)
AT2G19220 Myb/SANT-like DNA-binding domain protein;(source:Araport11)
AT2G19290 hypothetical protein;(source:Araport11)
AT2G19310 HSP20-like chaperones superfamily protein;(source:Araport11)
AT2G19330 Encodes PIRL6, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction.
AT2G19350 transmembrane protein (DUF872);(source:Araport11)
AT2G19410 Plant U-box type E3 ubiquitin ligase (PUB).
AT2G19460 DUF3511 domain protein (DUF3511);(source:Araport11)
AT2G19580 Member of TETRASPANIN family
AT2G19630 F-box and associated interaction domains-containing protein;(source:Araport11)
AT2G19640 ASH1-related protein 2;(source:Araport11)
AT2G19650 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT2G19740 Ribosomal protein L31e family protein;(source:Araport11)
AT2G19755 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.2e-08 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT2G19800 Encodes a myo-inositol oxygenase family gene.
AT2G19806 transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 1.2e-19 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10)
AT2G19810 Encodes Oxidation-related Zinc Finger 1 (OZF1), a plasma membrane protein involved in oxidative stress.
AT2G19820 LOB domain-containing protein 9;(source:Araport11)
AT2G19870 tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11)
AT2G19880 Encodes Glucosylceramide synthase (GCS) which catalyzes the final step in glucosylceramide (GlcCer) synthesis by transferring a glucosyl residue from UDP-Glc to the ceramide backbone.
AT2G19890 hypothetical protein;(source:Araport11)
AT2G19910 RNA-dependent RNA polymerase family protein;(source:Araport11)
AT2G19950 This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC1 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (558-715 aa) portion of the protein.
AT2G20000 Required for cell division and cell differentiation in meristems. Encodes a homolog of the CDC27 subunit of the anaphase-promoting complex (APC). Unlike other CDC27 homologs in Arabidopsis, its transcription is cell cycle regulated. Strong hbt mutants give rise to seedlings that lack an anatomically recognizable quiescent center and differentiated columella root cap cells, the cell types derived from the wild-type hypophysis. Furthermore, they have no mitotically active root meristem and lack a differentiated lateral root cap.
AT2G20010 Gls protein (DUF810);(source:Araport11)
AT2G20030 RING/U-box superfamily protein;(source:Araport11)
AT2G20050 protein phosphatase 2C and cyclic nucleotide-binding/kinase domain-containing protein;(source:Araport11)
AT2G20080 hypothetical protein;(source:Araport11)
AT2G20100 Together with PFA1 and PFA3 governs the competence of pericycle cells to initiate lateral root primordium formation.
AT2G20110 Tesmin/TSO1-like CXC domain-containing protein which is a transcriptional repressor of genes required for maintenance of DNA methylation, including MET1, CMT3, DDM1, KYP and VIMs. Functions redundantly with its paralogue TCX5 in repressing the expression of these genes.
AT2G20180 Encodes a novel Myc-related bHLH transcription factor that has transcriptional activation activity in the dark. It is a key negative regulator of phytochrome-mediated seed germination and acts by inhibiting chlorophyll biosynthesis, light-mediated suppression of hypocotyl elongation and far-red light-mediated suppression of seed germination, and promoting negative gravitropism in hypocotyls. Light reduces this activity in a phy-dependent manner. The protein preferentially interacts with the Pfr forms of Phytochrome A (PhyA) and Phytochrome B (PhyB), is physically associated with APRR1/TOC1 and is degraded in red (R) and far-red (FR) light through the ubiquitin (ub)-26S proteasome pathway to optimize photomorphogenic development in Arabidopsis. It also negatively regulates GA3 oxidase expression.
AT2G20190 Encodes a microtubule-associated protein that is involved in both cell division and cell expansion. It likely promotes microtubule stability.
AT2G20270 Thioredoxin superfamily protein;(source:Araport11)
AT2G20290 member of Myosin-like proteins
AT2G20350 encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11.
AT2G20360 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT2G20362 transmembrane protein;(source:Araport11)
AT2G20370 Encodes a xyloglucan galactosyltransferase located in the membrane of Golgi stacks that is involved in the biosynthesis of fucose. It is also involved in endomembrane organization. It is suggested that it is a dual-function protein that is responsible for actin organization and the synthesis of cell wall materials. The mRNA is cell-to-cell mobile.
AT2G20495 Serine/Threonine-kinase;(source:Araport11)
AT2G20510 One of two loci encoding the TIM44 subunit of the mitochondrial inner membrane translocase complex. TIM44 subunit is the part of the complex that hydrolyzes ATP to provide energy for protein translocation to the inner membrane.
AT2G20520 fasciclin-like arabinogalactan-protein 6 (Fla6). Possibly involved in embryogenesis and seed development.
AT2G20560 DNAJ heat shock family protein;(source:Araport11)
AT2G20625 hypothetical protein (DUF626);(source:Araport11)
AT2G20630 PP2C induced by AVRRPM1;(source:Araport11)
AT2G20670 sugar phosphate exchanger, putative (DUF506);(source:Araport11)
AT2G20690 A synthetic gene encoding the catalytic domain of the Arabidopsis thaliana gene At2g20690 was recombinant expressed in E. coli demonstrating the molecular function of riboflavin synthase. The mRNA is cell-to-cell mobile.
AT2G20720 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT2G20724 Annotated as pseudogene of unknown protein.Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 .
AT2G20770 Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor.GCL2 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase.
AT2G20790 clathrin adaptor complexes medium subunit family protein;(source:Araport11)
AT2G20800 NAD(P)H dehydrogenase B4;(source:Araport11)
AT2G20880 Encodes ERF53, a drought-induced transcription factor. Belongs to the AP2/ERF superfamily, and has a highly conserved AP2 domain. Regulates drought-responsive gene expressions by binding to the GCC box and/or dehydration-responsive element (DRE) in the promoter of downstream genes. Overexpression of AtERF53 driven by the CaMV35S promoter resulted in an unstable drought-tolerant phenotype in T2 transgenic plants. Involved in heat shock response.
AT2G20921 hypothetical protein;(source:Araport11)
AT2G20970 lipid-binding protein;(source:Araport11)
AT2G20993 Pseudogene of AT2G21045
AT2G21050 Encodes LAX2 (LIKE AUXIN RESISTANT), a member of the AUX1 LAX family of auxin influx carriers. Required for the establishment of embryonic root cell organization.
AT2G21060 Glycine-rich protein (AtGRP2b). Also named as CSP4 (cold shock domain protein 4) containing a well conserved cold shock domain (CSD) and glycine-rich motifs interspersed by two retroviral-like CCHC zinc fingers. AtCSP4 is expressed in all tissues but accumulates in reproductive tissues and those undergoing cell divisions. Overexpression of AtCSP4 reduces silique length and induces embryo lethality.
AT2G21070 This gene is predicted to an encode a nuclear-localized protein that is involved in regulating the period of circadian rhythms without affecting their amplitude or robustness. FIONA1 seems to act as a central oscillator-associated component, but its transcript levels are not regulated in a circadian or light-dependent manner. FIONA1 also appears to be involved in photoperiod-dependent flowering.
AT2G21080 Ras guanine nucleotide exchange factor K;(source:Araport11)
AT2G21210 Putative auxin-regulated protein whose expression is downregulated in response to chitin oligomers.
AT2G21220 SAUR-like auxin-responsive protein family;(source:Araport11)
AT2G21300 ATP binding microtubule motor family protein;(source:Araport11)
AT2G21385 Encodes a chloroplast stroma localized protein that is found only in the green plant lineage. It is involved in assembly of the chloroplast ATP synthase complex.
AT2G21410 Vacuolar proton ATPase subunit VHA-a isoform 2. Localized in the tonoplast. Required for efficient nutrient storage but not for sodium accumulation.
AT2G21420 E3 ubiquitin ligases, member of the RING between RING fingers (RBR)-type RSL1/RFA family, key regulator of ABA receptor stability in root and leaf tissues, targeting ABA receptors for degradation in different subcellular locations.
AT2G21430 Papain family cysteine protease;(source:Araport11)
AT2G21440 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT2G21480 BUSP2 plays a smaller role than BUSP1 in pollen tube growth. bups1/2 double mutants have reduced feritlity due to premature rupture of pollen tubes before they reach the ovule but single busp2 mutants are fertile. BUSP2 interacts with RALF4/19 peptide ligands and ANX1/2 receptors. BUPS/ANX signaling may regulate and promote pollen tube growth.
AT2G21500 RING/U-box superfamily protein;(source:Araport11)
AT2G21510 DNAJ heat shock N-terminal domain-containing protein;(source:Araport11)
AT2G21530 SMAD/FHA domain-containing protein;(source:Araport11)
AT2G21540 SEC14-like 3;(source:Araport11)
AT2G21550 One of three DRTS genes, this is the most divergent one.THY3/DRTS3 is preferentially expressed in the shoot apex, stipules and root caps.
AT2G21560 nucleolar-like protein;(source:Araport11)
AT2G21640 Encodes a protein of unknown function that is a marker for oxidative stress response.Expression in rosette leaves is activated by high concentration of boron.
AT2G21680 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT2G21720 ArgH (DUF639);(source:Araport11)
AT2G21740 Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion.
AT2G21750 Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion.
AT2G21770 cellulose synthase, related to CESA6.
AT2G21780 hypothetical protein;(source:Araport11)
AT2G21830 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT2G21860 violaxanthin de-epoxidase-like protein;(source:Araport11)
AT2G21900 member of WRKY Transcription Factor; Group II-c
AT2G21910 member of CYP96A
AT2G21940 Encodes a shikimate kinase. Its transcripts appear to be expressed most highly in mature embryos and senescing leaves, and its transcript levels rise during heat stress and recovery. It is believed to be localized to the chloroplast.
AT2G21980 HAUS augmin-like complex subunit;(source:Araport11)
AT2G22040 Encodes a homolog of LST8 (Lethal with Sec Thirteen 8/G protein b subunit-like (LST8/GbL).
AT2G22050 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT2G22055 Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. This gene is contained within a highly AT-rich repetitive sequence region.
AT2G22060 galactose oxidase/kelch repeat protein;(source:Araport11)
AT2G22080 transmembrane protein;(source:Araport11)
AT2G22125 Encodes a protein involved in cell elongation in root and anther filaments. Mutants have greater cell volumes in root tissues and have additive phenotypes with other cell expansion mutants such as those carrying mutations in COB, QUI and POM1 loci. POM2/CSI1 promotes Cellulose Synthase and microtubule co-alignment. The mRNA is cell-to-cell mobile.
AT2G22140 Forms a complex with MUS81 that functions as endonuclease in DNA recombination and repair processes.
AT2G22150 pseudogene of TRAF-like family protein;(source:Araport11)
AT2G22180 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT2G22200 encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.
AT2G22210 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.1e-19 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10)
AT2G22240 ** Referred to as MIPS1 in Mitsuhashi et al 2008. Myo-inositol-1-phosphate synthase isoform 2. Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization.
AT2G22250 Encodes a prokaryotic-type plastidic aspartate aminotransferase with glutamate/aspartate-prephenate aminotransferase (PAT) activity.
AT2G22270 hematological/neurological-like protein;(source:Araport11)
AT2G22300 Encodes a putative CAM binding transcription factor. Loss of function mutations show enhanced resistance to fungal and bacterial pathogens suggesting that CAMTA functions to suppress defense responses.It acts in the cold response pathway, it can bind to and activate the expression of DREB1 genes.
AT2G22330 Encodes a cytochrome P450. Involved in tryptophan metabolism. Converts Trp to indole-3-acetaldoxime (IAOx), a precursor to IAA and indole glucosinolates. The mRNA is cell-to-cell mobile.
AT2G22335 pseudogene of cytochrome P450 family protein
AT2G22426 hypothetical protein;(source:Araport11)
AT2G22460 MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11)
AT2G22470 Encodes arabinogalactan-protein (AGP2).
AT2G22475 Encodes GL2-expression modulator (GEM). Involved in the spatial control of cell division, patterning and differentiation of Arabidopsis root epidermal cells. GEM interacts with CDT1, a DNA replication protein and TTG1 (TRANSPARENT TESTA GLABRA1), a WD40-repeat protein involved in GL2-dependent cell fate decision. GEM seems to participate in the maintenance of a repressor histone H3 epigenetics status of the GL2 and CPC (CAPRICE) promoters.
AT2G22500 Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470).
AT2G22510 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT2G22530 Alkaline-phosphatase-like family protein;(source:Araport11)
AT2G22560 Kinase interacting (KIP1-like) family protein;(source:Araport11)
AT2G22600 RNA-binding KH domain-containing protein;(source:Araport11)
AT2G22620 Rhamnogalacturonate lyase family protein;(source:Araport11)
AT2G22630 Encodes a MADs domain containing protein involved in promoting flowering. Loss of function mutations show delayed flowering in long days and reduced levels of LFY and AP1 expression.
AT2G22640 Component of the WAVE protein complex which act as activators of ARP2/3 complex involved in actin nucleation. Required for trichome morphogenesis. Required for accumulation of SCAR1 protein in vivo. Selectively stabilizes SCAR2.
AT2G22680 Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11)
AT2G22780 encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA.
AT2G22790 hypothetical protein;(source:Araport11)
AT2G22810 key regulatory enzyme in the biosynthesis of the plant hormone ethylene. ACS4 is specifically induced by indoleacetic acid (IAA).
AT2G22830 squalene epoxidase 2;(source:Araport11)
AT2G22860 Phytosulfokine 2 precursor, coding for a unique plant peptide growth factor. The mRNA is cell-to-cell mobile.
AT2G22890 Kua-ubiquitin conjugating enzyme hybrid localization domain-containing protein;(source:Araport11)
AT2G22955 Natural antisense transcript overlaps with AT2G22960;(source:Araport11)
AT2G22960 Encodes a putative flavonol-phenylacyltransferase. Some accessions (e.g. C24) contain a full length protein that produces high levels of saiginols compared to Col which is non producing. The producer strains also appear to be more resistant to UV-B irradiation.
AT2G22990 sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose.
AT2G23000 serine carboxypeptidase-like 10;(source:Araport11)
AT2G23010 serine carboxypeptidase-like 9;(source:Araport11)
AT2G23050 A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis.
AT2G23060 Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11)
AT2G23096 Encodes a prolyl 4-hydroxylase that modifies the extensin proteins in root hair cells.
AT2G23170 encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro.
AT2G23180 member of CYP96A
AT2G23220 member of CYP81D
AT2G23230 Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11)
AT2G23240 AtMT4b is a member of Type 4 metallothionein (MT) genes. It is involved in the early develoment of the embryo and in the accumulation of metal ions especially Zn in the seeds.
AT2G23270 Encoding a precursor protein of a secreted peptide that is responsive to flg22 stimulus. Finetuning role in modulation of immunity through the regulation of SA and JA biosynthesis and signalling pathways.
AT2G23290 Member of the R2R3 factor gene family.
AT2G23300 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G23310 Encodes AtRER1C1, a Golgi membrane protein involved in returning the molecules that are exported from the endoplasmic reticulum (ER) to the Golgi apparatus back to the ER (a mechanism known as retrieval). There are two Arabidopsis homologues of AtRERC1: AtRER1A and AtRER1B.
AT2G23380 Similar to the product of the Polycomb-group gene Enhancer of zeste. Catalytic component of the PRC2 complex.Required for stable repression of AG and AP3. Putative role in cell fate determination. Involved in the control of leaf morphogenesis. mutants exhibit curled, involute leaves. AGAMOUS and APETALA3 are ectopically expressed in the mutant.
AT2G23400 Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11)
AT2G23420 nicotinate phosphoribosyltransferase 2;(source:Araport11)
AT2G23430 Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1.
AT2G23440 transmembrane protein;(source:Araport11)
AT2G23450 Protein kinase superfamily protein;(source:Araport11)
AT2G23460 encodes a novel G-alpha protein that shares similarity to plant, yeast, and animal G-alpha proteins at the C-terminus. It contains an N-terminus that is as large as the C-terminus, is a member of a small family, and is expressed in all tissues examined, including roots, leaves, stems, flowers, and fruits.
AT2G23470 DUF647 domain containing protein. Mutants are male sterile with defects in endothecium, tapetum and stamen maturation.
AT2G23520 Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11)
AT2G23600 Encodes a protein shown to have carboxylesterase activity, methyl salicylate esterase activity, methyl jasmonate esterase activity, and methyl IAA esterase activity in vitro. MES2 appears to be involved in MeSA hydrolysis in planta. This protein does not act on MeGA4, or MEGA9 in vitro and has been show to be capable of hydrolyzing methyl ester nicotinate back to nicotinate.
AT2G23610 Encodes a protein shown to have carboxylesterase activity, methyl IAA esterase activity, and methyl jasmonate esterase activity in vitro. This protein does not act on methyl salicylate, MeGA4, or MEGA9 in vitro.
AT2G23620 Encodes a protein shown to have carboxylesterase activity, methyl salicylate esterase activity, methyl jasmonate esterase activity, and methyl IAA esterase activity in vitro. MES1 appears to be involved in MeSA hydrolysis in planta. Expression of MES1 can restore systemic acquired resistance in SAR-deficient tobacco plants. This protein does not act on MeGA4, or MEGA9 in vitro.
AT2G23630 SKU5 similar 16;(source:Araport11)
AT2G23660 LOB domain-containing protein 10;(source:Araport11)
AT2G23680 Cold acclimation protein WCOR413 family;(source:Araport11)
AT2G23710 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G09370.1);(source:TAIR10)
AT2G23755 transmembrane family 220 helix protein;(source:Araport11)
AT2G23760 Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw2 and saw1 may act redundantly to repress BP in leaves. Regulates together with BLH2 demethylesterification of homogalacturonan in seed mucilage.
AT2G23770 Encodes a putative LysM-containing receptor-like kinase LYK4. Shares overlapping function with LYK5 in mediating chitin-triggered immune responses. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain.
AT2G23800 encodes an endoplasmic reticulum-targeted geranylgeranyl pyrophosphate synthase
AT2G23810 Member of TETRASPANIN family
AT2G23820 Metal-dependent phosphohydrolase;(source:Araport11)
AT2G23830 PapD-like superfamily protein;(source:Araport11)
AT2G23834 hypothetical protein;(source:Araport11)
AT2G23850 pseudogene of uricase / urate oxidase / nodulin 35;(source:Araport11)
AT2G23870 pseudogene of Terpenoid cyclases family protein;(source:Araport11)
AT2G23945 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT2G23985 hypothetical protein;(source:Araport11)
AT2G24060 SUPPRESSOR OF VARIEGATION9 (SVR9),encodes a chloroplast-localized prokaryotic type translation initiation factor 3. Mutant plants shows both chloroplast development defect, and a series of leaf developmental abnormalities including more serrated leaf margin, disorganized mesophyll cells, and altered cotyledon venation patterns.
AT2G24070 QWRF motif protein (DUF566);(source:Araport11)
AT2G24080 F-box protein (DUF295);(source:Araport11)
AT2G24090 Ribosomal protein L35;(source:Araport11)
AT2G24110 pseudogene of ribosomal protein S11-beta;(source:Araport11)
AT2G24130 Leucine-rich receptor-like protein kinase family protein;(source:Araport11)
AT2G24140 myosin-J heavy chain-like protein (Protein of unknown function, DUF593);(source:Araport11)
AT2G24160 pseudogene of receptor like protein 37;(source:Araport11)
AT2G24165 pseudogene of receptor like protein 30;(source:Araport11)
AT2G24190 Encodes an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. In addition, this enzyme can reduce methylglyoxal in vitro. It is believed that this enzyme localizes to the cytosol like the closely related protein encoded by AT3G61220.
AT2G24210 terpene synthase 10;(source:Araport11)
AT2G24230 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G24270 Encodes a protein with non-phosphorylating NADP-dependent glyceraldehyde-3-phosphate dehydrogenase activity. The activity of the enzyme was determined from leaf extracts; the enzyme has not been purified to confirm activity.
AT2G24310 TPRXL;(source:Araport11)
AT2G24330 Encodes one of two LUNAPARK proteins in Arabidopsis. Both LNPA and LNPB are predominantly distributed throughout the ER, but not preferentially localized at the three-way junctions. Mutation of both LNPA and LNPB together caused the cortical ER to develop poor ER cisternae and a less dense tubular network. E3 ligase involved in degradation of RHD3 to maintain a tubular ER network.
AT2G24340 sequence-specific DNA binding transcription factor;(source:Araport11)
AT2G24360 STYK serine threonine kinase that phosphorylates several oil body proteins including OLE1 and CLO4/CAL4.
AT2G24370 kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11)
AT2G24390 AIG2-like (avirulence induced gene) family protein;(source:Araport11)
AT2G24420 DNA repair ATPase-like protein;(source:Araport11)
AT2G24430 NAC domain containing protein 38;(source:Araport11)
AT2G24460 C3HC4-type RING finger protein;(source:Araport11)
AT2G24470 filament-like protein (DUF869);(source:Araport11)
AT2G24510 F-box associated ubiquitination effector family protein;(source:Araport11)
AT2G24520 plasma membrane H+-ATPase;(source:Araport11)
AT2G24530 Member of SAGA complex, SPT modulu subunit, interacts with HAG1.
AT2G24560 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT2G24570 member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae.
AT2G24580 FAD-dependent oxidoreductase family protein;(source:Araport11)
AT2G24590 Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926.
AT2G24650 B3 domain-containing protein REM13;(source:Araport11)
AT2G24696 transcriptional factor B3 family protein;(source:Araport11)
AT2G24700 Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily.
AT2G24710 member of Putative ligand-gated ion channel subunit family
AT2G24720 member of Putative ligand-gated ion channel subunit family
AT2G24730 pseudogene of Ribosomal protein L4/L1 family;(source:Araport11)
AT2G24740 Encodes a SU(VAR)3-9 homolog, a SET domain protein (Homology Subgroup V; Orthology Group 1). Known SET domain proteins are involved in epigenetic control of gene expression. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. This protein is a putative histone methyltransferase (predicted to methylate H3K9/20) related to the the Drosophila Su(var)3-9 and mammalian G9a proteins.
AT2G24748 pseudogene of transcriptional factor B3 family protein
AT2G24760 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.9e-16 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10)
AT2G24761 pseudogene of self-incompatibility protein-related protein
AT2G24762 Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7).
AT2G24791 Pseudogene of AT5G18880; glucose transmembrane transporter
AT2G24800 Peroxidase superfamily protein;(source:Araport11)
AT2G24945 transmembrane protein;(source:Araport11)
AT2G25040 pseudogene of casein lytic proteinase B4;(source:Araport11)
AT2G25050 actin-binding FH2 (formin 2) family protein;(source:Araport11)
AT2G25060 early nodulin-like protein 14;(source:Araport11)
AT2G25070 Protein phosphatase 2C family protein;(source:Araport11)
AT2G25095 Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC. Pri-mRNA coordinates for MIR156a (converted to TAIR10 based on PMID19304749): Chr2: 10677064-10673957 (reverse), length: 3108 bp; exon coordinates: exon 1: 10677064 to 10676955, exon 2: 10676613 to 10676366, exon 3: 10674380 to 10674338, exon 4: 10674245
AT2G25100 Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11)
AT2G25120 Bromo-adjacent homology (BAH) domain-containing protein;(source:Araport11)
AT2G25130 ARM repeat superfamily protein;(source:Araport11)
AT2G25140 Encodes ClpB4, which belongs to the Casein lytic proteinase/heat shock protein 100 (Clp/Hsp100) family. Targeted to the mitochondrion, also referred to as ClpB-m. Transcripts of ClpB4 accumulate dramatically at high temperatures, suggesting that it may be involved in response to heat stress.
AT2G25180 Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical.The retention of leaf water content, maintenance of cell membrane stability, and enhancement of anthocyanin biosynthesis were found to contribute to the enhanced drought tolerance of the arr1,10,12 triple mutant. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem.
AT2G25185 Encodes a defensin-like (DEFL) family protein.
AT2G25190 PPPDE putative thiol peptidase family protein;(source:Araport11)
AT2G25200 hypothetical protein (DUF868);(source:Araport11)
AT2G25220 Protein kinase superfamily protein;(source:Araport11)
AT2G25240 Serine protease inhibitor (SERPIN) family protein;(source:Araport11). Involved in stress response regulated cell death.
AT2G25260 Hyp O-arabinosyltransferase-like protein;(source:Araport11)
AT2G25270 transmembrane protein;(source:Araport11)
AT2G25290 Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones.
AT2G25300 Encodes a hydroxyproline O-galactosyltransferase.
AT2G25310 ER membrane protein complex subunit-like protein (DUF2012);(source:Araport11)
AT2G25360 RING/U-box superfamily protein;(source:Araport11)
AT2G25380 pseudogene of zinc finger protein-related
AT2G25409 hypothetical protein;(source:Araport11)
AT2G25430 AP180 N-terminal homology domain, TPLATE complex protein involved in clathrin-mediated endocytosis.
AT2G25440 receptor like protein 20;(source:Araport11)
AT2G25460 EEIG1/EHBP1 protein amino-terminal domain protein;(source:Araport11)
AT2G25470 receptor like protein 21;(source:Araport11)
AT2G25500 Inosine triphosphate pyrophosphatase family protein;(source:Araport11)
AT2G25520 Drug/metabolite transporter superfamily protein;(source:Araport11)
AT2G25530 AFG1-like ATPase family protein;(source:Araport11)
AT2G25540 cellulose synthase
AT2G25565 C3HC4-type RING finger protein;(source:Araport11)
AT2G25600 Encodes SPIK, a member of the Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mutant plants have impaired pollen-tube growth.
AT2G25605 DNA-directed RNA polymerase subunit beta;(source:Araport11)
AT2G25620 Encodes DBP1, a member of the DBP factors (DNA-binding protein phosphatases) featuring sequence-specific DNA-binding and protein phosphatase activity. DBP1 is involved in plant-potyvirus interactions. Loss-of-function of DBP1 renders resistance to potyviruses. Negatively regulates drought and salt tolerance through altering leaf surface permeability.
AT2G25660 Translocon at the inner-envelope membrane of chloroplasts which binds to the outer-membrane channel TOC75.
AT2G25680 Encodes a high-affinity molybdate transporter. Mutant has reduced concentrations of molybdate in roots and shoots, and reduced shoot and root length when growing on Mo-limited medium.
AT2G25730 zinc finger FYVE domain protein;(source:Araport11)
AT2G25735 hypothetical protein;(source:Araport11)
AT2G25770 Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11)
AT2G25780 hypothetical protein (DUF1677);(source:Araport11)
AT2G25790 Leucine-rich receptor-like protein kinase family protein;(source:Araport11)
AT2G25810 tonoplast intrinsic protein 4;(source:Araport11)
AT2G25930 Encodes a nuclear protein that is expressed rhythmically and interacts with phytochrome B to control plant development and flowering through a signal transduction pathway. Required component of the core circadian clock regardless of light conditions.
AT2G25950 PITH domain protein (DUF1000);(source:Araport11)
AT2G25975 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.1e-14 P-value blast match to GB:CAA26446 ORF2 (Ty1_Copia-element) (Drosophila melanogaster);(source:TAIR10)
AT2G26010 Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2.
AT2G26030 F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT2G26120 glycine-rich protein;(source:Araport11)
AT2G26130 Encodes a RING-type zinc finger ubiquitin ligase involved in seed longevity.Gain of function (35S promoter) increases, and loss of function decreases, seed longevity.
AT2G26135 RING/U-box protein with C6HC-type zinc finger;(source:Araport11)
AT2G26170 Encodes a protein with similarity to thromboxane-A synthase, member of the CYP711A cytochrome P450 family. MAX1 is a specific repressor of vegetative axillary buds generated by the axillary meristem. Expressed in vascular traces in the rosette stem and axillary buds throughout plant development. Mutants have increased axillary branches. Along with MAX3,4 thought to mediate control of shoot branching via synthesis of a signal molecule which is transported over long distance mediated by MAX2. cDNA supports the existence of the longer transcript predicted for this locus, no cDNA isolated for shorter transcript. MAX1 downregulates 11 genes involved in flavonoid pathway (CHS, CHI, F3H, F3'H, FLS, DFR, ANS, UFGT, RT, AAC and GST).
AT2G26210 Ankyrin repeat family protein;(source:Araport11)
AT2G26240 Transmembrane proteins 14C;(source:Araport11)
AT2G26280 smr (Small MutS Related) domain-containing protein
AT2G26300 Encodes an alpha subunit of a heterotrimeric GTP-binding protein. The active GTP-bound form of GPA1 binds to the GTG1 and GTG2 abscisic acid (ABA) receptors and appears to affect their GTPase and GTP-binding activity, and hence, ABA binding abilities. GPA1 is a positive regulator in ABA-mediated inhibition of stomatal opening. Plants with recessive mutant alleles have complex phenotypes including: reduced brassinolide response, reduced cell divisions, round leaves, short hypocotyls. It is likely to be involved in the signaling events that trigger unfolded protein response-associated cell death. GPA1 is also involved in sugar signaling. The mRNA is cell-to-cell mobile.
AT2G26390 Serine protease inhibitor (SERPIN) family protein;(source:Araport11). Involved in stress response regulated cell death.
AT2G26400 Encodes a protein predicted to belong to the acireductone dioxygenase (ARD/ARD?)family.
AT2G26410 Member of IQ67 (CaM binding) domain containing family.
AT2G26440 Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT2G26450 Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT2G26460 Encodes SMU2, a protein involved in RNA splicing.
AT2G26480 UDP-glucosyl transferase 76D1;(source:Araport11)
AT2G26490 JGB contains seven WD40 repeats and is highly conserved in flowering plants. Overexpression inhibits pollen germination. suggesting JGB is a negative regulator of pollen germination
AT2G26500 cytochrome b6f complex subunit (petM);(source:Araport11)
AT2G26530 Pheromone receptor-like protein involved in the early elicitor signaling events which occur within minutes and include ion fluxes across the plasma membrane, activation of MPKs and the formation of ROS related to PGPS1 and WRKY33.
AT2G26540 Encodes a uroporphyrinogen-III synthase involved in tetrapyrrole biosynthesis. The protein localizes to the chloroplast. Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype
AT2G26580 plant-specific transcription factor YABBY family protein;(source:Araport11)
AT2G26590 regulatory particle non-ATPase 13;(source:Araport11)
AT2G26600 Glycosyl hydrolase superfamily protein;(source:Araport11)
AT2G26650 Encodes AKT1, a member of the Shaker family inward rectifying potassium channel predominantly expressed in predominantly in root hairs and root endodermis. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500).
AT2G26670 Encodes a plastid heme oxygenase necessary for phytochrome chromophore biosynthesis and for coupling the expression of some nuclear genes to the functional state of the chloroplast.
AT2G26680 FkbM family methyltransferase;(source:Araport11)
AT2G26690 Major facilitator superfamily protein;(source:Araport11)
AT2G26695 Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11)
AT2G26700 Member of AGC VIIIa Kinase gene family. Encodes PID2, a homolog of PID. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons.
AT2G26710 Encodes a member of the cytochrome p450 family that serves as a control point between multiple photoreceptor systems and brassinosteroid signal transduction. Involved in brassinolide metabolism. Mediates response to a variety of light signals including hypocotyl elongation and cotyledon expansion.
AT2G26730 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G26740 Encodes a soluble epoxide hydrolase whose expression is induced by auxin and water stress.
AT2G26750 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT2G26760 Cyclin B1;(source:Araport11)
AT2G26780 ARM repeat superfamily protein;(source:Araport11)
AT2G26790 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT2G26800 Mutant has increased seed ile, leu and val as well as his and arg.
AT2G26830 Encodes a member of a small family of choline/ethanolamine kinases that is localized to the plasma membrane. Homozygous loss of function alleles are embryo lethal. Overexpression results in altered phospholipid levels suggesting a critical role in phospholipid biosynthesis.
AT2G26882 Natural antisense transcript overlaps with AT2G26880;(source:Araport11)
AT2G26900 Sodium Bile acid symporter family;(source:Araport11)
AT2G26930 Encodes a 4-(cytidine 5'-phospho)-2-C-methyl-D-erithritol kinase.
AT2G26940 C2H2-type zinc finger family protein;(source:Araport11)
AT2G26950 Member of the R2R3 factor gene family.
AT2G26960 Member of the R2R3 factor gene family.Expressed in microspores and required for progression into pollen mitosis I.
AT2G26980 encodes a serine-threonine protein kinase whose expression increases in response to abscisic acid, cold, drought, high salt, and wounding conditions. The gene is expressed in developing seeds and seedlings. Lines carrying a T-DNA insertions have reduced germination efficiency and expression of cold, high-salt, and abscisic acid marker genes are altered, but not drought-response markers.
AT2G26990 Represses photomorphogenesis and induces skotomorphogenesis in the dark.
AT2G27000 member of CYP705A
AT2G27010 member of CYP705A
AT2G27035 Has been classified as a stellacyanin. Has also been classified as an early nodulin-like protein (ENODL), because it does not have a His residue involved in Cu binding. ENODLs are proteins having one plastocyanin-like (PCNL) domain lacking the amino acid residues necessary for Cu binding.
AT2G27060 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G27110 FAR1-related sequence 3;(source:Araport11)
AT2G27120 Encodes a protein with similarity to DNA polymerase epsilon catalytic subunit. Based on yeast two hybrid analysis, not predicted to be a subunit of the DNA polymerase epsilon complex. No phenotype observed in homozygous mutant embryos or plants but in combination with TIL1-1/til1-1 heterozygotes arrest earlier than til1 homozygotes suggesting TIL2 functions redundantly with TIL1.
AT2G27130 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT2G27140 HSP20-like chaperones superfamily protein;(source:Araport11)
AT2G27180 hypothetical protein;(source:Araport11)
AT2G27220 BEL1-like homeodomain 5;(source:Araport11)
AT2G27229 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT2G27230 Encodes a nuclear-localized transcriptional activator with weak sequence similarity to basic helix-loop-helix(bHLH)-domain proteins. It promotes the production of stele cells in root meristems and is required to establish and maintain the normal vascular cell number and pattern in primary and lateral roots.
AT2G27285 nuclear speckle splicing regulatory-like protein (DUF2040);(source:Araport11)
AT2G27300 NTL8 is a membrane-associated NAC transcription factor that binds both TRY and TCL1. Overexpression results in fewer trichomes.
AT2G27310 F-box family protein;(source:Araport11)
AT2G27315 egg cell-secreted-like protein (DUF1278);(source:Araport11)
AT2G27330 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT2G27350 Encodes an otubain-like histone deubiquitinase involved in chromatin modification and regulation of plant gene expression.
AT2G27380 Encodes an extensin like gene involved in seed germination.
AT2G27410 B3 domain protein, putative (DUF313);(source:Araport11)
AT2G27420 Cysteine proteinases superfamily protein;(source:Araport11)
AT2G27430 ARM repeat superfamily protein;(source:Araport11)
AT2G27440 pseudogene of rac GTPase activating protein
AT2G27480 Calcium-binding EF-hand family protein;(source:Araport11)
AT2G27490 AT2G27490 encodes dephospho-CoA kinase. The molecular function was shown to phosphorylate the ribosyl moiety forming CoA.
AT2G27500 Glycosyl hydrolase superfamily protein;(source:Araport11)
AT2G27505 FBD-like domain family protein;(source:Araport11)
AT2G27520 F-box and associated interaction domains-containing protein;(source:Araport11)
AT2G27580 Regulated by heat shock.
AT2G27680 NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11)
AT2G27690 Encodes a CYP94C1. Has highest omega-hydroxylase activity with 9,10-epoxystearic acid, while also metabolized lauric acid (C12:0) and C18 unsaturated fatty acids. Gene expression is induced in response to wounding and jasmonic acid treatment.
AT2G27710 60S acidic ribosomal protein family;(source:Araport11)
AT2G27730 copper ion binding protein;(source:Araport11)
AT2G27750 Surfeit locus protein 6;(source:Araport11)
AT2G27760 Encodes tRNA isopentenyltransferase, similar to yeast MOD5.
AT2G27770 DUF868 family protein (DUF868);(source:Araport11)
AT2G27790 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT2G27820 Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250].
AT2G27830 hypothetical protein;(source:Araport11)
AT2G27840 Belongs to the plant specific HD2 type proteins; similar to nucleolar Zea mays histone deacetylase; HD2-p39
AT2G27880 AGO5.Required for antiviral RNA silencing.Confers resistance to Potato virus X.
AT2G27900 coiled-coil protein;(source:Araport11)
AT2G27920 serine carboxypeptidase-like 51;(source:Araport11)
AT2G27930 PLATZ transcription factor family protein;(source:Araport11)
AT2G27990 Encodes a BEL1-like homeobox gene that functions together with PNY in meristem maintenance by regulating the allocation process during vegetative and reproductive development. Both gene products are required for the competence of the SAM to respond properly to floral inductive signals.
AT2G28056 Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AGAAUCUUGAUGAUGCUGCAU. Pri-mRNA coordinates for MIR172a (converted to TAIR10 based on PMID19304749): Chr2: 11943611-11941515 (reverse), length: 2097 bp; exon coordinates: exon 1: 11943611 to 11942837, exon 2: 11942688 to 11942600, exon 3: 11941905 to 11941515; mature miRNA and miRNA* are located on exon 1.
AT2G28060 Component of the regulatory subunit of SNF1-related protein kinase. As part of the regulatory complex it binds maltose which promotes kinase activity.
AT2G28070 ABC-2 type transporter family protein;(source:Araport11)
AT2G28080 UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT2G28085 SAUR-like auxin-responsive protein family;(source:Araport11)
AT2G28090 Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT2G28130 NSE5 subunit of the SMC5/6 complex.
AT2G28140 enabled-like protein (DUF1635);(source:Araport11)
AT2G28150 DUF966 domain containing protein, expressed during embryogenesis.
AT2G28160 Encodes a putative transcription factor that regulates iron uptake responses. mRNA is detected in the outer cell layers of the root and accumulates in response to iron deficiency. The expression of many iron-regulated genes is dependent on FIT1. It specifically regulates FRO2 at the level of mRNA accumulation and IRT1 at the level of protein accumulation.Similar to FER in tomato and is a regulator of iron uptake. It is post-transcriptionally controlled.
AT2G28190 Encodes a chloroplastic copper/zinc superoxide dismutase CSD2 that can detoxify superoxide radicals. Its expression is affected by miR398-directed mRNA cleavage. Activation depends totally on CCS. Overexpression of a miR398-resistant form of CSD2 leads to more dramatic improvements in stress (hight light, Cu2+ and methyl viologen) tolerance than overexpression of wild-type CSD2. The mRNA is cell-to-cell mobile.
AT2G28200 C2H2-type zinc finger family protein;(source:Araport11)
AT2G28250 Protein kinase superfamily protein;(source:Araport11)
AT2G28260 member of Cyclic nucleotide gated channel family
AT2G28270 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT2G28280 pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11)
AT2G28315 UXT1 is a member of the NST-KT subfamily of nucleotide/sugar transporters. It is localized to the golgi and ER. UXT1 functions as a UDP-Xyl transporter. The mRNA is cell-to-cell mobile.
AT2G28320 Pleckstrin homology (PH) and lipid-binding START domains-containing protein;(source:Araport11)
AT2G28350 Involved in root cap cell differentiation.
AT2G28390 SAND family protein;(source:Araport11)
AT2G28400 senescence regulator (Protein of unknown function, DUF584);(source:Araport11)
AT2G28420 Vicinal oxygen chelate (VOC) superfamily member.
AT2G28426 hypothetical protein;(source:Araport11)
AT2G28460 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT2G28490 RmlC-like cupins superfamily protein;(source:Araport11)
AT2G28500 LOB domain-containing protein 11;(source:Araport11)
AT2G28510 DOF transcription factor with a conserved zinc finger (ZF) DNA-binding domain.
AT2G28520 Vacuolar proton ATPase subunit VHA-a isoform 1. Localized in the trans-Golgi network. The mRNA is cell-to-cell mobile.
AT2G28560 Encodes a protein of the RAD51B family involved in double stranded DNA repair. Homozygous mutant plants show increased sensitivity to mitomycin which induces DS breaks.
AT2G28570 hypothetical protein;(source:Araport11)
AT2G28580 transmembrane protein, putative (DUF247);(source:Araport11)
AT2G28590 Protein kinase superfamily protein;(source:Araport11)
AT2G28610 Encodes a homeodomain containing protein that regulates lateral axis-dependent development of Arabidopsis flowers and is required for cell proliferation. It is expressed in a restricted number of L1 cells at the lateral regions of flower primordia, floral organ primordia, and young leaf primordia.
AT2G28640 A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT2G28650 A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT2G28660 Chloroplast-targeted copper chaperone protein;(source:Araport11)
AT2G28680 RmlC-like cupins superfamily protein;(source:Araport11)
AT2G28690 TOX high mobility group box protein, putative (DUF1635);(source:Araport11)
AT2G28710 C2H2-type zinc finger family protein;(source:Araport11)
AT2G28720 Histone superfamily protein;(source:Araport11)
AT2G28725 forkhead box protein G1;(source:Araport11)
AT2G28760 Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase.
AT2G28770 pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10)
AT2G28780 P-hydroxybenzoic acid efflux pump subunit;(source:Araport11)
AT2G28810 Dof-type zinc finger DNA-binding family protein;(source:Araport11)
AT2G28830 Encodes a U-box E3 ubiquitin ligase involved in ubiquitination of pattern recognition receptor FLS2.pub12/pub13 double mutants enhanced chitin-induced ROS production and callose deposition suggesting they function redundantly to negatively regulate immune response to fungal elicitor.
AT2G28840 Putative E3 Ub protein ligase; regulates thermoresponsive hypocotyl growth through mediating degradation of the thermosensor ELF3.
AT2G28870 cyclin-dependent kinase inhibitor SMR1-like protein;(source:Araport11)
AT2G28890 Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves.
AT2G28900 Encodes AtOEP16, a 16-KDa plastid outer membrane protein involved in plastid import of protochlorophyllide oxidoreductase A. Predominantly expressed in leaves and is also inducible by cold treatment.
AT2G28920 RING/U-box superfamily protein;(source:Araport11)
AT2G28930 protein kinase 1B;(source:Araport11)
AT2G28960 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G28970 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G28990 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G29010 pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G29040 Exostosin family protein;(source:Araport11)
AT2G29090 Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. This gene predominantly accumulates in dry seeds and is up-regulated immediately following imbibition. CYP707A2 appears to play a major role in the rapid decrease in ABA levels during early seed imbibition.
AT2G29100 member of Putative ligand-gated ion channel subunit family
AT2G29110 member of Putative ligand-gated ion channel subunit family
AT2G29120 member of Putative ligand-gated ion channel subunit family
AT2G29125 ROTUNDIFOLIA like 2;(source:Araport11)
AT2G29130 Putative laccase, knockout mutant had reduced root elongation under PEG-induced dehydration.miR397b regulates root lignin deposition by regulating LACCASE2 expression during drought and phosphate deficiency.
AT2G29160 pseudogene of senescence-associated gene 13;(source:Araport11)
AT2G29180 transmembrane protein;(source:Araport11)
AT2G29220 Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT2G29250 Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT2G29280 pseudogene of tropinone reductase;(source:Araport11)
AT2G29300 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT2G29350 Encodes a senescence associated protein required for resistance against fungal pathogens. Negative regulator of defense against bacterial pathogens. Induced by ROS. Required for defense against ROS and fungal pathogens most likely by activating anthocyanin biosynthesis.
AT2G29360 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT2G29410 member of Zinc transporter (ZAT) family
AT2G29440 Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).
AT2G29450 Encodes a member of the TAU glutathione S-transferase gene family. Gene expression is induced by exposure to auxin, pathogen and herbicides. Naming convention according to Wagner et al. (2002)
AT2G29460 Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). Role in the degradation of H2O2 to water using glutathione as electron donor
AT2G29480 Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).
AT2G29490 Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).
AT2G29525 Inositol phosphorylceramide synthase
AT2G29590 Thioesterase superfamily protein;(source:Araport11)
AT2G29610 pseudogene of the F-box protein family, contains Pfam profile PF00646: F-box domain
AT2G29620 dentin sialophosphoprotein;(source:Araport11)
AT2G29660 zinc finger (C2H2 type) family protein;(source:Araport11)
AT2G29720 Encodes CTF2B.
AT2G29740 UDP-glucosyl transferase 71C2;(source:Araport11)
AT2G29760 Encodes a chloroplast RNA editing factor.
AT2G29770 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT2G29790 Encodes a Maternally expressed gene (MEG) family protein [pseudogene]
AT2G29800 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT2G29810 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT2G29820 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT2G29860 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT2G29870 Aquaporin-like superfamily protein;(source:Araport11)
AT2G29930 F-box/RNI-like superfamily protein;(source:Araport11)
AT2G29940 pleiotropic drug resistance 3;(source:Araport11)
AT2G29950 Member of a small family of proteins containing DUF1313 domain. Involved in flowering time.
AT2G29960 encodes a cyclophilin protein that exhibits peptidylprolyl cis/trans-isomerase and protein refolding activities that were sensitive to cyclosporin A. The protein interacts with GNOM in vitro and is localized to both the cytosolic and membrane fractions. The gene is expressed in the developing embryo.
AT2G29970 Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. The mRNA is cell-to-cell mobile.
AT2G29980 Endoplasmic reticulum enzyme responsible for the synthesis of 18:3 fatty acids from phospholipids. Uses cytochrome b5 as electron donor.
AT2G29990 alternative NAD(P)H dehydrogenase 2;(source:Araport11)
AT2G30010 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT2G30060 Pleckstrin homology (PH) domain superfamily protein;(source:Araport11)
AT2G30070 Encodes a high affinity potassium transporter.
AT2G30080 member of Fe(II) transporter isolog family. Gene expression is not regulated by iron, copper, or zinc deficiency or excess.
AT2G30090 Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11)
AT2G30105 LRR/ubiquitin-like domain protein;(source:Araport11)
AT2G30170 Encodes a chloroplast PP2C phosphatase that is required for efficient dephosphorylation of PSII proteins and involved in light acclimation.Loss of function enhances immunity to bacterial pathogens.
AT2G30220 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT2G30230 6,7-dimethyl-8-ribityllumazine synthase;(source:Araport11)
AT2G30240 Encodes a plasma membrane localized potassium transporter.
AT2G30250 member of WRKY Transcription Factor; Group I. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress.
AT2G30280 Encodes RDM4, a transcriptional regulator functioning in RNA-directed DNA methylation and plant development.
AT2G30290 VACUOLAR SORTING RECEPTOR 2;(source:Araport11)
AT2G30300 Major facilitator superfamily protein;(source:Araport11)
AT2G30310 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT2G30330 Putative homolog of mammalian BLOC-1 Subunit 1. Protein - protein interaction with BLOS2 and also with SNX1.Located in endomembrane system and hypothesized to be involved in endomembrane transport.
AT2G30360 Encodes a SOS2-like protein kinase that is a member of the CBL-interacting protein kinase family.Loss of function mutants show a decrease in sensitivity to high pH.Phosphorylates AHA2, a plasma membrane H+ ATPase.This phosphorylation appears to regulate the activity of the proton transporter.
AT2G30370 Encodes a small, potentially secreted protein that acts as an inhibitor of stomatal production though likely not through direct interaction with the TMM receptor. It is homologous to known stomatal regulators EPF1 and EPF2. Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis.
AT2G30380 MYB family transcription factor;(source:Araport11)
AT2G30390 Encodes one of two ferrochelatase genes in Arabidopsis. Ferrochelatase is the terminal enzyme of heme biosynthesis. FC-II is speculated to operate in photosynthetic cytochromes.
AT2G30395 Member of the plant specific ovate protein family of unknown function.
AT2G30400 ovate family protein 2;(source:Araport11)
AT2G30410 mutant has embryo defect; enlarged embryo cells and endosperm nuclei; Tubulin Folding Cofactor A
AT2G30430 hypothetical protein;(source:Araport11)
AT2G30490 Encodes a cinnamate-4-hydroxylase. Mutations in this gene impact phenylpropanoid metabolism, growth and development.
AT2G30520 Encodes a phototropin-interacting NRL protein that is an early signaling component in the phototrophic response and is essential for the phototropin-mediated chloroplast accumulation response but is not involved in the chloroplast avoidance response or stomatal opening.
AT2G30530 zinc finger CCCH domain protein;(source:Araport11)
AT2G30540 Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2.
AT2G30550 Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols.
AT2G30560 Needs to be reannotated and split into two genes, AtEAL2 and AtEAL3, both encoding maize Ebb apparatus 1-like proteins. The current predicted structure is not well supported (T8, one *). The predicted proteins can be found in doi.org/10.1007/s00425-005-0174-z
AT2G30580 Encodes a C3HC4 RING-domain-containing ubiquitin E3 ligase capable of interacting with DREB2A. DRIP2 seems to be involved in regulating stress-related transcriptional changes and drought tolerance.
AT2G30590 Encodes WRKY DNA-binding protein 21 (WRKY21).
AT2G30600 BTB/POZ domain-containing protein;(source:Araport11)
AT2G30640 Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8).
AT2G30660 ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11)
AT2G30670 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT2G30750 Putative cytochrome P450; together with CYP71A13 produces dihydrocamalexic acid (DHCA), the precursor to the defense-related compound camalexin, which accumulates in the intercellular space and contributes to the resistance of mature Arabidopsis to P. syringae without directly inhibiting bacterial growth.
AT2G30790 Encodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution.
AT2G30800 Has RNA or DNA helicase activity and expressed specifically in tapetum and vascular tissue. First identified member of a new group of the mle helicase group of the DEAH family.
AT2G30820 aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit;(source:Araport11)
AT2G30850 pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10)
AT2G30880 Pleckstrin homology (PH) domain-containing protein;(source:Araport11)
AT2G30900 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT2G30910 actin-related protein C1A;(source:Araport11)
AT2G30940 Protein kinase superfamily protein;(source:Araport11)
AT2G30942 Encodes a 56-amino acid polypeptide with low but significant similarity to human small subunit of serine palmitoyltransferase that localizes to the ER and physically interacts with and greatly stimulates the activity of LCB1/LCB2 heterodimer ser palmitoyltransferase complex.
AT2G30960 myosin-M heavy chain-like protein;(source:Araport11)
AT2G30970 ASPARTATE AMINOTRANSFERASE 1
AT2G31018 hypothetical protein;(source:Araport11)
AT2G31020 OSBP(oxysterol binding protein)-related protein 1A;(source:Araport11)
AT2G31060 elongation factor family protein;(source:Araport11)
AT2G31080 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.3e-49 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10)
AT2G31081 Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon.
AT2G31110 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT2G31130 hypothetical protein;(source:Araport11)
AT2G31141 hypothetical protein;(source:Araport11)
AT2G31180 Member of the R2R3 factor gene family.
AT2G31250 Glutamyl-tRNA reductase family protein;(source:Araport11)
AT2G31260 Involved in autophagy, the process of vacuolar bulk degradation of cytoplasmic components. Mutant shows accelerated bolting and senescence.
AT2G31300 putative ARP2/3 protein complex subunit p41
AT2G31340 embryo defective 1381;(source:Araport11)
AT2G31345 transmembrane protein;(source:Araport11)
AT2G31370 Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11)
AT2G31380 a B-box zinc finger protein that interacts with COP1. contains a novel 11 amino acid motif at the C-terminus (also found at the N-terminus of HY5) that is involved in the COP1 interaction.
AT2G31410 coiled-coil protein;(source:Araport11)
AT2G31440 Encodes a gamma-secretase subunit. Associates with other subunits in intracellular membrane compartments.
AT2G31460 B3 domain protein, putative (DUF313);(source:Araport11)
AT2G31470 Encodes a F-Box protein DOR (Drought tolerance Repressor) functionally as an inhibitory factor for abscisic acid-induced stomatal closure under drought stress.
AT2G31500 member of Calcium Dependent Protein Kinase
AT2G31570 glutathione peroxidase GPx
AT2G31580 ICA1 is a nuclear localized member of the tRNA(His) guanylyl transferase superfamily. Loss of function alleles show increased sensitivity to growth at high temperatures defects in cell cycle progression and DNA repair.
AT2G31660 SAD2 (super sensitive to ABA and drought 2) encodes an importin beta-domain family protein likely to be involved in nuclear transport in ABA signaling. Subcellular localization of GFP-tagged SAD2 showed a predominantly nuclear localization, consistent with a role for SAD2 in nuclear transport. Mutation of SAD2 in Arabidopsis alters abscisic acid sensitivity. SAD2 was ubiquitously expressed at low levels in all tissues except flowers. SAD2 expression was not induced by ABA or stress. Loss of function mutations in SAD2 exhibit increased tolerance for UV stress, increased production of UV protective secondary metabolites and suppression of nuclear localization of MYB4 (a repressor of UV stress response genes). Regulates microRNA activity. Defective trichome activity.
AT2G31690 encodes a triacylglycerol lipase located in plastoglobuli and involved in the degradation of triacylglycerol. It also has impact on leaf senescence and maintaining the structural integrity of thylakoids.
AT2G31700 transmembrane protein;(source:Araport11)
AT2G31725 FAM136A-like protein (DUF842);(source:Araport11)
AT2G31730 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT2G31760 RING/U-box superfamily protein;(source:Araport11)
AT2G31770 RING/U-box superfamily protein;(source:Araport11)
AT2G31780 RING/U-box superfamily protein;(source:Araport11)
AT2G31820 Ankyrin repeat family protein;(source:Araport11)
AT2G31850 hypothetical protein;(source:Araport11)
AT2G31860 pseudogene of poly(ADP-ribose) glycohydrolase 2;(source:Araport11)
AT2G31862 B3 domain protein;(source:Araport11)
AT2G31865 poly(ADP-ribose) glycohydrolase 2;(source:Araport11)
AT2G31870 The gene encodes a poly(ADPribose) glycohydrolase (PARG1). Mutant analysis suggests that PARG1 plays a role in abiotic stress responses and DNA repair. Loss of function mutants accumulate poly(ADPribose) and have increased cell death when treated with bleomycin.
AT2G31902 Natural antisense transcript overlaps with AT2G31900;(source:Araport11)
AT2G31940 oxidoreductase/transition metal ion-binding protein;(source:Araport11)
AT2G31960 encodes a protein similar to callose synthase
AT2G31980 PHYTOCYSTATIN 2;(source:Araport11)
AT2G31981 hypothetical protein;(source:Araport11)
AT2G31990 Exostosin family protein;(source:Araport11)
AT2G32020 Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11)
AT2G32050 cell cycle control-like protein (DUF572);(source:Araport11)
AT2G32100 ovate family protein 16;(source:Araport11)
AT2G32130 intracellular protein transporter, putative (DUF641);(source:Araport11)
AT2G32150 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT2G32160 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT2G32179 Natural antisense transcript overlaps with AT2G32180;(source:Araport11)
AT2G32200 cysteine-rich/transmembrane domain A-like protein;(source:Araport11)
AT2G32235 hypothetical protein;(source:Araport11)
AT2G32260 phosphorylcholine cytidylyltransferase;(source:Araport11)
AT2G32270 A member of Zrt- and Irt-related protein (ZIP) family. transcript is induced in response to zinc deficiency in the root. also response to iron deficiency.
AT2G32290 beta-amylase 6;(source:Araport11)
AT2G32295 EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11)
AT2G32310 CCT motif family protein;(source:Araport11)
AT2G32315 Natural antisense transcript overlaps with AT2G32310;(source:Araport11)
AT2G32320 Interacts genetically with its homolog ICA1; alters growth and flowering time plasticity in relation to temperature. Mutants display effects on growth, flowering and plant development, and ploidy level depending on ambient temperature (effects specific at >27C).
AT2G32350 Ubiquitin-like superfamily protein;(source:Araport11)
AT2G32360 Ubiquitin-like superfamily protein;(source:Araport11)
AT2G32415 Polynucleotidyl transferase, ribonuclease H fold protein with HRDC domain-containing protein;(source:Araport11)
AT2G32430 Galactosyltransferase family protein;(source:Araport11)
AT2G32460 Member of the R2R3 factor gene family.
AT2G32470 F-box associated ubiquitination effector family protein;(source:Araport11)
AT2G32490 pseudogene of 3'-5' exonuclease domain-containing protein
AT2G32500 Stress responsive alpha-beta barrel domain protein;(source:Araport11)
AT2G32510 Member of MEKK subfamily involved in wound and JA induced signaling.Interacts with At5g40440, and activates At1g59580.
AT2G32530 encodes a gene similar to cellulose synthase
AT2G32540 encodes a gene similar to cellulose synthase The mRNA is cell-to-cell mobile.
AT2G32550 Cell differentiation, Rcd1-like protein;(source:Araport11)
AT2G32590 condensin complex subunit;(source:Araport11)
AT2G32610 encodes a gene similar to cellulose synthase
AT2G32620 encodes a gene similar to cellulose synthase
AT2G32645 B3 domain protein, putative (DUF313);(source:Araport11)
AT2G32660 receptor like protein 22;(source:Araport11)
AT2G32680 NLP20 LRR receptor protein involved in PAMP mediated immunity.
AT2G32700 Encodes a WD40 repeat and LUFS domain containing protein that is similar to LUG. Interacts physically with SEUSS and likely functions as part of a repressor complex that represses AG. Involved in cell wall modifications necessary for mucilage extrusion and mediates aluminium sensitivity through PECTIN METHYLESTERASE46-modulated root cell wall pectin methylesterification.
AT2G32710 Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI). A member of seven KRP genes found in Arabidopsis thaliana. Negative regulator of cell division. Expressed in actively dividing cells.
AT2G32740 galactosyltransferase 13;(source:Araport11)
AT2G32750 Exostosin family protein;(source:Araport11)
AT2G32770 purple acid phosphatase 13;(source:Araport11)
AT2G32785 Encodes a Rapid ALkalinization Factor (RALF) family protein
AT2G32800 protein kinase family protein;(source:Araport11)
AT2G32810 putative beta-galactosidase
AT2G32820 Transcription elongation factor (TFIIS) family protein;(source:Araport11)
AT2G32830 Encodes Pht1;5, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341).
AT2G32835 Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide.
AT2G32870 TRAF-like family protein;(source:Araport11)
AT2G32880 TRAF-like family protein;(source:Araport11)
AT2G32905 B3 domain protein, putative (DUF313);(source:Araport11)
AT2G32930 Encodes a zinc finger protein.
AT2G32960 Encodes an atypical dual-specificity phosphatase.
AT2G32970 G1/S-specific cyclin-E protein;(source:Araport11)
AT2G32980 HAUS augmin-like complex subunit;(source:Araport11)
AT2G33000 ubiquitin-associated (UBA)/TS-N domain-containing protein-like protein;(source:Araport11)
AT2G33020 receptor like protein 24;(source:Araport11)
AT2G33070 Encodes a nitrile-specifier protein NSP2. NSP2 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation.
AT2G33090 Transcription elongation factor (TFIIS) family protein;(source:Araport11)
AT2G33160 Gene structure annotation for AT2G33160.1 is inaccurate in TAIR10, see PMID:23709666 and Comments field on the locus page for updated annotation.
AT2G33170 Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11)
AT2G33190 F-box only protein (DUF295);(source:Araport11)
AT2G33205 Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11)
AT2G33230 Encodes a flavin monooxygenase gene which belongs to the tryptophan-dependent auxin biosynthetic pathway and enhances drought resistance.
AT2G33233 Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT2G33255 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT2G33270 Encodes a member of the thioredoxin family protein. Located in the chloroplast.
AT2G33280 Major facilitator superfamily protein;(source:Araport11)
AT2G33300 Transcription elongation factor (TFIIS) family protein;(source:Araport11)
AT2G33310 Auxin induced gene, IAA13 (IAA13).
AT2G33320 Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT2G33330 Encodes a plasmodesmal protein that affects the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain.
AT2G33350 CCT motif family protein;(source:Araport11)
AT2G33370 Ribosomal protein L14p/L23e family protein;(source:Araport11)
AT2G33385 actin-related protein C2B;(source:Araport11)
AT2G33420 hypothetical protein (DUF810);(source:Araport11)
AT2G33430 Encodes a multiple organellar RNA editing factor, a chloroplast protein which is required for the maturation of the plastid ribosomal RNAs and is essential for chloroplast differentiation.Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing.
AT2G33435 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT2G33470 glycolipid transfer protein 1;(source:Araport11)
AT2G33480 NAC domain containing protein 41;(source:Araport11)
AT2G33490 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT2G33500 B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11)
AT2G33530 serine carboxypeptidase-like 46;(source:Araport11)
AT2G33550 Homeodomain-like superfamily protein;(source:Araport11)
AT2G33585 subtilisin-like protease;(source:Araport11)
AT2G33650 pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10)
AT2G33680 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT2G33690 Late embryogenesis abundant protein, group 6;(source:Araport11)
AT2G33700 Encodes a putative protein phosphatase 2C that positively regulates salt tolerance in abscisic acid-dependent manner.
AT2G33707 Encodes a defensin-like (DEFL) family protein.
AT2G33710 encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.
AT2G33720 AP2/B3-like transcriptional factor family protein;(source:Araport11)
AT2G33750 Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.
AT2G33775 Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide.
AT2G33780 VQ motif-containing protein;(source:Araport11)
AT2G33796 FBD-like domain family protein;(source:Araport11)
AT2G33800 Encodes SCABRA1 (SCA1), a nuclear gene encoding a plastid-type ribosomal protein that functions 
as a structural component of the 70S plastid ribosome. The sca1-rps5 allele exhibits defects in plastid 16SrRNA processing and a resulting decrease in accumulation of photosynthetic proteins. Loss-of-function mutations enhance the polarity defects of the as2 mutants.
AT2G33830 Negative regulator of local and systemic acquired resistance; target of FLD for activation of SAR.
AT2G33845 Nucleic acid-binding, OB-fold-like protein;(source:Araport11)
AT2G33850 Stigmatic factor that plays a role during the early post-pollination stages.
AT2G33855 transmembrane protein;(source:Araport11)
AT2G33860 ettin (ett) mutations have pleiotropic effects on Arabidopsis flower development, causing increases in perianth organ number, decreases in stamen number and anther formation, and apical-basal patterning defects in the gynoecium. The ETTIN gene encodes a protein with homology to DNA binding proteins which bind to auxin response elements. ETT transcript is expressed throughout stage 1 floral meristems and subsequently resolves to a complex pattern within petal, stamen and carpel primordia. ETT probably functions to impart regional identity in floral meristems that affects perianth organ number spacing, stamen formation, and regional differentiation in stamens and the gynoecium. During stage 5, ETT expression appears in a ring at the top of the floral meristem before morphological appearance of the gynoecium, consistent with the proposal that ETT is involved in prepatterning apical and basal boundaries in the gynoecium primordium. It is a target of the ta-siRNA tasiR-ARF. ETT is also a target of AP2; integrateing the functions of AGAMOUS and APETALA2 in floral meristem determinacy. Positive regulation of drought stress response genes.
AT2G33880 Encodes a protein with similarity to WUS type homeodomain protein. Required for meristem growth and development and acts through positive regulation of WUS. Loss of function phenotypes include embryo lethality, hyponastic cotyledons, reduced root development and smaller meristems. Phenotypes can be rescued by addition of sucrose in the growth media. Overexpression can partially rescue the triple mutant cytokinin receptor phenotype suggesting HB-3 is a downstream effector of cytokinin signaling.
AT2G34000 RING/U-box superfamily protein;(source:Araport11)
AT2G34010 verprolin;(source:Araport11)
AT2G34020 Calcium-binding EF-hand family protein;(source:Araport11)
AT2G34030 Calcium-binding EF-hand family protein;(source:Araport11)
AT2G34070 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TBL37 expression is regulated by MYC2 and activated in response to JA.
AT2G34080 Cysteine proteinases superfamily protein;(source:Araport11)
AT2G34090 maternal effect embryo arrest 18;(source:Araport11)
AT2G34120 Cytochrome C oxidase polypeptide VIB family protein;(source:Araport11)
AT2G34123 Encodes a defensin-like (DEFL) family protein.
AT2G34140 CDF4 is member of the group II DOF transcription factor family is involved in regulation of differentiation root columella cells. It is a direct target of the transcriptional repressor WOX5. CDF4 itself is a transcriptional repressor that appears to repress root columella stem cell identity. Ectopic expression of CDF leads to premature differentiation of root columella cells.
AT2G34170 hypothetical protein (DUF688);(source:Araport11)
AT2G34180 Encodes CBL-interacting protein kinase 13 (CIPK13).
AT2G34186 hypothetical protein;(source:Araport11)
AT2G34210 Transcription elongation factor Spt5;(source:Araport11)
AT2G34220 ubiquitin carboxyl-terminal hydrolase-like protein, putative (DUF627 and DUF629);(source:Araport11)
AT2G34240 ubiquitin carboxyl-terminal hydrolase-like protein, putative (Protein with domains of unknown function DUF627 and DUF632);(source:Araport11)
AT2G34270 hypothetical protein;(source:Araport11)
AT2G34280 F-box and associated interaction domains-containing protein;(source:Araport11)
AT2G34300 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT2G34330 LOW protein: protein BOBBER-like protein;(source:Araport11)
AT2G34350 Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11)
AT2G34357 ARM repeat superfamily protein;(source:Araport11)
AT2G34360 MATE efflux family protein;(source:Araport11)
AT2G34380 Membrane protein involved in lipid droplet biogenesis primarily in pollen. The interaction between VAP27-1 and SEIPIN3 requires the N-terminal 25 amino acids of SEIPIN3 that contain an FFAT motif.
AT2G34490 Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze the conversion of both 24-epi-campesterol and β-sitosterol to brassicasterol and stigmasterol, respectively, in the presence of NADPH.
AT2G34500 Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze in the presence of NADPH the conversion of β-sitosterol to stigmasterol, but not that of 24-epi-campesterol to brassicasterol (unlike CYP710A2).
AT2G34510 Protein of unknown function, DUF642. Found in cellulose enriched cell wall fractions.
AT2G34530 transmembrane protein;(source:Araport11)
AT2G34540 hypothetical protein;(source:Araport11)
AT2G34580 cytomegalovirus UL139 protein;(source:Araport11)
AT2G34600 Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators.
AT2G34610 cotton fiber protein;(source:Araport11)
AT2G34620 Mitochondrial transcription termination factor family member.
AT2G34630 Encodes a geranyl diphosphate synthase. RNAi lines are dwarf. T-DNA knock-out lines are embryo lethal.
AT2G34655 hypothetical protein;(source:Araport11)
AT2G34670 benzoyl-CoA reductase subunit C, putative (DUF630 and DUF632);(source:Araport11)
AT2G34710 Dominant PHB mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. Has overlapping functions with PHAVOLUTA, REVOLUTA and CORONA.
AT2G34740 protein phosphatase 2C family protein;(source:Araport11)
AT2G34790 Encodes a BBE-like enzyme that acts in monolignol metabolism by catalyzing the oxidation of aromatic allylic alcohols, such as coumaryl-, sinapyl-, and coniferyl alcohol, to the corresponding aldehydes.
AT2G34820 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT2G34835 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.6e-32 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT2G34880 JMJ15 is a novel H3K4 demethylase that regulates genes involved in flowering and response to stress. It is also a maternally expressed, imprinted gene.
AT2G34890 Cytidine triphosphate synthase.
AT2G34910 root hair specific protein;(source:Araport11)
AT2G34920 RING/U-box superfamily protein;(source:Araport11)
AT2G34930 disease resistance family protein / LRR family protein;(source:Araport11)
AT2G34940 VACUOLAR SORTING RECEPTOR 5;(source:Araport11)
AT2G35080 ATP binding / aminoacyl-tRNA ligase/ nucleotide binding protein;(source:Araport11)
AT2G35110 Component of the WAVE protein complex which act as activators of ARP2/3 complex involved in actin nucleation. Required for trichome morphogenesis. Mutant displays distorted trichomes, a phenotype that can be phenocopied by treatment of WT plants with actin-interacting drugs. Its ER localization is independent of upstream SPK1 activation signaling and the physical association with the WAVE/SCAR Regulatory complex binding partner SRA1. ER-localized NAP1 has little colocalization with actin and represent the inactive pool of NAP1 in these cell types.
AT2G35150 Encodes EXORDIUM LIKE 7.
AT2G35200 DUF740 family protein;(source:Araport11)
AT2G35260 CAAX protease self-immunity protein;(source:Araport11)
AT2G35270 Direct target of AGAMOUS. Regulates patterning and differentiation of reproductive organs.
AT2G35280 F-box family protein;(source:Araport11)
AT2G35360 ubiquitin family protein;(source:Araport11)
AT2G35380 Peroxidase superfamily protein;(source:Araport11)
AT2G35382 snoRNA;(source:Araport11)
AT2G35390 Phosphoribosyltransferase family protein;(source:Araport11)
AT2G35420 RING/U-box superfamily protein;(source:Araport11)
AT2G35430 Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11)
AT2G35470 ribosome maturation factor;(source:Araport11)
AT2G35480 envelope glycoprotein;(source:Araport11)
AT2G35520 Defender against death (DAD family) protein;(source:Araport11)
AT2G35570 pseudogene of Serine protease inhibitor (SERPIN) family protein;(source:Araport11)
AT2G35585 cystic fibrosis transmembrane conductance regulator;(source:Araport11)
AT2G35600 Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity.
AT2G35615 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT2G35680 Encodes a phosphatidylglycerophosphate (PGP) phosphatase involved in the synthesis of plastidial Phosphatidylglycerol (PG) in conjunction with PGPP1 and PTPMT2 in root. PTPMT1 levels were higher in node, cauline leaf, and flower than in root, leaf, and stem.
AT2G35710 Nucleotide-diphospho-sugar transferases superfamily protein;(source:Araport11)
AT2G35760 Uncharacterized protein family (UPF0497);(source:Araport11)
AT2G35770 serine carboxypeptidase-like 28;(source:Araport11)
AT2G35860 Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development.
AT2G35890 member of Calcium Dependent Protein Kinase
AT2G35900 Mal d 1-associated protein;(source:Araport11)
AT2G35930 Encodes a cytoplasmically localized U-box domain containing E3 ubiquitin ligase that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity.
AT2G35945 Natural antisense transcript overlaps with AT2G35940;(source:Araport11)
AT2G35950 embryo sac development arrest 12;(source:Araport11)
AT2G35990 Putative lysine decarboxylase family protein;(source:Araport11)
AT2G36020 HVA22-like protein J;(source:Araport11)
AT2G36080 Encodes a plant-specific B3 DNA-binding domain transcription factor. Has transcription repressor activity.
AT2G36180 EF hand calcium-binding protein family;(source:Araport11)
AT2G36190 cwINV4 appears to function as a cell wall-localized invertase (that can catalyze the hydrolysis of sucrose into fructose and glucose) based on the phenotype of cwinv4 mutants. cwINV4 transcripts are expressed at high levels in lateral and median nectaries and this enzyme plays an important role in nectar production. Also expressed in ovary placenta and appears to play a role linking sugar sensing to ovule intitiation.
AT2G36240 pentatricopeptide (PPR) repeat-containing protein;(source:Araport11)
AT2G36250 Encodes one of two FtsZ proteins, tubulin-like proteins, in Arabidopsis. It is involved in chloroplast division.
AT2G36270 Encodes a member of the basic leucine zipper transcription factor family, involved in ABA signalling during seed maturation and germination. The Arabidopsis abscisic acid (ABA)-insensitive abi5 mutants have pleiotropic defects in ABA response, including decreased sensitivity to ABA inhibition of germination and altered expression of some ABA-regulated genes. Comparison of seed and ABA-inducible vegetative gene expression in wild-type and abi5-1 plants indicates that ABI5 regulates a subset of late embryogenesis-abundant genes during both developmental stages. Responsible for reducing cadmium uptake, mediated by interaction with MYB49 .
AT2G36307 Has been identified as a translated small open reading frame by ribosome profiling.
AT2G36325 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT2G36350 Member of AGC VIIIa Kinase gene family.
AT2G36355 RAB6-interacting golgin (DUF662);(source:Araport11)
AT2G36440 hypothetical protein;(source:Araport11)
AT2G36470 DUF868 family protein, putative (DUF868);(source:Araport11)
AT2G36490 A repressor of transcriptional gene silencing. Functions by demethylating the target promoter DNA. Interacts physically with RPA2/ROR1. In the ros1 mutants, an increase in methylation is observed in a number of gene promoters. Among the loci affected by ros1, a few (RD29A and At1g76930) are affected in cytosine methylation in all sequence contexts (CpG, CpNpG or CpNpN), although many others are affected primarily in non-CpG contexts. The ros1 mutant is more susceptible to biotrophic pathogens and is repressed in its responsiveness of salyclic acid-dependent defence genes.
AT2G36530 Involved in light-dependent cold tolerance and encodes an enolase. Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. Affects seed size and weight by adjusting cytokinin content and forming ENO2-bZIP75 complex.
AT2G36570 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G36590 Encodes a proline transporter with affinity for gly betaine, proline, and GABA. Protein is expressed in leaves, flowers and siliques but to a much lesser extent in roots.
AT2G36620 RPL24A encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B (AT3G53020).
AT2G36650 CHUP1-like protein;(source:Araport11)
AT2G36660 polyadenylate-binding protein, putative / PABP, putative. Member of the class III family of PABP proteins.
AT2G36690 Protein belonging to the Fe-dependent 2-oxoglutarate dioxygenase superfamily, catalyzes the stereospecific hydration of GA12 to produce DHGA12, negatively regulates ABA sensitivity during germination, phototrophic establishment and seedling development.
AT2G36695 hypothetical protein;(source:Araport11)
AT2G36700 Pectin lyase-like superfamily protein;(source:Araport11)
AT2G36710 Pectin lyase-like superfamily protein;(source:Araport11)
AT2G36720 Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11)
AT2G36740 DNA binding protein SWC2;(source:Araport11)
AT2G36790 The At2g36790 gene encodes a UDP-glucose:flavonol-3-O-glycoside-7-O-glucosyltransferase (UGT73C6)attaching a glucosyl residue to the 7-O-position of the flavonols kaempferol, quercetin and their 3-O-glycoside derivatives.
AT2G36800 Encodes a DON-Glucosyltransferase. The UGT73C5 glucosylates both brassinolide and castasterone in the 23-O position. The enzyme is presumably involved in the homeostasis of those steroid hormones hence regulating BR activity. Transgenic plants overexpressing UGT73C5 show a typical BR-deficient phenotype.
AT2G36810 Specifically involved in gravity perception and/or gravity signal transduction for the shoot gravitropic response. Effects gravitropism only in inflorescence stems but normal in both hypocotyls and roots.
AT2G36815 mid region of cactin;(source:Araport11)
AT2G36830 Encodes a tonoplast intrinsic protein, which functions as water channel. It has also been shown to be able to facilitate the transport of urea and hydrogen peroxide. Highly expressed in vascular tissues of the root, stem, cauline leaves and flowers but not in the apical meristems. The mRNA is cell-to-cell mobile.
AT2G36870 Encodes a xyloglucan endotransglycosylase/hydrolase. Protein sequence and phylogenetic analysis indicates that this enzyme resides in Group III-A of the XTH family, with high similarity to Tropaeolum majus (nasturtium) xyloglucanase 1 (TmNXG1). By sequence similarity to XTH31 (At3g44990) and in vivo analysis, likely to exhibit predominant xyloglucan endo-hydrolase activity (EC 3.2.1.151) with only limited potential to act as a xyloglucan endo-transglycosylase (EC 2.4.1.207).
AT2G36900 member of Membrin Gene Family
AT2G36950 Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT2G36980 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT2G36985 Encodes ROTUNDIFOLIA4, a member of the seed plant-specific family of small peptides, RTFL (ROT FOUR LIKE), characterised by the presence of a 29-amino acid domain: RTF. Expressed in shoot apices, young leaves and flowers. Involved in controlling polarity-dependent cell proliferation.
AT2G37010 member of NAP subfamily
AT2G37025 TRF-like 8;(source:Araport11)
AT2G37030 SAUR-like auxin-responsive protein family;(source:Araport11)
AT2G37040 Encodes PAL1, a phenylalanine ammonia-lyase. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4).
AT2G37070 Encodes a microtubule-associated protein track growing microtubule plus ends.
AT2G37080 Encodes RIP2 (ROP interactive partner 2), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants).
AT2G37110 PLAC8 family protein;(source:Araport11)
AT2G37120 S1FA-like DNA-binding protein;(source:Araport11)
AT2G37150 RING/U-box superfamily protein;(source:Araport11)
AT2G37210 Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At5g11950.
AT2G37220 Encodes a chloroplast RNA binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds.
AT2G37260 Encodes a protein similar to WRKY transcription factors that is expressed in the seed integument and endosperm. Mutants are defective in proanthocyanidin synthesis and seed mucilate deposition. Seeds are yellow colored. Seed size is also affected; seeds are reduced in size but only when the mutant allele is transmitted through the female parent.Loss of function alleles are associated with a reduction in interploidy lethality.
AT2G37280 Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem.
AT2G37290 Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11)
AT2G37300 transmembrane protein;(source:Araport11)
AT2G37330 Encodes an ABC transporter-like protein, without an ATPase domain, required for aluminum (Al) resistance/tolerance and may function to redistribute accumulated Al away from sensitive tissues in order to protect the growing root from the toxic effects of Al.
AT2G37340 encodes an RS-containing Zinc knuckle protein with molecular mass of 33kDa that is localized to nuclear specks. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926.
AT2G37360 Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16).
AT2G37370 centrosomal protein of 135 kDa-like protein;(source:Araport11)
AT2G37390 Chloroplast-targeted copper chaperone protein;(source:Araport11)
AT2G37430 Encodes a member of the zinc finger family of transcriptional regulators. It is expressed in many root tips, primary roots, cotyledons and hypocotyl. The protein is localized to the nucleus. Overexpression of ZAT11 causes increased root growth and increased sensitivity to nickel ions. The mRNA is cell-to-cell mobile.
AT2G37435 Cystatin/monellin superfamily protein;(source:Araport11)
AT2G37440 DNAse I-like superfamily protein;(source:Araport11)
AT2G37450 nodulin MtN21-like transporter family protein
AT2G37460 nodulin MtN21-like transporter family protein
AT2G37470 Histone superfamily protein;(source:Araport11)
AT2G37520 Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11)
AT2G37540 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT2G37590 PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division.
AT2G37640 member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana.
AT2G37650 GRAS family transcription factor;(source:Araport11)
AT2G37660 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT2G37720 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT2G37790 NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11)
AT2G37800 cysteine/histidine-rich C1 domain protein;(source:Araport11)
AT2G37840 Protein kinase superfamily protein;(source:Araport11)
AT2G37890 Mitochondrial substrate carrier family protein;(source:Araport11)
AT2G37910 cation/hydrogen exchanger, putative (CHX21);(source:Araport11)
AT2G37940 Inositol phosphorylceramide synthase 2;(source:Araport11)
AT2G37950 RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11)
AT2G37960 myosin-M heavy protein;(source:Araport11)
AT2G37970 Encodes a cytosolic heme binding protein(cHBP)that can reversibly bind tetrapyrroles including heme, protoporphyrin IX and Mg-protoporphyrin IX dimethyl ester with distinct binding affinities.
AT2G38010 Neutral/alkaline non-lysosomal ceramidase;(source:Araport11)
AT2G38080 LAC4 appears to have laccase activity based on enzyme assays performed using lac4 mutants. These mutants also have reduced levels of lignin. LAC4 is expressed in vascular bundles and fibers and likely contributes to lignin biosynthesis, and hence cell wall biosynthesis, there. lac4/irx12 mutants have a mild irregular xylem phenotype.
AT2G38090 Duplicated homeodomain-like superfamily protein;(source:Araport11)
AT2G38100 Encodes a nitrate transporter that is involved in nitrogen accumulation in embryos.
AT2G38110 bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly.
AT2G38120 Encodes an auxin influx transporter. AUX1 resides at the apical plasma membrane of protophloem cells and at highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning. Shoot supplied ammonium targets AUX1 and inhibits lateral root emergence. The mRNA is cell-to-cell mobile.
AT2G38140 plastid-specific ribosomal protein 4 (PSRP4) mRNA, complete The mRNA is cell-to-cell mobile.
AT2G38150 alpha 1,4-glycosyltransferase family protein;(source:Araport11)
AT2G38170 Encodes a high affinity vacuolar calcium antiporter. The residue His 338 is critical to Ca2+ transport activity. Disruption of CAX1 reduces manganese and zinc of shoot tissue and results in a decrease in the activity of vacuolar V-type proton ATPase.
AT2G38250 Homeodomain-like superfamily protein;(source:Araport11)
AT2G38255 hypothetical protein (DUF239);(source:Araport11)
AT2G38260 Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167
AT2G38270 Encodes protein homologous to CXIP1. CXIP1 is a PICOT domain containing protein interacts with CAX1, a high capacity calcium transporter. However, CXP2 does not interact with CAX1 and only moderately activates another calcium transporter CAX4.
AT2G38320 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).TBL34 are required only for xylan 3-O-monoacetylation and 2,3-di-O-acetylation. This biochemical phenotype can be observed in tbl34 esk1, double mutant and tbl34 tbl35 esk1 triple mutants.
AT2G38325 Encodes a microRNA that targets the TAS3 family of tasiRNA-generating transcripts. Cleavage of TAS3 transcripts by miR390 initiates processing of these transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AAGCUCAGGAGGGAUAGCGCC
AT2G38340 encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought.
AT2G38365 endonuclease/glycosyl hydrolase;(source:Araport11)
AT2G38370 weak chloroplast movement under blue light protein (DUF827);(source:Araport11)
AT2G38400 alanine:glyoxylate aminotransferase 2 homolog (AGT3) mRNA,
AT2G38410 Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses.
AT2G38450 Sel1 repeat protein;(source:Araport11)
AT2G38465 hypothetical protein;(source:Araport11)
AT2G38490 member of AtCIPKs
AT2G38500 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT2G38530 Involved in lipid transfer between membranes and plays a role in maintaining the integrity of the cuticle-cell wall interface. Belongs to a family of Lipid transfer proteins. Sequence similarity to other plant/Arabidopsis LPT genes but highest similarity to LPT1. Stress and pathogen-inducible motifs found in the upstream region. Expressed in flower, leaves and siliques but absent in roots. Predicted to be a member of PR-14 pathogenesis-related protein family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15.
AT2G38570 hypothetical protein;(source:Araport11)
AT2G38580 Mitochondrial ATP synthase D chain-related protein;(source:Araport11)
AT2G38590 F-box and associated interaction domains-containing protein;(source:Araport11)
AT2G38630 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT2G38646 hypothetical protein;(source:Araport11)
AT2G38670 Encodes a mitochondrial ethanolamine-phosphate cytidylyltransferase, involved in phosphatidylethanolamine (PE) biosynthesis.
AT2G38680 5-nucleotidase / magnesium ion binding protein;(source:Araport11)
AT2G38720 microtubule-associated protein 65-5;(source:Araport11)
AT2G38750 Annexins are a family of calcium dependent membrane binding proteins though to be involved in Golgi mediated secretion. This is one of four annexins identified in Arabidopsis.
AT2G38760 Annexins are calcium binding proteins that are localized in the cytoplasm. When cytosolic Ca2+ increases, they relocate to the plasma membrane. The mRNA is cell-to-cell mobile.
AT2G38790 hypothetical protein;(source:Araport11)
AT2G38800 Plant calmodulin-binding protein-like protein;(source:Araport11)
AT2G38820 DNA-directed RNA polymerase subunit beta-beta protein, putative (DUF506);(source:Araport11)
AT2G38840 Guanylate-binding family protein;(source:Araport11)
AT2G38860 Encodes protease I (pfpI)-like protein YLS5.
AT2G38900 Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860.
AT2G38905 Low temperature and salt responsive protein family;(source:Araport11)
AT2G38910 member of Calcium Dependent Protein Kinase
AT2G38920 SPX (SYG1/Pho81/XPR1) domain-containing protein / zinc finger (C3HC4-type RING finger) protein-like protein;(source:Araport11)
AT2G38940 Encodes Pht1;4, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile.
AT2G38950 Transcription factor jumonji (jmj) family protein / zinc finger (C5HC2 type) family protein;(source:Araport11)
AT2G39000 Encodes a chloroplast localized n-acetyltransfefase involved in N-terminal protein amino acid acetylation.
AT2G39010 plasma membrane intrinsic protein 2E;(source:Araport11)
AT2G39040 Peroxidase superfamily protein;(source:Araport11)
AT2G39050 Encodes a nucleocytoplasmic lectin that is capable of binding carbohydrates. It is involved in ABA mediated stomatal movement and increased expression is correlated with increased resistance to Pseudomonas syringae.
AT2G39110 Protein kinase superfamily protein;(source:Araport11)
AT2G39130 Transmembrane amino acid transporter family protein;(source:Araport11)
AT2G39180 CRINKLY4 related 2;(source:Araport11)
AT2G39190 member of ATH subfamily
AT2G39250 Encodes a AP2 domain transcription factor that can repress flowering. SNZ and its paralogous gene, SCHLAFMUTZE (SMZ), share a signature with partial complementarity to the miR172 microRNA, whose precursor is induced upon flowering.
AT2G39300 CAP-gly domain linker;(source:Araport11)
AT2G39350 Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16).
AT2G39360 Protein kinase superfamily protein;(source:Araport11)
AT2G39370 Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6).
AT2G39435 Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11)
AT2G39470 PsbP-like protein 2;(source:Araport11)
AT2G39490 F-box family protein;(source:Araport11)
AT2G39510 Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed.
AT2G39570 Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes.
AT2G39650 cruciferin (DUF506);(source:Araport11)
AT2G39675 Trans-acting siRNA1c primary transcript (TAS1c). Gb: AY922999
AT2G39690 ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547);(source:Araport11)
AT2G39705 ROTUNDIFOLIA like 8;(source:Araport11)
AT2G39725 LYR family of Fe/S cluster biogenesis protein;(source:Araport11)
AT2G39740 Encodes HESO1 (HEN1 suppressor 1), a terminal nucleotidyl transferase that uridylates miRNAs and siRNAs at 3′ end. HESO1-mediated 3′ uridylation destabilizes small RNAs in hen1.
AT2G39760 Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6).
AT2G39780 Encodes the main endoribonuclease activity in plant cells and localizes to the endoplasmic reticulum (ER), ER-derived structures, and vacuoles. It is essential for normal ribosomal RNA recycling. The mRNA is cell-to-cell mobile.
AT2G39782 hypothetical protein;(source:Araport11)
AT2G39800 encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. P5CS1 appears to be involved in salt stress responses related to proline accumulation, including protection from reactive oxidative species. P5CS1 appears to be present in different cells and/or different subcellular locations from P5CS2 in a tissue-dependent manner.
AT2G39805 Integral membrane Yip1 family protein;(source:Araport11)
AT2G39820 Translation initiation factor IF6;(source:Araport11)
AT2G39830 Essential for early phloem development and function, and for root system development.DAR2 is a member of a small (7 member) ubiquitin binding protein family. It appears to play a role in regulation of endoreduplication in leaf epidermal tissue.
AT2G39850 Subtilisin-like serine endopeptidase family protein;(source:Araport11)
AT2G39855 plant/protein;(source:Araport11)
AT2G39865 transmembrane protein;(source:Araport11)
AT2G39870 hypothetical protein;(source:Araport11)
AT2G39880 Encodes a putative transcription factor (MYB25).
AT2G39890 Encodes a proline transporter with affinity for gly betaine, proline and GABA. Protein is expressed in the vascular tissue, specifically the phloem.
AT2G39920 HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11)
AT2G39930 Encodes an isoamylase-type debranching enzyme. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. Mutants have reduced starch content and abnormally structured amylopectins and phytoglycogens. It has been postulated that AtISA1 interacts with AtISA2 to form the Iso1 complex.
AT2G39960 Microsomal signal peptidase 25 kDa subunit (SPC25);(source:Araport11)
AT2G39980 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT2G39990 translation initiation factor eIF2 p47 subunit homolog
AT2G40004 transmembrane protein;(source:Araport11)
AT2G40060 Encodes a clathrin that is localized to the cortical division zone and the cell plate and colocalizes with TPLATE during cell plate anchoring. The mRNA is cell-to-cell mobile.
AT2G40070 Encodes a microtubule-associated protein involved in cortical microtubule organization during leaf development.
AT2G40085 hypothetical protein;(source:Araport11)
AT2G40090 member of ATH subfamily
AT2G40095 Alpha/beta hydrolase related protein;(source:Araport11)
AT2G40116 Phosphoinositide-specific phospholipase C family protein;(source:Araport11)
AT2G40120 Protein kinase superfamily protein;(source:Araport11)
AT2G40130 Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance.
AT2G40140 zinc finger (CCCH-type) family protein;(source:Araport11)
AT2G40170 Encodes a group 1 LEA gene that is activated by direct binding of ABI5 to its promoter and is involved in response to ABA. Is required for normal seed development. Involved in regulating the timing of desiccation tolerance and rate of water loss during seed maturation.
AT2G40180 Encodes PP2C5, a member of the PP2C family phosphatases. PP2C5 acts as a MAPK phosphatase that positively regulates seed germination, stomatal closure and ABA-inducible gene expression.
AT2G40200 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT2G40230 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT2G40250 SGNH hydrolase-type esterase superfamily protein;(source:Araport11)
AT2G40270 Protein kinase family protein;(source:Araport11)
AT2G40320 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). Chemical evidence for function comes from xylan NMR analysis. Secondary wall thickening phenotype can be only observed in double or triple mutant with esk1.
AT2G40330 Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2.
AT2G40350 encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought.
AT2G40360 Encodes BOP1, an ortholog of Block of cell proliferation (BOP) protein. A T-DNA null allele of the BOP1 gene is lethal, and a 50% decrease in transcript accumulation is sufficient to cause severe developmental defects linked to defective cell division.
AT2G40390 neuronal PAS domain protein;(source:Araport11)
AT2G40400 Encodes a chloroplast localized protein of unknown function that is involved in regulation of chloroplast development.
AT2G40450 BTB/POZ domain-containing protein;(source:Araport11)
AT2G40470 LOB-domain containing protein. Involved in regulation of xylem differentiation- acts as a regulator of VND7 which is a master regulator of xylem cell differentiation.
AT2G40560 Protein kinase superfamily protein;(source:Araport11)
AT2G40620 Basic leucine zipper transcription factor. Localizes from cytoplasm to the nucleus under heat stress.
AT2G40630 Uncharacterized conserved protein (UCP030365);(source:Araport11)
AT2G40670 response regulator 16
AT2G40711 hypothetical protein;(source:Araport11)
AT2G40730 kinase family with ARM repeat domain-containing protein;(source:Araport11)
AT2G40765 transmembrane protein;(source:Araport11)
AT2G40810 yeast autophagy-like protein;(source:Araport11)
AT2G40815 Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT2G40820 stomatal closure actin-binding-like protein;(source:Araport11)
AT2G40850 phosphoinositide 4-kinase gamma 1;(source:Araport11)
AT2G40880 Encodes a protein with cysteine proteinase inhibitor activity. Overexpression increases tolerance to abiotic stressors (i.e.salt,osmotic, cold stress). The mRNA is cell-to-cell mobile.
AT2G40890 encodes coumarate 3-hydroxylase (C3H), a P450-dependent monooxygenase. Involved in lignin biosynthesis and flavonoid biosynthesis. Also affects the biosynthesis of coumarins such as scopoletin and scopolin as a branching-out-pathway from the phenylpropanoid acid level.
AT2G40910 F-box and associated interaction domains-containing protein;(source:Araport11)
AT2G40925 F-box and associated interaction domains-containing protein;(source:Araport11)
AT2G40970 Homeodomain-like superfamily protein;(source:Araport11)
AT2G40990 DHHC-type zinc finger family protein;(source:Araport11)
AT2G41150 plant/protein;(source:Araport11)
AT2G41170 F-box family protein;(source:Araport11)
AT2G41220 Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression is most abundant in root. The mRNA is cell-to-cell mobile.
AT2G41240 Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member.
AT2G41250 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT2G41260 Late-embryogenesis-abundant gene. Involved in the acquisition of desiccation tolerance during late phase of embryogenesis.
AT2G41290 Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity.
AT2G41300 Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity.
AT2G41330 Glutaredoxin family protein;(source:Araport11)
AT2G41360 galactose oxidase/kelch repeat protein;(source:Araport11)
AT2G41390 Pollen Ole e 1 allergen and extensin family protein;(source:Araport11)
AT2G41415 Encodes a Maternally expressed gene (MEG) family protein
AT2G41445 agamous-like MADS-box protein;(source:Araport11)
AT2G41451 glycosyltransferase-like protein;(source:Araport11)
AT2G41473 F-box family protein;(source:Araport11)
AT2G41475 Embryo-specific protein 3, (ATS3);(source:Araport11)
AT2G41480 Encodes a cationic cell-wall-bound peroxidase homolog that is involved in the lignification of cell walls. Regulated by COG1, involved in seed longevity.
AT2G41510 It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins.Acts on zeatin 9-riboside-50-triphosphate substrate.
AT2G41560 Encodes a calmodulin-regulated Ca(2+)-ATPase that improves salt tolerance in yeast. Localized to the vacuole. Lesion mimic phenotype when mutation in the gene is combined with a mutation in ACA11. Lesion mimic phenotype of double knockout can be suppressed by nutritional supplements that increase anion levels (e.g. 15 mM Nitrate, Chloride, or Phosphate).
AT2G41600 Mitochondrial glycoprotein family protein;(source:Araport11)
AT2G41610 Transmembrane protein from a plant specific gene family. Overexpression causes abnormal cell wall composition and defects in cell growth.
AT2G41630 Encodes a transcription factor, TFIIB1, that plays important roles in pollen tube growth, guidance, and reception as well as endosperm development and is partially functionally different from AtTFIIB2 and AtTFIIB3/AtpBRP2.
AT2G41640 Glycosyltransferase family 61 protein;(source:Araport11)
AT2G41680 Encodes a NADPH thioredoxin reductase involved in chloroplast protection against oxidative damage.
AT2G41705 Encodes a fluoride export protein.
AT2G41740 Encodes a protein with high homology to animal villin.
AT2G41745 transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, blastp match of 28%25 identity and 4.7e-24 P-value to GP|20279456|gb|AAM18736.1|AC092548_14|AC092548 putative reverse transcriptase {Oryza sativa (japonica cultivar-group)};(source:TAIR10)
AT2G41750 Involved in posttranscriptional modification of tRNA. Can form acp3U20b on a tRNA expressed in yeast cells. The aspartate and tryptophan residues in the DXTW motif of this protein are required for modification activity. Required for the acp3U20a modification of cytosolic tRNA.
AT2G41780 hypothetical protein;(source:Araport11)
AT2G41790 Insulinase (Peptidase family M16) family protein;(source:Araport11)
AT2G41830 Uncharacterized protein;(source:Araport11)
AT2G41860 member of Calcium Dependent Protein Kinase
AT2G41880 Guanylate kinase. Involved in nucleotide metabolism.
AT2G41890 curculin-like (mannose-binding) lectin family protein / PAN domain-containing protein;(source:Araport11)
AT2G41900 AtOXS2 specifcally entered the nuclear under salt stress. Te specifc nuclear localization of AtOXS2 could play a role in salt tolerance at the molecular level. Tese results implied that AtOXS2 might target some downstream cis-elements which are required for salt stress responses
AT2G41910 Protein kinase superfamily protein;(source:Araport11)
AT2G41945 Encodes a novel protein found only in plants. RED1 has two isoforms RED1.1 and RED1.2. It is localized to the nucleus. Loss of function mutants are embryo lethal but can be rescued before desiccation by embryo culture.
AT2G41970 Encodes MRI, a plasma membrane-localized member of the RLCK-VIII subfamily. Preferentially expressed in both pollen tubes and root hairs. mri-knockout mutants display spontaneous pollen tube and root-hair bursting.
AT2G42000 AtMT4a is a member of Type 4 metallothionein (MT) genes. It is involved in the early develoment of the embryo and in the accumulation of metal ions especially Zn in the seeds.
AT2G42190 rho GTPase-activating gacO-like protein;(source:Araport11)
AT2G42200 Encodes a putative transcriptional regulator that is involved in the vegetative to reproductive phase transition. Expression is regulated by MIR156b. SPL activity nonautonomously inhibits initiation of new leaves at the shoot apical meristem.
AT2G42280 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT2G42300 Together with bHLH60 associates with phytochrome interacting factor 7 to regulate hypocotyl elongation.
AT2G42320 nucleolar protein gar2-like protein;(source:Araport11)
AT2G42400 VOZ transcription factor which acts as positive regulator of several salt-responsive genes. Functionally redundant in salt stress with VOZ1.
AT2G42450 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT2G42460 MATH domain/coiled-coil protein;(source:Araport11)
AT2G42470 TRAF-like family protein;(source:Araport11)
AT2G42480 MATH domain/coiled-coil protein;(source:Araport11)
AT2G42550 Protein kinase superfamily protein;(source:Araport11)
AT2G42560 Late embryogenesis protein. Based on in vitro studies, likely plays a role in stablizing membranes in response to freezing stress.
AT2G42610 LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11)
AT2G42620 The mutations at MAX2 cause increased hypocotyl and petiole elongation in light-grown seedlings. Positional cloning identifies MAX2 as a member of the F-box leucine-rich repeat family of proteins. MAX2 is identical to ORE9, a proposed regulator of leaf senescence. Involved in positive regulation of light responses. The mRNA is cell-to-cell mobile.
AT2G42650 Ribosomal protein L1p/L10e family;(source:Araport11)
AT2G42720 FBD, F-box, Skp2-like and Leucine Rich Repeat domains containing protein;(source:Araport11)
AT2G42730 F-box/FBD/LRR protein;(source:Araport11)
AT2G42750 DNAJ heat shock N-terminal domain-containing protein;(source:Araport11)
AT2G42835 Natural antisense transcript overlaps with AT2G42830;(source:Araport11)
AT2G42850 cytochrome P450, family 718;(source:Araport11)
AT2G42870 Encodes PHYTOCHROME RAPIDLY REGULATED1 (PAR1), an atypical basic helix-loop-helix (bHLP) protein. Closely related to PAR2 (At3g58850). Up regulated after simulated shade perception. Acts in the nucleus to control plant development and as a negative regulator of shade avoidance response. Functions as transcriptional repressor of auxin-responsive genes SAUR15 (AT4G38850) and SAUR68 (AT1G29510).
AT2G42880 member of MAP Kinase
AT2G42890 A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML2 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. AML2 is expressed during early embryo development (heart and torpedo stage) and predominantly in vegetative organs; no significant accumulation was detected in floral apices.
AT2G42900 Plant basic secretory protein (BSP) family protein;(source:Araport11)
AT2G42920 Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11)
AT2G42930 Carbohydrate-binding X8 domain superfamily protein;(source:Araport11)
AT2G42950 Magnesium transporter CorA-like family protein;(source:Araport11)
AT2G42960 Protein kinase superfamily protein;(source:Araport11)
AT2G42990 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT2G43000 Encodes a NAC transcription factor induced by hydrogen peroxide (H2O2). Involved in senescence. Over expression of the gene strongly delays senescence and enhances tolerance to various abiotic stresses.
AT2G43010 Isolated as a semidominant mutation defective in red -light responses. Encodes a nuclear localized bHLH protein that interacts with active PhyB protein. Negatively regulates phyB mediated red light responses. Involved in shade avoidance response. Protein abundance is negatively regulated by PhyB.Involved in the regulation of response to nutrient levels. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner.
AT2G43050 Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT2G43060 ILI1 binding bHLH 1;(source:Araport11)
AT2G43120 Encodes a member of the functionally diverse cupin protein superfamily that is involved in susceptibility to the bacterial plant pathogen Ralstonia solanacearum. It stabilizes the papain-like cysteine protease XCP2. The mRNA is cell-to-cell mobile.
AT2G43130 encodes a protein belonging to the Rab/Ypt family of small GTPases, which are implicated in intracellular vesicular traffic.
AT2G43140 bHLH129 is a nuclear localized basic helix loop helix protein. It has been shown to function as a transcriptional repressor. Overexpression of bHLH129 regulates root elongation and ABA response.
AT2G43150 Proline-rich extensin-like family protein;(source:Araport11)
AT2G43160 Involved in plant trans-Golgi network (TGN) transport.
AT2G43180 Phosphoenolpyruvate carboxylase family protein;(source:Araport11)
AT2G43230 Member of cytosolic ABA receptor kinases; interacts with ABA receptors RCAR11-14. Positively regulates germination, seedling architecture and root growth in response to ABA.
AT2G43240 Nucleotide-sugar transporter family protein;(source:Araport11)
AT2G43255 O-acyltransferase WSD1-like protein;(source:Araport11)
AT2G43261 transmembrane protein;(source:Araport11)
AT2G43290 Calmodulin-like MSS3.Encodes an endomembrane localized member of the CML subfamily VII. Contains a canonical CaM domain and unique N-terminal extension that distinguishes it from other members of the subfamily.
AT2G43340 hypothetical protein (DUF1685);(source:Araport11)
AT2G43390 hypothetical protein;(source:Araport11)
AT2G43450 hypothetical protein;(source:Araport11)
AT2G43470 zinc finger CCCH domain protein, putative (DUF3755);(source:Araport11)
AT2G43590 Chitinase family protein;(source:Araport11)
AT2G43610 Chitinase family protein;(source:Araport11)
AT2G43680 Member of IQ67 (CaM binding) domain containing family.
AT2G43700 Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT2G43710 Encodes a stearoyl-ACP desaturase, involved in fatty acid desaturation. The ssi2 mutants have increased 18:0 and reduced 18:1 fatty acids. Exogenous application of glycerol to wild type plants mimics the ssi2 mutant phenotype. The altered 18:1 fatty acid content in the ssi2 mutants has an impact on SA- and JA-mediated defense signaling. ssi2 mutants resulted in hyper-resistance to green peach aphid and antibiosis activity in petiole exudates. Redundant Δ9 stearoyl-ACP desaturase gene which together with AAD1 and AAD5 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with AAD1, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase.
AT2G43730 Mannose-binding lectin superfamily protein;(source:Araport11)
AT2G43745 jacalin lectin-like protein;(source:Araport11)
AT2G43820 Encodes a nicotinate-O-glycosyltransferase. Induced by Salicylic acid, virus, fungus and bacteria. Also involved in the tryptophan synthesis pathway. Independent of NPR1 for their induction by salicylic acid. UGT74F1 transfers UDP:glucose to salicylic acid (forming a glucoside (SAG) and a glucose ester (SGE)), benzoic acid, and anthranilate in vitro. UGT74F2 shows a weak ability to catalyze the formation of the p-aminobenzoate-glucose ester in vitro. But, UGT75B1 appears to be the dominant pABA acylglucosyltransferase in vivo based on assays in leaves, flowers, and siliques.
AT2G43840 UGT74F1 transfers UDP:glucose to salicylic acid (forming a glucoside), benzoic acid, quercetin, and athranilate in vitro. UGT74F1 shows a weak ability to catalyze the formation of the p-aminobenzoate-glucose ester in vitro. But, UGT75B1 appears to be the dominant pABA acylglucosyltransferase in vivo based on assays in leaves, flowers, and siliques. The true biological substrate(s) of UGT74F1 are not known, but mutant plants lacking UGT74F1 have a decreased level of salicylate glucoside.
AT2G43860 Pectin lyase-like superfamily protein;(source:Araport11)
AT2G43865 hypothetical protein;(source:Araport11)
AT2G43880 Pectin lyase-like superfamily protein;(source:Araport11)
AT2G43890 Pectin lyase-like superfamily protein;(source:Araport11)
AT2G43900 Encodes a 5-inositol-phosphate phosphatase, that, in vitro, shows activity against IP(1,4,5).
AT2G43910 HARMLESS TO OZONE LAYER 1;(source:Araport11)
AT2G43930 Protein kinase superfamily protein;(source:Araport11)
AT2G43932 Pseudogene of AT2G43940; thiol methyltransferase, putative
AT2G43940 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT2G43950 Constitutes a peptide sensitive ion channel in chloroplast outer membranes. Accumulates in germinating seeds and developing embryos.
AT2G43960 SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11)
AT2G44000 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11)
AT2G44010 hypothetical protein;(source:Araport11)
AT2G44070 NagB/RpiA/CoA transferase-like superfamily protein;(source:Araport11)
AT2G44100 GDP dissociation inhibitor involved in vesicular membrane traffic
AT2G44110 A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO15 belongs to the clade II, with ATMLO13 and ATMLO15. The gene is expressed during early seedling growth, in root tips and flower (papillae, anthers and pollen grains), as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s).
AT2G44120 Ribosomal protein L30/L7 family protein;(source:Araport11)
AT2G44130 Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family. Component of SCF ubiquitin protein ligase, interacts with phenylalanine ammonia-lyase. AtKFB39 is a homolog of previously identified AtKFB50 (At3g59940) and specifically interacts with Arabidopsis PAL3 and PAL4 in vitro. In planta, together with AtKFB01, KFB20 and KFB50, it regulates PAL protein stability thus controlling phenylpropanoid biosynthesis .
AT2G44140 Autophagy protein
AT2G44150 Encodes a protein-lysine N-methyltransferase. Located in ER.
AT2G44175 Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11)
AT2G44195 pre-mRNA splicing factor domain-containing protein;(source:Araport11)
AT2G44200 pre-mRNA splicing factor domain-containing protein;(source:Araport11)
AT2G44220 NEP-interacting protein (DUF239);(source:Araport11)
AT2G44230 hypothetical protein (DUF946);(source:Araport11)
AT2G44255 Natural antisense transcript overlaps with AT2G44260;(source:Araport11)
AT2G44320 pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10)
AT2G44340 VQ18 is an ABA responsive gene and interacts with the ABI5 transcription factor. Along with its paralog VQ26, it is involved in negative regulation of ABA responses during early seedling development.
AT2G44360 ecotropic viral integration site protein;(source:Araport11)
AT2G44370 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT2G44380 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT2G44390 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT2G44410 RING/U-box superfamily protein;(source:Araport11)
AT2G44430 DNA-binding bromodomain-containing protein;(source:Araport11)
AT2G44450 beta glucosidase 15;(source:Araport11)
AT2G44460 Beta-glucosidase, major myrosinase which initiates sulfur reallocation by hydrolyzing particular GL species, conferring sulfur deficiency tolerance, especially during early development.
AT2G44470 beta glucosidase 29;(source:Araport11)
AT2G44490 Encodes a glycosyl hydrolase that localizes to peroxisomes and acts as a component of an inducible preinvasion resistance mechanism. Required for mlo resistance. The mRNA is cell-to-cell mobile.
AT2G44500 O-fucosyltransferase family protein;(source:Araport11)
AT2G44530 Phosphoribosyltransferase family protein;(source:Araport11)
AT2G44560 glycosyl hydrolase 9B11;(source:Araport11)
AT2G44570 glycosyl hydrolase 9B12;(source:Araport11)
AT2G44580 zinc ion binding protein;(source:Araport11)
AT2G44590 DYNAMIN-like 1D;(source:Araport11)
AT2G44670 senescence-associated family protein (DUF581);(source:Araport11)
AT2G44680 Encodes casein kinase II beta chain, a CK2 regulatory subunit. Nuclear-localized CKB4 protein exists in vivo as different isoforms, resulting from phosphorylation on serine residues. The phosphorylated isoforms are the preferred substrate for ubiquitination and degradation by the proteasome pathway. Involved in regulation of circadian clock.
AT2G44700 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT2G44730 Alcohol dehydrogenase transcription factor Myb/SANT-like family protein;(source:Araport11)
AT2G44735 transmembrane protein;(source:Araport11)
AT2G44740 cyclin p4;(source:Araport11)
AT2G44750 Encodes a thiamine pyrophosphokinase capable of producing thiamine pyrophosphate from free thiamine.
AT2G44760 dihydroorotate dehydrogenase (DUF3598);(source:Araport11)
AT2G44770 ELMO/CED-12 family protein;(source:Araport11)
AT2G44780 Encodes a Uclacyanin/Basic blue family protein [pseudogene]
AT2G44790 Encodes a uclacyanin, a protein precursor that is closely related to precursors of stellacyanins and a blue copper protein from pea pods.
AT2G44830 AGCVIII kinase involved in the pulse-induced first positive phototropism. Plasma-membrane-associated element of a molecular rheostat that modulates auxin flux through developing protophloem sieve elements (PPSEs) while interacting with BRX, thereby timing PPSE differentiation. Activates PIN-mediated auxin efflux.
AT2G44840 encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. The mRNA is cell-to-cell mobile.
AT2G44890 member of CYP704A
AT2G44900 ARABIDILLO-1 and its homolog, ARABIDILLO -2, are unique among Arabidopsis Arm-repeat proteins in having an F-box motif and fall into a phylogenetically distinct subgroup from other plant Arm-repeat proteins Similar to arm repeat protein in rice and armadillo/beta-catenin repeat family protein / F-box family protein in Dictyostelium. ARABIDILLO-1 promote lateral root development. Mutant plants form fewer lateral roots, while ARABIDILLO-1-overexpressing lines produce more lateral roots than wild-type seedlings.
AT2G44910 Encodes a homeodomain protein whose expression displays a dependence on phyB for both red and far-red light response. Also involved in the shade avoidance syndrome.
AT2G44930 transmembrane protein, putative (DUF247);(source:Araport11)
AT2G44940 encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.
AT2G44970 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT2G44990 More Axillary Branching; carotenoid cleavage dioxygenases.
AT2G45040 Matrixin family protein;(source:Araport11)
AT2G45050 Encodes a member of the GATA factor family of zinc finger transcription factors. A positive regulator of photomorphogenesis.
AT2G45080 cyclin p3;(source:Araport11)
AT2G45120 C2H2-like zinc finger protein;(source:Araport11)
AT2G45150 cytidinediphosphate diacylglycerol synthase 4;(source:Araport11)
AT2G45160 Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization.
AT2G45220 Pectin methylesterase involved in pectin remodelling. Regulated by its PRO region that triggers PME activity in the resistance to Botrytis cinerea.
AT2G45300 encodes 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase involved in chorismate biosynthesis The mRNA is cell-to-cell mobile.
AT2G45310 UDP-D-glucuronate 4-epimerase
AT2G45340 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G45406 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT2G45420 LOB domain-containing protein 18;(source:Araport11)
AT2G45460 SMAD/FHA domain-containing protein;(source:Araport11)
AT2G45480 Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development.
AT2G45490 Encodes a member of a family of Ser/Thr kinases whose activities peak during cell division. Transcripts are abundant in tissues rich in dividing cells like roots and flowers but are low or absent in fully expanded leaves and stems. In interphase cells, the protein is predominantly nuclear. During mitosis, the protein associates with plant-specific cytoskeletal structures (preprophase band, phragmoplast, nascent cell plate) that are necessary for cytokinesis as well as with the microtubule spindle. The protein is concentrated in nuclear dots arranged around the nucleolus and the nuclear periphery in early prophase cells.
AT2G45520 coiled-coil protein;(source:Araport11)
AT2G45530 RING/U-box superfamily protein;(source:Araport11)
AT2G45550 Member of CYP76C family of cytochrome P450 enzymes.Has geraniol 9- or 8-hydroxylase activity.
AT2G45560 cytochrome P450 monooxygenase
AT2G45570 member of CYP76C
AT2G45580 cytochrome P450, family 76, subfamily C, polypeptide 3;(source:Araport11)
AT2G45610 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT2G45650 Sequence suggests this encodes a MADS-box transcription factor. Negatively regulates the FLC/MAF clade genes and positively regulates FT in Arabidopsis.
AT2G45700 sterile alpha motif (SAM) domain-containing protein;(source:Araport11)
AT2G45720 ARM repeat superfamily protein;(source:Araport11)
AT2G45730 eukaryotic initiation factor 3 gamma subunit family protein;(source:Araport11)
AT2G45740 member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. The mRNA is cell-to-cell mobile.
AT2G45750 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT2G45760 encodes a protein that is similar to BONZAI1-binding protein BAP1.
AT2G45800 Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization.
AT2G45830 downstream target of AGL15 2;(source:Araport11)
AT2G45840 O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11)
AT2G45850 AT hook motif DNA-binding family protein;(source:Araport11)
AT2G45890 Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Mutants exhibit longer root hairs under phosphate-deficient conditions. Involved in cell wall patterning. Encodes ROP activator, regulates the formation of ROP-activated domains; these in turn determine the pattern of cell wall pits. Forms a dimer that interacts with activated ROP11 in vivo, which could provide positive feedback for ROP activation. Required for periodic formation of secondary cell wall pits
AT2G45910 Plant U-box type E3 ubiquitin ligase (PUB).
AT2G45940 hypothetical protein (DUF295);(source:Araport11)
AT2G45980 Encodes an Atg8-interacting protein that is partially associated with the ER during favorable growth conditions and becomes mainly associated with a spherical compartment that dynamically moves along the ER network. In stress induced plants, ATI1 is localized to a novel plastid associated bodies that are transported to vesicles, in what appears to be an autophagy dependent process. ATI1 interacts with number of other plastid proteins such as NPQ4 and APE1.
AT2G46050 E-PPR protein involved in mitochondrial RNA editing.It is involved in editing of the mitochondrial tatC transcript at site 581.
AT2G46160 RING/U-box superfamily protein;(source:Araport11)
AT2G46170 Reticulon family protein;(source:Araport11)
AT2G46192 other_RNA;(source:Araport11)
AT2G46230 PIN domain-like family protein;(source:Araport11)
AT2G46250 myosin heavy chain-like protein;(source:Araport11)
AT2G46270 encodes a bZIP G-box binding protein whose expression is induced by ABA. It has been shown to bind to Adh that contains the G-box and is induced by cold and water deprivation. GBF3 has been shown to be expressed mostly in the root and dark-grown leaves. GBF3 can act as homodimers and as heterodimers with GFB1, GBF2 and GBF4. In addition, GBF3!?s DNA binding activity is enhanced by GIP1, GPRI1 and GPRI2.
AT2G46280 Encodes a homolog of mammalian TGF-beta receptor interacting protein. Co-immunoprecipitates with BRI1 and can be phosphorylated in vitro by BRI1 at specific sites (Thr-14, Thr-89, and either Thr-197 or Ser-198). May therefore be a cytoplasmic BRI1 substrate and involved in brassinosteroid regulated plant growth and development.The encoded protein has two DWD motifs. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase
AT2G46308 transmembrane protein;(source:Araport11)
AT2G46330 Encodes arabinogalactan protein (AGP16).
AT2G46370 Encodes a jasmonate-amido synthetase that is a member of the GH3 family of proteins. JAR1 catalyzes the formation of a biologically active jasmonyl-isoleucine (JA-Ile) conjugate. JA-Ile promotes the interaction between JAZ1 and COI1 in the jasmonate signaling pathway. JAR1 localizes to the cytoplasm and is also a phytochrome A signaling component. JAR1 is an auxin-induced gene. Loss of function mutants are defective in a variety of responses to jasmonic acid. JAR1 has additional enzymatic activities in vitro, (e.g. the ability to synthesize adenosine 5'-tetraphosphate and other JA conjugates), but there are no data to show whether JAR1 catalyzes many of these reactions in vivo. JAR1 is involved in pathogen defense, sensitivity to ozone, and wound responses.
AT2G46375 hypothetical protein;(source:Araport11)
AT2G46420 helicase with zinc finger protein;(source:Araport11)
AT2G46455 OxaA/YidC-like membrane insertion protein;(source:Araport11)
AT2G46480 Encodes a protein with putative galacturonosyltransferase activity.
AT2G46493 RING/U-box superfamily protein;(source:Araport11)
AT2G46494 RING/U-box superfamily protein;(source:Araport11)
AT2G46510 Encodes a nuclear localized BLH domain containing transcriptional activator involved in response to ABA. Overexpression confers enhanced ABA responsiveness while loss of function mutants are ABA sensitive.bHLH17 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH13 and bHLH14 to negatively regulate jasmonate responses.
AT2G46530 auxin response factor 11;(source:Araport11)
AT2G46600 Calcium-binding EF-hand family protein;(source:Araport11)
AT2G46630 serine/arginine repetitive matrix protein;(source:Araport11)
AT2G46650 member of Cytochromes b5 The mRNA is cell-to-cell mobile.
AT2G46680 encodes a putative transcription factor that contains a homeodomain closely linked to a leucine zipper motif. Transcript is detected in all tissues examined. Is transcriptionally regulated in an ABA-dependent manner and may act in a signal transduction pathway which mediates a drought response.
AT2G46685 Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. This particular miRNA is involved in the regulation of vascular development in inflorescence stems, primarily through the regulation of mRNA cleavage of the class III homeodomain-leucine zipper transcription factor ATHB15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC. Pri-mRNA coordinates for MIR166a (converted to TAIR10 based on PMID19304749): Chr2: 19175959-19177071 (forward), length: 1113 bp; exon coordinates: exon 1: 19175959 to 19176341, exon 2: 19176820 to 19177071; mature miRNA and miRNA* are located on exon 1.
AT2G46700 CDPK-related kinase 3;(source:Araport11)
AT2G46710 ROP (Rho of plant GTPases) family member Involved in cell wall patterning. Encodes ROP inactivator, regulates the formation of ROP-activated domains; these in turn determined the pattern of cell wall pits. Positively regulates pit formation, but negatively regulates pit size, required for periodic formation of secondary cell wall pits.
AT2G46720 Encodes KCS13, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids).
AT2G46760 D-arabinono-1,4-lactone oxidase family protein;(source:Araport11)
AT2G46780 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT2G46790 Pseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR5 and PRR7 to regulate hypocotyl growth under photoperiodic conditions.
AT2G46810 MYC-type transcription factor which interacts with ICE1 and negatively regulates cold-responsive genes and cold tolerance.
AT2G46820 Encodes the P subunit of Photosystem I. About 25% of the TMP14 pool appeared to be phosphorylated, and this ratio is not affected by light. Contains seven phosphorylation sites on threonine residue and chloroplast targeting signal. Located in the proximity of PSI-L, -H and -O subunits. Forms oligomers with other members of CURT1 family to modulate grana structure.
AT2G46850 Protein kinase superfamily protein;(source:Araport11)
AT2G46860 Encodes a protein that might have inorganic pyrophosphatase activity.
AT2G46880 purple acid phosphatase 14;(source:Araport11)
AT2G46940 fold protein;(source:Araport11)
AT2G46950 cytochrome P450, family 709, subfamily B, polypeptide 2;(source:Araport11)
AT2G46960 member of CYP709B
AT2G46970 encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family.
AT2G46980 Encodes ASY3, a coiled-coil domain protein that is required for normal meiosis.
AT2G46995 hypothetical protein;(source:Araport11)
AT2G47010 calcium/calcium/calmodulin-dependent Serine/Threonine-kinase;(source:Araport11)
AT2G47030 Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT2G47090 zinc ion binding/nucleic acid binding protein;(source:Araport11)
AT2G47130 Encodes a short-chain dehydrogenase/reductase that is not involved in ABA biosynthesis but plays an important role in plant defense response to bacteria.
AT2G47180 GolS1 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS1 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS1 have increased tolerance to salt, chilling, and high-light stress.
AT2G47200 hypothetical protein;(source:Araport11)
AT2G47260 Encodes a member of WRKY Transcription Factor; Group I. Involved in nematode feeding site establishment and auxin mediated PIN polar localization in roots. Expression is induced by auxin.
AT2G47310 Functions in an antagonistic manner to its close homolog FCA. The SSF414N protein variant interacts more strongly with CUL1, a component of the E3 ubiquitination complex, than the SSF414D form, mediating differences in SSF protein degradation and FLC expression.
AT2G47420 Encodes a putative rRNA dimethyltransferase.
AT2G47430 Encodes a putative plasma membrane-bound hybrid histidine kinase and cytokinin sensor that is expressed within the female gametophyte.
AT2G47450 A component of the chloroplast signal recognition particle pathway that is involved in LHCP targeting. It is downregulated in response to high light. It recognizes the DPLG motif in Lhcb1. The mRNA is cell-to-cell mobile.
AT2G47500 P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11)
AT2G47520 encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12. It plays a role in hypoxia-induced root slanting.
AT2G47540 Pollen Ole e 1 allergen and extensin family protein;(source:Araport11)
AT2G47580 encodes spliceosomal protein U1A
AT2G47590 photolyase/blue light photoreceptor PHR2 (PHR2) mRNA,
AT2G47740 pre-tRNA tRNA-Gly (anticodon: CCC);(source:Araport11, TAIR10)
AT2G47780 Encodes a small rubber particle protein homolog. Plays dual roles as positive factors for tissue growth and development and in drought stress responses.
AT2G47800 Encodes a plasma membrane localized ATPase transporter involved in multidrug transport. The expression of this gene is upregulated by herbicide safeners such as benoxacor, fluxofenim and fenclorim. The mRNA is cell-to-cell mobile.
AT2G47810 nuclear factor Y, subunit B5;(source:Araport11)
AT2G47820 arginine-glutamic acid dipeptide repeat protein;(source:Araport11)
AT2G47890 Acts as a positive regulator of red light signaling; overexpression causes markedly shortened hypocotyls under various light states. Binds to the HY5 promoter to activate its transcription, while both BBX21 and HY5 associate with its promoter to positively regulate its expression. T
AT2G47900 Member of plant TLP family which differs in having an F box domain. Plasma membrane tethering is mediated by PIP2 binding domain. Under abiotic stress TLP3 detaches from the PM and translocates to the nucleus. Mutants are insensitive to ABA.
AT2G47940 Encodes DegP2 protease (DEGP2); nuclear gene for chloroplast product.
AT2G47970 Nuclear pore localization protein NPL4;(source:Araport11)
AT2G48030 DNAse I-like superfamily protein;(source:Araport11)
AT2G48075 hypothetical protein;(source:Araport11)
AT2G48080 oxidoreductase, 2OG-Fe(II) oxygenase family protein;(source:Araport11)
AT2G48120 The pale cress (pac) mutant affects chloroplast and leaf development; mutants are ABA-deficient and accumulate lower levels of carotenoids and chlorophyll compared to wild type. PAC binds 23srRNA and appears to be required for 50s ribosome assembly. Three alternative transcripts of this gene exist.PAC is essential for photoautotrophic growth and associates with psbK-psbI, ndhF, ndhD, and 23S ribosomal RNA in vivo(PMID:28805278)
AT2G48150 Encodes glutathione peroxidase.
AT3G01015 MDP60 is a member of the TPX2 protein family. It co-localizes with microtubules and appears to function to destabilize them during light mediated hypocotyl growth.
AT3G01020 Encodes a mitochondrial protein similar to E.coli IscU. In bacteria, IscU is a scaffold protein accepting sulfur and iron to build a transient Fe-S cluster,which is subsequently transferred to a target apoprotein.
AT3G01030 C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11)
AT3G01040 Encodes a protein with putative galacturonosyltransferase activity.
AT3G01050 membrane-anchored ubiquitin-fold protein 1 precursor;(source:Araport11)
AT3G01060 lysine-tRNA ligase;(source:Araport11)
AT3G01070 early nodulin-like protein 16;(source:Araport11)
AT3G01085 Protein kinase superfamily protein;(source:Araport11)
AT3G01150 Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination.
AT3G01175 transmembrane protein;(source:Araport11)
AT3G01190 Peroxidase superfamily protein;(source:Araport11)
AT3G01290 SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11)
AT3G01300 Protein kinase superfamily protein;(source:Araport11)
AT3G01311 actin cross-linking protein, putative (DUF569);(source:Araport11)
AT3G01319 hypothetical protein;(source:Araport11)
AT3G01322 Encodes a ECA1 gametogenesis related family protein
AT3G01324 Encodes a ECA1 gametogenesis related family protein
AT3G01325 Expressed protein;(source:Araport11)
AT3G01328 Encodes a ECA1 gametogenesis related family protein
AT3G01329 Encodes a ECA1 gametogenesis related family protein
AT3G01420 Encodes an alpha-dioxygenase involved in protection against oxidative stress and cell death. Induced in response to Salicylic acid and oxidative stress. Independent of NPR1 in induction by salicylic acid. The mRNA is cell-to-cell mobile.
AT3G01440 Encodes a subunit of the NAD(P)H complex located in the chloroplast thylakoid lumen.
AT3G01460 Encodes a protein with a methyl-CpG-binding domain. Has sequence similarity to human MBD proteins. Involved in the modification of the FLC chromatin acetylation state to affect FLC expression. Mutants show an early flowering, and enhanced shoot branching phenotypes.
AT3G01470 Encodes a homeodomain leucine zipper class I (HD-Zip I) transcriptional activator involved in leaf and hypocotyl development. Its promoter is bound by PIF1 which likely regulates its expression. Its translation is regulated by a conserved upstream ORF (CPuORF33).
AT3G01480 Encodes a chloroplast cyclophilin functioning in the assembly and maintenance of photosystem II (PSII) supercomplexes. The mRNA is cell-to-cell mobile.
AT3G01490 Belongs to the Raf-like kinase subfamily of the mitogen-activated protein kinase kinase kinase (MAPKKK) family. Negatively regulates stomatal opening by negatively regulating plasma membrane H+-ATPase phosphorylation.
AT3G01510 Encodes a putative phosphatase, LSF1, required for normal starch turnover in leaves.
AT3G01516 transmembrane protein;(source:Araport11)
AT3G01530 Member of the R2R3 factor gene family.MYB57 interacts with JAZ proteins, and functions redundantly with MYB21 and MYB24 to regulate stamen development. Promote flavonol biosynthesis through regulation of FLS1 gene expression.
AT3G01540 RNA HELICASE DRH1
AT3G01630 Major facilitator superfamily protein;(source:Araport11)
AT3G01660 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT3G01670 Encodes a protein localized to phloem filaments that is required for phloem filament formation. The mRNA is cell-to-cell mobile.
AT3G01680 Encodes a protein localized to phloem filaments that is required for phloem filament formation. The mRNA is cell-to-cell mobile.
AT3G01705 pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10)
AT3G01750 Ankyrin repeat family protein;(source:Araport11)
AT3G01790 Ribosomal protein L13 family protein;(source:Araport11)
AT3G01830 Calcium-binding EF-hand family protein;(source:Araport11)
AT3G01840 Encodes a putative LysM-containing receptor-like kinase. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. Based on protein sequence alignment analysis, it was determined to be a pseudo kinase since lack of the ATP-binding P-loop in the kinase domain.
AT3G01850 Aldolase-type TIM barrel family protein;(source:Araport11)
AT3G01880 vacuolar sorting-associated protein (DUF946);(source:Araport11)
AT3G01900 member of CYP94B
AT3G01910 Encodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite.
AT3G01950 peroxidase (DUF 3339);(source:Araport11)
AT3G01990 Member of a small family of ACT domain containing proteins in Arabidopsis. ACT domains are involved in amino acid binding.
AT3G02100 UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT3G02120 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT3G02125 pinin-like protein;(source:Araport11)
AT3G02130 Encodes a receptor-like kinase RPK2 (also known as TOADSTOOL 2/TOAD2). Functions as a regulator of meristem maintenance. Mutants are insensitive to synthetic CLV3 peptide. Mutations in the RPK2 also result in stem cell expansion and increased number of floral organs, as seen in the other clv mutants. Forms homo-oligomers.
AT3G02150 a chloroplast trans-acting factor of the psbD light-responsive promoter.TCP gene involved in heterochronic control of leaf differentiation.
AT3G02260 Calossin-like protein required for polar auxin transport. Involved in regulating sugar response and C/N balance.
AT3G02280 Flavoenzyme-encoding gene.
AT3G02300 Regulator of chromosome condensation (RCC1) family protein;(source:Araport11)
AT3G02370 tRNA-splicing endonuclease subunit;(source:Araport11)
AT3G02410 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT3G02440 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT3G02480 Late embryogenesis abundant protein (LEA) family protein;(source:Araport11)
AT3G02510 Regulator of chromosome condensation (RCC1) family protein;(source:Araport11)
AT3G02550 LOB domain-containing protein 41;(source:Araport11)
AT3G02580 Brassinosteroid biosynthetic enzyme, catalyzes delta7 sterol C-5 desaturation step. Mutant has dwarf phenotype.
AT3G02590 Fatty acid hydroxylase superfamily protein;(source:Araport11)
AT3G02600 Encodes phosphatidic acid phosphatase. Expressed during germination.
AT3G02670 Glycine-rich protein family;(source:Araport11)
AT3G02690 Nucleotide/sugar transporter family protein
AT3G02700 NC domain-containing protein-like protein;(source:Araport11)
AT3G02715 pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10)
AT3G02740 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT3G02800 Encodes an atypical dual-specificity phosphatase.
AT3G02810 Encodes a receptor-like cytoplasmic kinase localized in the membrane of pollen tube tip regions that controls micropylar pollen tube guidance in Arabidopsis.
AT3G02850 Encodes SKOR, a member of Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mediates the delivery of K+ from stelar cells to the xylem in the roots towards the shoot. mRNA accumulation is modulated by abscisic acid. K+ gating activity is modulated by external and internal K+. Involved in response to low potassium.
AT3G02875 Hydrolyzes amino acid conjugates of the plant growth regulator indole-3-acetic acid (IAA), including IAA-Leu and IAA-Phe. Uses Mg and Co ions as cofactors.
AT3G02940 Encodes a putative transcription factor (MYB107).
AT3G02970 EXORDIUM like 6;(source:Araport11)
AT3G03000 Calmodulin like protein localized in the plant vacuolar compartment with a function of binding and modifying the activity of a tonoplast transporter (AtNHX1) from within the vacuole in a Ca+2- and pH-dependent manner
AT3G03170 hypothetical protein;(source:Araport11)
AT3G03200 NAC domain containing protein 45;(source:Araport11)
AT3G03240 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT3G03270 HRU1 is a hypoxia induced universal stress protein. It exists as two splice variants with AT3G03270.2 , which contains a putative dimerization domain, the predominant transcript found under anoxia. It is induced by RAP2.12. Subcellular localization is dynamic; under anoxia the localization of HRU1 shifts from cytoplasm to the plasma membrane.
AT3G03440 ARM repeat superfamily protein;(source:Araport11)
AT3G03470 P450 monooxygenase CYP89A9. Involved in NDCC accumulation during Arabidopsis leaf senescence.
AT3G03480 acetyl CoA:(Z)-3-hexen-1-ol acetyltransferase;(source:Araport11)
AT3G03500 TatD related DNase;(source:Araport11)
AT3G03510 Phototropic-responsive NPH3 family protein;(source:Araport11)
AT3G03570 signal transducer, putative (DUF3550/UPF0682);(source:Araport11)
AT3G03580 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT3G03610 ELMO/CED-12 family protein;(source:Araport11)
AT3G03640 Encodes beta-glucosidase (GLUC).
AT3G03650 Exostosin family protein;(source:Araport11)
AT3G03660 Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box.
AT3G03740 Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6).
AT3G03770 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT3G03773 Encodes one of two isoforms of a co-chaperone of HSP90 that is required for root growth, in particular in the maintenance of the root meristem. It can be phosphorylated in vitro by human and maize CK2.
AT3G03790 ankyrin repeat family protein / regulator of chromosome condensation (RCC1) family protein;(source:Araport11)
AT3G03800 member of SYP13 Gene Family
AT3G03852 pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10)
AT3G03855 Annotated as pseudogene of disease resistance protein.Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 .
AT3G03870 transmembrane protein;(source:Araport11)
AT3G03880 sterol O-acyltransferase, putative (DUF1639);(source:Araport11)
AT3G03930 kinase-like protein;(source:Araport11)
AT3G03960 TCP-1/cpn60 chaperonin family protein;(source:Araport11)
AT3G04050 Pyruvate kinase family protein;(source:Araport11)
AT3G04060 NAC046 is a member of the NAC domain containing family of transcription factors. It was identified in a screen for regulators of chlorophyll protein gene expression. Mutants in NAC046 have delayed senescence and increased CHL content suggesting a role in regulation of senescence and chlorophyll degradation.
AT3G04070 NAC domain containing protein 47;(source:Araport11)
AT3G04080 Encodes an Golgi-localized integral membrane enzyme with nucleoside diphosphate activity that when mutated in combination with ATAPY2 causes a complete inhibition of pollen germination.With respect to substrate specificity, APY1 shows the following preferences UTP>IDP>GDP.
AT3G04110 putative glutamate receptor (GLR1.1). Contains a functional cation - permeable pore domain. Involved in cellular cation homeostasis.
AT3G04150 RmlC-like cupins superfamily protein;(source:Araport11)
AT3G04184 hypothetical protein;(source:Araport11)
AT3G04200 RmlC-like cupins superfamily protein;(source:Araport11)
AT3G04240 Has O-linked N-acetyl glucosamine transferase activity. Similar to Arabidopsis SPY gene.
AT3G04270 two-component response regulator ARR22-like protein;(source:Araport11)
AT3G04290 Li-tolerant lipase 1;(source:Araport11)
AT3G04330 Kunitz family trypsin and protease inhibitor protein;(source:Araport11)
AT3G04350 vacuolar sorting-associated protein (DUF946);(source:Araport11)
AT3G04370 Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain.
AT3G04420 NAC domain containing protein 48;(source:Araport11)
AT3G04470 Ankyrin repeat family protein;(source:Araport11)
AT3G04545 Encodes a defensin-like (DEFL) family protein.
AT3G04590 AHL proteins contain two conserved structural units, the AT-hook motif and DUF296 domain.
AT3G04605 Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8).
AT3G04620 Target promoter of the male germline-specific transcription factor DUO1.
AT3G04660 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G04670 member of WRKY Transcription Factor; Group II-d
AT3G04680 Encodes a nuclear protein that functions in mRNA processing. Mutations in this gene cause embryo lethality and reduced transmission through the female gametophyte. Over-expression of a CLPS3:TAP protein changes the relative levels of two alternatively processed FCA transcripts. It also causes abnormal phyllotaxy and flower development, early flowering under long and short days, and increased levels of CUC1 and WUS expression.
AT3G04715 Based on qRT-PCR data, this annotated pseudogene is expressed and upregulated in response to infection with the yellow strain of Cucumber mosaic virus in C24 and Col-0. Exhibited higher levels of H3K27me3; H3K27me3 was significantly decreased (fourfold) in response to infection with CMV(Y).
AT3G04750 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT3G04765 Encodes a microRNA that targets ARF family members ARF6 and ARF8. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UAAGCUGCCAGCAUGAUCUUG
AT3G04780 Encodes a protein with little sequence identity with any other protein of known structure or function. Part of this protein shows a 42% sequence identity with the C-terminal domain of the 32-kD human thioredoxin-like protein.
AT3G04830 Protein prenylyltransferase superfamily protein;(source:Araport11)
AT3G04900 Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT3G04910 Serine/threonine protein kinase, whose transcription is regulated by circadian rhythm.
AT3G04960 trichohyalin, putative (DUF3444);(source:Araport11)
AT3G04990 intracellular protein transporter;(source:Araport11)
AT3G05010 Encodes a candidate G-protein Coupled Receptor that is involved in the regulation of root growth by bacterial N-acyl-homoserine lactones (AHLs) and plays a role in mediating interactions between plants and microbes.
AT3G05030 Encodes a vacuolar K+/H+ exchanger essential for active K+ uptake at the tonoplast and involved in regulating stomatal closure.
AT3G05040 Encodes member of importin/exportin family. Involved in timing of shoot maturation. Involved in miRNA transport. Mutants flower early and have small, curled leaves and reduced abundance of certain miRNA species.
AT3G05150 Major facilitator superfamily protein;(source:Araport11)
AT3G05155 Major facilitator superfamily protein;(source:Araport11)
AT3G05165 Major facilitator superfamily protein;(source:Araport11)
AT3G05170 Phosphoglycerate mutase family protein;(source:Araport11)
AT3G05180 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT3G05210 encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10.
AT3G05220 Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT3G05260 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT3G05320 Golgi localized protein with similarity to protein O-fucosyltransferases. Mutants show lower seed set/reduced fertility. Mutant pollen fails to compete with wild type due to the inability to penetrate the stigma-style boundary.
AT3G05327 Cyclin family protein;(source:Araport11)
AT3G05330 Encodes a protein with moderate sequence similarity to the maize microtubule-binding protein TANGLED1. A single base-pair deletion (-A) at position Chr3:1519176 in Columbia relative to the Landsberg erecta and Achkarren-2 ecotype (see ESTs DR378436 and CB26450) introduces a frame-shift and premature termination codon. The protein encoded from the Columbia gene is truncated by 29 amino acids relative to the Landsberg erecta and Achkarren-2 encoded proteins. Involved in the identification of the division plane during mitosis amd cytokinesis
AT3G05340 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT3G05345 Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT3G05350 Metallopeptidase M24 family protein;(source:Araport11)
AT3G05360 receptor like protein 30;(source:Araport11)
AT3G05370 receptor like protein 31;(source:Araport11)
AT3G05390 S-adenosyl-L-methionine-dependent methyltransferase;(source:Araport11)
AT3G05460 sporozoite surface protein-like protein;(source:Araport11)
AT3G05470 Actin-binding FH2 (formin homology 2) family protein;(source:Araport11)
AT3G05480 Involved in the regulation of DNA damage repair and homologous recombination.
AT3G05490 Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide.
AT3G05530 Encodes RPT5a (Regulatory Particle 5a), one of the six AAA-ATPases of the proteasome regulatory particle. Essential for gametophyte development. In Arabidopsis, the RPT5 subunit is encoded by two highly homologous genes, RPT5a and RPT5b. RPT5a and RPT5b show accession-dependent functional redundancy. In Wassilewskija (Ws) accession: mutant alleles of RPT5a displayed 50% pollen lethality, indicating that RPT5a is essential for male gametophyte development. In the Columbia (Col) accession, a rpt5a mutant allele did not display such a phenotype because the RPT5b Col allele complements the rpt5a defect in the male gametophyte, whereas the RPT5b Ws allele does not. Double rpt5a rpt5b mutants in Col background showed a complete male and female gametophyte lethal phenotype. The mRNA is cell-to-cell mobile.
AT3G05540 Encodes TCTP2, a homolog of Translationally Controlled Tumor Protein. Enhances in vitro plant regeneration.
AT3G05560 Ribosomal L22e protein family;(source:Araport11)
AT3G05570 dipeptide transport ATP-binding protein;(source:Araport11)
AT3G05580 Encodes a Type One Protein Phosphatase that acts as a nucleocytoplasmic negative regulator of tip growth. Mutants affect pollen germination, pollen tube growth, and root hair growth. It acts genetically downstream of ANX1 (AT3G04690) and ANX2 (AT5G28680) and is functionally redundant with TOPP8 (AT5G27840).
AT3G05590 Encodes cytoplasmic ribosomal protein L18.
AT3G05600 Encodes a cytosolic epoxide hydrolase capable of acting on 9,10-epoxystearic acid and on 12,13- epoxyoctadec-9-enoic acid that is involved in the synthesis of poly-hydroxylated cutin monomers.
AT3G05620 Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT3G05630 Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. Regulates vesicle trafficking. Required for auxin transport and distribution and hence auxin responses. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Plays a major role in phosphatidic acid production during phosphate deprivation. Induced upon Pi starvation in both shoots and roots. Involved in hydrolyzing phosphatidylcholine and phosphatidylethanolamine to produce diacylglycerol for digalactosyldiacylglycerol synthesis and free Pi to sustain other Pi-requiring processes. Does not appear to be involved in root hair patterning. Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots.
AT3G05640 EGR1 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress.EGR1 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane.
AT3G05660 receptor like protein 33;(source:Araport11)
AT3G05685 Cystatin/monellin superfamily protein;(source:Araport11)
AT3G05690 Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues.
AT3G05710 Encodes a member of SYP4 Gene Family that is a plant ortholog of the Tlg2/syntaxin16 Qa-SNARE. Together with SYP42, it regulates the secretory and vacuolar transport pathways in the post-Golgi network and maintains the morphology of the Golgi apparatus and TGN and is required for extracellular resistance responses to a fungal pathogen.
AT3G05741 Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT3G05746 hypothetical protein;(source:Araport11)
AT3G05750 Encodes a member of the TRM superfamily, that plays a role in preprophase band formation during plant cell division and controls the robustness of the orientation of that cell division.
AT3G05770 hypothetical protein;(source:Araport11)
AT3G05780 Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins.
AT3G05810 IGR motif protein;(source:Araport11)
AT3G05858 hypothetical protein;(source:Araport11)
AT3G05880 Induced by low temperatures, dehydration and salt stress and ABA. Encodes a small (54 amino acids), highly hydrophobic protein that bears two potential transmembrane domains.
AT3G05900 neurofilament protein-like protein;(source:Araport11)
AT3G05905 Natural antisense transcript overlaps with AT3G05900;(source:Araport11)
AT3G05910 Pectinacetylesterase family protein;(source:Araport11)
AT3G05935 hypothetical protein;(source:Araport11)
AT3G05936 hypothetical protein;(source:Araport11)
AT3G05940 organic solute transporter ostalpha protein (DUF300);(source:Araport11)
AT3G05950 RmlC-like cupins superfamily protein;(source:Araport11)
AT3G05960 Encodes a hexose sugar transporter that is expressed in pollen. STP6 may play a role in providing sugars during late pollen maturation or pollen tube germination.
AT3G05980 hypothetical protein;(source:Araport11)
AT3G05990 Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT3G06010 Encodes AtCHR12, a SNF2/Brahma-type chromatin-remodeling protein. AtCHR12 mediates temporary growth arrest in Arabidopsis upon perceiving environmental stress.
AT3G06019 hypothetical protein;(source:Araport11)
AT3G06020 A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines.
AT3G06035 Glycoprotein membrane precursor GPI-anchored;(source:Araport11)
AT3G06070 hypothetical protein;(source:Araport11)
AT3G06080 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT3G06090 homolog of prePIP1
AT3G06125 Unknown gene The mRNA is cell-to-cell mobile.
AT3G06140 Paralog of LOG2 (At3g09770), a ubiquitin ligase that regulates amino acid export.
AT3G06145 RING zinc finger protein;(source:Araport11)
AT3G06180 Ribosomal protein L34e superfamily protein;(source:Araport11)
AT3G06210 ARM repeat superfamily protein;(source:Araport11)
AT3G06230 member of MAP Kinase Kinase
AT3G06240 F-box family protein;(source:Araport11)
AT3G06280 F-box associated ubiquitination effector family protein;(source:Araport11)
AT3G06300 Encodes a prolyl-4 hydroxylase that can hydroxylate poly(L-proline)and other proline rich peptides, including those with sequences corresponding to those in arabinogalactan proteins and extensins. The mRNA is cell-to-cell mobile.
AT3G06310 Cox19-like CHCH family protein;(source:Araport11)
AT3G06360 Encodes an arabinogalactan-protein (AGP27).
AT3G06370 member of Sodium proton exchanger family
AT3G06390 Uncharacterized protein family (UPF0497);(source:Araport11)
AT3G06410 Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11)
AT3G06420 Autophagy protein.
AT3G06460 ELO family protein containing a characteristic histidine motif which binds to AtCb5-B, interacts with AtBI-1
AT3G06470 ELO family protein containing a characteristic histidine motif which binds to AtCb5-B, interacts with AtBI-1. Together with AtCb5-B interacts with KCR1, PAS2, and CER10, which are essential for the synthesis of VLCFAs.
AT3G06483 Pyruvate dehydrogenase kinase (PDK) specifically phosphorylates the E1α subunit of the pyruvate dehydrogenase complex (PDC) on a Ser residue using ATP as a phosphate donor. PDK is a unique type of protein kinase having a His-kinase-like sequence but Ser-kinase activity. Site-directed mutagenesis and structural analysis indicate that PDK belongs to the GHKL superfamily.
AT3G06500 Encodes an alkaline/neutral invertase which localizes in mitochondria. It may be modulating hormone balance in relation to the radicle emergence. Mutants display severely reduced shoot growth and reduced oxygen consumption. Mutant root development is not affected as reported for A/N-InvA mutant (inva) plants. The mRNA is cell-to-cell mobile.
AT3G06530 ARM repeat superfamily protein;(source:Araport11)
AT3G06540 Encodes a cytoplasmic Rab escort protein that preferentially binds the GDP-bound form of Rab and stimulates geranylgeranylation of various Rab GTPases in Arabidopsis extracts in vitro.
AT3G06560 Encodes a poly(A) polymerase. Located in the cytoplasm.
AT3G06590 Encodes RITF1, a bHLH transcription factor that regulates the transcription of several genes involved in the detoxification of reactive oxygen species generated by salt stress.
AT3G06620 PAS domain-containing protein tyrosine kinase family protein;(source:Araport11)
AT3G06640 PAS domain-containing protein tyrosine kinase family protein;(source:Araport11)
AT3G06670 SMEK1 forms a catalytically active complex with PP4 proteins. The complex has been shown to target and dephosphorylate HYL1 which in turn promotes miRNA biogenesis. Mutants have pleiotrophic phenotypes and decreased production of miRNA. SMEK1 accumulation is responsive to ABA.
AT3G06720 Encodes importin alpha involved in nuclear import. Protein interacts with Agrobacterium proteins VirD2 and VirE2. Is not individually essential for Agrobacterium-mediated root transformation, but when overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype.
AT3G06750 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT3G06778 Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT3G06780 glycine-rich protein;(source:Araport11)
AT3G06880 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT3G06910 Encodes a deSUMOylating enzyme. In vitro it has both peptidase activity and isopeptidase activity: it can cleave the C-terminal residues from SUMO to activate it for attachment to a target protein and it can also act on the isopeptide bond between SUMO and another protein. In vitro assays suggest that this enzyme is active against SUMO1 and SUMO2. It has weak activity with SUMO3 and cannot act on SUMO5. The N-terminal regulatory region of this protein is required for full activity. Suppresses growth during salt stress.
AT3G07040 Contains an N-terminal tripartite nucleotide binding site and a C-terminal tandem array of leucine-rich repeats. Confers resistance to Pseudomonas syringae strains that carry the avirulence genes avrB and avrRpm1.
AT3G07070 Protein kinase superfamily protein;(source:Araport11)
AT3G07115 pre-tRNA tRNA-Ser (anticodon: TGA);(source:Araport11, TAIR10)
AT3G07130 Encodes PAP15, a purple acid phosphatase with phytase activity. Expression of PAP15 is developmentally and temporally regulated, with strong expression at the early stages of seedling growth and pollen germination. The expression is also organ/tissue-specific, with strongest expression in the vasculature, pollen grains, and roots. Recombinant PAP protein exhibits broad substrate specificity with moderate phytase activity. PAP15 likely mobilizes phosphorus reserves in plants, particularly during seed and pollen germination.
AT3G07195 RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11)
AT3G07215 other_RNA;(source:Araport11)
AT3G07230 wound-responsive protein-like protein;(source:Araport11)
AT3G07250 RNA-binding (RRM-RBD-RNP motif) domain nuclear transport factor 2 family protein;(source:Araport11)
AT3G07260 SMAD/FHA domain-containing protein;(source:Araport11)
AT3G07273 hypothetical protein;(source:Araport11)
AT3G07310 phosphoserine aminotransferase, putative (DUF760);(source:Araport11)
AT3G07360 Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays.
AT3G07510 maternal effect embryo arrest protein;(source:Araport11)
AT3G07540 Actin-binding FH2 (formin homology 2) family protein;(source:Araport11)
AT3G07570 Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11)
AT3G07620 glycosyltransferase;(source:Araport11)
AT3G07730 hypothetical protein;(source:Araport11)
AT3G07750 3-5-exoribonuclease family protein;(source:Araport11)
AT3G07760 Ortholog of Peach WEEP gene containing a sterile alpha motif. In peach, WEEP is responsible for pendulous branching phenotype. However in Arabidopsis no morphological branching defect has been observed in mutant lines.
AT3G07800 Encodes a thymidine kinase that salvages DNA precursors.
AT3G07810 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT3G07820 Pectin lyase-like superfamily protein;(source:Araport11)
AT3G07830 Pectin lyase-like superfamily protein;(source:Araport11)
AT3G07880 RhoGTPase GDP dissociation inhibitor (RhoGDI) that spatially restricts the sites of growth to a single point on the trichoblast. It regulates the NADPH oxidase RHD2/AtrbohC, which is required for hair growth.
AT3G07930 DNA glycosylase superfamily protein;(source:Araport11)
AT3G07990 serine carboxypeptidase-like 27;(source:Araport11)
AT3G08010 Encodes a chloroplast-localized protein ATAB2. ATAB2 is involved in the biogenesis of Photosystem I and II. ATAB2 has A/U-rich RNA-binding activity and presumably functions as an activator of translation with targets at PS I and PS II.
AT3G08030 The mRNA of this gene is expressed in viable seeds. Its detection in a dry seed lot has potential for use as a molecular marker for germination performance as absence of expression correlates with decreased germination. Encodes DUF642 cell wall protein.
AT3G08040 Encodes a member of the MATE (multidrug and toxin efflux family), expressed in roots but not shoots. Mutants accumulate excess iron, manganese and zinc, and express root Fe(III) chelatase activity even under iron sufficiency conditions. FRD3 is likely to function in root xylem loading of an iron chelator or other factor necessary for efficient iron uptake out of the xylem or apoplastic space and into leaf cells.
AT3G08490 delta-latroinsectotoxin-Lt1a protein;(source:Araport11)
AT3G08500 Encodes a putative R2R3-type MYB transcription factor (MYB83).
AT3G08510 Phosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol. It is involved in auxin biosynthesis and signaling, modulating development of both male and female gametophytes. It also regulates MAMP-triggered immunity by modulating ROS production.
AT3G08560 vacuolar H+-ATPase subunit E isoform 2;(source:Araport11)
AT3G08570 Phototropic-responsive NPH3 family protein;(source:Araport11)
AT3G08580 mitochondrial ADP/ATP carrier
AT3G08590 Encodes a 2,3-biphosphoglycerate-independent phosphoglycerate mutase that is involved in pollen development and stomatal movement.
AT3G08670 serine/arginine repetitive matrix-like protein;(source:Araport11)
AT3G08680 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT3G08690 ubiquitin-conjugating enzyme 11;(source:Araport11)
AT3G08780 BRISC complex subunit Abro1-like protein;(source:Araport11)
AT3G08860 Encodes a protein that is predicted to have beta-alanine aminotransferase activity.
AT3G08880 Encodes a kinetochore hub-protein that is required for chromosome segregation to ensure proper cell division and the maintenance of plant architecture.
AT3G08900 RGP3 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It is a reversibly autoglycosylated protein. Fluorescently-tagged RGP3 is found in the cytosol and associated with Golgi-like particles when expressed in tobacco leaves. An RGP3-YFP fusion protein under the control a native promoter can be found in the endosperm of Arabidopsis embryos during the linear and bent cotyledon stages of development.
AT3G08947 ARM repeat superfamily protein;(source:Araport11)
AT3G08950 Encodes HCC1, homologue of the copper chaperone SCO1 (synthesis of cytochrome c oxidase 1) from the yeast Saccharomyces cerevisiae. SCO1 encodes a mitochondrial protein that is essential for the correct assembly of complex IV in the respiratory chain. HCC1 is localized in the mitochondrion. A chimeric yeast Sco1-Arabidopsis HCC1 protein complements yeast Sco1 activity. Embryos of hcc1 mutants became arrested at various developmental stages, mostly at the heart stage.
AT3G09010 Protein kinase superfamily protein;(source:Araport11)
AT3G09020 alpha 1,4-glycosyltransferase family protein;(source:Araport11)
AT3G09032 josephin-like protein;(source:Araport11)
AT3G09140 hypothetical protein (DUF674);(source:Araport11)
AT3G09160 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT3G09210 plastid transcriptionally active 13;(source:Araport11)
AT3G09220 putative laccase, a member of laccase family of genes (17 members in Arabidopsis).
AT3G09240 kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11)
AT3G09260 Encodes beta-glucosidase.The major constituent of ER bodies. One of the most abundant proteins in Arabidopsis seedlings. Exist in an soluble (inactive) and non-soluble (active) form, most probably formed in a polymerization process. Involved in the mutualistic interaction between Arabidopsis and the endophytic fungus Piriformospora indica.
AT3G09320 DHHC-type zinc finger family protein;(source:Araport11)
AT3G09330 Transmembrane amino acid transporter family protein;(source:Araport11)
AT3G09375 pseudogene of eukaryotic initiation factor 4A-III;(source:Araport11)
AT3G09385 pseudogene of Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT3G09400 Similar to POLTERGEIST (POL) protein phosphatase 2C. No phenotype observed in plants homozygous for a null allele. Ubiquitously expressed.
AT3G09510 Ribonuclease H-like superfamily protein;(source:Araport11)
AT3G09520 A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT3G09530 A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT3G09550 Ankyrin repeat family protein;(source:Araport11)
AT3G09630 Ribosomal protein L4/L1 family;(source:Araport11)
AT3G09670 PWWP domain protein involved in regulation of FLC and flowering time.
AT3G09700 Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT3G09720 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT3G09735 S1FA-like DNA-binding protein;(source:Araport11)
AT3G09760 RING/U-box superfamily protein;(source:Araport11)
AT3G09770 Encodes a ubiquitin E3 ligase LOG2 (LOSS OF GDU2). Required for GLUTAMINE DUMPER1(GDU1)-induced amino secretion.
AT3G09780 CRINKLY4 related 1;(source:Araport11)
AT3G09810 Encodes a catalytic subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase
AT3G09830 Encodes a member of subfamily VIIa of the receptor-like cytoplasmic kinases (RLCKs). It contributes to pattern-triggered immunity in response to P. syringae.
AT3G09870 SAUR-like auxin-responsive protein family;(source:Araport11)
AT3G09900 RAB GTPase homolog E1E;(source:Araport11)
AT3G09920 Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) family member. Family members are key enzymes in the process of phosphatidylinositol signaling pathway and have essential functions in growth, development, and biotic and abiotic stresses responses in plants
AT3G09922 Encodes a gene product whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots.
AT3G09930 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT3G09950 hypothetical protein;(source:Araport11)
AT3G09970 Encodes a cytosolic tyrosine phosphatase.
AT3G09980 Encodes ACIP1, a microtubules-associated protein required for bacterial immunity. The mRNA is cell-to-cell mobile.
AT3G10000 Homeodomain-like superfamily protein;(source:Araport11)
AT3G10010 Encodes a protein with DNA glycosylase activity that is involved in maintaining methylation marks.
AT3G10060 FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11)
AT3G10210 SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein;(source:Araport11)
AT3G10240 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G10320 MUCI21 is a GT61 protein required for the production of highly branched xylan in seed coat mucilage. MUCI21 likely decorates xylan with xylose side chains that seem to be necessary for pectin attachment to the seed surface.
AT3G10340 Encodes PAL4, a putative a phenylalanine ammonia-lyase. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4).
AT3G10350 One of 3 GET paralogs in Arabidopsis. GET3b is a chloroplast localized protein with no obvious role in Tail Anchored (TA) protein insertion.
AT3G10430 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G10450 serine carboxypeptidase-like 7;(source:Araport11)
AT3G10460 Plant self-incompatibility protein S1 family;(source:Araport11)
AT3G10480 Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. It binds the NAC-binding site, the Mitochondrial Dysfunction Motif.
AT3G10490 Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control.
AT3G10500 Encodes a transcriptional activator that is associated with the plasma membrane in a dormant form and is proteolytically cleaved to create a form that can enter the nucleus. It is thought to promote ROS production by binding directly to the promoters of genes encoding ROS biosynthetic enzymes during drought-induced leaf senescence. The mRNA is cell-to-cell mobile.
AT3G10520 Encodes a class 2 non-symbiotic hemoglobin. Over-expression of AHb2 in seeds led to a 40% increase in the total fatty acid content of developing and mature seeds in three subsequent generations. This was mainly due to an increase in the poly-unsaturated C18:2 (omega-6) linoleic and C18:3 (omega-3) alpha-linolenic acids.
AT3G10525 Encodes LGO (loss of giant cells from organs) required for endoreduplication in sepal giant cell formation. Giant cells in both leaves and sepals are absent in lgo mutants. LGO is a member of a plant specific cell cycle inhibitor family SIAMESE and was originally named as SMR1(SIAMESE RELATED 1).
AT3G10540 master regulator of AGC kinases
AT3G10585 Homeodomain-like superfamily protein;(source:Araport11)
AT3G10590 Duplicated homeodomain-like superfamily protein;(source:Araport11)
AT3G10650 Encodes a nucleoporin involved in mRNA export from the nucleus. It is also involved in the regulation of nuclear morphology.
AT3G10660 predicted to encode calcium-dependent protein kinase and is localized to the ER. Protein is myristoylated in a cell-free extract. Changing the proposed myristoylated site, G residue in the amino terminal, to A prevented the meristoylation . The G to A mutation decreased AtCPK2 membrane association by approximately 50%.
AT3G10670 Plastidic SufC-like ATP-binding cassette/ATPase essential for Arabidopsis embryogenesis. Involved in the biogenesis and/or repair of oxidatively damaged Fe?S clusters. Expressed in embryos and meristems.
AT3G10680 SLI1 is a heat shock like protein that is found in sieve elements, sieve plates and spherical bodies peripheral to the mitochondria. Mutants show increased phloem feeding by aphids and decreased heat tolerance.
AT3G10700 Encodes a GHMP kinase family protein that acts as a galacturonic acid-1-phosphate kinase that catalyzes the production of galacturonic acid-1-phosphate. This is a precursor of the important cell wall building block UDP-galacturonic acid. Based on gene trap line GT8007, the gene appears to be expressed in a petal and stamen-specific manner, between flower stages 8 to 11, however, later RT-qPCR analysis demonstrates that the transcript is present throughout the plant in all tissues tested.
AT3G10710 root hair specific 12;(source:Araport11)
AT3G10730 Encodes a member of the Sad1/UNC-84 (SUN)-domain proteins: AtSUN1(At5g04990), AtSUN2(AT3G10730). SUN domain proteins are part of the cytoskeletal-nucleoskeletal bridging complexes. AtSUN1 and AtSUN2 are localized to the nuclear envelope and are present as homomers and heteromers in vivo.
AT3G10815 RING/U-box superfamily protein;(source:Araport11)
AT3G10820 Transcription elongation factor (TFIIS) family protein;(source:Araport11)
AT3G10870 Encodes a methyl IAA esterase. Methyl IAA is believed to be an inactive form of auxin that needs to be demethylated to exert a biological effect. MES17 does not act on methyl JA, MeSA, MeGA4, or MEGA9 in vitro. This gene is expressed in several tissues of seedlings and adult plants, with a higher relative level of expression in the seedling shoot apex and the adult stem.
AT3G10890 Encodes an endo beta mannanase that is localized to the apoplast and involved in glutathione mediated cadmium tolerance.
AT3G10910 RING/U-box superfamily protein;(source:Araport11)
AT3G10980 PLAC8 family protein;(source:Araport11)
AT3G10986 LURP-one-like protein (DUF567);(source:Araport11)
AT3G10990 F-box associated ubiquitination effector family protein;(source:Araport11)
AT3G11020 encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2B). The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A.
AT3G11070 Outer membrane OMP85 family protein;(source:Araport11)
AT3G11080 receptor like protein 35;(source:Araport11)
AT3G11110 RING/U-box superfamily protein;(source:Araport11)
AT3G11165 hypothetical protein;(source:Araport11)
AT3G11170 Chloroplastic enzyme responsible for the synthesis of 16:3 and 18:3 fatty acids from galactolipids, sulpholipids and phosphatidylglycerol. Uses ferredoxin as electron donor. Gene expression is induced by wounding in shoot and root. The wound-response in shoot is independent of jasmonic acid mediated pathway whereas the root response is mediated by jasmonic acid. The mRNA is cell-to-cell mobile.
AT3G11200 Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7).
AT3G11210 SGNH hydrolase-type esterase superfamily protein;(source:Araport11)
AT3G11270 Mov34/MPN/PAD-1 family protein;(source:Araport11)
AT3G11280 Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay).
AT3G11285 pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10)
AT3G11300 hypothetical protein;(source:Araport11)
AT3G11320 Nucleotide-sugar transporter family protein;(source:Araport11)
AT3G11330 Encodes PIRL9, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen.
AT3G11340 Encodes a uridine diphosphate-dependent glucosyltransferase that conjugates isoleucic acid and modulates plant defense via glucosylation of N-hydroxypipecolic acid.
AT3G11350 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT3G11380 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT3G11385 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT3G11397 prenylated RAB acceptor 1.A3;(source:Araport11)
AT3G11405 hypothetical protein;(source:Araport11)
AT3G11415 other_RNA;(source:Araport11)
AT3G11420 beta-1,3-N-acetylglucosaminyltransferase lunatic protein, putative (DUF604);(source:Araport11)
AT3G11430 sn-glycerol-3-phosphate 2-O-acyltransferas, involved in the biosynthesis of suberin polyester.
AT3G11440 Member of the R2R3-MYB gene family. Similar to GA-induced Barley myb gene. May be induced during germination in response to GA. Double mutants with MYB33 are male sterile, showing defects in pollen development and anther development. Contains a binding site for miRNA159 and may be spatially regulated by this micro RNA. A highly conserved RNA secondary structure abuts the miR159 binding site which facilitates its regulation by miR159. The male sterile phenotype of the MYB33/MYB65 double mutant is light and temperature sensitive. Fertility can be restored with increased light intensity and lower temperatures.
AT3G11470 Encodes one of three splice variants. Differs in having CM in positions 88 and 89. The protein is localized to the mitochondria where it phosphopantetheinylates the mature apo mtACP isoforms. It is an essential gene as homozygous mutants cannot be recovered (embryo lethal).
AT3G11490 ROP (Rho of plant GTPases) family member Involved in cell wall patterning. Encodes ROP inactivator, regulates the formation of ROP-activated domains; these in turn determined the pattern of cell wall pits. Positively regulates pit formation, but negatively regulates pit size, required for periodic formation of secondary cell wall pits.
AT3G11510 Ribosomal protein S11 family protein;(source:Araport11)
AT3G11550 Uncharacterized protein family (UPF0497);(source:Araport11)
AT3G11570 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT3G11580 SOD7 encodes nuclear localized B3 DNA binding domain and a transcriptional repression motif. Belongs to the RAV gene family. Functions in regulation of seed size and binds to and represses KLU. Transcription repressor involved in regulation of inflorescence architecture.
AT3G11590 golgin family A protein;(source:Araport11)
AT3G11591 bric-a-brac protein;(source:Araport11)
AT3G11600 One of two plant specific paralogs of unknown function. Interacts with GL2. GIR1/GIR2 loss of function resembles gl2 lof mutations.
AT3G11660 encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus. Localization of the gene product is similar to that of NHL3 (plasma membrane) but it is yet inconclusive.
AT3G11673 pseudogene of F-box family protein
AT3G11700 Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development.
AT3G11740 LURP-one-like protein (DUF567);(source:Araport11)
AT3G11773 Thioredoxin superfamily protein;(source:Araport11)
AT3G11780 MD-2-related lipid recognition domain-containing protein / ML domain-containing protein;(source:Araport11)
AT3G11840 Encodes a U-box-domain-containing E3 ubiquitin ligase that acts as a negative regulator of PAMP-triggered immunity.
AT3G11964 Encodes a nucleolar protein that is a ribosome biogenesis co-factor. Mutants display aberrant RNA processing and female gametophyte development.
AT3G11980 Similar to fatty acid reductases.
AT3G12110 Encodes an actin that is expressed predominantly during reproductive development.
AT3G12120 Major enzyme responsible for the synthesis of 18:2 fatty acids in the endoplasmic reticulum. Contains His-rich motifs, which contribute to the interaction with the electron donor cytochrome b5. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2.
AT3G12140 Agenet domain containing nucleosome binding protein. Binds H3K36 sites.
AT3G12190 golgin family A protein;(source:Araport11)
AT3G12200 Encodes AtNek7, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.
AT3G12250 basic leucine zipper transcription factor involved in the activation of SA-responsive genes.
AT3G12320 Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK4 in having affects on biomass accumulation and phototrophism.
AT3G12420 Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11)
AT3G12490 Encodes a protein with cysteine proteinase inhibitor activity. Overexpression increases tolerance to abiotic stressors (i.e.salt,osmotic, cold stress).
AT3G12540 ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547);(source:Araport11)
AT3G12550 Belongs to a subgroup of SGS3-like proteins that act redundantly in RNA-directed DNA methylation: AT1G15910 (FDM1), AT4G00380 (FDM2), AT3G12550 (FDM3), AT1G13790 (FDM4), AT1G80790 (FDM5).
AT3G12560 Encodes a telomeric DNA-binding protein.
AT3G12650 transmembrane protein;(source:Araport11)
AT3G12710 DNA glycosylase superfamily protein;(source:Araport11)
AT3G12720 Member of the R2R3 factor gene family.
AT3G12775 ubiquitin-conjugating enzyme family protein;(source:Araport11)
AT3G12820 Member of the R2R3 factor gene family.
AT3G12830 SAUR-like auxin-responsive protein family;(source:Araport11)
AT3G12840 F-box/FBD-like domain protein;(source:Araport11)
AT3G12850 COP9 signalosome complex-related / CSN complex-like protein;(source:Araport11)
AT3G12880 Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT3G12890 Encodes a protein belonging to a class of CCT (CONSTANS, CONSTANS-like, TOC1) domain proteins. The protein contains a 43 amino acid-long sequence with high homology to the CCT domain but does not have any B-box or GATA-type zinc finger domains. Functions as a transcriptional activator and regulates the expression of at least a subset of sugar-inducible genes.
AT3G12900 S8H hydroxylates scopoletin to generate fraxetin (8-hydroxyscopoletin). Fraxetin and its oxidized analog sideretin (5-hydroxyfraxetin) are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil.S8H hydroxylates scopoletin to generate fraxetin (8-hydroxyscopoletin). Fraxetin and its oxidized analog sideretin (5-hydroxyfraxetin) are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil.
AT3G12920 Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea.
AT3G12955 SAUR-like auxin-responsive protein family;(source:Araport11)
AT3G12960 seed maturation protein;(source:Araport11)
AT3G12980 Encodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC5 acetylation of the H3 or H4 peptides, suggesting that HAC5 can acetylate any of several lysines present in the peptides. Di-acetylation of both lysines 9 and 14 on the H3 peptide significantly reduces the level of incorporated radioactive acetylation catalyzed by HAC5, indicating that HAC5 may acetylate either lysine 9 or lysine 14. The mRNA is cell-to-cell mobile.
AT3G13000 ubiquinone biosynthesis protein (Protein of unknown function, DUF547);(source:Araport11)
AT3G13010 hAT transposon superfamily protein;(source:Araport11)
AT3G13065 STRUBBELIG-receptor family 4;(source:Araport11)
AT3G13100 member of MRP subfamily
AT3G13110 Encodes a mitochondrial serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system.
AT3G13130 transmembrane protein;(source:Araport11)
AT3G13140 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT3G13160 Ribosomal pentatricopeptide repeat protein
AT3G13226 regulatory protein RecX family protein;(source:Araport11)
AT3G13228 RING/U-box superfamily protein;(source:Araport11)
AT3G13229 kinesin-like protein (DUF868);(source:Araport11)
AT3G13277 other_RNA;(source:Araport11)
AT3G13290 varicose-like protein;(source:Araport11)
AT3G13350 HMG (high mobility group) box protein with ARID/BRIGHT DNA-binding domain-containing protein;(source:Araport11)
AT3G13370 formin-like protein;(source:Araport11)
AT3G13390 SKU5 similar 11;(source:Araport11)
AT3G13400 SKU5 similar 13;(source:Araport11)
AT3G13460 Physically interacts with CIPK1. ECT2 regulates the mRNA levels of the roteasome regulator PTRE1 and of several 20S proteasome subunits, resulting in enhanced 26S proteasome activity. YTHDF protein which togeteher with ECT3 and ECT4 is involved in cell proliferation during plant organogenesis.
AT3G13480 nuclear polyadenylated RNA-binding protein;(source:Araport11)
AT3G13500 hypothetical protein;(source:Araport11)
AT3G13590 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT3G13600 calmodulin-binding family protein;(source:Araport11)
AT3G13610 Encodes a Fe(II)- and 2-oxoglutarate-dependent dioxygenase family gene F6'H1. Mutations in this gene compromise iron uptake and the production of fluorescent phenolics involved in Fe uptake. The mRNA is cell-to-cell mobile.
AT3G13682 Encodes a homolog of human Lysine-Specific Demethylase1. Involved in H3K4 methylation of target genes including the flowering loci FLC and FWA.
AT3G13690 kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11)
AT3G13700 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT3G13724 Encodes a microRNA that targets CMT3. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGGUGGUGAUCAUAUAAGAU
AT3G13730 Encodes a cytochrome P-450 gene that is involved in brassinosteroid biosynthesis, most likely in the conversion step of teasterone (TE) to 3-dehydroteasterone (3DT), and/or 6-deoxoteasterone (6-deoxoTE) to 6-deoxo-3-dehydroteasterone (6-deoxo3DT); or the conversion of cathasterone (CT) to TE, and/or 6-deoxocathasterone (6-deoxoCT) to 6-deoxoTE. Recently, CYP90D1 was shown to catalyse the C-23 hydroxylation of several brassinosteroids (the enzyme has a broad specificity for 22-hydroxylated substrates). Member of the CYP90C CYP450 family. Similar to Cytochrome P450 90C1 (ROT3).
AT3G13750 beta-galactosidase, glycosyl hydrolase family 35 The mRNA is cell-to-cell mobile.
AT3G13780 SMAD/FHA domain-containing protein;(source:Araport11)
AT3G13782 Plants mutated in three ubiquitously expressed NAP1 genes (NAP1;1~NAP1;3) and organ-specifically expressed NAP1;4 gene show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. The NAP1 genes act synergistically with NRP genes in promoting somatic homologous recombination.
AT3G13784 cell wall invertase 5;(source:Araport11)
AT3G13790 Encodes a protein with invertase activity.
AT3G13800 Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11)
AT3G13820 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G13830 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G13840 GRAS family transcription factor;(source:Araport11)
AT3G13855 U6;(source:Araport11)
AT3G13890 Encodes a putative transcription factor (MYB26). Mutants produces fertile pollen but plants are sterile because anthers do not dehisce. The cellulosic secondary wall thickenings are not formed in the endothecium as they are in non-mutant plants.
AT3G13910 hypothetical protein (DUF3511);(source:Araport11)
AT3G13920 eukaryotic translation initiation factor 4A-1
AT3G13965 Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167
AT3G13980 SKI/DACH domain protein;(source:Araport11)
AT3G14000 Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity.
AT3G14010 hydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2.
AT3G14020 nuclear factor Y, subunit A6;(source:Araport11)
AT3G14060 hypothetical protein;(source:Araport11)
AT3G14120 nuclear pore complex protein;(source:Araport11)
AT3G14130 Aldolase-type TIM barrel family protein;(source:Araport11)
AT3G14170 CORD1 is a member of a novel and plant specific family of microtubule associated proteins. CORD1 binds microtubules via a conserved protein domain shared among family members. CORD functions may overlap;cord1 / cord2 mutants have defects in secondary cell wall pit morphology.
AT3G14172 GPI-anchored adhesin-like protein;(source:Araport11)
AT3G14200 Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT3G14205 Phosphoinositide phosphatase family protein;(source:Araport11)
AT3G14210 A semidominant QTL which has an epistatic effect on the Epithiospecifier gene. Represses nitrile formation and favors isothiocyanate production during glucosinolate hydrolysis. The functional allele deters the insect herbivory T. ni.
AT3G14240 Subtilase family protein;(source:Araport11)
AT3G14250 RING/U-box superfamily protein;(source:Araport11)
AT3G14270 Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant.
AT3G14280 LL-diaminopimelate aminotransferase;(source:Araport11)
AT3G14300 pectinesterase family protein;(source:Araport11)
AT3G14310 encodes a pectin methylesterase, targeted by a cellulose binding protein (CBP) from the parasitic nematode Heterodera schachtii during parasitism.
AT3G14340 hypothetical protein;(source:Araport11)
AT3G14350 STRUBBELIG-receptor family 7;(source:Araport11)
AT3G14360 Lipid droplet-associated triacylglycerol lipase (TAG) involved in pollen tube growth. TAG is possibly a direct precursor for the synthesis of membrane lipids in pollen tubes.
AT3G14370 The WAG2 and its homolog, WAG1 each encodes protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons.
AT3G14380 Uncharacterized protein family (UPF0497);(source:Araport11)
AT3G14390 Meso-diaminopimelate decarboxylase which catalyzes the decarboxylation of mesodiaminopimelate, the final reaction in the diaminopimelate L-lysine biosynthetic pathway.
AT3G14395 Protein Involved in the Regulation of Herbivore-Associated Signaling Pathways, affecting the expression of genes involved in biosynthesis and signaling of the jasmonic acid and salicylic acid hormones.
AT3G14400 Encodes a ubiquitin-specific protease.
AT3G14410 Nucleotide/sugar transporter family protein
AT3G14440 Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane.
AT3G14450 RNA-binding protein, putative, contains Pfam profile: PF00076 RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (2 copies). Contains PAM PABC binding domain.
AT3G14452 transmembrane protein;(source:Araport11)
AT3G14490 Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11)
AT3G14520 Encodes a sesterterpene synthase responsible for the biosynthesis of the tricyclic sesterterpene (+)-thalianatriene with a 11-6-5 fused ring system.
AT3G14580 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT3G14590 Ca2+-dependent lipid-binding protein
AT3G14595 Ribosomal protein L18ae family;(source:Araport11)
AT3G14710 RNI-like superfamily protein;(source:Araport11)
AT3G14720 member of MAP Kinase The mRNA is cell-to-cell mobile.
AT3G14760 transmembrane protein;(source:Araport11)
AT3G14770 Nodulin MtN3 family protein;(source:Araport11)
AT3G14810 mechanosensitive channel of small conductance-like 5;(source:Araport11)
AT3G14840 Encodes LRR-RLK protein that is localized to the plasma membrane and is involved in regulation of plant innate immunity to microbes. LIK1 is phosphorylated by CERK1, a kinase involved in chitin perception. The mRNA is cell-to-cell mobile.
AT3G14850 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT3G14855 pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10)
AT3G14940 Encodes a cytosolic phosphoenolpyruvate carboxylase (PEPC) that has activity when expressed in E.coli. Its mRNA is most abundantly expressed in roots and siliques. PPC3 belongs to the plant-type PEPC family. It can form an enzymatically active complex with a castor bean ortholog of PPC4, which encodes a bacterial-type PEPC. The mRNA is cell-to-cell mobile.
AT3G14950 Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis.
AT3G14960 Galactosyltransferase family protein;(source:Araport11)
AT3G14970 RING/U-box superfamily protein;(source:Araport11)
AT3G14990 Encodes a homolog of animal DJ-1 superfamily protein. In the A. thaliana genome, three genes encoding close homologs of human DJ-1 were identified AT3G14990 (DJ1A), AT1G53280 (DJ1B) and AT4G34020 (DJ1C). Among the three homologs, DJ1C is essential for chloroplast development and viability. It exhibits glyoxalase activity towards glyoxal and methylglyoxal. The mRNA is cell-to-cell mobile.
AT3G15030 Arabidopsis thaliana TCP family transcription factor. Regulated by miR319. Involved in heterchronic regulation of leaf differentiation.
AT3G15040 senescence regulator (Protein of unknown function, DUF584);(source:Araport11)
AT3G15050 Member of IQ67 (CaM binding) domain containing family.
AT3G15060 RAB GTPase homolog A1G;(source:Araport11)
AT3G15080 Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11)
AT3G15110 transmembrane protein;(source:Araport11)
AT3G15115 serine/arginine repetitive matrix protein;(source:Araport11)
AT3G15220 Protein kinase superfamily protein;(source:Araport11)
AT3G15270 Encodes a member of the SPL (squamosa-promoter binding protein-like)gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. Contains the SBP-box, which encodes the SBP-domain, required and sufficient for interaction with DNA. It is involved in regulation of flowering and vegetative phase change. Its temporal expression is regulated by the microRNA miR156. The target site for the microRNA is in the 3'UTR.
AT3G15280 hypothetical protein;(source:Araport11)
AT3G15300 VQ motif-containing protein;(source:Araport11)
AT3G15330 pseudogene of the NLI interacting factor (NIF) protein family
AT3G15340 Encodes PPI2 (proton pump interactor 2), a homologue of PPI1, a protein that interacts with the plasma membrane H+ ATPase AHA1.
AT3G15350 G14 enzyme
AT3G15354 Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA3 (and SPA4) predominantly regulates elongation growth in adult plants.
AT3G15370 member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio)
AT3G15450 aluminum induced protein with YGL and LRDR motifs;(source:Araport11)
AT3G15490 Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11)
AT3G15500 Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3. The mRNA is cell-to-cell mobile.
AT3G15510 Note of caution: not to be confused with another protein (AtNAC6 locus AT5G39610) which on occasion has also been referred to as AtNAC2.
AT3G15518 hypothetical protein;(source:Araport11)
AT3G15530 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT3G15540 Primary auxin-responsive gene. Involved in the regulation stamen filaments development.
AT3G15570 Phototropic-responsive NPH3 family protein;(source:Araport11)
AT3G15590 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT3G15604 hypothetical protein;(source:Araport11)
AT3G15605 nucleic acid binding protein;(source:Araport11)
AT3G15700 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT3G15720 Pectin lyase-like superfamily protein;(source:Araport11)
AT3G15770 hypothetical protein;(source:Araport11)
AT3G15840 Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport.
AT3G15860 plant self-incompatibility protein S1 family protein;(source:Araport11)
AT3G15960 mismatched DNA binding / ATP binding protein;(source:Araport11)
AT3G16030 lectin protein kinase family protein;(source:Araport11)
AT3G16050 Encodes a protein with pyridoxal phosphate synthase activity whose transcripts were detected mostly in roots and accumulate during senescence. The protein was found in very low abundance, which prevented a specific localisation.
AT3G16070 LOW protein: ATP-dependent RNA helicase-like protein;(source:Araport11)
AT3G16130 Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily.
AT3G16140 Encodes subunit H of photosystem I reaction center subunit VI.
AT3G16180 Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves.
AT3G16210 F-box family protein;(source:Araport11)
AT3G16290 Strong interaction with TIC inner envelope protein translocon which consists of Tic20/Tic56/Tic100/Tic214(Ycf1)(DOI:10.1105/tpc.18.00357).
AT3G16340 Encodes a p-coumaryl alcohol exporter involved in lignin biosynthesis.
AT3G16350 MYB-like transcription factor involved in nitrate signaling trough regulation of CHL1.
AT3G16370 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. The mRNA is cell-to-cell mobile.
AT3G16390 Encodes a nitrile-specifier protein NSP3. NSP3 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. The mRNA is cell-to-cell mobile.
AT3G16415 pseudogene of myrosinase-binding protein 2;(source:Araport11)
AT3G16430 Encodes a protein that increases the beta-glucosidase activities of three scopolin glucosidases in vitro.
AT3G16490 Member of IQ67 (CaM binding) domain containing family.
AT3G16500 phytochrome-associated protein 1 (PAP1)
AT3G16510 Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT3G16530 Lectin like protein whose expression is induced upon treatment with chitin oligomers.
AT3G16555 F-box and associated interaction domains-containing protein;(source:Araport11).SON1 paralog.
AT3G16560 Protein phosphatase 2C family protein;(source:Araport11)
AT3G16570 Encodes RALF23, a member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. RALF23 is significantly downregulated by brassinolide treatment of seedlings. Overexpression of AtRALF23 impairs brassinolide-induced hypocotyls elongation, and mature overexpressing plants are shorter and bushier. RALF23 overexpression produces slower growing seedlings with roots that have reduced capacity to acidify the rhizosphere.
AT3G16600 SNF2 domain-containing protein / helicase domain-containing protein / zinc finger protein-like protein;(source:Araport11)
AT3G16630 Kinesin-13A localized to entire Golgi stacks. Involved in trichome development.
AT3G16650 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT3G16660 Pollen Ole e 1 allergen and extensin family protein;(source:Araport11)
AT3G16670 Pollen Ole e 1 allergen and extensin family protein;(source:Araport11)
AT3G16680 DNA binding / DNA-directed RNA polymerase;(source:Araport11)
AT3G16720 RING-H2 protein induced after exposure to chitin or inactivated crude cellulase preparations. The mRNA is cell-to-cell mobile.
AT3G16770 Encodes a member of the ERF (ethylene response factor) subfamily B-2 of the plant specific ERF/AP2 transcription factor family (RAP2.3). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12.It is localized to the nucleus and acts as a transcriptional activator through the GCC-box. It has been identified as a suppressor of Bax-induced cell death by functional screening in yeast and can also suppress Bax-induced cell death in tobacco plants. Overexpression of this gene in tobacco BY-2 cells confers resistance to H2O2 and heat stresses. Overexpression in Arabidopsis causes upregulation of PDF1.2 and GST6. It is part of the ethylene signaling pathway and is predicted to act downstream of EIN2 and CTR1, but not under EIN3. The mRNA is cell-to-cell mobile.
AT3G16780 Ribosomal protein L19e family protein;(source:Araport11)
AT3G16810 Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts.
AT3G16860 COBRA-like protein 8 precursor;(source:Araport11)
AT3G16880 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G16920 Encodes a chitinase-like protein expressed predominantly in stems. Mutants accumulate ligning in etiolated hypocotyls.
AT3G16950 encodes a plastid lipoamide dehydrogenase, subunit of the pyruvate dehydrogenase complex which provides acetyl-CoA for de novo fatty acid biosynthesis. The gene is highly expressed in developing seeds.
AT3G17000 Group XIV ubiquitin-conjugating enzyme that functions negative regulation of drought stress.
AT3G17010 transcriptional factor B3 family protein, contains Pfam profile PF02362: B3 DNA binding domain. Activated by AGAMOUS ina a cal-1, ap1-1 background. Expressed in stamen primordia, the placental region of developing carpels and the ovary.
AT3G17080 Plant self-incompatibility protein S1 family;(source:Araport11)
AT3G17110 Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167
AT3G17170 Translation elongation factor EF1B/ribosomal protein S6 family protein;(source:Araport11)
AT3G17180 serine carboxypeptidase-like 33;(source:Araport11)
AT3G17185 Encodes a trans-acting siRNA (tasi-RNA) that regulates the expression of auxin response factor genes (ARF2, ARF4, ETT). One of 3 genomic loci that encode the TAS3 siRNA. Has been identified as a translated small open reading frame by ribosome profiling.
AT3G17205 ubiquitin protein ligase 6;(source:Araport11)
AT3G17210 Encodes a heat stable protein with antimicrobial and antifungal activity.
AT3G17265 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G17270 F-box/associated interaction domain protein;(source:Araport11)
AT3G17280 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G17310 Encodes DRM3 (Domains Rearranged Methyltransferase3), a catalytically mutated paralog of the cytosine methyltransferase DRM2. Despite being catalytically mutated, DRM3 is required for normal maintenance of non-CG DNA methylation, establishment of RNA-directed DNA methylation triggered by repeat sequences and accumulation of repeat-associated small RNAs.
AT3G17360 PHRAGMOPLAST ORIENTING KINESIN 1 is one of the two Arabidopsis homologs isolated in yeast two-hybrid screen for interaction partners of maize gene TANGLED1 (TAN1). Based on sequence homology in their motor domains, POK1 and POK2 belong to the kinesin-12 class which also includes the well-characterized group of phragmoplast-associated kinesins AtPAKRPs. Both kinesins are composed of an N-terminal motor domain throughout the entire C terminus and putative cargo binding tail domains. The expression domains for POK1 constructs were more limited than those for POK2; both are expressed in tissues enriched for dividing cells. The phenotype of pok1/pok2 double mutants strongly resembles that of maize tan1 mutants, characterized by misoriented mitotic cytoskeletal arrays and misplaced cell walls.
AT3G17365 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT3G17420 Serine/threonine protein kinase-like protein expressed in etiolated cotyledons and found in glyoxysomes.
AT3G17500 F-box family protein;(source:Araport11)
AT3G17520 Late embryogenesis abundant protein (LEA) family protein;(source:Araport11)
AT3G17540 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G17550 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT3G17570 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G17580 SsrA-binding protein;(source:Araport11)
AT3G17600 Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA31 shares several residues with the conserved domain II region, believed to act as a degron in many of the rapidly degraded Aux/IAA family members. An IAA31 fusion protein is quite long-lived, but can be degraded more rapidly in the presence of auxin. Unlike many other family members, IAA31 transcript levels do not rise in response to auxin. Nevertheless, overexpression of IAA31 leads to defects in auxin-related processes such as gravitropism, root development, shoot development, and cotyledon vascular development.
AT3G17609 Encodes a homolog of HY5 (HYH). Involved in phyB signaling pathway.
AT3G17640 Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT3G17660 A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes; AGD15 belongs to the class 4, together with AGD14.
AT3G17675 Encodes a Plantacyanin/Basic blue family protein
AT3G17690 member of Cyclic nucleotide gated channel family
AT3G17700 cyclic nucleotide-binding transporter 1, member of a family of cyclic nucleotide gated channels. The mRNA is cell-to-cell mobile.
AT3G17730 NAC domain containing protein 57;(source:Araport11)
AT3G17760 glutamate decarboxylase 5;(source:Araport11)
AT3G17790 Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots.
AT3G17820 encodes a cytosolic glutamine synthetase, the enzyme has low affinity with substrate ammonium The mRNA is cell-to-cell mobile.
AT3G17880 Encodes a thioredoxin-like disulfide reductase. The protein interacts with the yeast Hsp70 protein Ssb2 in vitro. This interaction is sensitive to the redox status of the thioredoxin domain of AtTDX.
AT3G17890 hypothetical protein;(source:Araport11)
AT3G17980 Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT3G18020 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT3G18040 Encodes a protein with similarity to MAP kinases (MAPK9).Expressed preferentially in guard cells and appears to be involved in reactive oxygen species mediated ABA signaling.
AT3G18050 GPI-anchored protein;(source:Araport11)
AT3G18150 RNI-like superfamily protein;(source:Araport11)
AT3G18170 Glycosyltransferase family 61 protein;(source:Araport11)
AT3G18180 Glycosyltransferase family 61 protein;(source:Araport11)
AT3G18200 nodulin MtN21-like transporter family protein
AT3G18220 Phosphatidic acid phosphatase (PAP2) family protein;(source:Araport11)
AT3G18230 Octicosapeptide/Phox/Bem1p family protein;(source:Araport11)
AT3G18280 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT3G18282 hypothetical protein;(source:Araport11)
AT3G18350 Plant protein of unknown function (DUF639);(source:TAIR10)
AT3G18370 C2 domain-containing protein;(source:Araport11)
AT3G18440 Belongs to the aluminum-activated malate transporter family. Encodes a vacuolar malate channel. Expressed in all parts of plants. Almost exclusively expressed in mesophyll cells of leaves. The mRNA is cell-to-cell mobile.
AT3G18450 PLAC8 family protein;(source:Araport11)
AT3G18480 This gene is predicted to encode a protein that functions as a Golgi apparatus structural component, known as a golgin in mammals and yeast. A fluorescently-tagged version of CASP co-localizes with Golgi markers, and this localization appears to require the C-terminal (565?689aa) portion of the protein. The protein is inserted into a membrane in a type II orientation.
AT3G18485 Encodes a novel protein with no predicted membrane-spanning domains that is polymorphic among Arabidopsis accessions. The protein may modulate a metal transporter. Mutants are resistant to IAA-Leu, IAA-Phe, and the divalent metals cobalt and manganese but remain sensitive to free IAA; they are defective in lateral root formation and primary root elongation.
AT3G18490 Encodes ASPG1 (ASPARTIC PROTEASE IN GUARD CELL 1). Functions in drought avoidance through abscisic acid (ABA) signalling in guard cells.
AT3G18518 Member of a family of small polypeptides found only in angiosperm lineages.Contains a conserved 29 amino acid domain (RTF or DVL domain).
AT3G18535
AT3G18600 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT3G18610 Encodes ATNUC-L2 (NUCLEOLIN LIKE 2).
AT3G18620 DHHC-type zinc finger family protein;(source:Araport11)
AT3G18650 AGAMOUS-like 103;(source:Araport11)
AT3G18660 Plants expressing an RNAi construct specifically targeting PGSIP1 was shown to have a dramatically reduced amount of starch. Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition.
AT3G18670 Ankyrin repeat family protein;(source:Araport11)
AT3G18680 Encodes a functional UMP Kinase located in the plastid that binds to group II intron plastid transcription products. Mutants show decreased accumulation of target transcripts/proteins.
AT3G18710 Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays.
AT3G18720 F-box family protein;(source:Araport11)
AT3G18820 RAB7 homolog, forms retromer complex with VPS35; ES17 prevents the retromer complex to endosome anchoring, resulting in retention of RABG3f. The interaction of RABG3f?VPS35 functinons as a checkpoint in the control of traffic toward the vacuole.
AT3G18827 Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: CUUCUUAAGUGCUGAUAAUGC
AT3G18840 LOW protein: PPR containing-like protein;(source:Araport11)
AT3G18845 Encodes a Protease inhibitor/seed storage/LTP family protein [pseudogene]
AT3G18860 transducin family protein / WD-40 repeat family protein;(source:Araport11)
AT3G18870 Mitochondrial transcription termination factor family member.
AT3G18895 Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:TAATGTGATGATGAACTGACC
AT3G18900 ternary complex factor MIP1 leucine-zipper protein;(source:Araport11)
AT3G18910 EIN2 targeting protein2;(source:Araport11)
AT3G18950 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT3G18957 hypothetical protein;(source:Araport11)
AT3G18970 Encodes a pentatricopeptide repeat protein (PPR) protein involved in mitochondrial mRNA editing.
AT3G18990 Required for vernalization. Essential for the complete repression of FLC in vernalized plants. Required for the methylation of histone H3
AT3G19002 Natural antisense transcript overlaps with AT3G19000;(source:Araport11)
AT3G19010 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT3G19050 PHRAGMOPLAST ORIENTING KINESIN 2 is one of the two Arabidopsis homologs isolated in yeast two-hybrid screen for interaction partners of maize gene TANGLED1 (TAN1). Based on sequence homology in their motor domains, POK1 and POK2 belong to the kinesin-12 class which also includes the well-characterized group of phragmoplast-associated kinesins AtPAKRPs. Both kinesins are composed of an N-terminal motor domain throughout the entire C terminus and putative cargo binding tail domains. The expression domains for POK2 constructs were broader than those for POK1; both are expressed in tissues enriched for dividing cells. The phenotype of pok1/pok2 double mutants strongly resembles that of maize tan1 mutants, characterized by misoriented mitotic cytoskeletal arrays and misplaced cell walls.
AT3G19055 hypothetical protein;(source:Araport11)
AT3G19085 F-box/RNI/FBD-like domain protein;(source:Araport11)
AT3G19090 RNA-binding protein;(source:Araport11)
AT3G19150 Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type cyclins. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. KRP6 appears to be targeted for degradation by RHF1a and RHF2a to allow mitotic divisions during gametogenesis. In addition, KRP6 transcript levels rise prior to and drop following the meitotic divisions of gametogenesis. Elevated levels of KRP6 negatively affect plant development and fertility.
AT3G19160 Encodes cytokinin synthase.
AT3G19180 Encodes a chloroplast division factor located in the plastid inner envelope with its N-terminus exposed to the stroma. PARC6 influences FtsZ assembly and is required for recruitment of PDV1 during chloroplast division.
AT3G19230 Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT3G19240 Together with DEM1 plays an essential role in cell division in plants, most likely through an interaction with RAN1.
AT3G19260 LAG1 homolog. Loss of function mutant is sensitive to AAL-toxin. LOH2 is presumed to function in sphingolipid metabolism. It encodes a ceramide synthase essential for production of LCFA-ceramides (mainly C16). Uses palmitoyl-CoA and dihydroxy LCB substrates.
AT3G19270 Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family.
AT3G19300 Protein kinase superfamily protein;(source:Araport11)
AT3G19310 PLC-like phosphodiesterases superfamily protein;(source:Araport11)
AT3G19320 Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT3G19360 Zinc finger (CCCH-type) family protein;(source:Araport11)
AT3G19370 filament-like protein (DUF869);(source:Araport11)
AT3G19380 PUB25 and PUB26 are closely related paralogs that encode functional E3 ligases. They function in immune response pathway by targeting BIK1 for degradation.
AT3G19390 Granulin repeat cysteine protease family protein;(source:Araport11)
AT3G19400 Cysteine proteinases superfamily protein;(source:Araport11)
AT3G19430 late embryogenesis abundant protein-related / LEA protein-like protein;(source:Araport11)
AT3G19460 Reticulon family protein;(source:Araport11)
AT3G19480 Encodes a stromal phosphoglycerate dehydrogenase with a high NAD(H)-specificity that is active in photosynthesizing chloroplasts and draws its substrate 3-PGA directly from the Calvin-Benson-Bassham cycle.
AT3G19508 complex 1 protein, LYR family protein;(source:Araport11)
AT3G19530 hypothetical protein;(source:Araport11)
AT3G19540 glutamyl-tRNA (Gln) amidotransferase subunit A (DUF620);(source:Araport11)
AT3G19550 glutamate racemase;(source:Araport11)
AT3G19600 Encodes a Ser-2-specific RNAPII CTD phosphatase with two tandem-repeated CTD phosphatase domains that belongs to the group III CTD phosphatase-like (CPL) family. It positively regulates ABA and drought responses.
AT3G19610 Member of a novel, plant specific family of microtubule associated proteins.
AT3G19615 beta-1,4-xylosidase;(source:Araport11)
AT3G19620 Glycosyl hydrolase family protein;(source:Araport11)
AT3G19680 hypothetical protein (DUF1005);(source:Araport11)
AT3G19700 Encodes leucine rich repeat (LRR) kinase. Iku2-3 identified in a screen for mutants with abnormal endosperm. Sporophytic recessive mutants have reduced embryo and endosperm size. Seed size is also reduced and the shape is abnormal suggesting an interaction between the endosperm and cell elongation in the integuments.
AT3G19790 hypothetical protein;(source:Araport11)
AT3G19800 Encodes the DUF177B version of the two DUF177 proteins in Arabidopsis. This version differs from DUF177A in containing a 23 aa insertion compared to the DUF177A sequence.
AT3G19820 Involved in the conversion of the early brassinosteroid precursor 24-methylenecholesterol to campesterol. Brassinosteroids affect cellular elongation. Mutants have dwarf phenotype. DWF1 is a Ca2+-dependent calmodulin-binding protein.
AT3G19930 Encodes a sucrose hydrogen symporter that is induced by wounding. The mRNA is cell-to-cell mobile.
AT3G19940 Encodes a hexose-H(+) symporter that catalyzes the high-affinity uptake of glucose, galactose and mannose that is induced under low-glucose conditions in pollen tubes.
AT3G19960 member of Myosin-like proteins
AT3G19980 Encodes catalytic subunit of serine/threonine protein phosphatase 2A. It can associate with phytochromes A and B in vitro. Mutant plants display an accelerated flowering phenotype.Acts antagonistically to SnRK2 to regulate ABI5 phosphorylation. It inteacts with NRP which results in tethering to endosomes leading to its degradation.
AT3G20015 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT3G20020 protein arginine methyltransferase 6;(source:Araport11)
AT3G20030 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G20040 Hexokinase;(source:Araport11)
AT3G20083 pseudogene of cytochrome P450;(source:Araport11)
AT3G20090 cytochrome P450, family 705, subfamily A, polypeptide 18;(source:Araport11)
AT3G20155 hypothetical protein;(source:Araport11)
AT3G20170 ARM repeat superfamily protein;(source:Araport11)
AT3G20190 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT3G20200 kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11)
AT3G20220 SAUR-like auxin-responsive protein family;(source:Araport11)
AT3G20270 Encodes one of the two LBP/BPI related proteins (AT1G04970/LBR-1, AT3G20270/LBR-2) that bind to LPS directly and regulate PR1 expression.
AT3G20280 RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11)
AT3G20290 Encodes AtEHD1, one of the Arabidopsis Eps15 homology domain proteins involved in endocytosis (AtEHD2, At4g05520).
AT3G20300 extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11)
AT3G20310 Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-7). The protein contains one AP2 domain. Phosphorylated by PKS3 in vitro. Involved in ABA-mediated responses. Acts as a repressor of GCC box?mediated transcription together with AtSin3 and HDA19.
AT3G20360 TRAF-like family protein;(source:Araport11)
AT3G20460 Major facilitator superfamily protein;(source:Araport11)
AT3G20470 encodes a glycine-rich protein that is expressed more abundantly in immature seed pods than in stems and leaves. Expression is not detected in roots or flowers.
AT3G20475 Encodes MSH5, a homologue of the MutS-homolog family of genes required for normal levels of recombination in budding yeast, mouse and Caenorhabditis elegans. Involved in meiotic recombination. Required for the formation of Class I interference-sensitive crossovers. Transcripts of AtMSH5 are specific to reproductive tissues and expression of the protein is abundant during prophase I of meiosis. Involved in meiotic recombination. Required for the formation of Class I interference-sensitive crossovers.
AT3G20500 purple acid phosphatase 18;(source:Araport11)
AT3G20510 Encodes a member of the Tmemb_14 family that is predicted to be localized to the membranes of the secretory pathway. The mRNA is cell-to-cell mobile.
AT3G20540 Encodes an organellar DNA polymerase I that is also involved in double strand break repair.
AT3G20541 pseudogene of Ankyrin repeat family protein;(source:Araport11)
AT3G20580 COBRA-like protein 10 precursor;(source:Araport11)
AT3G20630 Encodes a ubiquitin-specific protease. Identical to TTN6. Loss of function mutations are embryo lethals, having development arrested at the preglobular/globular stage. Also involved in root responses to phosphate deficiency.
AT3G20640 Governs the competence of pericycle cells to initiate lateral root primordium formation.
AT3G20670 Encodes HTA13, a histone H2A protein.
AT3G20700 F-box associated ubiquitination effector family protein;(source:Araport11)
AT3G20720 amino-terminal region of chorein;(source:Araport11)
AT3G20750 Encodes a member of the GATA factor family of zinc finger transcription factors.
AT3G20760 Nse4, component of Smc5/6 DNA repair complex;(source:Araport11)
AT3G20810 JMJD5 encodes a protein which contains a jumonji-C (jmjC) domain. jmjd5 mutant plants have a short-period circadian phenotype. JMJD5 has histone demethylase activity and interacts with EFM to repress FT.
AT3G20830 AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11)
AT3G20840 Encodes a member of the AINTEGUMENTA-like (AIL) subclass of the AP2/EREBP family of transcription factors and is essential for quiescent center (QC) specification and stem cell activity. It is a key effector for establishment of the stem cell niche during embryonic pattern formation. It is transcribed in response to auxin accumulation and is dependent on auxin response transcription factors.
AT3G20850 proline-rich family protein;(source:Araport11)
AT3G20860 Encodes a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.
AT3G20940 a member of A-type cytochrome P450
AT3G20975 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.6e-08 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT3G20980 Gag-Pol-related retrotransposon family protein;(source:Araport11)
AT3G20990 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.9e-07 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT3G20993 Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT3G20997 Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT3G21080 ABC transporter-like protein;(source:Araport11)
AT3G21090 ABC-2 type transporter family protein;(source:Araport11)
AT3G21110 5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole synthetase (PUR7, syn. SAICAR synthetase), catalyzes aspartate addition at the alpha-amino group to the growing purine backbone.
AT3G21120 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G21130 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G21160 Encodes an alpha-mannosidase I enzyme responsible for N-glycan maturation.
AT3G21180 one of the type IIB calcium pump isoforms. encodes an autoinhibited Ca(2+)-ATPase that contains an N-terminal calmodulin binding autoinhibitory domain.
AT3G21190 O-fucosyltransferase family protein;(source:Araport11)
AT3G21200 Encodes a soluble glutamyl-tRNA reductase (GluTR) binding protein that forms a ternary complex with FLU and GluTR.
AT3G21210 zinc ion binding protein;(source:Araport11)
AT3G21220 Encodes a mitogen-activated kinase kinase, dual specific protein kinase that is expressed in vegetative tissues and floral buds. Involved in innate immunity. This protein activates MPK3/MPK6 and early-defense genes redundantly with MKK4. In plants with both MKK5 and MKK4 levels reduced by RNAi plants, floral organs do not abscise suggesting a role for both proteins in mediating floral organ abscission.MKK5 is part of a positive feedback loop that regulates HAE expression in floral receptacles.
AT3G21230 The gene encodes a 4-coumarate coenzyme A ligase being able to use sinapate as substrate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, 5-OH-ferulic acid, ferulic acid and sinapic acid. At4CL5 was unable to use cinnamic acid as substrate. Knockout of At4CL5 (4cl5) revealed no effect on syringyl lignin content indicating that the activity observed does probably not occur in vivo.
AT3G21240 encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, ferulic acid, 5-OH-ferulic acid and cinnamic acid. At4CL2 was unable to use sinapic acid as substrate.
AT3G21260 Glycolipid transfer protein (GLTP) family protein;(source:Araport11)
AT3G21320 EARLY FLOWERING protein;(source:Araport11)
AT3G21330 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT3G21340 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT3G21470 Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11)
AT3G21560 Encodes a protein with sinapic acid:UDP-glucose glucosyltransferase activity. Mutants defective in this gene are hyper-fluorescent (which accumulate in their trichomes a compound that is likely to be 3',5'-dimethoxynaringenin chalcone or sinapoyltriacetic acid lactone, potential products of the concerted action of 4-coumarate CoA ligase and chalcone synthase on sinapic acid). Also shown to be required for Arabidopsis nonhost resistance to the Asian soybean rust pathogen Phakopsora pachyrhizi.
AT3G21570 proline-rich nuclear receptor coactivator;(source:Araport11)
AT3G21590 Senescence/dehydration-associated protein-like protein;(source:Araport11)
AT3G21630 LysM receptor-like kinase, based on protein sequence alignment analysis, it has a typical RD signaling domain in its catalytic loop and possesses autophosphorylation activity. Involved in the perception and transduction of the chitin oligosaccharide elicitor. Located in the plasma membrane. CERK1 phosphorylates LIK1, a LLR-RLK that is involved in innate immunity,
AT3G21670 Major facilitator superfamily protein;(source:Araport11)
AT3G21680 hypothetical protein;(source:Araport11)
AT3G21700 Monomeric G protein. Expressed in root epidermal cells that are destined to become atrichoblasts. Also expressed during pollen development and in the pollen tube tip.
AT3G21720 Encodes a glyoxylate cycle enzyme isocitrate lyase (ICL) involved in salt tolerance.
AT3G21755 Natural antisense transcript overlaps with AT3G21760;(source:Araport11)
AT3G21760 Encodes HYR1, a UDP glycosyltransferase (UGT). HYR1 glucosylates hypostatin, an inhibitor of cell expansion in vivo to form a bioactive glucoside.
AT3G21781 Natural antisense transcript overlaps with AT3G21780;(source:Araport11)
AT3G21791 Pseudogene of AT3G21790; UDP-glucoronosyl/UDP-glucosyl transferase family protein
AT3G21800 UDP-glucosyl transferase 71B8;(source:Araport11)
AT3G21810 Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11)
AT3G21820 histone-lysine N-methyltransferase ATXR2;(source:Araport11)
AT3G21860 SKP1-like 10;(source:Araport11)
AT3G21880 Encodes a substrate of the COP1/SPA E3 ubiquitin ligase. It is degraded in darkness and stabilized by white, red and blue light. Overexpression results in decreased apical dominance, increased branching and delayed flowering in long days. The latter phenotype is due to reduced levels of FT and dependent on the presence of CO (PMID:29187570).
AT3G21890 B-box type zinc finger family protein;(source:Araport11)
AT3G21920 cysteine-rich repeat secretory protein, putative (DUF26);(source:Araport11)
AT3G22030 Receptor protein kinase-like protein;(source:Araport11)
AT3G22040 cysteine-rich repeat secretory-like protein (DUF26);(source:Araport11)
AT3G22072 Natural antisense transcript overlaps with AT3G22070;(source:Araport11)
AT3G22104 Phototropic-responsive NPH3 family protein;(source:Araport11)
AT3G22110 Encodes the alpha-3 subunit of 20s proteasome.
AT3G22133 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase GB:AAC33226.1 from (Arabidopsis thaliana);(source:TAIR10)
AT3G22136 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase GB:AAD22368 from (Arabidopsis thaliana);(source:TAIR10)
AT3G22150 Involved in RNA editing of plastid atpF and mitochondrial nad5.
AT3G22190 Member of IQ67 (CaM binding) domain containing family.
AT3G22200 Genetically redundant with POP3;mediates pollen tube guidance. Double mutants are self sterile; gamma-aminobutyrate transaminase subunit precursor; nuclear gene for mitochondrial product. Encodes gamma-aminobutyrate transaminase that uses pyruvate instead of alpha-ketoglutarate as cosubstrate. Mutations in POP2/HER1 render roots resistant to the inhibitory growth effects of the volatile organic compound E-2-hexenal implicated in plant defense.
AT3G22270 Topoisomerase II-associated protein PAT1;(source:Araport11)
AT3G22290 Endoplasmic reticulum vesicle transporter protein;(source:Araport11)
AT3G22310 Sequence similarity ot DEAD-box RNA helicases. Binds RNA and DNA. Involved in drought, salt and cold stress responses. The mRNA is cell-to-cell mobile.
AT3G22340 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.2e-60 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT3G22350 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G22360 encodes an alternative oxidase whose expression is limited to flowers and floral buds.
AT3G22370 Encodes AOX1a, an isoform of alternative oxidase that is expressed in rosettes, flowers, and root. The alternative oxidase of plant mitochondria transfers electrons from the ubiquinone pool to oxygen without energy conservations. It is regulated through transcriptional control and by pyruvate. Plays a role in shoot acclimation to low temperature. Also is capable of ameliorating reactive oxygen species production when the cytochrome pathway is inhibited. AOX1a also functions as a marker for mitochondrial retrograde response. The mRNA is cell-to-cell mobile.
AT3G22400 Encodes lipoxygenase5 (LOX5). LOX5 activity in roots facilitates green peach aphid colonization of Arabidopsis foliage by promoting green peach aphid feeding from sieve element and water consumption from xylem.
AT3G22410 Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT3G22415 hypothetical protein;(source:Araport11)
AT3G22420 Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms.
AT3G22440 FRIGIDA-like protein;(source:Araport11)
AT3G22540 hypothetical protein (DUF1677);(source:Araport11)
AT3G22550 NAD(P)H-quinone oxidoreductase subunit, putative (DUF581);(source:Araport11)
AT3G22560 Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11)
AT3G22600 Glycosylphosphatidylinositol (GPI)-anchored LTPg protein, downregulated in syncytia induced by the beet cyst nematode Heterodera schachtii and root knot nematode Meloidogyne incognita. Infection with bacteria (Pseudomonas syringae) and fungi (Botrytis cinerea) leads to the induction of the gene in leaves.
AT3G22630 Encodes 20S proteasome beta subunit PBD1 (PBD1).
AT3G22650 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G22720 F-box/associated interaction domain protein;(source:Araport11)
AT3G22723 hypothetical protein;(source:Araport11)
AT3G22730 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G22740 homocysteine S-methyltransferase (HMT3)
AT3G22770 F-box associated ubiquitination effector family protein;(source:Araport11)
AT3G22790 Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It binds filamentous actin and is localized to the plasma membrane and plasmodesmata.
AT3G22800 Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT3G22820 Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis.
AT3G22850 aluminum induced protein with YGL and LRDR motifs;(source:Araport11)
AT3G22886 Encodes a microRNA that targets ARF family members ARF6 and ARF8. Essential for fertility of both ovules and anthers. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGAAGCUGCCAGCAUGAUCUA. Pri-mRNA coordinates for MIR167a (converted to TAIR10 based on PMID19304749): Chr3: 8108021-8108622 (forward), length: 602 bp; exon coordinates: exon 1: 8108021 to 8108622; mature miRNA and miRNA* are located on exon 1.
AT3G22890 encodes ATP sulfurylase, the first enzyme in the sulfate assimilation pathway of Arabidopsis. It may also participate in selenium metabolism. The mRNA is cell-to-cell mobile.
AT3G22910 ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11)
AT3G22920 Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11)
AT3G22930 Encodes a calmodulin-like protein.
AT3G22961 Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11)
AT3G22970 hypothetical protein (DUF506);(source:Araport11)
AT3G23010 receptor like protein 36;(source:Araport11)
AT3G23030 auxin inducible gene expressed in the nucleus
AT3G23050 Transcription regulator acting as repressor of auxin-inducible gene expression. Plays role in the control of gravitropic growth and development in light-grown seedlings. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. Pseudomonas syringae type III effector AvrRpt2 stimulates AXR2 protein turnover.
AT3G23070 Encodes a CRM domain protein CFM3a, involved in group IIB intron splicing in chloroplasts.
AT3G23090 Member of the microtubule regulatory protein WVD2/WDL family WDL3 stabilizes cortical microtubules and is involved in light induced hypocotyl elongation. WDL3 is ubiquinated by COP1, leading to its degadation in the dark,
AT3G23110 receptor like protein 37;(source:Araport11)
AT3G23120 receptor like protein 38;(source:Araport11)
AT3G23125 Encodes a microRNA that targets the TAS1 and TAS2 families of tasiRNA-generating transcripts. Cleavage of TAS1 and TAS2 transcripts by miR173 initiates processing of these transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCGCUUGCAGAGAGAAAUCAC
AT3G23130 Flower-specific gene controlling the boundary of the stamen and carpel whorls. Similar to zinc finger transcription factors. Involved in shoot regenaration from root explants.
AT3G23150 Involved in ethylene perception in Arabidopsis The mRNA is cell-to-cell mobile.
AT3G23160 plant/protein (DUF668);(source:Araport11)
AT3G23175 HR-like lesion-inducing protein-like protein;(source:Araport11)
AT3G23190 HR-like lesion-inducing protein-like protein;(source:Araport11)
AT3G23245 hypothetical protein;(source:Araport11)
AT3G23250 Member of the R2R3 factor gene family. Key regulator of lignin biosynthesis in effector-triggered immunity
AT3G23255 tRNA dimethylallyltransferase;(source:Araport11)
AT3G23270 Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11)
AT3G23280 Encodes a ubiquitin ligase that is a novel player in ethylene signaling involved in negatively regulating apical hook curvature, with alternative splicing controlling dual targeting to the nuclear and cytoplasmic compartments.
AT3G23290 LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11)
AT3G23310 AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11)
AT3G23325 Splicing factor 3B subunit 5/RDS3 complex subunit 10;(source:Araport11)
AT3G23326 Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCCCCUCUUUAGCUUGGAGAAG
AT3G23360 Protein phosphatase 2C family protein;(source:Araport11)
AT3G23370 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT3G23380 encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Interacts with Rop1 and is involved in pollen tube growth and function. Gene is expressed predominantly in inflorescence and flower tissue.
AT3G23420 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G23430 Encodes a protein with the mainly hydrophilic N-terminal and the C-terminal containing 6 potential membrane-spanning domains. The mutant is deficient in the transfer of phosphate from root epidermal and cortical cells to the xylem. Its expression is repressed by phosphate (Pi) in shoots, and transiently induced by phosphite (Phi) in roots and shoots. PHO is expressed in developing ovules and plays a role in the transfer of Ph from maternal tissues to filial tissues.
AT3G23460 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT3G23480 Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11)
AT3G23510 Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11)
AT3G23530 Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11)
AT3G23580 Encodes one of the 3 ribonucleotide reductase (RNR) small subunit genes (RNR2A). Functionally redundant with the ribonucleotide reductase TSO2. mRNA was shown to specifically accumulate during the S-phase of the cell cycle in synchronized tobacco BY2 cells. Critical for cell cycle progression, DNA damage repair and plant development.
AT3G23590 Encodes a protein shown to physically associate with the conserved transcriptional coregulatory complex, Mediator, and is involved in the regulation of phenylpropanoid homeostasis. Acts redundantly with REF4/MED5b (At2g48110). Required for expression of some dark-upregulated genes. RFR1 is the MED5a subunit of the mediator complex.
AT3G23605 Ubiquitin-like superfamily protein;(source:Araport11)
AT3G23620 BRIX domain containing protein, similar to RNA biogenesis factors in yeast. Binds rRNA and likely also functions in RNA biogenesis in Arabidopsis. Essential gene, mutants are embryo lethal and does not transmit well through the gametophyte.
AT3G23630 Encodes an isopentenyl transferase involved in cytokinin biosynthesis.
AT3G23660 Sec23/Sec24 protein transport family protein;(source:Araport11)
AT3G23710 Tic22-like family protein;(source:Araport11)
AT3G23727 Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein).
AT3G23730 xyloglucan endotransglucosylase/hydrolase 16;(source:Araport11)
AT3G23760 transferring glycosyl group transferase;(source:Araport11)
AT3G23770 O-Glycosyl hydrolases family 17 protein;(source:Araport11)
AT3G23800 selenium-binding protein 3;(source:Araport11)
AT3G23805 Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide.
AT3G23820 Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. The mRNA is cell-to-cell mobile.
AT3G23840 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT3G23870 magnesium transporter NIPA (DUF803);(source:Araport11)
AT3G23880 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G23890 Encodes a topoisomerase II that is highly expressed in young seedlings. The protein is localized in the nucleus and gene expression levels are increased in proliferative tissues.
AT3G23930 troponin T, skeletal protein;(source:Araport11)
AT3G23950 F-box protein family gene.
AT3G23960 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G23990 mitochondrial chaperonin HSP. assist in rapid assembly of the oligomeric protein structures in the mitochondria.
AT3G24040 Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11)
AT3G24065 Plant self-incompatibility protein S1 family;(source:Araport11)
AT3G24070 Zinc knuckle (CCHC-type) family protein;(source:Araport11)
AT3G24093 Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11)
AT3G24140 Encodes a basic helix-loop-helix transcription factor whose activity is required to promote differentiation of stomatal guard cells and to halt proliferative divisions in their immediate precursors. It fulfills its role through recruitment of the Arabidopsis Retinoblastoma homologue, RETINOBLASTOMA-RELATED (RBR). Both transcript and protein are expressed in and are required for halting divisions at the end of the stomatal lineage. It also has a role in the promotion of guard cell fate and in controlling the transition from guard mother cell to guard cell. Its transcript levels change after inducing MUTE expression in a mute background.
AT3G24200 FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11)
AT3G24210 Ankyrin repeat family protein;(source:Araport11)
AT3G24220 A member of gene NCED-related gene family, encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition.
AT3G24230 Pectate lyase family protein;(source:Araport11)
AT3G24240 RGFR1 is a leucine--rich repeat receptor kinase that, together with RGFR2 and RGFR3, binds ROOT GROWTH FACTORS and is required for establishing the gradient of PLETHORA1 and PLETHORA2 essential for proper root growth and development.
AT3G24250 glycine-rich protein;(source:Araport11)
AT3G24255 RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11)
AT3G24260 paired amphipathic helix Sin3-like protein;(source:Araport11)
AT3G24280 small acidic protein 2;(source:Araport11)
AT3G24300 Encodes a plasma membrane localized ammonium transporter.
AT3G24330 O-Glycosyl hydrolases family 17 protein;(source:Araport11)
AT3G24360 ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11)
AT3G24420 DLK2 is a divergent member of the DWARF14 family. It's expression is dependent on D14 and KAI2 but it does not appear to play a role in stringolactone metabolism.
AT3G24440 Encodes Vernalization Insensitive 3-like 1 (VIL1). VIL1 is involved in the photoperiod and vernalization of Arabidopsis by regulating expression of the related floral repressors Flowering Locus C (FLC) and Flowering Locus M (FLM). VIL1, along with VIN3 (Vernalization Insensitive 3) is necessary for the chromatin modification to FLC and FLM.
AT3G24450 Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT3G24460 Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11)
AT3G24465 Encodes a Plant thionin family protein
AT3G24490 Alcohol dehydrogenase transcription factor Myb/SANT-like family protein;(source:Araport11)
AT3G24495 encodes a DNA mismatch repair homolog of human MutS gene, MSH6. There are four MutS genes in Arabidopsis, MSH2, MSH3, MSH6, and MSH7, which all act as heterodimers and bind to 51-mer duplexes. MSH2*MSH7 exhibit moderate affinity for a (T/G) substrate and weak binding of (+T), suggesting MSH2*MSH7 may be specialized for lesions/base mispairs not tested or for (T/G) mispairs in special contexts.
AT3G24500 One of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is specifically elevated in response to pathogen infection, salinity, drought, heat, hydrogen peroxide, and application of abscisic acid or salicylic acid. Constitutive expression enhances the tolerance of transgenic plants to various biotic and abiotic stresses.
AT3G24530 AAA-type ATPase family protein / ankyrin repeat family protein;(source:Araport11)
AT3G24535 hypothetical protein;(source:Araport11)
AT3G24580 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G24615 Encodes a Z43 snoRNA. Gb: AJ240080
AT3G24620 Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily.
AT3G24640 lyase;(source:Araport11)
AT3G24650 Homologous to the maize transcription factor Viviparous-1. Full length ABI3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of ABI3 requires the B3 DNA-binding domain and an activation domain. In addition to the known N-terminal-located activation domain, a second transcription activation domain was found in the B1 region of ABI3. ABI3 is essential for seed maturation. Regulator of the transition between embryo maturation and early seedling development. Putative seed-specific transcriptional activator. ABI3 is a central regulator in ABA signaling and is unstable in vivo. It interacts with and can by polyubiquitinated by AIP2 in vivo. Based on double mutant analyses, ABI3 interacts genetically with both FUS3 and LEC1 and is involved in controlling accumulation of chlorophyll and anthocyanins, sensitivity to abscisic acid, and expression of the members of the 12S storage protein gene family. In addition, both FUS3 and LEC1 regulate positively the abundance of the ABI3 protein in the seed. Alternative splicing of ABI3 is developmentally regulated by SUA (AT3G54230).
AT3G24690 hypothetical protein;(source:Araport11)
AT3G24740 cellulose synthase, putative (DUF1644);(source:Araport11)
AT3G24750 Encodes a member of the LAZY gene family that is expressed in the hypocotyl and the root
AT3G24760 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT3G24770 Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini. The C-terminal 12 amino acid sequence of CLE41 is identical to that of a dodeca peptide (TDIF, tracheary element differentiation inhibitory factor) isolated from Arabidopsis and functions as a suppressor of plant stem cell differentiation. TDIF sequence is also identical to the C-terminal 12 amino acids of CLE44 (At4g13195). The protein is expressed in the vascular system and is involved in axillary bud formation. The mRNA is cell-to-cell mobile.
AT3G24780 Uncharacterized conserved protein UCP015417, vWA;(source:Araport11)
AT3G24810 Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization.
AT3G24900 receptor like protein 39;(source:Araport11)
AT3G24929 hypothetical protein;(source:Araport11)
AT3G25030 RING/U-box superfamily protein;(source:Araport11)
AT3G25050 Encodes an endotransglucosylase that cleaves the beta-1,4-glucosidic linkage in amorphous cellulose and ligates the nascent reducing end to a non-reducing terminus of either cellulosic or xyloglucan oligosaccharide. Higher expression in flowers and in response to IAA treatment.
AT3G25110 Encodes a FatA acyl-ACP thioesterase
AT3G25120 Mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein;(source:Araport11)
AT3G25170 Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide.
AT3G25220 immunophilin (FKBP15-1)
AT3G25225 pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G25250 Arabidopsis protein kinase The mRNA is cell-to-cell mobile.
AT3G25290 Auxin-responsive family protein;(source:Araport11)
AT3G25450 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.7e-211 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT3G25460 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G25470 bacterial hemolysin-like protein;(source:Araport11)
AT3G25480 Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11)
AT3G25485 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.3e-49 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10)
AT3G25490 Protein kinase family protein;(source:Araport11)
AT3G25510 disease resistance protein (TIR-NBS-LRR class) family protein;(source:Araport11)
AT3G25550 F-box family protein;(source:Araport11)
AT3G25560 NSP-interacting kinase 2;(source:Araport11)
AT3G25570 S-adenosylmethionine decarboxylase family member.
AT3G25573 transmembrane protein;(source:Araport11)
AT3G25577 hypothetical protein;(source:Araport11)
AT3G25590 micronuclear linker histone polyprotein-like protein;(source:Araport11)
AT3G25597 transmembrane protein;(source:Araport11)
AT3G25600 Calmodulin like protein. Paralog of CML15.
AT3G25620 ABC-2 type transporter family protein;(source:Araport11)
AT3G25630 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 7.8e-20 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT3G25640 MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11)
AT3G25650 SKP1-like 15;(source:Araport11)
AT3G25655 Similar to Inflorescence Deficient in Abscission (IDA). Involved in floral organ abscission.
AT3G25660 Amidase family protein;(source:Araport11)
AT3G25710 Encodes a basic helix-loop-helix transcription factor that is expressed in the hypophysis-adjacent embryo cells, and is required and partially sufficient for MP-dependent root initiation. Involved in response to phosphate starvation. Negative regulator of root hair development, anthocyanin formation and Pi content. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots.
AT3G25717 ROTUNDIFOLIA like 16;(source:Araport11)
AT3G25719 hypothetical protein;(source:Araport11)
AT3G25720 RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11)
AT3G25725 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.3e-213 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT3G25730 ethylene response DNA binding factor 3;(source:Araport11)
AT3G25740 Encodes a plastid localized methionine aminopeptidase. Formerly called MAP1C, now called MAP1B.
AT3G25760 encodes allene oxide cyclase. One of four genes in Arabidopsis that encode this enzyme, which catalyzes an essential step in jasmonic acid biosynthesis. Gene expression is induced during senescence, a process that involves jasmonic acid signalling pathway. The mRNA is cell-to-cell mobile.
AT3G25890 encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. The mRNA is cell-to-cell mobile.
AT3G25900 Homocysteine S-methyltransferase family protein;(source:Araport11)
AT3G25960 Pyruvate kinase family protein;(source:Araport11)
AT3G25980 Encodes MAD2 (MITOTIC ARREST-DEFICIENT 2). May have the spindle assembly checkpoint protein functions conserved from yeast to humans.
AT3G26010 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT3G26040 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT3G26050 TPX2 (targeting protein for Xklp2) protein family;(source:Araport11)
AT3G26090 Encodes AtRGS1, a putative membrane receptor for D-glucose. Also functions as a regulator of G-protein signaling. Has GTPase-accelerating activity. Regulates the activity of AtGPA1. Lines over-expressing the gene are more tolerant to dehydration and root elongation. These phenotypes are dependent on ABA. Nuclear localization of the protein is dependent on ABA. RGS1 endocytosis is induced by JA which promotes its dissociation from GPA1.
AT3G26100 Regulator of chromosome condensation (RCC1) family protein;(source:Araport11)
AT3G26120 Similar to terminal ear1 in Zea mays. A member of mei2-like gene family; phylogenetic analysis revealed that TEL1 belongs to the third clade of mei2-like proteins (TEL clade), with conserved two N-terminal RNA recognition motifs (RRM), in addition to the C-terminal RRM, shared among all mei2-like proteins.
AT3G26125 encodes a protein with cytochrome P450 domain
AT3G26140 Cellulase (glycosyl hydrolase family 5) protein;(source:Araport11)
AT3G26150 putative cytochrome P450
AT3G26160 putative cytochrome P450
AT3G26165 putative cytochrome P450.
AT3G26190 putative cytochrome P450
AT3G26200 putative cytochrome P450 The mRNA is cell-to-cell mobile.
AT3G26210 putative cytochrome P450 The mRNA is cell-to-cell mobile.
AT3G26220 cytochrome P450 monooxygenase
AT3G26230 putative cytochrome P450
AT3G26235 hypothetical protein;(source:Araport11)
AT3G26250 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT3G26265 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.1e-76 P-value blast match to Q9SLM0 /314-478 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT3G26270 putative cytochrome P450
AT3G26280 cytochrome P450 monooxygenase
AT3G26290 putative cytochrome P450
AT3G26295 putative cytochrome P450.
AT3G26300 putative cytochrome P450
AT3G26320 putative cytochrome P450
AT3G26330 putative cytochrome P450
AT3G26340 N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein;(source:Araport11)
AT3G26350 proline-rich receptor-like kinase;(source:Araport11)
AT3G26380 APSE is a member of the Glycoside Hydrolase (GH27) family that functions as a β-l-arabinopyranosidase.
AT3G26390 hypothetical protein;(source:Araport11)
AT3G26440 transmembrane protein, putative (DUF707);(source:Araport11)
AT3G26470 Powdery mildew resistance protein, RPW8 domain-containing protein;(source:Araport11)
AT3G26480 Transducin family protein / WD-40 repeat family protein;(source:Araport11)
AT3G26486 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT3G26490 Phototropic-responsive NPH3 family protein;(source:Araport11)
AT3G26500 Encodes PIRL2, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction.
AT3G26520 gamma tonoplast intrinsic protein 2 (TIP2). expressed throughout the plant and transcript level is increased upon NaCl or ABA treatments. NaCl stress-sensitive yeast mutant strains exhibit more resistance to salt when expressing this protein.
AT3G26530 transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G08740.1);(source:TAIR10)
AT3G26570 low affinity phosphate transporter
AT3G26600 Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules.
AT3G26610 Encodes an apoplast-localized polygalacturonase involved in cell elongation and flower development.
AT3G26612 Has been identified as a translated small open reading frame by ribosome profiling.
AT3G26670 magnesium transporter, putative (DUF803);(source:Araport11)
AT3G26710 cofactor assembly of complex C;(source:Araport11)
AT3G26740 transcripts are differentially regulated at the level of mRNA stability at different times of day controlled by the circadian clock. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant.
AT3G26742 hypothetical protein;(source:Araport11)
AT3G26744 Encodes a MYC-like bHLH transcriptional activator that binds specifically to the MYC recognition sequences in the CBF3 promoter. It also binds to and inhibits the expression of ABI3. Mutants are defective in cold-regulated gene expression and ABA signaling druing seed germination.. Cold stress triggers protein degradation of nuclear GFPICE1 protein, and the RING finger protein HOS1 is required. Sumoylation of ICE1 controls CBF3/DREB1A expression and freezing tolerance. Together with ZOU, ICE1 determines primary seed dormancy depth independently of their joint role in endosperm development.ICE1 interacts with ABI5. Also members of the DELLA family, which repress ICE1 function.
AT3G26780 Encodes MEF14 (mitochondrial editing factor 14), a PPR (pentatricopeptide repeat proteins) protein required for RNA editing at site matR-1895 in mitochondria. The mRNA is cell-to-cell mobile.
AT3G26790 Transcriptional factor with high similarity to the B3 region of the VP1/ABI3-like proteins. Full length FUS3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of FUS3 requires the B3 DNA-binding domain and an activation domain. FUS3 specifies cotyledon identity. Regulator of gene expression during late embryogenesis. Involved in the control foliar organ identity in Arabidopsis by regulating the synthesis of two hormones, abscisic acid and gibberellin. FUS3 together with LEC1 positively regulate the abundance of the ABI3 protein in the seed.
AT3G26800 transmembrane protein;(source:Araport11)
AT3G26805 pseudogene of Eukaryotic aspartyl protease family protein;(source:Araport11)
AT3G26810 Auxin F box protein, the dominant auxin receptor in roots.
AT3G26820 Esterase/lipase/thioesterase family protein;(source:Araport11)
AT3G26830 Mutations in pad3 are defective in biosynthesis of the indole derived phytoalexin camalexin. Encodes a cytochrome P450 enzyme that catalyzes the conversion of dihydrocamalexic acid to camalexin. The mRNA is cell-to-cell mobile.
AT3G26840 Encodes a protein with phytyl ester synthesis and diacylglycerol acyltransferase activities that is involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.
AT3G26880 Plant self-incompatibility protein S1 family;(source:Araport11)
AT3G26900 Encodes a protein with some sequence similarity to shikimate kinases, but a truncated form of this protein (lacking a putative N-terminal chloroplast transit peptide) does not have shikimate kinase activity in vitro. skl1-3 mutants have a variegated phenotype and skl1-8 mutants have an albino phenotype consistent with the observation of chloroplast defects in these mutants.
AT3G26910 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT3G26930 Protein with RNI-like/FBD-like domain;(source:Araport11)
AT3G26934 hypothetical protein;(source:Araport11)
AT3G26935 DHHC-type zinc finger family protein;(source:Araport11)
AT3G26940 Receptor-like cytoplasmic kinase, RLCKVII subfamily. Overexpression causes abnormal differential and elongation growth after organ differentiation.
AT3G26980 membrane-anchored ubiquitin-fold protein 4 precursor;(source:Araport11)
AT3G27000 encodes a protein whose sequence is similar to actin-related proteins (ARPs) in other organisms. its transcript level is down regulated by light and is expressed in very low levels in all organs examined.
AT3G27010 Belongs to a TCP protein transcription factor family. Members of this family contain a predicted basic-helix-loop-helix domain involved in DNA binding. Related to rice PCF1 and PCF2 genes. Binds to the GCCCR element of CYCB1;1. Involved in regulation of expression of cell cycle control and ribosomal protein genes.
AT3G27027 GPI-anchored-like protein (DUF 3339);(source:Araport11)
AT3G27030 transmembrane protein;(source:Araport11)
AT3G27050 plant/protein;(source:Araport11)
AT3G27070 Form of TOM20, which is a component of the TOM complex, involved in transport of nuclear-encoded mitochondrial proteins
AT3G27150 Target gene of MIR2111-5p.
AT3G27160 GHS1 encodes plastid ribosomal protein S21 The mRNA is cell-to-cell mobile.
AT3G27180 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT3G27220 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT3G27230 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT3G27280 Part of protein complexes that are necessary for proficient mitochondrial function or biogenesis, thereby supporting cell division and differentiation in apical tissues
AT3G27290 RNI-like superfamily protein;(source:Araport11)
AT3G27325 hydrolases, acting on ester bond;(source:Araport11)
AT3G27327 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.7e-320 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT3G27330 zinc finger (C3HC4-type RING finger) family protein;(source:Araport11)
AT3G27331 Plant self-incompatibility protein S1 family;(source:Araport11)
AT3G27340 Myb domain protein;(source:Araport11)
AT3G27390 transmembrane protein;(source:Araport11)
AT3G27400 Encodes a pectate lyase involved in response to nematodes.
AT3G27430 Encodes 20S proteasome beta subunit PBB1 (PBB1).
AT3G27440 One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively.
AT3G27540 beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11)
AT3G27580 D6PK family kinase involved in pulse-induced phototropism but also for time-dependent second positive phototropism, and continuous light-induced hypocotyl phototropism.D6PKL3 is polarly localized within the plasma membrane. It is involved in pollen aperture formation. The protein is localized within distinct regions of the pollen plasma membrane and mutants are also defective in pollen aperture formation.
AT3G27620 encodes an isoform of alternate oxidase. expressed in all tissues examined and expression is not induced by antimycin A, an inhibitor of complex III in the mitochondrial respiratory chain.
AT3G27630 SMR7 is a member of the SIAMESE-RELATED Cyclin-Dependent Kinase Inhibitor family. It is induced by ROS/oxidative stress.
AT3G27650 LOB domain-containing protein 25;(source:Araport11)
AT3G27670 A novel protein, did not show high similarity to any protein of known function; reveals a novel genetic connection between lipid synthesis and embryo development. Expressed in all tissues examined including leaves, flowers, roots, stems, and siliques, but accumulation levels were not correlated with the degree to which different organs appeared affected by the mutation. Mutant plants showed alterations in the cuticular wax profiles and embryo development. The mRNA is cell-to-cell mobile.
AT3G27680 Plant self-incompatibility protein S1 family;(source:Araport11)
AT3G27730 DNA helicase required for interference-sensitive meiotic crossover events.
AT3G27750 Encodes a pentatricopeptide repeat (PPR) protein required for the splicing of specific group II introns. Null alleles are embryo lethal.
AT3G27770 plant/protein;(source:Araport11)
AT3G27785 MYB118 encodes a myb transcription factor that represses endosperm maturation and, along with MYB115, regulates glucosinolate biosynthesis.
AT3G27865 snoRNA;(source:Araport11)
AT3G27870 ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11)
AT3G27880 hypothetical protein (DUF1645);(source:Araport11)
AT3G27900 hypothetical protein (DUF1184);(source:Araport11)
AT3G27940 LOB domain-containing protein 26;(source:Araport11)
AT3G27950 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT3G27960 CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules.
AT3G27965 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.5e-26 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10)
AT3G28010 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G38037.1);(source:TAIR10)
AT3G28020 DNA-binding protein;(source:Araport11)
AT3G28040 Leucine-rich receptor-like protein kinase family protein;(source:Araport11)
AT3G28050 nodulin MtN21-like transporter family protein
AT3G28070 nodulin MtN21-like transporter family protein
AT3G28080 nodulin MtN21-like transporter family protein
AT3G28140 RNA ligase/cyclic nucleotide phosphodiesterase family protein;(source:Araport11)
AT3G28150 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. A putative xyloglucan O-acetyltransferase. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT3G28155 hypothetical protein;(source:Araport11)
AT3G28170 hypothetical protein;(source:Araport11)
AT3G28180 encodes a gene similar to cellulose synthase The mRNA is cell-to-cell mobile.
AT3G28190 transmembrane protein;(source:Araport11)
AT3G28193 transmembrane protein;(source:Araport11)
AT3G28200 Peroxidase superfamily protein;(source:Araport11)
AT3G28210 Encodes a putative zinc finger protein (PMZ).
AT3G28223 F-box family protein;(source:Araport11)
AT3G28310 hypothetical protein (DUF677);(source:Araport11)
AT3G28315 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-224 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT3G28340 Encodes a protein with putative galacturonosyltransferase activity.
AT3G28345 Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem.
AT3G28350 Pseudogene of AT3G28350; unknown protein
AT3G28370 spindle assembly checkpoint component;(source:Araport11)
AT3G28380 P-glycoprotein 17;(source:Araport11)
AT3G28390 P-glycoprotein 18;(source:Araport11)
AT3G28400 transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 4.6e-39 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10)
AT3G28412 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-08 P-value blast match to GB:AAC34906 reverse transcriptase (LINE-element) (Forficula auricularia);(source:TAIR10)
AT3G28420 Putative membrane lipoprotein;(source:Araport11)
AT3G28455 Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can not replace CLV3 function in vivo.CLE25 participates in long distance signaling in response to dehydration. It produces a graft transmissible signal from root to shoot that induces ABA synthesis and results in stomatal closure. The BAM1 and BAM3 receptor-kinases are likely receptors for CLE25 as they are required for this signaling.
AT3G28470 Member of the R2R3 factor gene family. Its E-box is critical for the DYT1- bHLH089 heterocomplex to bind to and activate its transcription.
AT3G28490 2-oxoglutarate-dependent dioxygenase
AT3G28510 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT3G28540 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT3G28550 Proline-rich extensin-like family protein;(source:Araport11)
AT3G28560 BCS1 AAA-type ATPase;(source:Araport11)
AT3G28570 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT3G28580 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT3G28590 transmembrane protein;(source:Araport11)
AT3G28600 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT3G28610 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT3G28670 oxidoreductase, zinc-binding dehydrogenase family protein;(source:Araport11)
AT3G28700 NADH dehydrogenase ubiquinone complex I, assembly factor-like protein (DUF185);(source:Araport11)
AT3G28730 encodes a component of the FAcilitates Chromatin Transcription (FACT) complex, SSRP1. Along with STP16 binds to the promoter of FLC.
AT3G28740 Encodes a member of the cytochrome p450 family. Expression is upregulated in response to cis-jasmonate treatment. Overexpression induces synthesis of volatile compounds that affect chemical ecology and insect interactions.
AT3G28770 transmembrane protein, putative (DUF1216);(source:Araport11)
AT3G28780 transmembrane protein, putative (DUF1216);(source:Araport11)
AT3G28790 transmembrane protein, putative (DUF1216);(source:Araport11)
AT3G28810 mediator of RNA polymerase II transcription subunit-like protein, putative (DUF1216);(source:Araport11)
AT3G28820 mediator of RNA polymerase II transcription subunit-like protein, putative (DUF1216);(source:Araport11)
AT3G28850 Glutaredoxin family protein;(source:Araport11)
AT3G28860 Encodes a member of the ATP-binding cassette (ABC) transporter family that is involved in auxin transport and is involved in postembryonic organ separation. Also known as AtMDR11 and PGP19. Possibly regulates auxin-dependent responses by influencing basipetal auxin transport in the root. Acts upstream of phyA in regulating hypocotyl elongation and gravitropic response. Exerts nonredundant, partially overlapping functions with the ABC transporter encoded by AtPGP1.
AT3G28880 serine/threonine-protein phosphatase 6 regulatory ankyrin repeat subunit;(source:Araport11)
AT3G28890 receptor like protein 43;(source:Araport11)
AT3G28917 mini zinc finger 2;(source:Araport11)
AT3G28920 homeobox protein 34;(source:Araport11)
AT3G28923 Pseudogene of AT5G01080; beta-galactosidase
AT3G28940 AIG2-like (avirulence induced gene) family protein;(source:Araport11)
AT3G28980 mediator of RNA polymerase II transcription subunit-like protein, putative (DUF1216);(source:Araport11)
AT3G28985 Encodes a ECA1 gametogenesis related family protein [pseudogene]
AT3G29034 transmembrane protein;(source:Araport11)
AT3G29035 Encodes a protein with transcription factor activity. Note: this protein (AT3G29035) on occasion has also been referred to as AtNAC3, not to be confused with the AtNAC3 found at locus AT3G15500. The mRNA is cell-to-cell mobile.
AT3G29037 Pseudogene of AT5G35760; beta-galactosidase
AT3G29050 receptor-like protein kinase-like protein;(source:Araport11)
AT3G29060 EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11)
AT3G29075 glycine-rich protein;(source:Araport11)
AT3G29153 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.3e-238 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10)
AT3G29156 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.9e-175 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT3G29160 encodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It has also been shown to interact with the WD protein PDL1.
AT3G29170 transmembrane protein (DUF872);(source:Araport11)
AT3G29180 DUF1336 family protein (DUF1336);(source:Araport11)
AT3G29185 Encodes a chloroplast protein that interacts with the CF1β, γ, and ε subunits of the chloroplast ATP synthase and is required for assembly of its F1 module. The protein is comprised primarily of two β-barrels and acts as a chaperone orchestrating the early steps of the CF1 assembly pathway via specific interaction with the CF1 β, γ, and ε subunits.
AT3G29200 L-ascorbate peroxidase
AT3G29255 Putative pentacyclic triterpene synthase 7;(source:Araport11)
AT3G29260 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT3G29265 transposable_element_gene;(source:Araport11);similar to zinc knuckle (CCHC-type) family protein [Arabidopsis thaliana] (TAIR:AT5G32482.1);(source:TAIR10)
AT3G29290 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT3G29300 transmembrane protein;(source:Araport11)
AT3G29320 Encodes a plastidic alpha-glucan phosphorylase. In vitro, the enzyme has a preference for maltooligosaccharides, such as maltoheptaose. The mRNA is cell-to-cell mobile.
AT3G29330 zinc finger RNA-binding-like protein;(source:Araport11)
AT3G29340 zinc finger (C2H2 type) family protein;(source:Araport11)
AT3G29360 Encodes one of four UDP-glucose dehydrogenase UGD) genes. Mutation of this gene in combination with UGD3 leads to swollen plant cell walls and severe developmental defects associated with changes in pectic polysaccharides.
AT3G29370 Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors.
AT3G29400 A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT3G29520 pseudogene of hypothetical protein;(source:Araport11)
AT3G29572 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT3G29575 ABI five binding protein 3;(source:Araport11)
AT3G29577 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.0e-133 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10)
AT3G29590 At3g29590 (At5MAT) encodes a malonyl-CoA:anthocyanidin 5-O-glucoside-6"-O-malonyltransferase that is coordinately expressed with a epistatic 5-O-anthocyanidin glucosyltransferase (At4g14090). The enzyme is involved in the malonylation of anthocyanins in Arabidopsis.
AT3G29618 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.5e-16 P-value blast match to Q9SI25 /181-349 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT3G29630 UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT3G29639 hypothetical protein;(source:Araport11)
AT3G29670 Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. The mRNA is cell-to-cell mobile.
AT3G29725 pseudogene of HXXXD-type acyl-transferase family protein;(source:Araport11)
AT3G29760 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT3G29770 Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro.
AT3G29774 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.6e-07 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10)
AT3G29779 transposable_element_gene;(source:Araport11);pseudogene, similar to SAE1-S9-protein, blastp match of 33%25 identity and 2.8e-14 P-value to GP|4760708|dbj|BAA77394.1||AB012866 SAE1-S9-protein {Brassica rapa};(source:TAIR10)
AT3G29792 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-243 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT3G29800 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT3G29810 During the course of seed coat epidermal cell differentiation, COBRA-LIKE 2 plays a role in cellulose deposition into mucilage secretory cells of Arabidopsis seeds. COBRA-LIKE 2 affects mucilage solubility and cellulosic ray formation.
AT3G29830 F-box/RNI-like superfamily protein;(source:Araport11)
AT3G29970 B12D protein;(source:Araport11)
AT3G30110 pseudogene of DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11)
AT3G30145 transposable_element_gene;(source:Araport11);pseudogene, putative helicase protein, blastp match of 39%25 identity and 7.7e-124 P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10)
AT3G30170 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.2e-51 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10)
AT3G30180 Encodes a cytochrome p450 enzyme that catalyzes the last reaction in the production of brassinolide. It is capable of converting 6-deoxocastasterone into castasterone, a C-6 oxidation, as well as the further conversion of castasterone into brassinolide by a Baeyer-Villinger oxidation reaction at C-6, resulting in the formation of an unusual seven-membered lactone ring. The enzyme possesses high affinity for both C28- and C27-Brassinosteroids. The expression of the gene using a CYP85A2 promoter:LUC fusion construct was shown to be under circadian and light control.
AT3G30212 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.6e-19 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10)
AT3G30213 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-53 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT3G30214 pseudogene of transmembrane protein;(source:Araport11)
AT3G30216 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains some similarity to polyproteins;(source:TAIR10)
AT3G30230 myosin heavy chain-like protein;(source:Araport11)
AT3G30280 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT3G30290 a member of cytochrome P450 gene family
AT3G30320 hypothetical protein;(source:Araport11)
AT3G30335 transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 2.2e-129 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10)
AT3G30350 Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9).
AT3G30440 transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT3G47260.1);(source:TAIR10)
AT3G30510 transposable_element_gene;(source:Araport11)
AT3G30520 heat shock protein;(source:Araport11)
AT3G30530 basic leucine-zipper 42;(source:Araport11)
AT3G30580 hypothetical protein;(source:Araport11)
AT3G30630 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-300 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT3G30705 transmembrane protein;(source:Araport11)
AT3G30715 transposable_element_gene;(source:Araport11);expressed protein;(source:TAIR10)
AT3G30722 transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 4.1e-24 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10)
AT3G30737 transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, blastp match of 48%25 identity and 0. P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10)
AT3G30745 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.2e-26 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10)
AT3G30749 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 9.4e-205 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT3G30775 Encodes a proline oxidase that is predicted to localize to the inner mitochondrial membrane, its mRNA expression induced by high levels of Al and by osmotic stress. The promoter contains an L-proline-inducible element.
AT3G30790 transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.0e-149 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10)
AT3G30805 Class II aminoacyl-tRNA and biotin synthetases superfamily protein;(source:Araport11)
AT3G30839 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-11 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT3G30841 Cofactor-independent phosphoglycerate mutase;(source:Araport11)
AT3G30842 pleiotropic drug resistance 10;(source:Araport11)
AT3G30875 Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167
AT3G31317 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.9e-32 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10)
AT3G31365 transposable_element_gene;(source:Araport11);pseudogene, putative helicase, similar to putative helicase GB:AAD15468 GI:4263825 from (Arabidopsis thaliana);(source:TAIR10)
AT3G31367 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.1e-71 P-value blast match to GB:226407 retrotransposon del1-46 (Gypsy_Ty3-element) (Lilium henryi);(source:TAIR10)
AT3G31908 pseudogene of Reticulon family protein;(source:Araport11)
AT3G31915 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G31370.1);(source:TAIR10)
AT3G31950 nucleic acid-binding/zinc ion-binding protein;(source:Araport11)
AT3G31970 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.3e-294 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10)
AT3G32031 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.0e-53 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT3G32040 Chloroplast localized GFDP synthase.
AT3G32043 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.2e-40 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10)
AT3G32240 transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 4.9e-90 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT3G32360 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.8e-18 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10)
AT3G32383 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.7e-05 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10)
AT3G32389 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT3G32925 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.1e-13 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10)
AT3G32966 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT3G33055 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-282 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT3G33058 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-112 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT3G33070 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.8e-191 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10)
AT3G33124 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 6.5e-171 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT3G33130 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.9e-256 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10)
AT3G33163 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT3G33193 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.4e-232 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10)
AT3G33520 Encodes ACTIN-RELATED PROTEIN6 (ARP6), a putative component of a chromatin-remodeling complex. Required for both histone acetylation and methylation of the FLC chromatin in Arabidopsis. Along with PIE1 forms a complex to deposit modified histone H2A.Z at several loci within the genome. This modification alters the expression of the target genes (i.e. FLC, MAF4, MAF6). Incorporation of this variant histone into chromatin mediates the ambient temperature response. Located at specific regions of the nuclear periphery. Expression throughout plants shown by in-situ and immunolocalization methods. Mutants show defects in fertility, leaf, flower and inflorescence development and shorter flowering times. ARP6 also is involved in globally controlling developmental responses to ambient temperature through incorporation of variant histone H2A.Z into chromatin.
AT3G33530 Transducin family protein / WD-40 repeat family protein;(source:Araport11)
AT3G41768 rRNA;(source:Araport11)
AT3G41979 5.8SrRNA
AT3G42090 transposable_element_gene;(source:Araport11);contains domain LIN-9 RELATED (PTHR21689);(source:TAIR10)
AT3G42130 glycine-rich protein;(source:Araport11)
AT3G42150 transmembrane protein;(source:Araport11)
AT3G42178 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-197 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT3G42180 Exostosin family protein;(source:Araport11)
AT3G42181 transposable_element_gene;(source:Araport11)
AT3G42190 transposable_element_gene;(source:Araport11);similar to cysteine-type peptidase [Arabidopsis thaliana] (TAIR:AT3G42820.1);(source:TAIR10)
AT3G42220 transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.9e-166 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10)
AT3G42245 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-95 P-value blast match to GB:AAC64917 gag-pol polyprotein (Ty1_Copia-element) (Glycine max);(source:TAIR10)
AT3G42250 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G48720.1);(source:TAIR10)
AT3G42280 transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.3e-71 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT3G42350 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G06095.1);(source:TAIR10)
AT3G42386 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.5e-116 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10)
AT3G42390 hypothetical protein;(source:Araport11)
AT3G42430 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G37045.1);(source:TAIR10)
AT3G42434 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 8.5e-111 P-value blast match to gb|AAL06419.1|AF378075_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10)
AT3G42460 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G05570.1);(source:TAIR10)
AT3G42542 Encodes a defensin-like (DEFL) family protein.
AT3G42550 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT3G42553 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.6e-22 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT3G42570 peroxidase family protein;(source:Araport11)
AT3G42622 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 0. P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10)
AT3G42640 H[+]-ATPase 8;(source:Araport11)
AT3G42711 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.7e-08 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10)
AT3G42722 pseudogene of the F-box protein family
AT3G42766 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.1e-274 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10)
AT3G42790 Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7).
AT3G42794 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.2e-05 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10)
AT3G42798 transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBb0043H09.1, similar to En/Spm-like transposon protein;(source:TAIR10)
AT3G42800 AF-like protein;(source:Araport11)
AT3G42820 transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10)
AT3G42835 transposable_element_gene;(source:Araport11);non-LTR retroelement reverse transcriptase -related, temporary automated functional assignment;(source:TAIR10)
AT3G42850 Mevalonate/galactokinase family protein;(source:Araport11)arabinokinase activity
AT3G42880 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT3G42886 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-89 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10)
AT3G42890 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.4e-10 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10)
AT3G42960 Arabidopsis homolog of TASSELSEED2. Expressed specifically in tapetal cells.
AT3G43123 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10)
AT3G43170 hypothetical protein;(source:Araport11)
AT3G43180 RING/U-box superfamily protein;(source:Araport11)
AT3G43190 Encodes a protein with sucrose synthase activity (SUS4).
AT3G43210 Encodes a kinesin TETRASPORE. Required for cytokinesis in pollen. In mutants, all four microspore nuclei remain within the same cytoplasm after meiosis.
AT3G43220 Phosphoinositide phosphatase family protein;(source:Araport11)
AT3G43250 coiled-coil protein (DUF572);(source:Araport11)
AT3G43251 Pseudogene of AT5G26880; tRNA/rRNA methyltransferase (SpoU) family protein
AT3G43358 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.8e-69 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10)
AT3G43444 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.9e-293 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT3G43505 Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT3G43510 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-11 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10)
AT3G43522 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative Ta11-like non-LTR retroelement protein;(source:TAIR10)
AT3G43573 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.7e-27 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10)
AT3G43580 Beta-galactosidase related protein;(source:Araport11)
AT3G43622 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.7e-37 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10)
AT3G43670 Copper amine oxidase family protein;(source:Araport11)
AT3G43710 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT3G43720 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT3G43726 transposable_element_gene;(source:Araport11);pseudogene, similar to P0703B11.15, blastp match of 44%25 identity and 1.3e-42 P-value to GP|18844826|dbj|BAB85296.1||AP003302 P0703B11.15 {Oryza sativa (japonica cultivar-group)};(source:TAIR10)
AT3G43750 E3 ubiquitin ligases, member of the RING between RING fingers (RBR)-type RSL1/RFA family, are key regulators of ABA receptor stability in root and leaf tissues, targeting ABA receptors for degradation in different subcellular locations.
AT3G43760 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10)
AT3G43770 transposable_element_gene;(source:Araport11);similar to disease resistance protein (TIR-NBS-LRR class), putative [Arabidopsis thaliana] (TAIR:AT5G45230.1);(source:TAIR10)
AT3G43800 Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). The mRNA is cell-to-cell mobile.
AT3G43820 pseudogene of Copper amine oxidase family protein;(source:Araport11)
AT3G43835 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.4e-26 P-value blast match to GB:NP_038604 L1 repeat, Tf subfamily, member 26 (LINE-element) (Mus musculus);(source:TAIR10)
AT3G43850 hypothetical protein;(source:Araport11)
AT3G43870 hypothetical protein;(source:Araport11)
AT3G43890 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT3G43920 Encodes a ribonuclease III family protein that is required for endogenous RDR2-dependent siRNA (but not miRNA) formation.
AT3G43930 BRCT domain-containing DNA repair protein;(source:Araport11)
AT3G43950 Protein kinase superfamily protein;(source:Araport11)
AT3G43960 Encodes a putative cysteine proteinase. Mutants exhibit shorter root hairs under phosphate-deficient conditions.
AT3G44005 pseudogene of Mitochondrial transcription termination factor family protein;(source:Araport11)
AT3G44090 F-box family protein;(source:Araport11)
AT3G44093 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.4e-162 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10)
AT3G44100 MD-2-related lipid recognition domain-containing protein;(source:Araport11)
AT3G44110 homologous to the co-chaperon DNAJ protein from E coli
AT3G44150 Expp1 protein;(source:Araport11)
AT3G44170 plant self-incompatibility protein S1 family protein;(source:Araport11)
AT3G44175 transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, similar to reverse transcriptase, putative;(source:TAIR10)
AT3G44190 FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11)
AT3G44200 Encodes AtNek5, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.Interacts physically with plant kinesins ARK1 and ARK2. Mutants show defects in root epidermal cell morphology, trichome branching and other epidermal cell abnormalities suggesting a rol e in epidermal cell differentiation. NEK6 co-localizes with cortical microtubules.
AT3G44220 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11)
AT3G44235 transmembrane protein;(source:Araport11)
AT3G44250 putative cytochrome P450
AT3G44260 Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses.
AT3G44262 pseudogene of subtilisin-like serine protease 2;(source:Araport11)
AT3G44264 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-99 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10)
AT3G44280 peptidyl-prolyl cis-trans isomerase G;(source:Araport11)
AT3G44300 Encodes an enzyme that catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (nitrile aminohydrolase, EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. Mutants have reduced sensitivity to IAN and are sensitive to IAA. This enzyme likely participates in other non-auxin-related metabolic pathways. The mRNA is cell-to-cell mobile.
AT3G44310 Mutants are resistant to indole-3-acetonitrile (IAN). NIT1 catalyzes the terminal activation step in indole-acetic acid biosynthesis. Predominantly expressed isoform of nitrilase isoenzyme family. Aggregation of NIT1 in cells directly abutting wound sites is one of the earliest events associated with wound and herbicide-induced cell death. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. It is also involved in the conversion of IAN to IAM (indole-3-acetamide) and other non-auxin-related metabolic processes. The mRNA is cell-to-cell mobile.
AT3G44320 This enzyme catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. It is the only one of the four Arabidopsis nitrilases whose mRNA levels are strongly induced when plants experience sulphur deprivation. This enzyme likely participates in other non-auxin-related metabolic pathways.
AT3G44340 homologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions.
AT3G44350 NAC domain containing protein 61;(source:Araport11)
AT3G44370 Member of the Oxa1 super family protein insertases. Involved in biogenesis of mitochondrial respiratory chain complex IV, specifically via membrane insertion of COX2.
AT3G44410 pseudogene of Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT3G44450 Plant specific protein.BIC1 and BIC2 inhibit cryptochrome function by blocking blue light-dependent cryptochrome dimerization.Light activated transcription of BICs is mediated by cryptochromes.
AT3G44510 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT3G44530 Encodes a nuclear localized WD-repeat containing protein involved in negative regulation of knox gene expression via epigenetic mechanism of chromatin re-organization. It is a part of the HISTONE REGULATOR complex that deposits histones in a DNA synthesis-independent manner and affects both nucleosome occupancy and the maintenance of transcriptional silencing. Interacts physically and genetically with AS1. Expressed in meristem and leaf primordia. Homozygous mutants are embryo lethal. Phenotype of cosuppressed lines is variable but show effects on leaf development similar to as1/as2.
AT3G44540 Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. The mRNA is cell-to-cell mobile.
AT3G44550 Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. The mRNA is cell-to-cell mobile.
AT3G44560 fatty acid reductase 8;(source:Araport11)
AT3G44590 cytosolic ribosomal protein gene, part of bL12 family
AT3G44600 Cyclophilin71 is a WD40 domain cyclophilin, which functions in gene repression, organogenesis and meristem development. CYP71 physically interacts with histone H3.
AT3G44610 Kinase involved in the first positive phototropism and gravitropism. Phosphorylates serine residues in the cytoplasmic loop of PIN1 and shares phosphosite preferences with D6PK. Critical component for both hypocotyl phototropism and gravitropism, control tropic responses mainly through regulation of PIN-mediated auxin transport by protein phosphorylation.
AT3G44630 Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT3G44640 transposable_element_gene;(source:Araport11);transposase IS4 family protein, contains Pfam profile: PF01609 transposase DDE domain;(source:TAIR10)
AT3G44680 Encodes HDA9 (a RPD3-like histone deacetylase). Functions in promoting the onset of leaf senescence.The hda9 mutant shows enhanced H3K9 acetylation levels,based on immunodetection using H3K9ac antibodies. Negatively controls gene expression in concert with interacting proteins POWERDRESS (PWR), HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENES 15 (HOS15), WRKY53, ELONGATED HYPOCOTYL 5 (HY5), ABA INSENSITIVE 4 (ABI4) and EARLY FLOWERING 3 (ELF3). Involved in mutual negative feedback regulation with WRKY53. Mutations lead to a mild early flowering phenotype under SD.
AT3G44700 transmembrane protein;(source:Araport11)
AT3G44713 hypothetical protein;(source:Araport11)
AT3G44716 hypothetical protein;(source:Araport11)
AT3G44717 Pseudogene of AT5G03495; nucleotide binding protein
AT3G44720 Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile.
AT3G44730 kinesin-like protein 1;(source:Araport11)
AT3G44757 pseudogene of transmembrane protein;(source:Araport11)
AT3G44760 transmembrane protein;(source:Araport11)
AT3G44765 other_RNA;(source:Araport11)
AT3G44770 transmembrane protein, putative (DUF626);(source:Araport11)
AT3G44780 Cysteine proteinases superfamily protein;(source:Araport11)
AT3G44810 F-box family protein;(source:Araport11)
AT3G44830 Lecithin:cholesterol acyltransferase family protein;(source:Araport11)
AT3G44840 SABATH methyltransferase
AT3G44860 Encodes a farnesoic acid carboxyl-O-methyltransferase. The mRNA is cell-to-cell mobile.
AT3G44900 member of Putative Na+/H+ antiporter family
AT3G44910 member of Putative Na+/H+ antiporter family
AT3G44920 member of Putative Na+/H+ antiporter family
AT3G44930 member of Putative Na+/H+ antiporter family
AT3G44935 hypothetical protein;(source:Araport11)
AT3G44940 enabled-like protein (DUF1635);(source:Araport11)
AT3G44950 glycine-rich protein;(source:Araport11)
AT3G44960 shugoshin;(source:Araport11)
AT3G44970 Cytochrome P450 superfamily protein;(source:Araport11)
AT3G44980 hypothetical protein;(source:Araport11)
AT3G45000 SNF7 family protein;(source:Araport11)
AT3G45010 serine carboxypeptidase-like 48;(source:Araport11)
AT3G45050 transmembrane protein;(source:Araport11)
AT3G45070 Encodes a sulfotransferase with sulfating activity toward flavonoids.
AT3G45120 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G17900.1);(source:TAIR10)
AT3G45130 lanosterol synthase 1;(source:Araport11)
AT3G45150 TCP domain protein 16;(source:Araport11)
AT3G45180 Ubiquitin like protein that appears to play a role in pre-mRNA splicing.
AT3G45190 SIT4 phosphatase-associated family protein;(source:Araport11)
AT3G45210 transcription initiation factor TFIID subunit (Protein of unknown function, DUF584);(source:Araport11)
AT3G45220 Serine protease inhibitor (SERPIN) family protein;(source:Araport11)
AT3G45230 Encodes the arabinogalactan protein core of plant cell wall proteoglycan that contains arabinogalactan and cell wall matrix glycan pectin and/or xylan domains.
AT3G45240 Encodes a geminivirus Rep interacting kinase (GRIK; GRIK1/AT3G45240, GRIK2/AT5G60550). GRIKs are SnRK1 (SNF1-related kinases) activating kinases. Both GRIKs specifically bind to the SnRK1 catalytic subunit and phosphorylate the equivalent threonine residue in its activation loop in vitro. Involved in resistance to S. sclerotiorum, fungal sRNA target.
AT3G45252 Encodes a ECA1 gametogenesis related family protein
AT3G45275 Encodes a ECA1 gametogenesis related family protein
AT3G45280 syntaxin of plants 72 (SYP72)
AT3G45290 A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO3 belongs to the clade IV, with AtMLO2, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in primary root and lateral root primordia, in fruit abscission zone, in vascular system of cotyledons and in trichomes of young leaves,; it was not expressed in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s).
AT3G45300 Encodes isovaleryl-coenzyme a dehydrogenase. Mutants have increases in 12 seed free amino acids, accumulation of seed homomethionine and 3-isovaleroyloxypropyl-glucosinolate, with a concomitant decrease in seed 3-benzoyloxypropyl-glucosinolate. The mRNA is cell-to-cell mobile.
AT3G45310 Cysteine proteinases superfamily protein;(source:Araport11)
AT3G45330 Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT3G45390 LOW protein: L-type lectin-domain receptor kinase-like protein;(source:Araport11)
AT3G45400 exostosin family protein;(source:Araport11)
AT3G45460 IBR domain containing protein;(source:Araport11)
AT3G45470 IBR domain containing protein;(source:Araport11)
AT3G45480 RING/U-box protein with C6HC-type zinc finger;(source:Araport11)
AT3G45500 hypothetical protein;(source:Araport11)
AT3G45510 RING/U-box protein;(source:Araport11)
AT3G45525 RING/U-box protein with C6HC-type zinc finger protein;(source:Araport11)
AT3G45540 RING/U-box protein with C6HC-type zinc finger;(source:Araport11)
AT3G45555 RING/U-box protein;(source:Araport11)
AT3G45560 zinc finger (C3HC4-type RING finger) family protein;(source:Araport11)
AT3G45570 RING/U-box protein with C6HC-type zinc finger domain-containing protein;(source:Araport11)
AT3G45577 tRNA-intron endonuclease;(source:Araport11)
AT3G45600 Member of TETRASPANIN family
AT3G45610 PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division.
AT3G45638 other_RNA;(source:Araport11)
AT3G45670 Protein kinase superfamily protein;(source:Araport11)
AT3G45680 Major facilitator superfamily protein;(source:Araport11)
AT3G45760 Nucleotidyltransferase family protein;(source:Araport11)
AT3G45780 Blue-light photoreceptor. Contains a light activated serine-threonine kinase domain and LOV1 and LOV2 repeats. Mutants are defective in blue-light response. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT1 undergoes blue-light-dependent autophosphorylation. At least eight phosphorylation sites have been identified in PHOT1. Phosphorylation of serine851 in the activation loop of PHOT1 appears to be required for stomatal opening, chloroplast accumulation, leaf flattening, and phototropism, and phosphorylation of serine849 may also contribute to the regulation of these responses. Phosphorylation-dependent binding of 14-3-3 proteins to the Hinge1 region of PHOT1 appears to require serine350 and serine376.
AT3G45790 Protein kinase superfamily protein;(source:Araport11)
AT3G45810 ferric reductase-like transmembrane component family protein;(source:Araport11)
AT3G45830 nuclear factor kappa-B-binding-like protein;(source:Araport11)
AT3G45850 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT3G45851 This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT3G45890 Encodes RUS1 (root UVB sensitive 1), a protein that contains DUF647 (domain of unknown function 647), a domain highly conserved in eukaryotes. The primary root of rus1 is hypersensitive to very low-fluence-rate (VLF) UVB.
AT3G45900 Ribonuclease P protein subunit P38-like protein;(source:Araport11)
AT3G45930 Histone superfamily protein;(source:Araport11)
AT3G45935 pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10)
AT3G45940 Glycosyl hydrolases family 31 protein;(source:Araport11)
AT3G45965 pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10)
AT3G45970 member of EXPANSIN-LIKE. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) The mRNA is cell-to-cell mobile.
AT3G45980 Encodes a histone 2B (H2B) protein. This protein can be ubiquitinated in planta, and this modification depends on the HUB1 and HUB2 E3 ubiquitin ligases as well as the UBC1 and UBC2 E2 ubiquitin conjugating enzymes. Lysine 146 appears to be the site of the ubiquitin addition.
AT3G46070 C2H2-type zinc finger family protein;(source:Araport11)
AT3G46080 C2H2-type zinc finger family protein;(source:Araport11)
AT3G46110 DUF966 domain containing protein, expressed during embryogenesis.
AT3G46130 Encodes a putative transcription factor (MYB48) that functions to regulate flavonol biosynthesis primarily in cotyledons.
AT3G46160 Protein kinase superfamily protein;(source:Araport11)
AT3G46260 kinase-like protein;(source:Araport11)
AT3G46340 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT3G46360 transmembrane protein;(source:Araport11)
AT3G46384 pseudogene of Protein kinase superfamily protein;(source:Araport11)
AT3G46385 pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT3G46420 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT3G46500 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT3G46530 Confers resistance to the biotrophic oomycete, Peronospora parasitica. Encodes an NBS-LRR type R protein with a putative amino-terminal leucine zipper. Fungal protein ATR13 induces RPP13 gene expression and disease resistance. The mRNA is cell-to-cell mobile.
AT3G46540 ENTH/VHS family protein;(source:Araport11)
AT3G46570 Glycosyl hydrolase superfamily protein;(source:Araport11)
AT3G46580 Protein containing a putative methyl-CpG-binding domain.Has sequence similarity to human MBD proteins.
AT3G46590 Encodes a protein that specifically binds plant telomeric DNA (TTTAGGG)n repeats. Involved in bending DNA. Expressed throughout the plant with highest levels in flowers.
AT3G46600 GRAS family transcription factor;(source:Araport11)
AT3G46616 hypothetical protein;(source:Araport11)
AT3G46620 Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants.
AT3G46630 DCL protein (DUF3223);(source:Araport11)
AT3G46640 Encodes a myb family transcription factor with a single Myb DNA-binding domain (type SHAQKYF) that is unique to plants and is essential for circadian rhythms, specifically for transcriptional regulation within the circadian clock. LUX is required for normal rhythmic expression of multiple clock outputs in both constant light and darkness. It is coregulated with TOC1 and seems to be repressed by CCA1 and LHY by direct binding of these proteins to the evening element in the LUX promoter. The mRNA is cell-to-cell mobile.
AT3G46650 UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT3G46690 UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT3G46710 NB-ARC domain-containing disease resistance protein;(source:Araport11)
AT3G46720 UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT3G46730 NB-ARC domain-containing disease resistance protein;(source:Araport11)
AT3G46740 Component of the translocon outer membrane (TOC) complex. Forms the outer envelope translocation channel (beta-barrel). Plays a role in preprotein conductance. Imported into chloroplast. Expressed in young dividing photosynthetic tissues. Knockout mutants are embryo lethal with arrested development at the two-cell stage. Knockout mutants have abnormal etioplasts.
AT3G46760 Protein kinase superfamily protein;(source:Araport11)
AT3G46780 plastid transcriptionally active 16;(source:Araport11)
AT3G46800 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT3G46840 Subtilase family protein;(source:Araport11)
AT3G46850 Subtilase family protein;(source:Araport11)
AT3G46860 Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860.
AT3G46870 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT3G46890 maternal effect embryo arrest protein;(source:Araport11)
AT3G46910 Cullin family protein;(source:Araport11)
AT3G46930 Encodes a Raf-Like Mitogen-Activated Protein Kinase Kinase Kinase Raf43. Required for tolerance to multiple abiotic stresses.
AT3G46940 DUTP-PYROPHOSPHATASE-LIKE 1;(source:Araport11)
AT3G46990 DUF740 family protein, putative (DUF740);(source:Araport11)
AT3G47000 Glycosyl hydrolase family protein;(source:Araport11)
AT3G47030 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G47040 Glycosyl hydrolase family protein;(source:Araport11)
AT3G47050 Glycosyl hydrolase family protein;(source:Araport11)
AT3G47080 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT3G47090 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT3G47130 F-box associated ubiquitination effector family protein;(source:Araport11)
AT3G47150 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G47180 RING/U-box superfamily protein;(source:Araport11)
AT3G47200 transmembrane protein, putative (DUF247);(source:Araport11)
AT3G47210 hypothetical protein (DUF247);(source:Araport11)
AT3G47230 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G12505.1);(source:TAIR10)
AT3G47240 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G54926.1);(source:TAIR10)
AT3G47290 phosphatidylinositol-speciwc phospholipase C8;(source:Araport11)
AT3G47295 hypothetical protein;(source:Araport11)
AT3G47330 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G09370.1);(source:TAIR10)
AT3G47350 Encodes a putative hydroxysteroid dehydrogenase (HSD). Genes that encode HSD include: At5g50600 and At5g50700 (HSD1), At3g47350(HSD2), At3g47360(HSD3), At5g50590 and At5g50690(HSD4), At5g50770(HSD6) (Plant Cell Physiology 50:1463). Two copies of HSD1 and HSD4 exist due to a gene duplication event. In Plant Physiology 145:87, At5g50690 is HSD7, At4g10020 is HSD5.
AT3G47390 Encodes a protein that is believed to function as a pyrimidine reductase involved in riboflavin and FAD biosynthesis. phs1 was identified as a photosensitive mutant that shows reduced growth, chloroplast developmental abnormalities, reduced chlorophyll levels, increased oxidative stress, reduced NADPH/NADP+ ratios, reduced photosystem I electron transport, and reduced photosynthetic protein levels under high light conditions. Many of these abnormal phenotypes likely arise from the reduction in the levels of FAD in the phs1 mutant.
AT3G47400 Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT3G47410 hypothetical protein;(source:Araport11)
AT3G47420 Encodes a Pi starvation-responsive protein AtPS3. A member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots.
AT3G47440 Encodes AtTIP5;1, functions as water and urea channels in pollen. Target promoter of the male germline-specific transcription factor DUO1. Essential target of gibberellins, promotes hypocotyl cell elongation under excess boron stress.
AT3G47470 Encodes a chlorophyll a/b-binding protein that is more similar to the PSI Cab proteins than the PSII cab proteins. The predicted protein is about 20 amino acids shorter than most known Cab proteins.
AT3G47500 Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions.
AT3G47540 Chitinase family protein;(source:Araport11)
AT3G47560 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT3G47610 transcription regulator/ zinc ion binding protein;(source:Araport11)
AT3G47620 Encodes a transcription factor AtTCP14 that regulates seed germination. AtTCP14 shows elevated expression level just prior to germination. AtTCP14 is predominantly expressed in the vascular tissue of the embryo, and affects gene expression in radicles in a non-cell-autonomous manner. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters.
AT3G47630 translocator assembly/maintenance protein;(source:Araport11)
AT3G47650 DnaJ/Hsp40 cysteine-rich domain superfamily protein;(source:Araport11)
AT3G47660 Regulator of chromosome condensation (RCC1) family protein;(source:Araport11)
AT3G47670 Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT3G47720 Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation.
AT3G47740 member of ATH subfamily
AT3G47750 member of ATH subfamily
AT3G47760 ABC2 homolog 4;(source:Araport11)
AT3G47780 member of ATH subfamily The mRNA is cell-to-cell mobile.
AT3G47790 ABC2 homolog 7;(source:Araport11)
AT3G47800 Galactose mutarotase-like superfamily protein;(source:Araport11)
AT3G47870 Required for normal cell division during pollen development. Mutant has extra cell in pollen of vegetative cell identity. Male gametophytic mutation.
AT3G47875 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.1e-40 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10)
AT3G47940 DNAJ heat shock family protein;(source:Araport11)
AT3G47990 SUGAR-INSENSITIVE 3;(source:Araport11)
AT3G48000 Encodes a putative (NAD+) aldehyde dehydrogenase.
AT3G48010 member of Cyclic nucleotide gated channel family
AT3G48050 Encodes a large protein with N-terminal bromo-adjacent homology (BAH) and transcription elongation factor S-II (TFS2N) domains and two C-terminal GW (glycine and tryptophan) repeats. It is nuclear and colocalizes with the processing-body component DCP1 in the cytoplasm. SOU is a component of the miRNA pathway and is involved in translational repression.
AT3G48057 Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUAGGUCGAGCUUCAUUGGA
AT3G48080 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT3G48090 Component of R gene-mediated disease resistance in Arabidopsis thaliana with homology to eukaryotic lipases.
AT3G48110 glycine-tRNA ligase
AT3G48190 Encodes a homolog of the human ATM gene, which is mutated in ataxia telangiectasia, a chromosome instability disorder. Suppresses leaf senescence triggered by DNA double-strand break through epigenetic control of senescence-associated genes. Characterization of mutants suggest a role homologous recombination for DNA damage repair in response to ionizing radiation as well as during meiosis. The protein has kinase domains and shows kinase activity in orthologs. There is also evidence that ATM might be involved in the telomerase-independent process known as Alternative Lengthening of Telomeres.
AT3G48195 Encodes a member of the Arabidopsis sorting nexin family.
AT3G48209 Encodes a Plant thionin family protein
AT3G48210 kinetochore protein;(source:Araport11)
AT3G48220 F-box protein;(source:Araport11)
AT3G48235 transposable_element_gene;(source:Araport11);pseudogene, similar to Hypothetical protein with similarity to putative Ac-like transposases, similar to Ac-like transposase;(source:TAIR10)
AT3G48240 Octicosapeptide/Phox/Bem1p family protein;(source:Araport11)
AT3G48250 Encodes a pentatricopeptide repeat protein implicated in splicing of intron 1 of mitochondrial nad7 transcripts.
AT3G48275 pre-tRNA tRNA-Thr (anticodon: TGT);(source:Araport11, TAIR10)
AT3G48280 putative cytochrome P450
AT3G48300 putative cytochrome P450
AT3G48330 Encodes protein-L-isoaspartate methyltransferase. Important for maintaining viability as the seed ages. Involved in germination.
AT3G48344 This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT3G48400 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT3G48450 RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11)
AT3G48470 embryo defective 2423;(source:Araport11)
AT3G48510 ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling.
AT3G48523 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT3G48550 SHOOT GRAVITROPISM-like protein;(source:Araport11)
AT3G48580 xyloglucan endotransglucosylase/hydrolase 11;(source:Araport11)
AT3G48650 pseudogene of pectinesterase;(source:Araport11)
AT3G48720 Encodes a hydroxycinnamoyl-CoA: v-hydroxy fatty acid transferase involved in cutin synthesis. Mutants are almost devoid of ferulic acid.
AT3G48740 Encodes a member of the SWEET sucrose efflux transporter family proteins.
AT3G48745 pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10)
AT3G48750 A-type cyclin-dependent kinase. Together with its specific inhibitor, the Kip-related protein, KRP2 they regulate the mitosis-to-endocycle transition during leaf development. Dominant negative mutations abolish cell division. Loss of function phenotype has reduced fertility with failure to transmit via pollen. Pollen development is arrested at the second mitotic division. Expression is regulated by environmental and chemical signals. Part of the promoter is responsible for expression in trichomes. Functions as a positive regulator of cell proliferation during development of the male gametophyte, embryo and endosperm. Phosphorylation of threonine 161 is required for activation of its associated kinase.
AT3G48760 DHHC-type zinc finger family protein;(source:Araport11)
AT3G48770 ATP/DNA binding protein;(source:Araport11)
AT3G48790 Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11)
AT3G48850 Encodes a mitochondrial phosphate transporter. Modulates plant responses to salt stress.
AT3G48900 Encodes one of two GEN1 homologs in Arabidopsis. It is a member of the class IV Rad2/XPG family of nucleases that processes Holliday junctions in a manner analogous to the HJ resolvases of phages, archaea, and bacteria.
AT3G48940 Remorin family protein;(source:Araport11)
AT3G49010 Encodes 60S ribosomal protein L13. Homolog of human breast basic conserved 1 (BBC1).
AT3G49030 FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11)
AT3G49040 F-box/FBD/LRR protein;(source:Araport11)
AT3G49055 ATP-binding protein;(source:Araport11)
AT3G49060 Plant U-box type E3 ubiquitin ligase (PUB).
AT3G49070 transmembrane protein, putative (DUF677);(source:Araport11)
AT3G49110 Class III peroxidase Perx33. Expressed in roots. Located in the cell wall. Involved in cell elongation. Expression activated by light. May play a role in generating H2O2 during defense response. The mRNA is cell-to-cell mobile.
AT3G49140 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT3G49150 F-box/FBD/LRR protein;(source:Araport11)
AT3G49160 Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress.
AT3G49190 O-acyltransferase (WSD1-like) family protein;(source:Araport11)
AT3G49200 O-acyltransferase (WSD1-like) family protein;(source:Araport11)
AT3G49220 Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT3G49260 IQ-domain 21;(source:Araport11)
AT3G49270 extensin-like protein;(source:Araport11)
AT3G49300 proline-rich family protein;(source:Araport11)
AT3G49305 transmembrane protein;(source:Araport11)
AT3G49310 Major facilitator superfamily protein;(source:Araport11)
AT3G49330 Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT3G49350 Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11)
AT3G49450 F-box protein involved in protein binding and ubiquitination; involved in male fertility.
AT3G49480 F-Box Gene regulated by Agrobacterium virulence protein VirD5 and essential for Agrobacterium-mediated plant transformation.
AT3G49520 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G49550 hypothetical protein;(source:Araport11)
AT3G49630 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT3G49650 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT3G49680 Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant.
AT3G49690 Putative homolog of the Blind gene in tomato. Together with RAX1 and RAX3 belong to the class R2R3 MYB genes; encoded by the Myb-like transcription factor MYB84, regulates axillary meristem formation.
AT3G49700 encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family. Mutants produce elevated levels of ethylene as etiolated seedlings.
AT3G49740 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT3G49800 BSD domain-containing protein;(source:Araport11)
AT3G49810 Encodes a protein with E3 ubiquitin ligase activity that is involved in negative regulation of salt stress tolerance during germination.
AT3G49832 pseudogene of kelch repeat-containing F-box family
AT3G49840 Encodes an orthlog of the Xenopus inner nuclear membrane (INM) protein Nemp1/TMEM194A.
AT3G49845 cysteine-rich TM module stress tolerance protein;(source:Araport11)
AT3G49890 hypothetical protein;(source:Araport11)
AT3G49910 Translation protein SH3-like family protein;(source:Araport11)
AT3G49925 pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10)
AT3G49930 C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11)
AT3G49940 LOB domain-containing protein 38;(source:Araport11)
AT3G49950 GRAS family transcription factor;(source:Araport11)
AT3G49960 Its expression is enriched in root hair cells (compared to non-root hair cells) and this enrichment is associated with increase in the transcription-associated mark trimethylation of H3 lysine 4 (H3K4me3) and decrease in the Polycomb silencing-associated mark trimethylation of H3 lysine 27 (H3K27me3) in root hair cells relative to non-root hair cells.
AT3G49970 Phototropic-responsive NPH3 family protein;(source:Araport11)
AT3G50000 Encodes the casein kinase II (CK2) catalytic subunit (alpha).
AT3G50030 ARM-repeat/Tetratricopeptide repeat (TPR)-like protein;(source:Araport11)
AT3G50070 Encode CYCD3;3, a CYCD3 D-type cyclin. Important for determining cell number in developing lateral organs. Mediating cytokinin effects in apical growth and development.
AT3G50090 Exonuclease family protein;(source:Araport11)
AT3G50120 transmembrane protein, putative (DUF247);(source:Araport11)
AT3G50150 transmembrane protein, putative (DUF247);(source:Araport11)
AT3G50180 transmembrane protein, putative (DUF247);(source:Araport11)
AT3G50190 transmembrane protein, putative (DUF247);(source:Araport11)
AT3G50220 Encode a DUF579 (domain of unknown function 579) containing protein essential for normal xylan synthesis and deposition in the secondary cell wall.
AT3G50230 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT3G50240 Encodes a kinesin-related protein.
AT3G50250 transmembrane protein;(source:Araport11)
AT3G50270 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT3G50280 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT3G50290 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT3G50295 pseudogene of Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT3G50300 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT3G50310 Encodes a member of MEKK subfamily. Target promoter of the male germline-specific transcription factor DUO1. Involved in osmotic stress response via regulation of MPK6 activity. It also plays an important role in regulating cell division and cell elongation in the primary root meristematic and elongation areas. Mutants show defects in root microtubule organization.It phosphorylates MPK18 and MKK3.It is a positive regulator of ABA-induced stomatal closure that acts by phosphorylating MKK5.
AT3G50330 Encodes a bHLH transcription factor that is involved in transmitting tract and stigma development. Inhibits thermomorphogenesis.
AT3G50340 hypothetical protein;(source:Araport11)
AT3G50376 pseudogene of NLI interacting factor (NIF) family protein
AT3G50380 vacuolar protein sorting-associated protein, putative (DUF1162);(source:Araport11)
AT3G50390 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT3G50400 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT3G50410 Arabidopsis Dof protein containing a single 51-amino acid zinc finger DNA-binding domain, which may play an important roles in plant growth and development.
AT3G50440 Encodes a protein shown to have methyl jasmonate esterase activity in vitro. This protein does not act on methyl IAA, MeSA, MeGA4, or MEGA9 in vitro.
AT3G50450 Homolog of RPW8
AT3G50480 Homolog of RPW8
AT3G50590 WD40/YVTN repeat protein.
AT3G50610 DNA-directed RNA polymerase II subunit RPB1-like protein;(source:Araport11)
AT3G50620 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT3G50625 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.1e-96 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10)
AT3G50660 Encodes a 22α hydroxylase whose reaction is a rate-limiting step in brassinosteroid biosynthetic pathway. The protein is a member of CYP90B gene family. CLM is an epi-allele with small, compressed rosette, reduced internode length, and reduced fertility, appears in selfed ddm mutant plants possibly due to loss of cytosine methylation. Transcripts accumulate in actively growing tissues, and GUS expression is negatively regulated by brassinosteroids. Localized in the endoplasmic reticulum. The in vitro expressed protein can perform the C-22 hydroxylation of a variety of C27-, C28- and C29-sterols. Cholesterol was the best substrate, followed by campesterol. Sitosterol was a poor substrate.
AT3G50665 pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10)
AT3G50700 zinc finger protein, similar to maize Indeterminate1 (ID1)
AT3G50710 F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT3G50740 UGT72E1 is an UDPG:coniferyl alcohol glucosyltransferase which specifically glucosylates sinapyl- and coniferyl aldehydes. The enzyme is thought to be involved in lignin metabolism.
AT3G50750 BES1/BZR1 homolog 1;(source:Araport11)
AT3G50760 Encodes a protein with putative galacturonosyltransferase activity. The mRNA is cell-to-cell mobile.
AT3G50780 BTB/POZ domain protein;(source:Araport11)
AT3G50800 PADRE protein.
AT3G50820 Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO2 is the minor isoform in the wild-type. Mutants defective in this gene have been shown to be affected in the dephosphorylation of the D1 protein of PSII.
AT3G50835 pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10)
AT3G50840 Phototropic-responsive NPH3 family protein;(source:Araport11)
AT3G50900 hypothetical protein;(source:Araport11)
AT3G50930 Encodes a protein that is present in a homo-multimeric protein complex on the outer mitochondrial membrane and plays a role in cell death and amplifying salicylic acid signalling. The mRNA is cell-to-cell mobile.
AT3G50940 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT3G50980 dehydrin xero 1;(source:Araport11)
AT3G51000 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT3G51050 NERD1 is a single copy locus encoding a protein of unknown function that is localized to the nucleus. Single mutants show defects in root hair growth, root meristem function, cell elongation. NERD1 appears to act synergistically with the exocyst in root development.
AT3G51060 A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. STY1/STY2 double mutants showed defective style, stigma as well as serrated leaves. Binds to the promoter of YUC4 and YUC8 (binding site ACTCTAC)
AT3G51080 Encodes a member of the GATA factor family of zinc finger transcription factors.
AT3G51090 coiled-coil 90B-like protein (DUF1640);(source:Araport11)
AT3G51100 altered inheritance of mitochondria protein;(source:Araport11)
AT3G51110 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT3G51130 transmembrane protein;(source:Araport11)
AT3G51190 Ribosomal protein L2 family;(source:Araport11)
AT3G51220 WEB family protein (DUF827);(source:Araport11)
AT3G51230 chalcone-flavanone isomerase family protein;(source:Araport11)
AT3G51260 20S proteosomal alpha subunits. Interacts with SnRK, SKP1/ASK1 during proteasomal binding of an SCF ubiquitin ligase.
AT3G51265 pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10)
AT3G51290 pyridoxal-phosphate-dependent serine hydroxymethyltransferase, putative (DUF632);(source:Araport11)
AT3G51300 Encodes a pollen-specific Rop GTPase, member of the Rho family of small GTP binding proteins that interacts with RIC3 and RIC4 to control tip growth in pollen tubes. These three proteins promote the proper targeting of exocytic vesicles in the pollen tube tip. ROP1 activity is regulated by the REN1 GTPase activator protein.
AT3G51325 RING/U-box superfamily protein;(source:Araport11)
AT3G51340 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT3G51360 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT3G51370 Protein phosphatase 2C family protein;(source:Araport11)
AT3G51375 Encodes a microRNA that targets several SCL family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAUUGAGCCGCGCCAAUAUC
AT3G51400 hypothetical protein (DUF241);(source:Araport11)
AT3G51410 hypothetical protein (DUF241);(source:Araport11)
AT3G51460 Encodes RHD4 (ROOT HAIR DEFECTIVE4), a phosphatidylinositol-4-phosphate phosphatase required for root hair development. The mRNA is cell-to-cell mobile.
AT3G51480 member of Putative ligand-gated ion channel subunit family
AT3G51540 mucin-5AC-like protein;(source:Araport11)
AT3G51570 Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT3G51580 transmembrane protein;(source:Araport11)
AT3G51590 Encodes a member of the lipid transfer protein family. Proteins of this family are generally small (~9 kD), basic, expressed abundantly and contain eight Cys residues. The proteins can bind fatty acids and acylCoA esters and can transfer several different phospholipids. They are localized to the cell wall. The LTP12 promoter is active exclusively in the tapetum during the uninucleate microspore and bicellular pollen stages. Predicted to be a member of PR-14 pathogenesis-related protein family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15.
AT3G51600 Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15.
AT3G51630 Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases.
AT3G51660 Chemokine-like MDL protein; modulate flowering time and innate immunity in plants.
AT3G51680 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT3G51690 DNA helicase homolog PIF1.
AT3G51700 PIF1 helicase;(source:Araport11)
AT3G51730 saposin B domain-containing protein;(source:Araport11)
AT3G51750 hypothetical protein;(source:Araport11)
AT3G51760 hypothetical protein (DUF688);(source:Araport11)
AT3G51800 putative nuclear DNA-binding protein G2p (AtG2) mRNA,
AT3G51860 cation exchanger 3;(source:Araport11)
AT3G51870 Mitochondrial substrate carrier family protein;(source:Araport11)
AT3G51890 Clathrin light chain protein;(source:Araport11)
AT3G51910 member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile.
AT3G51930 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT3G51960 bZIP transcription factor induced by salt stress and promoted salt tolerance. Localized to the cytoplasm and nucleus under control conditions and targeted preferentially to the nucleus under salt stress
AT3G52080 encodes a cation:proton exchanger expressed in pollen
AT3G52140 Involved in regulating mitochondrial quality control. Regulates mitochondrial association time and thereby is involved in mitochondrial fusion. Mutants show unregulated autophagy and display transcriptomic markers of mitochondrial stress. Its activity can be modulated by Lys acetylation.
AT3G52220 leukocyte immunoglobulin-like receptor family A protein;(source:Araport11)
AT3G52230 hypothetical protein;(source:Araport11)
AT3G52250 Encodes a protein with a putative role in mRNA splicing. The mRNA is cell-to-cell mobile.
AT3G52260 Pseudouridine synthase family protein;(source:Araport11)
AT3G52290 Member of IQ67 (CaM binding) domain containing family.
AT3G52320 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G52330 F-box associated ubiquitination effector family protein;(source:Araport11)
AT3G52350 D111/G-patch domain-containing protein;(source:Araport11)
AT3G52370 Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development.
AT3G52430 Encodes a lipase-like gene that is important for salicylic acid signaling and function in resistance (R) gene-mediated and basal plant disease resistance. PAD4 can interact directly with EDS1, another disease resistance signaling protein. Expressed at elevated level in response to green peach aphid (GPA) feeding, and modulates the GPA feeding-induced leaf senescence through a mechanism that doesn't require camalexin synthesis and salicylic acid (SA) signaling. Required for the ssi2-dependent heightened resistance to GPA. The mRNA is cell-to-cell mobile.
AT3G52440 Dof-type zinc finger DNA-binding family protein;(source:Araport11)
AT3G52450 Encodes a cytoplasmically localized U-box domain E3 ubiquitin ligase protein that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity.
AT3G52460 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT3G52490 Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance.
AT3G52510 F-box associated ubiquitination effector family protein;(source:Araport11)
AT3G52520 hypothetical protein;(source:Araport11)
AT3G52527 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-22 P-value blast match to GB:AAC02672 polyprotein (Ty1_Copia-element) (Arabidopsis arenosa);(source:TAIR10)
AT3G52540 ovate family protein 18;(source:Araport11)
AT3G52565 pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10)
AT3G52600 Cell wall invertase expressed in flowers and ovary placental tissues. Reduced expression is correlated with decreased ovule production suggesting a link between sugar sensing and ovule initiation.
AT3G52700 hypothetical protein;(source:Araport11)
AT3G52730 ubiquinol-cytochrome C reductase UQCRX/QCR9-like family protein;(source:Araport11)
AT3G52765 pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10)
AT3G52770 ZPR3 is a small-leucine zipper containing protein that is involved in the establishment of leaf polarity.
AT3G52800 A20/AN1-like zinc finger family protein;(source:Araport11)
AT3G52820 purple acid phosphatase 22;(source:Araport11)
AT3G52850 Encodes the Vacuolar Sorting Receptor-1 (VSR-1)/Epidermal Growth Factor Receptor-like protein1(VSR-1/ATELP1). Binds vacuolar targeting signals. Involved in sorting seed storage proteins into vacuoles. The mRNA is cell-to-cell mobile.
AT3G52870 IQ calmodulin-binding motif family protein;(source:Araport11)
AT3G52900 RAB6-interacting golgin (DUF662);(source:Araport11)
AT3G52905 Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11)
AT3G52920 transcriptional activator (DUF662);(source:Araport11)
AT3G52970 member of CYP76G
AT3G52980 Zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein;(source:Araport11)
AT3G52990 Pyruvate kinase family protein;(source:Araport11)
AT3G53010 carbohydrate esterase, putative (DUF303);(source:Araport11)
AT3G53040 late embryogenesis abundant protein, putative / LEA protein;(source:Araport11)
AT3G53060 SKP1-like 6;(source:Araport11)
AT3G53065 D-galactoside/L-rhamnose binding SUEL lectin protein;(source:Araport11)
AT3G53100 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT3G53150 UDP-glucosyl transferase 73D1;(source:Araport11)
AT3G53160 UGT73C7 is induced by pathogen infection. It glycosylates p-coumaric acid and ferulic acid to modulate phenylpropanoid metabolism and induce innate immune response.
AT3G53180 Encodes a protein that is the product of a fusion gene with a C-terminal GSI like sequence and an N-terminal part sharing homology with nodulins. It self-assembles into oligomers and its expression is increased in response to flagellin treatment. The protein co-localizes with microtubules and binds gamma-tubulin. RNAi lines are affected in root morphogenesis.
AT3G53190 Pectin lyase-like superfamily protein;(source:Araport11)
AT3G53210 nodulin MtN21-like transporter family protein
AT3G53230 CDC48 is induced upon oilseed rape mosaic tobamovirus infection and appears to be involved in controlling virus movement.
AT3G53250 SAUR-like auxin-responsive protein family;(source:Araport11)
AT3G53280 cytochrome P450 monooxygenase The mRNA is cell-to-cell mobile.
AT3G53290 missing N-term 80 AA not found between end of 71B5 and start of this sequence probably a pseudogene, from http://drnelson.utmem.edu/biblioD.html
AT3G53305 putative cytochrome P450
AT3G53330 plastocyanin-like domain-containing protein;(source:Araport11)
AT3G53350 Encodes RIP3 (ROP interactive partner 3), a microtubule-binding protein that is anchored to the plasma membrane domains and promotes local microtubule disassembly, forming as specific pattern of secondary walls in xylem vessel cells. Localized at microtubules and interacts with the plant-specific kinesin AtKinesin-13A.
AT3G53400 peptide upstream protein;(source:Araport11)
AT3G53410 Paralog of LOG2 (At3g09770), a ubiquitin ligase that regulates amino acid export.
AT3G53450 Putative lysine decarboxylase family protein;(source:Araport11)
AT3G53490 valine-tRNA ligase;(source:Araport11)
AT3G53530 Chloroplast-targeted copper chaperone protein;(source:Araport11)
AT3G53540 afadin;(source:Araport11)
AT3G53550 FBD-like domain family protein;(source:Araport11)
AT3G53590 LRR receptor-like Serine/Threonine-kinase;(source:Araport11)
AT3G53630 hypothetical protein;(source:Araport11)
AT3G53720 member of Putative Na+/H+ antiporter family. Involved in the osmoregulation through K(+) fluxes and possibly pH modulation of an active endomembrane system in guard cells.
AT3G53780 RHOMBOID-like protein 4;(source:Araport11)
AT3G53810 Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT3G53820 C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11)
AT3G53840 Protein kinase superfamily protein;(source:Araport11)
AT3G53990 Encodes universal stress protein (USP). Functions as a molecular chaperone under heat shock and oxidative stress conditions. Chaperone activity and assembly into complexes is redox regulated.
AT3G54000 TIP41-like protein;(source:Araport11)
AT3G54020 Inositol phosphorylceramide synthase
AT3G54030 kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11)
AT3G54040 PAR1 protein;(source:Araport11)
AT3G54050 Encodes a chloroplastic fructose 1,6-bisphosphate phosphatase. also known as HCEF1 (High Cyclic Electron Flow 1). hcef1 mutants have constitutively elevated electron flow (CEFI) and plants with antisense suppression of this enzyme have higher levels of net leaf photosynthesis and increased sucrose biosynthesis. The mRNA is cell-to-cell mobile.
AT3G54100 O-fucosyltransferase family protein;(source:Araport11)
AT3G54110 Member of Uncoupling protein PUMP2 family. Encodes a mitochondrial uncoupling protein AtUCP1 involved in maintain the redox poise of the mitochondrial electron transport chain to facilitate photosynthetic metabolism. Disruption of UCP1 results in a photosynthetic phenotype. Specifically there is a restriction in photorespiration with a decrease in the rate of oxidation of photorespiratory glycine in the mitochondrion. This change leads to an associated reduced photosynthetic carbon assimilation rate. The mRNA is cell-to-cell mobile.
AT3G54130 Josephin family protein;(source:Araport11)
AT3G54140 Encodes a di- and tri-peptide transporter that recognizes a variety of different amino acid combinations. GFP-tagged PTR1 localizes to the plasma membrane and has 8 to 11 predicted transmembrane domains. PTR1 is expressed in a number of different vascular tissues throughout the plant based on promoter:GUS expression analysis. ptr1 mutants have a lower dry weight than wild type plants when both are grown with Pro-Ala or Ala-Ala dipeptides as their nitrogen source, suggesting that PTR1 plays a role in dipeptide uptake in the roots. Furthermore N content of ptr1 mutants is lower than that of wild type plants when grown with Pro-Ala or a mixture of dipeptides as nitrogen source
AT3G54150 Encodes a DNA methyltransferase required for pollen exine formation and male fertility via the regulation of callose wall and primexine formation.
AT3G54230 Encodes a splicing factor SUA (suppressor of abi3-5), homologous to the human protein RBM5. Controls alternative splicing of the developmental regulator ABI3.
AT3G54240 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT3G54280 ROOT GROWTH DEFECTIVE 3;(source:Araport11)
AT3G54290 hemerythrin HHE cation-binding domain protein;(source:Araport11)
AT3G54300 Encodes a member of Synaptobrevin -like protein family. VAMP727 is a R-SNARE and interacts with SYP22/VTI11/SYP51. It is required for trafficking of storage proteins to the protein storage vacuoles (PSV) and also for PSV organization and biogenesis. Loss of function mutations have no phenotype but double mutants with SYP22 are embryo lethal.
AT3G54390 sequence-specific DNA binding transcription factor;(source:Araport11)
AT3G54410 hypothetical protein (DUF1163);(source:Araport11)
AT3G54430 A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis.
AT3G54440 glycoside hydrolase family 2 protein;(source:Araport11)
AT3G54520 hypothetical protein;(source:Araport11)
AT3G54590 Encodes a hydroxyproline-rich glycoprotein. The mRNA is cell-to-cell mobile.
AT3G54620 bZIP transcription factor-like protein mRNA
AT3G54700 Encodes Pht1;7, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341).
AT3G54710 Encodes a cyclin-dependent protein kinase. Involved in nuclear DNA replication and plastid division.
AT3G54800 Pleckstrin homology (PH) and lipid-binding START domains-containing protein;(source:Araport11)
AT3G54810 Encodes a protein containing a GATA type zinc finger domain that is expressed in the embryo axis and involved in germination. Mutants have a reduced rate of germination even when stratified.
AT3G54826 Zim17-type zinc finger protein;(source:Araport11)
AT3G54900 A.thaliana PICOT protein.It activates CAX1 gene Calcium transport activity.In other organisms, PICOT proteins appear to play a negative regulatory role in cellular stress responses.
AT3G54930 Protein phosphatase 2A regulatory B subunit family protein;(source:Araport11)
AT3G54950 Encodes pPLAIIIbeta, a member of the Group 3 patatin-related phospholipases. pPLAIIIbeta hydrolyzes phospholipids and galactolipids and additionally has acyl-CoA thioesterase activity. Alterations of pPLAIIIβ result in changes in lipid levels and composition.
AT3G54960 Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response.
AT3G55000 Encodes a protein of unknown function that is involved in cortical microtubule organization. Mutants exhibit abnormal cell growth and patterns of division. TON1A can functionally complement TON1B and their roles appear to be redundant in plants. Encodes a novel protein that is similar to human FOP and OFD1 centrosomal proteins. Localizes to the preprophase band, cytoplasm and cell cortex where it is probably associated with the cortical cytoskeleton. TON1A associates with plant centrins CEN1 and CEN2.
AT3G55050 Protein phosphatase 2C family protein;(source:Araport11)
AT3G55080 SET domain-containing protein;(source:Araport11)
AT3G55090 Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16).
AT3G55100 ABC-2 type transporter family protein;(source:Araport11)
AT3G55110 ABC-2 type transporter family protein;(source:Araport11)
AT3G55120 Catalyzes the conversion of chalcones into flavanones. Required for the accumulation of purple anthocyanins in leaves and stems. Co-expressed with CHS.
AT3G55130 Encodes a vacuole localized protein of the ABC transporter White-Brown Complex (WBC) family. When overexpressed in planta, confers resistance to kanamycin.
AT3G55150 A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT3G55160 THADA is an orphan gene in Arabidopsis thaliana. It is the only DUF2428 domain containing protein in the genome.
AT3G55190 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT3G55240 Overexpression leads to PEL (Pseudo-Etiolation in Light) phenotype.
AT3G55252 Plant self-incompatibility protein S1 family;(source:Araport11)
AT3G55320 P-glycoprotein 20;(source:Araport11)
AT3G55370 Encodes a nuclear localized Dof domain containing transcription factor expressed primarily in roots. Responsive to salicylic acid. Transgenic overexpressors have yellow leaves and short, defective roots.
AT3G55420 hypothetical protein;(source:Araport11)
AT3G55430 O-Glycosyl hydrolases family 17 protein;(source:Araport11)
AT3G55440 Encodes triosephosphate isomerase.
AT3G55450 PBS1-like 1;(source:Araport11)
AT3G55460 encodes an SC35-like splicing factor that is localized to nuclear specks. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. The mRNA is cell-to-cell mobile.
AT3G55510 Encodes a regulator of floral determinacy in that interacts with both nucleolar and nucleoplasmic proteins.
AT3G55512 Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AGAAUCUUGAUGAUGCUGCAG
AT3G55530 Encodes an intracellular membrane localized protein with E3 ligase activity, found in the ER with the C-terminus facing the cytoplasm. It is involved in regulation of ABA signaling. Loss of function alleles show decreased sensitivity to ABA. Overexpression results in increased sensitivity to ABA.
AT3G55550 Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT3G55620 Translation initiation factor IF6;(source:Araport11)
AT3G55640 Mitochondrial substrate carrier family protein;(source:Araport11)
AT3G55646 TPRXL;(source:Araport11)
AT3G55650 Pyruvate kinase family protein;(source:Araport11)
AT3G55672 Plant self-incompatibility protein S1 family;(source:Araport11)
AT3G55700 UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT3G55720 replication factor C subunit, putative (DUF620);(source:Araport11)
AT3G55760 hypothetical protein;(source:Araport11)
AT3G55780 Glycosyl hydrolase superfamily protein;(source:Araport11)
AT3G55800 Encodes the chloroplast enzyme sedoheptulose-1,7-bisphosphatase (SBPase), involved in the carbon reduction of the Calvin cycle. Increase in SBPase activity in transgenic lines accumulate up to 50% more sucrose and starch than wild-type. The mRNA is cell-to-cell mobile.
AT3G55810 Pyruvate kinase family protein;(source:Araport11)
AT3G55840 Hs1pro-1 protein;(source:Araport11)
AT3G55880 A gain-of-function mutant of SUE4 exhibited improved low sulphur tolerance.
AT3G55920 Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11)
AT3G55950 CRINKLY4 related 3;(source:Araport11)
AT3G55970 One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA.
AT3G55980 salt-inducible zinc finger 1;(source:Araport11)
AT3G55990 Encodes ESK1 (Eskimo1). A member of a large gene family of DUF231 domain proteins whose members encode a total of 45 proteins of unknown function. ESK1 functions as a negative regulator of cold acclimation. Mutations in the ESK1 gene provides strong freezing tolerance. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). The mRNA is cell-to-cell mobile.
AT3G56030 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT3G56040 UDP-glucose pyrophosphorylase 3;(source:Araport11)
AT3G56050 Protein kinase family protein;(source:Araport11)
AT3G56060 Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11)
AT3G56080 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT3G56090 Encodes FERRITIN 3, AtFER3. Ferritins are a class of 24-mer multi-meric proteins found in all kingdoms of life. Function as the main iron store in mammals. Evidence suggests that Arabidopsis ferritins are essential to protect cells against oxidative damage, but they do not constitute the major iron pool.
AT3G56100 Protein kinase expressed in meristematic cells. Phosphorylates AGL24.
AT3G56140 DUF399 family protein, putative (DUF399 and DUF3411);(source:Araport11)
AT3G56150 member of eIF3c - eukaryotic initiation factor 3c
AT3G56180 LURP-one-like protein (DUF567);(source:Araport11)
AT3G56220 transcription regulator;(source:Araport11)
AT3G56230 BTB/POZ domain-containing protein;(source:Araport11)
AT3G56275 pseudogene of expressed protein;(source:Araport11)
AT3G56277 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.6e-16 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10)
AT3G56280 pseudogene of Protein kinase superfamily protein;(source:Araport11)
AT3G56320 PAP/OAS1 substrate-binding domain superfamily;(source:Araport11)
AT3G56350 Iron/manganese superoxide dismutase family protein;(source:Araport11)
AT3G56360 hypothetical protein;(source:Araport11)
AT3G56380 response regulator 17
AT3G56410 hypothetical protein (DUF3133);(source:Araport11)
AT3G56440 yeast autophagy 18 D-like protein;(source:Araport11)
AT3G56520 NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11)
AT3G56530 NAC domain containing protein 64;(source:Araport11)
AT3G56580 Encodes a functional E3 ubiquitin ligase involved in the dehydration stress response and regulation of proline biosynthesis.
AT3G56600 phosphatidylinositol 4-kinase gamma-like protein;(source:Araport11)
AT3G56640 Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion.
AT3G56690 encodes a protein similar to ATPases and binds to calmodulin in vitro. This is a single-copy gene and is expressed in all tissues examined.
AT3G56700 Encodes a fatty-acyl-CoA reductase that is expressed in response to wounding.
AT3G56705 U2-6;(source:Araport11)
AT3G56710 Sig1 binding protein; interacts with Sig1R4. As well as Sig1, SibI is imported into chloroplasts and its expression is light-dependent in mature chloroplasts.
AT3G56740 ATI3A interacting protein containing a large N-terminal rhomboid-like transmembrane domain and a UBA domain at their C terminus, localized in the ER with an important role in plant heat tolerance. UBAC2 proteins may act as both cargo receptors and inducers of an ATI3-mediated selective autophagy pathway, where ATI3 and UBAC2 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner.
AT3G56760 Protein kinase superfamily protein;(source:Araport11)
AT3G56770 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT3G56790 RNA splicing factor-like protein;(source:Araport11)
AT3G56800 encodes a calmodulin
AT3G56930 Protein S-acyl transferase 4 (PAT4). Mutants display defects in root hair elongation. Along with SCN1 , it may be involved in targeting of ROP2 to the plasma membrane.
AT3G56940 Encodes a putative ZIP protein with varying mRNA accumulation in leaves, stems and roots. Has a consensus carboxylate-bridged di-iron binding site. The mRNA is cell-to-cell mobile.
AT3G56970 Encodes a member of the basic helix-loop-helix transcription factor family protein.
AT3G56980 Encodes a member of the basic helix-loop-helix transcription factor protein.
AT3G57000 nucleolar essential protein-like protein;(source:Araport11)
AT3G57010 Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11)
AT3G57020 Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11)
AT3G57040 response regulator ARR9, A two-component response regulator-like protein with a receiver domain with a conserved aspartate residue and a possible phosphorylation site and at the N-terminal half. Appears to interact with histidine kinase like genes ATHP3 and ATHP2
AT3G57090 Encodes a protein with similarity to yeast FIS proteins. These membrane anchored proteins bind DRP proteins and function during organelle division. FIS1B is expressed ubiquitously and appears to be involved in peroxisome division.
AT3G57100 transmembrane protein, putative (DUF677);(source:Araport11)
AT3G57130 Encodes BOP1. Contains Pfam domain, PF00023: Ankyrin repeat and Pfam domain, PF00651: BTB/POZ domain. Lines carrying recessive mutations exhibit a number of visible defects, most pronounced being ectopic outgrowths of in leaf petioles of rosette leaves. Along with BOP2, BOP1 is required for nectary development and formation of normal abscission zones.Forms homodimers and heterodimers with BOP2. Nuclear localization is required for activity which includes positive regulation of AS2 in leaves. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP1 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP1 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP1 expression is restricted to pedicel axils by BP and PNY. BOP1 promotes KNAT6 (At1g23380) expression.BOP1 Interacts with BIL1/BZR1 and Inhibits BIL1/BZR1 transport into the nucleus.
AT3G57157 Has been identified as a translated small open reading frame by ribosome profiling.
AT3G57160 cysteine-rich TM module stress tolerance protein;(source:Araport11)
AT3G57210 hypothetical protein;(source:Araport11)
AT3G57240 encodes a member of glycosyl hydrolase family 17
AT3G57250 Emsy N Terminus (ENT) domain-containing protein;(source:Araport11)
AT3G57260 beta 1,3-glucanase
AT3G57290 Encodes a protein that is found in not only the eif3 complex but also in association with subunits of the COP9 signalosome. eIF3e appears to be subjected to proteasome-dependent degradation that requires the PCI domain of eIF3e. The level of eIF3e present in cells appears to affect the rate of translation.
AT3G57340 DnaJ heat shock amino-terminal domain protein (DUF1977);(source:Araport11)
AT3G57380 Glycosyltransferase family 61 protein;(source:Araport11)
AT3G57400 transmembrane protein;(source:Araport11)
AT3G57410 Encodes a protein with high homology to animal villin. VLN3 is a Ca2+-regulated villin involved in actin filament bundling.
AT3G57460 catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding protein;(source:Araport11)
AT3G57510 Encodes ADPG1, a polygalacturonase protein involved in silique and anther dihiscence. Loss of function mutations have reduced seed set, indehiscent fruit and reduced pollen shedding. Required for release of cell wall-derived PR elicitors.
AT3G57540 Remorin family protein;(source:Araport11)
AT3G57550 guanylate kinase
AT3G57580 F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G57620 Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification.
AT3G57640 Protein kinase superfamily protein;(source:Araport11)
AT3G57650 Encodes an endoplasmic reticulum localized protein with lysophosphatidyl acyltransferase activity.
AT3G57680 C-terminal peptidase
AT3G57790 Pectin lyase-like superfamily protein;(source:Araport11)
AT3G57800 Together with bHLH48 associates with phytochrome interacting factor 7 to regulate hypocotyl elongation.
AT3G57840 Plant self-incompatibility protein S1 family;(source:Araport11)
AT3G57870 Encodes a SUMO ligase that directs the attachment of the small protein SUMO to target proteins via an isopeptide bond. This enzyme is localized to the nucleus and plants with reduced levels of this protein show higher sensitivity to ABA in root growth inhibition assays. It has high similarity to the yeast UBC9 SUMO ligase and is sometimes referred to by that name.
AT3G57910 D111/G-patch domain-containing protein;(source:Araport11)
AT3G57920 Encodes a putative transcriptional regulator that is involved in the vegetative to reproductive phase transition. Expression is regulated by MIR156b.
AT3G57930 rho GTPase-activating gacO-like protein;(source:Araport11)
AT3G57950 cotton fiber protein;(source:Araport11)
AT3G57970 Emsy N Terminus (ENT)/ plant Tudor-like domains-containing protein;(source:Araport11)
AT3G58020 Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT3G58040 Encodes a RING finger domain containing protein that interacts with AtRAP2.2. The mRNA is cell-to-cell mobile.
AT3G58060 TP8 is a tonoplast localized member of CDF family of cation transporters. It functions in roots as an Mn transporter.MTP8 transports manganese into root vacuoles of iron-deficient plants and thereby prevents inhibition of iron deficiency-induced ferric chelate reductase by manganese. In seed embryos, MTP8 is responsible for manganese and iron enrichment in the subepidermal cell layer (particularly in vit1 mutant background.)
AT3G58070 Putative transcription factor, contains C2H2 domain, regulates aspects of shoot maturation in Arabidopsis thaliana. GIS loss-of-function mutations affect the epidermal differentiation of inflorescence organs, causing a premature decrease in trichome production on successive leaves, stem internodes, and branches. Overexpression has the opposite effect on trichome initiation and causes other heterochronic phenotypes, affecting flowering and juvenile?adult leaf transition and inducing the formation of rosette leaves on inflorescence stems.
AT3G58140 phenylalanyl-tRNA synthetase class IIc family protein;(source:Araport11)
AT3G58210 TRAF-like family protein;(source:Araport11)
AT3G58230 Ubiquitin-specific protease family C19-related protein;(source:Araport11)
AT3G58240 TRAF-like superfamily protein;(source:Araport11)
AT3G58250 TRAF-like family protein;(source:Araport11)
AT3G58270 phospholipase-like protein (PEARLI 4) with TRAF-like domain protein;(source:Araport11)
AT3G58290 TRAF-like superfamily protein;(source:Araport11)
AT3G58300 phospholipase-like protein (PEARLI 4) family protein;(source:Araport11)
AT3G58310 cysteine-rich repeat secretory protein, putative (DUF26);(source:Araport11)
AT3G58330 phospholipase-like protein (PEARLI 4) family protein;(source:Araport11)
AT3G58347 Pseudogene of AT3G58330
AT3G58350 Encodes RTM3 (Restricted Tobacco etch potyvirus Movement), a protein belonging to a protein family of 29 members which has a meprin and TRAF homology (MATH) domain in its N-terminal region and a coiled-coil (CC) domain at its C-terminal end. There are at least three RTMs in Arabidopsis. RTM proteins might form a multiprotein complex in the resistance mechanism to block the long distance movement of potyviruses.
AT3G58360 TRAF-like family protein;(source:Araport11)
AT3G58380 TRAF-like family protein;(source:Araport11)
AT3G58390 Represses the RNA the non-stop decay (NSD) and no-go decay (NGD) quality control systems that act during translation. Impairs NSD likely by sequestering the HBS1 components of the NSD complex.
AT3G58400 TRAF-like family protein;(source:Araport11)
AT3G58410 TRAF-like family protein;(source:Araport11)
AT3G58420 TRAF-like superfamily protein;(source:Araport11)
AT3G58430 MATH domain/coiled-coil protein;(source:Araport11)
AT3G58440 TRAF-like superfamily protein;(source:Araport11)
AT3G58450 USP domain containing protein, member of the universal stress protein family, regulated by ABA and possibly regulated by the ABA-dependent transcription factor AREB/ABF. Involved in the regulation of seed germination.
AT3G58490 Encodes a long-chain base 1-phosphate (LCBP) phosphatase that is expressed in the endoplasmic reticulum.
AT3G58620 Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis.
AT3G58720 RING/U-box superfamily protein;(source:Araport11)
AT3G58730 Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes.
AT3G58740 Encodes a peroxisomal citrate synthase that is expressed in siliques and developing seeds.
AT3G58780 One of two genes (SHP1 and SHP2) that are required for fruit dehiscence. The two genes control dehiscence zone differentiation and promote the lignification of adjacent cells.
AT3G58820 F-box/RNI-like superfamily protein;(source:Araport11)
AT3G58830 Encodes a phosphatidylglycerophosphate (PGP) phosphatase that localizes to chloroplasts in above ground plant parts and mitochondria in root tips and root hairs and is involved in the synthesis of plastidial Phosphatidylglycerol (PG). This enzyme is responsible for the second step of PG synthesis. Mutants show reduced root growth.
AT3G58860 F-box/RNI-like superfamily protein;(source:Araport11)
AT3G58877 hypothetical protein;(source:Araport11)
AT3G58920 F-box/RNI-like superfamily protein;(source:Araport11)
AT3G58950 F-box/RNI-like superfamily protein;(source:Araport11)
AT3G59000 F-box/RNI-like superfamily protein;(source:Araport11)
AT3G59010 Encodes PME35, a pectin methylesterase. PME35-mediated demethylesterification of the primary cell wall regulates the mechanical strength of the supporting tissue.
AT3G59030 Encodes a proton antiporter. Involved in the transportation of proanthocyanidin precursors into the vacuole. In vitro transport experiments showed that cyanidin-3-O-glucoside (anthocyanin) was an effective substrate, whereas the proanthocyanidin precursor epicatechin was not transported. However catechin-3-O-glucoside inhibited anthocyanin transport in a dose-dependent manner suggesting that glycosylated epicatechin is the in vivo substrate. Recessive mutation has strong reduction of proanthocyanidin deposition in vacuoles and has reduced dormancy. Expressed in the endothelium of ovules and developing seeds.
AT3G59060 Encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. Involved in shade avoidance. Functions as negative regulator of PhyB. Protein levels are modulated by phytochrome B. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner.
AT3G59068 Natural antisense transcript overlaps with AT3G59070;(source:Araport11)
AT3G59070 Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11)
AT3G59080 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT3G59100 encodes a protein similar to callose synthase
AT3G59110 Protein kinase superfamily protein;(source:Araport11)
AT3G59140 member of MRP subfamily
AT3G59150 F-box/RNI superfamily protein;(source:Araport11)
AT3G59160 F-box/RNI-like superfamily protein;(source:Araport11)
AT3G59170 F-box/RNI-like superfamily protein;(source:Araport11)
AT3G59200 F-box/RNI-like superfamily protein;(source:Araport11)
AT3G59220 encodes a cupin-domain containing protein that is similar to pirins which interact with a CCAAT box binding transcription factor. The protein interacts with GPA1 (G protein alpha-subunit) in vitro. Mutants in the gene are affected in germination and early seedling development.
AT3G59230 RNI-like superfamily protein;(source:Araport11)
AT3G59250 F-box/RNI-like superfamily protein;(source:Araport11)
AT3G59260 pirin;(source:Araport11)
AT3G59270 FBD-like domain family protein;(source:Araport11)
AT3G59280 Encodes the ortholog of yeast PAM16, part of the mitochondrial inner membrane protein import motor. Single mutant plants exhibit a smaller size and enhanced resistance against virulent pathogens. They also display elevated reactive oxygen species (ROS) accumulation.
AT3G59310 solute carrier family 35 protein (DUF914);(source:Araport11)
AT3G59330 solute carrier family 35 protein (DUF914);(source:Araport11)
AT3G59340 solute carrier family 35 protein (DUF914);(source:Araport11)
AT3G59350 Pti-like protein. Interacts with CLV1 and functions in CLE peptide signaling pathway in root development. Membrane localization is dependent on palmytolation.
AT3G59440 Encodes an endomembrane localized member of the CML subfamily VII. Contains a canonical CaM domain and unique N-terminal extension that distinguishes it from other members of the subfamily.
AT3G59450 Calcium-binding EF-hand family protein;(source:Araport11)
AT3G59460 F-box/LRR protein;(source:Araport11)
AT3G59480 Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens).
AT3G59500 Integral membrane HRF1 family protein;(source:Araport11)
AT3G59510 Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT3G59540 Ribosomal L38e protein family;(source:Araport11)
AT3G59570 Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11)
AT3G59580 Plant regulator RWP-RK family protein;(source:Araport11)
AT3G59590 jacalin lectin family protein;(source:Araport11)
AT3G59640 Plasma membrane localized. glycine rich protein of unknown function. Involved in non host resistance.
AT3G59690 Member of IQ67 (CaM binding) domain containing family.
AT3G59700 Member of Receptor kinase-like protein family. Represses stomatal immunity induced by Pseudomonas syringae pv. tomato DC3000.
AT3G59710 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT3G59730 Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT3G59765 None;(source:Araport11)
AT3G59800 stress response protein;(source:Araport11)
AT3G59820 LETM1-like protein;(source:Araport11)
AT3G59840 allyl alcohol dehydrogenase-like protein;(source:Araport11)
AT3G59870 hypothetical protein;(source:Araport11)
AT3G59910 Ankyrin repeat family protein;(source:Araport11)
AT3G59920 RAB GDP DISSOCIATION INHIBITOR 2 The mRNA is cell-to-cell mobile.
AT3G59990 Encodes a MAP2 like methionine aminopeptidase
AT3G60020 SKP1-like 5;(source:Araport11)
AT3G60030 squamosa promoter-binding protein-like 12;(source:Araport11)
AT3G60060 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT3G60070 Major facilitator superfamily protein;(source:Araport11)
AT3G60100 citrate synthase 5;(source:Araport11)
AT3G60110 DNA-binding bromodomain-containing protein;(source:Araport11)
AT3G60130 beta glucosidase 16;(source:Araport11)
AT3G60180 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT3G60190 At3g60190 encodes Arabidopsis dynamin-related protein 1E, DRP1E, also known as EDR3, ADL4 and ADL1E, which is 624 amino acid residues long, has a predicted mass of 69.8 kDa and a pI of 7.5. Dynamin-related protein 1E belongs to a plant-specific subclass of dynamin-related proteins (DRP1), consisting of five members in Arabidopsis (A, B, C, D, E). This class is characterized by having an N-terminal GTPase domain, a central `dynamin 2` domain and a C-terminal GTPase effector domain (GED), a typical structure for plant dynamin-related proteins. However, this class lacks a PH domain and a proline-rich domain, which are found in classical animal dynamin-like proteins. Based on work on animal dynamins, the plant DRP1 proteins should be able to form polymeric structures that wrap around membranes to facilitate membrane tubulation and pinching off of vesicles, processes that are essential to vesicle trafficking and membrane compartmentalization. The edr3 mutation causes a P77L substitution in the G2 motif of the GTPase domain of DRP1E. edr3 mutant Arabidopsis plants display enhanced cell death in response to powdery mildew infection.
AT3G60210 GroES-like family protein;(source:Araport11)
AT3G60238 other_RNA;(source:Araport11)
AT3G60270 Cupredoxin superfamily protein;(source:Araport11)
AT3G60280 Encodes blue copper-binding protein III.
AT3G60328 This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT3G60330 H[+]-ATPase 7;(source:Araport11)
AT3G60360 embryo sac development arrest 14;(source:Araport11)
AT3G60380 cotton fiber protein;(source:Araport11)
AT3G60400 Mitochondrial transcription termination factor family protein;(source:Araport11)
AT3G60410 hypothetical protein (DUF1639);(source:Araport11)
AT3G60470 transmembrane protein, putative (DUF247);(source:Araport11)
AT3G60490 encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.
AT3G60500 Encodes a 3'-5' exoribonuclease, positively regulates CER3 transcription, involved in cuticular wax biosynthesis.
AT3G60510 ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11)
AT3G60530 Encodes a member of the GATA factor family of zinc finger transcription factors.
AT3G60560 hypothetical protein;(source:Araport11)
AT3G60580 C2H2-like zinc finger protein;(source:Araport11)
AT3G60590 cytochrome P450 family protein;(source:Araport11)
AT3G60600 Encodes VAP27 (for Vesicle-Associated Protein). VAP27 has high homology to the VAP33 family of SNARE-like proteins from animals. May be involved in vesicular transport to or from the ER. Located exclusively in limiting membrane of protein storage vacuoles. Binds SRC2.
AT3G60610 pseudogene of pre-mRNA processing ribonucleoprotein binding region-containing protein;(source:Araport11)
AT3G60620 cytidinediphosphate diacylglycerol synthase 5;(source:Araport11)
AT3G60630 Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization.
AT3G60710 F-box family protein.
AT3G60740 Encodes tubulin-folding cofactor D. Mutants arrest during embryogenesis with embryos that are small, mushroom-shaped ('pilz') and consist of only one or few large cells each containing one or more variably enlarged nuclei and often cell wall stubs. Gene product necessary for continuous microtubule organization.
AT3G60760 hypothetical protein;(source:Araport11)
AT3G60780 hypothetical protein (DUF1442);(source:Araport11)
AT3G60790 F-box family protein;(source:Araport11)
AT3G60870 Encodes an AT hook domain containing protein that, when overexpressed, delays flowering. Los s of function mutations have defects in primary and lateral root development.
AT3G60961 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT3G60972 other_RNA;(source:Araport11)
AT3G60990 glycosyltransferase family protein (DUF23);(source:Araport11)
AT3G61035 Cytochrome P450 superfamily protein;(source:Araport11)
AT3G61060 phloem protein 2-A13;(source:Araport11)
AT3G61111 Zinc-binding ribosomal protein family protein;(source:Araport11)
AT3G61150 Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family.
AT3G61170 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT3G61190 Encodes a protein with a C2 domain that binds to BON1 in yeast two hybrid analyses. Its ability to bind to phospholipids is enhanced by calcium ions. Involved in maintaining cell homeostasis.
AT3G61220 CytADR/SDR1 is an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. It can also act on menthone and neomenthol in vitro, but these do not represent likely endogenous activities of this enzyme in planta. GFP-tagged CytADR appears to localize to the cytosol where it likely plays a role in detoxifying reactive carbonyls. sdr1 mutants have altered responses to pathogens. The mRNA is cell-to-cell mobile.
AT3G61250 LATE MERISTEM IDENTITY2 (LMI2) is a target of the meristem identity regulator LEAFY (LFY). Has a role in the meristem identity transition from vegetative growth to flowering. Member of the R2R3 factor gene family.
AT3G61280 O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11)
AT3G61290 O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11)
AT3G61300 C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11)
AT3G61310 AT hook motif DNA-binding family protein;(source:Araport11)
AT3G61360 Encodes SLO3 (SLOW GROWTH3), a pentatricopeptide repeat protein required for the splicing of mitochondrial NADH dehydrogenase subunit7 intron 2. Mutants have smaller RAMs are slower growing than wild type.
AT3G61390 Plant U-box type E3 ubiquitin ligase (PUB).
AT3G61400 1-aminocyclopropane-1-carboxylate oxidase-like protein
AT3G61415 SKP1-like 21;(source:Araport11)
AT3G61430 a member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development. The mRNA is cell-to-cell mobile.
AT3G61450 syntaxin of plants 73 (SYP73)
AT3G61460 Encodes a novel ring finger protein and forms an N-terminal hydrophobic domain and a C-terminal RING-H2 signature. Expression is down regulated by brassinolide.
AT3G61490 Pectin lyase-like superfamily protein;(source:Araport11)
AT3G61500 BPS1-like protein;(source:Araport11)
AT3G61560 Reticulon family protein;(source:Araport11)
AT3G61580 Fatty acid/sphingolipid desaturase;(source:Araport11)
AT3G61590 F-box protein that is involved in some aspect of regulation of gene silencing by miRNA. Loss of function mutations have increased levels of some miRNAs. Its activity depends on the presence of functional F-box.
AT3G61610 Galactose mutarotase-like superfamily protein;(source:Araport11)
AT3G61620 exonuclease RRP41 (RRP41)
AT3G61630 CRF6 encodes one of the six cytokinin response factors. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves.
AT3G61640 arabinogalactan protein 20;(source:Araport11)
AT3G61680 PLIP1 encodes a plastid localized phospholipase A1 involved in seed oil biosynthesis.
AT3G61690 Putative TNAase
AT3G61710 Encodes autophagy protein 6 (ATG6), required for pollen germination and plant development.
AT3G61720 Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11)
AT3G61755 pre-tRNA tRNA-Ala (anticodon: CGC);(source:Araport11, TAIR10)
AT3G61790 SINAT E3 ubiquitin ligase involved in mediation of FREE1 and VPS23A degradation to modulate abscisic acid signaling.
AT3G61825 pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10)
AT3G61830 auxin response factor 18;(source:Araport11)
AT3G61840 auxin response factor, putative (DUF688);(source:Araport11)
AT3G61860 encodes an arginine/serine-rich splicing factor. transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926.
AT3G61880 Encodes a cytochrome p450 monooxygenase. Overexpression of this gene allows fruit growth independently of fertilization. The gene is normally expressed only in floral organs(during the Arabidopsis stage 14 flower) and in the funiculus at anthesis.
AT3G61890 Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Loss of function mutant has abnormally shaped leaves and stems.
AT3G61898 transmembrane protein;(source:Araport11)
AT3G61900 SAUR-like auxin-responsive protein family;(source:Araport11)
AT3G61930 hypothetical protein;(source:Araport11)
AT3G61940 Member of Zinc transporter (ZAT) family. Expressed in roots under low zinc conditions.
AT3G61950 MYC-type transcription factor which interacts with ICE1 and negatively regulates cold-responsive genes and cold tolerance.
AT3G61960 autophagy gene
AT3G62010 metal ion-binding protein;(source:Araport11)
AT3G62020 germin-like protein (GLP10)
AT3G62040 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT3G62050 Putative endonuclease or glycosyl hydrolase;(source:Araport11)
AT3G62070 hypothetical protein;(source:Araport11)
AT3G62090 encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family.
AT3G62100 Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA30 lacks the conserved degron (domain II) found in many family members. IAA30 transcripts are induced by auxin treatment and accumulate preferentially in the quiescent center cells of the root meristem. Overexpression of IAA30 leads to defects in gravitropism, root development, root meristem maintenance, and cotyledon vascular development. Target of LEC2 and AGL15. Promotes somatyic embryogenesis.
AT3G62150 Encodes a facultative transporter controlling auxin concentrations in plant cells.
AT3G62170 VANGUARD-like protein;(source:Araport11)
AT3G62190 Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT3G62200 Putative endonuclease or glycosyl hydrolase;(source:Araport11)
AT3G62230 Target promoter of the male germline-specific transcription factor DUO1. Increases seed oil content by attenuating GL2 inhibition. Overexpression results in reduced trichome numbers.
AT3G62270 BOR2 is involved in efficient borate crosslinking of rhamnogalacturonan II in cell walls under boron limitation.
AT3G62280 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT3G62300 Encodes a protein with Agenet/Tudor and DUF724 domains. It can interact with ABAP1, a negative regulator of DNA replication and transcription, with the plant histone modification 'reader' LHP1, and with non-modified histones. It may act as a link between DNA replication, transcription and chromatin remodeling during flower development. Loss of function mutant has a WT phenotype.
AT3G62370 heme binding protein;(source:Araport11)
AT3G62380 F-box/associated interaction domain protein;(source:Araport11)
AT3G62420 Encodes a group-S bZIP transcription factor. Forms heterodimers with group-C bZIP transcription factors. The heterodimers bind to the ACTCAT cis-element of proline dehydrogenase gene.
AT3G62529 pseudogene of pentatricopeptide (PPR) repeat-containing protein
AT3G62570 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT3G62620 Encodes a protein of unknown function. Previously this protein has been annotated computationally as a sucrose-phosphatase-related protein. However, the source of this annotation can not be verified. This annotation (sucrose-phosphatase-related) has been removed.
AT3G62630 stress response NST1-like protein (DUF1645);(source:Araport11)
AT3G62650 hypothetical protein;(source:Araport11)
AT3G62660 Encodes a protein with putative galacturonosyltransferase activity.
AT3G62670 member of Response Regulator: B- Type
AT3G62690 Encodes a RING-H2 zinc finger protein related to ATL2. The ATL gene family is represented by fifteen sequences that contain, in addition to the RING, a transmembrane domain which is located in most of them towards the N-terminal end.
AT3G62700 member of MRP subfamily
AT3G62730 desiccation-like protein;(source:Araport11)
AT3G62740 beta glucosidase 7;(source:Araport11)
AT3G62770 Required for autophagosome formation during nutrient deprivation and senescence, promotes pexophagy during seedling development.
AT3G62790 NADH-ubiquinone oxidoreductase-like protein;(source:Araport11)
AT3G62830 Encodes a Golgi localized isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes.
AT3G62850 zinc finger protein-like protein;(source:Araport11)
AT3G62890 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT3G62980 Encodes an auxin receptor that mediates auxin-regulated transcription. It contains leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation. Mutations in TIR1 block auxin stimulation of flavonoid synthesis.
AT3G63003 pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10)
AT3G63010 Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. The mRNA is cell-to-cell mobile.
AT3G63050 hypothetical protein;(source:Araport11)
AT3G63210 encodes a novel zinc-finger protein with a proline-rich N-terminus, identical to senescence-associated protein SAG102
AT3G63290 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT3G63320 Protein phosphatase 2C family protein;(source:Araport11)
AT3G63360 Encodes a defensin-like (DEFL) family protein.
AT3G63430 zinc finger CCCH domain protein;(source:Araport11)
AT3G63510 FMN-linked oxidoreductases superfamily protein;(source:Araport11)
AT3G63540 Conceptual translation of this open reading frame gave the sequence of a 229-residue hypothetical protein that contains the same sequence as the mature A. thaliana chloroplast luminal 19-kDa protein linked to a putative signal sequence.
AT3G66654 Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11)
AT4G00110 Encodes a putative membrane-anchored UDP-D-glucuronate 4-epimerase.
AT4G00140 Calcium-binding EF-hand family protein;(source:Araport11)
AT4G00160 F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT4G00200 AT hook motif DNA-binding family protein;(source:Araport11)
AT4G00210 LOB domain-containing protein 31;(source:Araport11)
AT4G00220 Encodes a protein containing a LOB domain that is expressed in embryos, flower primordium and lateral floral organ boundaries. Overexpression is correlated with activation of STM and KNAT1 and down regulation of PIN1 and reduced auxin transport levels. Ectopic expression in plants results in premature termination of the shoot apical meristem and small, lobed leaves. A maternally expressed imprinted gene.
AT4G00230 xylem serine peptidase 1;(source:Araport11)
AT4G00236 pseudogene of Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11)
AT4G00240 member of C2-PLD subfamily
AT4G00260 Transcriptional factor B3 family protein;(source:Araport11)
AT4G00290 Encodes a non-selective mechanosensitive ion channel localized to the inner mitochondrial membrane.
AT4G00300 AT4G00300 has been split into two loci based on new cDNA evidence provided by Aleksander Riise Hansen of University of Copenhagen: AT4G00300.2 becomes AT4G00300.1; a new locus AT4G00295 is created. See comments field for AT4G00295 annotation.
AT4G00305 RING/U-box superfamily protein;(source:Araport11)
AT4G00330 high overall homology to CRCK1
AT4G00335 RING-H2 finger B1A;(source:Araport11)
AT4G00342 hypothetical protein;(source:Araport11)
AT4G00360 Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems.
AT4G00390 DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11)
AT4G00400 bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly and is functionally redundant with GPAT4.
AT4G00416 Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins.
AT4G00440 GPI-anchored adhesin-like protein, putative (DUF3741);(source:Araport11)
AT4G00460 Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily.
AT4G00467 Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT4G00480 MYC-related protein with a basic helix-loop-helix motif at the C-terminus and a region similar to the maize B/R family at the N-terminus
AT4G00500 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT4G00530 UvrABC system protein A;(source:Araport11)
AT4G00560 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT4G00600 Amino acid dehydrogenase family protein;(source:Araport11)
AT4G00610 DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11)
AT4G00660 RNAhelicase-like 8;(source:Araport11)
AT4G00690 UB-like protease 1B;(source:Araport11)
AT4G00700 C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11)
AT4G00750 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT4G00752 UBX domain-containing protein;(source:Araport11)
AT4G00780 TRAF-like family protein;(source:Araport11)
AT4G00820 Member of IQ67 (CaM binding) domain containing family.
AT4G00840 DHHC-type zinc finger family protein;(source:Araport11)
AT4G00872 Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT4G00893 F-box/kelch-repeat protein;(source:Araport11)
AT4G00900 Type IIA (SERCA-type) Ca2+ ATPase, catalyzes the efflux of calcium from the cytoplasm.
AT4G00920 COP1-interacting protein-like protein;(source:Araport11)
AT4G00930 Encodes COP1-interacting protein CIP4.1.
AT4G00970 Encodes a cysteine-rich receptor-like protein kinase.
AT4G00975 Natural antisense transcript overlaps with AT4G00980;(source:Araport11)
AT4G00990 jJumonji-domain-containing H3K9 histone demethylase. Loss of function mutants are susceptible to bacterial infection and early flowering.
AT4G01000 Ubiquitin-like superfamily protein;(source:Araport11)
AT4G01010 member of Cyclic nucleotide gated channel family
AT4G01020 helicase domain-containing protein / IBR domain-containing protein / zinc finger protein-like protein;(source:Araport11)
AT4G01023 RING/U-box superfamily protein;(source:Araport11)
AT4G01030 pentatricopeptide (PPR) repeat-containing protein;(source:Araport11)
AT4G01070 the glycosyltransferase (UGT72B1) is involved in metabolizing xenobiotica (chloroaniline and chlorophenole). Comparison between wild type and knock-out mutant demonstrates the central role of this gene for metabolizing chloroaniline but significantly less for chlorophenole. The glucosyltransferase preferred UDP-xylose over UDP-glucose indicating its (additional) functioning as a xylosyltransferase in planta
AT4G01080 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT4G01090 Hypothetical protein; participates in wound-induced lateral root development.
AT4G01110 late embryogenesis abundant hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT4G01130 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT4G01150 Integral thylakoid membrane protein required for proper grana stack curvature.
AT4G01220 Encodes MGP4 (MALE GAMETOPHYTE DEFECTIVE 4), a rhamnogalacturonan II xylosyltransferase important for growth of pollen tubes and roots.
AT4G01230 Reticulon family protein. Mutants are resistant to agrobacterium infection.
AT4G01245 hypothetical protein;(source:Araport11)
AT4G01260 DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11)
AT4G01290 Protein with evolutionarily conserved eIF4E-binding motif in its N-terminal domain that can form mRNA cap?binding complexes and has the potential for regulating gene expression as a translation factor associated plant-specific cell cycle regulator.
AT4G01350 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT4G01360 Encodes a protein related to BYPASS1 (BPS1). Regulates production of mobile compound: bps signal.
AT4G01380 plastocyanin-like domain-containing protein;(source:Araport11)
AT4G01410 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11)
AT4G01430 Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed.
AT4G01440 nodulin MtN21-like transporter family protein
AT4G01450 nodulin MtN21-like transporter family protein
AT4G01455 tRNA-Glu (anticodon: TTC)
AT4G01470 Encodes AtTIP1;3, functions as water and urea channels in pollen.
AT4G01480 Encodes a protein that might have inorganic pyrophosphatase activity.
AT4G01490 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.4e-44 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10)
AT4G01500 AP2/B3-like transcriptional factor family protein;(source:Araport11)
AT4G01510 Arv1-like protein;(source:Araport11)
AT4G01515 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.1e-18 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10)
AT4G01520 NAC domain containing protein 67;(source:Araport11)
AT4G01550 Encodes a plasma-membrane bound NAC transcription factor, whose controlled proteolytic activation allows it to enter the nucleus.
AT4G01630 member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio)
AT4G01735 polyhomeotic-like protein;(source:Araport11)
AT4G01760 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT4G01810 Sec23 homolog , forms a distinct clade with SEC23D.Mutants have defects in pollen exine patterning, tapetal development and pollen intine formation.
AT4G01820 member of MDR subfamily
AT4G01830 P-glycoprotein 5;(source:Araport11)
AT4G01895 systemic acquired resistance (SAR) regulator protein NIMIN-1-like protein;(source:Araport11)
AT4G01960 transmembrane protein;(source:Araport11)
AT4G01970 Encodes a a raffinose and high affinity stachyose synthase as well as a stachyose and Gol specific galactosylhydrolase enzyme activity.AtRS4 is a sequential multifunctional RafS and StaS as well as a high affinity StaS, accepting only Raf and Gol for Sta product formation. AtRS4 possesses a Sta and Gol specific galactosylhydrolase enzyme activity.
AT4G02005 None;(source:Araport11)
AT4G02010 Protein kinase superfamily protein;(source:Araport11)
AT4G02030 Vps51/Vps67 family (components of vesicular transport) protein;(source:Araport11)
AT4G02075 RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11)
AT4G02090 PADRE protein.
AT4G02100 Heat shock protein DnaJ with tetratricopeptide repeat-containing protein;(source:Araport11)
AT4G02160 cotton fiber protein;(source:Araport11)
AT4G02170 cotton fiber protein;(source:Araport11)
AT4G02195 Encodes a member of SYP4 Gene Family that is a plant ortholog of the Tlg2/syntaxin16 Qa-SNARE. Together with SYP43, it regulates the secretory and vacuolar transport pathways in the post-Golgi network and maintains the morphology of the Golgi apparatus and TGN and is required for extracellular resistance responses to a fungal pathogen.
AT4G02210 Myb/SANT-like DNA-binding domain protein;(source:Araport11)
AT4G02235 AGAMOUS-like 51;(source:Araport11)
AT4G02250 Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT4G02270 root hair specific 13;(source:Araport11)
AT4G02290 glycosyl hydrolase 9B13;(source:Araport11)
AT4G02320 Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT4G02380 Encodes AtLEA5 (late embryogenesis abundant like protein). Also known as SENESCENCE-ASSOCIATED GENE 21 (SAG21). Has a role on oxidative stress tolerance. mRNA levels are elevated in response to various stresses.
AT4G02450 Encodes one of two isoforms of a co-chaperone of HSP90 that is required for root growth, in particular in the maintenance of the root meristem.
AT4G02465 hypothetical protein;(source:Araport11)
AT4G02480 AAA-type ATPase family protein;(source:Araport11)
AT4G02510 An integral membrane GTPase that functions as a transit-sequence receptor required for the import of proteins necessary for chloroplast biogenesis. Located in the outer chloroplast membrane. Phosphorylation of the G-domains regulate translocon assembly. The mRNA is cell-to-cell mobile.
AT4G02555 snoRNA;(source:Araport11)
AT4G02650 Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane.
AT4G02670 indeterminate(ID)-domain 12;(source:Araport11)
AT4G02710 Kinase interacting (KIP1-like) family protein;(source:Araport11)
AT4G02733 F-box family protein;(source:Araport11)
AT4G02740 F-box/RNI-like superfamily protein;(source:Araport11)
AT4G02780 Catalyzes the conversion of geranylgeranyl pyrophosphate (GGPP) to copalyl pyrophosphate (CPP) of gibberellin biosynthesis
AT4G02790 Encodes a GTPase that is targeted to chloroplasts and co-fractionated with chloroplast ribosomes. Mutants are embryo lethal due to this essential function being lost.
AT4G02810 A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines.
AT4G02830 hypothetical protein;(source:Araport11)
AT4G02850 DAAR1 encodes a PLP-independent racemase that catalyzes the conversion from L-Ile to D-allo-Ile.
AT4G02860 Phenazine biosynthesis PhzC/PhzF protein;(source:Araport11)
AT4G02870 B3 domain protein;(source:Araport11)
AT4G02880 ELKS/Rab6-interacting/CAST family protein;(source:Araport11)
AT4G02950 Ubiquitin family protein;(source:Araport11)
AT4G02980 Auxin binding protein involved in cell elongation and cell division. ABP1 is ubiquitinated in vitro and in planta by AtRma2. ABP1 was thought to be embryo lethal but further experimentation has demonstrated that lethality is due to a linked mutation in another gene.
AT4G03010 RNI-like superfamily protein;(source:Araport11)
AT4G03050 The transcribed allele in ecotype Ler encodes a 2-oxoglutarate-dependent dioxygenase which is involved in glucosinolate biosynthesis. AOP3 is transcriptionally silent in leaf tissues of ecotype Col.The natural variation in this locus explains the diversification of hydroxyalkyl glucosinolates among different ecotypes of Arabidopsis.
AT4G03110 Encodes a putative RNA-binding protein that is located in the cytoplasm and is involved in the hypersensitive response and positively regulates salicylic acid-mediated immunity.
AT4G03115 Mitochondrial substrate carrier family protein;(source:Araport11)
AT4G03190 Encodes an F box protein belonging to the TIR1 subfamily. This protein forms SCF complexes with ASK1 and CUL1 and interacts with Aux/IAA proteins in an auxin-dependent manner. It also has sequence similarity to the yeast protein GRR1, which is involved in glucose repression.
AT4G03200 catalytics;(source:Araport11)
AT4G03205 Coproporphyrinogen III oxidase;(source:Araport11)
AT4G03210 Encodes a member of xyloglucan endotransglucosylase/hydrolases (XTHs) that catalyze the cleavage and molecular grafting of xyloglucan chains function in loosening and rearrangement of the cell wall. Gene is expressed in shoot apex region, flower buds, flower stalks and internodes bearing flowers.
AT4G03220 Protein with RNI-like/FBD-like domain;(source:Araport11)
AT4G03250 Homeodomain-like superfamily protein;(source:Araport11)
AT4G03270 Cyclin D6, involved in cortex/endodermis asymmetric stem cell division.
AT4G03280 Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. The mRNA is cell-to-cell mobile.
AT4G03285 pre-tRNA tRNA-Thr (anticodon: TGT);(source:Araport11, TAIR10)
AT4G03290 EF hand calcium-binding protein family;(source:Araport11)
AT4G03320 Encodes a component of the TIC (translocon at the inner envelope membrane of chloroplasts) protein translocation machinery mediating the protein translocation across the inner envelope of plastids. The Arabidopsis genome encodes four Tic20 homologous proteins, AT1G04940(Tic20-I), AT2G47840(Tic20-II), AT4G03320(Tic20-IV) and AT5G55710(Tic20-V).
AT4G03340 Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11)
AT4G03364 Pseudogene of AT4G05230; ubiquitin family protein
AT4G03370 Ubiquitin family protein;(source:Araport11)
AT4G03380 hypothetical protein;(source:Araport11)
AT4G03420 hypothetical protein (DUF789);(source:Araport11)
AT4G03450 Ankyrin repeat family protein;(source:Araport11)
AT4G03470 Ankyrin repeat family protein;(source:Araport11)
AT4G03505 hypothetical protein;(source:Araport11)
AT4G03510 RMA1 encodes a novel 28 kDa protein with a RING finger motif and a C-terminal membrane-anchoring domain that is involved in the secretory pathway. Has E3 ubiquitin ligase activity.
AT4G03550 Encodes a callose synthase that is required for wound and papillary callose formation in response to fungal pathogens Erysiphe and Blumeria. Mutants are resistant to P. parasitica and exhibit an exaggerated PR1 response.Contributes to PAMP-induced basal defense. The mRNA is cell-to-cell mobile.
AT4G03565 Cystatin/monellin superfamily protein;(source:Araport11)
AT4G03580 hypothetical protein;(source:Araport11)
AT4G03590 Cystatin/monellin superfamily protein;(source:Araport11)
AT4G03610 Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11)
AT4G03620 myosin heavy chain-like protein;(source:Araport11)
AT4G03630 RNI-like superfamily protein;(source:Araport11)
AT4G03730 transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.3e-102 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10)
AT4G03816 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.6e-22 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10)
AT4G03873 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 8.5e-06 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10)
AT4G03876 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT4G03930 Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT4G04020 Fibrillin precursor protein. The fibrillin preprotein, but not the mature protein interacts with ABI2. Regulated by abscisic acid response regulators. Involved in abscisic acid-mediated photoprotection. The mRNA is cell-to-cell mobile.
AT4G04030 transcription repressor;(source:Araport11)
AT4G04040 Encodes a pyrophosphate-dependent phosphofructokinase B subunit (PFPbeta2).
AT4G04100 transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.6e-16 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT4G04170 transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.3e-87 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT4G04220 receptor like protein 46;(source:Araport11)
AT4G04255 transposable_element_gene;(source:Araport11);pseudogene, similar to unnamed protein product, blastp match of 37%25 identity and 5.0e-30 P-value to GP|6815097|dbj|BAA90383.1||AP001081 unnamed protein product {Oryza sativa (japonica cultivar-group)};(source:TAIR10)
AT4G04260 Bromo-adjacent homology (BAH) domain-containing protein;(source:Araport11)
AT4G04316 transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 9.6e-40 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10)
AT4G04360 transmembrane protein, putative (DUF1068);(source:Araport11)
AT4G04380 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.5e-248 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT4G04404 C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11)
AT4G04405 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.6e-50 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10)
AT4G04410 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-176 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10)
AT4G04423 hypothetical protein;(source:Araport11)
AT4G04460 Saposin-like aspartyl protease family protein;(source:Araport11)
AT4G04480 F-box protein with a domain protein;(source:Araport11)
AT4G04490 Encodes a cysteine-rich receptor-like protein kinase.
AT4G04500 Encodes a cysteine-rich receptor-like protein kinase.
AT4G04510 Encodes a cysteine-rich receptor-like protein kinase.
AT4G04547 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-68 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT4G04620 Autophagy protein.
AT4G04635 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43722.1);(source:TAIR10)
AT4G04690 F-box and associated interaction domains-containing protein;(source:Araport11)
AT4G04693 pseudogene of F-box family protein;(source:Araport11)
AT4G04695 member of Calcium Dependent Protein Kinase. Involved in response to salicylic acid.
AT4G04750 Putative mitochondrial F1F0-ATPase.
AT4G04780 Encodes the med21 subunit of the mediator complex which is involved in transcriptional regulation. MED21 interacts physically with the E3 ligase HUB1 and this interaction may be important in mediation defense responses to fungal pathogens.
AT4G04830 methionine sulfoxide reductase B5;(source:Araport11)
AT4G04850 Encodes a potassium efflux antiporter; has three splice forms KEA3.1, KEA3.2, and KEA3.3, KEA3.2 is the most abundant splice form in all plant organs (silique, flower, leaf and root). KEA3.1 and KEA3.3 are minor variants that can be found in flowers and in leaves. KEA3 is localized to the thylakoid membrane and enriched in the stromal lamellae. It allows proton efflux from the thylakoid lumen by proton/potassium antiport.
AT4G04885 Encodes PCFS4 (Pcf11p-similar protein 4), a homolog of yeast polyadenylation factor Protein 1 of Cleavage Factor (Pcf11p). Regulates FCA (AT4G16280) mRNA polyadenylation. Promotes flowering time.
AT4G04890 Encodes a homeodomain protein that is expressed in the LI layer of the vegetative, floral and inflorescence meristems. Binds to the L1 box promoter element which is required in some proteins for L1 specific expression.
AT4G04900 encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Most similar to RIC9 and RIC11 (subfamily group I). Gene is expressed predominantly in roots, leaves, and seedlings.
AT4G04930 Encodes a sphingolipid delta4-desaturase, involved in sphingolipid biosynthesis. Specifically expressed in floral tissues. Knockout mutants were devoid of sphinga-4,8-dienine in floral tissues.
AT4G04940 transducin family protein / WD-40 repeat family protein;(source:Araport11)
AT4G04950 Encodes a monothiol glutaredoxin that is a critical component involved in ROS accumulation, auxin signaling, and temperature-dependent postembryonic growth in plants. It has been shown to associate with the cytosolic Fe-S assembly (CIA) complex and contributes to, but is not essential for, the correct functioning of client Fe-S proteins in unchallenged conditions.
AT4G04957 RRM in demeter (DUF1985);(source:Araport11)
AT4G04960 Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT4G04972 hypothetical protein;(source:Araport11)
AT4G04980 hypothetical protein;(source:Araport11)
AT4G05000 Vacuolar protein sorting-associated protein VPS28 family protein;(source:Araport11)
AT4G05010 F-box family protein;(source:Araport11)
AT4G05020 Miitochondrial alternative NADH dehydrogenase.
AT4G05048 Encodes a C/D box snoRNA (U49.1). Gb: AJ300655
AT4G05071 This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT4G05100 Member of the R2R3 factor gene family.
AT4G05105 Encodes a microRNA that targets several Laccase family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCAUUGAGUGCAGCGUUGAUG
AT4G05110 equilibrative nucleoside transporter 6;(source:Araport11)
AT4G05120 Encodes an equilibrative nucleoside transporter AtENT3. Mutations of this locus allow mutants to grow on uridine analogue fluorouridine.
AT4G05145 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10)
AT4G05160 Encodes a peroxisomal protein involved in the activation of fatty acids through esterification with CoA. At4g05160 preferentially activates fatty acids with medium chain length (C6:0 and C7:0) as well as even-numbered long-chain fatty acids (C14:0, C16:0 and C18:0). At4g05160 was also able to catalyze the conversion of OPC-6:0 to its CoA ester and is therefore thought to be involved in the peroxisomal β-oxidation steps of jasmonic acid biosynthesis.
AT4G05170 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT4G05180 Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II.
AT4G05200 Encodes a cysteine-rich receptor-like protein kinase.
AT4G05220 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11)
AT4G05240 Ubiquitin-like superfamily protein;(source:Araport11)
AT4G05260 Ubiquitin-like superfamily protein;(source:Araport11)
AT4G05310 Ubiquitin-like superfamily protein;(source:Araport11)
AT4G05320 One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. The mRNA is cell-to-cell mobile.
AT4G05330 A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.
AT4G05340 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT4G05360 Zinc knuckle (CCHC-type) family protein;(source:Araport11)
AT4G05380 P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11)
AT4G05430 Carbohydrate-binding X8 domain superfamily protein;(source:Araport11)
AT4G05440 Plays a role in pollen development and modulating DNA replication via interaction with MCM4 and MCM7 of the pre-replication complex.
AT4G05460 Encodes a SKP1/ASK-Interacting protein.
AT4G05475 RNI-like superfamily protein;(source:Araport11)
AT4G05497 RNI-like superfamily protein;(source:Araport11)
AT4G05508 Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:ATGAGTTGGGTCTAACCCATAACT
AT4G05510 transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 4.0e-144 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10)
AT4G05530 Encodes a peroxisomal member of the short-chain dehydrogenase/reductase (SDR) family of enzymes. Loss of IBR1 function causes increased resistance to indole-3-butyric acid without affecting plant responses to IAA, NAA, and 2,4-D. This enzyme may be responsible for catalyzing a dehydrogenation step in the beta-oxidation-like conversion of IBA to IAA. The mRNA is cell-to-cell mobile.
AT4G05540 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT4G05590 Encodes NRGA1, a putative mitochondrial pyruvate carrier that mediates ABA regulation of guard cell ion channels and drought stress responses.
AT4G06479 nucleic acid binding / zinc ion binding protein;(source:Araport11)
AT4G06491 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.4e-214 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10)
AT4G06494 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains Pfam domain PF03778: Protein of unknown function (DUF321);(source:TAIR10)
AT4G06496 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT4G06497 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.0e-48 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10)
AT4G06529 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.7e-246 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10)
AT4G06530 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT4G06533 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT4G06537 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.5e-20 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT4G06548 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.5e-39 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT4G06557 transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 6.5e-16 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10)
AT4G06571 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT4G06594 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.1e-215 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10)
AT4G06617 transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 6.2e-37 P-value blast match to At5g59620.1/14-257 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT4G06635 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT4G06646 transposable_element_gene;(source:Araport11);pseudogene, similar to OJ1081_B12.13, blastp match of 33%25 identity and 9.8e-51 P-value to GP|27817864|dbj|BAC55632.1||AP003865 OJ1081_B12.13 {Oryza sativa (japonica cultivar-group)};(source:TAIR10)
AT4G06648 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.0e-181 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT4G06654 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.2e-88 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10)
AT4G06658 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-182 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10)
AT4G06678 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT4G06700 transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.7e-54 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10)
AT4G06701 other_RNA;(source:Araport11)
AT4G06702 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT4G06708 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.9e-289 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT4G06710 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT4G06718 transposable_element_gene;(source:Araport11);pseudogene, expressed protein;(source:TAIR10)
AT4G07031 transposable_element_gene;(source:Araport11);similar to cytochrome P-450 aromatase-related [Arabidopsis thaliana] (TAIR:AT2G05870.1);(source:TAIR10)
AT4G07454 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.2e-139 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10)
AT4G07510 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42110.1);(source:TAIR10)
AT4G07526 hypothetical protein;(source:Araport11)
AT4G07662 transposable_element_gene;(source:Araport11);pseudogene, helicase -related, similar to putative helicase;(source:TAIR10)
AT4G07720 pseudogene of myosin heavy chain-like protein;(source:Araport11)
AT4G07730 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 6.8e-198 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT4G07740 hypothetical protein (DUF3287);(source:Araport11)
AT4G07770 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.7e-12 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10)
AT4G07803 transposable_element_gene;(source:Araport11);pseudogene, helicase -related, similar to putative helicase;(source:TAIR10)
AT4G07810 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.1e-230 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT4G07820 CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11)
AT4G07915 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-15 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10)
AT4G07932 hypothetical protein;(source:Araport11)
AT4G07945 transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, similar to reverse transcriptase, putative;(source:TAIR10)
AT4G07950 DNA-directed RNA polymerase, subunit M, archaeal;(source:Araport11)
AT4G07960 encodes a XyG glucan synthase; gene similar to cellulose synthase
AT4G07990 Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT4G08025 ECA1 gametogenesis family protein (DUF784);(source:Araport11)
AT4G08032 transposable_element_gene;(source:Araport11);pseudogene, similar to putative transposable element, similar to transposase, putative;(source:TAIR10)
AT4G08033 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT4G08038 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to reverse transcriptase, putative;(source:TAIR10)
AT4G08039 Encodes a defensin-like (DEFL) family protein.
AT4G08040 encodes an aminotransferase that belongs to ACC synthase gene family structurally
AT4G08053 transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 3.4e-89 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10)
AT4G08056 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30843.1);(source:TAIR10)
AT4G08078 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 4.6e-276 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT4G08090 transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.4e-12 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT4G08108 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT4G08135 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.2e-10 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT4G08136 pseudogene of purple acid phosphatase 10;(source:Araport11)
AT4G08150 A member of class I knotted1-like homeobox gene family (together with KNAT2). Similar to the knotted1 (kn1) homeobox gene of maize. Normally expressed in the peripheral and rib zone of shoot apical meristem but not in the leaf primordia. It is also expressed in the fourth floral whorl, in the region that would become style, particularly in the cell surrounding the transmitting tissue. No expression was detected in the first three floral whorls. Expression is repressed by auxin and AS1 which results in the promotion of leaf fate.
AT4G08160 Encodes a putative glycosyl hydrolase family 10 protein (xylanase).
AT4G08190 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT4G08230 glycine-rich protein;(source:Araport11)
AT4G08262 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.5e-30 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10)
AT4G08300 nodulin MtN21-like transporter family protein
AT4G08310 DNA ligase;(source:Araport11)
AT4G08330 hypothetical protein;(source:Araport11)
AT4G08360 KOW domain-containing protein;(source:Araport11)
AT4G08380 Proline-rich extensin-like family protein;(source:Araport11)
AT4G08410 Proline-rich extensin-like family protein;(source:Araport11)
AT4G08450 Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT4G08500 Encodes a member of the A1 subgroup of the MEKK (MAPK/ERK kinase kinase) family. MEKK is another name for Mitogen-Activated Protein Kinase Kinase Kinase (MAPKKK or MAP3K). This subgroup has four members: At4g08500 (MEKK1, also known as ARAKIN, MAP3Kb1, MAPKKK8), At4g08480 (MEKK2, also known as MAP3Kb4, MAPKKK9), At4g08470 (MEKK3, also known as MAP3Kb3, MAPKKK10) and At4g12020 (MEKK4, also known as MAP3Kb5, MAPKKK11, WRKY19). Nomenclatures for mitogen-activated protein kinases are described in Trends in Plant Science 2002, 7(7):301. Mediates cold, salt, cadmium and wounding stress signalling. Phosphorylates MEK1.
AT4G08530 Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15.
AT4G08540 One of a pair of paralogs (the other is AT1G77890)that is a subunit of the lass III phosphatidylinositol 3-kinase (PI3K) complex,but is not essential for PI3P biosynthesis.
AT4G08555 hypothetical protein;(source:Araport11)
AT4G08560 Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts.
AT4G08570 Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT4G08596 transposable_element_gene;(source:Araport11);pseudogene, FAR1 -related protein, temporary automated functional assignment;(source:TAIR10)
AT4G08630 fas-binding factor-like protein;(source:Araport11)
AT4G08640 ATP binding protein;(source:Araport11)
AT4G08657 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT4G08670 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT4G08730 RNA-binding protein;(source:Araport11)
AT4G08740 hypothetical protein;(source:Araport11)
AT4G08750 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G08760.1);(source:TAIR10)
AT4G08770 Encodes a putative apoplastic peroxidase Prx37. Primarily expressed in the vascular bundles. Overexpression renders a dwarf phenotype with smaller plants and delayed development. Plants overexpressing Prx37 also shows an increase in the amount of esterified phenolic material associated with their walls.
AT4G08790 NIT1 amidase involved in the breakdown of deaminated glutathione (dGSH). It is active towards dGSH and dOA with a preference for dGSH.
AT4G08840 Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts.
AT4G08876 pyrophosphate-fructose-6-phosphate 1-phosphotransferase-related / pyrophosphate-dependent 6-phosphofructose-1-kinase-like protein;(source:Araport11)
AT4G08910 homeobox protein;(source:Araport11)
AT4G08920 Encodes CRY1, a flavin-type blue-light photoreceptor with ATP binding and autophosphorylation activity. Functions in perception of blue / green ratio of light. The photoreceptor may be involved in electron transport. Mutant phenotype displays a blue light-dependent inhibition of hypocotyl elongation. Photoreceptor activity requires light-induced homodimerisation of the N-terminal CNT1 domains of CRY1. Involved in blue-light induced stomatal opening. The C-terminal domain of the protein undergoes a light dependent conformational change. Also involved in response to circadian rhythm. Mutants exhibit long hypocotyl under blue light and are out of phase in their response to circadian rhythm. CRY1 is present in the nucleus and cytoplasm. Different subcellular pools of CRY1 have different functions during photomorphogenesis of Arabidopsis seedlings. The mRNA is cell-to-cell mobile.
AT4G08930 Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. The mRNA is cell-to-cell mobile.
AT4G08945 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.2e-16 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10)
AT4G08980 Encodes an F-box gene that is a novel negative regulator of AGO1 protein levels and may play a role in ABA signalling and/or response. It is a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins.
AT4G09070 TATA-binding related factor (TRF) of subunit 20 of Mediator complex;(source:Araport11)
AT4G09090 Carbohydrate-binding X8 domain superfamily protein;(source:Araport11)
AT4G09100 RING/U-box superfamily protein;(source:Araport11)
AT4G09120 RING/U-box superfamily protein;(source:Araport11)
AT4G09130 RING/U-box superfamily protein;(source:Araport11)
AT4G09180 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT4G09190 F-box and associated interaction domains-containing protein;(source:Araport11)
AT4G09300 LisH and RanBPM domains containing protein;(source:Araport11)
AT4G09316 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.3e-116 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10)
AT4G09340 SPla/RYanodine receptor (SPRY) domain-containing protein;(source:Araport11)
AT4G09350 Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT4G09360 NB-ARC domain-containing disease resistance protein;(source:Araport11)
AT4G09410 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.4e-40 P-value blast match to Q9SI25 /181-349 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT4G09430 disease resistance protein (TIR-NBS-LRR class);(source:Araport11)
AT4G09450 Duplicated homeodomain-like superfamily protein;(source:Araport11)
AT4G09452 Pseudogene of AT2G38590; F-box family protein
AT4G09460 Encodes myb6 DNA-binding protein. The mRNA is cell-to-cell mobile.
AT4G09530 SAUR-like auxin-responsive protein family;(source:Araport11)
AT4G09540 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-43 P-value blast match to GB:AAC64917 gag-pol polyprotein (Ty1_Copia-element) (Glycine max);(source:TAIR10)
AT4G09545 Encodes a ECA1 gametogenesis related family protein
AT4G09550 Encodes a gamma-tubulin complex protein that plays a role in gamma-tubulin complex localization, spindle stability and chromosomal segregation.
AT4G09610 GAST1 protein homolog 2;(source:Araport11)
AT4G09630 transmembrane protein (DUF616);(source:Araport11)
AT4G09690 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT4G09730 Encodes RH39, a DEAD-box protein involved in the introduction of the hidden break into the 23S rRNA in the chloroplasts. Recombinant RH39 binds to the 23S rRNA in a segment adjacent to the stem-loop creating the hidden break target loop in a sequence-dependent manner. Has ATP-hydrolyzing activity at a Kcat of 5.3 /min in the presence of rRNA sequence. Mutants have drastically reduced level of level of ribulose 1,5-bisphosphate carboxylase/oxygenase. The mRNA is cell-to-cell mobile.
AT4G09740 glycosyl hydrolase 9B14;(source:Araport11)
AT4G09840 hypothetical protein;(source:Araport11)
AT4G09860 hypothetical protein;(source:Araport11)
AT4G09870 F-box and associated interaction domains-containing protein;(source:Araport11)
AT4G09900 Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro.
AT4G09920 FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11)
AT4G09940 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT4G09950 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT4G09965 hypothetical protein;(source:Araport11)
AT4G09987 Encodes a defensin-like (DEFL) family protein.
AT4G09990 glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11)
AT4G10000 Thioredoxin family protein;(source:Araport11)
AT4G10010 Protein kinase superfamily protein;(source:Araport11)
AT4G10020 Encodes a putative hydroxysteroid dehydrogenase (HSD). Genes that encode HSD include: At5g50600 and At5g50700 (HSD1), At3g47350(HSD2), At3g47360(HSD3), At5g50590 and At5g50690(HSD4), At5g50770(HSD6) (Plant Cell Physiology 50:1463). Two copies of HSD1 and HSD4 exist due to a gene duplication event. In Plant Physiology 145:87, At5g50690 is HSD7, At4g10020 is HSD5.
AT4G10050 esterase/lipase/thioesterase family protein;(source:Araport11)
AT4G10060 Glucosylceramidase that preferentially hydrolyzes long acyl chain glucosylceramides.
AT4G10090 elongator protein 6;(source:Araport11)
AT4G10115 Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein).
AT4G10140 transmembrane protein;(source:Araport11)
AT4G10150 RING/U-box superfamily protein;(source:Araport11)
AT4G10160 RING/U-box superfamily protein;(source:Araport11)
AT4G10190 F-box and associated interaction domains-containing protein;(source:Araport11)
AT4G10200 TTF-type zinc finger protein with HAT dimerization domain-containing protein;(source:Araport11)
AT4G10201 Pseudogene of AT3G21130; F-box family protein-related
AT4G10290 RmlC-like cupins superfamily protein;(source:Araport11)
AT4G10300 RmlC-like cupins superfamily protein. Overexpression leads to trehalose resistance, drought and stress tolerance.
AT4G10310 encodes a sodium transporter (HKT1) expressed in xylem parenchyma cells. Mutants over-accumulate sodium in shoot tissue and have increased sodium in the xylem sap and reduced sodium in phloem sap and roots.
AT4G10320 tRNA synthetase class I (I, L, M and V) family protein;(source:Araport11)
AT4G10350 NAC domain protein. SMB, BRN1, and BRN2 act to regulate root cap maturation, in a partially redundant fashion.BRN1 and BRN2, control the cell wall maturation processes that are required to detach root cap layers from the root.
AT4G10360 TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11)
AT4G10380 Boric acid channel. Essential for efficient boron uptake and plant development under boron limitation. Also functions in arsenite transport and tolerance. Localized preferentially in outer membrane domains of root cells.
AT4G10390 Protein kinase superfamily protein;(source:Araport11)
AT4G10430 TMPIT-like protein;(source:Araport11)
AT4G10440 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT4G10470 hypothetical protein;(source:Araport11)
AT4G10480 Nascent polypeptide-associated complex (NAC), alpha subunit family protein;(source:Araport11)
AT4G10490 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT4G10500 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT4G10507 other_RNA;(source:Araport11)
AT4G10510 Subtilase family protein;(source:Araport11)
AT4G10520 Subtilase family protein;(source:Araport11)
AT4G10540 Proteolytic enzyme of that phytaspase family which at pH 5.5 is strictly Asp-specific. Strongly preferred cleavage motifs are YVAD and IETD.
AT4G10595 Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT4G10610 RNA-binding protein, putative. Member of a family of proteins having an PABC binding domain (PAM motif).
AT4G10650 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT4G10660 CDC68-like protein;(source:Araport11)
AT4G10670 Homologous to yeast SPT16, a general chromatin factor required for transcription
AT4G10695 CDC68-like protein;(source:Araport11)
AT4G10770 oligopeptide transporter
AT4G10780 LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11)
AT4G10820 F-box family protein;(source:Araport11)
AT4G10840 CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules.
AT4G10860 hypothetical protein;(source:Araport11)
AT4G10925 Nuclear transport factor 2 (NTF2) family protein;(source:Araport11)
AT4G11040 Encodes a nuclear localized protein with sequence similarity to PP2C phosphatases that is involved in seed dormancy. Loss of function mutations have reduced seed dormancy but does not act through ABA or DOG1 pathways. Lacks several conserved key residues and does not possess any appreciable phosphatase activity in in vitro assays. QTL allele with a nonsynonymous amino acid change confers seed dormancy phenotype.
AT4G11050 glycosyl hydrolase 9C3;(source:Araport11)
AT4G11080 Encodes a protein containing three copies of the HMG (high mobility group)-box domain. The two Arabidopsis 3xHMG-box proteins are: AT4G11080 (3xHMG-box1) and AT4G23800 (3xHMG-box2). Interacts with mitotic and meiotic chromosomes.
AT4G11140 Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin.
AT4G11170 Encodes RMG1 (Resistance Methylated Gene 1), a NB-LRR disease resistance protein with a Toll/interleukin-1 receptor (TIR) domain at its N terminus. RMG1 is expressed at high levels in response to flg22 and in naive met1/nrpd2 relative to wild-type plants. Expression of this gene is controlled by DNA methylation in its promoter region. The RMG1 promoter region is constitutively demethylated by active DNA demethylation mediated by the DNA glycosylase ROS1.
AT4G11175 Nucleic acid-binding, OB-fold-like protein;(source:Araport11)
AT4G11200 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30370.1);(source:TAIR10)
AT4G11250 AGAMOUS-like 52;(source:Araport11)
AT4G11300 ROH1, putative (DUF793);(source:Araport11)
AT4G11330 MAP kinase
AT4G11393 Encodes a defensin-like (DEFL) family protein.
AT4G11400 ARID/BRIGHT DNA-binding , ELM2 domain and myb-like DNA-binding domain-containing protein;(source:Araport11)
AT4G11405 pre-tRNA tRNA-Thr (anticodon: TGT);(source:Araport11, TAIR10)
AT4G11410 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT4G11420 Encodes a subunit of eukaryotic initiation factor 3 (eIF3), a multisubunit complex that is required for binding of mRNA to 40 S ribosomal subunits, stabilization of ternary complex binding to 40 S subunits, and dissociation of 40 and 60 S subunits.
AT4G11440 Mitochondrial substrate carrier family protein;(source:Araport11)
AT4G11450 bromo-adjacent domain protein, putative (DUF3527);(source:Araport11)
AT4G11460 Encodes a cysteine-rich receptor-like protein kinase.
AT4G11470 Encodes a cysteine-rich receptor-like protein kinase.
AT4G11480 Encodes a cysteine-rich receptor-like protein kinase.
AT4G11485 Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT4G11540 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT4G11570 Encodes plastid localized protein involved in riboflavin biosynthesis. It dephosphorylates 5-amino-6-ribitylamino- 2,4(1H,3H) pyrimidinedione 5′-phosphate (ARPP) .
AT4G11580 RNI-like superfamily protein;(source:Araport11)
AT4G11610 C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11)
AT4G11630 Ribosomal protein L19 family protein;(source:Araport11)
AT4G11660 member of Heat Stress Transcription Factor (Hsf) family
AT4G11690 Encodes ABO8, a pentatricopeptide repeat (PPR) protein responsible for the splicing of NAD4 intron 3 in mitochondrial complex I. Abo8 mutants accumulate more reactive oxygen species (ROS) in root tips than the wild type.
AT4G11700 hypothetical protein (DUF626);(source:Araport11)
AT4G11720 Encodes HAP2 with the following predicted motifs: an N-terminal secretion signal, a single transmembrane domain and a C-terminal histidine-rich domain. HAP2 is expressed only in the haploid sperm and is required for pollen tube guidance and fertilization. Predominantly localized to sperm endoplasmic reticulum membranes. May also reside in other endomembranes, including the plasma membrane. Target promoter of the male germline-specific transcription factor DUO1.
AT4G11730 Cation transporter/ E1-E2 ATPase family protein;(source:Araport11)
AT4G11740 Isolated as a suppressor of a dominant mutant in the Ara4 gene that was expressed in yeast ypt1 mutant strains. A novel protein with a small region of similarity to coil-coiled domain of yeast VSP27 protein.
AT4G11745 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT4G11800 Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11)
AT4G11810 Encodes an SPX domain protein that transports Pi into the vacuole. Overexpression of PHT5:2 leads to massive Pi sequestration into vacuoles and altered regulation of Pi starvation-responsive genes.
AT4G11820 Encodes a protein with hydroxymethylglutaryl-CoA synthase activity which was characterized by phenotypical complementation of the S. cerevisiae mutant. Involved in glucosinolate biosynthesis.
AT4G11840 member of C2-PLD subfamily
AT4G11890 Encodes a receptor-like cytosolic kinase ARCK1. Negatively controls abscisic acid and osmotic stress signal transduction.
AT4G11910 Acts antagonistically with SGR1 to balance chlorophyll catabolism in chloroplasts with the dismantling and remobilizing of other cellular components in senescing leaf cells.
AT4G11930 hypothetical protein;(source:Araport11)
AT4G11950 transmembrane protein, putative (DUF1191);(source:Araport11)
AT4G11990 TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of aurora kinase activity.
AT4G12030 Required for the biosynthesis of methionine-derived glucosinolates. Involved in the transport of 2-keto acids between chloroplasts and the cytosol.
AT4G12040 A20/AN1-like zinc finger family protein;(source:Araport11)
AT4G12050 Putative AT-hook DNA-binding family protein;(source:Araport11)
AT4G12065 pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10)
AT4G12080 AT-hook motif nuclear-localized protein 1;(source:Araport11)
AT4G12090 Cornichon family protein;(source:Araport11)
AT4G12100 Cullin family protein;(source:Araport11)
AT4G12110 Encodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha-methyl oxidase. Works together with SMO1-2 to maintain correct sterol composition and balance auxin and cytokinin activities during embryogenesis.
AT4G12115 pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10)
AT4G12120 member of KEULE Gene Family
AT4G12160 pseudogene of Ribosomal protein S4;(source:Araport11)
AT4G12180 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.2e-28 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10)
AT4G12200 transposable_element_gene;(source:Araport11);similar to polyprotein [Oryza sativa] (GB:BAB03249.1);(source:TAIR10)
AT4G12220 hypothetical protein;(source:Araport11)
AT4G12270 Copper amine oxidase family protein;(source:Araport11)
AT4G12320 member of CYP706A
AT4G12334 Cytochrome P450 superfamily protein;(source:Araport11)
AT4G12350 Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation.
AT4G12370 F-box/kelch-repeat protein;(source:Araport11)
AT4G12420 Encodes a protein of unknown function involved in directed root tip growth. It is a member of 19-member gene family and is distantly related structurally to the multiple-copper oxidases ascorbate oxidase and laccase, though it lacks the copper-binding domains. The protein is glycosylated and GPI-anchored. It is localized to the plasma membrane and the cell wall. The gene is expressed most strongly in expanding tissues.
AT4G12423 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.8e-26 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10)
AT4G12430 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT4G12440 adenine phosphoribosyl transferase 4;(source:Araport11)
AT4G12450 zinc finger (C2H2 type) family protein;(source:Araport11)
AT4G12460 OSBP(oxysterol binding protein)-related protein 2B;(source:Araport11)
AT4G12470 Encodes AZI1 (AZELAIC ACID INDUCED 1). Involved in the priming of salicylic acid induction and systemic immunity triggered by pathogen or azelaic acid. Targeting if AZI1 to chloroplasts is increased during SAR induction and that localization requires the PRR domain.It is involved in the uptake and movement of the azelaic acid signal. AZI1 uses a previously undescribed variant of the signal anchor proteins mechanism to target plastids. AZI1 uses a bipartite N-terminal signature: a non-cleavable TMD that anchors the protein to membranes, followed by a proline rich region with features that are shared with bona fide chloroplastic transit peptides. flg22 MAMP treatment strongly induces AZI1/EARLI1 protein levels and increases their relative enrichment in the plastid fraction.
AT4G12520 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT4G12570 Knock-out mutants showed accelerated senescence of leaves. The mRNA is cell-to-cell mobile.
AT4G12617 B3 domain protein;(source:Araport11)
AT4G12670 Homeodomain-like superfamily protein;(source:Araport11)
AT4G12690 DUF868 family protein (DUF868);(source:Araport11)
AT4G12730 AF333971 Arabidopsis thaliana fasciclin-like arabinogalactan-protein 2 (Fla2) mRNA, complete cds. Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development.
AT4G12731 hypothetical protein;(source:Araport11)
AT4G12735 Encodes a peroxisomal protein.
AT4G12740 HhH-GPD base excision DNA repair family protein;(source:Araport11)
AT4G12760 RPA-interacting protein A;(source:Araport11)
AT4G12790 GPN GTPase involved in selective nuclear import of RNA polymerase II.
AT4G12810 KIB1 contains an F-box domain at the N-terminal region and three kelch repeats at the C-terminal region. It is expressed ubiquitously and accumulates in the nucleolus and to a lesser extent in the cytoplasm.
AT4G12825 Encodes a Protease inhibitor/seed storage/LTP family protein
AT4G12870 Gamma interferon responsive lysosomal thiol (GILT) reductase family protein;(source:Araport11)
AT4G12910 serine carboxypeptidase-like 20;(source:Araport11)
AT4G12980 Activated by OXS2 under the treatment of salt.
AT4G12990 transmembrane protein;(source:Araport11)
AT4G13050 Acyl-ACP thioesterase;(source:Araport11)
AT4G13100 RING/U-box superfamily protein;(source:Araport11)
AT4G13120 transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.6e-50 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10)
AT4G13180 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT4G13195 Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini. The C-terminal 12 amino acid sequence of CLE44 is identical to that of a dodeca peptide (TDIF, tracheary element differentiation inhibitory factor) isolated from Arabidopsis and functions as a suppressor of plant stem cell differentiation. TDIF sequence is also identical to the C-terminal 12 amino acids of CLE41 (At3g24770). The protein is expressed in the vascular system and is involved in axillary bud formation.
AT4G13200 Plastoglobular protein which is involved in chloroplast function and thylakoid formation.
AT4G13215 pseudogene of transmembrane kinase-like 1;(source:Araport11)
AT4G13230 Late embryogenesis abundant protein (LEA) family protein;(source:Araport11)
AT4G13240 Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily.
AT4G13250 Encodes a chlorophyll b reductase involved in the degradation of chlorophyll b and LHCII (light harvesting complex II).
AT4G13260 Encodes YUC2. Catalyzes conversion of IPA (indole-3-pyruvic acid) to IAA (indole-3-acetic acid) in auxin biosynthesis pathway.
AT4G13262 pseudogene of Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein;(source:Araport11)
AT4G13265 pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10)
AT4G13310 putative cytochrome P450
AT4G13345 Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11)
AT4G13420 Encodes a protein of the KUP/HAK/KT potassium channel class that is upregulated in the roots by K levels.
AT4G13440 Calcium-binding EF-hand family protein;(source:Araport11)
AT4G13455 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-12 P-value blast match to GB:AAC24836 pol polyprotein (Ty1_Copia-element) (Candida albicans);(source:TAIR10)
AT4G13480 Member of the R2R3 factor gene family.
AT4G13490 RING/U-box superfamily protein;(source:Araport11)
AT4G13493 Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UAAGAUCCGGACUACAACAAAG
AT4G13494 Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGAGAGCAACAAGACAUAAU
AT4G13505 Natural antisense transcript overlaps with AT4G13510;(source:Araport11)
AT4G13510 Encodes a plasma membrane localized ammonium transporter. Contains a cytosolic trans-activation domain essential for ammonium uptake. The mRNA is cell-to-cell mobile.
AT4G13540 ADR is a peroxisome localized, myristoylated protein. It is expressed in flowers and plays a role in suppressing ROS accumulation in anthers. Overexpression results in reduced ROS, lower levels of NST1 and NST2 and, consequently alterations in lignification of the anther endothecium resulting in male sterility.
AT4G13572 hypothetical protein;(source:Araport11)
AT4G13590 Chloroplast manganese transporter required for chloroplast manganese homeostasis and photosynthetic function.
AT4G13600 Carbohydrate-binding X8 domain superfamily protein;(source:Araport11)
AT4G13615 Uncharacterized protein family SERF;(source:Araport11)
AT4G13620 encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. The mRNA is cell-to-cell mobile.
AT4G13670 plastid transcriptionally active 5;(source:Araport11)
AT4G13680 hypothetical protein (DUF295);(source:Araport11)
AT4G13710 Pectin lyase-like superfamily protein;(source:Araport11)
AT4G13750 Encodes NO VEIN (NOV), a plant-specific nuclear factor required for leaf vascular development, cellular patterning and stem cell maintenance in the root meristem, as well as for cotyledon outgrowth and separation. nov mutations affect many aspects of auxin-dependent development without directly affecting auxin perception.
AT4G13770 Encodes a cytochrome p450 enzyme that catalyzes the initial conversion of aldoximes to thiohydroximates in the synthesis of glucosinolates not derived from tryptophan. Also has a role in auxin homeostasis.
AT4G13790 SAUR-like auxin-responsive protein family;(source:Araport11)
AT4G13810 receptor like protein 47;(source:Araport11)
AT4G13820 Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT4G13830 DnaJ-like protein (J20); nuclear gene
AT4G13840 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT4G13860 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT4G13870 Encodes a protein with homology to the exonuclease domain of hWRN-p of human protein Werner Syndrome Exonuclease (WEX). Forms a complex with the heterodimeric factor Ku. The interaction with KU stimulates WEX exonuclease activity.
AT4G13880 receptor like protein 48;(source:Araport11)
AT4G13890 Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11)
AT4G13930 Encodes a serine hydroxymethyltransferase maximally expressed in root
AT4G13940 Encodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing. The mRNA is cell-to-cell mobile.
AT4G13965 F-box/FBD/LRR protein;(source:Araport11)
AT4G13980 member of Heat Stress Transcription Factor (Hsf) family
AT4G14010 Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide.
AT4G14060 Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11)
AT4G14080 Involved in the formation of the pollen wall. DYT1 and bHLH089 specifically recognize the TCATGTGC box to activate expression.
AT4G14090 The At4g14090 encodes a anthocyanidin 5-O-glucosyltransferase specifically glucosylating the 5-position of the flavonoid A-ring.
AT4G14100 transferases, transferring glycosyl groups;(source:Araport11)
AT4G14110 Represses photomorphogenesis and induces skotomorphogenesis in the dark. A component of the COP9 signalosome complex.
AT4G14147 actin-related protein 2/3 complex 34kDa subunit family / arp2/3 complex 34kDa subunit family
AT4G14149 Pseudogene of AT2G24480; zinc finger (C3HC4-type RING finger) family protein
AT4G14150 Microtubule motor kinesin PAKRP1/Kinesin-12A. Together with PAKRP1L/Kinesin-12B, serve as linkers of the plus ends of antiparallel microtubules in the phragmoplast.
AT4G14190 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT4G14200 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT4G14220 encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. RHF1a can interact with the cell cycle inhibitor ICK4/KRP6 in vitro. It apppears to target ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF1a is expressed in the carpels throughout floral development. It is expressed in various tissues of the anthers during the early stages of anther development but not in stage 12 flowers and beyond. The mRNA is cell-to-cell mobile.
AT4G14225 A20/AN1-like zinc finger family protein;(source:Araport11)
AT4G14226 This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT4G14230 CBS domain protein with a domain protein (DUF21);(source:Araport11)
AT4G14240 CBS domain protein with a domain protein (DUF21);(source:Araport11)
AT4G14250 This locus is annotated as a protein-coding gene in TAIR10. Based on communication with Jean-Luc GALLOIS (April 2013), this gene is split into two UBX domain-containing pseudogenes: one retains the original name: AT4G14250 (Chr4:8213237..8211984), one given a new locus identifier AT4G14245 (Chr4:8210231..8208985). Note that the Map Detail Image on the locus detial page and in GBrowse will not be updated until after the next genome release.
AT4G14280 ARM repeat superfamily protein;(source:Araport11)
AT4G14301 transmembrane protein;(source:Araport11)
AT4G14310 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT4G14365 hypothetical protein;(source:Araport11)
AT4G14368 Regulator of chromosome condensation (RCC1) family protein;(source:Araport11)
AT4G14370 Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT4G14380 cotton fiber protein;(source:Araport11)
AT4G14390 Ankyrin repeat family protein;(source:Araport11)
AT4G14420 HR-like lesion-inducing protein-like protein;(source:Araport11)
AT4G14455 Encodes a Bet1/Sft1-like SNARE protein, which can only partially suppresses the temperature-sensitive growth defect in sft1-1 yeast cells; however, it cannot support the deletion of the yeast BET1 gene (bet1Δ). In yeast, Bet1p is the v-SNARE (soluble N-ethylmaleimide-sensitive factor adaptor protein receptor, V-type) involved in trafficking between the ER and Golgi.
AT4G14460 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.2e-253 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT4G14480 Encodes a putative Ser/Thr protein kinase, BLUS1 (BLUE LIGHT SIGNALING1). BLUS1 functions as a phototropin substrate and primary regulator of stomatal control to enhance photosynthetic CO2 assimilation under natural light conditions.
AT4G14500 Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11)
AT4G14550 IAA14 is a member of the Aux/IAA protein family. Involved in lateral root development. Gain of function mutation decreases auxin-inducible gene expression. Protein is localized to the nucleus. Expressed in stele and root tip epidermis. Functions as a negative regulator of ARF7/19.
AT4G14560 auxin (indole-3-acetic acid) induced gene (IAA1) encoding a short-lived nuclear-localized transcriptional regulator protein. The mRNA is cell-to-cell mobile.
AT4G14580 CBL-interacting protein kinase
AT4G14610 Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167
AT4G14630 germin-like protein with N-terminal signal sequence that may target it to the vacuole, plasma membrane and/or outside the cell. The mRNA is cell-to-cell mobile.
AT4G14650 hypothetical protein;(source:Araport11)
AT4G14670 This locus was originally annotated as encoding ClpB2 (also referred to as Hsp92.7), which belongs to the Casein lytic proteinase/heat shock protein 100 (Clp/Hsp100) family. However, according to Lee et al. (2007, Plant Journal, 49:115-127), there is no evidence for expression of an appropriate-sized mRNA from this locus. Re-annotation of the genome indicates that this locus potentially encodes a 68.8-kDa protein, containing only the N-terminal two thirds of the originally predicted open reading frame. This locus contains a 626-bp deletion in WS ecotype compared with the Col ecotype, which eliminates residues 1-86 of the predicted protein.
AT4G14720 PPD2 (and its paralog, PPD1) encode plant-specific putative DNA-binding proteins. Deletion of the PPD locus increases leaf lamina size and results in dome-shaped rather than flat leaves. Siliques are also altered in shape because of extra lamina growth.
AT4G14723 Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis.
AT4G14730 Stress induced membrane protein. Mutants show enhanced cell death under stress.
AT4G14740 FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions.
AT4G14746 neurogenic locus notch-like protein;(source:Araport11)
AT4G14750 Member of IQ67 (CaM binding) domain containing family.
AT4G14760 kinase interacting (KIP1-like) family protein;(source:Araport11)
AT4G14770 Regulates fate transition and cell Divisions in the stomatal lineage.
AT4G14780 Protein kinase superfamily protein;(source:Araport11)
AT4G14785 Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein).
AT4G14790 encodes a nuclear-encoded DExH box RNA helicase, which is localized to mitochondria and whose in vitro ATPase activity is stimulated with mitochondrial RNA.
AT4G14815 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT4G14830 17.6 kDa class II heat shock protein;(source:Araport11)
AT4G14870 Encodes a component of the thylakoid-localized Sec system involved in the translocation of cytoplasmic proteins into plastid. The mRNA is cell-to-cell mobile.
AT4G14900 FRIGIDA-like protein;(source:Araport11)
AT4G14905 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT4G14940 atao1 gene of Arabidopsis thaliana encodes an extracellular copper amine oxidase expressed during early stages of vascular tissue development.
AT4G14970 Encodes a protein that is required for meiotic homologous recombination and acts in parallel to both MUTS HOMOLOG 4 (AtMSH4), known for its role in promoting interfering cross-overs (COs) and MMS AND UV SENSITIVE 81 (AtMUS81), known for its role in the formation of non-interfering COs.
AT4G15010 Mitochondrial substrate carrier family protein;(source:Araport11)
AT4G15040 Subtilisin-like serine endopeptidase family protein;(source:Araport11)
AT4G15050 NEP-interacting protein, putative (DUF239);(source:Araport11)
AT4G15060 FBD, F-box/LRR protein;(source:Araport11)
AT4G15093 catalytic LigB subunit of aromatic ring-opening dioxygenase family;(source:Araport11)
AT4G15100 serine carboxypeptidase-like 30;(source:Araport11)
AT4G15110 member of CYP97B
AT4G15120 VQ motif-containing protein;(source:Araport11)
AT4G15140 hypothetical protein;(source:Araport11)
AT4G15150 glycine-rich protein;(source:Araport11)
AT4G15200 Actin nucleation factor that directs the formation of actin cables in pollen tubes. Involved in cytoplasmic streaming and polarized growth in pollen tubes.
AT4G15210 cytosolic beta-amylase expressed in rosette leaves and inducible by sugar. RAM1 mutants have reduced beta amylase in leaves and stems.
AT4G15233 ABC-2 and Plant PDR ABC-type transporter family protein;(source:Araport11)
AT4G15248 B-box type zinc finger family protein;(source:Araport11)
AT4G15250 B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11)
AT4G15260 UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT4G15270 glucosyltransferase-like protein;(source:Araport11)
AT4G15280 UDP-glucosyl transferase 71B5;(source:Araport11)
AT4G15300 cytochrome P450, family 702, subfamily A, polypeptide 2;(source:Araport11)
AT4G15310 a member of the cytochrome P450 gene family. molecular function unknown.
AT4G15320 encodes a gene similar to cellulose synthase
AT4G15330 cytochrome P450, family 705, subfamily A, polypeptide 1;(source:Araport11)
AT4G15360 member of CYP705A
AT4G15380 member of CYP705A
AT4G15390 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT4G15417 RNAse II-like 1;(source:Araport11)
AT4G15430 ERD (early-responsive to dehydration stress) family protein;(source:Araport11)
AT4G15450 Senescence/dehydration-associated protein-like protein;(source:Araport11)
AT4G15490 Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity.
AT4G15500 Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity.
AT4G15530 Encodes a dual-targeted protein believed to act as a pyruvate, orthophosphate dikinase. These enzymes are normally associated with C4 photosynthesis which does not occur in Arabidopsis. However, PPDK may play a role in remobilizing nitrogen during leaf senescence in Arabidopsis. The product of the long transcript (.1 gene model) was shown to be targeted to the chloroplast, whereas the shorter transcript (no targeting sequence) accumulates in the cytosol. The two proteins were also found to be expressed in slightly different tissues.
AT4G15545 NAI1 interacting protein, involved in ER body formation.
AT4G15550 UDP-glucose:indole-3-acetate beta-D-glucosyltransferase
AT4G15570 Similar to yeast Sen1 (splicing endonuclease 1)helicase protein. Involved in female gametophyte development. The mRNA is cell-to-cell mobile.
AT4G15610 Uncharacterized protein family (UPF0497);(source:Araport11)
AT4G15630 Uncharacterized protein family (UPF0497);(source:Araport11)
AT4G15670 Encodes a member of the CC-type glutaredoxin (ROXY) family.
AT4G15740 Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT4G15760 Encodes a protein with similarity to monooxygenases that are known to degrade salicylic acid (SA).
AT4G15780 member of VAMP72 Gene Family
AT4G15802 Encodes a protein with similarity to heat shock factor binding proteins. Involved in negative regulation of heat shock response. Becomes nuclear localized upon heat treatment.
AT4G15820 ABC subfamily C protein;(source:Araport11)
AT4G15850 plant DEAD box-like RNA helicase.
AT4G15860 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-43 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10)
AT4G15920 Encodes a vacuolar fructose transporter expressed in parenchyma and xylem that controls leaf fructose content. When its expression is reduced, fructose accumulates in leaves.
AT4G15970 Nucleotide-diphospho-sugar transferase family protein;(source:Araport11)
AT4G15975 RING/U-box superfamily protein;(source:Araport11)
AT4G16024 hypothetical protein;(source:Araport11)
AT4G16030 Ribosomal protein L19e family protein;(source:Araport11)
AT4G16045 TRAF-like superfamily protein;(source:Araport11)
AT4G16050 Aminotransferase-like, plant mobile domain family protein;(source:Araport11)
AT4G16095 RNI-like superfamily protein;(source:Araport11)
AT4G16110 Encodes a pollen-specific transcription factor involved in the expression of nuclear genes for components of mitochondrial complex I in Arabidopsis. Acts in concert with other type-B ARRs in the cytokinin signaling pathway. AHK3 mediates cytokinin-induced phosphorylation of ARR2 on the Asp-80 residue. This phosphorylation plays a positive role of ARR2 in cytokinin-mediated control of leaf longevity. Also involved in cytokinin-dependent inhibition of hypocotyl elongation.
AT4G16143 Protein interacts with Agrobacterium proteins VirD2 and VirE2. Is not individually essential for Agrobacterium-mediated root transformation, but when overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype.
AT4G16144 Encodes AMSH3, a deubiquitinating enzyme that hydrolyzes K48- and K63-linked ubiquitin chains in vitro. Required for intracellular trafficking and vacuole biogenesis.
AT4G16146 cAMP-regulated phosphoprotein 19-related protein;(source:Araport11)
AT4G16150 CATMA5 is a transcriptional activator. It acts in the cold response pathway, it can bind to and activate the expression of DREB1 genes.
AT4G16155 dihydrolipoamide dehydrogenase;(source:Araport11)
AT4G16162 Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT4G16165 Carbohydrate-binding X8 domain superfamily protein;(source:Araport11)
AT4G16230 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT4G16310 FAD-dependent lysine-specific histone demethylase involved in the control of flowering time.
AT4G16330 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT4G16340 Encodes SPIKE1 (SPK1), the lone DOCK family guanine nucleotide exchange factor (GEF) in Arabidopsis. SPK1 is a peripheral membrane protein that accumulates at, and promotes the formation of, a specialized domain of the endoplasmic reticulum (ER) termed the ER exit site (ERES). SPK1 promotes polarized growth and cell-cell adhesion in the leaf epidermis. Mutant has seedling lethal; cotyledon, leaf-shape, trichome defects.
AT4G16370 Encodes a phloem-specific iron transporter that is essential for systemic iron signaling and redistribution of iron and cadmium. It loads iron into the phloem, facilitates iron recirculation from the xylem to the phloem, and regulates both shoot-to-root iron signaling and iron redistribution from mature to developing tissues.
AT4G16380 Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT4G16390 Encodes a pentatricopeptide repeat protein, SVR7 (SUPPRESSOR OF VARIEGATION7), required for FtsH-mediated chloroplast biogenesis. It is involved in accumulation and translation of chloroplast ATP synthase subunits.
AT4G16410 transmembrane protein;(source:Araport11)
AT4G16447 hypothetical protein;(source:Araport11)
AT4G16490 ARM repeat superfamily protein;(source:Araport11)
AT4G16500 Cystatin/monellin superfamily protein;(source:Araport11)
AT4G16515 Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9).
AT4G16540 Heat shock protein HSP20/alpha crystallin family;(source:Araport11)
AT4G16563 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT4G16600 Nucleotide-diphospho-sugar transferases superfamily protein;(source:Araport11)
AT4G16610 C2H2-like zinc finger protein;(source:Araport11)
AT4G16620 nodulin MtN21-like transporter family protein
AT4G16640 Matrix metalloprotease.
AT4G16720 Ribosomal protein L23/L15e family protein;(source:Araport11)
AT4G16740 Encodes an (E,E)-alpha-farnesene synthase in the Col ecotype of Arabidopsis. This enzyme can also catalyze the formation of (E)-beta-ocimene as well as trace amounts of myrcene and other related compounds in vitro. The cytosolic localization of the protein may make it favor (E,E)-alpha-farnesene biosynthesis because the precursor of this product, FPP, is primarily cytosolic. Transcript levels for this gene increase in response to treatment with the jasmonic acid mimic coronalon or in response to the insect Plutella xylostella. TPS03 transcripts can also be detected in flowers. A similar protein from the C24 ecotype with one amino acid change (S267F) has a different substrate specificity.
AT4G16745 Exostosin family protein;(source:Araport11)
AT4G16748 other_RNA;(source:Araport11)
AT4G16760 Encodes a medium to long-chain acyl-CoA oxidase. Catalyzes the first step of fatty acid beta-oxidation. Involved in jasmonate biosynthesis. Gene expression is induced by wounding, drought stress, abscisic acid, and jasmonate.
AT4G16790 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT4G16830 Encodes a perinuclear and cytoplasmically localized mRNA binding protein. AtRGGA is likely involved in stress responsivness. It is induced by salt and osmotic stress and loss of function mutations are more sensitive to stress. The mRNA is cell-to-cell mobile.
AT4G16845 The VERNALIZATION2 (VRN2) gene mediates vernalization and encodes a nuclear-localized zinc finger protein with similarity to Polycomb group (PcG) proteins of plants and animals. In wild-type Arabidopsis, vernalization results in the stable reduction of the levels of the floral repressor FLC. In vrn2 mutants, FLC expression is downregulated normally in response to vernalization, but instead of remaining low, FLC mRNA levels increase when plants are returned to normal temperatures. VRN2 maintains FLC repression after a cold treatment, serving as a mechanism for the cellular memory of vernalization. Required for complete repression of FLC. Required for the methylation of histone H3
AT4G16855 hypothetical protein;(source:Araport11)
AT4G16890 Encodes a Toll Interleukin1 receptor-nucleotide binding-Leu- rich repeat-type resistance gene (TIR-NB-LRR-type) involved in the salicylic acid-dependent defense response pathway. Mutant plants constitutively express pathogenesis-related (PR) genes and are pathogen resistant. Resistance signaling in snc1 requires EDS1, MOS3 and PAD4.
AT4G16920 Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT4G16930 Toll-Interleukin-Resistance (TIR) domain-containing protein;(source:Araport11)
AT4G16935 transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 3.3e-16 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10)
AT4G16970 Protein kinase superfamily protein;(source:Araport11)
AT4G16990 disease resistance protein (TIR-NBS class);(source:Araport11)
AT4G17000 neurofilament heavy protein;(source:Araport11)
AT4G17030 Encodes EXLB1 (expansin-like B1), a member of the expansin family.
AT4G17080 Histone H3 K4-specific methyltransferase SET7/9 family protein;(source:Araport11)
AT4G17150 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT4G17160 RAB GTPase homolog B1A;(source:Araport11)
AT4G17210 weak chloroplast movement under blue light protein (DUF827);(source:Araport11)
AT4G17220 Encodes a microtubule associated protein (MAP70-5). Regulates secondary wall patterning in wood cells. Expressed in all tissues.
AT4G17245 RING/U-box superfamily protein;(source:Araport11)
AT4G17260 Lactate/malate dehydrogenase family protein;(source:Araport11)
AT4G17330 gene of unknown function expressed in seedlings, flower buds and stems
AT4G17360 encodes one of the two putative formyltetrahydrofolate deformylase. Located in the mitochondrion. Involved in photorespiratory tetrahydrofolate cycle.
AT4G17410 PQT3 is a nuclear localized E3 ligase involved in negative regulation of stress tolerance.PRMT4b is a substrate of PQT3.
AT4G17420 PAWH1 along with PAWH2 is part of endoplasmic reticulum ubiquitin ligase complex with Arabidopsis HRD1 via interaction with EBS7. As such it plays a role in promoting protein degradation via the ERAD pathway.
AT4G17460 Encodes a class II HD-ZIP protein that regulates meristematic activity in different tissues, and that it is necessary for the correct formation of the gynoecium.
AT4G17470 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT4G17480 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT4G17483 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT4G17490 Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-6). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. It is involved in the response to reactive oxygen species and light stress. Involved in regulating root architecture and the response to cold stress.
AT4G17550 Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5).
AT4G17580 Bax inhibitor-1 family protein;(source:Araport11)
AT4G17650 Polyketide cyclase / dehydrase and lipid transport protein;(source:Araport11)
AT4G17660 Protein kinase superfamily protein;(source:Araport11)
AT4G17670 senescence-associated family protein (DUF581);(source:Araport11)
AT4G17680 Encodes an S-ribonuclease binding protein specifically involved in plant tolerance to NaHCO3.
AT4G17700 hypothetical protein;(source:Araport11)
AT4G17710 Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family.
AT4G17713 Encodes a defensin-like (DEFL) family protein.
AT4G17720 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT4G17730 member of SYP2 Gene Family. Together with SYP23 interacts with Tobacco mosaic virus 126 kDa protein; required for normal local virus accumulation and spread.
AT4G17780 F-box and associated interaction domains-containing protein;(source:Araport11)
AT4G17785 Encodes a putative transcription factor (MYB39) involved in the regulation of suberin biosynthetic genes.
AT4G17790 SNARE associated Golgi protein family;(source:Araport11)
AT4G17800 Putative AT-hook DNA-binding family protein;(source:Araport11)
AT4G17810 C2H2 domain regulatory protein. Functions downstream of GL2 during root hair development and regulates expression of targets RDH6, RSL2 and RSL4.
AT4G17840 CAAX protease self-immunity protein;(source:Araport11)
AT4G17870 Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2.
AT4G17890 A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.
AT4G17900 PLATZ transcription factor family protein;(source:Araport11)
AT4G17908 pseudogene of ubiquitin-specific protease
AT4G17990 hypothetical protein;(source:Araport11)
AT4G18010 Encodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not appear to be active against phosphatidylinositol 4,5 bisphosphate. Overexpression of this gene renders plants insensitive to ABA in germination and growth assays.
AT4G18040 eIF4E protein. The cum1 mutation affects the local spreading of CMV within the inoculated leaf, delaying accumulation of cucumber mosaic virus coat protein.
AT4G18050 P-glycoprotein 9;(source:Araport11)
AT4G18090 hypothetical protein;(source:Araport11)
AT4G18180 Pectin lyase-like superfamily protein;(source:Araport11)
AT4G18190 Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.
AT4G18250 receptor Serine/Threonine kinase-like protein;(source:Araport11)
AT4G18255 pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10)
AT4G18260 Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11)
AT4G18270 Encodes protein similar to similar to bacterial translocase I (mra Y). Expressed during flower bud development.
AT4G18330 Translation elongation factor EF1A/initiation factor IF2gamma family protein;(source:Araport11)
AT4G18335 hypothetical protein;(source:Araport11)
AT4G18340 Glycosyl hydrolase superfamily protein;(source:Araport11)
AT4G18350 Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition.
AT4G18380 F-box family protein;(source:Araport11)
AT4G18395 hypothetical protein;(source:Araport11)
AT4G18422 transmembrane protein;(source:Araport11)
AT4G18425 transmembrane protein, putative (DUF679);(source:Araport11)
AT4G18450 encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
AT4G18480 Encodes the CHLI subunit of magnesium chelatase which is required for chlorophyll biosynthesis. All four cysteine residues of the protein form two disulfide bonds (Cys102-Cys193 and Cys354-Cys396) under oxidized conditions but are fully reduced by reduction. It was suggested that the redox state of CHLI is regulated in vivo by the change of the redox environment in the chloroplasts probably via the Trx system.
AT4G18540 transmembrane protein;(source:Araport11)
AT4G18550 DSEL is cytosolic acylhydrolase that shows prefential lipase activity against the sn-1 position of several classes of lipids, including 1,3-diacylglycerols and 1-monoacylglycerols. Overexpression of DSEL leads to increased peroxisome and oil body levels in cotyledons and reduced beta-oxidation activity in seedlings.
AT4G18580 hypothetical protein;(source:Araport11)
AT4G18600 Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments.
AT4G18630 hypothetical protein (DUF688);(source:Araport11)
AT4G18640 Required for root hair elongation during tip growth. The mRNA is cell-to-cell mobile.
AT4G18650 A maternally expressed imprinted gene in the endosperm. It's expression is positively regulated by ROS1.
AT4G18660 delay of germination protein;(source:Araport11)
AT4G18700 Encodes CBL-interacting protein kinase 12 (CIPK12).
AT4G18740 Rho termination factor;(source:Araport11)
AT4G18770 MYB98 is a member of the R2R3-MYB gene family, the members of which likely encode transcription factors. Within an ovule, MYB98 is expressed exclusively in the synergid cells, and mutations in this gene affect the female gametophyte specifically. myb98 female gametophytes are affected in two unique features of the synergid cell, pollen tube guidance and the filiform apparatus, but are otherwise normal. This suggests that MYB98 controls the development of specific features within the synergid cell during female gametophyte development. MYB98 also is expressed in trichomes and endosperm. Homozygous myb98 mutants exhibit no sporophytic defects, including trichome and endosperm defects.
AT4G18780 Encodes a member of the cellulose synthase family involved in secondary cell wall biosynthesis. Mutants have abnormal xylem formation, reduced cellulose content, and enhanced drought and osmotic stress tolerance. Mediates resistance towards bacterial pathogens via ABA. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling.
AT4G18810 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT4G18823 Encodes a defensin-like (DEFL) family protein.
AT4G18870 E2F/DP family winged-helix DNA-binding domain-containing protein;(source:Araport11)
AT4G18890 BES1/BZR1 homolog 3;(source:Araport11)
AT4G18905 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT4G18910 Encodes an aquaporin homolog. Functions in arsenite transport and tolerance.When expressed in yeast cells can conduct hydrogen peroxide into those cells.
AT4G18950 BHP1 is a Raf-like protein kinase involved in mediating blue light dependent stomatal opening.
AT4G18975 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT4G18980 Encodes a nuclear-targeted protein AtS40-3 that modulates senescence associated gene expression.
AT4G19000 The C-terminal portion of this protein has homology to the C-termini of the IWS1 (Interacts With Spt6) proteins found in yeast and humans.
AT4G19006 Proteasome component (PCI) domain protein;(source:Araport11)
AT4G19030 an aquaporin whose expression level is reduced by ABA, NaCl, dark, and desiccation. is expressed at relatively low levels under normal conditions. Also functions in arsenite transport and tolerance.
AT4G19038 Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT4G19045 Member of a conserved family of proteins. Functions redundantly with MOB1A to regulate cell proliferation and JA metabolism.
AT4G19050 NB-ARC domain-containing disease resistance protein;(source:Araport11)
AT4G19110 Protein kinase superfamily protein;(source:Araport11)
AT4G19120 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT4G19130 Replication factor-A protein 1-like protein;(source:Araport11)
AT4G19150 Ankyrin repeat family protein;(source:Araport11)
AT4G19160 transglutaminase family protein;(source:Araport11)
AT4G19170 Encodes a chloroplast-targeted member of a family of enzymes similar to nine-cis-epoxycarotenoid dioxygenase that acts as a major regulator of carotenoid degradation during dark-induced leaf senescence.. The mRNA is cell-to-cell mobile.
AT4G19190 zinc knuckle (CCHC-type) family protein;(source:Araport11)
AT4G19210 member of RLI subfamily The mRNA is cell-to-cell mobile.
AT4G19220 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT4G19230 Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. CYP707A1 appears to play an important role in determining the ABA levels in dry seeds. Gene involved in postgermination growth. Overexpression of CYP707A1 leads to a decrease in ABA levels and a reduction in after-ripening period to break dormancy.
AT4G19360 SCD6 protein-like protein;(source:Araport11)
AT4G19370 chitin synthase, putative (DUF1218);(source:Araport11)
AT4G19395 Encodes a microRNA that targets AGO1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCGCUUGGUGCAGGUCGGGAA. MIR168a is highly expressed and predominantly produces a 21-nt miR168 species. By contrast, MIR168b is expressed at low levels and produces an equal amount of 21- and 22-nt miR168 species. Only the 21-nt miR168 is preferentially stabilized by AGO1, and consequently, the accumulation of the 22-nt but not the 21-nt miR168 is reduced when DCL1 activity is impaired. mir168a mutants with strongly reduced levels of 21-nt miR168 are viable but exhibit developmental defects, particularly during environmentally challenging conditions.
AT4G19410 Pectinacetylesterase family protein;(source:Araport11)
AT4G19420 Pectinacetylesterase family protein;(source:Araport11)
AT4G19430 hypothetical protein;(source:Araport11)
AT4G19450 Major facilitator superfamily protein;(source:Araport11)
AT4G19460 UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT4G19510 Disease resistance protein (TIR-NBS-LRR class);(source:Araport11)
AT4G19520 disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT4G19570 Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT4G19580 DNAJ heat shock N-terminal domain-containing protein;(source:Araport11)
AT4G19600 Encodes a cyclin T partner CYCT1;4. Plays important roles in infection with Cauliflower mosaic virus (CaMV). The mRNA is cell-to-cell mobile.
AT4G19610 nucleotide/nucleic acid binding protein;(source:Araport11)
AT4G19633 pseudogene of heat shock factor related protein
AT4G19670 RING/U-box superfamily protein;(source:Araport11)
AT4G19700 Encodes BOI (Botrytis Susceptible 1 Interactor). Has E3 ubiquitin ligase activity. Interacts with and ubiquitinates BOS1 (Botrytis Susceptible 1). It prevents caspase activation and attenuates cell death.
AT4G19720 Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11)
AT4G19730 Glycosyl hydrolase superfamily protein;(source:Araport11)
AT4G19740 Glycosyl hydrolase superfamily protein;(source:Araport11)
AT4G19770 Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11)
AT4G19810 ChiC encodes a Class V chitinase that is a part of glycoside hydrolase family 18 based on CAZy groupings. It appears to primarily act as an exochitinase in vitro where it predominantly cleaves a chitobiose (GlcNAc)2 residue from the non-reducing end of a chitin oligosaccharide. However, it shows some minor endochitinase activity in vitro, as well. A putative 24 amino-acid signal peptide may direct this protein to the secretory system and it has been detected in cell wall apoplastic fluid. RT-PCR experiments demonstrate that ChiC transcript levels are increased in response to abscisisc acid, jasmonic acid, and NaCl stress. Microarray results also suggest that transcript levels rise in response to osmotic stress, two fungal pathogens, a bacterial pathogen, and the elicitor flagellin. The mRNA is cell-to-cell mobile.
AT4G19820 Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11)
AT4G19840 encodes a phloem lectin, similar to phloem lectin in cucumber and celery. Gene is expressed in the phloem, predominantly in the companion cells. The mRNA is cell-to-cell mobile.
AT4G19850 encodes a protein similar to phloem protein 2 in cucumber. a member of a large gene family.
AT4G19865 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT4G19910 Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11)
AT4G19970 nucleotide-diphospho-sugar transferase family protein;(source:Araport11)
AT4G19980 hypothetical protein;(source:Araport11)
AT4G20000 VQ motif-containing protein;(source:Araport11)
AT4G20030 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT4G20040 Pectin lyase-like superfamily protein;(source:Araport11)
AT4G20050 Encodes a polygalacturonase that plays a direct role in degrading the pollen mother cell wall during microspore development.
AT4G20080 Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein;(source:Araport11)
AT4G20095 hypothetical protein (DUF626);(source:Araport11)
AT4G20100 PQ-loop repeat family protein / transmembrane family protein;(source:Araport11)
AT4G20110 VACUOLAR SORTING RECEPTOR 7;(source:Araport11)
AT4G20140 Encodes GASSHO1 (GSO1), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO1 and a homolog GSO2 (At5g44700) are required for the formation of a normal epidermal surface during embryogenesis. Necessary for localizing CASPARIAN STRIP DOMAIN PROTEINS (CASPs) - major players of endodermal differentiation - into an uninterrupted, ring-like domain.
AT4G20160 golgin family A protein;(source:Araport11)
AT4G20170 glycosyltransferase family protein (DUF23);(source:Araport11)
AT4G20190 hypothetical protein;(source:Araport11)
AT4G20200 Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11)
AT4G20210 Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11)
AT4G20250 hypothetical protein;(source:Araport11)
AT4G20270 Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. The mRNA is cell-to-cell mobile.
AT4G20280 Encodes TAF11, a putative TBP-associated factor (TBP: TATA binding protein).
AT4G20290 transmembrane protein;(source:Araport11)
AT4G20310 Encodes a Golgi-localized protease that can cleave the transcription factors bZIP17 and bZIP28 that are translocated from the ER through the Golgi so that the transcription factors can be released to translocate into the nucleus.
AT4G20325 ribonuclease H2 subunit B;(source:Araport11)
AT4G20360 Nuclear transcribed, plastid localized EF-Tu translation elongation factor. Referred to as AtRabE1b in DOI:10.1104/pp.013052. However, wider community usage and more publications assign the symbol RabE1b to At5g59840.
AT4G20410 Encodes a member of the gamma-soluble NSF attachment protein (gSNAP) gene family.
AT4G20420 Tapetum specific protein TAP35/TAP44;(source:Araport11)
AT4G20450 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT4G20770 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT4G20780 Calcium sensor involved in trichome branching.
AT4G20800 FAD-binding Berberine family protein;(source:Araport11)
AT4G20820 FAD-binding Berberine family protein;(source:Araport11)
AT4G20850 Tripeptidyl Peptidase II. Ser protease that assembles into a large oligomeric complex containing two proteins of 153 and 142 kD that are derived from a single TPP2 gene, with the smaller version missing part of the C-terminal end. Not essential, based on the lack of phenotype of a T-DNA disruption mutant.
AT4G20860 involved in the generation of H2O2 from reduced compounds
AT4G20940 Encodes a plasma-membrane localized LRR receptor-like protein involved in both ABA and H202 mediated signaling involved in stomatal movement. TAIR10 annotation for this gene has a low confidence score (2-star). See Comments field for structural annotation by the community.
AT4G21090 MITOCHONDRIAL FERREDOXIN 2;(source:Araport11)
AT4G21130 similar to man and yeast U3-55K genes, involved in processing of pre-ribosomal RNA.
AT4G21200 Encodes a protein with gibberellin 2-oxidase activity which acts specifically on C-20 gibberellins.
AT4G21215 transmembrane protein;(source:Araport11)
AT4G21220 Trimeric LpxA-like enzymes superfamily protein;(source:Araport11)
AT4G21230 Encodes a cysteine-rich receptor-like protein kinase.
AT4G21240 F-box and associated interaction domains-containing protein;(source:Araport11)
AT4G21250 Sulfite exporter TauE/SafE family protein;(source:Araport11)
AT4G21260 Sulfite exporter TauE/SafE family protein;(source:Araport11)
AT4G21270 Encodes a kinesin-like motor protein heavy chain. Loss of function mutations have reduced fertility and are defective in spindle formation in male meiosis.
AT4G21330 Encodes a bHLH transcription factor strongly expressed in the tapetum from late anther stage 5 to early stage 6, and at a lower level in meiocytes. dyt1 mutant exhibits abnormal anther morphology beginning at anther stage 4. DYT1 acts downstream of SPL/NZZ and EMS1/EXS , and regulates the expression of downstream genes like AMS, MS1 and other tapetum preferential genes for pollen development, primarily via TDF1.
AT4G21350 Encodes a U-box/ARM repeat protein required fore self-incompatibility.
AT4G21362 Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGAACAUGGUUUAUUAGGAA
AT4G21366 Protein kinase superfamily protein;(source:Araport11)
AT4G21380 encodes a putative receptor-like serine/threonine protein kinases that is similar to Brassica self-incompatibility (S) locus. Expressed in root. Shoot expression limited to limited to the root-hypocotyl transition zone and at the base of lateral roots as well as in axillary buds, and pedicels.
AT4G21390 S-locus lectin protein kinase family protein;(source:Araport11)
AT4G21420 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.9e-06 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10)
AT4G21430 protein B160;(source:Araport11)
AT4G21437 unknown pseudogene
AT4G21450 PapD-like superfamily protein;(source:Araport11)
AT4G21480 Putative sugar transporter. Expressed in nematode-induced root syncytia.
AT4G21490 NAD(P)H dehydrogenase B3;(source:Araport11)
AT4G21530 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT4G21534 Diacylglycerol kinase family protein;(source:Araport11)
AT4G21560 vacuolar protein sorting-associated protein-like protein;(source:Araport11)
AT4G21580 oxidoreductase, zinc-binding dehydrogenase family protein;(source:Araport11)
AT4G21600 Encodes a protein with mismatch-specific endonuclease activity with a preference for T/G, A/G, and G/G of single base mismatches. It also has the ability to cleave indel types of mismatches (heteroduplexes with loops).
AT4G21620 glycine-rich protein;(source:Araport11)
AT4G21630 Subtilase family protein;(source:Araport11)
AT4G21640 Subtilase family protein;(source:Araport11)
AT4G21650 Subtilase family protein;(source:Araport11)
AT4G21670 encodes a a novel transcriptional repressor harboring two double-stranded RNA-binding domains and a region homologous to the catalytic domain of RNA polymerase II C-terminal domain phosphatases found in yeast and in animals that regulate gene transcription. Protein exhibits innate phosphatase activity in vitro. Mutants exhibit hyperresponsiveness to ABA, cold, and NaCl.
AT4G21680 Encodes a nitrate transporter (NRT1.8). Functions in nitrate removal from the xylem sap. Mediates cadmium tolerance.
AT4G21690 gibberellin 3-oxidase 3;(source:Araport11)
AT4G21700 DUF2921 family protein, putative (DUF2921);(source:Araport11)
AT4G21705 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT4G21760 beta-glucosidase 47;(source:Araport11)
AT4G21830 methionine sulfoxide reductase B7;(source:Araport11)
AT4G21850 methionine sulfoxide reductase B9;(source:Araport11)
AT4G21890 zinc finger MYND domain protein;(source:Araport11)
AT4G21902 hypothetical protein;(source:Araport11)
AT4G21910 MATE efflux family protein;(source:Araport11)
AT4G21920 hypothetical protein;(source:Araport11)
AT4G21970 senescence regulator (Protein of unknown function, DUF584);(source:Araport11)
AT4G21980 Encodes APG8, a component of autophagy conjugation pathway. Delivered to the lumens of vacuole under nitrogen-starvation condition. Highest expression in flowers. mRNA abundance increased during dark-induced carbon starvation. Predominantly cytoplasmic with or without N starvation. Upon concanamycin A the protein accumulates in the central vacuole as punctuate structures that resemble autophagic bodies. This localization is more abundant upon N starvation. The mRNA is cell-to-cell mobile.
AT4G22010 SKU5 similar 4;(source:Araport11)
AT4G22030 F-box protein with a domain protein;(source:Araport11)
AT4G22050 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT4G22065 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-09 P-value blast match to GB:AAB51275 reverse transcriptase, gag, polyprotein (Ty1_Copia-element) (Volvox carteri f. nagariensis);(source:TAIR10)
AT4G22066 Pseudogene of AT5G66830; F-box family protein
AT4G22080 root hair specific 14;(source:Araport11)
AT4G22090 Pectin lyase-like superfamily protein;(source:Araport11)
AT4G22100 beta glucosidase 2;(source:Araport11)
AT4G22105 Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein).
AT4G22120 Calcium-permeable stretch activated cation channel.
AT4G22140 Encoding a chromatin remodeling factor that regulates flowering time.
AT4G22150 Arabidopsis thaliana CDC48-interacting UBX-domain protein (PUX3)
AT4G22165 F-box protein (DUF295);(source:Araport11)
AT4G22185 pseudogene of F-box protein (DUF295);(source:Araport11)
AT4G22200 Encodes AKT2, a photosynthate- and light-dependent inward rectifying potassium channel with unique gating properties that are regulated by phosphorylation. Expressed in guard cell protoplasts and in the phloem and xylem of aerial portions of the plant. The channel can coassemble with another K+ channel, KAT1, in vitro. In guard cells, AKT2/3 is responsible for the Ca2+ sensitivity of the K+ uptake channel. In the phloem, it regulates the sucrose/H+ symporters via the phloem potential. AKT2 belongs to the Shaker family K+ channels which include the following groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500).
AT4G22220 Encodes a mitochondrial protein similar to E.coli IscU. In bacteria, IscU is a scaffold protein accepting sulfur and iron to build a transient Fe-S cluster,which is subsequently transferred to a target apoprotein.
AT4G22240 Involved in photoprotection of photosystem II. The RVSI and twin-positive motifs in the transit peptide are necessary for efficient leucoplast import of prFB.
AT4G22250 RING/U-box superfamily protein;(source:Araport11)
AT4G22265 pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10)
AT4G22305 Encodes SOBER1, a carboxylesterase that inhibits AvrBsT-triggered phenotypes in Arabidopsis. SOBER1 was formerly linked to AT4G22300 but this locus was split in the TAIR10 annotation into AT4G22300 and AT4G22305. AT4G22300 is now known as TIPSY1 and AT4G22305 corresponds to SOBER1.
AT4G22320 golgin family A protein;(source:Araport11)
AT4G22380 Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11)
AT4G22400 hypothetical protein;(source:Araport11)
AT4G22485 Encodes a Protease inhibitor/seed storage/LTP family protein
AT4G22490 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT4G22530 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT4G22560 sulfated surface-like glycoprotein;(source:Araport11)
AT4G22580 Exostosin family protein;(source:Araport11)
AT4G22590 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT4G22600 Encodes a protein involved in involved in the formation of the pollen surface apertures. It acts late in aperture formation by excluding specific membrane domains from exine deposition.
AT4G22640 LTPG protein
AT4G22670 Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The mRNA is cell-to-cell mobile.
AT4G22680 Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation.
AT4G22690 member of CYP706A The mRNA is cell-to-cell mobile.
AT4G22730 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT4G22745 Protein containing methyl-CpG-binding domain.
AT4G22754 pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10)
AT4G22758 PPR containing protein;(source:Araport11)
AT4G22770 AT hook motif DNA-binding family protein;(source:Araport11)
AT4G22790 Encodes a plasma membrane localized MATE type transporter that is involved in CO2 signaling during stomatal aperture regulation. RHC1 regulates HT1 which phosphorylates OST1, a kinase that regulates the SLAC1 anion channel and thus stomatal closing.
AT4G22820 A member of the A20/AN1 zinc finger protein family involved in stress response.Expression is increased in response to water, salt , pathogen and other stressors.SAP9 can pull down both K48-linked and K63- linked tetraubiquitin chains and functions as a E3 ubiquitin ligase suggesting a role in proteasome-dependent protein degradation.
AT4G22850 SNARE associated Golgi protein family;(source:Araport11)
AT4G22880 encodes leucoanthocyanidin dioxygenase, which is involved in proanthocyanin biosynthesis. Mutant analysis suggests that this gene is also involved in vacuole formation.
AT4G22900 transmembrane protein, putative (DUF1191);(source:Araport11)
AT4G22910 FIZZY-related 2;(source:Araport11)
AT4G22940 Protein kinase superfamily protein;(source:Araport11)
AT4G22960 FAM63A-like protein (DUF544);(source:Araport11)
AT4G22970 Encodes a separase (ESP), homologous to human and mouse separase protein. Separase is a capase family protease required for the release of sister chromatid cohesion during meiosis and mitosis. Arabidopsis separase contains a predicted 2Fe2S-ferredoxin domain that is not present in the proteins of other organisms. Also contains a putative EF-hand calcium binding domain. Mutant seeds exhibited embryo arrest at the globular stage. The endosperm also exhibited a weak titan-like phenotype. Transgenic plants expressing AESP RNA interference (RNAi) from the meiosis-specific DMC1 promoter exhibited alterations in chromosome segregation during meiosis I and II that resulted in polyads containing from one to eight microspores. Plays an essential role in embryo development. Required for the removal of cohesin from meiotic chromosomes and establishment of meiotic nuclear domains. This gene was also identified through the rsw4 mutant. Lines carrying recessive, temperature-sensitive mutations exhibit reduced anisotropic growth at 30 degrees Celsius. Microtubules and cellulose microfibrils are not depleted or disoriented in the mutants at the restrictive temperature.
AT4G22980 molybdenum cofactor sulfurase-like protein;(source:Araport11)
AT4G22990 Encodes a member of the PHOSPHATE TRANSPORTER 5 family (PHT5;3). Overexpression of PHT5:3 leads to Pi sequestration into vacuoles and altered regulation of Pi starvation-responsive genes.
AT4G23010 UDP-galactose transporter 2;(source:Araport11)
AT4G23030 MATE efflux family protein;(source:Araport11)
AT4G23130 Encodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307)
AT4G23150 Encodes a cysteine-rich receptor-like protein kinase.
AT4G23160 Encodes a cysteine-rich receptor-like protein kinase.
AT4G23170 Induced in response to Salicylic acid.Similar to receptor-like kinase 4 and 5. NPR1, a known positive regulator of the SA signaling pathway is responsible for the SA-dependent induction and constitutive repression of EP1 gene's basal expression. The mRNA is cell-to-cell mobile.
AT4G23180 Encodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) The mRNA is cell-to-cell mobile.
AT4G23200 Encodes a cysteine-rich receptor-like protein kinase.
AT4G23210 Encodes a Cysteine-rich receptor-like kinase (CRK13). Overexpression of CRK13 leads to hypersensitive response cell death, and induces defense against pathogens by causing increased accumulation of salicylic acid.
AT4G23220 Encodes a cysteine-rich receptor-like protein kinase.
AT4G23240 Encodes a cysteine-rich receptor-like protein kinase.
AT4G23250 cysteine-rich receptor-like protein kinase 17;(source:Araport11)
AT4G23260 Encodes a cysteine-rich receptor-like protein kinase.
AT4G23310 Encodes a cysteine-rich receptor-like protein kinase.
AT4G23320 Encodes a cysteine-rich receptor-like protein kinase.
AT4G23340 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT4G23400 Plasma membrane intrinsic protein, involved redundantly with PIP1;1/2/3/4 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development.
AT4G23410 TET5 encodes a member of the TETRASPANIN gene family that is expressed in the embryo and vascular system and is involved in organ growth redundantly with TET6.
AT4G23430 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT4G23440 Disease resistance protein (TIR-NBS class);(source:Araport11)
AT4G23450 AtAIRP1 gene encodes a C3H2C3-type RING E3 Ub ligase. It has been shown to be a positive regulator in the Arabidopsis ABA-dependent drought response.
AT4G23470 PLAC8 family protein;(source:Araport11)
AT4G23493 hypothetical protein;(source:Araport11)
AT4G23500 Pectin lyase-like superfamily protein;(source:Araport11)
AT4G23510 Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT4G23520 Cysteine proteinases superfamily protein;(source:Araport11)
AT4G23530 ROH1, putative (DUF793);(source:Araport11)
AT4G23540 ARM repeat superfamily protein;(source:Araport11)
AT4G23550 Encodes WRKY DNA-binding protein 29 (WRKY29). The mRNA is cell-to-cell mobile.
AT4G23600 Encodes cystine lyase which is expected to be involved in amino acid metabolism, providing the plant with cysteine and the generation of precursors of ethylene biosynthesis. mRNA levels are elevated in response to wounding.
AT4G23690 Encodes a homodimeric all-beta dirigent protein in the superfamily of calycins. Dirigent proteins impart stereoselectivity on the phenoxy radical coupling reaction yielding optically active lignans from two molecules of coniferyl alcohol.
AT4G23700 member of Putative Na+/H+ antiporter family
AT4G23710 vacuolar ATP synthase subunit G2;(source:Araport11)
AT4G23713 Encodes a microRNA that targets several TCP family members controlling leaf development. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGACUGAAGGGAGCUCCCU. The miR319a pri-mRNA also encodes a regulatory peptide miPEP319a (AT4G23712) that regulates accumulation of its own miRNA.
AT4G23720 transmembrane protein, putative (DUF1191);(source:Araport11)
AT4G23730 Galactose mutarotase-like superfamily protein;(source:Araport11)
AT4G23740 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT4G23760 Cox19-like CHCH family protein;(source:Araport11)
AT4G23790 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues.A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT4G23810 member of WRKY Transcription Factor; Group III
AT4G23870 hypothetical protein;(source:Araport11)
AT4G23880 hypothetical protein;(source:Araport11)
AT4G23900 Nucleoside diphosphate kinase family protein;(source:Araport11)
AT4G23960 F-box family protein;(source:Araport11)
AT4G23990 encodes a protein similar to cellulose synthase
AT4G24000 encodes a protein similar to cellulose synthase
AT4G24010 encodes a protein similar to cellulose synthase
AT4G24015 RING/U-box superfamily protein;(source:Araport11)
AT4G24020 Encodes NIN Like Protein 7 (NLP7). Modulates nitrate sensing and metabolism. Mutants of NLP7 show features of nitrogen-starved plants and are tolerant to drought stress. Localized in the nucleus and functions as a putative transcription factor. The mRNA is cell-to-cell mobile.
AT4G24040 Encodes a trehalase, member of Glycoside Hydrolase Family 37.
AT4G24050 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT4G24070 carbon-carbon lyase;(source:Araport11)
AT4G24110 NADP-specific glutamate dehydrogenase;(source:Araport11)
AT4G24120 Member of a small family of oligopeptide transporters similar to the yellow stripe locus of maize (ZmYS1).
AT4G24130 ABA responsive SVB family gene.
AT4G24140 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT4G24150 Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in shoot and flower.
AT4G24160 Encodes a soluble lysophosphatidic acid acyltransferase with additional triacylglycerol lipase and phosphatidylcholine hydrolyzing enzymatic activities. Plays a pivotal role in maintaining the lipid homeostasis by regulating both phospholipid and neutral lipid levels.
AT4G24170 ATP binding microtubule motor family protein;(source:Araport11)
AT4G24175 kinesin-like protein;(source:Araport11)
AT4G24220 encodes a progesterone-5beta-reductase-like protein. It has enone reductase activity against a wide range of substrates, including 3-oxo-Δ-4,5-steroids in vitro. The in vivo substrates and product of this enzyme have not yet been elucidated but it is likely to participate in steroid metabolism. The protein contains a mammalian death domain involved in programmed cell death. The gene is expressed in the vascular system and mutants carrying a dominant mutation in the gene have defective vascular patterning. VEP1 gene expression is induced specifically by wounding.
AT4G24230 acyl-CoA-binding protein ACBP3. Localized extracellularly in transiently expressed tobacco BY-2 cells and onion epidermal cells. Binds arachidonyl-CoA with high affinity. Microarray data shows up-regulation of many biotic- and abiotic-stress-related genes in an ACBP3 OE-1 in comparison to wild type.
AT4G24231 This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT4G24250 A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO13 belongs to the clade II, with ATMLO1 and ATMLO15. The gene is expressed during early seedling growth, in root and cotyledon vascular system, in pollen and also in placenta of developing siliques, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s).
AT4G24265 homeobox protein;(source:Araport11)
AT4G24290 MAC/Perforin domain-containing protein;(source:Araport11)
AT4G24320 Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11)
AT4G24400 Encodes a CBL (calcineurin B-like calcium sensor proteins) -interacting serine/threonine protein kinase. Regulates the low-affinity phase of the primary nitrate response. The mRNA is cell-to-cell mobile.
AT4G24410 hypothetical protein;(source:Araport11)
AT4G24450 phosphoglucan, water dikinase;(source:Araport11)
AT4G24480 Protein kinase superfamily protein;(source:Araport11)
AT4G24490 RAB geranylgeranyl transferase alpha subunit 1;(source:Araport11)
AT4G24510 Encodes a component of the fatty acid elongation machinery required for C28 to C30 fatty acid elongation. It does not require the acyltransferase catalytic site for biological function.
AT4G24530 O-fucosyltransferase family protein;(source:Araport11)
AT4G24540 Encodes a MADS-box protein involved in flowering. Regulates the expression of SOC1 and is also upregulated by SOC1. Binds with IMK3 kinase domain. Phosphorylated by IMK3; likely to be a target for IMK3 kinase domain.
AT4G24690 Encodes NBR1, a selective autophagy substrate. The mRNA is cell-to-cell mobile.
AT4G24710 Encodes an AAA+ ATPase that mediates meiotic chromosome remodeling and crossover maturation.
AT4G24780 Encodes a pectate lyase involved in response to nematodes.
AT4G24790 AAA-type ATPase family protein;(source:Araport11)
AT4G24860 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT4G24880 snurportin-1 protein;(source:Araport11)
AT4G24910 glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11)
AT4G24960 Homologous to a eukaryote specific ABA- and stress-inducible gene first isolated from barley. Groups in one subfamily with ATHVA22E. Along with other members of the ATHVA22 family, it may be involved in regulation of autophagy during development. The mRNA is cell-to-cell mobile.
AT4G24972 Encodes a novel small protein which is similar to proteins of unknown function from other plant species. TPD1 is involved in cell specification during anther and pollen development. Identified in a screen for male steriles. Mutants lack tapetal cells and have an increased number of microsporocytes. Expressed in flower buds, leaves and young seedlings. In anthers, TPD1 is expressed throughout pollen development in parietal cells and sporocytes. Physically interacts with the LRR kinase EMS1 and that interaction results in phosphorylation of TPD1.
AT4G24977 Pseudogene of AT4G24972; TPD1 (TAPETUM DETERMINANT 1)
AT4G24980 nodulin MtN21-like transporter family protein
AT4G25000 Predicted to be secreted protein based on signalP prediction. Involved in starch mobilization. Mutants are defective in alpha-amylase activity. (Note: AMY1 has been found in the literature to be referred to as AMY3, which is not to be confused with AMY3/At1g69830).
AT4G25010 Encodes a member of the SWEET sucrose efflux transporter family proteins. Together with SWEET13, it is likely involved in modulating the GA response and is required for proper development of anthers, seeds and seedlings.
AT4G25050 encodes an acyl carrier protein predominantly expressed in leaves. Gene expression is upregulated by light.
AT4G25070 caldesmon-like protein;(source:Araport11)
AT4G25080 Encodes a protein with methyltransferase activity responsible for the methylation of magnesium protoporphyrin IX. Mutants defective in this gene are affected in chlorophyll biosynthesis and show a reduction in the accumulation of a number of major thylakoid-associated proteins including components of PSI (LHCI), PSII (LHCII, D1, CP43) and the cytochrome b6f complex (Cytf). By contrast, no significant changes were detected for the proteins of the stroma and the chloroplast envelope.
AT4G25090 Riboflavin synthase-like superfamily protein;(source:Araport11)
AT4G25130 Encodes a chloroplast-localized methionine sulfoxide reductase that is a member of the MSRA family. Involved in protection of chloroplasts from oxidative stress.
AT4G25180 RNA polymerase III RPC4;(source:Araport11)
AT4G25220 Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5).
AT4G25235 Encodes a ECA1 gametogenesis related family protein [pseudogene]
AT4G25260 Pectin methylesterase inhibitor. Forms pH dependent complex with PME3.
AT4G25310 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT4G25320 AT hook motif DNA-binding family protein;(source:Araport11)
AT4G25340 Encodes a member of the FKBP-type immunophilin family that functions as a histone chaparone. Binds to 18S rDNA and represses its expression. The N-terminal nucleoplasmin domain interacts with H2A/H2B and H3/H4 histone oligomers, individually, as well as simultaneously, suggesting two different binding sites for H2A/H2B and H3/H4.
AT4G25350 SHB1 encodes a nuclear and cytosolic protein that has motifs homologous with SYG1 protein family members. Acts in cryptochrome signaling. Overexpression of SHB1 enhanced the expression of PHYTOCHROME-INTERACTING FACTOR4 (PIF4) under red light and promoted proteasome-mediated degradation of phytochrome A and hypocotyl elongation under far-red light. A knockout allele suppressed LONG HYPOCOTYL IN FAR-RED LIGHT1 (HFR1) expression and showed several deetiolation phenotypes. Acts upstream of HFR1. Regulates seed development.
AT4G25390 Protein kinase superfamily protein;(source:Araport11)
AT4G25430 hypothetical protein;(source:Araport11)
AT4G25433 peptidoglycan-binding LysM domain-containing protein;(source:Araport11)
AT4G25434 nudix hydrolase homolog 10;(source:Araport11)
AT4G25470 Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature, abscisic acid, and circadian rhythm. Overexpressing this gene leads to increased freeze tolerance and induces the expression level of 85 cold-induced genes and reduces the expression level of 8 cold-repressed genes, which constitute the CBF2 regulon. Mutations in CBF2 increases the expression level of CBF1 and CBF3, suggesting that this gene may be involved in a negative regulatory or feedback circuit of the CBF pathway.
AT4G25490 Transcriptional activator that binds to the DRE/CRT regulatory element and induces COR (cold-regulated) gene expression increasing plant freezing tolerance. It encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid.
AT4G25500 Encodes an arginine/serine-rich splicing factor. The transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. RS40 binds to HYL1 and co-localizes to the nuclear dicing body. Along with RS41, it appears to be involved in pri-miRNA processing and miRNA biogenesis (DOI:10.1093/nar/gkv751).
AT4G25560 LAF1 is a R2R3-MYB transcription factor and positive regulator of the phyA photoresponse. Interaction of LAF1 with HFR1 stabilize the proteins against ubiquitination by COP1(AT2G32950) and subsequent degrations. Mutants have an elongated hypocotyl specifically under far-red light but retain wild-type responses to other light wavelengths.
AT4G25570 Encodes cytochrome b561.
AT4G25610 C2H2-like zinc finger protein;(source:Araport11)
AT4G25630 encodes a fibrillarin, a key nucleolar protein in eukaryotes which associates with box C/D small nucleolar RNAs (snoRNAs) directing 2'-O-ribose methylation of the rRNA. This gene also encodes a novel box C/D snoRNA, U60.2f in its fifth intron that accumulates in seedlings and that their targeted residue on the 25 S rRNA is methylated. The mRNA is cell-to-cell mobile.
AT4G25640 Encodes a multidrug and toxin efflux family transporter. Involved in flavonoid metabolism, affecting Root growth, seed development and germination, and pollen development, release and viability.
AT4G25670 stress response NST1-like protein;(source:Araport11)
AT4G25740 RNA binding Plectin/S10 domain-containing protein;(source:Araport11)
AT4G25750 ABC-2 type transporter family protein;(source:Araport11)
AT4G25760 Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7).
AT4G25800 Calmodulin-binding protein;(source:Araport11)
AT4G25810 xyloglucan endotransglycosylase-related protein (XTR6)
AT4G25820 Encodes a xyloglucan endotransglycosylase with a clear preference for non-fucosylated xyloglucan polymer. The mRNA is cell-to-cell mobile.
AT4G25860 OSBP(oxysterol binding protein)-related protein 4A;(source:Araport11)
AT4G25870 Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11)
AT4G25885 Natural antisense transcript overlaps with AT4G25880;(source:Araport11)
AT4G25900 Galactose mutarotase-like superfamily protein;(source:Araport11)
AT4G25940 ENTH/ANTH/VHS superfamily protein;(source:Araport11)
AT4G25950 V-ATPase G-subunit like protein
AT4G25960 P-glycoprotein 2;(source:Araport11)
AT4G25970 Encodes the major form of the two non-mitochondrail phosphatidylserine decarboxylase. Located at the ER. The mRNA is cell-to-cell mobile.
AT4G25990 chloroplast import apparatus CIA2-like. CIA2 is a transcription factor which upregulates chloroplast translocon genes
AT4G26055 transmembrane protein;(source:Araport11)
AT4G26060 Ribosomal protein L18ae family;(source:Araport11)
AT4G26130 cotton fiber protein;(source:Araport11)
AT4G26140 putative beta-galactosidase
AT4G26180 Encodes a mitochondrial CoA transporter.
AT4G26200 Member of a family of proteins in Arabidopsis that encode 1-Amino-cyclopropane-1-carboxylate synthase, an enzyme involved in ethylene biosynthesis. Not expressed in response to IAA.
AT4G26210 Mitochondrial ATP synthase subunit G protein;(source:Araport11)
AT4G26220 Encodes a caffeoyl-coenzyme A O-methyltransferase (CCoAOMT)-like protein with a strong preference for methylating the para position of flavanones and dihydroflavonols, whereas flavones and flavonols are methylated in the meta-position.
AT4G26260 Encodes a myo-inositol oxygenase, which is the first enzyme in the inositol route to ascorbate (L‐ascorbic acid, AsA, vitamin C). Overexpression results in enhanced biomass and abiotic stress tolerance.
AT4G26300 Arginyl-tRNA synthetase, class Ic;(source:Araport11)
AT4G26310 elongation factor P (EF-P) family protein;(source:Araport11)
AT4G26320 arabinogalactan protein 13;(source:Araport11)
AT4G26330 Subtilisin-like serine endopeptidase family protein;(source:Araport11)
AT4G26340 F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT4G26350 F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT4G26375 pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10)
AT4G26380 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT4G26385 pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10)
AT4G26460 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT4G26466 Encodes a membrane localized (putative GPI-anchored) protein involved in fertilization. Loss of function mutations display defects in fertilization-around 25% of embryo sacs abort.
AT4G26470 Calcium-binding EF-hand family protein;(source:Araport11)
AT4G26485 methyltransferase small domain protein;(source:Araport11)
AT4G26540 Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11)
AT4G26560 Encodes calcineurin B-like protein 7 (CBL7).Interacts with and modulates the activity of the PM ATPase AHA2.
AT4G26570 member of AtCBLs (Calcineurin B-like Calcium Sensor Proteins)
AT4G26580 RING/U-box superfamily protein;(source:Araport11)
AT4G26590 oligopeptide transporter
AT4G26600 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT4G26700 Encodes a member of the fimbrin family. Different members of the fimbrin/plastin family have diverged biochemically during evolution to generate either tight actin bundles or loose networks with distinct biochemical and biophysical properties. FIM4 generates both actin bundles and branched actin filaments whereas FIM5 only generates actin bundles.
AT4G26740 Encodes caleosin, a 27-kDa protein found within seed lipid bodies. Gene is expressed preferentially in the embryo, has similarity to a rice ABA-responsive gene, EFA27. Catalyze hydroperoxide-dependent mono-oxygenation reactions. Require calcium for peroxygenase activity. Probably deeply buried in lipid droplets or microsomes.
AT4G26770 Phosphatidate cytidylyltransferase family protein;(source:Araport11)
AT4G26780 unknown function
AT4G26890 Member of MEKK subfamily. Involved in wound response signaling. Interacts with At5g40440, and activates At1g59580.
AT4G26910 Encodes the E2 subunit of the 2-oxoglutarate dehydrogenase.
AT4G26930 Encodes a putative transcription factor (MYB97).
AT4G26950 senescence regulator (Protein of unknown function, DUF584);(source:Araport11)
AT4G26965 NADH:ubiquinone oxidoreductase, 17.2kDa subunit;(source:Araport11)
AT4G26970 Encodes an aconitase that can catalyze the conversion of citrate to isocitrate through a cis-aconitate intermediate, indicating that it may participate in the TCA cycle and other primary metabolic pathways. The protein is believed to accumulate in the mitochondria and the cytosol. It affects CSD2 (At2g28190 - a superoxide dismutase) transcript levels and may play a role in the response to oxidative stress. One member of the family (ACO1 - At35830) was shown to specifically bind to the 5' UTR of CSD2 in vitro. The mRNA is cell-to-cell mobile.
AT4G26980 RNI-like superfamily protein;(source:Araport11)
AT4G26990 polyadenylate-binding protein interacting protein;(source:Araport11)
AT4G27000 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT4G27050 F-box/RNI-like superfamily protein;(source:Araport11)
AT4G27110 COBRA-like protein 11 precursor;(source:Araport11)
AT4G27190 NB-ARC domain-containing disease resistance protein;(source:Araport11)
AT4G27220 NB-ARC domain-containing disease resistance protein;(source:Araport11)
AT4G27230 Encodes HTA2, a histone H2A protein.
AT4G27250 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT4G27260 encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. It is involved in camalexin biosynthesis via conjugating indole-3-carboxylic acid (ICA) and cysteine (Cys). The mRNA is cell-to-cell mobile.
AT4G27270 Quinone reductase family protein;(source:Araport11)
AT4G27290 S-locus lectin protein kinase family protein;(source:Araport11)
AT4G27300 S-locus lectin protein kinase family protein;(source:Araport11)
AT4G27310 Encodes an atypical B-box domain protein that negatively regulates photomorphogenic development by interfering with the binding of the transcription factor HY5 to target gene promoters. Degradation of BBX28 in darkness is dependent on COP1 and occurs via the 26S proteasome pathway. BBX28 acts as a key factor in the COP1-HY5 regulatory hub by maintaining proper HY5 activity to ensure normal photomorphogenic development in plants. Interacts with CO via B-box domain resulting in decreased FT expression and delayed flowering.
AT4G27330 Encodes a putative transcription factor that is required for the initiation of both micro- and megagametogenesis and is expressed in the sporogenous tissue of the anther and the ovule. SPL is a chalaza identity gene that share overlapping functions in establishing the prospective chalaza of the ovule. It also plays a central role in patterning both the proximal-distal and the adaxial-abaxial axes in the ovule and generally interacts with YABBY proteins in vitro. Mutant is defective in the differentiation of primary sporogenous cells into microsporocytes, and does not properly form the anther wall. Regulator of anther cell differenctiation. Interacts with TPL and TCP proteins.
AT4G27340 Met-10+ like family protein;(source:Araport11)
AT4G27370 member of Myosin-like proteins
AT4G27390 transmembrane protein;(source:Araport11)
AT4G27410 Encodes a NAC transcription factor induced in response to desiccation. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response.
AT4G27420 ABC-2 type transporter family protein;(source:Araport11)
AT4G27430 Positive regulator of light-regulated genes. Novel nuclear protein which requires light for its high level expression. The mRNA is cell-to-cell mobile.
AT4G27435 fiber (DUF1218);(source:Araport11)
AT4G27440 light-dependent NADPH:protochlorophyllide oxidoreductase B The mRNA is cell-to-cell mobile.
AT4G27450 aluminum induced protein with YGL and LRDR motifs;(source:Araport11)
AT4G27550 Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active but no trehalose phosphatase (TPP)-like domain.
AT4G27570 Encodes a UDP-glycosyltransferase that contributes to cold, salt and drought stress tolerance via modulating anthocyanin accumulation.
AT4G27585 Encodes a stomatin-like protein that is present in a mitochondrial membrane-bound 3 MDa protein complex and is involved in the assembly of mitochondrial respiratory supercomplexes. There is an observed increase in abundance of respiratory complex III2 in SLP1 single and double knockout mutants. The protein is not redundant with Arabidopsis SLP2 (At5g54100).
AT4G27595 Encodes a microtubule-associated protein.
AT4G27610 intracellular protein transporter;(source:Araport11)
AT4G27640 Nuclear import receptor for GRF-interacting factors (GIFs),roles in ovule development.
AT4G27690 vacuolar protein sorting 26B;(source:Araport11)
AT4G27700 Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11)
AT4G27710 member of CYP709B The mRNA is cell-to-cell mobile.
AT4G27720 Major facilitator superfamily protein;(source:Araport11)
AT4G27730 oligopeptide transporter
AT4G27800 Choroplast protein phosphatase TAP38/PPH1 is required for efficient dephosphorylation of the LHCII anthena and state transition from state 2 to state 1.
AT4G27820 beta glucosidase 9;(source:Araport11)
AT4G27830 Encodes a beta-glucosidase that may be responsible for acyl-glucose-dependent anthocyanin glucosyltransferase activity in Arabidopsis. In vitro efforts to demonstrate AAGT activity for BGLU10 have been unsuccessful but experiments with mutants in this gene suggest at least an indirect involvement in anthocyanin formation.
AT4G27860 vacuolar iron transporter (VIT) family protein;(source:Araport11)
AT4G27900 CCT motif family protein;(source:Araport11)
AT4G27940 manganese tracking factor for mitochondrial SOD2;(source:Araport11)
AT4G27950 Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin.
AT4G27960 ubiquitin conjugating enzyme
AT4G27970 Encodes a protein with ten predicted transmembrane helices. The SLAH2 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. But, it is not expressed in guard cells and cannot complement a slac1-2 mutant suggesting that it performs a different function. SLAH2:GFP localizes to the plasma membrane.
AT4G28080 Encodes REDUCED CHLOROPLAST COVERAGE 2 (REC2). Along with REC1 and REC3 it contributes to establishing the size of the chloroplast compartment.
AT4G28090 SKU5 similar 10;(source:Araport11)
AT4G28110 Member of the R2R3 factor gene family. Expression is induced in response to desiccation, ABA and salt treatment. Overexpression of Myb41 results in abnormal cuticle development and decreased cell expansion.
AT4G28130 diacylglycerol kinase 6;(source:Araport11)
AT4G28140 encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. Regulated by heat shock.
AT4G28160 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT4G28162 Natural antisense transcript overlaps with AT4G28160;(source:Araport11)
AT4G28270 Encodes a RING finger E3 ubiquitin ligase. Binds and ubiquitinates ABP1 in vivo and in vitro.
AT4G28330 pyrroline-5-carboxylate reductase;(source:Araport11)
AT4G28370 Encodes an E3 ubiquitin ligase that is involved in plant cell wall modification, seed mucilage extrusion, and controls the degree of pectin methylesterification in seed mucilage. fly1 mutant seeds release more compact mucilage capsules and detached outer tangential primary walls when hydrated in water. Fly1 is located in the endomembrane system, likely localized in late endosome/multivesicular bodies/prevacular compartment. It has been shown to ubiquitinate proteins in conjunction with UBA1 and UBC8.
AT4G28395 related to lipid transfer proteins
AT4G28397 non-specific lipid-transfer-like protein;(source:Araport11)
AT4G28410 Tyrosine transaminase family protein;(source:Araport11)
AT4G28430 Reticulon family protein;(source:Araport11)
AT4G28460 Activates immune responses through RECEPTOR-LIKE KINASE7 (RLK7). Induces stomatal closure is dependent on RLK7 and the transcription of genes involved in SA production and SA-dependent stomatal closure. SA promotes the flg22-induced expression of PIP1 preligand, prePIP1.
AT4G28480 DNAJ heat shock family protein;(source:Araport11)
AT4G28485 The structure of this gene is mis-annotated in TAIR10. Please refer to PMID:20712629 and the Comment field on the TAIR locus page for revised annotation.
AT4G28500 NAC domain containing protein 73;(source:Araport11)
AT4G28530 Member of NAC family of transcription factors. Along with NAC2, KIR1 positively regulates programmed cell death of stigmatic tissue.
AT4G28540 Member of CKL gene family (CKL-C group).
AT4G28556 Encodes RIC7, the downstream effector of active Rop2 GTPase.
AT4G28560 encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Most similar to RIC6 and RIC8 (subfamily group II). Gene is expressed in all tissues examined.
AT4G28570 Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11)
AT4G28590 Encodes a dual-targeted nuclear/plastidial phytochrome signaling component required for PEP assembly. It controls PhAPG expression primarily from the nucleus by interacting with phytochromes and promoting their localization to photobodies for the degradation of the transcriptional regulators PIF1 and PIF3. RCB-dependent PIF degradation in the nucleus signals the plastids for PEP assembly and PhAPG expression.
AT4G28600 encodes a calmodulin-binding protein that is expressed in pollen, suspension culture cells, flowers, and fruits.
AT4G28650 Encodes one of the two putative eLRR kinase closely related to PXY (At1g08590/PXL1 and At4g28650/PXL2). Insertion mutants in either pxl1 or pxl2 do not exhibit an obvious phenotype in the stem; double-mutant combinations of a Col allele, of pxy (pxy-3) with pxl1 and pxl2, generate a more severe vascular phenotype than pxy-3 alone, suggesting that these genes act synergistically with PXY in regulating vascular-tissue development in the stem.
AT4G28660 Similar to PsbW subunit of photosystem II.
AT4G28670 cysteine-rich RECEPTOR-like kinase, putative (DUF26);(source:Araport11)
AT4G28690 hypothetical protein;(source:Araport11)
AT4G28700 ammonium transporter 1;(source:Araport11)
AT4G28703 RmlC-like cupins superfamily protein;(source:Araport11)
AT4G28720 Auxin biosynthetic gene regulated by RVE1. Overexpression leads to suppression of bri1 phenotype.
AT4G28730 Encodes a glutaredoxin GrxC5. GrxC5 exists as two forms when expressed in Escherichia coli. The monomeric apoprotein possesses deglutathionylation activity mediating the recycling of plastidial methionine sulfoxide reductase B1 and peroxiredoxin IIE, whereas the dimeric holoprotein incorporates a [2Fe-2S] cluster.
AT4G28740 LOW PSII ACCUMULATION-like protein;(source:Araport11)
AT4G28750 mutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Subunit E of Photosystem I
AT4G28760 methyl-coenzyme M reductase II subunit gamma, putative (DUF3741);(source:Araport11)
AT4G28780 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT4G28790 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT4G28800 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT4G28811 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT4G28840 Encodes TCP INTERACTOR-CONTAINING EAR MOTIF PROTEIN 1 (TIE1), an important repressor of CINCINNATA (CIN)-like TEOSINTE BRANCHED1/CYCLOIDEA/PCF (TCP) transcription factors, which are key for leaf development.
AT4G28860 Member of CKL gene family (CKL-A group)
AT4G28890 RING/U-box superfamily protein;(source:Araport11)
AT4G29020 glycine-rich protein;(source:Araport11)
AT4G29030 Putative membrane lipoprotein;(source:Araport11)
AT4G29080 phytochrome-associated protein 2 (PAP2)
AT4G29103 transmembrane protein;(source:Araport11)
AT4G29120 6-phosphogluconate dehydrogenase family protein;(source:Araport11)
AT4G29130 Encodes a hexokinase (HXK1) in the plant glucose-signaling network. Functions as a glucose sensor to interrelate nutrient, light, and hormone signaling networks for controlling growth and development in response to the changing environment.
AT4G29140 Encodes Activated Disease Susceptibility 1 (ADS1), a putative MATE (multidrug and toxic compound extrusion) transport protein that negatively regulates plant disease resistance.
AT4G29160 SNF7 family protein;(source:Araport11)
AT4G29190 Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11)
AT4G29200 Over-expressed by salt stress.
AT4G29220 phosphofructokinase 1;(source:Araport11)
AT4G29230 NAC domain protein involved in negative regulation of flowering.
AT4G29273 Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT4G29290 Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT4G29300 Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT4G29305 Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT4G29430 ribosomal protein S15A E;(source:Araport11)
AT4G29440 Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11)
AT4G29450 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT4G29460 Encodes one of the four Arabidopsis phospholipase PLA2 parologs: AT2G06925 (PLA2-ALPHA), AT2G19690 (PLA2-BETA), AT4G29460 (PLA2-GAMMA) and AT4G29470 (PLA2-DELTA). Involved in pollen development and germination and tube growth.
AT4G29570 Cytidine/deoxycytidylate deaminase family protein;(source:Araport11)
AT4G29690 Alkaline-phosphatase-like family protein;(source:Araport11)
AT4G29700 Alkaline-phosphatase-like family protein;(source:Araport11)
AT4G29710 Alkaline-phosphatase-like family protein;(source:Araport11)
AT4G29720 polyamine oxidase 5;(source:Araport11)
AT4G29730 cell cycle-related repressor genes encoding WD-repeat proteins.
AT4G29780 Expression of the gene is affected by multiple stresses. Knockout and overexpression lines show no obvious phenotypes.
AT4G29900 one of the type IIB calcium pump isoforms. encodes an autoinhibited Ca(2+)-ATPase that contains an N-terminal calmodulin binding autoinhibitory domain.
AT4G29905 hypothetical protein;(source:Araport11)
AT4G29920 Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. Loss of function mutants show increased sensitivity to salt stress and drought.
AT4G29930 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT4G29950 Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11)
AT4G29990 Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11)
AT4G30010 ATP-dependent RNA helicase;(source:Araport11)
AT4G30020 PA-domain containing subtilase family protein;(source:Araport11)
AT4G30030 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT4G30040 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT4G30050 transmembrane protein;(source:Araport11)
AT4G30064 Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT4G30074 Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT4G30080 Involved in root cap cell differentiation. Gene expression is regulated by mir160.Located in the nucleus.
AT4G30110 encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc
AT4G30120 encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc
AT4G30170 Peroxidase family protein;(source:Araport11)
AT4G30180 hypothetical protein;(source:Araport11)
AT4G30190 Belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal domain. Its plasma membrane localization is light-dependent.
AT4G30200 Encodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus.
AT4G30220 small nuclear ribonucleoprotein F;(source:Araport11)
AT4G30250 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT4G30260 Encodes one of the two YPT/RAB GTPase Interacting Protein 4a (YIP4a) and YIP4b (formerly YIP2), which form a TGN-localized complex with ECHIDNA (ECH). This complex is required for the secretion of cell wall polysaccharides.
AT4G30270 encodes a protein similar to endo xyloglucan transferase in sequence. It is also very similar to BRU1 in soybean, which is involved in brassinosteroid response.
AT4G30280 Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs.
AT4G30300 member of NAP subfamily
AT4G30330 Differs from PCP only in two amino acids, expression is regulated in a manner opposite to that of PCP in that it was upregulated in response to increasing ambient temperature.
AT4G30350 Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. Regulates root and root hair development downstream of KAI2-mediated signaling.
AT4G30360 member of Cyclic nucleotide gated channel family
AT4G30370 RING/U-box superfamily protein;(source:Araport11)
AT4G30390 UDP-arabinopyranose mutase;(source:Araport11)
AT4G30400 RING/U-box superfamily protein;(source:Araport11)
AT4G30410 sequence-specific DNA binding transcription factor;(source:Araport11)
AT4G30420 nodulin MtN21-like transporter family protein
AT4G30430 Member of TETRASPANIN family
AT4G30450 glycine-rich protein;(source:Araport11)
AT4G30510 yeast autophagy 18 B-like protein;(source:Araport11)
AT4G30520 Encodes SARK (SENESCENCE-ASSOCIATED RECEPTOR-LIKE KINASE). Regulates leaf senescence through synergistic actions of auxin and ethylene. It is one of a group of LRR-RLKs, designated as CLAVATA3 INSENSITIVE RECEPTOR KINASES (CIKs), that act as co-receptors and have essential roles in regulating CLV3-mediated stem cell homeostasis.
AT4G30530 Encodes a gamma-glutamyl peptidase, outside the GGT family, that can hydrolyze gamma-glutamyl peptide bonds. The mRNA is cell-to-cell mobile.
AT4G30550 Class I glutamine amidotransferase-like superfamily protein;(source:Araport11)
AT4G30662 hypothetical protein;(source:Araport11)
AT4G30760 Putative endonuclease or glycosyl hydrolase;(source:Araport11)
AT4G30790 Encodes autophagy-related 2 (ATG11)
AT4G30810 serine carboxypeptidase-like 29;(source:Araport11)
AT4G30825 P-class pentatricopeptide repeat (PPR) protein essential for accumulation of the dicistronic atpH/F transcript in chloroplasts. Acts as barrier to prevent the atpH/F transcript degradation by exoribonucleases by binding to the consensus sequence of the atpF-atpA intergenic region.
AT4G30830 myosin-like protein (Protein of unknown function, DUF593);(source:Araport11)
AT4G30860 Encodes a member of the trxG protein family. Contains a SET domain which is known to be involved in modification of histone tails by methylation. Interacts physically with AMS, but the implications of this interaction are unknown.Overexpression results in plieotrophic developmental defects.
AT4G30872 other_RNA;(source:Araport11)
AT4G30890 Encodes a ubiquitin-specific protease.
AT4G30940 BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11)
AT4G30970 hypothetical protein;(source:Araport11)
AT4G30990 ARM repeat superfamily protein;(source:Araport11)
AT4G30993 Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11)
AT4G31000 Calmodulin-binding protein;(source:Araport11)
AT4G31020 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT4G31030 Putative membrane lipoprotein;(source:Araport11)
AT4G31080 Encodes one of two LUNAPARK proteins in Arabidopsis. Both LNPA and LNPB are predominantly distributed throughout the ER, but not preferentially localized at the three-way junctions. Mutation of both LNPA and LNPB together caused the cortical ER to develop poor ER cisternae and a less dense tubular network. E3 ligase involved in degradation of RHD3 to maintain a tubular ER network.
AT4G31115 DUF1997 family protein, putative (DUF1997);(source:Araport11)
AT4G31150 endonuclease V family protein;(source:Araport11)
AT4G31160 Encodes a DCAF/DWD protein capable of interacting with DDB1 and associating with CUL4, likely as part of a nuclear ubiquitin ligase complex. DCAF1 appears to be required for plant embryogenesis and to affect several other developmental processes including leaf, shoot, and flower development.
AT4G31170 Protein kinase superfamily protein;(source:Araport11)
AT4G31180 The IBI1 gene encodes an aspartyl tRNA synthetase (AspRS). In addition, the IBI1 protein acts as a receptor protein of the chemical plant defence activator beta-aminobutyric acid (BABA). Binding of IBI1 to the active R-enantiomer of BABA primes non-canonical defence activity of the AspRS protein against pathogen attack.
AT4G31260 hypothetical protein;(source:Araport11)
AT4G31320 SAUR-like auxin-responsive protein family;(source:Araport11)
AT4G31380 encodes a small protein with unknown function and is similar to flower promoting factor 1. This gene is not expressed in apical meristem after floral induction but is expressed in roots, flowers, and in low abundance, leaves.
AT4G31398 Natural antisense transcript overlaps with AT4G31400;(source:Araport11)
AT4G31400 Encodes CTF7, a homolog of the yeast CTF protein required for the formation of sister chromatid cohesion. Arabidopsis CTF7 is similar to Saccharomyces cerevisiae CTF7 in that it lacks an N-terminal extension, exhibits acetyltransferase activity, and can complement a yeast ctf7 temperature-sensitive mutation. Arabidopsis CTF7 is critical for female gametophyte and embryo development, but not for the establishment of mitotic cohesion during microgametogenesis or during endosperm development. Inactivation of CTF7 results in severe defects in reproduction and vegetative growth.
AT4G31440 transcriptional regulator of RNA polII, SAGA, subunit;(source:Araport11)
AT4G31450 RING/U-box superfamily protein;(source:Araport11)
AT4G31500 Encodes an oxime-metabolizing enzyme in the biosynthetic pathway of glucosinolates. Is required for phytochrome signal transduction in red light. Mutation confers auxin overproduction.
AT4G31550 member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae.
AT4G31580 Encodes a Serine/arginine-rich (SR) protein RSZp22. SR proteins are splicing regulators that share a modular structure consisting of one or two N-terminal RNA recognition motif domains and a C-terminal RS-rich domain. RSZp22 is located in the nucleolus. It is a nucleocytoplasmic shuttling protein and an interacting partner to the Arabidopsis U1-70K. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926.
AT4G31610 Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. Expressed specifically in reproductive meristems.
AT4G31620 Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily.
AT4G31660 AP2/B3-like transcriptional factor family protein;(source:Araport11)
AT4G31670 ubiquitin-specific protease 18;(source:Araport11)
AT4G31680 Transcriptional factor B3 family protein;(source:Araport11)
AT4G31690 transcriptional factor B3 family protein;(source:Araport11)
AT4G31700 Encodes a putative ribosomal protein S6 (rps6a). RPS6A and RPS6B are fully redundant and essential during gametogenesis.
AT4G31710 member of Putative ligand-gated ion channel subunit family
AT4G31770 Encodes a RNA lariat debranching enzyme required for embryogenesis.
AT4G31790 Tetrapyrrole (Corrin/Porphyrin) Methylase;(source:Araport11)
AT4G31805 Encodes POLAR, a scaffold protein associated with cellular asymmetry of meristemoids. Its transcript levels change after inducing MUTE expression in a mute background.
AT4G31810 ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11)
AT4G31820 A member of the NPY family genes (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Encodes a protein with similarity to NHP3. Contains BTB/POZ domain. Promoter region has canonical auxin response element binding site and Wus binding site. Co-localizes to the late endosome with PID. Regulates cotyledon development through control of PIN1 polarity in concert with PID. Also involved in sepal and gynoecia development.
AT4G31880 One of 5 PO76/PDS5 cohesion cofactor orthologs of Arabidopsis.
AT4G31890 ARM repeat superfamily protein;(source:Araport11)
AT4G31900 chromatin remodeling factor;(source:Araport11)
AT4G31910 Encodes an acyltransferase that can modify brassinosteroids (BRs) by acylation and may modulate endogenous BR levels.
AT4G31930 Mitochondrial glycoprotein family protein;(source:Araport11)
AT4G31980 PPPDE thiol peptidase family protein;(source:Araport11)
AT4G31990 Encodes a plastid-localized aspartate aminotransferase. Does not display any PAT (glutamate/aspartate-prephenate aminotransferase) activity even in the presence of a high concentration of prephenate.
AT4G32010 Transcriptional repressor involved in the recruitment of PRC2 for genome-wide polycomb silencing.
AT4G32020 serine/arginine repetitive matrix-like protein;(source:Araport11)
AT4G32050 neurochondrin family protein;(source:Araport11)
AT4G32060 Encodes an EF-hand protein with homology to constituents of the mitochondrial Ca2+ uniporter machinery in mammals. MICU binds Ca2+ and localizes to the mitochondria in Arabidopsis. It is a negative regulator of mitochondrial calcium uptake. Mutants display elevated matrix calcium at steady state and modified calcium transient kinetics in vivo.
AT4G32080 hypothetical protein;(source:Araport11)
AT4G32140 EamA-like transporter family;(source:Araport11)
AT4G32170 member of CYP96A
AT4G32200 meiotic asynaptic mutant 2, homologue of ASY1
AT4G32230 hypothetical protein;(source:Araport11)
AT4G32240 hypothetical protein;(source:Araport11)
AT4G32320 Encodes a cytosolic ascorbate peroxidase APX6. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms.
AT4G32330 WDL5 is an target of EIN3 that co-localizes with cortical microtubles. It its thought to function to stabilize microtubles during ethylene induced hypocotyl elongation.
AT4G32340 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT4G32342 hypothetical protein;(source:Araport11)
AT4G32350 Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11)
AT4G32370 Pectin lyase-like superfamily protein;(source:Araport11)
AT4G32400 Encodes a plastidial nucleotide uniport carrier protein required to export newly synthesized adenylates into the cytosol.
AT4G32410 Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening.
AT4G32440 Plant Tudor-like RNA-binding protein;(source:Araport11)
AT4G32470 Cytochrome bd ubiquinol oxidase, 14kDa subunit;(source:Araport11)
AT4G32500 Encodes AKT5, a member of the Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500).
AT4G32510 HCO3- transporter family;(source:Araport11)
AT4G32540 Mutant has elevated levels of free IAA in dominant mutant allele; Flavin Monooxygenase-Like Enzyme; Auxin Biosynthesis
AT4G32560 paramyosin-like protein;(source:Araport11)
AT4G32570 TIFY domain protein 8;(source:Araport11)
AT4G32630 ArfGap/RecO-like zinc finger domain-containing protein;(source:Araport11)
AT4G32670 RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11)
AT4G32780 FORKED-LIKE family member, part of Group 2 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions.
AT4G32790 Exostosin family protein;(source:Araport11)
AT4G32810 Encodes a protein with similarity to carotenoid cleaving deoxygenases, the enzymes that cleave beta-carotene. Involved in the production of a graft transmissable signal to suppress axillary branching. Protein is localized to chloroplast stroma and expressed primarily in root tip. Mutants in the gene exhibit increased shoot branching, and light-dependent defects in hook opening and hypocotyl/root elongation. Only upregulated by auxin in the root and hypocotyl, and this is not required for the inhibition of shoot branching.
AT4G32820 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT4G32840 phosphofructokinase 6;(source:Araport11)
AT4G32860 Avr9/Cf-9 rapidly elicited protein;(source:Araport11)
AT4G32880 member of homeodomain-leucine zipper family, acting as a differentiation-promoting transcription factor of the vascular meristems.
AT4G32890 Encodes a member of the GATA factor family of zinc finger transcription factors.
AT4G32940 Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteinases that is expressed in vegetative organs and is upregulated in association with various types of cell death and under stressed conditions. They are essential in processing seed storage proteins and for mediating the susceptible response of toxin-induced cell death.
AT4G33000 Encodes a member of the calcineurin B-like calcium sensor gene family. Mediates salt tolerance by regulating ion homeostasis in Arabidopsis.
AT4G33010 glycine decarboxylase P-protein 1;(source:Araport11)
AT4G33040 Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2.
AT4G33070 Thiamine pyrophosphate dependent pyruvate decarboxylase family protein;(source:Araport11)
AT4G33150 This is a splice variant of the LKR/SDH locus. It encodes a bifunctional polypeptide lysine-ketoglutarate reductase and saccharopine dehydrogenase involved in lysine degradation. There is another splice variant that encodes a mono saccharopine dehydrogenase protein. Gene expression is induced by abscisic acid, jasmonate, and under sucrose starvation.
AT4G33160 F-box family protein;(source:Araport11)
AT4G33170 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT4G33220 pectin methylesterase 44;(source:Araport11)
AT4G33230 Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT4G33240 Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant.
AT4G33270 Encodes a CDC20 protein that interacts with APC subunits, components of the mitochondrial checkpoint complex and mitotic cyclin substrates and is indispensable for normal plant development and fertility.
AT4G33310 hypothetical protein;(source:Araport11)
AT4G33330 Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition.
AT4G33390 WEAK CHLOROPLAST MOVEMENT UNDER BLUE LIGHT-like protein (DUF827);(source:Araport11)
AT4G33420 Peroxidase superfamily protein;(source:Araport11)
AT4G33430 Leu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. Contributes to postinvasive immunity against Alternaria brassicola.
AT4G33440 Pectin lyase-like superfamily protein;(source:Araport11)
AT4G33460 Member of NAP subfamily. Putative component of chloroplast ECF/ABC-Transporter involved in metal homeostasis.
AT4G33467 hypothetical protein;(source:Araport11)
AT4G33480 BTB/POZ domain protein TNFAIP protein;(source:Araport11)
AT4G33490 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT4G33495 A member of the RPD gene family - there are13 annotated genes and one EST encoding RPD1-like proteins in Arabidopsis. Shows no homology to any protein of known function. Abundant expression found in the shoot apex and the root. rpd1 mutant is a temperature-sensitive mutant isolated on the basis of the impairment in adventitious roots formation in hypocotyl region. Also, disruption of the RPD1 gene by a T-DNA insertion caused embryogenesis arrest at the globular to transition stages. This phenotype is consistent with the hypothesized function of RPD1 in the maintenance of active cell proliferation.
AT4G33500 Protein phosphatase 2C family protein. Loss of function enhances immunity to bacterial pathogens.
AT4G33530 potassium transporter
AT4G33540 metallo-beta-lactamase family protein;(source:Araport11)
AT4G33560 Member of the wound-induced polypeptide (WIP) family.
AT4G33565 RING/U-box superfamily protein;(source:Araport11)
AT4G33580 beta carbonic anhydrase 5;(source:Araport11)
AT4G33590 transmembrane protein;(source:Araport11)
AT4G33600 transmembrane protein;(source:Araport11)
AT4G33620 Encodes a SUMO protease that, along with ASP1,is required for fertility as asp1/spf2 double mutants have defects in gametogenesis and embroygenesis.
AT4G33640 costars family protein;(source:Araport11)
AT4G33660 cysteine-rich TM module stress tolerance protein;(source:Araport11)
AT4G33666 hypothetical protein;(source:Araport11)
AT4G33780 ATP phosphoribosyltransferase regulatory subunit;(source:Araport11)
AT4G33800 hypothetical protein;(source:Araport11)
AT4G33820 Glycosyl hydrolase superfamily protein;(source:Araport11)
AT4G33830 Glycosyl hydrolase family 10 protein;(source:Araport11)
AT4G33840 Glycosyl hydrolase family 10 protein;(source:Araport11)
AT4G33850 Pseudogene of AT4G33850; glycosyl hydrolase family 10 protein
AT4G33860 Glycosyl hydrolase family 10 protein;(source:Araport11)
AT4G33890 Component of SAGA complex, SPT module subunit, interacts with HAG1.
AT4G33900 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT4G33905 Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11)
AT4G33950 Encodes calcium-independent ABA-activated protein kinase, a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Mutations disrupted ABA induction of stomatal closure as well as ABA inhibition of light-induced stomatal opening. However, regulation of stomatal opening/closing by light or CO(2) is not affected in these mutants. May act in the interval between ABA perception and reactive oxygen species production in the ABA signalling network.
AT4G33985 membrane insertase, putative (DUF1685);(source:Araport11)
AT4G33990 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT4G34050 Methyltransferase in the lignin biosynthetic pathway.
AT4G34060 Encodes a protein with 5-meC and thymine-DNA glycosylase activity with a preference for CpG and CpHpG sequences. Involved in maintaining methylation marks. Many targets of DML3 are senescence-associated genes (SAGs).
AT4G34065 Pseudogene of AT5G06265; hyaluronan mediated motility receptor-related
AT4G34131 UDP-glucosyl transferase 73B3;(source:Araport11)
AT4G34160 encodes a cyclin D-type protein involved in the switch from cell proliferation to the final stages of differentiation. The gene is transcriptionally regulated by cytokinin and brassinosteroid. Protein interacts with cyclin-dependent kinase inhibitor ICK1.
AT4G34170 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT4G34180 Encodes a cyclase-family protein that is a negative regulator of cell death that regulates pathogen-induced symptom development.
AT4G34215 Encodes a member of the SGNH-hydrolase superfamily of enzymes. The enzymes of the SGNH-hydrolase superfamily facilitate the hydrolysis of ester, thioester and amide bonds in a range of substrates including complex polysaccharides, lysophospholipids, acyl-CoA esters and other compounds.
AT4G34220 Encodes a receptor like kinase involved in ABA-mediated seedling development and drought tolerance.RDK1 is an atypical or pseudokinase and has no phosphorylation activity. Its expression is upregulated in response to ABA.interacts with ABI1 and other PP2C phosphatases.
AT4G34260 1,2-alpha-L-fucosidase;(source:Araport11)
AT4G34320 transmembrane protein, putative (DUF677);(source:Araport11)
AT4G34380 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT4G34390 extra-large GTP-binding protein 2;(source:Araport11)
AT4G34400 B3-type transcription factor, which promotes floral transition and is repressed by FLC/SVP and promoted by SOC1.
AT4G34410 Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Regulates programmed cell death (PCD) inhibitor genes. Involved in retarding programmed cell death under salt stress due to the regulation of processes participating in ROS inhibition. ERF-regulated transcripts belong to the tryptophan biosynthesis, tryptophan metabolism, and downstream plant hormone signal transduction pathways, where ERF109 potentially acts as a 'master switch' mediator of a cascade of consecutive events across the three pathways, promoting plant growth and re-adjustment to homeostasis due the direct participation in auxin biosynthesis leading to the plants ability to tolerate salt stress.
AT4G34440 Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807).
AT4G34450 Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation.
AT4G34480 O-Glycosyl hydrolases family 17 protein;(source:Araport11)
AT4G34490 CYCLASE ASSOCIATED PROTEIN
AT4G34500 Protein kinase superfamily protein;(source:Araport11)
AT4G34520 Encodes KCS18, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids).
AT4G34550 F-box protein;(source:Araport11)
AT4G34555 Ribosomal protein S25 family protein;(source:Araport11)
AT4G34560 transmembrane protein;(source:Araport11)
AT4G34580 Encodes COW1 (can of worms1), a phosphatidylinositol transfer protein essential for root hair tip growth. The N-terminus of the COW1 protein is 32% identical to an essential phosphatidylinositol transfer protein (PITP), the yeast Sec14 protein (sec14p) while the C-terminus is 34.5% identical to a late nodulin of Lotus japonicus, Nlj16. Expression of COW1 complements the growth defect associated with Sec14p dysfunction in yeast. GFP fused to the COW1 protein specifically accumulates at the site of root hair outgrowth.
AT4G34590 Encodes a basic domain leucine zipper (bZip) transcription factor bZIP11. Translation is repressed by sucrose. Directly regulates gene expression of ASN1 and ProDH2, which are enzyme-coding genes involved in amino acid metabolism. Susceptibility factor during Pseudomonas syringae infection.
AT4G34600 CAF2 is a peptide hormone expressed in the root stele that specifically binds the endodermis-expressed leucine-rich repeat receptor kinase GASSHO1 (GSO1)/SCHENGEN3 and its homolog, GSO2. Together with CAF1 it is required for formation of the casparian band.
AT4G34610 BEL1-like homeodomain 6;(source:Araport11)
AT4G34650 Encodes a protein with similarity to squalene synthase which catalyzes the first committed step in sterol biosynthesis. To date no experimental evidence exists that SQS2 functions as a squalene synthase and some experiments indicate it does not have this function.
AT4G34660 SH3 domain-containing protein;(source:Araport11)
AT4G34700 Encodes the B22 subunit of eukaryotic mitochondrial Complex I. Mutation in the gene display pleiotropic phenotypes including shorter roots, smaller plants and delayed flowering. The mRNA is cell-to-cell mobile.
AT4G34710 Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1.
AT4G34730 ribosome-binding factor A family protein;(source:Araport11)
AT4G34760 SAUR-like auxin-responsive protein family;(source:Araport11)
AT4G34770 SAUR-like auxin-responsive protein family;(source:Araport11)
AT4G34780 SAUR-like auxin-responsive protein family;(source:Araport11)
AT4G34790 Putative OXS2-binding DEGs were constitutively activated by OXS2.
AT4G34890 Encodes a xanthine dehydrogenase, involved in purine catabolism. Ubiquitously expressed, but the transcript level is altered during aging, senescence, salt and cold stress, ABA treatment, and dark treatment. RNAi lines that suppress both XDH1 and XDH2 produce small plants with reduced fertility and accelerated leaf senescence. Role in drought tolerance.
AT4G34900 xanthine dehydrogenase 2;(source:Araport11)
AT4G34920 PLC-like phosphodiesterases superfamily protein;(source:Araport11)
AT4G34930 PLC-like phosphodiesterases superfamily protein;(source:Araport11)
AT4G34940 Armadillo repeat protein. One of a family of four in Arabidopsis. Located in the nucleus and cytoplasm of pollen vegetative cells, and in the cytoplasm of egg cells. Involved in the signaling network controlling tip growth and actin organization in the pollen tube.
AT4G34950 Major facilitator superfamily protein;(source:Araport11)
AT4G34960 Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11)
AT4G34970 A member of actin polymerizing factors (ADFs)family, ADF9 primarily functions as an actin bundling protein.
AT4G34980 Serine protease similar to subtilisin.
AT4G34990 Member of the R2R3 factor gene family.
AT4G35000 Encodes a microsomal ascorbate peroxidase APX3. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. The APX3 protein interacts with AKR2 (ankyrin-containing protein that interacts with AFT1) and AFT1, a 14-3-3 protein.
AT4G35025 This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT4G35040 Basic-region leucine zipper (bZIP19) transcription factor involved in the adaptation to zinc deficiency. Binds ZDRE motifs.
AT4G35070 SBP (S-ribonuclease binding protein) family protein;(source:Araport11)
AT4G35100 a member of the plasma membrane intrinsic protein PIP. functions as aquaporin. Salt-stress-inducible MIP
AT4G35120 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT4G35160 Encodes a cytosolic N-acetylserotonin O-methyltransferase that can convert N-acetylserotonin to melatonin and serotonin to 5-methoxytryptamine in the process of melatonin synthesis. It does not have caffeic acid O- methyltransferase activity.
AT4G35180 LYS/HIS transporter 7;(source:Araport11)
AT4G35190 Putative lysine decarboxylase family protein;(source:Araport11)
AT4G35220 Cyclase family protein;(source:Araport11)
AT4G35230 Encodes BR-signaling kinase 1 (BSK1), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized.
AT4G35240 DNA-directed RNA polymerase subunit beta, putative (DUF630 and DUF632);(source:Araport11)
AT4G35250 HCF244 is a member of the atypical short-chain dehydrogenase/reductase superfamily, a modified group, which has lost enzyme activity.HCF244 interacts with unknown partners in a 200-400 kD membrane associated complex.
AT4G35280 Target promoter of the male germline-specific transcription factor DUO1.
AT4G35310 calmodulin-domain protein kinase CDPK isoform 5 (CPK5)
AT4G35360 pantothenate kinase;(source:Araport11)
AT4G35370 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT4G35380 Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking.
AT4G35390 AT-hook protein of GA feedback 1;(source:Araport11)
AT4G35460 NADPH-dependent thioredoxin reductase 1 (NTR1. Similar to E.coli NTR and has conserved NADPH binding domains.
AT4G35480 Encodes a putative RING-H2 finger protein RHA3b.
AT4G35490 mitochondrial ribosomal protein L11;(source:Araport11)
AT4G35510 PHD finger-like protein;(source:Araport11)
AT4G35530 phosphatidylinositolglycan-like protein;(source:Araport11)
AT4G35550 Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. WOX13 is the only family member that does not contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box.
AT4G35560 Target promoter of the male germline-specific transcription factor DUO1. The mRNA is cell-to-cell mobile.
AT4G35570 Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Cannot be phosphorylated by CK2alpha.
AT4G35630 Encodes a phosphoserine aminotransferase which is involved in serine biosynthesis in the chloroplast which operates via the phosphorylated pathway. The mRNA is cell-to-cell mobile.
AT4G35655 RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11)
AT4G35680 selection/upkeep of intraepithelial T-cells protein;(source:Araport11)
AT4G35690 hypothetical protein (DUF241);(source:Araport11)
AT4G35790 Encodes a protein with phospholipase D activity. Involved in phospolipase metabolism. Mutants are affected in hydrogen peroxide mediated cell death.
AT4G35800 Encodes the unique largest subunit of nuclear DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB1 and a homolog of the E. coli RNA polymerase beta prime subunit.
AT4G35810 2-oxoglutarate-dependent dioxygenase
AT4G35900 bZIP protein required for positive regulation of flowering. Mutants are late flowering. FD interacts with FT to promote flowering.Expressed in the shoot apex in floral anlagen, then declines in floral primordia.
AT4G35905 Trm112p-like protein;(source:Araport11)
AT4G35920 Encodes an integral plasma membrane protein. Functionally complements the yeast mid1 mutant, a deficiency of Ca2+ influx. Involved in Ca2+ influx and mechanical sensing in roots. An over-expression line showed increased Ca2+ uptake than the wild type plant. The primary root of a knock-out mutant failed to penetrate a harder agar medium from a softer medium.
AT4G35970 Encodes a microsomal ascorbate peroxidase APX5. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms.
AT4G35985 Senescence/dehydration-associated protein-like protein;(source:Araport11)
AT4G36010 Pathogenesis-related thaumatin superfamily protein;(source:Araport11)
AT4G36030 Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules.
AT4G36060 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT4G36070 member of Calcium Dependent Protein Kinase
AT4G36105 polyamine-modulated factor 1-binding protein;(source:Araport11)
AT4G36110 SAUR-like auxin-responsive protein family;(source:Araport11)
AT4G36120 filament-like protein (DUF869);(source:Araport11)
AT4G36130 Ribosomal protein L2 family;(source:Araport11)
AT4G36160 Encodes a NAC-domain transcription factor that is expressed in developing xylem. Over expression of this protein causes ectopic secondary cell wall growth. Complements some of the cell wall defects seen in SND1/NST1 double mutants.
AT4G36170 hypothetical protein;(source:Araport11)
AT4G36180 LRR-RLK which regulates lateral root development.
AT4G36210 transmembrane/coiled-coil protein (DUF726);(source:Araport11)
AT4G36220 encodes ferulate 5-hydroxylase (F5H). Involved in lignin biosynthesis.
AT4G36230 transmembrane protein;(source:Araport11)
AT4G36250 Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures.
AT4G36260 A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Encodes protein with a single zinc finger motif and a members of a small gene family of putative transcription factors in which the SHORT INTERNODES (SHI) gene is found. STY2/STY1 double mutants showed defective style, stigma as well as serrated leaves.
AT4G36280 Member of the microrchidia protein family which have been described as epigenetic regulators and plant immune mediators, contains a hallmark GHKL-type ATPase domain in N-terminus.
AT4G36290 R-protein-interacting protein that localizes to endosomes and functions in resistance gene?mediated immunity. Belongs to the conserved Microrchidia (MORC) adenosine triphosphatase (ATPase) family, predicted to catalyze alterations in chromosome superstructure. Required for heterochromatin condensation and gene silencing.
AT4G36350 purple acid phosphatase 25;(source:Araport11)
AT4G36380 Encodes a cytochrome P-450 gene that is involved in leaf blade expansion by controlling polar cell expansion in the leaf length direction. Member of the CYP90C CYP450 family. ROT3 was shown to be involved in brassinosteroid biosynthesis, most likely in the conversion step of typhasterol (TY) to castasterone (CS). As 6-deoxo-CS was unable to restore the phenotype of rot3-1, it has been postulated that ROT3 might be specifically involved in the conversion of TY to CS in the C6-oxidation pathway of brassinolide. Recently, CYP90C1 was shown to catalyse the C-23 hydroxylation of several brassinosteroids (the enzyme has a broad specificity for 22-hydroxylated substrates).
AT4G36390 Methylthiotransferase;(source:Araport11)
AT4G36400 Encodes a (D)-2-hydroxyglutarate dehydrogenase.
AT4G36410 ubiquitin-conjugating enzyme
AT4G36420 Ribosomal protein L12 family protein;(source:Araport11)
AT4G36430 Peroxidase superfamily protein;(source:Araport11)
AT4G36480 Encodes the LCB1 subunit of serine palmitoyltransferase. Together with the LCB2 subunit, forms a functional serine palmitoyltransferase complex, which catalyzes the first reaction of sphingolipid biosynthesis. Knockout of LCB1 was embryo lethal. Partial suppression of LCB1 expression led to smaller plants due to reduced cell expansion.
AT4G36490 SEC14-like 12;(source:Araport11)
AT4G36510 hypothetical protein;(source:Araport11)
AT4G36515 trichohyalin-like protein;(source:Araport11)
AT4G36530 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT4G36540 Encodes the brassinosteroid signaling component BEE2 (BR-ENHANCED EXPRESSION 2). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings.
AT4G36550 Plant U-box type E3 ubiquitin ligase (PUB).
AT4G36560 transmembrane protein;(source:Araport11)
AT4G36580 AAA-type ATPase family protein;(source:Araport11)
AT4G36590 MADS-box transcription factor family protein;(source:Araport11)
AT4G36610 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT4G36640 Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT4G36670 Major facilitator superfamily protein;(source:Araport11)
AT4G36680 Ribosomal pentatricopeptide repeat protein
AT4G36690 Regulates flowering time and displays a redundant role in pollen tube growth together with AtU2AF65b.
AT4G36700 RmlC-like cupins superfamily protein;(source:Araport11)
AT4G36730 member of a gene family encoding basic leucine zipper proteins (GBFs) which bind the G-box
AT4G36760 Arabidopsis aminopeptidase P1 The mRNA is cell-to-cell mobile.
AT4G36790 Major facilitator superfamily protein;(source:Araport11)
AT4G36808 Natural antisense transcript overlaps with AT4G36810;(source:Araport11)
AT4G36830 ELO family protein.
AT4G36860 DAR1 is a member of a small (7 member) ubiquitin binding protein family. It appears to play a role in regulation of endoreduplication in leaf epidermal tissue.
AT4G36880 cysteine proteinase1;(source:Araport11)
AT4G36890 IRX14 was identified as MUCI64 in a reverse genetic screen for MUCILAGE-RELATED genes. IRX14/MUCI64 is a GT43 protein essential for xylan elongation in seed coat mucilage. The xylan backbone maintains the attachment of mucilage to the seed surface and the distribution of cellulose. It was identified based on its gene expression co-variance with the IRX3 gene involved in secondary cell wall synthesis. A biochemical assay using the irx14 mutant indicates that IRX14 might function in xylose chain elongation.
AT4G36925 transmembrane protein;(source:Araport11)
AT4G36930 Encodes a transcription factor of the bHLH protein family. Mutants have abnormal, unfused carpels and reduced seed dormancy.
AT4G36940 nicotinate phosphoribosyltransferase 1;(source:Araport11)
AT4G36970 Remorin family protein;(source:Araport11)
AT4G36990 Encodes a protein whose sequence is similar to heat shock factors that regulate the expression of heat shock proteins. Transcript level is increased in response to heat shock. However, overexpression of this gene did not result in the increase of decrease of heat shock proteins.
AT4G37000 Mutants have spontaneous spreading cell death lesions and constitutive activation of defenses in the absence of pathogen infection. Its product was shown to display red chlorophyll catabolite reductase (RCCR), which catalyzes one step in the breakdown of the porphyrin component of chlorophyll. The enzyme was further assessed to be a Type-1 (pFCC-1-producing) RCCR.Upon P. syringae infection, ACD2 localization shifts from being largely in chloroplasts to partitioning to chloroplasts, mitochondria, and to a small extent, cytosol. Overexpression of ACD2 delayed cell death and the replication of P. syringae.
AT4G37010 Encodes a member of the Centrin family. Mutants are hypersensitive to UV and prone to UV induced DNA damage. Based on sequence similarity and mutant phenotype CEN2 is thought to be involved in nucelotide excision repair/DNA repair.
AT4G37030 membrane protein;(source:Araport11)
AT4G37040 encodes a methionine aminopeptidase
AT4G37050 Patatin-related phospholipase A. Expressed in the floral gynaecium and is induced by abscisic acid (ABA) or phosphate deficiency in roots.
AT4G37080 ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547);(source:Araport11)
AT4G37100 Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11)
AT4G37150 Encodes a protein shown to have carboxylesterase activity, methyl salicylate esterase activity, methyl jasmonate esterase activity, and methyl IAA esterase activity in vitro. MES9 appears to be involved in MeSA hydrolysis in planta. Expression of MES9 can restore systemic acquired resistance in SAR-deficient tobacco plants. This protein does not act on MeGA4, or MEGA9 in vitro.
AT4G37160 SKU5 similar 15;(source:Araport11)
AT4G37170 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT4G37190 plasma membrane, autoregulation-binding site, misato segment II, myosin-like, tubulin/FtsZ protein;(source:Araport11)
AT4G37235 Uncharacterized protein family (UPF0497);(source:Araport11)
AT4G37240 PADRE protein down-regulated after infection by S. sclerotiorun.
AT4G37250 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT4G37295 Encodes an 86 AA polypeptide sequence that produces an 11 AA secreted, bioactive peptide. It is induced by BD16. The peptide is bound by the RLK7 receptor kinase and inhibits the formation of lateral root founder cells. Homolog of prePIP1.
AT4G37310 member of CYP81H
AT4G37320 member of CYP81D
AT4G37330 member of CYP81D
AT4G37340 member of CYP81D
AT4G37360 member of CYP81D
AT4G37420 glycosyltransferase family protein (DUF23);(source:Araport11)
AT4G37430 Encodes a member of the CYP81F cytochrome P450 monooxygenase subfamily.
AT4G37445 calcium ion-binding protein;(source:Araport11)
AT4G37450 AGP18 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP17 and AGP19, other lysine-rich AGPs. It is expressed in young leaves, shoots, roots and flowers and is active in the regulation of the selection and survival of megaspores.
AT4G37460 Encodes a tetratricopeptide repeat domain containing protein that shows sequence similarity to those of transcriptional repressors in other organisms. Involved in mediating effector-triggered immunity.
AT4G37470 HTL belonging to the alpha/beta fold hydrolase superfamily. Mutant and over-expression studies indicates its involvement in seedling de-etiolation process. Involved in the perception of karrikins. Interacts with MAX2. Important for cotyledon expansion.
AT4G37490 Cyclin-dependent protein kinase CYCB1;1. Functions as an effector of growth control at G2/M. Regulated by TCP20.
AT4G37510 Ribonuclease III family protein;(source:Araport11)
AT4G37553 Natural antisense transcript overlaps with AT4G37550 and AT4G37560;(source:Araport11)
AT4G37580 involved in apical hook development. putative N-acetyltransferase
AT4G37590 A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis.
AT4G37620 transposable_element_gene;(source:Araport11);similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT4G09490.1);(source:TAIR10)
AT4G37630 core cell cycle genes; a quantitative trait gene for endoreduplication.
AT4G37650 Involved in radial organization of the root and shoot axial organs. Essential for normal shoot gravitropism. The protein moves in a highly specific manner from the cells of the stele in which it is synthesized outward. Movement requires sequences within the GRAS and VHIID domains. SHORT-ROOT forms a network in combination with JACKDAW, BLUEJAY AND SCARECROW to regulate tissue patterning through asymmetric cell division. The ground tissue lineage remains in shortroot mutant, while it is progressively lost in the triple mutant bluejay jackdaw scarecrow and double mutant jackdaw scarecrow. In addition, ground tissue basal identity remains in shortroot mutant while it is defective in the quadruple mutant bluejay jackdaw magpie nutcracker.
AT4G37660 Ribosomal protein L12/ ATP-dependent Clp protease adaptor protein ClpS family protein;(source:Araport11)
AT4G37705 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.5e-203 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10)
AT4G37710 VQ motif-containing protein;(source:Araport11)
AT4G37720 Probable phytosulfokines 6 precursor, coding for a unique plant peptide growth factor.
AT4G37730 basic leucine-zipper 7;(source:Araport11)
AT4G37750 ANT is required for control of cell proliferation and encodes a putative transcriptional regulator similar to AP2. Loss of function alleles have reduced fertility, abnormal ovules and abnormal lateral organs. Expressed in the chalaza, floral organ primordia, and lateral shoot organ primordia. Regulates growth and cell numbers during organogenesis.
AT4G37760 squalene epoxidase 3;(source:Araport11)
AT4G37770 Encodes an auxin inducible ACC synthase.
AT4G37820 transmembrane protein;(source:Araport11)
AT4G37840 Encodes a putative hexokinase.
AT4G37850 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT4G37860 SPT2 chromatin protein;(source:Araport11)
AT4G37890 Involved in shoot regenaration from root explants.
AT4G37930 Encodes a protein with mitochondrial serine hydroxymethyltransferase activity, which functions in the photorespiratory pathway, catalyzes the conversion of serine and tetrahydrofolate to glycine and 5,10-methylene tetrahydrofolate. Involved in controlling cell damage caused by abiotic stress, such as high light and salt and the hypersensitive defense response of plants.
AT4G37940 encodes a MADS box protein, highly expressed in the root.
AT4G37970 cinnamyl alcohol dehydrogenase 6;(source:Araport11)
AT4G38060 hypothetical protein;(source:Araport11)
AT4G38070 transcription factor bHLH131-like protein;(source:Araport11)
AT4G38190 encodes a gene similar to cellulose synthase
AT4G38230 member of Calcium Dependent Protein Kinase
AT4G38340 Chip-seq data indicates bZIP1 binds to the NLP3 promoter.
AT4G38360 LAZ1 is a DUF300 domain protein that appears to function in vacuolar transport effecting brassinosteroid and programmed cell dealth signaling pathways.
AT4G38370 Phosphoglycerate mutase family protein;(source:Araport11)
AT4G38510 One of three genes encoding the vacuolar ATP synthase subunit B1. The protein binds to and co-localizes with F-actin, bundles F-actin to form higher-order structure, and stabilizes actin filaments in vitro.
AT4G38552 Natural antisense transcript overlaps with AT4G38550;(source:Araport11)
AT4G38590 putative beta-galactosidase (BGAL14 gene)
AT4G38600 encodes a member of HECT ubiquitin protein ligase family that is involved in trichome cell morphogenesis. Mutants in this gene exhibit supernumerary trichome branches and increased DNA content.
AT4G38620 Encodes a R2R3 MYB protein which is involved in the response to UV-B. It functions as a repressor of target gene expression. One of its target genes encodes cinnamate 4-hydroxylase; mutants accumulate sinapate esters in their leaves. MYB4 binds to its own promoter and represses its own expression. Nuclear localization of MYB4 depends on the action of the beta importin SAD2. The mRNA is cell-to-cell mobile.
AT4G38630 Regulatory particle non-ATPase subunit of the 26S proteasome with multiubiquitin-chain-binding capabilities
AT4G38740 Encodes cytosolic cyclophilin ROC1.
AT4G38760 nucleoporin (DUF3414);(source:Araport11)
AT4G38850 mRNA is rapidly induced by auxin and is very short-lived. Has been used as a reporter gene in studying auxin mutants.
AT4G38860 SAUR-like auxin-responsive protein family;(source:Araport11)
AT4G38880 GLN PHOSPHORIBOSYL PYROPHOSPHATE AMIDOTRANSFERASE 2
AT4G38900 Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11)
AT4G38910 Encodes a basic pentacysteine protein that is localized to the nucleus and specifically binds in vitro to GA dinucleotide repeats.
AT4G38920 vacuolar-type H[+]-ATPase C3;(source:Araport11)
AT4G38932 Natural antisense transcript overlaps with AT4G38930;(source:Araport11)
AT4G38940 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT4G38950 ATP binding microtubule motor family protein;(source:Araport11)
AT4G38960 BBX19 is a B-box containing transcriptional regulator involved in photomorphogenesis and flowering.
AT4G38970 Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds.
AT4G38990 glycosyl hydrolase 9B16;(source:Araport11)
AT4G39000 glycosyl hydrolase 9B17;(source:Araport11)
AT4G39030 Encodes an orphan multidrug and toxin extrusion transporter. Essential component of salicylic acid-dependent signaling for disease resistance. Member of the MATE-transporter family. Expression induced by salicylic acid. Mutants are salicylic acid-deficient.
AT4G39100 Encodes a plant-specific histone reader capable of recognizing both H3K27me3 and H3K4me3 via its bromo-adjacent homology (BAH) and plant homeodomain (PHD) domains, respectively. Detailed biochemical and structural studies suggest a binding mechanism that is mutually exclusive for either H3K4me3 or H3K27me3. SHL plays a role in the repression of flowering.
AT4G39110 bups1 and bups1/2 double mutants have reduced feritlity due to premature rupture of pollen tubes before they reach the ovule. BUSP1 interacts with RALF4/19 peptide ligands and ANX1/2 receptors. BUPS/ANX signaling may regulate and promote pollen tube growth.
AT4G39140 RING/U-box superfamily protein;(source:Araport11)
AT4G39220 Key player of retrieval of ER membrane proteins
AT4G39290 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT4G39340 Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion.
AT4G39360 hypothetical protein;(source:Araport11)
AT4G39380 TSL-kinase interacting-like protein;(source:Araport11)
AT4G39400 Encodes a plasma membrane localized leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction. BRI1 ligand is brassinolide which binds at the extracellular domain. Binding results in phosphorylation of the kinase domain which activates the BRI1 protein leading to BR responses. Residue T-1049 and either S-1044 or T-1045 were essential for kinase function in vitro and normal BRI1 signaling in planta. The structure of BRI1 ligand-binding domain has been determined at 2.5A resolution. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. BRI1 appears to be involved in the autonomous pathway that regulates the transition to flowering, primarily through its effects on FLC expression levels, as uncovered by double mutant analyses. This most likely occurs as a result of BRI1-dependent effects on histone acetylation, but not histone triMeH3K4 methylation, at the FLC locus. The mRNA is cell-to-cell mobile.
AT4G39420 spatacsin carboxy-terminus protein;(source:Araport11)
AT4G39490 member of CYP96A
AT4G39500 cytochrome P450, family 96, subfamily A, polypeptide 11;(source:Araport11)
AT4G39530 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT4G39540 Encodes a shikimate kinase. Its transcripts appear to be expressed in vegetative tissues and developing embryos. SK2 transcript levels rise in response to Phytophthora infestans spores. SK2 is believed to be localized to the chloroplast.
AT4G39570 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT4G39610 MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11)
AT4G39650 The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in the apoplast of young siliques (within the ovules of the carpel) and is involved in the degradation of glutathione. The encoded enzyme also acts as part of a GSH pumping gamma-glutamyl cycle in this tissue and may also be involved in gamma-glutamyl amino acid formation.
AT4G39670 Member of the glycolipid transfer protein (GLTP) superfamily, shuttles ceramide-1-phosphate (C1P) between membranes.
AT4G39700 Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT4G39770 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT4G39780 encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.
AT4G39800 ** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization.
AT4G39810 Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11)
AT4G39840 cell wall integrity/stress response component-like protein;(source:Araport11)
AT4G39850 Encodes a peroxisomal protein of the ATP binding cassette (ABC) transporter class (PMP subfamily) with significant identity to the human X-linked adrenoleukodystrophy protein (ALDP). The gene product promotes germination and represses embryo dormancy. ABI3, ABA1, FUS3 and LEC1 are epistatic to this gene. Mutants accumulate fatty acyl CoA suggesting a defect in uptake of fatty acyl CoA into the peroxisome.
AT4G39860 hematological/neurological-like protein;(source:Araport11)
AT4G39880 Ribosomal protein L23/L15e family protein;(source:Araport11)
AT4G39890 RAB GTPase homolog H1C;(source:Araport11)
AT4G39910 Encodes a nuclear ubiquitin-specific protease.
AT4G39940 adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete The mRNA is cell-to-cell mobile.
AT4G39955 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT4G39960 Essential for chloroplast iron?sulfur cluster biogenesis.
AT4G39970 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT4G39990 Rab GTPase that selectively marks cell wall-containing TGN compartments. Involved in protein trafficking to membranes during tip growth.
AT4G40020 Myosin heavy chain-related protein;(source:Araport11)
AT4G40050 signal transducer, putative (DUF3550/UPF0682);(source:Araport11)
AT4G40060 Encodes a homeodomain leucine zipper class I (HD-Zip I) protein.
AT4G40070 RING/U-box superfamily protein;(source:Araport11)
AT4G40090 arabinogalactan protein 3;(source:Araport11)
AT5G01020 Protein kinase superfamily protein;(source:Araport11)
AT5G01030 enolase, putative (DUF3527);(source:Araport11)
AT5G01040 putative laccase, knockout mutant showed early flowering
AT5G01050 putative laccase, a member of laccase family of genes (17 members in Arabidopsis).
AT5G01070 RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11)
AT5G01100 O-fucosyltransferase family protein;(source:Araport11)
AT5G01110 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT5G01130 hypothetical protein (DUF674);(source:Araport11)
AT5G01140 hypothetical protein (DUF674);(source:Araport11)
AT5G01150 hypothetical protein (DUF674);(source:Araport11)
AT5G01170 hypothetical protein (DUF740);(source:Araport11)
AT5G01180 Encodes a dipeptide transporter expressed in pollen and ovules during early seed development. GFP-tagged PTR5 localizes to the plasma membrane.
AT5G01215 Natural antisense transcript overlaps with AT5G01210;(source:Araport11)
AT5G01220 Encodes a UDP-sulfoquinovose:DAG sulfoquinovosyltransferase that is involved in sulfolipid biosynthesis and whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots.
AT5G01225 josephin-like protein;(source:Araport11)
AT5G01250 alpha 1,4-glycosyltransferase family protein;(source:Araport11)
AT5G01270 Encodes CPL2, a carboxyl-terminal domain (CTD) phosphatase that dephosphorylates CTD Ser5-PO4 of the RNA polymerase II complex. Regulates plant growth, stress and auxin responses.
AT5G01310 Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro.
AT5G01320 Thiamine pyrophosphate dependent pyruvate decarboxylase family protein;(source:Araport11)
AT5G01360 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).The dwarf phenotype can only be seen in tbl3 tbl31 esk1 triple mutant. tbl3 and tbl31 are specifically involved in 3-O-monoacetylation of xylan.
AT5G01380 Homeodomain-like superfamily protein;(source:Araport11)
AT5G01390 DNAJ heat shock family protein;(source:Araport11)
AT5G01420 Glutaredoxin family protein;(source:Araport11)
AT5G01430 Got1/Sft2-like vescicle transport protein family;(source:Araport11)
AT5G01450 RING/U-box superfamily protein;(source:Araport11)
AT5G01490 Encodes a cation/proton antiporter, a member of low affinity calcium antiporter CAX2 family. Involved in root development under metal stress.
AT5G01520 Encodes a cytosolic RING-type E3 ubiquitin (Ub) ligase that is critical for ABA and high salinity responses during germination. AtAIRP2 and SDIR1 likely play a combinatory role in ABA signaling and the response to high salt in Arabidopsis.
AT5G01540 Encodes LecRKA4.1, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. Positively regulates pattern-triggered immunity.
AT5G01550 Encodes LecRKA4.2, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination.
AT5G01620 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).TBL35 are required only for xylan 3-O-monoacetylation and 2,3-di-O-acetylation. The biochemical phenotype can be observed in tbl35 esk1, double mutant and tbl34 tbl35 esk1 triple mutants.
AT5G01660 influenza virus NS1A-binding protein;(source:Araport11)
AT5G01680 member of Putative Na+/H+ antiporter family
AT5G01690 member of Putative Na+/H+ antiporter family
AT5G01700 Protein phosphatase 2C family protein;(source:Araport11)
AT5G01720 RAE1 is an F-box protein component of a SCF-type E3 ligase complex. It is part of an alumium induced regulatory loop: its activity is induced by STOP1 and it in turn ubiquitinates STOP1 which is then targeted for degradation.
AT5G01730 Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments.
AT5G01790 hypothetical protein;(source:Araport11)
AT5G01820 Encodes a CBL-interacting serine/threonine protein kinase.
AT5G01840 Encodes a member of the plant specific ovate protein family. Members of this family have been shown to bind to KNOX and BELL- like TALE class homeodomain proteins. This interaction may mediate relocalization of the TALE homeodomain from the nucleus to the cytoplasm. Functions as a transcriptional repressor that suppresses cell elongation. May also directly affect microtubule organization via interactions with TON2.
AT5G01880 RING/U-box superfamily protein;(source:Araport11)
AT5G01890 Leucine-rich receptor-like protein kinase family protein;(source:Araport11)
AT5G01950 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G02030 Mutant has additional lateral organs and phyllotaxy defect. Encodes a homeodomain transcription factor. Has sequence similarity to the Arabidopsis ovule development regulator Bell1. Binds directly to the AGAMOUS cis-regulatory element. Its localization to the nucleus is dependent on the coexpression of either STM or BP.
AT5G02035 microRNA ath-MIR2111b precursor;(source:Araport11)
AT5G02060 Uncharacterized protein family (UPF0497);(source:Araport11)
AT5G02090 hypothetical protein;(source:Araport11)
AT5G02110 Encodes CYCLIN D7;1. Overexpression of CYCD7;1 induces cell proliferation and cell enlargement in the embryo and endosperm leading to overgrowth.
AT5G02120 Encodes a one helix protein homologous to cyanobacterial high-light inducible proteins. The protein is localized to the thylakoid membrane and its transcript is transiently induced by exposure to high light conditions. The mRNA is cell-to-cell mobile.
AT5G02130 SSR1 encodes a tetratricopeptide repeat- containing protein localized in mitochondria. It is involved in root development, possibly by through effects on auxin transport. In ssr1 mutants, the expression PIN genes and trafficking of PIN2 is altered which in turn affects distribution of auxin in the roots.
AT5G02170 Transmembrane amino acid transporter family protein;(source:Araport11)
AT5G02180 Transmembrane amino acid transporter family protein;(source:Araport11)
AT5G02200 Encodes a small plant-specific protein with both nuclear localization and nuclear export signals that is specifically required, together with FHY1, for the light-regulated nuclear accumulation of phyA.
AT5G02250 Encodes a exoribonuclease involved in rRNA processing in mitochondria and chloroplasts.Loss of function mutations are pale green and require supplementation with sucrose for germination and early development. Plants are pale green due to defects in chloroplast biogenesis.
AT5G02260 member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio)
AT5G02310 Encodes PROTEOLYSIS6 (PRT6), a component of the N-end rule pathway that targets protein degradation through the identity of the amino-terminal residue of specific protein substrates. Another component of the N-end rule pathway is arginyl-tRNA:protein arginyltransferase (ATE). Arabidopsis contains two ATE genes: At5g05700/ATE1, At3g11240/ATE2. PRT6 and ATE were shown to regulate seed after-ripening, seedling sugar sensitivity, seedling lipid breakdown, and abscisic acid (ABA) sensitivity of germination. The mRNA is cell-to-cell mobile.
AT5G02385 pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10)
AT5G02400 Encodes a protein with similarity to the POL locus which is a novel protein phosphatase 2C. Ubiquitously expressed. No phenotype observed in homozygous null mutant background.
AT5G02410 Encodes ALG10, an ER-resident alpha1,2-glucosyltransferase that is required for lipid-linked oligosaccharide biosynthesis and subsequently for normal leaf development and abiotic stress response.
AT5G02450 Ribosomal protein L36e family protein;(source:Araport11)
AT5G02460 PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division.
AT5G02480 HSP20-like chaperones superfamily protein;(source:Araport11)
AT5G02502 Oligosaccaryltransferase;(source:Araport11)
AT5G02520 Arabidopsis KNL2 localizes at chromocenters during all stages of the mitotic cell cycle, except from metaphase to mid-anaphase, and its level is strictly regulated by the proteasome degradation pathway. Knockout of KNL2 via a T-DNA insertion resulted in a reduced amount of centromeric cenH3, mitotic and meiotic abnormalities, and reduced growth and fertility.
AT5G02540 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT5G02560 Encodes HTA12, a histone H2A protein.
AT5G02590 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT5G02600 Encodes a phloem mobile metal binding protein necessary for phloem function and root meristem maintenance.
AT5G02630 Lung seven transmembrane receptor family protein;(source:Araport11)
AT5G02640 hypothetical protein;(source:Araport11)
AT5G02660 ubiquitin carboxyl-terminal hydrolase-like protein, putative (DUF627 and DUF629);(source:Araport11)
AT5G02740 Ribosomal protein S24e family protein;(source:Araport11)
AT5G02750 Encodes an E3 ligase, SHOOT GRAVITROPISM9. Modulates the interaction between statoliths and F-Actin in gravity sensing.
AT5G02760 Encodes a phosphatase that functions in sustaining proper leaf longevity and preventing early senescence by suppressing or perturbing SARK-mediated senescence signal transduction.
AT5G02870 Ribosomal protein L4/L1 family;(source:Araport11)
AT5G02880 encodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis. The mRNA is cell-to-cell mobile.
AT5G02920 F-box/RNI-like superfamily protein;(source:Araport11)
AT5G02930 F-box/RNI-like superfamily protein;(source:Araport11)
AT5G03020 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT5G03040 Member of IQ67 (CaM binding) domain containing family.
AT5G03130 hypothetical protein;(source:Araport11)
AT5G03180 RING/U-box superfamily protein;(source:Araport11)
AT5G03190 peptide upstream protein;(source:Araport11)
AT5G03260 LAC11 is a putative laccase, a member of laccase family of genes (17 members in Arabidopsis).
AT5G03280 Involved in ethylene signal transduction. Acts downstream of CTR1. Positively regulates ORE1 and negatively regulates mir164A,B,C to regulate leaf senescence. A maternally expressed imprinted gene. Mutations in ein2 block ethylene stimulation of flavonol synthesis. The mRNA is cell-to-cell mobile.
AT5G03290 Encodes a catalytic subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase. The mRNA is cell-to-cell mobile.
AT5G03300 Encodes adenosine kinase 2 (ADK2), a typical, constitutively expressed housekeeping enzyme. Shows a high sequence identity with ADK1. Involved in salvage synthesis of adenylates and methyl recycling. Enzyme activity is substantially inhibited in roots, siliques and dry seeds by an unknown compound. May contribute to cytokinin interconversion. The mRNA is cell-to-cell mobile.
AT5G03320 Protein kinase superfamily protein;(source:Araport11)
AT5G03330 Cysteine proteinases superfamily protein;(source:Araport11)
AT5G03377 pseudogene of acylphosphatase family protein
AT5G03415 Encodes a homolog of the animal DP protein. DP, in animals, forms a heterodimer with E2F and plays a central role in G1/S transition in the cell division cycle. DPB has been shown to interact with non phosphorylated E2Fc; when E2Fc is phosphorylated, the formation of the E2Fc/DPB heterodimer is lost.
AT5G03435 Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11)
AT5G03450 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT5G03455 Encodes a homolog of yeast cell cycle regulator CDC25. It has a sole catalytic domain and devoid of the N-terminal regulatory region found in the human CDC25 and is capable of reducing the mitotic cell length of transformed fission yeast. Non-plant CDC25 proteins have been shown to do this. However, the gene is more or less constant, regardless of whether the tissue examined contained proliferative cells. Also described as having arsenate reductase activity involved in arsenate resistance.
AT5G03480 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT5G03495 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT5G03510 C2H2-type zinc finger family protein;(source:Araport11)
AT5G03520 GTPase that colocalizes with golgi and plasma membranes.
AT5G03530 Encodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. CFP:RabC2a appears to co-localize with peroxisomes.
AT5G03545 Expressed in roots in response to phosphate starvation, this response is enhanced by the presence of IAA. Additionally, its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. The mRNA is cell-to-cell mobile.
AT5G03550 MATH domain/coiled-coil protein;(source:Araport11)
AT5G03552 Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGCGGGAAGCAUUUGCACAUG
AT5G03580 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT5G03620 Subtilisin-like serine endopeptidase family protein;(source:Araport11)
AT5G03650 Encodes starch branching enzyme (E.C.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout the plant and highest in seedlings and cauline leaves.
AT5G03668 Natural antisense transcript overlaps with AT5G03670;(source:Araport11)
AT5G03670 histone-lysine N-methyltransferase SETD1B-like protein;(source:Araport11)
AT5G03680 Recessive mutations are defective in organ initiation and orientation in the second whorl. This gene encodes a trihelix transcription factor whose expression is limited to margins of floral and vegetative organs. Overexpression and double mutant analyses suggest that this gene is involved in limiting lateral growth of organs.
AT5G03710 replication factor C large subunit;(source:Araport11)
AT5G03720 Member of Heat Stress Transcription Factor (Hsf) family. Expression is regulated by DREB2A and in turn HSFA3 regulates the expression of hsps Hsp18.1-CI and Hsp26.5-MII35S. Involved in establishing thermotolerence.
AT5G03740 HD2-type histone deacetylase HDAC. Involved in the ABA and stress responses. Mediates transcriptional repression via histone modification.
AT5G03745 pre-tRNA tRNA-Leu (anticodon: TAA);(source:Araport11, TAIR10)
AT5G03750 E3 ubiquitin-protein ligase;(source:Araport11)
AT5G03760 encodes a beta-mannan synthase that is required for agrobacterium-mediated plant genetic transformation involves a complex interaction between the bacterium and the host plant. 3' UTR is involved in transcriptional regulation and the gene is expressed in the elongation zone of the root.
AT5G03770 Encodes a putative KDO (3-deoxy-D-manno-octulosonate) transferase
AT5G03790 Encodes a homeodomain leucine zipper class I (HD-Zip I) meristem identity regulator that acts together with LFY to induce CAL expression. It binds to the CAL promoter proximal CAATNATTG element. LMI1 acts primarily downstream of LFY in meristem identity regulation. The interaction between LFY, LMI1 and CAL resembles a feed-forward loop transcriptional network motif. The gene also had additional LFY-independent roles in leaf morphogenesis and bract formation.
AT5G03795 Exostosin family protein;(source:Araport11)
AT5G03810 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT5G03820 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT5G03858 Pseudogene of AT5G03960; IQD12 (IQ-domain 12); calmodulin binding protein
AT5G03880 Thioredoxin family protein;(source:Araport11)
AT5G03890 PADRE protein up-regulated after infection by S. sclerotiorum.
AT5G03930 F-box protein;(source:Araport11)
AT5G03960 Member of IQ67 (CaM binding) domain containing family.
AT5G03980 SGNH hydrolase-type esterase superfamily protein;(source:Araport11)
AT5G03990 FK506-binding-like protein;(source:Araport11)
AT5G04000 hypothetical protein;(source:Araport11)
AT5G04010 F-box family protein;(source:Araport11)
AT5G04030 transmembrane protein;(source:Araport11)
AT5G04050 Essential maturase splicing factor required for splicing of nad1 introns 1, 3 and 4, holo‐complex I biogenesis, and embryo development.
AT5G04080 cysteine-rich TM module stress tolerance protein;(source:Araport11)
AT5G04140 Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation. The mRNA is cell-to-cell mobile.
AT5G04150 Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant.
AT5G04170 Calcium-binding EF-hand family protein;(source:Araport11)
AT5G04200 Encodes a putative metacaspase. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200.
AT5G04230 Member of Phenylalanine ammonialyase (PAL) gene family. Differs significantly from PAL1 and PAL2 and other sequenced plant PAL genes. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4).
AT5G04250 Cysteine proteinases superfamily protein;(source:Araport11)
AT5G04267 This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT5G04275 Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AGAAUCUUGAUGAUGCUGCAU. Pri-mRNA coordinates for MIR172b (converted to TAIR10 based on PMID19304749): Chr5: 1188916-1187500 (reverse), length: 1417 bp; exon coordinates: exon 1: 1188916 to 1188742, exon 2: 1188623 to 1188583, exon 3: 1188383 to 1188133, exon 4: 1187852 to 1187500; mature miRNA and miRNA* are located on exon 3.
AT5G04310 Pectin lyase-like superfamily protein;(source:Araport11)
AT5G04340 Encodes a C2H2 zinc finger transcription factor that coordinately activates phytochelatin-synthesis related gene expression and directly targets GSH1 by binding to its promoter to positively regulate Cd accumulation and tolerance.
AT5G04347 Plant self-incompatibility protein S1 family;(source:Araport11)
AT5G04400 NAC domain protein;(source:Araport11)
AT5G04460 RING/U-box superfamily protein;(source:Araport11)
AT5G04470 Encodes a novel nuclear 14-kD protein containing a cyclin binding motif and a motif found in ICK/KRP cell cycle inhibitor proteins. It is required for coordinating cell division and cell differentiation during the development of Arabidopsis trichomes, playing a key role in the mitosis-to-endoreduplication transition. It interacts with D-type cyclins in vivo.
AT5G04490 Encodes a protein with phytol kinase activity involved in tocopherol biosynthesis.
AT5G04510 Encodes 3-phosphoinositide-dependent protein kinase that contains pleckstrin homology domain and binds 3-phosphoinositides. It activates the protein kinase AGC2-1 in a phosphatidic acid dependent manner. Phosphorylates S6K1. Interacts with PID, and transphosphorylation by PDK1 increases PID autophosphorylation. The mRNA is cell-to-cell mobile.
AT5G04530 Encodes KCS19, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids).
AT5G04550 type-1 restriction enzyme mjaxp r protein (DUF668);(source:Araport11)
AT5G04590 A.thaliana gene encoding sulfite reductase.
AT5G04670 Polycomb related protein that is part of a protein complex involved in histone deacetylation and heterochromatin silencing.
AT5G04680 Ankyrin repeat family protein;(source:Araport11)
AT5G04690 Ankyrin repeat family protein;(source:Araport11)
AT5G04700 Ankyrin repeat family protein;(source:Araport11)
AT5G04720 Encodes a member of the ADR1 family nucleotide-binding leucine-rich repeat (NB-LRR) immune receptors. The mRNA is cell-to-cell mobile.
AT5G04730 Ankyrin-repeat containing protein;(source:Araport11)
AT5G04780 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT5G04810 Pentatricopeptide which is essential during the early stages of embryo development and acts in the plastid nucleoids as the factor responsible of rps12 intron 1 trans-splicing and, indirectly, in the assembly of 70S ribosomes and plastid translation.
AT5G04820 ovate family protein 13;(source:Araport11)
AT5G04830 Nuclear transport factor 2 (NTF2) family protein;(source:Araport11)
AT5G04840 bZIP protein;(source:Araport11)
AT5G04870 A calcium-dependent protein kinase that can phosphorylate phenylalanine ammonia lyase (PAL), a key enzyme in pathogen defense.Phosphorylates, in vivo, the transcription factor ORE1, a master regulator of senescence.
AT5G04885 Encodes a beta-glucosidase involved in xyloglucan metabolism.
AT5G04890 Specifically restricts the long-distance movement of tobacco etch potyvirus (TEV) without involving either hypersensitive cell death or systemic acquired resistance. Multidomain protein containing an N-terminal region with high similarity to plant small heat shock proteins (HSPs).
AT5G04895 DEA(D/H)-box RNA helicase family protein;(source:Araport11)
AT5G04910 DNA repair REX1-B protein;(source:Araport11)
AT5G04930 Encodes a putative aminophospholipid translocase (p-type ATPase) involved in chilling response. It is targeted to the plasma membrane following association in the endoplasmic reticulum with an ALIS protein beta-subunit. The mRNA is cell-to-cell mobile.
AT5G04940 Encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. SUVH1 has been shown to have a preference for binding methylated DNA.
AT5G04970 Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT5G04980 DNAse I-like superfamily protein;(source:Araport11)
AT5G05020 Pollen Ole e 1 allergen and extensin family protein;(source:Araport11)
AT5G05025 Encodes a Pollen Ole e I allergen and extensin family protein [pseudogene]
AT5G05110 Cystatin/monellin family protein;(source:Araport11)
AT5G05130 DNA/RNA helicase protein;(source:Araport11)
AT5G05140 Transcription elongation factor (TFIIS) family protein;(source:Araport11)
AT5G05150 autophagy-related protein 18E;(source:Araport11)
AT5G05180 myosin heavy chain, striated protein;(source:Araport11)
AT5G05220 hypothetical protein;(source:Araport11)
AT5G05280 Encodes a RING-finger E3 ligase protein that controls anther dehiscence by positively regulating the expression of DAD1 in the jasmonic acid biosynthesis pathway.
AT5G05290 Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio)
AT5G05300 IDL6 peptide is induced in response to Pathogen-Associated Molecular Patterns (PAMPs). Overexpression of IDL6 results in increased susceptibility to pathogens.
AT5G05330 Encodes a protein with a putative HMG-box domain. The high-mobility group (HMG) proteins are chromatin-associated proteins that act as architectural factors in various nucleoprotein structures, which regulate DNA-dependent processes such as transcription and recombination. Expression of this gene was not detected according to Grasser et al. (J. Mol. Biol. 2006:358, 654-664).
AT5G05340 Encodes a protein with sequence similarity to peroxidases that is involved in lignin biosynthesis. Loss of function mutations show abnormal development of xylem fibers and reduced levels of lignin biosynthetic enxymes.
AT5G05350 PLAC8 family protein;(source:Araport11)
AT5G05380 prenylated RAB acceptor 1.B3;(source:Araport11)
AT5G05390 putative laccase, a member of laccase family of genes (17 members in Arabidopsis).
AT5G05420 FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11)
AT5G05460 Encodes a cytosolic beta-endo-N-acetyglucosaminidase (ENGase). ENGases N-glycans cleave the O-glycosidic linkage between the two GlcNAc residues of the N-glycan core structure and thus generate a protein with a single GlcNAc attached to asparagine.
AT5G05480 Peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase A protein;(source:Araport11)
AT5G05550 Encodes trihelix-domain transcription factor VFP5. Interacts with agrobacterium virulence protein VirF.
AT5G05598 Encodes a Defensin-like (DEFL) family protein
AT5G05600 Encodes a protein with similarity to flavonol synthases that is involved in the detoxifcation polycyclic aromatic hydrocarbons.One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA.
AT5G05640 nucleoprotein-like protein;(source:Araport11)
AT5G05657 late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT5G05670 signal recognition particle binding protein;(source:Araport11)
AT5G05700 Encodes an arginyl-tRNA:protein transferase (ATE1), a component of the N-end rule pathway that targets protein degradation through the identity of the amino-terminal residue of specific protein substrates. Arabidopsis contains two ATE genes: At5g05700/ATE1, At3g11240/ATE2. Another component of the N-end rule pathway is At5g02310/PROTEOLYSIS6 (PRT6). PRT6 and ATE were shown to regulate seed after-ripening, seedling sugar sensitivity, seedling lipid breakdown, and abscisic acid (ABA) sensitivity of germination. Mutants of ATE1 also display delayed leaf senescence and altered responses to pathogens.
AT5G05720 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT5G05740 S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442?454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171?179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria.
AT5G05760 A SNARE protein (ortholog of syntaxin 5), a membrane fusion machine component involved in cytokinesis
AT5G05780 Encodes a putative 26S proteasome subunit RPN8a. The function of RPN8a and other 26S subunits may be required for specifying leaf adaxial identity. The mRNA is cell-to-cell mobile.
AT5G05790 Duplicated homeodomain-like superfamily protein;(source:Araport11)
AT5G05810 RING/U-box superfamily protein;(source:Araport11)
AT5G05820 Nucleotide-sugar transporter family protein;(source:Araport11)
AT5G05840 replication factor C subunit, putative (DUF620);(source:Araport11)
AT5G05850 Encodes PIRL1, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen.
AT5G05870 UDP-glucosyl transferase 76C1;(source:Araport11)
AT5G05880 Encodes a nicotinate-N-glycosyltransferase.
AT5G05890 Encodes a nicotinate-N-glycosyltransferase.
AT5G05910 RING/U-box superfamily protein;(source:Araport11)
AT5G05940 Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily.
AT5G05980 Encodes one of the three folylpolyglutamate synthetase isoforms (FPGSs): FPGS1 (At5g05980, plastidic), FPGS2 (At3g10160, mitochondrial) and FPGS3 (At3g55630, cytosolic).
AT5G06010 hypothetical protein;(source:Araport11)
AT5G06070 Isolated as a mutation defective in petal development with specific effects on adaxial petals which are filamentous or absent. Encodes a Superman (SUP) like protein with zinc finger motifs. Transcript is detected in petal primordia and protein is localized to the nucleus.
AT5G06090 putative sn-glycerol-3-phosphate 2-O-acyltransferase
AT5G06100 Encodes a member of the myb family of transcription factors (MYB33), contains Pfam profile: PF00249 myb DNA-binding domain. Double mutants with MYB65 are male sterile- anthers are small, pollen development is defective. Spatial expression appears to be under the control of miR159, contains a target site for this micro RNA. A highly conserved RNA secondary structure abuts the miR159 binding site which facilitates its regulation by miR159. When the target site is mutated, expression is detected in leaves, roots, anther filament, pistil. The expression of a translational fusion is specific to anther locules in contrast to constructs lacking the miR159 target site. Phenotype is conditional and can be restored by lower temperature or higher light intensity.
AT5G06130 Encodes an OR(orange)-like protein that interacts directly with the PSY (phytoene synthase) protein and acts as a positive posttranscriptional regulator of its expression, thereby affecting carotenoid biosynthesis.
AT5G06150 Encodes a cyclin whose expression is reduced in response to high salt.
AT5G06170 sucrose symporter with hight affinity for sucrose (K0.5=0.066 +/- 0.025mM), that can also transport a wide range of glucosides.
AT5G06220 LETM1-like protein;(source:Araport11)
AT5G06230 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT5G06250 Transcription repressor involved in regulation of inflorescence architecture.
AT5G06265 hyaluronan mediated motility receptor-like protein;(source:Araport11)
AT5G06270 One of two plant specific paralogs of unknown function. Interacts with GL2. GIR1/GIR2 loss of function resembles gl2 lof mutations
AT5G06278 pseudogene of abscisic acid-responsive HVA22 family protein
AT5G06290 Encodes a 2-Cys peroxiredoxin (2-Cys PrxB) that contains two catalytic Cys residues. The mRNA is cell-to-cell mobile.
AT5G06310 Encodes AtPOT1b. Note on nomenclature: different names have been given to Arabidopsis POT-like genes (Kuchar and Fajkus, 2004; Shakirov et al, 2005; Tani and Murata, 2005). According to a unifying nomenclature (Surovtseva et al, 2007), At2g05210 (previously named AtPOT1) is designated AtPOT1a, while At5g06310 (previously named AtPOT2) is designated AtPOT1b.
AT5G06320 encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus, spermine and Pseudomonas syringae pv. tomato DC3000. The gene product is localized to the plasma membrane.
AT5G06330 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11)
AT5G06350 ARM repeat superfamily protein;(source:Araport11)
AT5G06390 FASCICLIN-like arabinogalactan protein 17 precursor;(source:Araport11)
AT5G06440 polyketide cyclase/dehydrase/lipid transport superfamily protein;(source:Araport11)
AT5G06470 Glutaredoxin family protein;(source:Araport11)
AT5G06510 nuclear factor Y, subunit A10;(source:Araport11)
AT5G06570 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G06610 DUF620 domain protein. In xylem cells BRD1 is expressed in the secondary wall pit boundaries. BRD1 interacts with and appears to be necessary to recruit WALLIN to the plasma membrane.
AT5G06620 SET domain protein 38;(source:Araport11)
AT5G06710 Homeobox-leucine zipper protein.
AT5G06720 Encodes a peroxidase with diverse roles in the wound response, flower development, and syncytium formation.
AT5G06730 Peroxidase superfamily protein;(source:Araport11)
AT5G06740 Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT5G06790 cotton fiber protein;(source:Araport11)
AT5G06800 myb-like HTH transcriptional regulator family protein;(source:Araport11)
AT5G06850 Encodes an endoplasmic reticulum protein that is involved in the transport of the florigen FT from companion cells to sieve elements, thus affecting FT transport through the phloem to the SAM.
AT5G06920 Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development.
AT5G06960 Encodes a basic leucine zipper (B-ZIP) containing protein that interacts with NPR1 to promote expression of salicylic acid induced genes. Binds the ocs-element.
AT5G06970 PATROL1 is a Munc13-like protein involved in mediating H[+]-ATPase translocation. It interacts with AHA1and is responsible for its translocation during stomatal movement.
AT5G07010 Encodes a sulfotransferase that acts specifically on 11- and 12-hydroxyjasmonic acid. Transcript levels for this enzyme are increased by treatments with jasmonic acid (JA), 12-hydroxyJA, JA-isoleucine, and 12-oxyphytodienoic acid (a JA precursor).
AT5G07030 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT5G07080 Encodes enzymes that can efficiently convert putrescine and caffeoyl-CoA to di-caffeoyl putrescine. Can convert spermidine/spermine and feruloyl CoA to mono-feruloyl spermidine/spermine. Has a preference for feruloyl-CoA binding, but little acyl-acceptor specificity.
AT5G07090 Ribosomal protein S4 (RPS4A) family protein;(source:Araport11)
AT5G07100 Encodes WRKY DNA-binding protein 26 (WRKY26).
AT5G07140 Protein kinase superfamily protein;(source:Araport11)
AT5G07160 Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11)
AT5G07170 TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of Aurora kinase activity.
AT5G07180 Encodes a receptor-like kinase that, together with ER and ERL1 governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. It is also important for maintaining stomatal stem cell activity and preventing terminal differentiation of the meristemoid into the guard mother cell. When heterozygous in an er/erl1 null background, plants are female sterile due to cell division defect in the integuments.
AT5G07215 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.9e-34 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10)
AT5G07280 Encodes EMS1 (EXCESS MICROSPOROCYTES1), a putative leucine-rich repeat receptor protein kinase that controls somatic and reproductive cell fates in Arabidopsis anther.
AT5G07290 AML4 A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML4 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM14. AML4 is expressed during embryo development (heart and torpedo stage) and in vegetative and floral apices.
AT5G07300 Encodes a copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms.
AT5G07310 encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Cytokinin production induced by jasmonate represses adventitious rooting.
AT5G07322 other_RNA;(source:Araport11)
AT5G07360 Amidase family protein;(source:Araport11)
AT5G07390 respiratory burst oxidase homolog A;(source:Araport11)
AT5G07450 cyclin p4;(source:Araport11)
AT5G07480 KAR-UP oxidoreductase 1;(source:Araport11)
AT5G07540 encodes a glycine-rich protein that is expressed only in flowers during a specific developmental stage (flower stages 11 and 12).
AT5G07550 member of Oleosin-like protein family
AT5G07600 Oleosin family protein;(source:Araport11)
AT5G07610 F-box family protein;(source:Araport11)
AT5G07620 Protein kinase superfamily protein;(source:Araport11)
AT5G07640 RING/U-box superfamily protein;(source:Araport11)
AT5G07650 Actin-binding FH2 protein;(source:Araport11)
AT5G07660 Encodes SMC6A (STRUCTURAL MAINTENANCE OF CHROMOSOMES 6A), a component of the SMC5/6 complex. SMC5/6 complex promotes sister chromatid alignment and homologous recombination after DNA damage.
AT5G07690 Encodes a putative transcription factor (MYB29) that acts as a negative regulator of mitochondrial stress responses.
AT5G07700 Encodes a putative transcription factor (MYB76).
AT5G07710 Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11)
AT5G07740 actin binding protein;(source:Araport11)
AT5G07760 formin homology 2 domain-containing protein / FH2 domain-containing protein;(source:Araport11)
AT5G07790 hypothetical protein;(source:Araport11)
AT5G07800 Flavin-binding monooxygenase family protein;(source:Araport11)
AT5G07810 SNF2 domain-containing protein / helicase domain-containing protein / HNH endonuclease domain-containing protein;(source:Araport11)
AT5G07820 Plant calmodulin-binding protein-like protein;(source:Araport11)
AT5G07830 Belongs to the plant glycoside hydrolase family 79. Encodes a protein with several posttranslational modification sites including O-β-GlcNAc attachment sites and serine-, threonine- and tyrosine-phosphorylation sites, suggesting that this protein is extensively modified posttranslationally. The protein is predicted (WoLF PSORT program) to be membrane-associated. It is involved in cell elongation. The mRNA is cell-to-cell mobile.
AT5G07840 Ankyrin repeat family protein;(source:Araport11)
AT5G07850 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT5G07910 Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT5G07920 Encodes a putative diacylglycerol kinase that is mainly expressed in roots, shoots and leaves, but its enzyme product was not active in vitro.
AT5G08000 Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and binds callose.
AT5G08010 hypothetical protein;(source:Araport11)
AT5G08090 transmembrane protein;(source:Araport11)
AT5G08110 Plays a role in the maintenance of genome stability and the repair of aberrant replication intermediates in the root meristem. Is involved with RAD1, FAN1, and RECQ4A in the repair of DNA CLs.
AT5G08141 Part of complex with ENO2 which mediates secondary metabolism, affecting seed size and weight.
AT5G08150 Encodes SOB5. Activation tagging lines accumulated higher level of cytokinin.
AT5G08160 Encodes a serine/threonine protein kinase.
AT5G08230 HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions.
AT5G08250 Cytochrome P450 superfamily protein;(source:Araport11)
AT5G08270 C5orf35;(source:Araport11)
AT5G08305 E+-type pentatricopeptide repeat protein involved in C to U editing in mitochondria and chloroplasts.
AT5G08335 Encodes an isoprenyl cysteine methylatransferase (ICMT) involved in the post-translational processing of proteins that have a C-terminal CaaX box. This protein appears to have higher catalytic activity and a higher transcript expression level than the other ICMT present in Arabidopsis (At5g23320). Analysis of ICMT RNAi lines suggests that this protein is involved in flower and stem development.
AT5G08360 Stu1, putative (DUF789);(source:Araport11)
AT5G08370 Member of Glycoside Hydrolase Family 27 (GH27)that functions as an α-galactosidase.
AT5G08400 structural maintenance of chromosomes-like protein, putative (DUF3531);(source:Araport11)
AT5G08450 Component of histone-deacetylase complexes. Interacts with HDA6 and HDA19 and facilitates histone deacetylation. Several salt-inducible genes are de-repressed in hdc1 mutants. Mutants are hypersensitive to ABA during germination, grow less and flower later than wildtype. HDC1-overexpressing plants display opposite phenotypes.
AT5G08540 ribosomal RNA small subunit methyltransferase J;(source:Araport11)
AT5G08560 WRDR26 is a WD-40 repeat containing protein initially identified as an interacting partner RanBPM. Its expression is induced by abiotic stress as well as various plant growth regulators including IAA, ABA and ethylene. Role as a novel modulator of redox homeostatis, responding to developmental and stress signals to regulate leaf senescence.
AT5G08630 DDT domain-containing protein;(source:Araport11)
AT5G08640 Encodes a flavonol synthase that catalyzes formation of flavonols from dihydroflavonols. Co-expressed with CHI and CHS (qRT-PCR).
AT5G08710 Regulator of chromosome condensation (RCC1) family protein;(source:Araport11)
AT5G08717 Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC
AT5G08730 IBR domain-containing protein;(source:Araport11)
AT5G08750 RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11)
AT5G09220 member of AAAP family The mRNA is cell-to-cell mobile.
AT5G09270 transmembrane protein;(source:Araport11)
AT5G09280 Pectin lyase-like superfamily protein;(source:Araport11)
AT5G09300 Thiamin diphosphate-binding fold (THDP-binding) superfamily protein;(source:Araport11)
AT5G09320 vacuolar protein sorting-associated 9A-like protein;(source:Araport11)
AT5G09420 Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones.
AT5G09430 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G09450 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT5G09460 transcription factor bHLH143;(source:Araport11)
AT5G09550 GDP dissociation inhibitor family protein / Rab GTPase activator family protein;(source:Araport11)
AT5G09560 RNA-binding KH domain-containing protein;(source:Araport11)
AT5G09570 Twin CX9C domain protein. Induced by low phosphate or iron, drought and heat stress. Loss of both At12cys-1 and At12cys-2 lead to enhanced tolerance to drought and light stress and increased anti-oxidant capacity.
AT5G09610 Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts.
AT5G09680 Encodes RLF (Reduced Lateral root Formation). Involved in lateral root formation. Contains a cytochrome b5-like heme/steroid binding domain. Localized in the cytosol.
AT5G09740 Encodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2.
AT5G09770 Ribosomal protein L17 family protein;(source:Araport11)
AT5G09790 Encodes a SET-domain protein, a H3K27 monomethyltransferases required for chromatin structure and gene silencing. Regulates heterochromatic DNA replication. Contains a PCNA-binding domain. ATXR5 accumulates preferentially during the late G1 or S phase, suggesting that it plays a role in cell-cycle regulation or progression. A plant line expressing an RNAi construct directed against this gene has reduced agrobacterium-mediated tumor formation.
AT5G09800 Plant U-box type E3 ubiquitin ligase (PUB).
AT5G09805 Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission.
AT5G09820 Encodes fibrillin 5 (FBN5). Located in chloroplast stroma. Essential for plastoquinone-9 biosynthesis. Stimulates enzymatic activity of solanesyl diphosphate synthases (SPS) 1 and 2 through binding to solanesyl moiety. Two splicing variants, named FBN5-A shorter one and FBN5-B longer one. FBN5-B is the protein detected in chloroplast stroma. Involved in plastoquinone biosynthesis.
AT5G09830 Encodes a cytosolic BolA protein. Plays a repressive role in the tolerance against excess iron and methyl viologen-induced oxidative stress.
AT5G09850 Transcription elongation factor (TFIIS) family protein;(source:Araport11)
AT5G09870 Encodes a cellulose synthase CESA5 that produces seed mucilage cellulose.Mutants are defective in seed coat mucilage.Involved in the regulation of mucilage composition and/or mucilage synthesis.
AT5G09900 Encodes one of two isoforms for the 26S proteasome regulatory protein (RN) subunit RPN5. For many functions it acts redundantly with the paralogous gene RPN5b but also appears to exert independent effects.
AT5G09930 ABCF2 is one of five members of the ABCF gene family in Arabidopsis, which are homologs of the yeast ABCF protein, GCN20.
AT5G09940 hypothetical protein (DUF1635);(source:Araport11)
AT5G09960 sorbin/SH3 domain protein;(source:Araport11)
AT5G09990 elicitor peptide 5 precursor;(source:Araport11)
AT5G09995 transmembrane protein;(source:Araport11)
AT5G10080 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT5G10090 Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones.
AT5G10100 Trehalose-6-phosphate phosphatase which enhances drought tolerance by regulating stomatal apertures.
AT5G10110 DNA-directed RNA polymerase subunit beta;(source:Araport11)
AT5G10160 Thioesterase superfamily protein;(source:Araport11)
AT5G10180 Encodes a low-affinity sulfate transporter expressed in the root cap and central cylinder, where it is induced by sulfur starvation. Expression in the shoot vascular system is not induced by sulfur starvation.
AT5G10210 nitric oxide synthase-interacting protein;(source:Araport11)
AT5G10230 Encodes a calcium-binding protein annexin (AnnAt7).
AT5G10240 Encodes asparagine synthetase (ASN3).
AT5G10260 RAB GTPase homolog H1E;(source:Araport11)
AT5G10270 Encodes CDKC;1, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development.
AT5G10310 Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis.
AT5G10380 Encodes a RING finger domain protein with E3 ligase activity that is localized to the lipid rafts of the plasma membrane. Expression is increased in response to fungal pathogen. May be involved in regulation of programmed cell death by facilitating degredation of regulation of PDC activators. The mRNA is cell-to-cell mobile.
AT5G10470 Kinesin that binds cyclin-dependent kinase CDKA;1 as homodimer or as heterodimer with KCA2. Demarcates the division site in plant cells.
AT5G10500 Kinase interacting (KIP1-like) family protein;(source:Araport11)
AT5G10510 Encodes an AP2-domain transcription factor involved in root stem cell identity and root development. It is also required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions. Intronic sequences are required for its expression in flowers.Acts redundantly with PLT5 and 7 in lateral root pattern formation.
AT5G10520 ROP binding protein kinases 1;(source:Araport11)
AT5G10540 Zincin-like metalloproteases family protein;(source:Araport11)
AT5G10580 plant/protein (Protein of unknown function, DUF599);(source:Araport11)
AT5G10620 methyltransferase;(source:Araport11)
AT5G10660 calmodulin-binding protein-like protein;(source:Araport11)
AT5G10690 pentatricopeptide (PPR) repeat-containing protein / CBS domain-containing protein;(source:Araport11)
AT5G10720 member of Histidine Kinase
AT5G10730 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT5G10750 enhanced disease resistance-like protein (DUF1336);(source:Araport11)
AT5G10760 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT5G10770 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT5G10820 Major facilitator superfamily protein;(source:Araport11)
AT5G10930 Encodes CBL-interacting protein kinase 5 (CIPK5).
AT5G10946 hypothetical protein;(source:Araport11)
AT5G10950 Tudor/PWWP/MBT superfamily protein;(source:Araport11)
AT5G10970 C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11)
AT5G11000 hypothetical protein (DUF868);(source:Araport11)
AT5G11010 Nuclear-localizing protein.
AT5G11020 Protein kinase superfamily protein;(source:Araport11)
AT5G11050 Member of R2R3-MYB transcription factor gene family.
AT5G11060 A member of Class II KN1-like homeodomain transcription factors (together with KNAT3 and KNAT5), with greatest homology to the maize knox1 homeobox protein. Expression regulated by light. Detected in all tissues examined, but most prominent in leaves and young siliques. Transient expression of GFP translational fusion protein suggests bipartite localization in nucleus and cytoplasm. KNAT4 promoter activity showed cell-type specific pattern along longitudinal root axis; GUS expression pattern started at the elongation zone, predominantly in the phloem and pericycle cells, extending to endodermis toward the base of the root.
AT5G11070 hypothetical protein;(source:Araport11)
AT5G11100 Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT5G11110 Encodes a sucrose-phosphate synthase involved in pollen exine formation. This is the dominant SPS isoform in leaves with respect to protein levels.
AT5G11140 phospholipase-like protein (PEARLI 4) family protein;(source:Araport11)
AT5G11160 adenine phosphoribosyltransferase 5;(source:Araport11)
AT5G11190 Encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11.
AT5G11242 pseudogene of ribosomal protein
AT5G11250 Encodes an atypical TIR-NBS-LRR protein that is involved in stress responses. Loss of function alleles overproduce stress hormones JA,SA, ABA, and ET.
AT5G11290 transmembrane protein, putative (DUF247);(source:Araport11)
AT5G11310 The SOAR1 gene encodes a pentatricopeptide repeat (PPR) protein which localizes to both the cytosol and nucleus. Down-regulation of SOAR1 strongly enhances, but up-regulation of SOAR1 almost completely impairs, ABA responses, revealing that SOAR1 is a critical, negative, regulator of ABA signalling. Further genetic evidence supports that SOAR1 functions downstream of ABAR and probably upstream of an ABA-responsive transcription factor ABI5. Changes in the SOAR1 expression alter expression of a subset of ABA-responsive genes including ABI5. These findings provide important information to elucidate further the functional mechanism of PPR proteins and the complicated ABA signalling network.
AT5G11320 Belongs to the YUC gene family. Encodes a predicted flavin monooxygenase. YUC4 is part of a pathway linking auxin biosynthesis and gynoecium development. It is expressed in the stigma and the apical meristem and is ethylene inducible.
AT5G11325 pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10)
AT5G11350 Deadenylase.
AT5G11360 Interleukin-1 receptor-associated kinase 4 protein;(source:Araport11)
AT5G11440 Interacts with PAB (poly A binding protein) in yeast two hybrid experiments. Contains PAM2 motif, a PABC interacting domain.
AT5G11460 FCS like zinc finger 10 is induced during energy starvation through SnRK1 signaling. Mutants accumulate more SnRK1alpha1 which results in the inhibition of seedling growth under favorable growth conditions. Increased SnRK1 activity in the mutant also results in the downregulation of TOR signaling (DOI:10.1111/tpj.13854).
AT5G11470 SG1 is a Bromo-Adjacent Homology (BAH) domain containing protein involved in CHG methylation within genebodies. Loss of function results in pleiotrophic developmental effects that increase after 4 generations.
AT5G11500 coiled-coil protein;(source:Araport11)
AT5G11530 Involved in regulating reproductive development
AT5G11540 Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid.
AT5G11650 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G11660 NEP-interacting protein, putative (DUF239);(source:Araport11)
AT5G11670 The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME2 is presumably a cytosolic enzyme involved in malate metabolism and possibly assisting the oxidative pentose phosphate pathway. AtNADP-ME2 counts for the major part of NADP-ME activity in mature tissues of Arabidopsis.
AT5G11730 Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11)
AT5G11790 Plays a role in dehydration stress response.
AT5G11820 Plant self-incompatibility protein S1 family;(source:Araport11)
AT5G11830 Plant self-incompatibility protein S1 family;(source:Araport11)
AT5G11840 YCF36, putative (DUF1230);(source:Araport11)
AT5G11880 Meso-diaminopimelate decarboxylase which catalyzes the decarboxylation of mesodiaminopimelate, the final reaction in the diaminopimelate L-lysine biosynthetic pathway.
AT5G11900 Translation initiation factor SUI1 family protein;(source:Araport11)
AT5G11920 Encodes a protein with fructan exohydrolase (FEH) activity acting on both inulin and levan-type fructans (1- and 6-FEH). The enzyme does not have invertase activity.
AT5G11940 Subtilase family protein;(source:Araport11)
AT5G11990 proline-rich family protein;(source:Araport11)
AT5G12010 nuclease;(source:Araport11)
AT5G12050 rho GTPase-activating protein;(source:Araport11)
AT5G12060 Plant self-incompatibility protein S1 family;(source:Araport11)
AT5G12140 Encodes a cystatin.
AT5G12180 member of Calcium Dependent Protein Kinase
AT5G12235 Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo.
AT5G12250 Encodes a beta-tubulin. Expression of TUB6 has been shown to decrease in response to cold treatment.
AT5G12260 transferring glycosyl group transferase;(source:Araport11)
AT5G12270 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT5G12280 SWAP (Suppressor-of-White-APricot)/surp RNA-binding domain-containing protein;(source:Araport11)
AT5G12290 Encodes a mitochondrial outer membrane protein that is found in a complex with MIC60, TOM40, RISP and TOM20. Involved in galactoglycerolipid biosynthesis/lipid homeostasis. The dgd1 mutant phenotype is suppressed in the dgs1 mutant background.
AT5G12300 Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT5G12400 PHD-finger and DNA binding domain-containing protein;(source:Araport11)
AT5G12420 WSD7 can function in vitro as wax ester synthase but does not appear to be essential for cuticular wax biosynthesis.
AT5G12430 Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones.
AT5G12860 AtpOMT1 encodes dicarboxylate transporter functions both as as an oxaloacetate/malate transporter and as a 2-oxoglutarate/malate transporter.
AT5G12870 Encodes MYB46, member of the R2R3 factor gene family. Modulates Disease Susceptibility to Botrytis cinerea.
AT5G12880 proline-rich family protein;(source:Araport11)
AT5G12900 DNA double-strand break repair RAD50 ATPase;(source:Araport11)
AT5G12920 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT5G12940 Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT5G12970 Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein;(source:Araport11)
AT5G12990 Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon.
AT5G13070 MSF1-like family protein;(source:Araport11)
AT5G13100 Gap junction beta-4 protein;(source:Araport11)
AT5G13130 Member of the microrchidia protein family which have been described as epigenetic regulators and plant immune mediators, contains a hallmark GHKL-type ATPase domain in N-terminus. Possible role in the development of reproductive tissues.
AT5G13140 Pollen Ole e 1 allergen and extensin family protein;(source:Araport11)
AT5G13170 Encodes a member of the SWEET sucrose efflux transporter family proteins.
AT5G13180 Encodes a NAC domain transcription factor that interacts with VND7 and negatively regulates xylem vessel formation.
AT5G13181 This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT5G13190 Encodes a plasma membrane localized LITAF domain protein that interacts with LSD1 and acts as a negative regulation of hypersensitive cell death.
AT5G13210 Uncharacterized conserved protein UCP015417, vWA;(source:Araport11)
AT5G13230 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT5G13240 Global repressor of RNA polymerase III (Pol III). Maf1 repressor activity is critical for plant survival during environmental stresses, and is regulated by its phosphorylation/dephosphorylation through the activity of TOR and PP4/PP2A phosphatases.
AT5G13250 RING finger protein;(source:Araport11)
AT5G13260 myosin;(source:Araport11)
AT5G13300 Belongs to 15-member small GTPase gene family, ARF-GAP domain proteins (AGD); corresponds to AGD3, and is one of four proteins belonging to class 1, together with AGD1, AGD2 and AGD4. The protein contains four domains: BAR domain, PH domain, an ARF-GAP domain, and two Ankyrin repeats. In sfc mutants, the secondary and tertiary veins of cotyledons, leaves, sepals and petals are largely replaced by small segments of discontinuous veins. sfc mutants have exaggerated responses to auxin.
AT5G13350 Auxin-responsive GH3 family protein;(source:Araport11)
AT5G13380 Auxin-responsive GH3 family protein;(source:Araport11)
AT5G13390 Required for normal pollen development and lipid accumulation within the tapetum
AT5G13420 Transaldolase which contributes to reactive oxygen species homeostasis in response to Glc during early seedling growth.
AT5G13460 Member of IQ67 (CaM binding) domain containing family.
AT5G13548 Pseudogene of AT3G12600; ATNUDT16 (Arabidopsis thaliana Nudix hydrolase homolog 16); hydrolase
AT5G13550 Encodes a sulfate transporter.
AT5G13590 hypothetical protein;(source:Araport11)
AT5G13610 Encodes a mitochondria-localized protein involved in ABI4-mediated mitochondrial retrograde signalling.
AT5G13640 arabidopsis phospholipid:diacylglycerol acyltransferase (PDAT)
AT5G13670 nodulin MtN21-like transporter family protein
AT5G13680 A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1?ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. Mutants have no ncm5U (5-carbamoylmethyluridine).
AT5G13700 Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants).
AT5G13730 Encodes sigma 4 factor, involved in regulating the activity of the plastid-encoded RNA polymerase PEP. Regulates the overall quantity of NDH complexes and thus influences NDH activity.
AT5G13810 Glutaredoxin family protein;(source:Araport11)
AT5G13850 nascent polypeptide-associated complex subunit alpha-like protein 3;(source:Araport11)
AT5G13860 ELCH-like protein;(source:Araport11)
AT5G13930 Encodes chalcone synthase (CHS), a key enzyme involved in the biosynthesis of flavonoids. Required for the accumulation of purple anthocyanins in leaves and stems. Also involved in the regulation of auxin transport and the modulation of root gravitropism. The mRNA is cell-to-cell mobile.
AT5G13940 aminopeptidase;(source:Araport11)
AT5G14000 NAC domain containing protein 84;(source:Araport11)
AT5G14010 Encodes KNUCKLES (KNU), a C2H2-type zinc finger protein with a conserved transcriptional repression motif. Mediates the repression of WUS in floral meristem determinacy control.
AT5G14020 Endosomal targeting BRO1-like domain-containing protein;(source:Araport11)
AT5G14060 lysine-sensitive aspartate kinase
AT5G14070 Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. ROXY2, together with ROXY1 (AT3G02000), controls anther development. roxy1 roxy2 double mutants are sterile and do not produce pollen.
AT5G14090 LAZY1 is required for gravitropic response. Mutants have abnormal shoot angles and abnormal root gravitropism. LZY1 affects the redistribution of auxin in response to gravity in shoots and roots via an unknown mechanism.
AT5G14110 peroxidase (DUF 3339);(source:Araport11)
AT5G14130 Peroxidase superfamily protein;(source:Araport11)
AT5G14180 Myzus persicae-induced lipase 1;(source:Araport11)
AT5G14210 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G14280 DNA-binding storekeeper-like protein;(source:Araport11)
AT5G14300 prohibitin 5;(source:Araport11)
AT5G14340 Member of the R2R3 factor gene family.
AT5G14360 Ubiquitin-like superfamily protein;(source:Araport11)
AT5G14370 CCT motif family protein;(source:Araport11)
AT5G14440 Surfeit locus protein 2 (SURF2);(source:Araport11)
AT5G14460 Pseudouridine synthase family protein;(source:Araport11)
AT5G14490 NAC domain containing protein 85;(source:Araport11)
AT5G14510 Armadillo (ARM) repeat containing protein involved in vascular development.
AT5G14520 Encodes a nucleolar protein that plays an essential role in cell growth and survival through its regulation of ribosome biogenesis and mitotic progression.
AT5G14560 hypothetical protein;(source:Araport11)
AT5G14580 polyribonucleotide nucleotidyltransferase;(source:Araport11)
AT5G14602 methyltransferase-like protein;(source:Araport11)
AT5G14640 shaggy-like kinase 13;(source:Araport11)
AT5G14660 Encodes a peptide deformylase PDF1B. The crystal structure has been determined at a resolution of 0.24 nm (Biochem J, 2008, vol 413:417-427).
AT5G14690 transmembrane protein;(source:Araport11)
AT5G14700 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT5G14710 proteasome assembly chaperone-like protein;(source:Araport11)
AT5G14740 Encodes a beta carbonic anhydrase likely to be localized in the cytoplasm. Expression of its mRNA is seen in etiolated seedlings and points to a possible nonphotosynthetic role for this isoform.
AT5G14770 PPR repeat protein;(source:Araport11)
AT5G14790 ARM repeat superfamily protein;(source:Araport11)
AT5G14850 Encodes a putative mannosyltransferase homolog to human PIG-B and yeast GPI10, both of which are involved in the biosynthesis of glycosylphosphatidylinositol (GPI) anchors. Disruption of the gene affects COBRA-LIKE10 localization, a GPI-anchored protein (GPI-AP) important for pollen tube growth and guidance.
AT5G14870 Encodes a member of the cyclic nucleotide gated channel family that is asymmetrically localized to the plasma membrane at the growing tip of the pollen tube and is involved in pollen tube growth and pollen tube guidance to ovules. It likely directly transduces a cNMP signal into an ion flux that can produce a localized signal capable of regulating the pollen tip-growth machinery. Also functions as a Ca2+ permeable channel.
AT5G14890 potassium transporter;(source:Araport11)
AT5G14910 Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT5G14940 Major facilitator superfamily protein;(source:Araport11)
AT5G14980 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G14990 WPP domain associated protein;(source:Araport11)
AT5G14995 Encodes a ECA1 gametogenesis related family protein
AT5G15000 Encodes a ECA1 gametogenesis related family protein
AT5G15008 This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT5G15010 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT5G15020 Encodes a homolog of the transcriptional repressor SIN3 (AT1G24190).
AT5G15022 Natural antisense transcript overlaps with AT5G15030;(source:Araport11)
AT5G15100 Encodes an auxin transporter with a strong expression in a male gametophyte. Mutant studies reveal a role for auxin transport in regulating pollen development and function. It acts together with PIN5.
AT5G15110 Pectate lyase family protein;(source:Araport11)
AT5G15120 2-aminoethanethiol dioxygenase, putative (DUF1637);(source:Araport11)
AT5G15140 Galactose mutarotase-like superfamily protein;(source:Araport11)
AT5G15150 homeobox-containing gene with an unusual feature: a leucine zipper motif adjacent to the carboxyl-terminal of the homeodomain structure. This gene is expressed primarily in the cortex of the root and the stem.
AT5G15200 Ribosomal protein S4;(source:Araport11)
AT5G15210 Encodes ZFHD3, a member of the zinc finger homeodomain transcriptional factor family.
AT5G15230 Encodes gibberellin-regulated protein GASA4. Promotes GA responses and exhibits redox activity.
AT5G15240 Transmembrane amino acid transporter family protein;(source:Araport11)
AT5G15250 Encodes an FtsH protease that is localized to the chloroplast. AtFtsH6 is involved in the degradation of both Lhcb3 and Lhcb1 during senescence and high-light acclimation.
AT5G15265 transmembrane protein;(source:Araport11)
AT5G15290 Uncharacterized protein family (UPF0497);(source:Araport11)
AT5G15310 Member of the R2R3 factor gene family; MIXTA-like transcription factor that controls trichome maturation and cuticle formation.
AT5G15360 transmembrane protein;(source:Araport11)
AT5G15380 Encodes methyltransferase involved in the de novo DNA methylation and maintenance of asymmetric methylation of DNA sequences.
AT5G15390 tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11)
AT5G15400 Single copy gene encoding a putative ubiquitin conjugating E4 factor. Contains Ub elongating factor core domain and C-terminal U-box. Involved in ubiquitination of NLRs.
AT5G15480 Cys2/His2 zinc finger protein involved in pollen wall development.
AT5G15490 Encodes one of four UDP-glucose dehydrogenase UGD) genes. Mutation of this gene in combination with UGD2 leads to swollen plant cell walls and severe developmental defects associated with changes in pectic polysaccharides.
AT5G15510 TPX2 (targeting protein for Xklp2) protein family;(source:Araport11)
AT5G15520 Ribosomal protein S19e family protein;(source:Araport11)
AT5G15540 Encodes Adherin SCC2. Essential for viability. Required for normal seed development. Plays a role in the establishment of sister-chromatid cohesion and chromosome organization during meiosis.
AT5G15560 hypothetical protein;(source:Araport11)
AT5G15640 Mitochondrial substrate carrier family protein;(source:Araport11)
AT5G15650 RGP2 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1(at3g02230)/rgp2 double mutants have a male gametophyte lethal phenotype. RGP2 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. RGP2 was originally identified as Reversibly Glycosylated Polypeptide-2. Constitutive expression in tobacco impairs plant development and virus spread.
AT5G15690 zinc ion binding protein;(source:Araport11)
AT5G15700 Nucleus encoded plastid RNA polymerase. Localized in mitochondria and chloroplast.
AT5G15720 Contains lipase signature motif and GDSL domain.
AT5G15740 RRT1 is a member of a novel glycosyltransferase famly in plants. It functions as a rhamnosyltransferase, elongating the RG-1 backbone. It functions during seed coat mucilage development.
AT5G15750 Alpha-L RNA-binding motif/Ribosomal protein S4 family protein;(source:Araport11)
AT5G15770 Encodes a putative glucose-6-phosphate acetyltransferase that is likely involved in UDP-N-acetylglucosamine biosynthesis. A GFP:GNA1 fusion protein localizes to the endoplasmic reticulum.
AT5G15830 basic leucine-zipper 3;(source:Araport11)
AT5G15850 Homologous to the flowering-time gene CONSTANS.
AT5G15900 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT5G15940 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT5G16000 NSP-interacting kinase (NIK1), receptor-like kinase, involved in defense response against geminivirus It acts as a virulence target of the begomovirus nuclear shuttle protein (NSP).
AT5G16010 3-oxo-5-alpha-steroid 4-dehydrogenase family protein;(source:Araport11)
AT5G16020 Encodes GEX3, a plasma membrane localized protein expressed in the male gametophyte. Required for micropylar pollen tube guidance. Also plays a role during early embryogenesis.
AT5G16023 Encodes a plant peptide that could be involved in the coordination of socket cell development in wild-type plants.
AT5G16060 Cytochrome c oxidase biogenesis protein Cmc1-like protein;(source:Araport11)
AT5G16090 RAD23 UV excision repair family protein;(source:Araport11)
AT5G16100 RWP-RK domain protein;(source:Araport11)
AT5G16120 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G16150 Encodes a putative plastidic glucose transporter.
AT5G16190 encodes a gene similar to cellulose synthase
AT5G16220 Octicosapeptide/Phox/Bem1p family protein;(source:Araport11)
AT5G16230 Encodes one of two ∆9 palmitoyl-ACP desaturases responsible for the biosynthesis of ω-7 fatty acids in the maturing endosperm.
AT5G16240 Redundant Δ9 stearoyl-ACP desaturase gene which together with FAB2 and AAD5 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with FAB2, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase.
AT5G16250 transmembrane protein;(source:Araport11)
AT5G16260 Encodes a RNA binding protein ELF9 (EARLY FLOWERING9). Loss of ELF9 function in the Wassilewskija ecotype causes early flowering in short days. ELF9 reduces SOC1 (SUPPRESSOR OF OVEREXPRESSION OF CO1) transcript levels, possibly via nonsense-mediated mRNA decay. The mRNA is cell-to-cell mobile.
AT5G16280 Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking.
AT5G16350 O-acyltransferase (WSD1-like) family protein;(source:Araport11)
AT5G16400 Encodes an f-type thioredoxin (Trx-f2) localized in chloroplast stroma.
AT5G16410 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT5G16450 Ribonuclease E inhibitor RraA/Dimethylmenaquinone methyltransferase;(source:Araport11)
AT5G16490 encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). It interacts with Rop1 and is involved in pollen tube growth and function, and exocytosis in the pollen tube tip. Protein most similar to RIC2 (family subgroup V). Gene is expressed in all tissues examined.Interacts with ROP2 during pavement cell morphogenesis and with ROP1 to promote apical F-actin assembly.
AT5G16500 Encodes a receptor-like cytoplasmic kinase localized in the membrane of pollen tube tip regions that controls micropylar pollen tube guidance in Arabidopsis.
AT5G16540 Encodes a zinc finger protein.
AT5G16550 Lipid droplet protein associated with LDAP3.
AT5G16560 Encodes a KANADI protein (KAN) that regulates organ polarity in Arabidopsis. KAN is required for abaxial identity in both leaves and carpels, and encodes a nuclear-localized protein in the GARP family of putative transcription factors. Together with KAN2, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN2 and KAN4, KAN1 appears to be required for proper regulation of PIN1 in early embryogenesis.
AT5G16570 Encodes a cytosolic glutamine synthetase, the enzyme has high affinity with substrate ammonium
AT5G16580 beta glucosidase 2;(source:Araport11)
AT5G16590 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G16610 hypothetical protein;(source:Araport11)
AT5G16640 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT5G16680 PHD protein which cooperates with AIPP2 and BAH domain protein AIPP3 to read H3K4 histone marks. The BAH-PHD bivalent histone reader complex silences a substantial subset of H3K27me3-enriched loci, including development and stress response-related genes. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription.
AT5G16720 caldesmon-like protein (Protein of unknown function, DUF593);(source:Araport11)
AT5G16730 Encodes a microtubule-associated protein. The mRNA is cell-to-cell mobile.
AT5G16770 Member of the R2R3 factor gene family.
AT5G16820 Encodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes.
AT5G16900 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G16910 encodes a gene similar to cellulose synthase. Located in Golgi membranes. The mRNA is cell-to-cell mobile.
AT5G16920 Fasciclin-like arabinogalactan family protein;(source:Araport11)
AT5G16960 Zinc-binding dehydrogenase family protein;(source:Araport11)
AT5G17030 UDP-glucosyl transferase 78D3;(source:Araport11)
AT5G17080 Cysteine proteinases superfamily protein;(source:Araport11)
AT5G17090 Cystatin/monellin superfamily protein;(source:Araport11)
AT5G17120 Cystatin/monellin superfamily protein;(source:Araport11)
AT5G17130 cysteine-type peptidase;(source:Araport11)
AT5G17170 rubredoxin family protein;(source:Araport11)
AT5G17220 Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). Mutants display no pigments on leaves and stems. Likely to function as a carrier to transport anthocyanin from the cytosol to tonoplasts.
AT5G17240 SET domain group 40;(source:Araport11)
AT5G17250 Alkaline-phosphatase-like family protein;(source:Araport11)
AT5G17260 NAC domain containing protein 86;(source:Araport11)
AT5G17290 Autophagy protein ATG5. Forms a conjugate with ATG12 with an essential role in plant nutrient recycling. Mutants missing ATG5 display early senescence and are hypersensitive to nitrogen or carbon starvation, accompanied by a more rapid loss of organellar and cytoplasmic proteins.
AT5G17310 UDP-glucose pyrophosphorylase 2;(source:Araport11)
AT5G17350 PADRE protein up-regulated after infection by S. sclerotiorum.
AT5G17360 DNA ligase;(source:Araport11)
AT5G17380 Thiamine pyrophosphate dependent pyruvate decarboxylase family protein;(source:Araport11)
AT5G17420 Encodes a xylem-specific cellulose synthase that is phosphorylated on one or more serine residues (on either S185 or one of S180 or S181).
AT5G17450 Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT5G17460 glutamyl-tRNA (Gln) amidotransferase subunit C;(source:Araport11)
AT5G17470 EF hand calcium-binding protein family;(source:Araport11)
AT5G17490 Encodes a DELLA subfamily member that acts as a negative regulator of GA signaling and as a coactivator of ABI3 to promote seed storage protein biosynthesis during the seed maturation stage.
AT5G17500 Glycosyl hydrolase superfamily protein;(source:Araport11)
AT5G17540 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT5G17550 Encodes the predominant PEX19 peroxin isoform, a cytosolic chaperone for peroxisome membrane proteins (PMPs) that delivers PMPs to the endoplasmic reticulum or peroxisomal membrane. It is predominantly cytosolic, forms dimers, promotes peroxisome function and is essential for viability. The protein is farnesylated in vivo through the actions of ERA1 and PLP.
AT5G17580 Phototropic-responsive NPH3 family protein;(source:Araport11)
AT5G17590 Putative membrane lipoprotein;(source:Araport11)
AT5G17600 RING/U-box superfamily protein;(source:Araport11)
AT5G17610 hypothetical protein;(source:Araport11)
AT5G17630 Phosphate translocator family member which resides in the plastid inner envelope membrane. Retrieves excessive pentose phosphates from the extra-plastidial space and makes them available to the plastids.
AT5G17650 glycine/proline-rich protein;(source:Araport11)
AT5G17690 Regulates the meristem response to light signals and the maintenance of inflorescence meristem identity. Influences developmental processes controlled by APETALA1. TFL2 silences specific genes within euchromatin but not genes positioned in heterochromatin. TFL2 protein localized preferentially to euchromatic regions and not to heterochromatic chromocenters. Involved in euchromatin organization. Required for epigenetic maintenance of the vernalized state.
AT5G17700 MATE efflux family protein;(source:Araport11)
AT5G17710 Chloroplast GrpE protein involved in chloroplastic response to heat stress and the correct oligomerization of the photosynthesis-related LHCII complex.
AT5G17720 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G17725 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.9e-07 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10)
AT5G17730 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT5G17750 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT5G17760 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT5G17770 Encodes NADH:cytochrome (Cyt) b5 reductase that displayed strict specificity to NADH for the reduction of a recombinant Cyt b5 (AtB5-A), whereas no Cyt b5 reduction was observed when NADPH was used as the electron donor.
AT5G17780 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G17810 Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Together with WOX11, WOX12 is involved in de novo root organogenesis.
AT5G17830 Plasma-membrane choline transporter family protein;(source:Araport11)
AT5G17847 hypothetical protein;(source:Araport11)
AT5G17860 Cation/Ca2+ exchanger family member. Double mutants with CCX4 show delayed greening and defects in ROS response.
AT5G17900 microfibrillar-associated protein-like protein;(source:Araport11)
AT5G17960 Encodes a member of a Cys-rich protein family known as C1-clan proteins, that contains C1_2, C1_3 and ZZ/PHD type C1 domains. Its expression is responsive to phytohormones and is affected by biotic (chitin) and different abiotic (salinity, drought, cold and UV) treatments.
AT5G17980 C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11)
AT5G17990 Encodes the tryptophan biosynthetic enzyme phosphoribosylanthranilate transferase (PAT1, called trpD in bacteria). Converts anthranilate and phosphoribosylpyrophosphate into phosphoribosylanthranilate and inorganic pyrophosphate. The mRNA is cell-to-cell mobile.
AT5G18000 Encodes VERDANDI (VDD), a putative transcription factor belonging to the reproductive meristem (REM) family. VDD is a direct target of the MADS domain ovule identity complex. Mutation in VDD affects embryo sac differentiation.
AT5G18020 SAUR-like auxin-responsive protein family;(source:Araport11)
AT5G18060 SAUR-like auxin-responsive protein family;(source:Araport11)
AT5G18070 encodes a novel protein involved in DNA repair from UV damage. Isolated by functional complementation of E. coli UV-sensitive mutants (UVR genes).
AT5G18080 Encodes SAUR24 (small auxin up RNA 24). Note that TAIR nomenclature is based on Plant Mol Biol. 2002, 49:373-85 (PMID:12036261). In Planta (2011) 233:1223?1235 (PMID:21327815), SAUR24 is At5g18010.
AT5G18090 AP2/B3-like transcriptional factor family protein;(source:Araport11)
AT5G18130 transmembrane protein;(source:Araport11)
AT5G18140 Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT5G18150 Methyltransferase-related protein;(source:Araport11)
AT5G18160 F-box and associated interaction domains-containing protein;(source:Araport11)
AT5G18220 O-Glycosyl hydrolases family 17 protein;(source:Araport11)
AT5G18240 Encodes MYR1 (MYR1).
AT5G18270 NAC domain containing protein 87;(source:Araport11)
AT5G18280 Encodes an enzyme with ATPase and ADPase activity (an apyrase) that when mutated in combination with ATAPY1 causes a complete inhibition of pollen germination.
AT5G18300 NAC domain containing protein 88;(source:Araport11)
AT5G18310 ubiquitin hydrolase;(source:Araport11)
AT5G18320 One of three tandemly located, paralogous plant U-box proteins. Mutants show increased sensitivity to water stress.Expression in roots is enhanced by auxin and to a lesser extent ABA and cytokinin treatment.
AT5G18340 One of three tandemly located, paralogous plant U-box proteins. Mutants show increased sensitivity to water stress. E3 ligase which acts as a regulator in the heat response signaling pathway. Over-expressing AtPUB48 could induce the expression of the heat-related genes (HSP101, HSP70, HSP25.3, HSFA2, and ZAT12). Enhances plant resistance to heat stress during seed germination and seedling growth.
AT5G18350 Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT5G18390 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT5G18407 Encodes a defensin-like (DEFL) family protein.
AT5G18410 distorted trichomes and exhibits a diffuse actin cytoskeleton
AT5G18440 Encodes NUFIP that directs assembly of C/D snoRNP (small nucleolar ribonucleoprotein).
AT5G18450 encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought.
AT5G18460 carboxyl-terminal peptidase (DUF239);(source:Araport11)
AT5G18490 vacuolar sorting-associated protein (DUF946);(source:Araport11)
AT5G18560 Encodes PUCHI, a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. PUCHI is required for morphogenesis in the early lateral root primordium of Arabidopsis. Expressed in early floral meristem (stage 1 to 2). Required for early floral meristem growth and for bract suppression. Triple mutant with bop1 and bop2 displays a strong defect in the determination of floral meristem identity with reduced LFY expression and the lack of AP1 expression.
AT5G18580 fass mutants have aberrant cell shapes due to defects in arrangement of cortical microtubules. Encodes a protein highly conserved in higher plants and similar in its C-terminal part to B' regulatory subunits of type 2A protein phosphatases. Interacts with an Arabidopsis type A subunit of PP2A in the yeast two-hybrid system.
AT5G18660 Encodes a protein with 3,8-divinyl protochlorophyllide a 8-vinyl reductase activity. Mutants accumulate divinyl chlorophyll rather than monovinyl chlorophyll.
AT5G18750 DNAJ heat shock N-terminal domain-containing protein;(source:Araport11)
AT5G18755 pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT5G18790 Ribosomal protein L33 family protein;(source:Araport11)
AT5G18840 Major facilitator superfamily protein;(source:Araport11)
AT5G18850 Low-density receptor-like protein;(source:Araport11)
AT5G18860 Encodes a purine nucleoside hydrolase active in the apoplast. It might play a role in salvaging extracellular ATP. NSH3 transcript levels rise in response to jasmonic acid and wounding.
AT5G18870 Similar to N terminal region of NSH1 nucleoside hydrolase.
AT5G18890 Inosine-uridine preferring nucleoside hydrolase family protein;(source:Araport11)
AT5G18910 Protein kinase superfamily protein;(source:Araport11)
AT5G18930 S-adenosylmethionine decarboxylase family member.
AT5G18940 Mo25 family protein;(source:Araport11)
AT5G18950 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT5G18970 AWPM-19-like family protein;(source:Araport11)
AT5G18980 ARM repeat superfamily protein;(source:Araport11)
AT5G19020 Encodes a pentatricopeptide repeat protein (PPR) protein involved in mitochondrial mRNA editing.
AT5G19030 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT5G19040 Encodes cytokinin synthase.
AT5G19050 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G19060 cytochrome P450 family protein;(source:Araport11)
AT5G19080 Paralog of LOG2 (At3g09770), a ubiquitin ligase that regulates amino acid export.
AT5G19090 Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT5G19095 pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10)
AT5G19160 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT5G19170 NEP-interacting protein, putative (DUF239);(source:Araport11)
AT5G19190 hypothetical protein;(source:Araport11)
AT5G19260 A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines.
AT5G19280 kinase associated protein phosphatase composed of three domains: an amino-terminal signal anchor, a kinase interaction (KI) domain, and a type 2C protein phosphatase catalytic region
AT5G19320 Encodes RAN GTPase activating protein 2. The protein is localized to the nuclear envelope during interphase.
AT5G19360 member of Calcium Dependent Protein Kinase
AT5G19390 Encodes a protein with similarity to REN1, a Rho GTPase activating protein.It is cytoplasmic and plasma membrane associated in interphase, but during mitosis localizes to the CDZ/CDS in a POK-dependent manner.
AT5G19400 Encodes SMG7, a protein that possesses an evolutionarily conserved EST1 domain and exhibits strong homology to human SMG6 (EST1A) and SMG7 (EST1C) proteins. SMG7 plays an evolutionarily conserved role in nonsense-mediated RNA decay (NMD). Required for exit from meiosis. Hypomorphic smg7 alleles render mutant plants sterile by causing an unusual cell-cycle arrest in anaphase II that is characterized by delayed chromosome decondensation and aberrant rearrangement of the meiotic spindle. Disruption of SMG7 causes embryonic lethality.
AT5G19410 ABC-2 type transporter family protein;(source:Araport11)
AT5G19440 similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), apple tree, PIR:T16995; NOT a cinnamyl-alcohol dehydrogenase
AT5G19473 RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11)
AT5G19520 mechanosensitive channel of small conductance-like 9;(source:Araport11)
AT5G19530 Encodes a spermine synthase. Required for internode elongation and vascular development, specifically in the mechanism that defines the boundaries between veins and nonvein regions. This mechanism may be mediated by polar auxin transport. Though ACL5 has been shown to function as a spermine synthase in E. coli, an ACL5 knockout has no effect on the endogenous levels of free and conjugated polyamines in Arabidopsis, suggesting that ACL5 may have a very specific or altogether different in vivo function.
AT5G19560 Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily.
AT5G19570 transmembrane protein;(source:Araport11)
AT5G19580 Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification.
AT5G19610 GNOM-like 2;(source:Araport11)
AT5G19630 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G19640 Influences leaf N export via sink-to-source feedback, perhaps via a role in sensing plant internal N-status. Necessary for normal leaf N export under low N.
AT5G19670 Exostosin family protein;(source:Araport11)
AT5G19720 Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain-containing protein;(source:Araport11)
AT5G19820 Encodes an importin that transports HYL1, a component of the microprocessor, from the cytoplasm to the nucleus to constitute functional microprocessor, thereby affecting miRNA processing. Knockdown amiR mutants significantly reduced nuclear portion of HYL1 protein and correspondingly compromised the pri-miRNA processing in the nucleus.KETCH1 may protect RPs from the 26S proteasome-mediated degradation.
AT5G19850 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G19860 transmembrane protein, putative (Protein of unknown function, DUF538);(source:Araport11)
AT5G19880 Peroxidase superfamily protein;(source:Araport11)
AT5G19890 Peroxidase superfamily protein;(source:Araport11)
AT5G19900 PRLI-interacting factor;(source:Araport11)
AT5G19970 GRAS family transcription factor family protein;(source:Araport11)
AT5G20030 Plant Tudor-like RNA-binding protein;(source:Araport11)
AT5G20100 Tightly connected with MAPK signaling to fine-tune stomatal production and patterning.
AT5G20150 Expression is upregulated in the shoot of cax1/cax3 mutant. Additionally, its expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. The mRNA is cell-to-cell mobile.
AT5G20160 Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11)
AT5G20190 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT5G20220 zinc knuckle (CCHC-type) family protein;(source:Araport11)
AT5G20225 Natural antisense transcript overlaps with AT5G20220;(source:Araport11)
AT5G20250 encodes a member of glycosyl hydrolase family 36. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile.
AT5G20260 Exostosin family protein;(source:Araport11)
AT5G20270 heptahelical transmembrane protein homologous to human adiponectin receptors and progestin receptors
AT5G20280 Encodes a sucrose-phosphate synthase activity. This is the major leaf isoform.
AT5G20300 Encodes Toc90, part of the TOC (translocon at the outer chloroplast membrane) machinery involved in the import of nucleus-encoded proteins into the chloroplast.
AT5G20310 Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11)
AT5G20340 Encodes a putative beta 1,3-glucanase.
AT5G20370 serine-rich protein-like protein;(source:Araport11)
AT5G20440 Mob1/phocein family protein;(source:Araport11)
AT5G20470 Encodes a headless derivative of myosin XI-K, which likely arose from a partial duplication of the XI-K gene and is developmentally regulated.
AT5G20570 Encodes a ring-box 1 like protein and component of the SCF ubiquitinization complex mediating auxin responses. Forms a E3 ubiquitin ligase complex with CUL3A and At1g21780.1 a BTB domain protein.
AT5G20630 Encodes a germin-like protein. Its transcripts are more abundant in RNA from leaves collected in the evening, suggesting some kind of circadian regulation.
AT5G20635 Encodes an atypical heterotrimeric G-protein gamma-subunit involved in guard cell K+-channel regulation and morphological development.
AT5G20650 Encodes COPT5, a member of copper transporter family and functionally complements a high affinity copper transporter mutant in yeast. Plays an important role in the plant response to environmental copper scarcity, probably by remobilizing copper from prevacuolar vesicles, which could act as internal stores or recycling vesicles to provide the metal cofactor to key copper-dependent processes such as photosynthesis.
AT5G20670 DUF1677 family protein (DUF1677);(source:Araport11)
AT5G20690 PRK6 is pollen specific receptor kinase that functions as a receptor for the pollen attractant LURE1 in pollen tube guidance. It is localized to the tip the pollen tube and becomes asymmetrically distributed towards the source of the LURE1 signal prior to pollen tube growth reorientation.
AT5G20700 senescence-associated family protein, putative (DUF581);(source:Araport11)
AT5G20720 Encodes a chloroplast co-chaperonin with similarity to CPN21 from spinach, E.coli GroES.
AT5G20760 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42700.1);(source:TAIR10)
AT5G20830 Encodes a protein with sucrose synthase activity (SUS1).
AT5G20858 pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10)
AT5G20860 Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT5G20870 O-Glycosyl hydrolases family 17 protein;(source:Araport11)
AT5G20885 RING/U-box superfamily protein;(source:Araport11)
AT5G20910 Encodes an E3 ligase that can interact with and polyubiquitinate ABI3 in vitro. AIP2 likely negatively regulates ABA signaling by targeting ABI3 for post-translational destruction.
AT5G20970 HSP20-like chaperones superfamily protein;(source:Araport11)
AT5G21020 transmembrane protein;(source:Araport11)
AT5G21030 PAZ domain-containing protein / piwi domain-containing protein;(source:Araport11)
AT5G21080 Uncharacterized protein;(source:Araport11)
AT5G21100 Plant L-ascorbate oxidase;(source:Araport11)
AT5G21120 ethylene-insensitive3-like2 (EIL2)
AT5G21150 AGO9-dependent sRNA silencing is crucial to specify cell fate in the Arabidopsis ovule. AGO9 is expressed in reproductive companion cells but not in the associated male or female gametes or their precursors. Therefore, AGO9 acts non-cell autonomously to silencing the activity of TEs activity in the female gametophyte.Loss of function mutants produce ectopic megaspore mother cell and supernumary female gametophytes.
AT5G21160 Encodes a protein with sequence similarity to mRNA binding proteins from humans. LARP1a is involved in mRNA degradation in response to heat stress. Upon heat stress LARP1a interacts with XRN4 and appears to be responsible for addressing XRN4 to the polysome. LARP1/XRN4 double mutants are impaired in thermotolerance and lower levels of heat induced RNA turnover.
AT5G21170 Encodes AKINbeta1, a subunit of the SnRK1 kinase (Sucrose non-fermenting-1-related protein kinase). Involved in regulation of nitrogen and sugar metabolism. As part of the regulatory subunit, it binds maltose which promotes kinase activity. Acts as a global regulator of genes involved in carbon, lipid and nitrogen metabolism.
AT5G21280 Seed plant lineage specific gene that is expressed in response to oxidative and abiotic stresses.
AT5G21482 This gene used to be called AtCKX5. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. Enzyme assays show preference for N6 -(2-isopentenyl)adenine 9-glucoside substrate.
AT5G21535 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT5G21900 Contributes to UV tolerance through nucleotide excision repair.
AT5G21940 hybrid signal transduction histidine kinase M-like protein;(source:Araport11)
AT5G21950 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G22000 encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. Double mutant analyses with RHF1a suggests that RHF2a may be involved in targetting ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF2a is expressed in all four floral whorls and is present at ~8-fold higher levels than RHF1a in inflorescences by RT-PCR analyses.
AT5G22010 Encodes RFC1, the largest subunit of replication factor C. Mediates genomic stability and transcriptional gene silencing.
AT5G22080 Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT5G22090 EAR1 is a negative regulator of ABA signaling that enhances the activity of all six clade A PP2Cs (ABI1, ABI2, HAB1, HAB2, AHG1, AHG3) by interacting with and releasing the N-terminal autoinhibition of these proteins. EAR1 indirectly affects OST1 activity through enhancing ABI1 activity. The EAR1 141-287 fragment is sufficient for the functioning of EAR1 in ABA responses; the 131-248 region harbors an intrinsically disordered region and only 249-278 can form a predicted regular structure. EAR1 is located in the ER, nuclei, and cytoplasm; ABA signaling promotes the translocation of EAR1 from the ER and/or cytoplasm to the nucleus. Mutations showed that it functions in seed germination, primary root growth, and drought tolerance.
AT5G22100 RNA cyclase family protein;(source:Araport11)
AT5G22120 coiled-coil protein;(source:Araport11)
AT5G22180 hypothetical protein;(source:Araport11)
AT5G22250 Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses.
AT5G22260 Sporophytic factor controlling anther and pollen development. Mutants fail to make functional pollen;pollen degeneration occurs after microspore release and the tapetum also appears abnormally vacuolated. Similar to PHD-finger motif transcription factors.
AT5G22310 trichohyalin-like protein;(source:Araport11)
AT5G22340 NF-kappa-B inhibitor-like protein;(source:Araport11)
AT5G22350 fission ELM1-like protein (DUF1022);(source:Araport11)
AT5G22380 NAC domain containing protein 90;(source:Araport11)
AT5G22390 FANTASTIC four-like protein (DUF3049);(source:Araport11)
AT5G22400 Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11)
AT5G22410 root hair specific 18;(source:Araport11)
AT5G22420 fatty acid reductase 7;(source:Araport11)
AT5G22430 Pollen Ole e 1 allergen and extensin family protein;(source:Araport11)
AT5G22460 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G22470 PARP3 is one of three canonical PARPs in Arabidopsis.
AT5G22500 Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue.
AT5G22510 Encodes a chloroplast-targeted alkaline/neutral invertase that is implicated in the development of the photosynthetic apparatus and nitrogen assimilation in seedlings to control the sucrose to hexose ratio.
AT5G22530 Unknown protein, knockout shows increased sensitivity to Al stress.
AT5G22540 Associated with a QTL for quantitative disease resistance.
AT5G22555 transmembrane protein;(source:Araport11)
AT5G22580 Stress responsive A/B Barrel Domain-containing protein;(source:Araport11)
AT5G22630 Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile.
AT5G22660 FBD, F-box, Skp2-like and Leucine Rich Repeat domains containing protein;(source:Araport11)
AT5G22730 F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT5G22750 DNA repair gene. gamma-radiation hypersensitive (RAD5) involved in stable transformation and T-DNA transfer
AT5G22791 F-box family protein;(source:Araport11)
AT5G22800 A locus involved in embryogenesis. Mutations in this locus result in embryo lethality.
AT5G22810 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT5G22850 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT5G22910 member of Putative Na+/H+ antiporter family
AT5G22930 enabled-like protein (DUF1635);(source:Araport11)
AT5G22950 SNF7 family protein;(source:Araport11)
AT5G22980 serine carboxypeptidase-like 47;(source:Araport11)
AT5G23010 Encodes a methylthioalkylmalate synthase, catalyzes the condensation reactions of the first two rounds of methionine chain elongation in the biosynthesis of methionine-derived glucosinolates. The mRNA is cell-to-cell mobile.
AT5G23020 methylthioalkymalate synthase-like. Also known as 2-isopropylmalate synthase (IMS2). encodes a methylthioalkylmalate synthase involved in the biosynthesis of aliphatic glucosinolates which accepts all the omega-methylthio-2-oxoalkanoic acids needed to form the known C3 to C8 glucosinolates in Arabidopsis. The mRNA is cell-to-cell mobile.
AT5G23060 Encodes a chloroplast-localized protein that modulates cytoplasmic Ca2+ concentration and is crucial for proper stomatal regulation in response to elevations of external Ca2+. Phosphorylation of this protein is dependent on calcium.
AT5G23080 Interacts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. It is an important component of miRNA and siRNA biogenesis. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1.
AT5G23100 MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11)
AT5G23110 Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11)
AT5G23120 encodes a stability and/or assembly factor of photosystem II The mRNA is cell-to-cell mobile.
AT5G23130 Peptidoglycan-binding LysM domain-containing protein;(source:Araport11)
AT5G23140 One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). This mitochondrial CLPP2 assists coordination and homeostasis of respiratory complexes.
AT5G23150 Putative transcription factor. Member of the floral homeotic AGAMOUS pathway.Mutations in HUA enhance the phenotype of mild ag-4 allele. Single hua mutants are early flowering and have reduced levels of FLC mRNA. Other MADS box flowering time genes such as FLM and MAF2 also appear to be regulated by HUA2. HUA2 normally activates FLC expression and enhances AG function. HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. The mRNA is cell-to-cell mobile.
AT5G23160 transmembrane protein;(source:Araport11)
AT5G23180 mediator-associated-like protein;(source:Araport11)
AT5G23190 cytochrome P450 CYP86B1, nuclear gene for chloroplast product. CYP86B1 is a very long chain fatty acid hydroxylase specifically involved in polyester monomer biosynthesis during the course of plant development.
AT5G23210 serine carboxypeptidase-like 34;(source:Araport11)
AT5G23212 Encodes a defensin-like (DEFL) family protein.
AT5G23220 nicotinamidase 3;(source:Araport11)
AT5G23250 Succinyl-CoA ligase, alpha subunit;(source:Araport11)
AT5G23260 Encodes a MADS box protein. Regulates proanthocyanidin biosynthesis in the inner-most cell layer of the seed coat. Also controls cell shape of the inner-most cell layer of the seed coat. Also shown to be necessary for determining the identity of the endothelial layer within the ovule. Paralogous to GOA. Plays a maternal role in fertilization and seed development.
AT5G23270 Membrane localized sucrose transporter.
AT5G23280 Transcription factor which plays an important role during leaf and hypocotyl development, redundantly, with at least six class I TCPs, and regulates the expression of CYCD1;1 to affect endoreplication.
AT5G23290 prefoldin 5;(source:Araport11)
AT5G23300 dihydroorotate dehydrogenase, catalyses fourth step of pyrimidine biosynthesis
AT5G23340 RNI-like superfamily protein;(source:Araport11)
AT5G23360 GRAM domain-containing protein / ABA-responsive protein-like protein;(source:Araport11)
AT5G23390 polygalacturonase inhibitor (DUF639);(source:Araport11)
AT5G23413 pseudogene of HMG-box (high mobility group) DNA-binding family protein;(source:Araport11)
AT5G23430 One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules.
AT5G23440 ferredoxin/thioredoxin reductase subunit A (variable subunit) 1;(source:Araport11)
AT5G23450 Encodes a sphingosine kinase that specifically phosphorylates D-erythro-dihydrosphingosine (DHS), but not N-acetyl-DHS or D-threo-DHS. It also also phosphorylates D-erythro-sphingosine, trans-4, trans-8-sphingadienine and phytosphingosine.
AT5G23480 SWIB/MDM2, Plus-3 and GYF domain-containing protein;(source:Araport11)
AT5G23510 hypothetical protein;(source:Araport11)
AT5G23530 carboxyesterase 18;(source:Araport11)
AT5G23550 Got1/Sft2-like vescicle transport protein family;(source:Araport11)
AT5G23580 Member of a unique family of enzymes containing a single polypeptide chain with a kinase domain at the amino terminus and a putative calcium-binding EF hands structure at the carboxyl terminus; recombinant protein is fully active and induced by Ca2+
AT5G23660 Encodes a member of the SWEET sucrose efflux transporter family proteins.
AT5G23730 Encodes REPRESSOR OF UV-B PHOTOMORPHOGENESIS 2 (RUP2). Functions as a repressor of UV-B signaling.
AT5G23750 Remorin family protein;(source:Araport11)
AT5G23790 Predicted to encode a galactinol synthase.
AT5G23830 MD-2-related lipid recognition domain-containing protein;(source:Araport11)
AT5G23860 beta-tubulin, preferentially expressed in endodermal and phloem cells of primary roots and in the vascular tissues of leaves, stems, and flowers. The mRNA is cell-to-cell mobile.
AT5G23880 Encodes a protein similar to the 100kD subunit of cleavage and polyadenylation specificity factor (CPSF), the factor responsible for the recognition of the AAUAAA motif during mRNA polyadenylation. The protein interacts with a portion of a nuclear poly(A) polymerase. It is likely to be a part of the mRNA 3'end formation apparatus.
AT5G23890 GPI-anchored adhesin-like protein;(source:Araport11)
AT5G23910 ATP binding microtubule motor family protein;(source:Araport11)
AT5G23920 transmembrane protein;(source:Araport11)
AT5G23955 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.6e-41 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10)
AT5G23960 Encodes a sesquiterpene synthase involved in generating all of the group A sesquiterpenes found in the Arabidopsis floral volatile blend. Strongly expressed in the stigma.
AT5G23970 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT5G23990 Encodes a ferric chelate reductase that is expressed at low levels in roots,shoots and flowers, but not cotyledons.
AT5G24010 Protein kinase superfamily protein;(source:Araport11)
AT5G24080 Protein kinase superfamily protein;(source:Araport11)
AT5G24090 Chitinase A (class III) expressed exclusively under environmental stress conditions. Shown be a plant lysozyme involved in plant immunity.
AT5G24105 Encodes a putative arabinogalactan-protein (AGP41).
AT5G24130 polypyrimidine tract-binding-like protein;(source:Araport11)
AT5G24140 Encodes a protein with similarity to squalene monoxygenases.
AT5G24165 hypothetical protein;(source:Araport11)
AT5G24180 Lipase class 3-related protein;(source:Araport11)
AT5G24200 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G24205 other_RNA;(source:Araport11)
AT5G24220 Lipase class 3-related protein;(source:Araport11)
AT5G24270 encodes a calcium sensor that is essential for K+ nutrition, K+/Na+ selectivity, and salt tolerance. The protein is similar to calcineurin B. Lines carrying recessive mutations are hypersensitive to Na+ and Li+ stresses and is unable to grow in low K+. The growth defect is rescued by extracellular calcium.
AT5G24280 Encodes GMI1, a structural-maintenance-of-chromosomes-hinge domain-containing protein. Involved in somatic homologous recombination.
AT5G24290 Vacuolar iron transporter (VIT) family protein;(source:Araport11)
AT5G24314 plastid transcriptionally active7;(source:Araport11)
AT5G24316 proline-rich family protein;(source:Araport11)
AT5G24330 Encodes a SET-domain protein, a H3K27 monomethyltransferases required for chromatin structure and gene silencing. Regulates heterochromatic DNA replication. Contains a PCNA-binding domain. ATXR6 accumulates preferentially during the late G1 or S phase, suggesting that it plays a role in cell-cycle regulation or progression.
AT5G24340 3-5 exonuclease domain-containing protein;(source:Araport11)
AT5G24350 Member of MAG2 complex on the ER that is responsible for efficient transport of seed storage proteins, functions in protein transport between the ER and Golgi apparatus, contain a Zeste?White 10 (ZW10) domain and a Sec39 domain. Required for proper maturation of seed storage proteins.
AT5G24360 IRE1A and IRE1B catalyze bZIP60 mRNA splicing, producing the active bZIP60 transcription factor.
AT5G24370 Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT5G24380 closest Arabidopsis homolog of Zea maize metal-phytosiderophore/metal-nicotianamine transporter ZmYS1
AT5G24390 Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11)
AT5G24400 Encodes a protein with 6-phosphoglucunolactonase activity that localizes to the chloroplasts and the peroxisome. However, mutant phenotypes observed in pgl3 mutant plants can be complemented with a chloroplast-targeted version of the protein. PGL3 likely functions in the oxidative branch of the pentose phosphate pathway. pgl3 mutant phenotypes suggest that it is important in pathogen defense and maintenance of cellular redox homeostasis.
AT5G24420 Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP).
AT5G24430 Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11)
AT5G24530 Encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility to downy mildew. The mRNA is cell-to-cell mobile.
AT5G24540 beta glucosidase 31;(source:Araport11)
AT5G24570 hypothetical protein;(source:Araport11)
AT5G24620 Pathogenesis-related thaumatin superfamily protein;(source:Araport11)
AT5G24655 response to low sulfur 4;(source:Araport11)
AT5G24660 response to low sulfur 2;(source:Araport11)
AT5G24740 Encodes a vacuolar sorting protein that interacts with the plant-specific GRAS family transcription factor SHORT-ROOT and acts in a pathway that controls root growth and radial patterning. It provides a connections between gibberellic acid, SHR and PLT signaling in the root.
AT5G24775 transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.6e-99 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10)
AT5G24790 transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11)
AT5G24810 ABC1 family protein;(source:Araport11)
AT5G24820 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT5G24825 Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: CAGCCAAGGAUGACUUGCCGG
AT5G24840 tRNA (guanine-N-7) methyltransferase;(source:Araport11)
AT5G24870 Ubiquitin E3 ligase, works with WDL7 in module which regulates microtubule disassembly to mediate stomatal closure in response to drought stress and ABA treatment. MREL57 interacts with, ubiquitinates and degrades WDL7, effect is enhanced by ABA.
AT5G24879 This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT5G24880 chromo domain cec-like protein;(source:Araport11)
AT5G24890 stress response NST1-like protein;(source:Araport11)
AT5G24900 Member of CYP714A. Encodes one of the two tandemly duplicated gene pair ELA1 (CYP714A1) and ELA2 (CYP714A2), homologs of the rice cytochrome P450 monooxygenase gene EUI1. Double mutation of ELA1 and ELA2 results in increased biomass and enlarged organs.
AT5G24915 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.1e-38 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10)
AT5G24930 Flowering repressor in long days (LD) and short days (SD) and acts on the expression of FT and FT-like genes as well as on SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1).
AT5G24940 Protein phosphatase 2C family protein;(source:Araport11)
AT5G24950 putative cytochrome P450
AT5G25010 enhanced disease resistance-like protein (DUF1336);(source:Araport11)
AT5G25040 Major facilitator superfamily protein;(source:Araport11)
AT5G25050 Major facilitator superfamily protein;(source:Araport11)
AT5G25060 RNA recognition motif (RRM)-containing protein;(source:Araport11)
AT5G25080 Sas10/Utp3/C1D family;(source:Araport11)
AT5G25110 salt- and anoxia-induced member of AtCIPK family.
AT5G25120 putative cytochrome P450 The mRNA is cell-to-cell mobile.
AT5G25140 putative cytochrome P450
AT5G25160 Encodes a zinc finger protein containing only a single zinc finger.
AT5G25190 encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11.
AT5G25200 Ta11-like non-LTR retrotransposon;(source:Araport11)
AT5G25210 hypothetical protein;(source:Araport11)
AT5G25260 Belongs to the group of plant flotillins, which are plasma membrane proteins. Flot2 complexes are found in microdomains and may be involved in plant-pathogen interactions, water transport and intracellular trafficking.
AT5G25280 serine-rich protein-like protein;(source:Araport11)
AT5G25290 F-box protein (DUF295);(source:Araport11)
AT5G25310 Exostosin family protein;(source:Araport11)
AT5G25320 ACT-like superfamily protein;(source:Araport11)
AT5G25330 Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11)
AT5G25340 Ubiquitin-like superfamily protein;(source:Araport11)
AT5G25360 hypothetical protein;(source:Araport11)
AT5G25370 member of C2-PLD subfamily. Analyses on the gene structures/sequences, overall amino acid sequences, and domain structures indicate that PLDalpha3 is most closely related to other two PLDalphas than to other PLDs. Phylogenetic analysis has not identified a true ortholog for PLDalpha3. Involved in hyperosmotic response.
AT5G25380 core cell cycle genes
AT5G25400 Nucleotide-sugar transporter family protein;(source:Araport11)
AT5G25420 Xanthine/uracil/vitamin C permease;(source:Araport11)
AT5G25430 HCO3- transporter family;(source:Araport11)
AT5G25440 Receptor like kinase involved in HopZ1a effector triggered immunity. Interacts with ZAR1. Localization to membrane is dependent on N-terminal myristoylation domain.
AT5G25451 Pseudogene of AT5G25440; protein kinase family protein
AT5G25470 AP2/B3-like transcriptional factor family protein;(source:Araport11)
AT5G25475 AP2/B3-like transcriptional factor family protein;(source:Araport11)
AT5G25500 exosome complex exonuclease;(source:Araport11)
AT5G25530 DNAJ heat shock family protein;(source:Araport11)
AT5G25560 CHY-type/CTCHY-type/RING-type Zinc finger protein;(source:Araport11)
AT5G25580 hypothetical protein;(source:Araport11)
AT5G25585 pre-tRNA tRNA-Leu (anticodon: CAA);(source:Araport11, TAIR10)
AT5G25600 putative nucleic-acid protein;(source:Araport11)
AT5G25640 Rhomboid-related intramembrane serine protease family protein;(source:Araport11)
AT5G25754 RNA polymerase I-associated factor PAF67;(source:Araport11)
AT5G25757 RNA polymerase I-associated factor PAF67;(source:Araport11)
AT5G25770 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G25800 Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11)
AT5G25830 Encodes a member of the GATA factor family of zinc finger transcription factors.
AT5G25840 DUF1677 family protein (DUF1677);(source:Araport11)
AT5G25850 F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT5G25860 F-box/RNI-like superfamily protein;(source:Araport11)
AT5G25880 The malic enzyme (EC 1.1.1.40) encoded by the ATNADP-ME3 is presumably cytosolic and restricted in its expression by both developmental and cell-specific signals.
AT5G25890 encodes a protein that may be a negative regulator of lateral root formation in response to auxin. It is a member of IAA/ARF gene family and is plant-specific. Gain of function mutations in this gene suppresses lateral root formation and is resistant to inhibition of root elongation by auxin, cytokinin, and ethylene.
AT5G25900 Encodes a member of the CYP701A cytochrome p450 family that is involved in later steps of the gibberellin biosynthetic pathway.
AT5G25930 kinase family with leucine-rich repeat domain-containing protein;(source:Araport11)
AT5G25980 Myrosinase (thioglucoside glucohydrolase) gene involved in glucosinoloate metabolism. The mRNA is cell-to-cell mobile.
AT5G26038 Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCAAUAGAUUGGACUAUGUAU
AT5G26040 Class III RPD3 type protein. Encodes HDA2, a member of the histone deacetylase family proteins.
AT5G26080 proline-rich family protein;(source:Araport11)
AT5G26090 Plant self-incompatibility protein S1 family;(source:Araport11)
AT5G26100 hypothetical protein;(source:Araport11)
AT5G26120 alpha-L-arabinofuranosidase 2;(source:Araport11)
AT5G26130 CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11)
AT5G26170 member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses.
AT5G26190 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT5G26250 Sugar transporter expressed strongly in pollen and pollen tubes.
AT5G26286 pseudogene of TRAF-like family protein;(source:Araport11)
AT5G26300 TRAF-like family protein;(source:Araport11)
AT5G26330 Cupredoxin superfamily protein;(source:Araport11)
AT5G26570 chloroplastidic phosphoglucan, water dikinase (PWD) which is required for normal degradation of leaf starch in Arabidopsis. NMR analysis of the mutants, suggests that the gene is specifically involved in the phosphorylation of the glucosyl residues of starch at the C3 position.
AT5G26622 Beta-galactosidase related protein;(source:Araport11)
AT5G26630 MADS-box transcription factor family protein;(source:Araport11)
AT5G26660 myb domain protein 86;(source:Araport11)
AT5G26670 Pectinacetylesterase family protein;(source:Araport11)
AT5G26692 Encodes a Plant thionin family protein
AT5G26717 Encodes a Plant thionin family protein
AT5G26731 hypothetical protein;(source:Araport11)
AT5G26740 organic solute transporter ostalpha protein (DUF300);(source:Araport11)
AT5G26742 DEAD box RNA helicase (RH3);(source:Araport11)
AT5G26760 Encodes RPAP2 IYO Mate (RIMA), a homologue of yeast and human proteins linked to nuclear import of selective cargo. Knockdown of RIMA causes delayed onset of cell differentiation.
AT5G26780 Encodes a protein with serine hydroxymethyltransferase activity which is thought to be localized in the mitochondrial matrix. SHM2 expression fails to rescue the conditional lethal phenotype of the shm1-1 mutant, defective in SHM1.
AT5G26790 transmembrane protein;(source:Araport11)
AT5G26805 B3 domain protein;(source:Araport11)
AT5G26930 Encodes a member of the GATA factor family of zinc finger transcription factors. Controls lateral root founder cell specification.
AT5G26990 Drought-responsive family protein;(source:Araport11)
AT5G27010 ARM repeat superfamily protein;(source:Araport11)
AT5G27020 hypothetical protein;(source:Araport11)
AT5G27043 pseudogene of cell division cycle 20.2;(source:Araport11)
AT5G27120 SAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; has similarity to MAR binding NOP58 protein The mRNA is cell-to-cell mobile.
AT5G27130 AGAMOUS-like 39;(source:Araport11)
AT5G27140 NOP56-like pre RNA processing ribonucleoprotein;(source:Araport11)
AT5G27150 Encodes a vacuolar sodium/proton antiporter involved in salt tolerance, ion homeostasis, and leaf development. The mRNA is cell-to-cell mobile.
AT5G27210 Protein of unknown function, transmembrane-40;(source:Araport11)
AT5G27220 Frigida-like protein;(source:Araport11)
AT5G27230 Frigida-like protein;(source:Araport11)
AT5G27238 Plant self-incompatibility protein S1 family;(source:Araport11)
AT5G27247 This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT5G27310 Transcription factor IIS family protein;(source:Araport11)
AT5G27320 Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4.
AT5G27350 Encodes a sugar-porter family protein that is induced during leaf senescence. The increase in its gene expression during leaf senescence is paralleled by an accumulation of monosaccharides. The mRNA is cell-to-cell mobile.
AT5G27400 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; CONTAINS InterPro DOMAIN/s: Methyltransferase-16, putative (InterPro:IPR019410); BEST Arabidopsis thaliana protein match is: D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein (TAIR:AT5G27410.2). Note that the At5g27410.2 gene model (TAIR10) of the adjacent locus has been obsoleted due to the lack of experimental support.
AT5G27410 D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Aminotransferase, class IV (InterPro:IPR001544); BEST Arabidopsis thaliana protein match is: D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein (TAIR:AT3G05190.1). Note that the At5g27410.2 gene model (TAIR10) has been obsoleted due to the lack of experimental support.
AT5G27430 Signal peptidase subunit;(source:Araport11)
AT5G27460 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT5G27470 seryl-tRNA synthetase / serine-tRNA ligase;(source:Araport11)
AT5G27500 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43920.1);(source:TAIR10)
AT5G27510 Protein kinase superfamily protein;(source:Araport11)
AT5G27530 Member of pectin lyase gene family.
AT5G27540 Encodes a protein with similarity to GTPases that is localized to the mitochondrion. Involved in embryogenesis, pollen tube growth and required for mitochondrial development.
AT5G27550 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT5G27580 AGAMOUS-like 89;(source:Araport11)
AT5G27610 protein ALWAYS EARLY 1;(source:Araport11)
AT5G27620 core cell cycle genes The mRNA is cell-to-cell mobile.
AT5G27640 encodes a member of eukaryotic translation initiation factor 3B family.
AT5G27670 Encodes HTA7, a histone H2A protein.
AT5G27680 RECQ helicase SIM;(source:Araport11)
AT5G27700 Cytosolic ribosomal protein. Similar to EVR1 and redundant with EVR1. Also enhances VAR2 mutant varigation, but to a lesser extent than evr1.
AT5G27807 Encodes a microRNA that targets several genes containing NAC domains including NAC1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCG. Early extra petal mutant (eep1). Pri-mRNA coordinates for MIR164c (converted to TAIR10 based on PMID19304749): Chr5: 9852483-9853314 (forward), length: 832 bp; exon coordinates: exon 1: 9852483-9853314; mature miRNA and miRNA* are located on exon 1.
AT5G27840 Encodes a Type One Protein Phosphatase that acts as a nucleocytoplasmic negative regulator of tip growth. Mutants affect pollen germination, pollen tube growth, and root hair growth. It acts genetically downstream of ANX1 (AT3G04690) and ANX2 (AT5G28680) and is functionally redundant with ATUNIS1/TOPP9 (AT3G05580).
AT5G27850 Ribosomal protein L18e/L15 superfamily protein;(source:Araport11)
AT5G27870 Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT5G27889 This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT5G27902 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 5.3e-51 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10)
AT5G27930 EGR2 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress. EGR2 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane.
AT5G27940 WPP domain protein 3;(source:Araport11)
AT5G27950 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT5G28010 Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11)
AT5G28020 Encodes cysteine synthase CysD2.
AT5G28050 Cytidine/deoxycytidylate deaminase family protein;(source:Araport11)
AT5G28080 Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases.
AT5G28145 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.1e-195 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10)
AT5G28150 hypothetical protein (DUF868);(source:Araport11)
AT5G28180 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT5G28190 transmembrane protein;(source:Araport11)
AT5G28210 mRNA capping enzyme family protein;(source:Araport11)
AT5G28237 Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11)
AT5G28240 transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10)
AT5G28280 pseudogene of sterol desaturase domain-containing protein;(source:Araport11)
AT5G28285 transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 9.8e-101 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10)
AT5G28295 hypothetical protein;(source:Araport11)
AT5G28300 Encodes a Ca(2+)-dependent CaM-binding protein. AtGT2L specifically targets the nucleus and possesses both transcriptional activation and DNA-binding abilities, implicating its function as a nuclear transcription factor.
AT5G28310 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT5G28463 transmembrane protein;(source:Araport11)
AT5G28480 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G28270.1);(source:TAIR10)
AT5G28490 Encodes a nuclear protein that mediates light regulation of seedling development in a phytochrome-dependent manner.
AT5G28510 beta glucosidase 24;(source:Araport11)
AT5G28523 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 8.9e-31 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10)
AT5G28525 pseudogene of hypothetical protein;(source:Araport11)
AT5G28526 transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 7.1e-289 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10)
AT5G28530 FAR1-related sequence 10;(source:Araport11)
AT5G28545 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.7e-08 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10)
AT5G28550 separase;(source:Araport11)
AT5G28600 transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10)
AT5G28605 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.3e-44 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT5G28620 kinase C-like protein;(source:Araport11)
AT5G28637 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.1e-23 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT5G28646 Encodes a novel protein. The wvd2 gain-of-function mutant has impaired cell expansion and root waving, and changed root skewing.
AT5G28680 Receptor-like kinase required for maintenance of pollen tube growth. Display polar localization at the plasma membrane of the pollen tube tip.
AT5G28773 transposable_element_gene;(source:Araport11);pseudogene, similar to Putative retroelement, similar to putative reverse transcriptase;(source:TAIR10)
AT5G28776 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.6e-199 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10)
AT5G28780 PIF1 helicase;(source:Araport11)
AT5G28870 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT5G28880 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT5G28885 hypothetical protein;(source:Araport11)
AT5G28890 transposable_element_gene;(source:Araport11);similar to DNA binding [Arabidopsis thaliana] (TAIR:AT4G01980.1);(source:TAIR10)
AT5G28892 transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, blastp match of 40%25 identity and 7.3e-142 P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10)
AT5G28894 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-23 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10)
AT5G28910 alpha-(1,6)-fucosyltransferase;(source:Araport11)
AT5G28927 transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 3.9e-45 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10)
AT5G28935 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.0e-48 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT5G28996 pseudogene of phosphoenolpyruvate carboxykinase 1;(source:Araport11)
AT5G29015 transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.3e-121 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10)
AT5G29020 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G60930.1);(source:TAIR10)
AT5G29029 transposable_element_gene;(source:Araport11);pseudogene, similar to Putative copia-type polyprotein, blastp match of 46%25 identity and 3.0e-30 P-value to GP|15209144|gb|AAK91877.1|AC091665_3|AC091665 Putative copia-type polyprotein {Oryza sativa};(source:TAIR10)
AT5G29031 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT5G29090 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G33131.1);(source:TAIR10)
AT5G29210 hypothetical protein;(source:Araport11)
AT5G29560 caleosin-related family protein;(source:Araport11)
AT5G29562 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.8e-228 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10)
AT5G30269 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-141 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT5G30584 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-15 P-value blast match to GB:CAA28054 ORF (Ty1_Copia-element) (Drosophila melanogaster);(source:TAIR10)
AT5G30852 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to contains similarity to Arabidopsis thaliana hypothetical protein (GB:AC004483);(source:TAIR10)
AT5G31122 transposable_element_gene;(source:Araport11);pseudogene, similar to Putative copia-type polyprotein, blastp match of 56%25 identity and 1.5e-39 P-value to GP|15209144|gb|AAK91877.1|AC091665_3|AC091665 Putative copia-type polyprotein {Oryza sativa};(source:TAIR10)
AT5G31355 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 9.8e-153 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10)
AT5G31412 hAT transposon superfamily protein;(source:Araport11)
AT5G31770 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.7e-53 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT5G31787 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32312.1);(source:TAIR10)
AT5G31804 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-259 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT5G31807 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.4e-05 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10)
AT5G31821 transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 6.2e-86 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT5G32072 pseudogene of Glucose-6-phosphate isomerase
AT5G32112 transposable_element_gene;(source:Araport11);pseudogene, replication protein A1 -related, similar to putative replication protein A1;(source:TAIR10)
AT5G32600 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G60930.1);(source:TAIR10)
AT5G32605 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G06140.1);(source:TAIR10)
AT5G32630 transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, various predicted helicase proteins, Arabidopsis thaliana and others;(source:TAIR10)
AT5G32702 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-150 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10)
AT5G32875 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-79 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT5G32925 transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.0e-105 P-value blast match to GB:AAA66266 unknown protein ORF1 transposable element En-1 (CACTA-element) (Zea mays);(source:TAIR10)
AT5G32975 transposable_element_gene;(source:Araport11);pseudogene, similar to putative transposase, similar to En/Spm-like transposon protein, putative;(source:TAIR10)
AT5G33050 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 6.2e-129 P-value blast match to gb|AAL06421.1|AF378079_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10)
AT5G33270 transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBb0043H09.1, predicted proteins - Arabidopsis thaliana;(source:TAIR10)
AT5G33285 transposable_element_gene;(source:Araport11);pseudogene, similar to Hypothetical protein with similarity to putative Ac-like transposases, similar to Ac-like transposase;(source:TAIR10)
AT5G33290 Acts as a xylogalacturonan xylosyltransferase within the XGA biosynthesis pathway. Involved in pectin biosynthesis.
AT5G33340 Encodes a protein with aspartic protease activity (also known as aspartate-type endopeptidase activity). Overexpression of the gene was shown to lead to salicylic acid (SA)-mediated disease resistance upon exposure to the pathogen Pseudomonas syringae. Moreover, overexpression of this gene led to the upregulation of two pathogenesis-related genes PR1 and PR2. This upregulation was no longer observed in transgenic lines expressing the bacterial NahG gene encoding a hydroxylase suppressing SA accumulation.
AT5G33360 transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT1G17390.1);(source:TAIR10)
AT5G33370 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. Mutants are defective in cuticle formation with reduced sepal cuticle ridge formation.
AT5G33405 pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11)
AT5G33406 hAT dimerization domain-containing protein / transposase-like protein;(source:Araport11)
AT5G33420 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT5G33441 pseudogene of cytochrome P450;(source:Araport11)
AT5G34832 pseudogene of hypothetical protein;(source:Araport11)
AT5G34835 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT5G34839 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-09 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT5G34841 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 0.00011 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT5G34846 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.2e-44 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT5G34848 pseudogene of hypothetical protein;(source:Araport11)
AT5G34850 Encodes a root-secreted purple acid phosphatase precursor involved in extracellular phosphate-scavenging.
AT5G34854 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-96 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10)
AT5G34857 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.7e-70 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT5G34860 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G06908.1);(source:TAIR10)
AT5G34866 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 5.8e-39 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT5G34871 other_RNA;(source:Araport11)
AT5G34920 transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 3.2e-40 P-value blast match to At5g59620.1/14-257 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT5G34940 The protein is predicted (WoLF PSORT program) to be membrane-associated.
AT5G34945 pseudogene of Zinc-finger domain of monoamine-oxidase A repressor R1 protein;(source:Araport11)
AT5G35050 hypothetical protein (DUF1985);(source:Araport11)
AT5G35073 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.3e-39 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10)
AT5G35080 Encodes a protein involved in the endoplasmic reticulum-associated degradation of glycoproteins.
AT5G35111 pseudogene of Peroxidase superfamily protein;(source:Araport11)
AT5G35118 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.5e-10 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10)
AT5G35160 Endomembrane protein 70 protein family;(source:Araport11)
AT5G35170 adenylate kinase family protein;(source:Araport11)
AT5G35190 proline-rich extensin-like family protein;(source:Araport11)
AT5G35200 ENTH/ANTH/VHS superfamily protein;(source:Araport11)
AT5G35220 Membrane-associated and ATP-independent metalloprotease; EGY1 protein contains eight trans-membrane domains at its C-terminus, and carries out beta-casein degradation in an ATP-independent manner. EGY1 is required for development of both thylakoid grana and a well-organized lamellae system in chloroplast. Additionally, EGY1 is required for the accumulation of chlorophyll and chlorophyll a/b binding (CAB) proteins (both PS I and PS II) in chloroplast membranes, and for grana formation and normal chloroplast development. Loss of EGY1 function also has an effect on endodermal plastid biogenesis. Mutant studies suggest that EGY1 is involved in the regulation of nuclear gene expression response to ammonium stress and interacts with ABA signaling.
AT5G35280 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G07310.1);(source:TAIR10)
AT5G35339 pseudogene of Polynucleotidyl transferase;(source:Araport11)
AT5G35341 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT5G35360 Encodes biotin carboxylase subunit (CAC2).
AT5G35370 S-locus lectin protein kinase family protein;(source:Araport11)
AT5G35375 transmembrane protein;(source:Araport11)
AT5G35407 Encodes a microRNA that targets several GRF family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCCACAGCUUUCUUGAACUU. Expression increased with leaf development, antagonizing with expression of GRFs. Transcript accumulates in the distal zone of young developing seeds, restricing the expression of GRF2 to the proximal part. miR396 attenuates cell proliferation in developing leaves through the repression of GRF activity and a decrease in the expression of cell cycle genes.
AT5G35410 encodes a member of the CBL-interacting protein kinase family, is a regulatory component controlling plant potassium nutrition
AT5G35450 Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11)
AT5G35460 membrane protein;(source:Araport11)
AT5G35510 TIR-NBS-LRR class disease resistance protein;(source:Araport11)
AT5G35520 encodes a homologue of the yeast (S. pombe) Mis12 (minichromosome instability) protein. MIS12 co-localizes with 180 bp repeats of centromeric DNA throughout the cell cycle with a similar pattern to AtCENH3/HTR12. Neither of these two proteins completely cover the 180 bp regions based on FISH analysis.
AT5G35550 TT2 encodes a R2R3 MYB domain putative transcription factor that acts as a key determinant in the proanthocyanidin accumulation of developing seed. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium.
AT5G35555 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.1e-177 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT5G35575 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 7.5e-41 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10)
AT5G35580 Protein kinase superfamily protein;(source:Araport11)
AT5G35600 Encodes a histone deacetylase that is crucial for female gametophyte development and embryogenesis.
AT5G35603 hypothetical protein (DUF3287);(source:Araport11)
AT5G35605 pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10)
AT5G35615 pseudogene of Ribonuclease H-like superfamily protein;(source:Araport11)
AT5G35630 chloroplastic glutamine synthetase The mRNA is cell-to-cell mobile.
AT5G35640 Putative endonuclease or glycosyl hydrolase;(source:Araport11)
AT5G35715 encodes a protein with cytochrome P450 domain
AT5G35720 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.9e-12 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10)
AT5G35735 Auxin-responsive family protein;(source:Araport11)
AT5G35736 transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT5G35737 Ta11-like non-LTR retrotransposon;(source:Araport11). Maternally expressed, imprinted gene.
AT5G35750 Encodes histidine kinase AHK2.
AT5G35756 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.3e-30 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10)
AT5G35760 Beta-galactosidase related protein;(source:Araport11)
AT5G35780 pseudogene of B3 domain protein (DUF313);(source:Araport11)
AT5G35805 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G01700.1);(source:TAIR10)
AT5G35830 Ankyrin repeat family protein;(source:Araport11)
AT5G35917 a pseudogene with cytochrome P450 domain
AT5G35926 Protein with RNI-like/FBD-like domain;(source:Araport11)
AT5G35932 pseudogene of hypothetical protein;(source:Araport11)
AT5G35935 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-232 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT5G35950 Mannose-binding lectin superfamily protein;(source:Araport11)
AT5G35960 Protein kinase family protein;(source:Araport11)
AT5G36090 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G28010.1);(source:TAIR10)
AT5G36160 Encodes a cytosolic L-tyrosine aminotransferase. AtTAT2 exhibits much broader amino donor specificity than AtTAT1 and can use not only Tyr but also Phe, Trp, His, Met, Leu, Ala, Ser, Cys, Asp, Asn, Gln, and Arg as amino donors.
AT5G36190 F-box protein interaction domain protein;(source:Araport11)
AT5G36210 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G36228 nucleic acid binding / zinc ion binding protein;(source:Araport11)
AT5G36230 ARM repeat superfamily protein;(source:Araport11)
AT5G36260 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT5G36270 Annotated as pseudogene of dehydroascorbate reductase. Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167
AT5G36296 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.6e-14 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10)
AT5G36297 pseudogene of aspartyl protease family protein
AT5G36880 Encodes a plastidic acetyl-coA synthetase. This enzyme plays a role in converting acetate to acetyl-coA in the plastids. It does not appear to be a major contributor to fatty acid biosynthesis based on mutant phenotypes. The enzyme seems to act as a monomer and may play an important role in preventing the toxic accumulation of fermentation products including acetaldehyde, acetate, and ethanol. It participates in the pyruvate dehydrogenase bypass pathway
AT5G36903 pseudogene of protein related to self-incompatibility
AT5G36960 hypothetical protein;(source:Araport11)
AT5G36970 NDR1/HIN1-like protein, expression induced during incompatible response to a pathogen, expression is at least partly dependent on the salicylic acid signaling pathway
AT5G36990 transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 8.5e-61 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10)
AT5G37055 Encodes SERRATED LEAVES AND EARLY FLOWERING (SEF), an Arabidopsis homolog of the yeast SWC6 protein, a conserved subunit of the SWR1/SRCAP complex. SEF loss-of-function mutants have a pleiotropic phenotype characterized by serrated leaves, frequent absence of inflorescence internodes, bushy aspect, and flowers with altered number and size of organs. sef plants flower earlier than wild-type plants both under inductive and non-inductive photoperiods. SEF, ARP6 and PIE1 might form a molecular complex in Arabidopsis related to the SWR1/SRCAP complex identified in other eukaryotes.
AT5G37140 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT5G37160 P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11)
AT5G37170 O-methyltransferase family protein;(source:Araport11)
AT5G37175 transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT2G15750.1);(source:TAIR10)
AT5G37200 RING/U-box superfamily protein;(source:Araport11)
AT5G37210 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT5G37260 Encodes a MYB family transcription factor Circadian 1 (CIR1). Involved in circadian regulation in Arabidopsis.
AT5G37310 Endomembrane protein 70 protein family;(source:Araport11)
AT5G37320 hypothetical protein (DUF674);(source:Araport11)
AT5G37370 encodes a putative splicing factor. Over-expression in yeast and Arabidopsis result in increased tolerance to high salt.
AT5G37430 hypothetical protein (DUF577);(source:Araport11)
AT5G37440 Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT5G37445 pseudogene of hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT5G37450 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G37460 hypothetical protein (DUF577);(source:Araport11)
AT5G37476 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-18 P-value blast match to GB:CAA37925 orf 3 (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT5G37478 TPX2 (targeting protein for Xklp2) protein family;(source:Araport11)
AT5G37480 maltase-glucoamylase, intestinal protein;(source:Araport11)
AT5G37490 Plant U-box type E3 ubiquitin ligase (PUB).
AT5G37500 Encodes a guard cell outward potassium channel. Belongs to the Shaker family K+ channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mutants have increased water consumption and limited stomatal closure in response to abscisic and jasmonic acids. It forms a heteromeric K(out) channels with SKOR. The gene is expressed ubiquitously in root and the vasculature and guard cells of leaves. Expression is suppressed during agrobacterium-induced tumor formation and increased in response to water deprivation and cold.
AT5G37540 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT5G37550 hypothetical protein;(source:Araport11)
AT5G37560 RING/U-box superfamily protein;(source:Araport11)
AT5G37590 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT5G37650 hypothetical protein (DUF577);(source:Araport11)
AT5G37660 Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain.
AT5G37730 hypothetical protein;(source:Araport11)
AT5G37732 pseudogene of hypothetical protein;(source:Araport11)
AT5G37770 Encodes a protein with 40% similarity to calmodulin. Binds Ca(2+) and, as a consequence, undergoes conformational changes. CML24 expression occurs in all major organs, and transcript levels are increased from 2- to 15-fold in plants subjected to touch, darkness, heat, cold, hydrogen peroxide, abscisic acid (ABA), and indole-3-acetic acid. However, CML24 protein accumulation changes were not detectable. The putative CML24 regulatory region confers reporter expression at sites of predicted mechanical stress; in regions undergoing growth; in vascular tissues and various floral organs; and in stomata, trichomes, and hydathodes. CML24-underexpressing transgenics are resistant to ABA inhibition of germination and seedling growth, are defective in long-day induction of flowering, and have enhanced tolerance to CoCl(2), molybdic acid, ZnSO(4), and MgCl(2). Also regulates nitric oxide levels.
AT5G37790 Protein kinase superfamily protein;(source:Araport11)
AT5G37795 pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10)
AT5G37800 RHD SIX-LIKE 1;(source:Araport11)
AT5G37810 NOD26-like intrinsic protein 4;(source:Araport11)
AT5G37830 Encodes a 5-oxoprolinase that acts in the glutathione degradation pathway and in 5-oxoproline metabolism.
AT5G37840 PADRE protein, up-regulated after infection by S. sclerotiorum.
AT5G37860 Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT5G37920 hypothetical protein (DUF577);(source:Araport11)
AT5G37930 Protein with RING/U-box and TRAF-like domain;(source:Araport11)
AT5G37970 SABATH family methyltransferase.
AT5G37980 Zinc-binding dehydrogenase family protein;(source:Araport11)
AT5G38000 Zinc-binding dehydrogenase family protein;(source:Araport11)
AT5G38005 other_RNA;(source:Araport11)
AT5G38020 encodes a protein whose sequence is similar to SAM:salicylic acid carboxyl methyltransferase (SAMT) (GI:6002712)(Clarkia breweri) and to SAM:benzoic acid carboxyl methyltransferase (BAMT)(GI:9789277)(Antirrhinum majus). SABATH family methyltransferase.
AT5G38030 MATE transporter involved in auxin homeostasis in roots.
AT5G38035 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.9e-71 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT5G38080 transmembrane protein;(source:Araport11)
AT5G38100 SABATH family methyltransferase.
AT5G38130 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT5G38210 Protein kinase family protein;(source:Araport11)
AT5G38240 Protein kinase family protein;(source:Araport11)
AT5G38250 Protein kinase family protein;(source:Araport11)
AT5G38270 F-box family protein;(source:Araport11)
AT5G38275 pseudogene of PR5-like receptor kinase;(source:Araport11)
AT5G38310 hypothetical protein;(source:Araport11)
AT5G38317 Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT5G38344 Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11)
AT5G38350 Disease resistance protein (NBS-LRR class) family;(source:Araport11)
AT5G38380 zinc transporter;(source:Araport11)
AT5G38386 F-box/RNI-like superfamily protein;(source:Araport11)
AT5G38393 pseudogene of F-box/RNI-like superfamily protein;(source:Araport11)
AT5G38396 F-box/RNI-like superfamily protein;(source:Araport11)
AT5G38400 hypothetical protein;(source:Araport11)
AT5G38440 Plant self-incompatibility protein S1 family;(source:Araport11)
AT5G38450 cytochrome P450, family 735, subfamily A, polypeptide 1;(source:Araport11)
AT5G38470 Encodes a member of the RADIATION SENSITIVE23 (RAD23) family: AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome.
AT5G38490 B3 domain protein (DUF313);(source:Araport11)
AT5G38500 B3 domain protein (DUF313);(source:Araport11)
AT5G38510 Rhomboid-related intramembrane serine protease family protein;(source:Araport11)
AT5G38520 CLD1 is involved in steady-state chlorophyll turnover; CLD1 dephytylates chlorophyll a, chlorophyll b, and pheophytin a in vitro; CLD1 and CHLG form a salvage cycle in recycling chlorophyll. Suppression of CLD1 expression results in reduced tolerance to moderately high temperature.
AT5G38540 Mannose-binding lectin superfamily protein;(source:Araport11)
AT5G38565 F-box/FBD-like domains containing protein;(source:Araport11)
AT5G38570 F-box/RNI-like superfamily protein;(source:Araport11)
AT5G38610 Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT5G38620 MADS-box transcription factor family protein;(source:Araport11)
AT5G38640 NagB/RpiA/CoA transferase-like superfamily protein;(source:Araport11)
AT5G38650 Proteasome maturation factor UMP1;(source:Araport11)
AT5G38710 Methylenetetrahydrofolate reductase family protein;(source:Araport11)
AT5G38730 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT5G38800 basic leucine-zipper 43;(source:Araport11)
AT5G38810 F-box and associated interaction domains-containing protein;(source:Araport11)
AT5G38850 Disease resistance protein (TIR-NBS-LRR class);(source:Araport11)
AT5G38900 Thioredoxin superfamily protein;(source:Araport11)
AT5G38960 RmlC-like cupins superfamily protein;(source:Araport11)
AT5G38970 Encodes a polypeptide involved in the C-6 oxidation of brassinosteroids. Heterologous expression of the protein in yeast conferred the ability to catalyze multiple reactions in which the C-6 position of 6-deoxocastasterone, 6-deoxotyphasterol, 3-dehydro-6-deoxoteasterone and 6-deoxoteasterone are oxidized.
AT5G38975 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.0e-15 P-value blast match to GB:CAA30503 pol polypeptide (Ty1_Copia-element) (Drosophila melanogaster);(source:TAIR10)
AT5G39000 Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth.
AT5G39040 Encodes a member of TAP subfamily of ABC transporters that is located in the vacuole. Mutants are hypersensitive to aluminum and the gene product may be important for intracellular movement of some substrate, possibly chelated Al, as part of a mechanism of aluminum sequestration.
AT5G39050 Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification.
AT5G39060 transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 7.3e-252 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10)
AT5G39095 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-250 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10)
AT5G39100 germin-like protein (GLP6)
AT5G39110 RmlC-like cupins superfamily protein;(source:Araport11)
AT5G39210 Encodes a protein of the chloroplastic NAD(P)H dehydrogenase complex (NDH Complex) involved in respiration, photosystem I (PSI) cyclic electron transport and CO2 uptake. The product of this gene appears to be essential for the stable formation of the NDH Complex. The mRNA is cell-to-cell mobile.
AT5G39230 TFIIB zinc-binding protein;(source:Araport11)
AT5G39240 Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors.
AT5G39320 UDP-glucose 6-dehydrogenase family protein;(source:Araport11)
AT5G39330 transmembrane protein, putative (DUF1163);(source:Araport11)
AT5G39380 Plant calmodulin-binding protein-like protein;(source:Araport11)
AT5G39390 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G39400 Calcium/lipid-binding (CaLB) phosphatase;(source:Araport11)
AT5G39420 CDC2C;(source:Araport11)
AT5G39460 F-box family protein;(source:Araport11)
AT5G39470 F-box family protein;(source:Araport11)
AT5G39473 pseudogene of DC1 (domain-containing protein)
AT5G39480 F-box family protein;(source:Araport11)
AT5G39500 Encodes GNOM-LIKE1/ERMO1, a member of ARF-GEF family. Required for endoplasmic reticulum (ER) morphology. The mRNA is cell-to-cell mobile.
AT5G39520 Plastid localized transmembrane protein involved in ABA mediated leaf senescence and stomatal movement.
AT5G39532 Pseudogene of AT3G59455
AT5G39540 F-box associated ubiquitination effector family protein;(source:Araport11)
AT5G39610 Encodes a NAC-domain transcription factor. Positively regulates aging-induced cell death and senescence in leaves. This gene is upregulated in response to salt stress in wildtype as well as NTHK1 transgenic lines although in the latter case the induction was drastically reduced. It was also upregulated by ABA, ACC and NAA treatment, although in the latter two cases, the induction occurred relatively late when compared with NaCl or ABA treatments. Note: this protein (AtNAC6) on occasion has also been referred to as AtNAC2, not to be confused with the AtNAC2 found at locus AT3G15510.
AT5G39620 RAB GTPase homolog G1;(source:Araport11)
AT5G39630 Vesicle transport v-SNARE family protein;(source:Araport11)
AT5G39670 Calmodulin like protein involved in negative regulation of pattern triggered immunity.
AT5G39690 NAC domain containing protein 93;(source:Araport11)
AT5G39760 Functions together with TZP in co-regulation of the expression of blue-light dependent transcriptional regulators. Coassociates with and regulates the expression of light-regulated loci as well as transcriptional regulators to shape plant development in response to environmental stimuli with targets in RNA processing factors as well as proteins involved in salt stress and ABA signaling, in addition to embryo development. Acts downstream of TZP action with regard to blue-light-regulated hypocotyl elongation.
AT5G39785 hypothetical protein (DUF1666);(source:Araport11)
AT5G39820 NAC domain containing protein 94;(source:Araport11)
AT5G39850 Ribosomal protein S4;(source:Araport11)
AT5G39860 Encodes PRE1 (PACLOBUTRAZOL RESISTANCE1). PRE1 and IBH1 form a pair of antagonistic HLH/bHLH transcription factors that function downstream of BZR1 to mediate brassinosteroid regulation of cell elongation. BNQ1 is directly and negatively regulated by AP3 and PI in petals.Required for appropriate regulation of flowering time.
AT5G39861 pseudogene of receptor kinase 3;(source:Araport11)
AT5G39863 pseudogene of receptor kinase 3;(source:Araport11)
AT5G39865 Glutaredoxin family protein;(source:Araport11)
AT5G39870 hypothetical protein (DUF1216);(source:Araport11)
AT5G39920 pre-mRNA cleavage complex II protein;(source:Araport11)
AT5G39930 Encodes a protein with similarity to the CLP1 polyadenylation factor.
AT5G39940 FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11)
AT5G39990 Encodes GlcAT14A, a beta-glucuronosyltransferase involved in the biosynthesis of type II arabinogalactan. The protein was localized to the Golgi apparatus when transiently expressed in Nicotiana benthamiana. Plays a role in cell elongation during seedling growth.
AT5G39995 pseudogene of myb domain protein 110;(source:Araport11)
AT5G40010 Encodes a mitochondrial ATPase involved in seed and silique development.
AT5G40130 pseudogene of ribosomal protein L5 B;(source:Araport11)
AT5G40160 Encodes ankyrin repeat protein EMB506. Mutations in this locus result in embryo lethality.
AT5G40170 receptor like protein 54;(source:Araport11)
AT5G40190 Identified in a screen for calmodulin-binding proteins obtained from an auxin treated cDNA library.
AT5G40230 nodulin MtN21-like transporter family protein
AT5G40250 RING/U-box superfamily protein;(source:Araport11)
AT5G40260 Encodes RPG1 (RUPTURED POLLEN GRAIN1), a member of the MtN3/saliva gene family. Crucial for exine pattern formation and cell integrity of microspores.
AT5G40275 other_RNA;(source:Araport11)
AT5G40280 encodes a beta subunit of farnesyl-trans-transferase, which is involved in meristem organization and ABA-mediated signal transduction pathway. Mutant phenotypes have been observed in meristem organization, and response to abscisic acid and drought. The mRNA is cell-to-cell mobile.
AT5G40290 HD domain-containing metal-dependent phosphohydrolase family protein;(source:Araport11)
AT5G40330 Encodes a MYB gene that, when overexpressed ectopically, can induce ectopic trichome formation. It is a member of subgroup 15, together with WER and GL1. Members of this subgroup share a conserved motif of 19 amino acids in the putative transcription activation domain at the C-terminal end. The gene is expressed in leaves, stems, flowers, seeds and roots and quite strongly in trichomes. There is partial functional redundancy between ATMYB23 and GL1. The two proteins are functionally equivalent with respect to the regulation of trichome initiation but not with respect to trichome branching - which is controlled by MYB23 and not GL1.
AT5G40360 Encodes a member of the MYB family of transcription factors and in involved in regulation of glucosinolate (GLS) biosynthesis. MYB115 binds to the promoters of a number of GLS biosynthetic enzymes and mutations show differences in accumulation of GLS compared to wild type.
AT5G40370 Glutaredoxin family protein;(source:Araport11)
AT5G40380 Encodes a cysteine-rich receptor-like protein kinase.
AT5G40382 Cytochrome c oxidase subunit Vc family protein;(source:Araport11)
AT5G40384 Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: ACAAAAUCCGUCUUUGAAGA
AT5G40390 Encodes a protein which might be involved in the formation of verbascose. A T-DNA insertion mutant was shown to have a decreased amount of verbascose (as well as mannitol) whereas the levels of raffinose and stachyose remained unchanged. Enhances drought tolerance through raffinose synthesis or galactinol hydrolysis.
AT5G40395 U6acat;(source:Araport11)
AT5G40410 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT5G40440 Encodes a mitogen-activated protein kinase kinase. Activates MPK8 and is a target of MPKKK20. Mutant root growth is sensitive oryzalin and suggestive of a role in signaling during microtubule organization.
AT5G40450 Encodes a member of a plant gene family, APK_ORTHOMCL5144,of unknown function. RBB1 is localized to the cytosol and involved in vacuolar biogenesis and organization. RBB1 mutants have increased number of vacuolar bulbs and fewer trans-vacuolar strands.
AT5G40460 cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11)
AT5G40470 RNI-like superfamily protein;(source:Araport11)
AT5G40490 HLP1 is a member of the conserved hnRNP A/B family and contains RNA Recognition Motifs (RRM).It binds mRNA and appears to be involved in targeting alternative polyadenylation (APA). APA targets include genes involved in flowering. Loss of HLP1 function results causes late flowering under long and short day conditions. This phenotype is suppressed by loss of FLC.
AT5G40510 Sucrase/ferredoxin-like family protein;(source:Araport11)
AT5G40580 Encodes 20S proteasome beta subunit PBB2 (PBB2).
AT5G40590 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT5G40620 transmembrane protein;(source:Araport11)
AT5G40630 Ubiquitin-like superfamily protein;(source:Araport11)
AT5G40640 transmembrane protein;(source:Araport11)
AT5G40680 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT5G40690 histone-lysine N-methyltransferase trithorax-like protein;(source:Araport11)
AT5G40830 Encodes an SAM‐dependent methyltransferase superfamily protein that has an N‐terminal transmembrane domain and a putative methyltransferase domain, DUF248, and is strongly expressed in the vasculature. Overexpression results in increased phloem and xylem in the plant.
AT5G40880 Involved in seed germination, seedling/seed development, interacting with PPPDE family protein Desi1.
AT5G40890 Encodes a member of the voltage-dependent chloride channel. Also functions as a NO3-/H+ exchanger that serves to accumulate nitrate nutrient in vacuoles. Mutants homozygous for the T-DNA insertion mutation have reduced nitrate uptake capacity in high nitrate environment and exhibit hypersensitivity to chlorate. Role in cytosolic pH homeostasis.
AT5G40981 This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT5G40990 Component of plant resistance. Contains lipase signature motif and GDSL domain. Directly interferes with the fungal infection process by acting on fungal cell walls through its action as a antimicrobial compound. Critical component for both local and systemic resistance responses in the incompatible interaction with Alternaria brassicicola in the ethylene-dependent pathway.
AT5G41040 Encodes a feruloyl-CoA transferase required for suberin synthesis. Has feruloyl-CoA-dependent feruloyl transferase activity towards substrates with a primary alcohol.
AT5G41060 DHHC-type zinc finger family protein;(source:Araport11)
AT5G41080 Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family.
AT5G41090 NAC domain containing protein 95;(source:Araport11)
AT5G41100 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT5G41109 hypothetical protein;(source:Araport11)
AT5G41110 meiosis chromosome segregation family protein;(source:Araport11)
AT5G41170 Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11)
AT5G41190 Encodes a cytoplasmic protein with RNA endonuclease activity. Mutants display aberrant RNA processing and male and female gametophyte development.
AT5G41250 Exostosin family protein;(source:Araport11)
AT5G41265 pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10)
AT5G41300 Receptor-like protein kinase-related family protein;(source:Araport11)
AT5G41310 P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11)
AT5G41315 Encodes a basic helix loop helix domain protein that interacts with GL1 in trichome development.GL3 interacts with JAZ and DELLA proteins to regulate trichome initiation.
AT5G41320 stress response NST1-like protein;(source:Araport11)
AT5G41330 BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11)
AT5G41360 Encodes XPB2, a DNA repair protein and transcription factor. Arabidopsis thaliana has duplicated XPB gene (AtXPB1 and AtXPB2, with high similarity to each other). XPB proteins are involved in both DNA repair and transcription, they are component of the transcription factor IIH (TFIIH) and are responsible for DNA helicase activity during nucleotide (nt) excision repair (NER). Complementation assays in yeast rad25 mutant strains suggest the involvement of AtXPB2 in DNA repair. Although both genes are expressed in a constitutive manner during the plant life cycle, Northern blot analyses suggest that light modulates the expression level of both XPB copies.XPB2 preferentially expressed in developing organs and during the cell cycle.
AT5G41370 Encodes XPB1, a DNA repair protein and transcription factor. Arabidopsis thaliana has duplicated XPB gene (AtXPB1 and AtXPB2, with high similarity to each other). XPB proteins are involved in both DNA repair and transcription, they are component of the transcription factor IIH (TFIIH) and are responsible for DNA helicase activity during nucleotide (nt) excision repair (NER). Complementation assays in yeast rad25 mutant strains suggest the involvement of AtXPB2 in DNA repair. Although both genes are expressed in a constitutive manner during the plant life cycle, Northern blot analyses suggest that light modulates the expression level of both XPB copies. The mRNA is cell-to-cell mobile.
AT5G41390 PLAC8 family protein;(source:Araport11)
AT5G41410 Homeodomain protein required for ovule identity.Loss of function mutations show homeotic conversion of integuments to carpels.Forms heterodimers with STM and KNAT1. Interacts with AG-SEP heterodimers is thought to restrict WUS expression. BEL interacts with MADS box dimers composed of SEP1(or SEP3) and AG, SHP1, SHP2 and STK. The interaction of BEL1 with AG-SEP3 is required for proper integument development and specification of integument identity.
AT5G41480 Encodes a dihydrofolate synthetase based on yeast complementation experiments. This protein is involved in folate biosynthesis.
AT5G41490 F-box associated ubiquitination effector family protein;(source:Araport11)
AT5G41500 F-box and associated interaction domains-containing protein;(source:Araport11)
AT5G41530 transmembrane protein;(source:Araport11)
AT5G41550 Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT5G41590 LURP-one-like protein (DUF567);(source:Araport11)
AT5G41600 VIRB2-interacting protein 3;(source:Araport11)
AT5G41612 Natural antisense transcript overlaps with AT5G41610;(source:Araport11)
AT5G41620 intracellular protein transporter USO1-like protein;(source:Araport11)
AT5G41640 Mutants have decreased tolerance to osmotic stress.
AT5G41663 Encodes a microRNA that targets several TCP family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGGACUGAAGGGAGCUCCCU. Pri-mRNA coordinates for MIR319b (converted to TAIR10 based on PMID19304749): Chr5: 16660967-16660095 (reverse), length: 873 bp; exon coordinates: exon 1: 16660967 to 16660095; mature miRNA and miRNA* are located on exon 1.
AT5G41690 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT5G41710 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 6.2e-18 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10)
AT5G41730 Protein kinase family protein;(source:Araport11)
AT5G41740 Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT5G41750 Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT5G41765 DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11)
AT5G41780 myosin heavy chain-like protein;(source:Araport11)
AT5G41790 encodes a protein that physically interacts specifically with the putative coiled-coil region of COP1 in vitro. In hypocotyl and cotyledon protoplasts, it is associated to the cytoskeleton, but not in the root. expression is not regulated by light. The mRNA is cell-to-cell mobile.
AT5G41800 Transmembrane amino acid transporter family protein;(source:Araport11)
AT5G41820 RAB geranylgeranyl transferase alpha subunit 2;(source:Araport11)
AT5G41840 F-box/RNI-like superfamily protein;(source:Araport11)
AT5G41905 Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC
AT5G41950 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT5G42010 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT5G42020 Luminal binding protein (BiP2) involved in polar nuclei fusion during proliferation of endosperm nuclei.
AT5G42053 This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT5G42120 Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT5G42130 Encodes a protein belonging to the mitochondrial carrier family and similar to animal mitoferrin but likely NOT to be located in the mitochondria, but rather in chloroplasts. It is likely to be involved in transporting iron into the chloroplast.
AT5G42180 Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification.
AT5G42210 Major facilitator superfamily protein;(source:Araport11)
AT5G42223 Encodes a defensin-like (DEFL) family protein.
AT5G42242 Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT5G42323 Pseudogene of AT1G06390; GSK1 (GSK3/SHAGGY-LIKE PROTEIN KINASE 1); kinase
AT5G42340 Plant U-box type E3 ubiquitin ligase (PUB).
AT5G42360 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT5G42410 SAUR-like auxin-responsive protein family;(source:Araport11)
AT5G42430 F-box and associated interaction domains-containing protein;(source:Araport11)
AT5G42490 ATP binding microtubule motor family protein;(source:Araport11)
AT5G42500 Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11)
AT5G42505 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-23 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10)
AT5G42520 Encodes a member of the BASIC PENTACYSTEINE (BPC) proteins. BPC proteins are plant-specific transcription factors present throughout land plants. BPC transcription factor family is integral for a wide range of processes that support normal growth and development.
AT5G42540 Encodes a protein with similarity to yeast 5'-3'exonucleases and can functionally complement the yeast mutations. In Arabidopsis XRN2 acts as a suppressor of posttranscriptional gene silencing.
AT5G42570 B-cell receptor-associated 31-like protein;(source:Araport11)
AT5G42600 Encodes an oxidosqualene synthase that produces the monocyclic triterpene marneral. Crucial for growth and development.
AT5G42635 glycine-rich protein;(source:Araport11)
AT5G42640 Member of a small family of zinc finger containing putative transcription factors.Similar to GAZ.
AT5G42650 Encodes a member of the cytochrome p450 CYP74 gene family that functions as an allene oxide synthase. This enzyme catalyzes dehydration of the hydroperoxide to an unstable allene oxide in the JA biosynthetic pathway. It shows a dual catalytic activity, the major one being a 13-AOS but also expressing a 9-AOS activity. CFA-Leu, CFA-Val, CFA-Met and CFA-Ala can induce the expression of AOS.
AT5G42660 DNA-directed RNA polymerase subunit beta (DUF616);(source:Araport11)
AT5G42677 Pseudogene of AT5G19630
AT5G42680 MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11)
AT5G42690 transcription factor, putative (Protein of unknown function, DUF547);(source:Araport11)
AT5G42710 hypothetical protein;(source:Araport11)
AT5G42730 pseudogene similar to ACT domain-containing protein, similar to F-box family protein
AT5G42750 Encodes a plasma-membrane associated phosphoprotein that interacts directly with the kinase domain of BRI1 through the evolutionarily conserved C-terminal BIM motif binding to the C-lobe of the BRI1 kinase domain. It interferes with the interaction between BRI1 with its signalling partner, the plasma membrane localised LRR-receptor kinase BAK1 by inhibiting the transphosphorylation to keep BRI1 at a basal level of activity. It is phosphorylated by BRI1 at Ser270 & Ser274 and at tyrosine site Tyr211 and dissociates from plasma membrane to end up in the cytosol after phosphorylation. Its loss-of-function mutant shows higher sensitivity to BR treatment.
AT5G42800 dihydroflavonol reductase. Catalyzes the conversion of dihydroquercetin to leucocyanidin in the biosynthesis of anthocyanins. Not expressed in roots (qRT-PCR). The mRNA is cell-to-cell mobile.
AT5G42850 Thioredoxin superfamily protein;(source:Araport11)
AT5G42900 Acts with COR28 as a key regulator in the COP1-HY5 regulatory hub by regulating HY5 activity to ensure proper skotomorphogenic growth in the dark and photomorphogenic development in the light.
AT5G42920 Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis.
AT5G42930 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G42940 RING/U-box superfamily protein;(source:Araport11)
AT5G42957 inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (DUF784);(source:Araport11)
AT5G42960 outer envelope pore 24B-like protein;(source:Araport11)
AT5G43010 26S proteasome AAA-ATPase subunit RPT4a (RPT4a) mRNA,
AT5G43020 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G43060 Peptidase, activity detected in extracts of root, leaf and cell culture.
AT5G43066 Homolog of prePIP1.
AT5G43090 Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts.
AT5G43110 Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts.
AT5G43120 ARM-repeat/Tetratricopeptide repeat (TPR)-like protein;(source:Araport11)
AT5G43170 Encodes zinc finger protein. mRNA levels are elevated in response to high salinity and low temperature. The protein is localized to the nucleus and acts as a transcriptional repressor.
AT5G43175 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT5G43180 transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11)
AT5G43211 hypothetical protein;(source:Araport11)
AT5G43270 Member of the SPL (squamosa-promoter binding protein-like) gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. In conjunction with SPL10 and SPL11, SPL2 redundantly controls proper development of lateral organs in association with shoot maturation in the reproductive phase. SPL2, SPL10, and SPL11, suppress root regeneration with age by inhibiting wound-induced auxin biosynthesis.
AT5G43300 Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family.
AT5G43320 Member of CKL gene family (CKL-C group)
AT5G43340 Encodes Pht1;6, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341).
AT5G43370 Encodes a phosphate transporter Pht1;2. Members of the Pht1 family of phosphate transporters include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341) The mRNA is cell-to-cell mobile.
AT5G43380 encodes a type I serine/threonine protein phosphatase expressed in expressed in roots, rosettes and flowers.
AT5G43390 plant/protein;(source:Araport11)
AT5G43400 plant/protein;(source:Araport11)
AT5G43403 other_RNA;(source:Araport11)
AT5G43420 RING/U-box superfamily protein;(source:Araport11)
AT5G43455 pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10)
AT5G43513 Encodes a cysteine-rich peptide that acts as a pollen tube attractant guiding pollen tubes to the ovular micropyle. It is expressed in the synergid cell and appears to be secreted toward the funicular surface through the micropyle.
AT5G43520 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT5G43535 pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10)
AT5G43580 Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Functions in resistance to necrotrophic fungi and insect herbivory. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860.
AT5G43590 Acyl transferase/acyl hydrolase/lysophospholipase superfamily protein;(source:Araport11)
AT5G43600 Encodes a protein with ureidoglycolate amidohydrolase activity in vitro. It is 27% identical and 43% similar to the E. coli allantoate amidohydrolase (AAH), but, in vitro assays with purified protein and allantoate as a substrate do not show any increase in ammonium concentration, indicating that there this enzyme has no AAH activity. The mRNA is cell-to-cell mobile.
AT5G43630 Encodes a zinc knuckle protein that negatively regulates morning specific growth. The role of TZP in hypocotyl elongation was established through a QTL analysis of BayXSha RIL populations. The Bay-0 allele contains a deletion causing a frameshift mutation. TZP is under circadian control and acts to regulate morning-specific hypocotyl growth. The mRNA is cell-to-cell mobile.
AT5G43640 cytosolic ribosomal protein gene, part of uS19 family.
AT5G43700 Auxin inducible protein similar to transcription factors.
AT5G43745 ion channel POLLUX-like protein, putative (DUF1012);(source:Araport11)
AT5G43755 non-LTR retrolelement reverse transcriptase-like protein;(source:Araport11)
AT5G43770 proline-rich family protein;(source:Araport11)
AT5G43780 sulfate adenylyltransferase, ATP sulfurylase
AT5G43790 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT5G43810 Encodes Argonaute10, a member of the EIF2C (elongation initiation factor 2c)/ Argonaute class of proteins. Required to establish the central-peripheral organization of the embryo apex. Along with WUS and CLV genes, controls the relative organization of central zone and peripheral zone cells in meristems. Acts in embryonic provascular tissue potentiating WUSCHEL function during meristem development in the embryo. AGO10 specifically sequesters miR166/165 to regulate shoot apical meristem development.
AT5G43820 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT5G43830 aluminum induced protein with YGL and LRDR motifs;(source:Araport11)
AT5G43840 member of Heat Stress Transcription Factor (Hsf) family
AT5G43850 RmlC-like cupins superfamily protein;(source:Araport11)
AT5G43860 Encodes a chlorophyllase, the first enzyme in chlorophyll degradation. It catalyzes the hydrolysis of the ester bond to chlorophyllide and phytol. AtCLH2 has a typical signal sequence for the chloroplast. Gene expression does not respond to methyljasmonate, a known promoter of senescence and chlorophyll degradation.
AT5G43870 FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions.
AT5G43880 methyl-coenzyme M reductase II subunit gamma, putative (DUF3741);(source:Araport11)
AT5G43890 Encodes a YUCCA-like putative flavin monooxygenase, the activation tagging mutant has increased level of IAA, increased auxin response and phenotype of auxin overproduction, rescues erecta mutant phenotype
AT5G43900 Encodes a member of the type XI myosin protein family that binds F-actin and co-localizes with actin filaments and peroxisomes. Homozygous mutants are reported to have pleiotropic effects in growth and fertility and may also be lethal. This protein is also involved in root hair growth and organelle trafficking. This protein interacts with RabC2a and RabD1 in a GTP-dependent manner.
AT5G43920 transducin family protein / WD-40 repeat family protein;(source:Araport11)
AT5G43980 Encodes a plasmodesmal protein that affects the intercellular movement of molecules through the plasmodesmata. The cytoplasmic C-terminal portion of the protein is connected to the apoplastic N-terminal portion of the protein by a single transmembrane domain (TMD). It is transported to the plasmodesmata through the secretory pathway. PDLP1 has two DUF26 domains and a signal peptide, but the proper localization of the protein appears to depend on the TMD.
AT5G44005 hypothetical protein;(source:Araport11)
AT5G44030 Encodes a cellulose synthase involved in secondary cell wall biosynthesis. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling. The mRNA is cell-to-cell mobile.
AT5G44040 eisosome SEG2-like protein;(source:Araport11)
AT5G44060 embryo sac development arrest protein;(source:Araport11)
AT5G44080 Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11)
AT5G44100 Member of CKL gene family. Expression up-regulated under high temperature in anthers. Transcription activated by MYB24.
AT5G44160 NUC is a member of the BIRD group of transcriptional regulators and is required for the formative divisions that pattern the root. the ground tissue into cortex and endodermis.
AT5G44170 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT5G44210 encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-9). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
AT5G44220 F-box family protein;(source:Araport11)
AT5G44240 Expression is upregulated in the shoot of cax1/cax3 mutant. The mRNA is cell-to-cell mobile.
AT5G44255 transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.5e-09 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10)
AT5G44300 Dormancy/auxin associated family protein;(source:Araport11)
AT5G44310 Late embryogenesis abundant protein (LEA) family protein;(source:Araport11)
AT5G44316 Stabilizer of iron transporter SufD superfamily protein;(source:Araport11)
AT5G44345 F-box associated ubiquitination effector family protein;(source:Araport11)
AT5G44360 FAD-binding Berberine family protein;(source:Araport11)
AT5G44370 Encodes an inorganic phosphate transporter (PHT4;6).
AT5G44375 pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10)
AT5G44380 FAD-binding Berberine family protein;(source:Araport11)
AT5G44390 FAD-binding Berberine family protein;(source:Araport11)
AT5G44400 FAD-binding Berberine family protein;(source:Araport11)
AT5G44410 FAD-binding Berberine family protein;(source:Araport11)
AT5G44416 transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.6e-75 P-value blast match to Q9SI25 /181-349 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT5G44418 pseudogene of cytochrome P450;(source:Araport11)
AT5G44430 Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2.
AT5G44440 FAD-binding Berberine family protein;(source:Araport11)
AT5G44460 Calcium sensor.
AT5G44480 mutant has Altered lateral root; UDP Glucose Epimerase The mRNA is cell-to-cell mobile.
AT5G44530 Subtilase family protein;(source:Araport11)
AT5G44540 Tapetum specific protein TAP35/TAP44;(source:Araport11)
AT5G44550 Uncharacterized protein family (UPF0497);(source:Araport11)
AT5G44555 Encodes a ECA1 gametogenesis related family protein [pseudogene]
AT5G44562 Natural antisense transcript overlaps with AT5G44560;(source:Araport11)
AT5G44568 Secreted peptide which functions in plant growth and pathogen defense.
AT5G44590 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT5G44610 Encodes a protein with seven repeated VEEKK motifs. RNAi and overexpression experiments suggest that the gene is not involved in cell division but might be consequential for cell shape of epidermal and cortical cells. The protein encoded by this gene binds to cortical microtubules and inhibits tubulin polymerization. Associates to the plasma membrane and interacts with calmodulin and phosphatidylinositol phosphates, indicating an involvement in cellular signal transduction. Expression is enhanced by abiotic and hormonal factors. Induced during senescence.Interacts with Ca2+/calmodulin complex, phosphatidylinositol phosphates, and free Ca2+.
AT5G44670 glycosyltransferase family protein (DUF23);(source:Araport11)
AT5G44680 DNA glycosylase superfamily protein;(source:Araport11)
AT5G44690 RING finger PFF0165c-like protein;(source:Araport11)
AT5G44700 Encodes GASSHO2 (GSO2), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO2 and a homolog GSO1 (At4g20140) are required for the formation of a normal epidermal surface during embryogenesis.
AT5G44705 pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10)
AT5G44730 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT5G44750 Homologous to Y-family DNA polymerases, contains BRCT domain. Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS).
AT5G44760 C2 domain-containing protein;(source:Araport11)
AT5G44780 Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing.
AT5G44785 Organellar Single-stranded DNA Binding protein. Decreases MMEJ on long ssDNA templates.
AT5G44790 ATP dependent copper transporter vital for ethylene response pathway
AT5G44820 Nucleotide-diphospho-sugar transferase family protein;(source:Araport11)
AT5G44910 Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11)
AT5G44920 Encodes a KASH domain protein that localizes to the nuclear envelope and affects nuclear morphology.
AT5G44930 Encodes a putative arabinosyltransferase that is associated with arabinan biosynthesis and is not redundant with ARAD1. The two glycosyltransferases may function in complexes held together by disulfide bridges.
AT5G44940 F-box/RNI-like superfamily protein;(source:Araport11)
AT5G44950 F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT5G44960 F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT5G44990 Glutathione S-transferase family protein;(source:Araport11)
AT5G45020 Glutathione S-transferase family protein;(source:Araport11)
AT5G45085 transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.2e-148 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10)
AT5G45090 phloem protein 2-A7;(source:Araport11)
AT5G45100 Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea.
AT5G45110 Encodes NPR3, a paralog of NPR1. Involved in negative regulation of defense responses against bacterial and oomycete pathogens. npr3 mutants has elevated level of PR1 expression. Interacts with TGA2, TGA3, TGA5 and TGA6 in yeast two hybrid assays. NPR3 and NPR4 are receptors for the immune signal salicylic acid. The mRNA is cell-to-cell mobile.
AT5G45116 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.2e-227 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT5G45120 Eukaryotic aspartyl protease family protein;(source:Araport11)
AT5G45130 small GTP binding protein The mRNA is cell-to-cell mobile.
AT5G45150 RNAse THREE-like protein 3;(source:Araport11)
AT5G45160 Root hair defective 3 GTP-binding protein (RHD3);(source:Araport11)
AT5G45170 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT5G45180 Flavin-binding monooxygenase family protein;(source:Araport11)
AT5G45190 Encodes a cyclin T partner CYCT1;5. Plays important roles in infection with Cauliflower mosaic virus (CaMV).
AT5G45200 Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT5G45210 Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT5G45240 Disease resistance protein (TIR-NBS-LRR class);(source:Araport11)
AT5G45250 RPS4 belongs to the Toll/interleukin-1 receptor (TIR)-nucleotide binding site (NBS)-Leu-rich repeat (LRR) class of disease resistance (R ) genes. Confers specific resistance to Pseudomonas syringae pv. tomato carrying the avirulence gene AvrRPS4. Produces alternative transcripts with truncated open reading frames.
AT5G45260 Confers resistance to Ralstonia solanacearum. Similar to NBLS-TIR resistance genes,and also contains similarity to transcription factors. Interacts with pathogen effector protein AvrPop2.
AT5G45275 Major facilitator superfamily protein;(source:Araport11)
AT5G45276 pseudogene of Frigida-like protein;(source:Araport11)
AT5G45280 Pectin acetylesterase involved in pectin remodelling.
AT5G45300 Encodes a beta-amylase-like protein present in the nucleus rather than targeted to the chloroplast. Contains BRASSINAZOLE RESISTANT1 (BZR1)-type DNA binding domains. Activates gene expression in protoplast transactivation assays.
AT5G45320 late embryogenesis abundant protein;(source:Araport11)
AT5G45330 decapping 5-like protein;(source:Araport11)
AT5G45340 Encodes a protein with ABA 8'-hydroxylase activity; involved in ABA catabolism. Mutant analyses show that disruption in the gene results in more drought tolerance whereas overexpression results in increased transpiration rate and reduced drought tolerance. Gene involved in postgermination growth. Plant P450 CYP707A3, ABA 8'-hydroxylase, binds enantioselectively (+)-ABA but not (-)-ABA, whereas the enzyme binds both enantiomers of AHI1 (a structural ABA analogue used as ABA 8'-hydroxylase competitive inhibitor).
AT5G45390 One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). The mRNA is cell-to-cell mobile.
AT5G45410 Plastid localized protein of unknown function. Mutants are more susceptible to P. syringae and produce less callose upon infection.
AT5G45430 Protein kinase superfamily protein;(source:Araport11)
AT5G45440 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT5G45469 transmembrane protein;(source:Araport11)
AT5G45470 transmembrane protein, putative (DUF594);(source:Araport11)
AT5G45475 other_RNA;(source:Araport11)
AT5G45510 Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT5G45520 Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT5G45530 transmembrane protein, putative (DUF594);(source:Araport11)
AT5G45540 transmembrane protein, putative (DUF594);(source:Araport11)
AT5G45630 senescence regulator (Protein of unknown function, DUF584);(source:Araport11)
AT5G45650 subtilase family protein;(source:Araport11)
AT5G45680 Peptidyl-Prolyl Isomerase located in chloroplast thylakoid lumen The mRNA is cell-to-cell mobile.
AT5G45690 histone acetyltransferase (DUF1264);(source:Araport11)
AT5G45710 member of Heat Stress Transcription Factor (Hsf) family
AT5G45720 AAA-type ATPase family protein;(source:Araport11)
AT5G45740 Ubiquitin domain-containing protein;(source:Araport11)
AT5G45745 pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10)
AT5G45750 RAB GTPase homolog A1C;(source:Araport11)
AT5G45770 receptor like protein 55;(source:Araport11)
AT5G45780 Encodes one of a group of LRR-RLKs, designated as CLAVATA3 INSENSITIVE RECEPTOR KINASES (CIKs), that act as co-receptors and have essential roles in regulating CLV3-mediated stem cell homeostasis.
AT5G45790 Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11)
AT5G45800 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G45810 Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.5), which has also been reported as a member of the CBL-interacting protein kinases (CIPK19).
AT5G45820 Encodes a CBL-interacting serine/threonine protein kinase comprised of an N-terminal kinase catalytic domain similar to SNF1/AMPK and a unique C-terminal regulatory domain.
AT5G45840 Encodes a leucine-rich-repeat RLK that is localized to the plasma membrane of pollen tubes and functions with MIK1/2 as the male receptor of the pollen tube chemo-attractant LURE1.MDIS1 forms a complex with MIK1/2 and binds LURE1.
AT5G45850 hypothetical protein (DUF688);(source:Araport11)
AT5G45875 Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein).
AT5G45940 Encodes a CoA pyrophosphatase, also has ppGpp pyrophosphohydrolase and exhibits minor activity of NADH pyrophosphatase. Most strongly expressed in embryo cotyledon and hypocotyl, flower, and phloem of vascular tissue. Over-expression mutant had a bigger plant with wider rosette.
AT5G45970 Encodes a Rac-like protein ARAC2. A member of ROP GTPase gene family.
AT5G45990 crooked neck protein, putative / cell cycle protein;(source:Araport11)
AT5G46000 Mannose-binding lectin superfamily protein;(source:Araport11)
AT5G46010 Homeodomain-like superfamily protein;(source:Araport11)
AT5G46040 Major facilitator superfamily protein;(source:Araport11)
AT5G46080 Protein kinase superfamily protein;(source:Araport11)
AT5G46105 pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT5G46115 hypothetical protein;(source:Araport11)
AT5G46160 Ribosomal protein L14p/L23e family protein;(source:Araport11)
AT5G46180 Encodes an ornithine delta-aminotransferase that is transcriptionally up-regulated in young seedlings and in response to salt stress. It is unlikely to play a role in salt-stress-induced proline accumulation, however, it appears to participate in arginine and ornithine catabolism.
AT5G46200 carboxyl-terminal proteinase-like protein (DUF239);(source:Araport11)
AT5G46220 Encodes a protein with alkaline ceramidase activity that is involved in regulation of turgor during pollen tube growth and silique stomatal movement. Tod1 is expressed specifically in pollen and silique guard cells. Loss of function mutations have reduced fertility due to defects in pollen transmission.
AT5G46250 RNA-binding protein;(source:Araport11)
AT5G46295 transmembrane protein;(source:Araport11)
AT5G46315 U6-29;(source:Araport11)
AT5G46330 Encodes a leucine-rich repeat serine/threonine protein kinase that is expressed ubiquitously. FLS2 is involved in MAP kinase signalling relay involved in innate immunity. Essential in the perception of flagellin, a potent elicitor of the defense response. FLS2 is directed for degradation by the bacterial ubiquitin ligase AvrPtoB. The mRNA is cell-to-cell mobile.
AT5G46340 Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Has high similarity to RWA2 whose mutant displays reduced acetylation. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis.
AT5G46350 member of WRKY Transcription Factor; Group II-c
AT5G46390 C-terminal peptidase
AT5G46420 16S rRNA processing protein RimM family;(source:Araport11)
AT5G46460 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT5G46490 Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT5G46500 protein VARIATION IN COMPOUND TRIGGERED ROOT growth protein;(source:Araport11)
AT5G46510 Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT5G46520 VICTR (VARIATION IN COMPOUND TRIGGERED ROOT growth response) encodes a TIR-NB-LRR (for Toll-Interleukin1 Receptor-nucleotide binding-Leucine-rich repeat) protein. VICTR is necessary for DFPM-induced root growth arrest and inhibition of abscisic acid-induced stomatal closing (DFPM is [5-(3,4-dichlorophenyl)furan-2-yl]-piperidine-1-ylmethanethione)(PMID:21620700). DFPM-mediated root growth arrest is accession-specific and depends on EDS1 and PAD4; Col-0 has a functional copy of VICTR. Induction of the VICTR gene by DFPM treatment requires functional VICTR (Col). A close homolog to VICTR, named VICTL (At5g46510) lies in tandem with VICTR. The mRNA is cell-to-cell mobile.
AT5G46530 AWPM-19-like family protein;(source:Araport11)
AT5G46540 P-glycoprotein 7;(source:Araport11)
AT5G46560 Man1-Src1p-carboxy-terminal domain protein;(source:Araport11)
AT5G46570 Encodes BR-signaling kinase 2 (BSK2), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized.
AT5G46590 Transcription factor required for the initiation of cell division during wound healing. Redundantly involved with ANAC071 in the process of "cambialization".
AT5G46600 aluminum activated malate transporter family protein;(source:Araport11)
AT5G46640 AT hook motif DNA-binding family protein;(source:Araport11)
AT5G46660 protein kinase C-like zinc finger protein;(source:Araport11)
AT5G46690 beta HLH protein 71;(source:Araport11)
AT5G46710 PLATZ transcription factor family protein;(source:Araport11)
AT5G46820 carboxyl-terminal proteinase-like protein, putative (DUF239);(source:Araport11)
AT5G46830 Calcium-binding transcription factor involved in salt stress signaling.
AT5G46845 Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA
AT5G46874 Encodes a defensin-like (DEFL) family protein.
AT5G46880 homeobox-7;(source:Araport11)
AT5G46900 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT5G46910 H3K27me3 demethylase involved in temperature and photoperiod dependent repressing of flowering.
AT5G46915 transcriptional factor B3 family protein;(source:Araport11)
AT5G46950 One of of a pair of paralogous invertase with very high similarity.Expressed in female gametophyte and endosperm, particularly mycropylar endosperm. May function during embryogenesis to provide sugars to the developing embryo.
AT5G47040 Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins.
AT5G47050 SBP (S-ribonuclease binding protein) family protein;(source:Araport11)
AT5G47060 hypothetical protein (DUF581);(source:Araport11)
AT5G47070 Encodes a member of the RLCK VII-4 subfamily of receptor-like cytoplasmic kinases that has been shown to phosphorylate MAPKKK5 Ser-599 and MEKK1 Ser-603, both players in PRR-mediated resistance to bacterial and fungal pathogens.
AT5G47077 Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT5G47100 member of AtCBLs (Calcineurin B-like Calcium Sensor Proteins. CBL9 interacts with and targets CIPK23 to the plasma membrane in vivo.
AT5G47120 Encodes BI-1, a homolog of mammalian Bax inhibitor 1. Functions as an attenuator of biotic and abiotic types of cell death. Bax-induced cell death can be downregulated by ectopically expressing AtBI in planta. The mRNA is cell-to-cell mobile.
AT5G47140 Encodes a member of the GATA factor family of zinc finger transcription factors.
AT5G47150 YDG/SRA domain-containing protein;(source:Araport11)
AT5G47160 YDG/SRA domain-containing protein;(source:Araport11)
AT5G47175 Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT5G47220 Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-2). The protein contains one AP2 domain. Functions as activator of GCC box?dependent transcription. Positive regulator of JA-responsive defense genes and resistance to F. oxysporum and enhances JA inhibition of root elongation.
AT5G47225 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10)
AT5G47360 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT5G47370 homeobox-leucine zipper genes induced by auxin, but not by other phytohormones. Plays opposite roles in the shoot and root tissues in regulating auxin-mediated morphogenesis.
AT5G47380 electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11)
AT5G47440 FORKED-LIKE family member, part of Group 3 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions.
AT5G47460 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT5G47500 predicted to encode a pectin methylesterase
AT5G47510 Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT5G47530 Auxin-responsive family protein;(source:Araport11)
AT5G47590 Heat shock protein HSP20/alpha crystallin family;(source:Araport11)
AT5G47610 RING/U-box superfamily protein;(source:Araport11)
AT5G47620 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT5G47635 Pollen Ole e 1 allergen and extensin family protein;(source:Araport11)
AT5G47818 pseudogene of WPP domain interacting protein 1;(source:Araport11)
AT5G47820 Encodes a kinesin-like protein with an N-terminal microtubule binding motor domain. Protein is localized to the periphery of the cytoplasm and mutants in the gene exhibit altered orientation of cellulose microfibrils and reduced mechanical strength of fibers.
AT5G47840 adenosine monophosphate kinase;(source:Araport11)
AT5G47850 CRINKLY4 related 4;(source:Araport11)
AT5G47910 NADPH/respiratory burst oxidase protein D (RbohD).Interacts with AtrbohF gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. The mRNA is cell-to-cell mobile.
AT5G47950 BIA2 is a putative HXXXD-type BAHD acyltransferase. Overexpression results in a BR deficient phenotype and is dependent on a functional HXXXD motif. BIA2 may function in BR homeostasis by regulating the pool of bioactive BR.
AT5G48000 Encodes a member of the CYP708A family of cytochrome P450 enzymes. THAH appears to add a hydroxyl group to the triterpene thalianol. thah1 mutants have an elevated accumulation of thalianol. thah1-1 mutants have longer roots than wild type plants. Thalian-diol and desaturated thalian-diol are lost from the root extracts of thah1-1 mutants. Overexpression of the sequence from At5g48000.1 rescues the thah1-1 mutant phenotype (Field 2008); it is unknown whether the shorter sequences associated with other gene models would provide functional complementation.
AT5G48020 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT5G48060 C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11)
AT5G48070 putative xyloglucan endotransglycosylase/hydrolase, expressed primarily in the stele of mature non-elongating regions of both the main and the lateral root. Is expressed in lateral root primordia but expression ceases after lateral root begins to grow. Involved in cell proliferation in incised inflorescence stems.
AT5G48090 EDM2-like protein1;(source:Araport11)
AT5G48100 Encodes a protein that is similar to laccase-like polyphenol oxidases. Involved in lignin and flavonoids biosynthesis. It has four conserved copper binding domains. Expressed in developing testa, where it colocalizes with the flavonoid end products proanthocyanidins and flavonols. Mutant plants exhibited a delay in developmentally determined browning of the testa, characterized by the pale brown color of seed coat. The tt10 mutant seeds accumulate more epicatechin monomers and more soluble proanthocyanidins than wild-type seeds. Flavonol composition was also affected in tt10 seeds, which exhibited a higher ratio of quercetin rhamnoside monomers versus dimers than wild-type seeds.
AT5G48130 Phototropic-responsive NPH3 family protein;(source:Araport11)
AT5G48160 Encodes a nuclear PHD finger protein that is functionally redundant with OBE1 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems.
AT5G48230 Encodes an acetoacetyl-CoA thiolase that generates the bulk of the acetoacetyl-CoA precursor needed for the cytosolic localized, mevalonate-derived isoprenoids biosynthetic pathway. Loss-of-function mutants are embryo lethal.
AT5G48250 B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11)
AT5G48375 Is a myrosinase pseudogene that codes for a truncated and frameshifted protein. Although TGG3 apparently is a pseudogene, its mRNA is expressed specifically in stamen and petal according to RT-PCR analysis. Western analysis shows no band of the size expected for a TGG3 protein.
AT5G48385 FRIGIDA-like protein;(source:Araport11)
AT5G48400 member of Putative ligand-gated ion channel subunit family
AT5G48410 member of Putative ligand-gated ion channel subunit family
AT5G48450 Encodes a protein with two DUF26 domains and a signal peptide for secretion. The protein is transported to the apoplast when it is expressed as a GFP fusion protein.
AT5G48490 Encodes a protein with similarity to a lipid transfer protein that may contribute to systemic acquired resistance (SAR).
AT5G48500 pathogenic type III effector avirulence factor Avr AvrRpt-cleavage: cleavage site protein;(source:Araport11)
AT5G48510 BTB/POZ domain-containing protein;(source:Araport11)
AT5G48545 Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro.
AT5G48550 F-box associated ubiquitination effector family protein;(source:Araport11)
AT5G48570 Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones.
AT5G48605 Encodes a defensin-like (DEFL) family protein.
AT5G48610 myb-like protein X;(source:Araport11)
AT5G48630 Cyclin family protein;(source:Araport11)
AT5G48650 Negative regulator of defense response to Pseudomonas syringae pv. tomato through altered stomatal and apoplastic immunity.
AT5G48680 Sterile alpha motif (SAM) domain-containing protein;(source:Araport11)
AT5G48690 ubiquitin-associated (UBA)/TS-N domain protein;(source:Araport11)
AT5G48710 Ubiquitin-like superfamily protein;(source:Araport11)
AT5G48730 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT5G48740 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G48800 Phototropic-responsive NPH3 family protein;(source:Araport11)
AT5G48820 Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type and CDC2A cyclins and may inhibit cell cycle. Seven KRP genes were found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization.
AT5G48830 phosphoglycolate phosphatase;(source:Araport11)
AT5G48880 Encodes a peroxisomal 3-keto-acyl-CoA thiolase 2 precursor. EC2.3.1.16 thiolases. AT5G48880.1 is named PKT1 and AT5G48880.2 is named PKT2.
AT5G48890 Encodes a C(2) H(2) -type zinc-finger transcriptional regulator and is expressed in the leaf vasculature and the vegetative shoot apical meristem and controls the transition to flowering.
AT5G48900 Pectin lyase-like superfamily protein;(source:Araport11)
AT5G48940 RGFR2 is a leucine--rich repeat receptor kinase that, together with RGFR1 and RGFR3, binds ROOT GROWTH FACTORS and is required for establishing the gradient of PLETHORA1 and PLETHORA2 essential for proper root growth and development.
AT5G49040 Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11)
AT5G49070 Encodes KCS21, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids).
AT5G49110 fanconi anemia group I-like protein;(source:Araport11)
AT5G49120 DUF581 family protein, putative (DUF581);(source:Araport11)
AT5G49138 Natural antisense transcript overlaps with AT5G49130;(source:Araport11)
AT5G49170 hypothetical protein;(source:Araport11)
AT5G49240 member of Response Regulator: Pseudo
AT5G49270 Involved in successfully establishing tip growth in root hairs.
AT5G49280 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT5G49290 receptor like protein 56;(source:Araport11)
AT5G49300 Encodes a member of the GATA factor family of zinc finger transcription factors.
AT5G49301 Pseudogene of AT5G49310; importin alpha-1 subunit, putative
AT5G49310 Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype.
AT5G49320 transmembrane protein, putative (DUF1218);(source:Araport11)
AT5G49330 Member of the R2R3 factor gene family. Together with MYB11 and MYB111 redundantly regulates flavonol biosynthesis.
AT5G49340 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT5G49350 Glycine-rich protein family;(source:Araport11)
AT5G49420 MADS-box transcription factor family protein;(source:Araport11)
AT5G49460 One of the two genes encoding subunit B of the cytosolic enzyme ATP Citrate Lyase (ACL)
AT5G49470 Encodes a protein with similarity to RAF MAP Kinase that is expressed in most plant tissues. Based on loss of function and gain of function phenotypes, RAF10 appears to be involved in ABA response.
AT5G49490 AGAMOUS-like 83;(source:Araport11)
AT5G49510 prefoldin 3;(source:Araport11)
AT5G49520 Encodes WRKY48, a member of the WRKY Transcription Factor. WRKY48 is a stress- and pathogen-induced transcriptional activator that represses plant basal defense. The mRNA is cell-to-cell mobile.
AT5G49525 transmembrane protein;(source:Araport11)
AT5G49540 Rab5-interacting family protein;(source:Araport11)
AT5G49570 Encodes a protein that has peptide:N-glycanase activity in enzymatic assay in heterologous systems (although the activity was not detected in wild-type plants).
AT5G49610 F-box family protein;(source:Araport11)
AT5G49620 Member of the R2R3 factor gene family.
AT5G49640 hypothetical protein;(source:Araport11)
AT5G49650 Encodes a cytosolic protein capable of phosphorylating xylulose and deoxy-xylulose. It most likely plays a role in producing precursors for isoprenoid biosynthesis.
AT5G49660 The gene encodes receptorlike kinase (RLK). Involved in the maintenance organization of cell files or cell morphology in conductive elements. Functions as a receptor for CEP1 peptide. Mediates nitrate uptake signaling.
AT5G49665 Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11)
AT5G49680 Conserved among eukaryotes, similar to Arabidopsis SABRE. The phenotype of the kip/sab double mutant suggests related functions for both genes, however, the KIP protein is mostly required for tip-growth. Predicted to be targeted to the secretory pathway. mRNA was detected in all organs, with most abundance in pollen and roots.
AT5G49690 UDP-glycosyltransferase that can act upon sulcotrione herbicide. Overexpression confers resistance to herbicide.
AT5G49740 Encodes a chloroplast ferric chelate reductase. Shows differential splicing and has three different mRNA products. Expressed in the shoot, flower and cotyledon.
AT5G49760 Leucine rich receptor kinase. Encodes a receptor of extracellular reactive oxygen species.
AT5G49770 Leucine rich receptor kinase.
AT5G49780 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G49790 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G36010.1);(source:TAIR10)
AT5G49820 root UVB sensitive protein (Protein of unknown function, DUF647);(source:Araport11)
AT5G49880 Encodes a spindle assembly checkpoint protein MAD1. The mRNA is cell-to-cell mobile.
AT5G49890 member of Anion channel protein family
AT5G49900 Beta-glucosidase, GBA2 type family protein;(source:Araport11)
AT5G49950 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G49960 ion channel protein;(source:Araport11)
AT5G49990 Xanthine/uracil permease family protein;(source:Araport11)
AT5G50000 Belongs to the Raf-like kinase subfamily of the mitogen-activated protein kinase kinase kinase (MAPKKK) family. Negatively regulates stomatal opening by negatively regulating plasma membrane H+-ATPase phosphorylation.
AT5G50020 DHHC-type zinc finger family protein;(source:Araport11)
AT5G50080 encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain and is phosphorylated in planta. There are 7 members in this subfamily.
AT5G50120 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT5G50150 LOTR1 protein has an unknown function. It contains both DUF4409 and DUF239 domains. Loss of function mutations show defects in formation of the Casparian band- which is correlated with mis localization of CASP1.
AT5G50160 Encodes a ferric chelate reductase that is expressed in shoots and flowers.
AT5G50170 C2 calcium/lipid-binding and GRAM domain containing protein;(source:Araport11)
AT5G50175 transmembrane protein;(source:Araport11)
AT5G50190 other_RNA;(source:Araport11)
AT5G50200 Wound-responsive gene 3 (WR3). Encodes a high-affinity nitrate transporter. Up-regulated by nitrate. Involved in jasmonic acid-independent wound signal transduction.
AT5G50240 L-isoaspartyl methyltransferase 2 (PIMT2)gene, alternatively spliced.
AT5G50250 Encodes a RNA binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). Supports editing of specific CP31A-dependent sites.
AT5G50290 wall-associated receptor kinase galacturonan-binding protein;(source:Araport11)
AT5G50300 Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2).
AT5G50340 DNA repair protein RadA-like protein;(source:Araport11)
AT5G50345 Encodes a Maternally expressed gene (MEG) family protein
AT5G50360 ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling.
AT5G50375 Converts pentacyclic cyclopropyl sterols to conventional tetracyclic sterols. CPI1 function during and just after division and support gravitropism by establishing polar PIN2 localization. Required for endocytosis of PIN2
AT5G50380 A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT5G50440 Member of Membrin Gene Family. Encodes a Golgi-localized SNARE protein MEMB12. MEMB12 is a target of miR393b-mediated gene silencing during Pseudomonas syringae pv. Tomato infection. Loss of function of MEMB12 leads to increased exocytosis of an antimicrobial pathogenesis-related protein, PR1.
AT5G50450 HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11)
AT5G50470 nuclear factor Y, subunit C7;(source:Araport11)
AT5G50740 Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT5G50750 RGP4 is a reversibly glycosylated polypeptide. Analyses using tagged RGP4 suggest that it is present in the cytosol and in association with the Golgi apparatus. Recombinant RGP4 does not have UDP-arabinose mutase activity based on an in vitro assay even though the related RGP1, RGP2, and RGP3 proteins do have activity in the same assay. RGP4 can form complexes with RGP1 and RGP2. RGP4 is expressed during seed development.
AT5G50760 SAUR-like auxin-responsive protein family;(source:Araport11)
AT5G50780 MORC4 is a member of a family of GHKL ATPases. It is localized in the nuceloplasm and adjacent to chromocenters. Along with MORC7, it appears to repress the expression
AT5G50790 Encodes a member of the SWEET sucrose efflux transporter family proteins. Transcriptionally activated by long photoperiods; activation depends on FT and SOC1. The ectopic expression of SWEET10 causes early flowering and leads to higher levels of transcription of flowering-time related genes in the shoot apex.
AT5G50810 Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus.
AT5G50820 NAC domain containing protein 97;(source:Araport11)
AT5G50840 alpha-taxilin-like protein;(source:Araport11)
AT5G50900 ARM repeat superfamily protein;(source:Araport11)
AT5G50915 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT5G50960 Highly similar to Saccharomyces cerevisiae NBP35, locus YGL091C. Cytosolic protein that homodimerizes and can assemble both 4Fe-4S - type and 2Fe-2S - type clusters on its amino terminal and carboxy therminal respectively. Null mutants are embryo lethal.
AT5G51020 Encodes CRL (CRUMPLED LEAF), a protein localized in the outer envelope membrane of plastids. Mutation in this gene affects the pattern of cell division, cell differentiation and plastid division.
AT5G51070 ATP-dependent Clp protease regulatory subunit The mRNA is cell-to-cell mobile.
AT5G51105 ECA1 gametogenesis family protein (DUF1278);(source:Araport11)
AT5G51110 Encodes a protein involved in Rubisco assembly that also mediates Abscisic acid-dependent stress response. It is a ubiquitination target of the intracellular E3 ligase SDIR1. It selectively regulates the expression of the downstream basic region/leucine zipper motif transcription factor gene ABA-INSENSITIVE5, rather than ABA-RESPONSIVE ELEMENTS BINDING FACTOR3 (ABF3) or ABF4, to regulate ABA-mediated seed germination and the plant salt response.
AT5G51180 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G51190 encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture and the response to cold stress.
AT5G51230 Polycomb group protein with zinc finger domain involved in negative regulation of reproductive development. Forms a complex with FIE, CLF, and MSI1. This complex modulates the expression of target genes including AG, PI and AP3.
AT5G51250 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT5G51260 HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11)
AT5G51280 DEAD-box protein abstrakt;(source:Araport11)
AT5G51320 transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42556.1);(source:TAIR10)
AT5G51330 Encodes novel protein involved in sister chromatid cohesion and meiotic chromosome organization during both male and female meiosis. Gene has two alternate transcripts which produce two similar proteins, one 57 aa shorter than the other.
AT5G51360 Transcription elongation factor (TFIIS) family protein;(source:Araport11)
AT5G51420 long-chain-alcohol O-fatty-acyltransferase family protein / wax synthase family protein;(source:Araport11)
AT5G51440 HSP20-like chaperones superfamily protein;(source:Araport11)
AT5G51460 homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases
AT5G51510 jagunal-like protein;(source:Araport11)
AT5G51530 Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11)
AT5G51550 EXORDIUM like 3;(source:Araport11)
AT5G51560 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G51600 Mutant has defective roots. Essential for giant cell ontogenesis. Role in organizing the mitotic microtubule array during both early and late mitosis in all plant organs.
AT5G51630 Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT5G51660 cleavage and polyadenylation specificity factor 160;(source:Araport11)
AT5G51670 hypothetical protein (DUF668);(source:Araport11)
AT5G51680 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT5G51700 Encodes a resistance signalling protein with two zinc binding (CHORD) domains that are highly conserved across eukaryotic phyla. Mutant has reduced RPS5 and RPM1 mediated resistance. Potentially involved in transduction of R gene mediated disease resistance. Required for R protein accumulation.
AT5G51710 member of Putative potassium proton antiporter family
AT5G51750 subtilase 1.3;(source:Araport11)
AT5G51770 Protein kinase superfamily protein;(source:Araport11)
AT5G51780 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT5G51800 Protein kinase superfamily protein;(source:Araport11)
AT5G51810 Encodes gibberellin 20-oxidase. Involved in gibberellin biosynthesis. Up-regulated by far red light in elongating petioles. Not regulated by a circadian clock. Mutation of GA20ox2 delays flowering.
AT5G51820 Encodes a plastid isoform of the enzyme phosphoglucomutase involved in controlling photosynthetic carbon flow. Effective petiole movement against the direction of the gravity requires functional PGM activity that is required for full development of amyloplasts.
AT5G51830 Encodes one of the several Arabidopsis fructokinases. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). Important for seed oil accumulation and vascular development.
AT5G51840 junctophilin-like protein;(source:Araport11)
AT5G51845 Encodes a defensin-like (DEFL) family protein.
AT5G51890 encodes peroxidase involved in the lignification of tracheary elements (TE) in roots
AT5G51920 Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11)
AT5G51980 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT5G52000 Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. Target promoter of the male germline-specific transcription factor DUO1.
AT5G52040 Encodes an arginine/serine-rich splicing factor. Transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. RS41 binds to HYL1 and co-localizes to the nuclear dicing body. Along with RS41, it appears to be involved in pri-miRNA processing and miRNA biogenesis.
AT5G52050 MATE efflux family protein;(source:Araport11)
AT5G52055 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-30 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT5G52060 A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development.
AT5G52130 hypothetical protein;(source:Araport11)
AT5G52145 Encodes a defensin-like (DEFL) family protein.
AT5G52170 Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family.
AT5G52250 Encodes a transducin protein whose gene expression is induced by UV-B. This induction is reduced in hy5 mutant and may be a target of HY5 during UV-B response. Functions as a repressor of UV-B signaling.
AT5G52260 Member of the R2R3 factor gene family.
AT5G52270 SNARE-like superfamily protein;(source:Araport11)
AT5G52300 Encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and desiccation. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. Upregulation by P. polymyxa CR1 increases drought resistance.
AT5G52310 cold regulated gene, the 5' region of cor78 has cis-acting regulatory elements that can impart cold-regulated gene expression The mRNA is cell-to-cell mobile.
AT5G52320 cytochrome P450, family 96, subfamily A, polypeptide 4;(source:Araport11)
AT5G52340 A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT5G52355 pre-tRNA tRNA-Ser (anticodon: TGA);(source:Araport11, TAIR10)
AT5G52400 member of CYP715A
AT5G52420 transmembrane protein;(source:Araport11)
AT5G52440 HCF106; nuclear gene for chloroplast. Thylakoid membrane delta pH translocation pathway component protein; related to Escherichia coli TatA and TatB The mRNA is cell-to-cell mobile.
AT5G52450 MATE efflux family protein;(source:Araport11)
AT5G52480 RNI-like superfamily protein;(source:Araport11)
AT5G52490 Fibrillarin family protein;(source:Araport11)
AT5G52520 Encodes a chloroplast and mitochondria localized prolyl-tRNA synthetase.
AT5G52530 dentin sialophosphoprotein-like protein;(source:Araport11)
AT5G52545 RNA-binding protein-like RNA recognition motif protein;(source:Araport11)
AT5G52610 F-box and associated interaction domains-containing protein;(source:Araport11)
AT5G52640 Encodes a cytosolic heat shock protein AtHSP90.1. AtHSP90.1 interacts with disease resistance signaling components SGT1b and RAR1 and is required for RPS2-mediated resistance. The mRNA is cell-to-cell mobile.
AT5G52650 RNA binding Plectin/S10 domain-containing protein;(source:Araport11)
AT5G52680 Copper transport protein family;(source:Araport11)
AT5G52690 Copper transport protein family;(source:Araport11)
AT5G52700 Member of plant specific copper transport protein family. Expressed in response to Al treatment.
AT5G52780 Chloroplast NAD(P)H dehydrogenase complex assembly factor.
AT5G52790 CBS domain protein with a domain protein (DUF21);(source:Araport11)
AT5G52820 Encodes a NOTCHLESS homolog, a non-ribosomal protein involved in the maturation and assembly of the 60S ribosomal subunit, that is required for female gametogenesis. The mRNA is cell-to-cell mobile.
AT5G52850 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT5G52860 ABC-2 type transporter family protein;(source:Araport11)
AT5G52882 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT5G52890 AT hook motif-containing protein;(source:Araport11)
AT5G52900 Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6).
AT5G52920 encodes a dominant chloroplast pyruvate kinase beta subunit. Important for seed oil biosynthesis. Ubiquitously expressed, with significantly increased expression in maturing seeds. The mutant plant has wrinkled seeds, with a 50-70% reduction in seed fatty acid content. The mRNA is cell-to-cell mobile.
AT5G52940 DUF295 domain protein.
AT5G52980 ER-based factor for assembly of V-ATPase;(source:Araport11)
AT5G53010 calcium-transporting ATPase;(source:Araport11)
AT5G53020 Ribonuclease P protein subunit P38-like protein;(source:Araport11)
AT5G53030 hypothetical protein;(source:Araport11)
AT5G53040 Encodes GROUNDED (GRD), a putative RWP-RK-type transcription factor broadly expressed in early development. GRD promotes zygote elongation and basal cell fates.
AT5G53048 Natural antisense transcript overlaps with AT5G53050;(source:Araport11)
AT5G53100 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT5G53120 encodes a novel spermine synthase and is a paralog of previously characterized spermidine synthases, SPDS1 and SPDS2. SPDS3 forms heterodimers with SDPS2, which in turn forms heterodimers with SDPS1 in vivo. The gene does not complement speDelta3 deficiency of spermidine synthase in yeast but DOES complement speDelta4 deficiency.
AT5G53160 Encodes RCAR3, a regulatory component of ABA receptor. Interacts with protein phosphatase 2Cs ABI1 and ABI2. Stimulates ABA signaling. The mRNA is cell-to-cell mobile.
AT5G53190 Nodulin MtN3 family protein;(source:Araport11)
AT5G53220 hypothetical protein;(source:Araport11)
AT5G53230 hypothetical protein (DUF295);(source:Araport11)
AT5G53240 hypothetical protein (DUF295);(source:Araport11)
AT5G53250 arabinogalactan protein 22;(source:Araport11)
AT5G53290 encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin.
AT5G53300 Encodes a ubiquitin conjugating enzyme.
AT5G53340 Encodes a hydroxyproline O-galactosyltransferase.
AT5G53370 pectin methylesterase PCR fragment F;(source:Araport11)
AT5G53380 O-acyltransferase (WSD1-like) family protein;(source:Araport11)
AT5G53410 F-box associated ubiquitination effector family protein;(source:Araport11)
AT5G53420 Member of ASML2 family of CCT domain proteins.There is a preferential accumulation of RNA isoforms CCT101.1 and CCT101.2 in response to N-treatment, each isoform has different targets.
AT5G53430 Homology Subgroup III; Orthology Group 2 - A putative histone methyltransferase (predicted to methylate H3K4) related to the Drosophila trithorax group proteins TRX and TRR and the yeast gene SET1. A plant line expressing an RNAi construct directed against this gene has reduced agrobacterium-mediated tumor formation.
AT5G53490 thylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein.
AT5G53500 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT5G53510 oligopeptide transporter
AT5G53520 Encodes an oligopeptide transporter. Target promoter of the male germline-specific transcription factor DUO1.
AT5G53530 Homolog of yeast retromer subunit VPS26. Part of a retromer-like protein complex involved in endosome to lysosome protein transport.
AT5G53550 YELLOW STRIPE like 3;(source:Araport11)
AT5G53570 Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11)
AT5G53580 NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11)
AT5G53592 FBD-like domain family protein;(source:Araport11)
AT5G53635 F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT5G53680 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT5G53700 RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT5G53710 hypothetical protein;(source:Araport11)
AT5G53780 F-box protein, putative (DUF295);(source:Araport11)
AT5G53790 F-box protein, putative (DUF295);(source:Araport11)
AT5G53800 nucleic acid-binding protein;(source:Araport11)
AT5G53820 Late embryogenesis abundant protein (LEA) family protein;(source:Araport11)
AT5G53830 VQ motif-containing protein;(source:Araport11)
AT5G53870 early nodulin-like protein 1;(source:Araport11)
AT5G53890 Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of phytosulfokine (PSK), which is a 5-aa tyrosine-sulfated peptide that primarily promotes cellular proliferation.
AT5G53900 Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11)
AT5G53920 Protein methyltransferase. One target is PRPL11 which it methylates on Lys 109.
AT5G53930 transcriptional regulator ATRX-like protein;(source:Araport11)
AT5G53960 Mid-1-related chloride channel domain-containing protein;(source:Araport11)
AT5G53970 Encodes a cytosolic tyrosine aminotransferase which is strongly induced upon aging and coronatine treatment. AtTAT1 prefers Tyr as an amino donor but can also use Phe, Trp, His, Met, and Leu. The mRNA is cell-to-cell mobile.
AT5G54010 Encodes a flavonoid 3-O-glucoside:2″-O-glucosyltransferase that determines pollen-specific flavonol structure.
AT5G54045 pseudogene of UF3GT
AT5G54060 Encodes a anthocyanin 3-O-glucoside: 2"-O-xylosyl-transferase involved in anthocyanin modification that converts cyanidin 3-O-glucoside to cyanidin 3-O-xylosyl(1->2)glucoside. Its preferred sugar donor is UDP-xylose.
AT5G54070 A member of Heat Stress Transcription Factor (Hsf) family. Not responding to heat stress. Is regulated by the seed-specific transcription factor ABI3. In turn, it regulates other heat stress proteins including Hsp17.4-CI, Hsp17.7-CII and Hsp101 during seed maturation.
AT5G54075 U3 small nucleolar RNA
AT5G54090 DNA mismatch repair protein MutS, type 2;(source:Araport11)
AT5G54100 SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11)
AT5G54130 Calcium-binding endonuclease/exonuclease/phosphatase family;(source:Araport11)
AT5G54145 hypothetical protein;(source:Araport11)
AT5G54148 sarcosine dehydrogenase-2C protein;(source:Araport11)
AT5G54165 Avr9/Cf-9 rapidly elicited protein;(source:Araport11)
AT5G54190 light-dependent NADPH:protochlorophyllide oxidoreductase A
AT5G54200 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT5G54210 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT5G54240 membrane lipoprotein lipid attachment site-like protein, putative (DUF1223);(source:Araport11)
AT5G54250 member of Cyclic nucleotide gated channel family, downstream component of the signaling pathways leading to HR resistance. mutant plants exhibit gene-for-gene disease resistance against avirulent Pseudomonas syringae despite the near-complete absence of the hypersensitive response (HR). Salicylic acid accumulation in dnd2 mutants is completely PAD4-independent.
AT5G54260 DNA repair and meiotic recombination protein, component of MRE11 complex with RAD50 and NBS1
AT5G54270 Lhcb3 protein is a component of the main light harvesting chlorophyll a/b-protein complex of Photosystem II (LHC II).
AT5G54280 Type VII myosin gene
AT5G54290 Encodes CcdA, a thylakoid membrane protein required for the transfer of reducing equivalents from stroma to thylakoid lumen.
AT5G54300 cotton fiber-like protein (DUF761);(source:Araport11)
AT5G54365 pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10)
AT5G54370 Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11)
AT5G54375 pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10)
AT5G54400 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT5G54430 Contains a universal stress protein domain. Protein is phosphorylated in response to Phytophthora infestans zoospores and xylanase.
AT5G54450 hypothetical protein (DUF295);(source:Araport11)
AT5G54460 wound-responsive protein-like protein;(source:Araport11)
AT5G54470 B-box type zinc finger family protein;(source:Araport11)
AT5G54480 hypothetical protein (DUF630 and DUF632);(source:Araport11)
AT5G54490 Encodes a PINOID (PID)-binding protein containing putative EF-hand calcium-binding motifs. The interaction is dependent on the presence of calcium. mRNA expression is up-regulated by auxin. Not a phosphorylation target of PID, likely acts upstream of PID to regulate the activity of this protein in response to changes in calcium levels.
AT5G54500 Encodes a flavin mononucleotide-binding flavodoxin-like quinone reductase that is a primary auxin-response gene.
AT5G54510 Encodes an IAA-amido synthase that conjugates Ala, Asp, Phe, and Trp to auxin. Lines overexpressing this gene accumulate IAA-ASP and are hypersensitive to several auxins. Identified as a dominant mutation that displays shorter hypocotyls in light grown plants when compared to wild type siblings. Protein is similar to auxin inducible gene from pea (GH3).
AT5G54520 Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT5G54540 Uncharacterized conserved protein (UCP012943);(source:Araport11)
AT5G54570 beta glucosidase 41;(source:Araport11)
AT5G54585 hypothetical protein;(source:Araport11)
AT5G54600 Translation protein SH3-like family protein;(source:Araport11)
AT5G54630 zinc finger protein-like protein;(source:Araport11)
AT5G54661 Pseudogene of AT5G54660; heat shock protein-related
AT5G54670 Encodes a truncated KatC polypeptide (KatC(207-754)), which includes the carboxyl-terminal region of KatC. This was expressed in Escherichia coli and was shown to possess microtubule-stimulated ATPase activity.
AT5G54680 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT5G54690 Encodes a protein with putative galacturonosyltransferase activity. Mutants defective in this gene displayed a notable reduction in xylose (>50%) in the cell walls from stems and roots and a reduction in cellulose (~25%).
AT5G54700 Ankyrin repeat family protein;(source:Araport11)
AT5G54730 yeast autophagy 18 F-like protein;(source:Araport11)
AT5G54760 Translation initiation factor SUI1 family protein;(source:Araport11)
AT5G54770 Encodes a thiamine biosynthetic gene that has a dual function in thiamine biosynthesis and mitochondrial DNA damage tolerance. It appears to be involved in producing the thiazole portion of thiamine (vitamin B1). A crystal structure of the protein reveals that it forms a 2-ring homo-octamer. The mRNA is cell-to-cell mobile.
AT5G54820 F-box/RNI-like superfamily protein;(source:Araport11)
AT5G54840 Monomeric G protein. Expressed in the root quiescent center, flowers, and leaf guard cells and hydathodes.
AT5G54865 pre-tRNA tRNA-Met;(source:Araport11, TAIR10)
AT5G54910 DEA(D/H)-box RNA helicase family protein;(source:Araport11)
AT5G54930 AT hook motif-containing protein;(source:Araport11)
AT5G54950 Aconitase family protein;(source:Araport11)
AT5G54990 RING/U-box superfamily protein;(source:Araport11)
AT5G55020 Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB120).
AT5G55040 DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components.
AT5G55050 GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. The mRNA is cell-to-cell mobile.
AT5G55070 Encodes the E2 subunit of the 2-oxoglutarate dehydrogenase.
AT5G55090 member of MEKK subfamily
AT5G55120 Encodes a GDP-L-galactose phosphorylase, with similar biochemical properties as VTC2.
AT5G55140 ribosomal protein L30 family protein;(source:Araport11)
AT5G55150 F-box SKIP23-like protein (DUF295);(source:Araport11)
AT5G55160 Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets. SUMO2 can form SUMO chains through lysine residue 10 during in vitro assays.
AT5G55230 Binds and bundles microtubules. Plays a role in stabilizing anti-parallel microtubules in the central spindle at anaphase to early cytokinesis but is not essential at the midline of the phragmoplast at later stages. The timing with which the MAP65-1 was targeted to the spindle appears to be regulated by a phosphorylation sensitive switch. Enhances microtubule polymerization, promotes nucleation and stabilizes microtubules against cold treatment and dilution.
AT5G55240 Catalyze hydroperoxide-dependent mono-oxygenation reactions. Require calcium for peroxygenase activity. Probably deeply buried in lipid droplets or microsomes.
AT5G55250 Encodes an enzyme which specifically converts IAA to its methyl ester form MelIAA. This gene belongs to the family of carboxyl methyltransferases whose members catalyze the transfer of the methyl group from S-adenosyl-L-methionine to carboxylic acid-containing substrates to form small molecule methyl esters. Expression of TCP genes is downregulated in mutant iamt1-D. SABATH methyltransferase.
AT5G55260 Encodes a protein with similarity to the catalytic subunit of the mammalian PPX protein phospatase.
AT5G55270 hypothetical protein (DUF295);(source:Araport11)
AT5G55290 Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes.
AT5G55300 Encodes a type-I DNA topoisomerase I. Disruptions in this gene affect phyllotaxis and plant architecture suggesting that the gene plays a critical role in the maintenance of a regular pattern of organ initiation. Isolated as a protein oxidized during seed germination; proteomics approach revealed differences in de novo synthesis levels of this protein in condition with vs. without salicylic acid in the period from 0 to 40 hrs. following seed imbibition. Functions in stem cell maintenance at all stages of shoot and floral meristems and in the regulation of gene silencing.
AT5G55310 Encodes one of two Arabidopsis type-I DNA topoisomerase I genes. Reducing the level of expression of this gene in a top1alpha (At5g55300) mutant background causes seedling lethality.
AT5G55330 MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11)
AT5G55350 MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11)
AT5G55390 Encodes EDM2 (enhanced downy mildew 2). The predicted protein bears typical features of transcriptional regulators. EDM2 contains two putative bipartite nuclear localization signals (NLS) two zinc-finger-like motifs, a Proline-rich region and a large aspartic acid-rich region. Both zinc-finger-like stretches resemble the PHD (plant homeodomain) finger motif. Mutations in EDM2 comprise RPP7 mediated resistance against Hyaloperonospora parasitica isolate Hiks1 (HpHiks1). EDM2 may function as a direct or indirect regulator of RPP7 expression.
AT5G55400 Encodes a member of the fimbrin family. Different members of the fimbrin/plastin family have diverged biochemically during evolution to generate either tight actin bundles or loose networks with distinct biochemical and biophysical properties. FIM4 generates both actin bundles and branched actin filaments whereas FIM5 only generates actin bundles.
AT5G55410 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT5G55450 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT5G55480 Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development. The mRNA is cell-to-cell mobile.
AT5G55490 Encodes a transmembrane domain containing protein that is expressed in pollen germ cells.
AT5G55500 Encodes a beta-1,2-xylosyltransferase that is glycosylated at two positions. The mRNA is cell-to-cell mobile.
AT5G55510 PRAT protein family which has a unique system for importing and exporting proteins from chloroplasts. Acts in the export of proteins from chloroplasts during leaf senescence.
AT5G55520 kinesin-like protein;(source:Araport11)
AT5G55540 Encodes a large plant-specific protein of unknown function, with conserved domains also found in a variety of signaling proteins, In trn mutants, the leaf venation network had a severely reduced complexity: incomplete loops, no tertiary or quaternary veins, and vascular islands. The leaf laminas were asymmetric and narrow because of a severely reduced cell number. TRN1 is required for the maintenance of both the radial pattern of tissue differentiation in the root and for the subsequent circumferential pattern within the epidermis. Double mutant analysis showed that TRN1 and TRN2 act in the same pathway.
AT5G55640 Na-translocating NADH-quinone reductase subunit A;(source:Araport11)
AT5G55650 transmembrane protein;(source:Araport11)
AT5G55700 In vitro assay indicates no beta-amylase activity of BAM4. However mutation in BAM4 impairs starch breakdown. BAM4 may play a regulatory role.
AT5G55780 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT5G55835 Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAAAGAGAGCAC
AT5G55840 PPR superfamily protein;(source:Araport11)
AT5G55860 WEB1/PMI2 related protein involved in mecahnotransduction.TREPH1 is phosphorylated at position S625 in response to touch, and this is required for mechanosensitive growth response.
AT5G55896 transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.7e-49 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10)
AT5G55900 Sucrase/ferredoxin-like family protein;(source:Araport11)
AT5G55940 Uncharacterized protein family (UPF0172);(source:Araport11)
AT5G55960 transmembrane protein C9orf5 protein;(source:Araport11)
AT5G55970 Drought-induced gene encoding an ER-localized RING-type E3 Ub ligase.
AT5G55980 serine-rich protein-like protein;(source:Araport11)
AT5G55990 Encodes a member of the Arabidopsis CBL (Calcineurin B-like Calcium Sensor) protein family.
AT5G56000 HEAT SHOCK PROTEIN 81.4;(source:Araport11)
AT5G56040 Leucine-rich receptor-like protein kinase family protein;(source:Araport11)
AT5G56050 late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT5G56110 Encodes a member of the R2R3 MYB transcription factor gene family that is required for anther development by regulation tapetum development, callose dissolution and exine formation. It acts upstream of MS2.
AT5G56150 ubiquitin-conjugating enzyme 30;(source:Araport11)
AT5G56160 Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT5G56170 LORELEI-LIKE-GPI-ANCHORED PROTEIN 1;(source:Araport11)
AT5G56200 Encodes a transcription factor expressed in the female gametophyte.
AT5G56210 Encodes an outer nuclear membrane protein that anchors RanGAP1 to the nuclear envelope. It interacts with SUN proteins and is required for maintaining the elongated nuclear shape of epidermal cells.
AT5G56230 prenylated RAB acceptor 1.G2;(source:Araport11)
AT5G56240 hapless protein;(source:Araport11)
AT5G56250 hapless 8;(source:Araport11)
AT5G56260 Ribonuclease E inhibitor RraA/Dimethylmenaquinone methyltransferase;(source:Araport11)
AT5G56290 Encodes the peroxisomal targeting signal type 1 receptor that facilitates peroxisomal protein translocation. It recognizes proteins with the PTS1 consensus sequence (tripeptide SKL or a conserved variant) at the extreme C terminus. The protein has several domains, including C-terminal tetratricopeptide repeat motifs which act in binding the C-terminal "SKL" targeting signal. The mechanism of transport has been worked out in other organisms: The receptor recognizes and binds cytosolic PTS1-containing proteins. The PEX5-PTS1 complex binds a PEX14/PEX13 receptor complex at the peroxisome membrane and is translocated into the peroxisome matrix in a process dependent on PEX2,PEX10, and PEX12. In the peroxisome matrix, PEX5 releases its cargo and is recycled to the cytosol in a process dependent on PEX1, PEX4, PEX6 and PEX22. It is also involved, in conjunction with PEX7, in PTS1- and PTS2-dependent peroxisomal protein import. RNAi experiments suggest that PEX5 is necessary for the maintenance of both glyoxysomal and leaf peroxisomal functions.
AT5G56320 member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio)
AT5G56370 F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT5G56390 F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT5G56400 FBD, F-box, Skp2-like and Leucine Rich Repeat domains containing protein;(source:Araport11)
AT5G56440 F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT5G56452 FBD-like domain family protein;(source:Araport11)
AT5G56460 Protein kinase superfamily protein;(source:Araport11)
AT5G56470 FAD-dependent oxidoreductase family protein;(source:Araport11)
AT5G56510 Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts.
AT5G56520 hypothetical protein;(source:Araport11)
AT5G56530 tRNA-splicing ligase (DUF239);(source:Araport11)
AT5G56540 Encodes arabinogalactan protein (AGP14). Mutants exhibit longer root hairs. The mRNA is cell-to-cell mobile.
AT5G56544 pseudogene of arginyl-tRNA synthetase
AT5G56560 FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11)
AT5G56610 Encodes a phosphatidylglycerophosphate (PGP) phosphatase involved in the synthesis of plastidial Phosphatidylglycerol (PG) in conjunction with PGPP1 and PTPMT1 in root. For PTPMT2.1, lower expression levels were detected in leaf and stem as compared to the other tissues.
AT5G56630 phosphofructokinase 7;(source:Araport11)
AT5G56640 Myo-Inositol Oxygenase gene family
AT5G56690 FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11)
AT5G56720 predicted to encode a cytosolic malate dehydrogenase.
AT5G56760 Encodes a cytosolic serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system.
AT5G56770 transcription repressor-like protein;(source:Araport11)
AT5G56790 Protein kinase superfamily protein;(source:Araport11)
AT5G56795 one of the five metallothioneins (MTs) genes identified in Arabidopsis. MTs are cysteine-rich proteins required for heavy metal tolerance. The MT1b gene, however, is indicated to be inactive.
AT5G56810 F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT5G56830 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.7e-14 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT5G56850 hypothetical protein;(source:Araport11)
AT5G56870 beta-galactosidase 4;(source:Araport11)
AT5G56880 hypothetical protein;(source:Araport11)
AT5G56890 Protein kinase superfamily protein;(source:Araport11)
AT5G56950 Encodes a member of a small gene family of proteins with similarity to nucleosome assembly proteins.May function in nucleotide excision repair. Loss of function mutations have no obvious visible phenotypes but do seem to affect transcription of NER related genes. Plants mutated in three ubiquitously expressed NAP1 genes (NAP1;1~NAP1;3) and organ-specifically expressed NAP1;4 gene show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. The NAP1 genes act synergistically with NRP genes in promoting somatic homologous recombination.
AT5G56960 basic helix-loop-helix (bHLH) DNA-binding family protein;(source:Araport11)
AT5G56970 It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins.Acts on N6-(2-isopentenyl)adenine 9-riboside.
AT5G56975 pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10)
AT5G56990 proteinase inhibitor I25, cystatin, motif protein;(source:Araport11)
AT5G57015 Member of CKL gene family (member of CKL-B group).
AT5G57030 Lutein-deficient 2 (LUT2) required for lutein biosynthesis, member of the xanthophyll class of carotenoids. Encodes lycopene epsilon cyclase
AT5G57040 Vicinal oxygen chelate (VOC) superfamily member. Responds to NaCl,drought and high light stress.
AT5G57070 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT5G57080 transmembrane protein;(source:Araport11)
AT5G57090 Encodes an auxin efflux carrier that is similar to bacterial membrane transporters. Root-specific role in the transport of auxin. Acts downstream of CTR1 and ethylene biosynthesis, in the same pathway as EIN2 and AUX1, and independent from EIN3 and EIN5/AIN1 pathway. In the root, the protein localizes apically in epidermal and lateral root cap cells and predominantly basally in cortical cells. Functions may be regulated by phosphorylation status. EIR1 expression is induced by brassinolide treatment in the brassinosteroid-insensitive br1 mutant. Gravistimulation results in asymmetric PIN2 distribution, with more protein degraded at the upper side of the gravistimulated root. Membrane sterol composition is essential for the acquisition of PIN2 polarity. Its expression is downregulated at hypoxic conditions. RAP2.12 overexpression inhibits this downregulation.
AT5G57110 Arabidopsis-autoinhibited Ca2+ -ATPase, isoform 8, contains all of the characteristic motifs of Ca2+ -transporting P-type Ca2+ -ATPases and is localized to the plasma membrane.
AT5G57126 transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.2e-282 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT5G57140 purple acid phosphatase 28;(source:Araport11)
AT5G57150 basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT5G57160 Encodes the Arabidopsis orthologue of the yeast and mammalian DNA ligase IV. Involved in the repair of DNA damage but, unlike in yeast, not required for T-DNA integration. Interacts with the Arabidopsis homologue of XRCC4.
AT5G57230 Thioredoxin superfamily protein;(source:Araport11)
AT5G57260 putative cytochrome P450
AT5G57270 Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11)
AT5G57290 60S acidic ribosomal protein family;(source:Araport11)
AT5G57330 Galactose mutarotase-like superfamily protein;(source:Araport11)
AT5G57340 ras guanine nucleotide exchange factor Q-like protein;(source:Araport11)
AT5G57345 OXR is a single copy gene in Arabidopsis. It is localized to the ER. It is expressed throughout the plant and expression is induced in response to abiotic stress. While the function of OXR is unknown, overexpression results in increased abiotic stress tolerance and increased ascorbic acid content.
AT5G57350 member of Plasma membrane H+-ATPase family
AT5G57380 Encodes a plant homeodomain protein VERNALIZATION INSENSITIVE 3 (VIN3). In planta VIN3 and VRN2, VERNALIZATION 2, are part of a large protein complex that can include the polycomb group (PcG) proteins FERTILIZATION INDEPENDENT ENDOSPERM (FIE), CURLY LEAF (CLF), and SWINGER (SWN or EZA1). The complex has a role in establishing FLC (FLOWERING LOCUS C) repression during vernalization.
AT5G57390 Encodes a member of the AP2 family of transcriptional regulators. May be involved in germination and seedling growth. Mutants are resistant to ABA analogs and are resistant to high nitrogen concentrations.essential for the developmental transition between the embryonic and vegetative phases in plants. Overexpression results in the formation of somatic embryos on cotyledons. It is also required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions. Acts redundantly with PLT3 and 7 in lateral root pattern formation.
AT5G57410 Encodes a microtubule-associated protein.
AT5G57420 Belongs to auxin inducible gene family.
AT5G57460 TPLATE complex subunit involved in clathirin mediated endocytosis.
AT5G57480 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT5G57500 Galactosyltransferase family protein;(source:Araport11)
AT5G57510 cotton fiber protein;(source:Araport11)
AT5G57540 Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity.
AT5G57560 Encodes a cell wall-modifying enzyme, rapidly upregulated in response to environmental stimuli.
AT5G57570 GCK domain-containing protein;(source:Araport11)
AT5G57580 Calmodulin-binding protein;(source:Araport11)
AT5G57590 Encodes a bifunctional enzyme with both dethiobiotin synthetase and diaminopelargonic acid aminotransferase activities that is involved in biotin synthesis.
AT5G57620 MYB36 is a transcriptional regulator that acts to promote differentiation of the endodermis during root development. It promotes the development the Casparian band in part by regulating the expression of genes involved in localizing lignin biosynthetic machinery to the Casparian band. MYB36 binds to and regulates the expression of factors involved in producing the Casparian band including CASP1, PER64, and ESB1.
AT5G57630 CBL-interacting protein kinase.When mutated plants are hypersensitive to salt and osmotic stress.
AT5G57660 CONSTANS-like 5;(source:Araport11)
AT5G57670 Protein kinase superfamily protein;(source:Araport11)
AT5G57685 Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7).
AT5G57690 Involved in nitric oxide-dependent pollen tube guidance and fertilization.
AT5G57700 BNR/Asp-box repeat family protein;(source:Araport11)
AT5G57750 RING/U-box superfamily protein;(source:Araport11)
AT5G57760 hypothetical protein;(source:Araport11)
AT5G57790 Encodes a nuclear localized protein of unknown function that is involved in pollen and embryo sac development.
AT5G57800 encodes a transmembrane protein with similarity to the sterol desaturase family at the N-terminus and to the short-chain dehydrogenase/reductase family at the C-terminus. Mutant analyses indicate this protein is involved in cuticle membrane and wax biosynthesis. The mRNA is cell-to-cell mobile.
AT5G57820 zinc ion binding protein;(source:Araport11)
AT5G57840 encodes a protein whose sequence is similar to anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (gi:2239091)
AT5G57900 F-box protein, interacts with SKP1/ASK1 subunit of SCF ubiquitin ligase in a glucose-dependent manner
AT5G57930 ACCUMULATION OF PHOTOSYSTEM ONE 2
AT5G57960 GTP-binding protein, HflX;(source:Araport11)
AT5G58000 Reticulon family protein;(source:Araport11)
AT5G58010 Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3).
AT5G58060 Constitutively expressed SNARE protein of the YKT6 family.
AT5G58080 member of Response Regulator: B- Type
AT5G58120 DM10 is a singleton TIR-NLR, and causal QTL responsible for severe hybrid necrosis.
AT5G58130 Encodes ROS3 (repressor of silencing 3), a RNA-binding protein required for DNA demethylation.
AT5G58170 Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family.
AT5G58290 26S proteasome AAA-ATPase subunit RPT3 (RPT3) mRNA,
AT5G58310 Encodes a protein shown to have methyl IAA esterase activity in vitro. This protein does not act on methyl JA, MeSA, MeGA4, or MEGA9 in vitro.
AT5G58330 lactate/malate dehydrogenase family protein;(source:Araport11)
AT5G58360 ovate family protein 3;(source:Araport11)
AT5G58390 Peroxidase superfamily protein;(source:Araport11)
AT5G58410 HEAT/U-box domain-containing protein;(source:Araport11)
AT5G58412 Encodes a Plant thionin family protein
AT5G58450 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT5G58580 Encodes a functional E3 ligase that is involved in membrane trafficking and regulation of salt stress responses. It is localized to membranes including the plasma membrane, pre-vacuolar compartments and Golgi.
AT5G58590 Encodes a Ran-binding protein 1 homolog (RanBP1).
AT5G58610 PHD finger transcription factor;(source:Araport11)
AT5G58640 Selenoprotein, Rdx type;(source:Araport11)
AT5G58660 Encodes a class III gibberellin 2-oxidase that oxidizes GA12 to GA110 and GA9 to GA40.
AT5G58670 phosphatidylinositol-specific phospholipase C is induced to a significant extent under various environmental stresses, such as dehydration, salinity, and low temperature. May play a role in secondary ABA response. There are two genes called ATPLC1, one corresponding to AT4g38530 and one corresponding ot AT5g58670 (this one).
AT5G58690 phosphatidylinositol-speciwc phospholipase C5;(source:Araport11)
AT5G58740 Member of the family of NudC proteins. Over-expression improves free radical sacenving activity and antioxidant status, promotes root growth and branching under abiotic stress.
AT5G58750 Putative PRISE (progesterone 5β-reductase and/or iridoid synthase-like 1,4-enone reductases).
AT5G58770 AtCPT7 synthesizes medium-chain polyprenols of approximately 55 carbons in length. The enzyme utlizes geranylgeranyl pyrophosphate (GGPP) and isopentenyl pyrophosphate (IPP) as substrates. The enzymatic product accumulates into plastdial membranes (DOI:10.1105/tpc.16.00796).
AT5G58780 Encodes a novel Z,E-mixed heptaprenyl diphosphate (Z,E-HepPP) synthase, which may be responsible for short-chain betulaprenols. It catalyzes the formation of C 35 short-chain polyisoprenoids in which the optimal allylic substrate was E,E-FPP. It may have a role in response to cold stress in root.
AT5G58784 Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11)
AT5G58810 pseudogene of Subtilase family protein;(source:Araport11)
AT5G58820 Subtilisin-like serine endopeptidase family protein;(source:Araport11)
AT5G58830 Subtilisin-like serine endopeptidase family protein;(source:Araport11)
AT5G58840 Subtilase family protein;(source:Araport11)
AT5G58850 Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB119).
AT5G58860 Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly only in root tissue.
AT5G58880 LRR protein;(source:Araport11)
AT5G58890 AGAMOUS-like 82;(source:Araport11)
AT5G58910 putative laccase, a member of laccase family of genes (17 members in Arabidopsis).
AT5G58940 Arabidopsis thaliana calmodulin-binding receptor-like kinase mRNA The mRNA is cell-to-cell mobile.
AT5G58960 Mutant plants display impaired light-regulation of the hypocotyl randomization response.
AT5G58970 UCP2 and its paralog UCP1 is a member of the PUMP2 family of uncoupling proteins. It functions as a mitochondrial transporter of spartate, glutamate and dicarboxylates.
AT5G59000 RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11)
AT5G59040 encodes a member of copper transporter family and functionally complements a high affinity copper transporter mutant in yeast
AT5G59050 G patch domain protein;(source:Araport11)
AT5G59080 hypothetical protein;(source:Araport11)
AT5G59090 subtilase 4.12;(source:Araport11)
AT5G59100 Subtilisin-like serine endopeptidase family protein;(source:Araport11)
AT5G59110 subtilisin-like serine protease-like protein;(source:Araport11)
AT5G59120 SBT4.13 subtilase. Activity is inhibited by SPI-1.
AT5G59130 Subtilase family protein;(source:Araport11)
AT5G59190 subtilase family protein;(source:Araport11)
AT5G59200 Encodes a chloroplast RNA editing factor.
AT5G59230 transcription factor-like protein;(source:Araport11)
AT5G59240 Ribosomal protein S8e family protein;(source:Araport11)
AT5G59260 Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT5G59290 Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes.
AT5G59330 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT5G59340 Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. WOX2 has a putative Zinc finger domain downstream of the homeodomain. Transcripts are expressed in the egg cell, the zygote and the apical cell lineage and are reduced in met3-1 early embryos. This gene is necessary for cell divisions that form the apical embryo domain.
AT5G59420 OSBP(oxysterol binding protein)-related protein 3C;(source:Araport11)
AT5G59430 Encodes a telomeric repeat binding protein with a DNA binding domain at its C terminus. The DNA binding domain has a preference for GGTTTAG sequences and at least five of these repeats are required for recognition by a nearly full-length TRP1 protein.
AT5G59450 GRAS family transcription factor;(source:Araport11)
AT5G59480 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT5G59490 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT5G59570 Encodes BOA (BROTHER OF LUX ARRHYTHMO), a component of the circadian clock. The mRNA is cell-to-cell mobile.
AT5G59580 UDP-glucosyl transferase 76E1;(source:Araport11)
AT5G59600 Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT5G59670 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G59690 Histone superfamily protein;(source:Araport11)
AT5G59710 Encodes a nuclear-localized NOT (negative on TATA-less) domain-containing protein that interacts with the Agrobacterium VirE2 protein and is required for Agrobacterium-mediated plant transformation. It likely facilitates T-DNA integration into plant chromosomes and may play a role as a transcriptional regulator. The mRNA is cell-to-cell mobile.
AT5G59720 encodes a low molecular weight heat shock protein that contains the heat shock element in the promoter region. Expression is induced in response to heat shock.
AT5G59780 Encodes a putative transcription factor (MYB59). In roots it is involved in K+/NO3- transport and expression of the NPF7.3 transporter.
AT5G59800 Encodes a protein containing a methyl-CpG-binding domain that acts as an anti-silencing factor that prevent gene repression and DNA hypermethylation by tethering other anti-silencing factors to methylated DNA, which enables the function of DNA demethylases that in turn limit DNA methylation and prevent transcriptional gene silencing.
AT5G59810 Subtilase family protein;(source:Araport11)
AT5G59820 Encodes a zinc finger protein involved in high light and cold acclimation. Overexpression of this putative transcription factor increases the expression level of 9 cold-responsive genes and represses the expression level of 15 cold-responsive genes, including CBF genes. Also, lines overexpressing this gene exhibits a small but reproducible increase in freeze tolerance. Because of the repression of the CBF genes by the overexpression of this gene, the authors speculate that this gene may be involved in negative regulatory circuit of the CBF pathway. The mRNA is cell-to-cell mobile.
AT5G59870 Encodes HTA6, a histone H2A protein.
AT5G59890 actin depolymerizing factor 4 (ADF4) mRNA, complete cds
AT5G59920 Isolated in a screen for UV-B insensitive mutants using a hypocotyl growth inhibition assay. Mutants are defective in a number of UV-B responses.
AT5G59930 Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT5G60010 ferric reductase-like transmembrane component family protein;(source:Araport11)
AT5G60020 LAC17 appears to have laccase activity based on enzyme assays performed using lac17 mutants. Notably, these mutants appear to have a reduced deposition of G lignin units. LAC17 is expressed in interfascicular fibers and likely contributes to lignin biosynthesis, and hence, cell wall biosynthesis, there.
AT5G60030 hypothetical protein;(source:Araport11)
AT5G60060 F-box SKIP23-like protein (DUF295);(source:Araport11)
AT5G60070 ankyrin repeat family protein;(source:Araport11)
AT5G60080 Protein kinase superfamily protein;(source:Araport11)
AT5G60090 Protein kinase superfamily protein;(source:Araport11)
AT5G60160 Vacuolar aspartyl aminopeptidase which also functions as a molecular chaperone.
AT5G60170 E3 ligase involved in regulation of chloroplast protein synthesis through activity of PGR3.
AT5G60180 Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts.
AT5G60190 Encodes a protein that can cleave residues from the C-terminus of RUB1 to prepare it for conjugation to target proteins.
AT5G60200 Encodes a Dof-type transcription factor. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division.
AT5G60210 Encodes RIP5 (ROP interactive partner 5), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants).
AT5G60260 hypothetical protein;(source:Araport11)
AT5G60310 Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT5G60335 Encodes the mitochondria-localized 3-hydroxyacyl-acyl carrier protein (ACP) dehydratase (mtHD) component of the mitochondrial fatty acid synthase (mtFAS) system. It catalyzes the third of the four iterative reactions that constitute the mtFAS cycle. Additionally, it supports the assembly of lipid A-like molecules and has an unexpected function in maintaining the morphology of chloroplastic starch granules.
AT5G60350 hypothetical protein;(source:Araport11)
AT5G60360 Encodes a senescence-associated thiol protease. The mRNA is cell-to-cell mobile.
AT5G60370 exonuclease V-like protein;(source:Araport11)
AT5G60408 Encodes a microRNA of the miR390 family with unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCGCAGGAGAGAUAGCGCCA
AT5G60450 Encodes a member of the ARF family of transcription factors which mediate auxin responses. ARF4 appears to have redundant function with ETT(ARF3) in specifying abaxial cell identity.
AT5G60460 Preprotein translocase Sec, Sec61-beta subunit protein;(source:Araport11)
AT5G60490 Encodes a member of fasciclin-like arabinogalactan proteins (FLAs) containing a cell adhesion fasciclin (FAS) domain. Mutations result in altered stem biomechanics with reduced tensile strength and reduced tensile modulus of elasticity, as well as altered cell wall architecture and composition, with increased cellulose microfibril angle, reduced arabinose, galactose and cellulose content. Possibly involved in embryogenesis and seed development.
AT5G60510 Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11)
AT5G60520 Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11)
AT5G60530 Root tip expressed LEA protein involved in ribosome biogenesis.
AT5G60570 Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT5G60580 RING/U-box superfamily protein;(source:Araport11)
AT5G60610 F-box/RNI-like superfamily protein;(source:Araport11)
AT5G60615 Encodes a defensin-like (DEFL) family protein.
AT5G60650 proline-rich receptor-like kinase;(source:Araport11)
AT5G60680 transcription initiation factor TFIID subunit (Protein of unknown function, DUF584);(source:Araport11)
AT5G60700 glycosyltransferase family protein 2;(source:Araport11)
AT5G60710 Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11)
AT5G60720 electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11)
AT5G60740 ABC transporter family protein. Localizes to the growing tip of pollen tubes where it appears to be critical for localizing polyamines and reactive oxygen species.
AT5G60780 member of High affinity nitrate transporter family
AT5G60820 RING/U-box superfamily protein;(source:Araport11)
AT5G60850 Encodes a zinc finger protein.
AT5G60870 Encodes a mitochondrial protein RUG3 that is required for accumulation of mitochondrial respiratory chain complex I. RUG3 is related to human REGULATOR OF CHROMOSOME CONDENSATION 1 (RCC1) and Arabidopsis UV-B RESISTANCE 8 (UVR8).
AT5G60880 Encodes BASL (BREAKING OF ASYMMETRY IN THE STOMATAL LINEAGE), a regulator of asymmetric divisions. In asymmetrically dividing stomatal-lineage cells, BASL accumulates in a polarized crescent at the cell periphery before division, and then localizes differentially to the nucleus and a peripheral crescent in self-renewing cells and their sisters after division. Its transcript levels change after inducing MUTE expression in a mute background.
AT5G60900 Encodes a receptor-like protein kinase.
AT5G60910 MADS box gene negatively regulated by APETALA1
AT5G60920 Encodes a glycosylphosphatidylinositol-anchored protein localized primarily in the plasma membrane of the longitudinal sides of root cells. Necessary for oriented cell expansion in Arabidopsis. Cob mutants have abnormal roots that expand radially rather than longitudinally under certain growth conditions.
AT5G60950 COBRA-like protein 5 precursor;(source:Araport11)
AT5G61010 A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT5G61060 Encodes a member of the histone deacetylase family. Class II RPD3-like family HDAC member which controls negative responses to salinity stress.
AT5G61070 Encodes a protein with similarity to histone deacetylases, a class of chromatin remodeling factors which act on H3/H4 histones. Class II RPD3-like family HDAC member which controls negative responses to salinity stress. Expressed in roots where it appears to regulate the expression of epidermal cell fate genes controlling hair cell differentiation.
AT5G61110 PHD finger-containing protein. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription.
AT5G61120 PHD finger-containing protein. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription.
AT5G61210 membrane localized t-SNARE SNAP25 homologue, probably involved in cytokinesis and cell plate formation The mRNA is cell-to-cell mobile.
AT5G61240 Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT5G61250 Belongs to the plant glycoside hydrolase family 79. Encodes a protein with several posttranslational modification sites including O-β-GlcNAc attachment sites and serine-, threonine- and tyrosine-phosphorylation sites, suggesting that this protein is extensively modified posttranslationally. The protein is predicted (WoLF PSORT program) to be secreted.
AT5G61260 Plant calmodulin-binding protein-like protein;(source:Araport11)
AT5G61270 Basic helix-loop-helix (bHLH) phytochrome interacting factor. Interacts specifically with the far-red light?absorbing Pfr form of phyB through a conserved domain called the active phyB binding motif. Upon light exposure, PIF7 rapidly migrates to intranuclear speckles, where it colocalizes with phyB. Role as negative regulator of phyB-mediated seedling deetiolation.
AT5G61280 Remorin family protein;(source:Araport11)
AT5G61290 Flavin-binding monooxygenase family protein;(source:Araport11)
AT5G61330 rRNA processing protein-like protein;(source:Araport11)
AT5G61340 transmembrane protein;(source:Araport11)
AT5G61350 Encodes a membrane-localized receptor-like kinase that regulates root hair tip growth by maintaining cytoplasmic Ca2+ gradients. Knockouts of CAP1 produced more cytoplasmic NH4+ and ceased growth of root hairs on MS medium except when NH4+ was depleted; NH4+ depletion reestablished the Ca2+ gradient necessary for normal growth. The lower net NH4+ influx across the vacuolar membrane and relatively alkaline cytosolic pH of root hairs in cap1-1 relative to wild type implied that mutation of CAP1 results in more NH4+ accumulation in the cytoplasm. Furthermore, CAP1 functionally complemented npr1 kinase yeast mutant defective in high-affinity NH4+ uptake via MEP2, distinguishing CAP1 as a cytosolic modulator of NH4+ level that participates in NH4+ homeostasis-regulated root hair growth by modulating tip-focused cytoplasmic Ca2+ gradients.
AT5G61360 hypothetical protein;(source:Araport11)
AT5G61390 Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11)
AT5G61400 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT5G61420 Encodes a nuclear localized member of the MYB transcription factor family. Involved in positive regulation of aliphatic glucosinolate biosynthesis.Expression is induced by touch, wounding and glucose.
AT5G61430 NAC domain containing protein 100;(source:Araport11)
AT5G61480 Encodes PXY, a receptor-like kinase essential for maintaining polarity during plant vascular-tissue development.
AT5G61490 transmembrane protein;(source:Araport11)
AT5G61510 GroES-like zinc-binding alcohol dehydrogenase family protein;(source:Araport11)
AT5G61560 Plant U-box type E3 ubiquitin ligase (PUB).
AT5G61570 Protein kinase superfamily protein;(source:Araport11)
AT5G61600 encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture.
AT5G61620 myb-like transcription factor family protein;(source:Araport11)
AT5G61680 Pectin lyase-like superfamily protein;(source:Araport11)
AT5G61690 ABC2 homolog 15;(source:Araport11)
AT5G61700 ABC2 homolog 16;(source:Araport11)
AT5G61710 cotton fiber protein;(source:Araport11)
AT5G61720 hypothetical protein (DUF1216);(source:Araport11)
AT5G61730 Encodes an ER-localized ABC transporter with a role in the supply of fatty acid substrates for TAG biosynthesis at the ER during the seed-filling stage.
AT5G61750 RmlC-like cupins superfamily protein;(source:Araport11)
AT5G61780 Involved in the regulation of AtGA20ox3 expression, as well as seed germination. The mRNA is cell-to-cell mobile.
AT5G61790 calnexin 1;(source:Araport11)
AT5G61800 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT5G61810 Encodes the predominant of three APC isoforms in Arabidopsis, a calcium-dependent mitochondrial ATP-Mg/Pi transporter.
AT5G61840 Encodes a UDP-Xyl:beta-(1,4)-xylosyl transferase.
AT5G61890 encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.
AT5G61900 Encodes a plasma-membrane localized, copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Mutants exhibit temperature-sensitive growth defects and increased hypersensitive response where permissive conditions are low temperature (22 degrees Celsius) and low humidity. Gene is expressed at 22 but not at 28 (restrictive condition) degrees. Lethality of double mutants with BON3 can be partially suppressed by SNC1. Double mutants show defects in development that are genetically separable from hypersensitive/cell death response.
AT5G61910 DCD (Development and Cell Death) domain protein;(source:Araport11)
AT5G61940 Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11)
AT5G61960 A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML1 is a member of two sister clades of mei2-like gene family, AML1 through AML5 and belongs to the clade named ALM14. AML1 is expressed during early embryo development, particularly along embryonic axis at torpedo stage, in shoot apex (weaker expression) and in the organogenic regions of floral apices.
AT5G61970 signal recognition particle-related / SRP-like protein;(source:Araport11)
AT5G61990 Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT5G62020 member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile.
AT5G62065 Encodes a Protease inhibitor/seed storage/LTP family protein. Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15.
AT5G62080 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT5G62100 A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development.
AT5G62130 Per1-like family protein;(source:Araport11)
AT5G62140 ATP-dependent Clp protease ATP-binding subunit;(source:Araport11)
AT5G62150 peptidoglycan-binding LysM domain-containing protein;(source:Araport11)
AT5G62162 Encodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCAAAGGAGAGUUGCCCUG
AT5G62170 LOW protein: M-phase inducer phosphatase-like protein;(source:Araport11)
AT5G62180 Carboxyesterase that binds stringolactones.
AT5G62200 Embryo-specific protein 3, (ATS3);(source:Araport11)
AT5G62210 Embryo-specific protein 3, (ATS3);(source:Araport11)
AT5G62230 Encodes a receptor-like kinase that, together with ER and ERL2 governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. It is important for maintaining stomatal stem cell activity and preventing terminal differentiation of the meristemoid into the guard mother cell. Along with erl2 functionally compensates for loss of erecta during integument development. Its transcript levels change after inducing MUTE expression in a mute background.
AT5G62240 TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of Aurora kinase activity.
AT5G62250 microtubule-associated protein 65-9;(source:Araport11)
AT5G62270 Ribosomal protein L20;(source:Araport11). Required for proper mitochondrial cristae formation. Expressed throughout plant. Mutants are defective in late stages of megagametogenesis. Pollen tube defective. Gametophytic lethality is probably due to mitochondrial disfunction.
AT5G62280 DUF1442 family protein (DUF1442);(source:Araport11)
AT5G62360 Pectin methylesterase inhibitor expressed throughout the plant.
AT5G62380 Encodes a NAC-domain transcription factor involved in xylem formation. Induces transdifferentiation of various cells into metaxylem vessel elements. Located in the nucleus. Expression induced in the presence of auxin, cytokinin and brassinosteroids.
AT5G62420 NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11)
AT5G62460 RZFP is a zinc finger protein involved in mediating abiotic stress tolerance.
AT5G62490 Part of the AtHVA22 family. Protein expression is ABA- and stress-inducible.
AT5G62570 Calmodulin binding protein-like protein;(source:Araport11)
AT5G62627 Encodes a defensin-like (DEFL) family protein.
AT5G62630 hipl2 protein precursor;(source:Araport11)
AT5G62640 nuclear targeted protein involved in flowering time regulation that affects flowering time independent of FLC
AT5G62680 Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds.
AT5G62690 encodes tubulin beta-2/beta-3 chain The mRNA is cell-to-cell mobile.
AT5G62710 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G62720 Integral membrane HPP family protein. Putative nitrate transporter.
AT5G62730 Major facilitator superfamily protein;(source:Araport11)
AT5G62740 SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11)
AT5G62750 hypothetical protein;(source:Araport11)
AT5G62760 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT5G62780 Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT5G62820 Uncharacterized protein family (UPF0497);(source:Araport11)
AT5G62830 F-box associated ubiquitination effector family protein;(source:Araport11)
AT5G62840 Phosphoglycerate mutase family protein;(source:Araport11)
AT5G62860 F-box associated ubiquitination effector family protein;(source:Araport11)
AT5G62865 hypothetical protein;(source:Araport11)
AT5G62880 ROP (Rho of plant GTPases) family member involved in cell wall patterning. Locally activated to form plasma membrane domains, which direct formation of cell wall pits in metaxylem vessel cells through interaction with cortical microtubules. Pattern formation of cell wall pits is governed by ROP activation via a reaction-difusion mechanism. Patterning involves active ROP1 recruiting BDR1 to the plasma membrane in pit regions. BRD1 in turn recruits the actin binding protein WAL.
AT5G62900 PADRE protein down-regulated after infection by S. sclerotiorum.
AT5G62920 Encodes a Type-A response regulator that is responsive to cytokinin treatment. Its C-ter domain is very short in comparison to other Arabidopsis ARRs (17 total). Arr6 protein is stabilized by cytokinin.
AT5G62940 HCA2 induces the formation of interfascicular cambium and regulates vascular tissue development in the aerial parts of the plant. Evidence from both gain of function and dominant negative alleles. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division.
AT5G62950 RNA polymerase II, Rpb4, core protein;(source:Araport11)
AT5G62960 UDP-N-acetylglucosamine-N-acetylmuramyl-pyrophosphoryl-undecaprenol N-acetylglucosamine protein;(source:Araport11)
AT5G62970 Protein with RNI-like/FBD-like domain;(source:Araport11)
AT5G62980 Encodes an enzyme that can act as a aldolase or an epimerase for 7,8-dihydroneopterin and 7,8-dihydromonapterin in vitro. It is likely to act in folate biosynthesis as a homooctamer in vivo.
AT5G63030 Thioredoxin superfamily protein, redox sensor.
AT5G63040 transmembrane protein;(source:Araport11)
AT5G63060 Sec14p like protein involved in chloroplast vesicle transport. Required for photoauxotrophic growth.
AT5G63087 Encodes a Plant thionin family protein
AT5G63090 Involved in lateral organ development
AT5G63130 Octicosapeptide/Phox/Bem1p family protein;(source:Araport11)
AT5G63160 BTB and TAZ domain protein. Short-lived nuclear-cytoplasmic protein targeted for degradation by the 26S proteosome pathway. Acts redundantly with BT2 and BT3 during female gametophyte development.
AT5G63190 Encodes a member of the MRF (MA3 DOMAIN-CONTAINING TRANSLATION REGULATORY FACTOR) gene family under TOR control that is transcriptionally induced by dark and starvation. MRF1 can be phosphorylated in vitro by S6K1 and S6K2.
AT5G63200 tetratricopeptide repeat (TPR)-containing protein;(source:Araport11)
AT5G63220 golgi-to-ER traffic-like protein;(source:Araport11)
AT5G63340 hypothetical protein;(source:Araport11)
AT5G63410 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G63450 AtWRKY33 regulates root apoplastic barrier formation by controlling AtCYP94B1 leading to increased salt tolerance of Arabidopsis plants. Regulation by WRKY33 to control apoplastic barrier formation in roots to confer salt tolerance.
AT5G63460 Enhances ABA response and plant drought tolerance by modulating the stability and localization of c2-domain ABA-related proteins.LOT1 regulates plant tolerance to drought stress by affecting ABA signaling through regulating the stability and dynamic localization of CAR9 (PMID:31102784).
AT5G63530 Farnesylated protein that binds metals.
AT5G63560 HXXXD-type acyl-transferase family protein;(source:Araport11)
AT5G63600 encodes a protein whose sequence is similar to flavonol synthase
AT5G63610 significant sequence similarity to plant and animal cyclin-dependent protein kinases, and was classified as an E-type CDK with a SPTAIRE cyclin binding motif in the kinase domain.
AT5G63620 Encodes an oxidoreductase involved in transducing the perception of E-2-hexenal, which changes the redox status of the mitochondria.
AT5G63630 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT5G63650 encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress.
AT5G63690 Nucleic acid-binding, OB-fold-like protein;(source:Araport11)
AT5G63710 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G63715 Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. Dominant gain of function alleles have enlarged meristems, fasciated stems and radialized leaves. During early embryo development expression is reciprocal to target mRNAs but then changes to overlapping expression with targets. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC
AT5G63720 Encodes KOKOPELLI (KPL). kokopelli (kpl) mutants display frequent single-fertilization events indicating that KPL is involved in double fertilization. KPL and an inversely transcribed gene, ARIADNE14 (ARI14), which encodes a putative ubiquitin E3 ligase, generate a sperm-specific natural cis-antisense siRNA pair. In the absence of KPL, ARI14 RNA levels in sperm are increased and fertilization is impaired.
AT5G63730 Encodes ARIADNE14 (ARI14), a putative ubiquitin E3 ligase. ARI14 and an inversely transcribed gene KPL generate a sperm-specific natural cis-antisense siRNA pair. In the absence of KPL, ARI14 RNA levels in sperm are increased and fertilization is impaired.
AT5G63750 RING/U-box superfamily protein;(source:Araport11)
AT5G63780 Encodes SHA1 (shoot apical meristem arrest), a putative E3 ligase (a RING finger protein) required for post-embryonic SAM maintenance. The mutant sha1-1 shows a primary SAM-deficient phenotype at the adult stage.
AT5G63800 Involved in mucilage formation. Mutants form columella and outer cell wall architecture of the mucilage cells resembles wild-type. However, mum2 seeds completely lack seed coat mucilage. This mutation appears to represent a later step in the development of this cell-type. Encodes a beta-galactosidase involved in seed coat mucilage biosynthesis. Member of Glycoside Hydrolase Family 35
AT5G63810 member of Glycoside Hydrolase Family 35
AT5G63820 hypothetical protein (DUF626);(source:Araport11)
AT5G63850 Amino acid transporter whose expression is downregulated by dehydration.
AT5G63900 Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11)
AT5G63930 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G63941 Pseudogene of AT5G09270
AT5G63990 Inositol monophosphatase family protein;(source:Araport11)
AT5G64000 3'(2'),5'-bisphosphate nucleotidase
AT5G64010 U2 small nuclear ribonucleoprotein auxiliary factor-like protein;(source:Araport11)
AT5G64030 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT5G64060 NAC domain containing protein 103;(source:Araport11)
AT5G64090 hyccin;(source:Araport11)
AT5G64110 Peroxidase superfamily protein;(source:Araport11)
AT5G64130 cAMP-regulated phosphoprotein 19-related protein;(source:Araport11)
AT5G64140 Encodes a putative ribosomal protein S28.
AT5G64190 neuronal PAS domain protein;(source:Araport11)
AT5G64210 encodes an isoform of alternative oxidase, which is expressed in rosettes, stems, and roots. Transcript accumulates in dry seeds and decreased upon germination and is not affected by actinomycin A. Protein is localized to mitochondria.
AT5G64230 1,8-cineole synthase;(source:Araport11)
AT5G64250 Aldolase-type TIM barrel family protein;(source:Araport11)
AT5G64310 Encodes arabinogalactan-protein (AGP1). The mRNA is cell-to-cell mobile.
AT5G64330 Involved in blue light response signaling pathway; interacts with the blue light photoreceptor NPH1. Null mutations abolish phototrophic responses of etiolated seedlings to low fluence blue light. Protein contains multiple protein-protein interaction domains.
AT5G64340 Encodes a bHLH(basic helix-loop-helix)-type transcription factor SAC51 [suppressor of acaulis 51]. Upregulation of SAC51 reverses the dwarf phenotype caused by a loss-of-function mutation in ACL5 (Arabidopsis thaliana ACAULIS 5) gene, suggesting that activation of SAC51 may lead to the expression of a subset of genes required for stem elongation.
AT5G64410 oligopeptide transporter
AT5G64420 DNA polymerase V family;(source:Araport11)
AT5G64440 AtFAAH (fatty acid amide hydrolase) modulates endogenous NAEs (N-Acylethanolamines) levels in plants by hydrolyzing NAEs to ethanolamine and their corresponding free fatty acids. NAE depletion likely participates in the regulation of plant growth. The mRNA is cell-to-cell mobile.
AT5G64450 NYN domain protein;(source:Araport11)
AT5G64490 ARM repeat superfamily protein;(source:Araport11)
AT5G64520 Encodes a protein of the XRCC2 family involved in DNA repair. atxrcc2-1 Mutants are sensitive to MitomycinC but do not show fertility defects.
AT5G64530 xylem NAC domain 1;(source:Araport11)
AT5G64570 Encodes a beta-d-xylosidase that belongs to family 3 of glycoside hydrolases.
AT5G64580 Strong interaction with TIC inner envelope protein translocon which consists of Tic20/Tic56/Tic100/Tic214(Ycf1)(DOI:10.1105/tpc.18.00357).
AT5G64610 Encodes an enzyme with histone acetyltransferase activity. HAM1 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM1. HAM1 acetylates histone H4 lysine 5.
AT5G64650 Ribosomal protein L17 family protein;(source:Araport11)
AT5G64690 neurofilament triplet H protein-like protein;(source:Araport11)
AT5G64700 nodulin MtN21-like transporter family protein
AT5G64735 pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10)
AT5G64740 Encodes a cellulose synthase isomer. CESA6 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA6, along with CESA1 and CESA3 are present in the same plasma membrane complex for cellulose biosynthesis. CESA2 and CESA5 are related to CESA6, having partially redundant roles. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. The mRNA is cell-to-cell mobile.
AT5G64750 Encodes a putative transcription factor containing an AP2 domain. Is a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. Expressed in response to ABA, osmotic stress, sugar stress and drought. Mutants are hypersensitive to these stresses. May be involved in regulation of ABA mediated stress response. The mRNA is cell-to-cell mobile.
AT5G64770 Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9).
AT5G64790 O-Glycosyl hydrolases family 17 protein;(source:Araport11)
AT5G64810 member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses.
AT5G64855 pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10)
AT5G64860 Encodes a maltotriose-metabolizing enzyme with chloroplastic α-1,4-glucanotransferase activity. Mutant has altered starch degradation.
AT5G64870 Belongs to the group of plant flotillins, which are plasma membrane proteins. Flot3 is found in membrane nanodomains.
AT5G64880 transmembrane protein;(source:Araport11)
AT5G64910 Serine/Threonine-kinase;(source:Araport11)
AT5G64920 Encodes a RING-H2 protein that interacts with the RING finger domain of COP1. CIP8 exhibits a strong interaction with the E2 ubiquitin conjugating enzyme AtUBC8 through its N-terminal domain and promotes ubiquitination in an E2-dependent fashion in vitro. It is possible that the AtUBC8-CIP8 module might interact with COP1 in vivo, thereby participating in proteasome-mediated degradation of HY5.
AT5G64930 Regulator of expression of pathogenesis-related (PR) genes. Participates in signal transduction pathways involved in plant defense (systemic acquired resistance -SAR).
AT5G64990 RAB GTPase homolog H1A;(source:Araport11)
AT5G65030 nitric oxide synthase-interacting protein;(source:Araport11)
AT5G65060 MADS domain protein - flowering regulator that is closely related to FLC
AT5G65080 Is upregulated during vernalization and regulates flowering time. Encodes MADS-domain protein. Two variants encoding proteins of 198 and 184 amino acids have been reported.
AT5G65090 Encodes a protein involved in root hair morphogenesis and tip growth. Required for restricting both the size of the root-hair initiation site and the width of the root hairs during the transition to tip growth, but, apparently, is not required for normal subsequent tip growth.
AT5G65120 DNA-directed RNA polymerase subunit beta;(source:Araport11)
AT5G65130 encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.
AT5G65140 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT5G65160 Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones.
AT5G65165 One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Transcripts appear during seed maturation, persist through desiccation, are abundant in dry seeds, and markedly decline during germination.
AT5G65170 VQ motif-containing protein;(source:Araport11)
AT5G65180 ENTH/VHS family protein;(source:Araport11)
AT5G65205 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT5G65210 Encodes TGA1, a redox-controlled regulator of systemic acquired resistance. TGA1 targets the activation sequence-1 (as-1) element of the promoter region of defense proteins. TGA1 are S-nitrosylated.
AT5G65250 transmembrane protein;(source:Araport11)
AT5G65274 ARP2/3 complex 16 kDa subunit (p16-Arc);(source:Araport11)
AT5G65280 Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor. Loss of function mutations in GCL1 show no ABA response defects based on assays of seed germination and seedling development.GCL1 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase.
AT5G65290 LMBR1-like membrane protein;(source:Araport11)
AT5G65300 Gene of unknown function. Expression is induced by a variety of biotic (P. syringae) and abiotic stresses (salt, ABA,IAA, and more.)Member of a small family that includes AT1G35210, AT1G72240, and AT1G22470.Mutants have no obvious loss of function phenotype but overexpressors are early flowering.
AT5G65305 pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10)
AT5G65330 AGAMOUS-like 78;(source:Araport11)
AT5G65340 MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11)
AT5G65380 MATE efflux family protein;(source:Araport11)
AT5G65400 alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G65410 Encodes ZFHD2, a member of the zinc finger homeodomain transcriptional factor family.Gain of function of ATHB25 (35S and UBQ10 proomoters) and double loss of function of ATHB25 and ATHB22 increases and decreases, respectively, seed longevity. This phenotype is maternal and related to seed coat alterations. Gain of function increases expression of GA3OX2 and GA4 and GA1 levels. Together with REM7 induces the expression of genes controlling shoot stem characteristics by ectopic expression in roots.
AT5G65420 Encodes a D-type cyclin CYCD4;1 that physically interacts with CDC2A and is expressed during vascular tissue development, embryogenesis, and formation of lateral root primordia. Its expression is upregulated early during germination.Involved in stomatal cell lineage proliferation in the hypocotyl.
AT5G65450 Encodes a ubiquitin-specific protease. The mRNA is cell-to-cell mobile.
AT5G65460 Kinesin that binds cyclin-dependent kinase CDKA;1 as homodimer or as heterodimer with KCA1
AT5G65470 O-fucosyltransferase family protein;(source:Araport11)
AT5G65500 Plant U-box type E3 ubiquitin ligase (PUB).
AT5G65550 UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT5G65575 Natural antisense transcript overlaps with AT5G65580;(source:Araport11)
AT5G65590 Encodes a plant-specific Dof-type transcription factor expressed in maturing guard cells, but not in guard mother cells. It regulates essential processes of stomatal guard cell maturation and functions as a key transcription factor regulating the final stages of guard cell differentiation.
AT5G65615 pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10)
AT5G65630 This gene is predicted to encode a bromodomain-containing protein. Plant lines expressing RNAi constructs targeted against GTE7 show some resistance to agrobacterium-mediated root transformation.
AT5G65660 hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT5G65670 auxin (indole-3-acetic acid) induced gene The mRNA is cell-to-cell mobile.
AT5G65687 Major facilitator superfamily protein;(source:Araport11)
AT5G65700 Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM2,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM1 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. The mRNA is cell-to-cell mobile.
AT5G65770 Encodes a protein that localizes to the nuclear periphery and affects nuclear morphology. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5.
AT5G65780 Encodes a chloroplast branched-chain amino acid aminotransferase, can complement the yeast leu/iso-leu/val auxotrophy mutant. Note that the AT5G65780.2 gene model (TAIR10) has been obsoleted due to the lack of experimental support. The mRNA is cell-to-cell mobile.
AT5G65790 Encodes a MYB family protein with N-terminal R2R3 DNA-binding domains involved in root development.
AT5G65800 1-aminocyclopropane-1-carboxylate synthase (ACS) is encoded by a multigene family consisting of at least five members whose expression is induced by hormones, developmental signals, and protein synthesis inhibition.
AT5G65840 Thioredoxin superfamily protein;(source:Araport11)
AT5G65860 ankyrin repeat family protein;(source:Araport11)
AT5G65880 transmembrane protein;(source:Araport11)
AT5G65930 encodes a novel member of the kinesin superfamily of motor proteins. recessive mutations have reduced number of trichome branches.
AT5G65950 TRAPPIII complex protein which regulates TGN integrity, by altered TGN/EE association of several residents, including SYNTAXIN OF PLANTS 61 (SYP61), and altered vesicle morphology. Involved in regulation of endosomal function and salt stress response.
AT5G65970 A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO10 belongs to the clade III, with AtMLO5, AtMLO7, AtMLO8, and AtMLO9. The gene is expressed in root and cotyledon vascular system, in root-shoot junction and lateral root primordia and in developing siliques, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s
AT5G65990 Transmembrane amino acid transporter family protein;(source:Araport11)
AT5G66020 Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. non-consensus AT donor splice site at exon 7, TA donor splice site at exon 10, AT acceptor splice at exon 13.
AT5G66050 Wound-responsive family protein;(source:Araport11)
AT5G66052 transmembrane protein;(source:Araport11)
AT5G66070 E3 ubiquitin ligase that functions in negative regulation of ABA signaling.
AT5G66090 cell wall integrity/stress response component;(source:Araport11)
AT5G66160 Encodes a receptor homology region transmembrane domain, ring H2 motif protein involved in transport of storage proteins to protein storage vacuoles. Localized to endoplasmic reticulum and co-localizes with DIP positive vesicles and to the trans-golgi network when complexed with RMR2.
AT5G66180 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT5G66260 SAUR-like auxin-responsive protein family;(source:Araport11)
AT5G66310 ATP binding microtubule motor family protein;(source:Araport11)
AT5G66320 Encodes GATA transcription factor gene GNC, involved in regulating carbon and nitrogen metabolism. Expression occurs in aerial tissue at an early stage of development and is inducible by nitrate.
AT5G66340 hypothetical protein;(source:Araport11)
AT5G66370 metal ion-binding protein;(source:Araport11)
AT5G66390 Encodes a peroxidase that is involved in lignin biosynthesis. Required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification.
AT5G66440 tRNA-methyltransferase non-catalytic subunit trm6MTase subunit;(source:Araport11)
AT5G66460 Encodes a endo-beta-mannanase involved in seed germination and silique dehiscence.
AT5G66540 U3 small nucleolar ribonucleoprotein;(source:Araport11)
AT5G66550 Maf-like protein;(source:Araport11)
AT5G66570 Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO1 is the major isoform in the wild-type. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the membrane. The mRNA is cell-to-cell mobile.
AT5G66607 This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT5G66630 DA1-related protein 5;(source:Araport11)
AT5G66650 Chloroplast localized mitochondrial calcium uniporter.
AT5G66658 hypothetical protein;(source:Araport11)
AT5G66670 pectinesterase, putative (DUF677);(source:Araport11)
AT5G66675 transmembrane protein, putative (DUF677);(source:Araport11)
AT5G66690 UGT72E2 is an UDPG:coniferyl alcohol glucosyltransferase which glucosylates sinapyl- and coniferyl aldehydes as well as sinapyl- and coniferyl alcohol. The enzyme is thought to be involved in lignin metabolism. A knockdown mutant line (72E2KD) was obtained using RNAi silencing. A twofold reduction in coniferyl alcohol 4-O-glucoside and sinapyl alcohol 4-O-glucoside was detected in this line compared to wildtype. In comparison, both knockout and knockdown lines of UGT72E1 and UGT72E3, respectively, failed to display the same reduction in phenylpropanoid 4-O-glucosides. The mRNA is cell-to-cell mobile.
AT5G66700 Encodes a homeodomain protein. Member of HD-ZIP 1 family, most closely related to HB5. AtHB53 is auxin-inducible and its induction is inhibited by cytokinin, especially in roots therefore may be involved in root development.
AT5G66755 pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10)
AT5G66790 Protein kinase superfamily protein;(source:Araport11)
AT5G66815 Counteracts auxin effects by stabilizing AUX/IAA transcriptional repressors. Impact on abiotic stress processes.
AT5G66816 DNA-directed RNA polymerase II subunit RPB1-like protein;(source:Araport11)
AT5G66820 transmembrane protein;(source:Araport11)
AT5G66870 Encodes LOB domain protein whose overexpression results in KNOX gene repression. Overexpression also results in plants with hyponastic leaves, downward pointing flowers and reduced apical dominance. May be involved in the transcriptional regulation of the homeobox gene BP (brevipedicellus) during lateral organ differentiation. Acts together with AS2 in proximal-distal symmetry determination.
AT5G66880 encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. The mRNA is cell-to-cell mobile.
AT5G66890 RPW8 -CNL gene.
AT5G66920 SKU5 similar 17;(source:Araport11)
AT5G66940 Encodes a nuclear localized DOF-domain binding transcription factor.
AT5G66950 Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11)
AT5G67040 F-box protein, putative (DUF295);(source:Araport11)
AT5G67090 Encodes a subtilisin-like serine protease with in vitro protease activity.
AT5G67140 F-box/RNI-like superfamily protein;(source:Araport11)
AT5G67190 encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10.
AT5G67200 Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G67230 Encodes a member of the GT43 family glycosyltransferases involved in glucuronoxylan biosynthesis: AT2G37090 (IRX9) and AT1G27600 (IRX9-L or I9H, IRX9 homolog); AT4G36890 (IRX14) and AT5G67230 (IRX14-L or I14H, IRX14 homolog). They form two functionally non-redundant groups essential for the normal elongation of glucuronoxylan backbone. I9H functions redundantly with IRX9, I14H is redundant with IRX14. IRX9 or I9H do not complement IRX14, IRX14 or I14H do not complement IRX9.
AT5G67245 hypothetical protein;(source:Araport11)
AT5G67270 encodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis.
AT5G67280 receptor-like kinase;(source:Araport11)
AT5G67290 FAD-dependent oxidoreductase family protein;(source:Araport11)
AT5G67340 Plant U-box type E3 ubiquitin ligase (PUB).
AT5G67380 Casein kinase II (CK2) catalytic subunit (alpha 1). One known substrate of CK2 is Phytochrome Interacting Factor 1 (PIF1). CK2-mediated phosphorylation enhances the light-induced degradation of PIF1 to promote photomorphogenesis.
AT5G67385 Encodes a phototropin-interacting NRL protein that is an early signaling component in the phototrophic response and is essential for the phototropin-mediated chloroplast accumulation response but is not involved in the chloroplast avoidance response or stomatal opening.
AT5G67390 glycosyltransferase-like protein;(source:Araport11)
AT5G67400 root hair specific 19;(source:Araport11)
AT5G67411 GRAS family transcription factor;(source:Araport11)
AT5G67420 Encodes a LOB-domain protein involved in nitrogen metabolism and affecting leaf morphogenesis.
AT5G67440 A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis.
AT5G67460 O-Glycosyl hydrolases family 17 protein;(source:Araport11)
AT5G67470 formin homolog 6;(source:Araport11)
AT5G67480 BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves.
AT5G67540 Arabinanase/levansucrase/invertase;(source:Araport11)
AT5G67550 transmembrane protein;(source:Araport11)
AT5G67560 A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. Possible pseudogene because it lacks an N-terminal part that is conserved among the other ARL8 proteins. The mRNA is cell-to-cell mobile.
AT5G67570 Encodes a pentratricopeptide repeat containing protein that is targeted to the chloroplast. Mutants have pale young leave and reduced accumulation of plastid encoded transcripts suggesting a role for DG1 in regulation of plastid gene expression.
AT5G67600 cysteine-rich TM module stress tolerance protein;(source:Araport11)
AT5G67610 Encodes an orthlog of the Xenopus inner nuclear membrane (INM) protein Nemp1/TMEM194A.
AT5G67640 hypothetical protein;(source:Araport11)